Method for purifying cells

Abstract

To provide a method wherein, even when a small number of mutant cells are mixed before expansive culturing, the mutant cells are detected and removed to purify normal cells, thereby producing a purified cell population.SOLUTION: The present invention provides a method for purifying normal cells from a cell population containing mutant cells at a mixing ratio of 1% or less, including the following steps: (step 1) fractionating and culturing the cell population; (step 2) detecting mutant cells in each cultured fraction; and (step 3) culturing cells of a fraction in which no mutant cell was detected.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for purifying normal cells from a cell population contaminated with mutant cells. The present invention also relates to a method for identifying contaminating cells having a mutation in the EP300 gene as mutant cells, and primers and probes suitable for said method. [Background technology]

[0002] In recent years, cell-based drug discovery and regenerative medicine have made remarkable progress, and research and development is still ongoing. Usually, cells are used as a collection of individual cells, i.e., a cell population, but the individual cells in a cell population are not necessarily uniform. There is a possibility that mutant cells are mixed in at a certain rate, and it is preferable and required to remove such mutant cells in advance from the viewpoints of ensuring the accuracy and reproducibility of experiments and safety in the medical field. When there is a certain degree of contamination, for example, the limiting dilution method, which can remove mutant cells by limiting dilution, is known as a classical method for isolating single cells, and is a method in which a dilution series is created that is calculated to be 1 cell / well, and the cells in each well are observed. Therefore, if the contamination rate is low, the work is complicated and inefficient. The presence or absence of mutations in the cells in each well is confirmed, and only cells without mutations are expanded and cultured (Non-Patent Document 1). In the case of limiting dilution, since the cells are multiplied from a single cell, it takes time and is inefficient, and therefore methods for efficiently ensuring homogeneity have been investigated (Patent Document 1). [Prior art documents] [Patent documents]

[0003] [Patent Document 1] JP 2018-148830 A [Non-patent literature]

[0004] [Non-Patent Document 1] "Single Cell Cloning", CeLLaviSta, AppLication Note, July 19, 2023, searched internet <URL:http: / / www.primetech.co.jp / Portals / 0 / db / product / SynenTec / Cellavista_App_Single_Cell_Cloning_J_rev00_201303.pdf> Summary of the Invention [Problem to be solved by the invention]

[0005] iPS cells and other cells are difficult to grow when the number of cells is small, and there are some cells for which it is difficult to remove mutant cells using limiting dilution. In addition, when the number of mutant cells mixed in the cell population is extremely small, the limiting dilution method may allow the mutant cells to be expanded without noticing the presence of the mutant cells, and if the division rate of the mutant cells is faster than that of normal cells, the proportion of mutant cells will increase as a result of expansion, which may affect the efficacy and safety of the final product (pharmaceutical). The present invention aims to provide a method that enables the purification of normal cells and the production of a purified cell population by detecting and removing mutant cells, even if they are present in a small amount before expansion culture. [Means for solving the problem]

[0006] In view of the above problems, the present inventors have found that when the rate of mutant cells contaminating a cell population is low, the efficiency of detecting mutant cells can be increased by culturing the cells in several fractions containing a certain number of cells rather than one cell per well, and then purifying the cell population by culturing the cells in the fractions in which mutant cells were not detected. Furthermore, based on the knowledge first obtained by the present inventors that mutant cells having a mutation in the EP300 gene may be contaminated in a cell population, particularly a cell population of pluripotent stem cells, preferably iPS cells, the present inventors have succeeded in designing primers and / or probes capable of detecting the mutant cells, thereby completing the present invention.

[0007] That is, the present invention provides the following. [1] A method for purifying normal cells from a cell population containing mutant cells at a contamination rate of 1% or less, comprising the steps of: Step 1: fractionating and culturing the cell population; Step 2: detecting mutant cells in each cultured fraction; and Step 3: Culturing the fraction of cells in which no mutant cells were detected. [2] The method described in [1], further comprising one or more expansion culture steps between steps 1 and 2. [3] The method described in [1] or [2], wherein the contamination rate is 0.1 to 1%. [4] The method according to any one of [1] to [3], wherein in step 1, the number of fractions is 20 to 30. [5] In step 1, 0.05 to 2 × 10 per fraction 3 cells / cm 2 The method described in [4], in which the cells are seeded at a density of [6] The method according to any one of [1] to [3], wherein in step 1, the number of fractions is 90 to 100. [7] In step 1, 0.03 to 3 × 10 per fraction 3 cells / cm 2 The method described in [6], wherein the cells are seeded at a density of 1000×1000. [8] The method according to any of [1] to [7], wherein the cell is a pluripotent stem cell. [9] The method described in [8], wherein the pluripotent stem cells are iPS cells.

[10] The method according to any of [1] to [9], wherein the mutation is in the EP300 gene.

[11] The method described in

[10] , wherein the mutation in the EP300 gene is a partial deletion in the PHD (Plant homeodomain) region of the EP300 gene.

[12] A primer set for specifically detecting a mutation in the PHD region of the EP300 gene, comprising: The primer set includes a combination of a forward primer having the base sequence of SEQ ID NO:7 and a reverse primer having the base sequence of SEQ ID NO:8.

[13] A probe for specifically detecting a mutation in the PHD region of the EP300 gene, the probe having the base sequence of SEQ ID NO:9.

[14] A primer set for detecting the PHD region of the EP300 gene, The primer set includes a combination of a forward primer having the base sequence of SEQ ID NO:1 and a reverse primer having the base sequence of SEQ ID NO:2.

[15] A probe for detecting the PHD region of the EP300 gene, having the base sequence of SEQ ID NO:3.

[16] A primer set for detecting the EP300 gene, The primer set includes a combination of a forward primer having the base sequence of SEQ ID NO:4 and a reverse primer having the base sequence of SEQ ID NO:5.

[17] A probe for detecting the EP300 gene, having the base sequence of SEQ ID NO:6.

[18] A primer set for amplifying a target nucleic acid sequence, comprising a combination of a forward primer having the base sequence of SEQ ID NO: 10 and a reverse primer having the base sequence of SEQ ID NO: 11, characterized in that the target nucleic acid sequence is within a PHD region having a mutation in the EP300 gene.

[19] The primer set according to

[18] , wherein the mutation in the EP300 gene is a partial deletion in the PHD region of the EP300 gene.

[20] The method according to [1], characterized in that in step 2, the primer set according to

[12] and the probe according to

[13] are used.

[21] The method according to [1], characterized in that in step 2, the primer set according to

[18] is used. Effect of the Invention

[0008] Since a certain number of cells are cultured, the culture time required to reach a certain number of cells can be shortened compared to the limiting dilution method, and mutant cells can be detected even if the contamination rate of mutant cells is low, and mutant cells can be removed efficiently. By carrying out this method before the expansion culture of iPS cells, mutant cells that are difficult to detect before expansion culture can be found and removed early, and contamination by mutant cells after expansion culture can be prevented. [Brief description of the drawings]

[0009] [Figure 1] Schematic diagram of the cell purification method of the present invention (method of obtaining a cell population that does not contain mutant cells). In the figure, P indicates the passage number, for example, P16 means that the cells have been passaged 16 times. "P16 to P17 awakening" means that the cells that have been passaged 16 times were cryopreserved and the cryopreserved cells were awakened (17th passage). [Diagram 2] The figure shows the positions of each primer (arrow) and each probe (oval) on the genome of the wild-type EP300 gene (WT) and mutant-type EP300 gene (Mutant). 1 indicates the common region, 2 indicates the deleted region, and 3 indicates the region containing the cleavage site. VIC (registered trademark): carboxyrhodamine, FAM (trademark): Carboxyfluorescein, MGB: minor groove binder, NFQ: nonfluorescent quencher [Diagram 3] This figure shows the results of multiplex PCR using samples prepared from cells having the wild-type EP300 gene (WT) and mutant EP300 gene (Mutant). The horizontal axis shows the cycle number, and the vertical axis shows the magnitude of the fluorescent signal (ΔRn). [Figure 4]

[0036] Figure 1 shows the results of qPCR performed using samples prepared from cells having the wild-type EP300 gene (WT) and mutant EP300 gene (Mutant) to examine the expression of the mutant region and the deleted region. The relative expression is graphed using the common region as an endogenous control. [Diagram 5]This figure shows the results of RT-PCR performed on samples prepared from cells having a wild-type EP300 gene (EP300 deficiency-; MCB P15) and cells having a mutant EP300 gene (EP300 deficiency+; CECSi) to examine the expression of each region. [Figure 6] This figure shows the results of RT-PCR performed on samples prepared from cells having a wild-type EP300 gene (EP300 deficiency-; MCB P15) and cells having a mutant EP300 gene (EP300 deficiency+; CECSi) to examine the expression of each region. [Figure 7] This is a graph showing the results of quantitative PCR performed on samples prepared from cell populations in which the contamination rate of cells with mutant EP300 genes (EP300 deletion +) was gradually changed. A contamination rate of about 0.1% was detected. [Figure 8] FIG. 1 shows the positions of each primer on the wild-type EP300 gene (WT) and mutant EP300 gene (MT). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] The present invention will now be described. Terms used in the present specification have the meanings commonly used in the art unless otherwise specified.

[0011] 1. Cell purification method The present invention provides a method for purifying normal cells from a cell population containing mutant cells (hereinafter, also referred to as the purification method of the present invention). The purification method of the present invention comprises the following steps: Step 1: fractionating and culturing the cell population; Step 2: detecting mutant cells in each cultured fraction; and Step 3: Culturing the fraction of cells in which no mutant cells were detected.

[0012] (Process 1) Step 1 is a step of fractionating and culturing a cell population containing mutant cells. Here, the "cell population containing mutant cells" to which step 1 is applied is a cell population that is contaminated or may be contaminated with mutant cells, and may not be contaminated as a result. If the contamination rate is high, mutant cells may be contained in all fractions, and step 3 cannot be performed, so the contamination rate of mutant cells is preferably 1% or less, and may be 0.9% or less, 0.8% or less, 0.7% or less, 0.6% or less, 0.5% or less, 0.4% or less, 0.3% or less, or 0.2% or less. From the viewpoint of ease of detection in step 2, it is preferable that the contamination rate is 0.1% or more, but since it is ultimately desirable that mutant cells are not contaminated, the contamination rate may be less than 0.1%. The fractionation of the cell population is not particularly limited in terms of the number of fractions or the number of cells per fraction, as long as steps 2 and 3 can be appropriately performed. For example, when the number of fractions is 20 to 30, the number of cells per fraction is 0.05 to 2 × 10 3 cells / cm 2 For example, if the number of fractions is 90 to 100, the density of each fraction is 0.03 to 3 × 10 3 cells / cm 2 As shown in Fig. 1, the number of fractions can be changed stepwise (e.g., 96 wells → 24 wells → 6 wells) and cultured. From the viewpoint of improving the yield of cells without mutations, it is preferable to carry out one or more expansion culture steps, preferably two expansion culture steps, between step 1 and step 2. The cells are not particularly limited as long as they are cells that may undergo mutation and have proliferation ability, but stem cells are preferred, pluripotent stem cells are particularly preferred, and iPS cells are particularly preferred.

[0013] Stem cells are cells that have the ability to replicate themselves and differentiate into cells of multiple lineages. Examples include, but are not limited to, embryonic stem cells (ES cells), embryonic tumor cells, embryonic germ stem cells, induced pluripotent stem cells (iPS cells), neural stem cells, hematopoietic stem cells, mesenchymal stem cells, hepatic stem cells, pancreatic stem cells, muscle stem cells, germline stem cells, intestinal stem cells, cancer stem cells, hair follicle stem cells, and skin stem cells.

[0014] Pluripotent stem cells can be derived from fertilized eggs, cloned embryos, germline stem cells, tissue stem cells, somatic cells, etc. Examples of pluripotent stem cells include embryonic stem cells (ES cells), EG cells (embryonic germ cells), induced pluripotent stem cells (iPS cells), etc. Muse cells (Multi-lineage differentiating Stress Enduring cells) obtained from mesenchymal stem cells (MSCs), and GS cells prepared from germ cells (e.g., testes) are also included in pluripotent stem cells.

[0015] ES cells can be produced by culturing the inner cell population on feeder cells or in a medium containing leukemia inhibitory factor (LIF). They are also available from designated institutions and can be purchased commercially. Nuclear transfer ES cells (ntES cells), which are one type of ES cell, can be established from a cloned embryo created by transplanting the nucleus of a somatic cell into an egg from which the nucleus has been removed.

[0016] EG cells can be prepared by culturing primordial germ cells in a medium containing mouse stem cell factor (mSCF), LIF and basic fibroblast growth factor (bFGF) (Cell, 70:841-847, 1992).

[0017] An iPS cell is a cell in which pluripotency is induced by reprogramming a somatic cell by a known method. Specific examples of iPS cells include cells in which pluripotency is induced by reprogramming a somatic cell differentiated into a fibroblast, peripheral blood mononuclear cell, or the like, through expression of a plurality of genes selected from a group of reprogramming genes including Oct3 / 4, Sox2, Klf4, Myc (c-Myc, N-Myc, L-Myc), Glis1, Nanog, Sall4, lin28, Esrrb, and the like. In 2006, Yamanaka et al. established induced pluripotent stem cells from mouse cells (Cell, 2006, 126(4) pp.663-676). In 2007, induced pluripotent stem cells were established from human fibroblasts, and they have the same pluripotency and self-renewal ability as embryonic stem cells (Cell, 2007, 131(5) pp.861-872; Science, 2007, 318(5858) pp.1917-1920; Nat. Biotechnol., 2008, 26(1) pp.101-106). In addition to the method of producing induced pluripotent stem cells by direct reprogramming through gene expression, induced pluripotent stem cells can also be induced from somatic cells by adding chemical compounds (Science, 2013, 341, pp.651-654).

[0018] Somatic cells used in producing induced pluripotent stem cells are not particularly limited, but include tissue-derived fibroblasts, blood cells (e.g., peripheral blood mononuclear cells, T cells, etc.), hepatic cells, pancreatic cells, intestinal epithelial cells, smooth muscle cells, etc.

[0019] When producing artificial pluripotent stem cells, in the case of initializing by the expression of several kinds of genes (for example, four factors, Oct3 / 4, Sox2, Klf4 and Myc), the means for expressing the genes is not particularly limited. Examples of the means for expressing the genes include infection methods using virus vectors (for example, retrovirus vectors, lentivirus vectors, Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors), gene transfer methods using plasmid vectors (for example, plasmid vectors, episomal vectors) (for example, calcium phosphate method, lipofection method, retronectin method, electroporation method), gene transfer methods using RNA vectors (for example, calcium phosphate method, lipofection method, electroporation method), and direct protein injection method.

[0020] It is also possible to obtain strains of induced pluripotent stem cells. Specifically, the iPS cells include 201B7, 201B7-Ff, 253G1, 253G4, 1201C1, 1205D1, 1210B2, 836B3, FF-I14s03, FF-I01s04, MH09s01, Ff-XT18s02, Ff-WIs03, Ff-WJs513, Ff-CLs14, Ff-KVs09, QHJI14s03, QHJI01s04, RWMH09s01, DRXT18s02, RJWIs03, YZWJs513, ILCLs14, GLKVs09, Ff-XT28s05-ABo_To, Ff-I01s04-ABII-KO, Ff-I14s04-ABII-KO (all from iPS Academia Japan, Inc., or Kyoto University iPS Research Foundation), Tic (JCRB1331 strain), Dotcom (JCRB1327 strain), Squeaky (JCRB1329 strain), Toe (JCRB1338 strain), and Lollipop (JCRB1336 strain) (all from the National Center for Child Health and Development, Department of Rare and Intractable Diseases and Disease Resources, National Institute of Biomedical Innovation, JCRB Cell Bank), UTA-1 strain and UTA-1-SF-2-2 strain (all from the University of Tokyo), 21526, 21528, 21530, 21531, 31536, and 31538 strains (all from the University of Tokyo). Alternatively, any of the following strains may be used: ATCC-DYP0730, ATCC-DYP0250, ATCC-HYR0103, ATCC-DYR0100, ATCC-DYR0530, ATCC-DYS0530, ATCC-DYP0530, ATCC-DYS0100, ATCC-HYS0103, ATCC-CYS0105, KYOU-DXR0109B, ATCC-BYS0110, ATCC-BYS0111, ATCC-BYS0112, ATCC-BYS0113, ATCC-BXS0114, ATCC-BXS0115, ATCC-BXS0116, and ATCC-BXS0117 (all from the American Type Culture Collection, a non-profit organization).

[0021] The induced pluripotent stem cells can be induced to differentiate into various cells, for example, corneal endothelial replacement cells (sometimes referred to as "CECSi cells" in this specification).

[0022] "Mammals" include rodents, ungulates, felines, lagomorphs, primates, etc. Rodents include mice, rats, hamsters, guinea pigs, etc. Ungulates include pigs, cows, goats, horses, sheep, etc. Felidae include dogs, cats, etc. Lagomorphs include rabbits, etc. "Primates" refers to mammals belonging to the order Primates, and examples of primates include prosimians such as lemurs, lorises, and tree shrews, and anthropoids such as monkeys, apes, and humans.

[0023] The pluripotent stem cells used in the present invention are mammalian pluripotent stem cells, preferably rodent (e.g., mouse, rat) or primate (e.g., human, monkey) pluripotent stem cells, and most preferably human pluripotent stem cells.

[0024] (Process 2) Step 2 is a step carried out after step 1 (optionally after an expansion culture step carried out after step 1), and is a step of detecting mutant cells in each cultured fraction. Here, the "mutated cells" are not particularly limited as long as they are cells in which a mutation has occurred in a gene, and may be cells in which a mutation has occurred acquiredly during the process of subculture, or cells in which a mutation has occurred congenitally. Detection of mutant cells may be at the gene level (e.g., Northern blot, PCR) or at the protein level (e.g., Western blot), but generally, the difference in gene sequence between mutant cells and normal cells is small, and only a few bases are often different, so detection at the gene level is preferable. An example of a mutant cell is a cell having a mutation in the EP300 gene. EP300 (E1A binding protein 300) is a transcriptional coactivator with histone acetyltransferase activity (HAT activity). In the gene promoter region, it changes the chromatin structure by weakening the interaction between histones and DNA through its HAT activity, and promotes transcription by inviting the basal transcription machinery and transcriptional regulatory factors therein. Somatic mutations in EP300 are widely observed in cancer, and the majority of these are truncated mutations that are likely to cause functional inactivation, and it is thought that they may function as a tumor suppressor gene. A schematic diagram illustrating each domain in the EP300 gene is shown in Figure 8. The present inventors found mutations in the EP300 gene in some iPS cells. The specific procedure for detecting cells having a mutation in the EP300 gene is described in " 2. Tools for detecting defects in the EP300 gene " section. If mutant cells are detected in all fractions in step 2, the next step, step 3, cannot be performed, so the number of cells to be fractionated in step 1 is reduced and step 1 is performed again (in some cases, an expansion culture step is performed after step 1).

[0025] (Step 3) Step 3 is a step of expanding the cell fraction in which no mutation was detected in step 2. Since the culture is started from a certain number of cells, mutation-free cells can be obtained in a high yield in a short period of time.

[0026] Culture conditions for the culture step in step 1, the expansion culture step carried out between steps 1 and 2, and the culture step in step 3 are appropriately selected depending on the type of target cells, and known culture conditions can be used. For example, a known basal medium can be used as the medium used in each step, and is not particularly limited as long as it does not inhibit the proliferation of the target cells, preferably pluripotent stem cells, more preferably iPS cells. Media for pluripotent stem cell culture are preferred, such as DMEM, DMEMHG, EMEM, IMDM (Iscove's Modified Dulbecco's Medium), GMEM (Glasgow's MEM), RPMI-1640, α-MEM, Ham's Medium F-12, Ham's Medium F-10, Ham's Medium F12K, Medium 199, ATCC-CRCM30, DM-160, DM-201, BME, Fischer, McCoy's 5A, Leibovitz's L-15, RITC80-7, MCDB105, MCDB107, MCDB131, MCDB153, MCDB201, NCTC109, NCTC135, Waymouth's MB752 / 1, CMRL-1066, Williams' medium E, Brinster's BMOC-3 Medium, E8 medium (Nature Methods, 2011, 8, 424-429), ReproFF2 medium (ReproCell, Inc.), StemFit (registered trademark) AK medium (Ajinomoto), and a mixture thereof.

[0027] The medium may contain additives known per se. The additives are not particularly limited as long as they do not inhibit the proliferation of cells, particularly pluripotent stem cells, preferably iPS cells, and examples of such additives include growth factors (e.g., insulin, etc.), iron sources (e.g., transferrin, etc.), polyamines (e.g., putrescine, etc.), minerals (e.g., sodium selenate, etc.), sugars (e.g., glucose, etc.), organic acids (e.g., pyruvic acid, lactic acid, etc.), amino acids other than the amino acids to be reduced in the present invention (e.g., L-glutamine, etc.), reducing agents (e.g., 2-mercaptoethanol, etc.), vitamins (e.g., ascorbic acid, d-biotin, etc.), steroids (e.g., β-estradiol, progesterone, etc.), antibiotics (e.g., streptomycin, penicillin, gentamicin, etc.), buffers (e.g., HEPES, etc.), lipids (e.g., linoleic acid, etc.), and nucleic acids (e.g., thymidine, etc.). In addition, additives known per se that have been used conventionally in the culture of pluripotent stem cells may also be appropriately contained. The additives are preferably contained within their respective known concentration ranges.

[0028] The medium may contain serum. The serum is not particularly limited as long as it is derived from an animal and does not inhibit the proliferation of cells, particularly pluripotent stem cells, preferably iPS cells, but is preferably derived from a mammal (e.g., fetal bovine serum, human serum, etc.), and more preferably human serum. The concentration of the serum may be within a known concentration range.

[0029] The culture vessel used for cell culture is not particularly limited as long as it is capable of culturing the target cells, particularly pluripotent stem cells, preferably iPS cells, and examples thereof include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, multi-plates, multi-well plates, microslides, chamber slides, petri dishes, tubes, trays, culture bags, and roller bottles. In the culture step of step 1 and the expansion culture step between steps 1 and 2, the cell population is fractionated and cultured, so that a culture vessel capable of simultaneously culturing in multiple wells, such as a microplate, microwell plate, multi-plate, or multi-well plate, is preferred.

[0030] The culture vessel may be either cell-adhesive or cell-non-adhesive, and is appropriately selected depending on the purpose. The cell-adhesive culture vessel may be coated with any cell-supporting substrate, such as an extracellular matrix (ECM), for the purpose of improving adhesion of the surface of the culture vessel to cells. The cell-supporting substrate may be any substance intended for cell adhesion.

[0031] The culture temperature is not particularly limited, but may be about 30 to 40° C., preferably about 37° C. The CO2 concentration may be about 1 to 10%, preferably about 2 to 5%. The oxygen partial pressure may be 1 to 10%.

[0032] 2. Tools for detecting defects in the EP300 gene One embodiment of the present invention is to provide a tool for detecting mutant cells that can be used in step 2 of the cell purification method of the present invention. Examples of the tool include a primer set (a pair of a forward primer and a reverse primer) used in a method utilizing a DNA amplification reaction (PCR method) and a probe used in a hybridization method. When detection at the protein level is possible, examples of the tool include an antibody and the like.

[0033] (1) Amplification reaction (PCR) In the present invention, for example, the polymerase chain reaction (PCR) can be used to detect mutant cells (mutated genes therein) simply and with high accuracy. First, primers capable of amplifying the mutant gene and the wild-type gene by comparing their base sequences are designed. The primer set may be designed based on the cDNA sequence of the wild-type gene or the cDNA sequence of the mutant gene, or may be designed based on the genomic sequence of the wild-type gene or the genomic sequence of the mutant gene. Primer design techniques are well known in the art, and primers that can be used in the present invention are designed to satisfy conditions that allow specific annealing, for example, to have a length and base composition (melting temperature) that allow specific annealing. For example, the length that functions as a primer is preferably 10 bases or more, more preferably 15 to 50 bases, and even more preferably 15 to 30 bases. In addition, when designing, it is preferable to confirm the GC content of the primer and the melting temperature (Tm) of the primer. Tm means the temperature at which 50% of any nucleic acid strand forms a hybrid with its complementary strand, and in order for the template DNA and the primer to form a double strand and anneal, it is necessary to optimize the annealing temperature. On the other hand, if this temperature is lowered too much, a non-specific reaction will occur, so it is desirable that the temperature be as high as possible. Known software for primer design can be used to confirm Tm. The designed primer can be chemically synthesized by a known oligonucleotide synthesis technique, but is usually synthesized using a commercially available chemical synthesis device.

[0034] In a specific embodiment, examples of primer sets that can be used to detect the EP300 gene and / or a mutation in the EP300 gene (deletion of the exon 22 region of the EP300 gene on chromosome 22) include, but are not limited to, the following primer sets: A primer set for detecting a deletion region of the EP300 gene, comprising a forward primer represented by the base sequence of SEQ ID NO: 1 (AAACTATTTTCAGTTCTTTGGTCATGAC) and a reverse primer represented by the base sequence of SEQ ID NO: 2 (CCTTAACCAAATGAAAACTTGCAA); A primer set for detecting the EP300 common region, comprising a forward primer represented by the base sequence (ATGCTGCTGGCATGAATAGGT) of SEQ ID NO: 4 and a reverse primer represented by the base sequence (GCTGTTCCTGCCCTAACCAA) of SEQ ID NO: 5; A primer set for detecting a mutant region of the EP300 gene, comprising a forward primer represented by the base sequence of SEQ ID NO: 7 (AAACTATTTTCAGTTCTTTGGTCATGAC) and a reverse primer represented by the base sequence of SEQ ID NO: 8 (GCCAAACCCAAAGAAAACAATT); When a primer set designed in this way is used, the amplification product obtained from the mutant gene differs in length and / or base sequence from the amplification product obtained from the wild-type gene. Therefore, whether or not the EP300 gene has a mutation can be determined from the difference in length and / or base sequence of the amplification product obtained by the amplification reaction using the primer set.

[0035] The amplification reaction is not particularly limited, but may be a known method utilizing the principle of the polymerase chain reaction (PCR). Amplification is performed until the amplified product reaches a detectable level. The optimal conditions for PCR can be easily determined by those skilled in the art. In the RT-PCR method, first, cDNA is prepared by reverse transcriptase reaction using mRNA as a template, and then PCR is performed using the prepared cDNA as a template and a pair of primers. Examples of primer sets for the RT-PCR method include the following. A primer set for detecting a mutant region of the EP300 gene, comprising a forward primer represented by the base sequence of SEQ ID NO: 10 (GATGACCCTTCCCAGCCTCAAAC) and a reverse primer represented by SEQ ID NO: 11 (CTTTAAACAGCCATCACAGACGAATAGTT).

[0036] To detect whether a specific amplification reaction has occurred after the above-mentioned amplification reaction, a known means capable of specifically recognizing the amplification product obtained by the amplification reaction can be used. For example, a specific amplification reaction can be detected by confirming whether an amplified fragment of a specific size has been amplified using agarose gel electrophoresis or the like. The size of the amplified product can be estimated based on the base sequence between the designed primers.

[0037] Alternatively, the presence or absence of amplification of a nucleic acid fragment is detected based on the label attached to the primer or substrate. For example, a label such as a radioisotope, a fluorescent substance, or a luminescent substance can be reacted with the dNTP incorporated during the amplification reaction, and the label can be detected. Examples of radioisotopes include: 32 P, 125 I, 35 S, etc. can be used. As the fluorescent substance, for example, fluorescein (FITC), sulforhodamine (TR), tetramethylrhodamine (TRITC), etc. can be used. As the luminescent substance, luciferin, etc. can be used. There are no particular limitations on the type of these labels and the method of introducing the labels, and various conventionally known means can be used. For example, the method of introducing the labels includes the random prime method using a radioisotope.

[0038] The method for observing the amplification product incorporating the labeled dNTP may be any method known in the art for detecting the above-mentioned label. For example, when a radioisotope is used as the label, the radioactivity can be measured, for example, by a liquid scintillation counter, a γ-counter, etc. When a fluorescent substance is used as the label, the fluorescence can be detected using a fluorescent microscope, a fluorescent plate reader, etc.

[0039] (2) Hybridization method Mutations in the EP300 gene can also be detected using a hybridization method.

[0040] First, a probe capable of distinguishing between the base sequence of the mutant EP300 gene and the base sequence of the wild-type EP300 gene is designed by comparing the two, and the presence or absence of hybridization using such a probe can be used to detect whether or not a sample contains the mutant EP300 gene.

[0041] Probe design techniques are well known in the art, and probes that can be used in the present invention are designed to satisfy conditions that allow specific hybridization, for example, to have a length and base composition (melting temperature) that allow specific hybridization. The length of the probe is preferably 10 bases or more, more preferably 20 to 50 bases, and even more preferably 20 to 30 bases.

[0042] In a specific embodiment, probes that can be used to detect the EP300 gene and / or a mutation in the EP300 gene (deletion of the exon 22 region of the EP300 gene on chromosome 22) include, but are not limited to, the following probes: A probe for detecting the deletion region of the EP300 gene represented by the base sequence of SEQ ID NO: 3 (CTTTGTCAGAAGTCATGGGA), A probe for detecting the common region of the EP300 gene represented by the base sequence (CCTGGTAAGGGTCACCA) of SEQ ID NO:6, A probe for detecting the mutant region of the EP300 gene represented by the base sequence of SEQ ID NO:9 (CTTTGTCAGGTTTTTTATTC).

[0043] In this method, a hybridization reaction is carried out using a probe, and the presence of the mutant EP300 gene is detected by detecting the specific binding (hybrid). The hybridization reaction must be carried out under stringent conditions. Such stringent conditions are well known in the art and are not particularly limited.

[0044] When hybridization is performed in this method, the probe may be labeled with a fluorescent label (fluorescein, rhodamine, VIC, etc.), a radioactive label ( 32 Appropriate labels such as phospholipids (e.g., phospholipids), enzyme labels (e.g., alkaline phosphatase, horseradish peroxidase), and biotin labels can be added.

[0045] The regions of the EP300 gene to which each primer and probe corresponds are shown in FIG. 2 and FIG.

[0046] (3) Detection at the protein level The detection of mutant cells at the protein level is carried out, for example, by detecting a protein specifically expressed in mutant cells or a denatured protein. The detection can be carried out by an immunoassay (immunological measurement method). That is, the expression of a protein is measured based on the reaction between a protein specifically expressed in mutant cells or a denatured protein in a sample and an antibody that specifically binds to the protein. The immunoassay may be performed in either a liquid phase system or a solid phase system as long as it is a method commonly used in the field. The format of the immunoassay is not limited, and may be a direct solid phase method, a sandwich method, a competitive method, a Western blotting method, an ELISA (enzyme linked immunosorbent assay) method, or the like.

[0047] The binding (reaction) of a protein specifically expressed in mutant cells or a denatured protein with an antibody can be measured according to a known method. Those skilled in the art can determine an effective and optimal measurement method for each assay depending on the type and format of the immunoassay employed, the type of label used, etc. For example, in order to easily detect the binding between a protein in a sample and an antibody, the antibody is labeled to directly detect the binding, or a labeled secondary antibody or a biotin-avidin complex is used to indirectly detect the binding.

[0048] As a label for labeling an antibody used in an immunoassay, an enzyme, a radioisotope, a fluorescent dye, or an avidin-biotin system can be used. As an enzyme, an enzyme used in a normal enzyme immunoassay (EIA), such as peroxidase, β-galactosidase, alkaline phosphatase, etc. can be used. As a radioisotope, 125 I and 3 The fluorescent dye may be one used in a conventional radioimmunoassay (RIA), such as Fluorescein isothiocyanate (FITC) or tetramethylrhodamine isothiocyanate (TRITC), which is used in a conventional fluorescent antibody technique.

[0049] Detection of the label signal can also be performed according to a method known in the art. For example, when an enzyme label is used, a substrate that is decomposed by the action of the enzyme to develop a color is added, and the amount of decomposition of the substrate is optically measured to determine the enzyme activity, which is converted into the amount of bound antibody, and the amount of antibody is calculated by comparing it with a standard value. The substrate varies depending on the type of enzyme used. For example, when peroxidase is used as the enzyme, 3,3',5,5'-tetramethylbenzidine can be used, and when alkaline phosphatase is used as the enzyme, paranitrophenol or the like can be used. When a radioactive label is used, the amount of radiation emitted by the radioactive label is measured using a scintillation counter or the like. Fluorescent labels can be detected and quantified using, for example, a fluorescent microscope, a plate reader, or the like. EXAMPLES

[0050] The present invention will be described in detail below using examples, but the present invention is not limited thereto. In addition, the reagents and materials used are commercially available unless otherwise specified. Abbreviations used in this specification are the same as those commonly used in the art unless otherwise specified.

[0051] Example 1: Cell purification iPS cells were cultured in StemFit® AK03N medium (Ajinomoto) containing Y-27632 (FUJIFILM Wako Pure Chemical Industries, Ltd.) and iMatrix-511 (0.6 μg / cm 2 )-coated 96-well plates at a density of 100 cells / well. After 1 day of culture, the medium was replaced with AK03N medium without Y-27632 (Day 1). After 4 days of culture (Day 4), 5 days of culture (Day 5), and 6 days of culture (Day 6), the medium was replaced with AK03N medium, and after 7 days of culture (Day 7), the medium was replaced with AK03N medium (with Y-27632) containing iMatrix-511 (0.6 μg / cm 2 The colonies were then subcultured onto a 24-well plate coated with 96-well PBS (the entire colony in one well of the 96-well plate was seeded into one well of a 24-well plate). The medium was replaced with AK03N medium on the day after (Day 1'), and 4 and 5 days later (Day 4' and Day 5') of the passage, and 6 days later (Day 6'), AK03N (Y-27632-supplemented) medium was used to inoculate the cells with iMatrix-511 (0.6 μg / cm 2 The cells were subcultured onto a 6-well plate coated with 24-well plate (half of a colony in one well of a 24-well plate was seeded into one well of a 6-well plate). The medium was replaced with AK03N medium on the day after subculture (Day 1''). After that, the medium was replaced as needed, and when the cells became confluent, the cells were harvested using AK03N medium (supplemented with Y-27632). Wells in which EP300 mutation was not observed were evaluated as wells of cell populations not contaminated by mutant cells, and the cells were collected. Results of quantitative PCR of the collected cells (method was the same as in Example 5, primer set used was F1+R6). All the collected cells were normal cells.

[0052] [Table 1]

[0053] Example 2: Taqman PCR To detect the EP300 gene on the chromosome, three types of primers were designed and Taqman probe sequences specific to the regions flanked by the primers were created, targeting three sequences: the deleted region in the EP300 expression region on the chromosome, the region that is independent of the presence or absence of deletion (common region), and the region that is linked after deletion (mutant region). Multiplex PCR is possible because VIC dye is used for the probe of the common region, and FAM dye is used for the deleted region and mutant region. The relative positions of the primers and probes in each region are shown in Figure 2. The sequences are as follows: <For detection of deleted sequences (deleted region)> Forward primer: AAACTATTTTCAGTTCTTTGGTCATGAC (SEQ ID NO: 1) Reverse primer: CCTTAACCAAATGAAAACTTGCAA (SEQ ID NO: 2) Probe: CTTTGTCAGAAGTCATGGGA (SEQ ID NO: 3) <Design in common areas regardless of whether there are defects or not (common areas)> Forward primer: ATGCTGCTGGCATGAATAGGT (SEQ ID NO: 4) Reverse primer: GCTGTTCCTGCCCTAACCAA (SEQ ID NO:5) Probe: CCTGGTAAGGGTCACCA (SEQ ID NO: 6) <For detecting sequences after deletion (mutant region)> Forward primer: AAACTATTTTCAGTTCTTTGGTCATGAC (SEQ ID NO: 7) Reverse primer: GCCAAACCCAAAGAAAACAATT (SEQ ID NO: 8) Probe: CTTTGTCAGGTTTTTTATTC (SEQ ID NO: 9) As a positive control, two sequences of the regions between each primer were joined together and the sequences before and after were added to adjust the length to 300 bp. (1) Mutant region and common region, and (2) deletion region and common region were synthesized by ThermoFisher's Strings DNA Fragments synthesis service to create GeneArt Strings DNA Fragment Positive control. A calibration curve was created using this as shown below. The compound was diluted to 1 × 10 in DNase-free water. 10 Adjust to 1 x 10 copies / µl 8 The working solution is diluted to copies / μl, and then diluted 1 / 10 from that to prepare a standard curve sample. The sequence is shown below. (1) Mutant and common regions ATAGAAACTTTATTAAAACTATTTTCAGTTCTTTGGTCATGACCTTGGCTGTCTTTGTCAGGTTTTTTATTCTATGCAATTGACTGTATTATATCTTCAAAGTTACTATCTTTAAATTGTTTTCTTTGGGTTTGGCCACGATAATTATAGGGAT CATGCTGCTGGCATGAATAGGTCTGGCCCTGGTAAGGGTCACCATTTGGTTAGGGCAGGAACAGCAAGTTATAAGGCTGCAGTCATAGTGTAATTGCCTAGTAAAAGGGAGGGGCCATCGCTCTGTACAAGAGGAACTAATCCCAG (SEQ ID NO: 12) (2) Missing areas and common areas AGAAACTTTATTAAAACTATTTTCAGTTCTTTGGTCATGACCTTGGCTGTCTTTGTCAGAAGTCATGGGAAATATTGCAAGTTTTCATTTGGTTAAGGTTTGGGGTTAATTTTGGAATTGGCTCTGCTCTTCCAG GTTTGTTGAATGTACGGATCATGCTGCTGGCATGAATAGGTCTGGCCCTGGTAAGGGTCACCATTTGGTTAGGGCAGGAACAGCAAGTTATAAGGCTGCAGTCATAGTGTAATTGCCTAGTAAAAGGGAGGGGCC ATCGCTCTGTACAAGAGGAACTAATCCCAG (SEQ ID NO: 13) The reaction solution was adjusted to 900 nM primer and 250 nM probe, and 1 to 20 ng template was used to perform Taqman PCR. After reacting at 95°C for 20 seconds, analysis was performed using a StepOnePlusTM Real Time PCR System (Applied Biosystems) with a program that reacted at 95°C for 1 second and 60°C for 20 seconds for 40 cycles. Genomic extract samples of two types of mutants (Samples A and B) and two types of WTs (Samples C and D) were used as templates. The results of qPCR using 8 ng template are shown in Figure 3. Mutants and wild types (WT) could be detected separately. After performing qPCR, the dCT value was calculated using the common region as an endogenous control, and then the ddCT was calculated to examine the relative expression. The results are shown in Figure 4. It was confirmed that the mutant region was not detected in the WT sample. Since the deleted region was also confirmed in the mutant sample, this mutant sample is considered to be heterozygous with the WT. Samples A and B were mutant (mutant) CEC Si cells derived from iPS cells contaminated with EP300 mutant cells, and samples C and D were wild-type (WT) CEC Si cells derived from iPS cells not contaminated with EP300 mutant cells. The genome was extracted using the PureLink Genomic DNA Kit (Invitrogen, K1820-01). After extraction, the genome concentration was measured and the samples were stored at -20°C.

[0054] Reference example 1 RNA was extracted from CECSi derived from each iPS cell with or without the EP300 mutation using QIAGEN's RNeasy mini kit (#74106), and cDNA was synthesized using TOYOBO's ReverTra-plus- (#PCR501). Primer: Random primer Reaction scale: 20μL Reaction conditions: 42℃ 20 min × 1, 99℃ 5 min × 1 The cDNA thus prepared was subjected to RT-PCR using TaKaRa Ex Taq (registered trademark) (#RR001A) manufactured by TaKaRa Co., Ltd. in a thermal cycler. Reaction scale: 20μL Reaction conditions: (98℃ 3 seconds, 60℃ 30 seconds) x 40 After the reaction was completed, the mixture was applied to a 3.5% agarose gel, electrophoresed, and then stained with an ethidium bromide solution. The sequences of the main primers used in RT-PCR are shown in the table below. The positional relationship of the targets of the primers F1, R1, R2, and R3 is shown in Figure 8.

[0055] [Table 2]

[0056] The results are shown in Figure 5.

[0057] Example 3 RNA was extracted from corneal endothelial cells with 0% EP300 mutation contamination (lane 1, negative control: B4G12), iPS cells with 6.3% mutation contamination (lane 2: MCB P15), and corneal endothelial substitute cells with 75% mutation contamination (lane 3, positive control: TR1 CECSi) using QIAGEN's RNeasy mini kit (#74106), and cDNA was synthesized using TOYOBO's ReverTra-plus- (#PCR501). Primer: Random primer Reaction scale: 20μL Reaction conditions: 42℃ 20 min × 1, 99℃ 5 min × 1 The cDNA was subjected to RT-PCR using TOYOBO THUNDERBIRD SYBR qPCR Mix (#QPS201) in a thermal cycler. Reaction scale: 20μL Reaction conditions: (95℃ 3 sec, 62℃ 30 sec) x 40. After the reaction was completed, the mixture was applied to a 3.5% agarose gel, electrophoresed, and then stained with an ethidium bromide solution. The sequences of the primers used in RT-PCR are shown in the table below. The positional relationship targeted by the primers F1 and R6 is shown in FIG.

[0058] [Table 3]

[0059] The results are shown in Figure 6. There was a correlation between the mutation contamination rate and the band intensity, and EP300 mutation (EP300 having a deleted region) was detected.

[0060] Example 4 In order to confirm that the use of the primer set used in Example 3 in step 2 of Example 1 allows removal of mutant cells even when the contamination rate is low, iPS cells lacking EP300 were spiked into iPS cells without EP300 loss at various ratios (0%, 0.01%, 0.1%, 1%, 10%, 100%) and quantitative PCR was performed. RNA was extracted from each sample using QIAGEN's RNeasy mini kit (#74106), and cDNA was synthesized using TOYOBO's ReverTra-plus- (#PCR501). Primer: Random primer Reaction scale: 20μL Reaction conditions: 42℃ 20 min × 1, 99℃ 5 min × 1 The cDNA was subjected to quantitative PCR using TOYOBO THUNDERBIRD SYBR qPCR Mix (#QPS201) and ABI Step OnePlus. Reaction scale: 20μL Reaction conditions: (95℃ 3 seconds, 62℃ 30 seconds) x 40 The results are shown in Figure 7. Figure 7 shows comparative values ​​when the value for the group containing 100% EP300-deficient iPS cells is set to 100%. The sequences of the primers used for qPCR are shown in the table below.

[0061] [Table 4]

[0062] It was found that mutant cells can be detected even with a spike rate (contamination rate) of at least 0.1%.

[0063] Example 5 A master cell bank of iPS cells different from that in Example 1 was passaged to estimate the contamination rate of EP300 mutant cells. Quantitative PCR was performed in the same manner as in Example 4. The results are shown in Table 5 below.

[0064] [Table 5]

[0065] The division rate of EP300 mutant cells is faster than that of normal cells, and the proportion of mutant cells increases with expansion. However, by following the method of Example 1, mutant cells can be removed early and contamination can be prevented. Note that the method of Example 1 is not limited to the removal of EP300 mutant cells, but can also be applied to the removal of cells mutated by other genes. [Industrial Applicability]

[0066] Since a certain number of cells are cultured, a certain cell population can be obtained compared to the limiting dilution method, which shortens the culture time, and mutant cells can be detected even with a low contamination rate, allowing efficient removal of mutant cells. By carrying out this method before the expansion culture of iPS cells, mutant cells that are difficult to detect before expansion culture can be found and removed early, and contamination by mutant cells after expansion culture can be prevented.

Claims

1. 1. A method for purifying normal cells from a cell population containing mutant cells at a contamination rate of 1% or less, comprising the steps of: Step 1: fractionating and culturing the cell population; Step 2: detecting mutant cells in each cultured fraction; and Step 3: Culturing the fraction of cells in which no mutant cells were detected.

2. The method according to claim 1 , further comprising one or more expansion culture steps between steps 1 and 2.

3. The method according to claim 1, wherein the contamination rate is 0.1 to 1%.

4. 2. The method according to claim 1, wherein the number of fractions in step 1 is 20 to 30.

5. In step 1, 0.05 to 2 × 10 per fraction ３ cells / cm ２ 5. The method of claim 4, wherein the seeds are seeded at a density of

6. The method according to claim 1, wherein in step 1, the number of fractions is 90 to 100.

7. In step 1, 0.03 to 3 × 10 per fraction ３ cells / cm ２ 7. The method of claim 6, wherein the seeds are seeded at a density of

8. The method of claim 1 , wherein the cell is a pluripotent stem cell.

9. The method of claim 8, wherein the pluripotent stem cells are iPS cells.

10. The method according to any one of claims 1 to 9, wherein the mutation is a mutation in the EP300 gene.

11. The method according to claim 10, wherein the mutation in the EP300 gene is a partial deletion in the PHD (Plant homeodomain) region of the EP300 gene.

12. A primer set for specifically detecting a mutation in the PHD region of the EP300 gene, The primer set includes a combination of a forward primer having the base sequence of SEQ ID NO:7 and a reverse primer having the base sequence of SEQ ID NO:

8.

13. A probe for specifically detecting a mutation in the PHD region of the EP300 gene, the probe having the base sequence of SEQ ID NO:

9.

14. A primer set for detecting a PHD region of the EP300 gene, The primer set includes a combination of a forward primer having the base sequence of SEQ ID NO:1 and a reverse primer having the base sequence of SEQ ID NO:

2.

15. A probe for detecting the PHD region of the EP300 gene, having the base sequence of SEQ ID NO:

3.

16. A primer set for detecting the EP300 gene, The primer set includes a combination of a forward primer having the base sequence of SEQ ID NO:4 and a reverse primer having the base sequence of SEQ ID NO:

5.

17. A probe for detecting the EP300 gene, having the base sequence of SEQ ID NO:

6.

18. A primer set for amplifying a target nucleic acid sequence, comprising a combination of a forward primer having the base sequence of SEQ ID NO: 10 and a reverse primer having the base sequence of SEQ ID NO: 11, characterized in that the target nucleic acid sequence is within a PHD region having a mutation in the EP300 gene.

19. The primer set according to claim 18, wherein the mutation in the EP300 gene is a partial deletion in the PHD region of the EP300 gene.

20. The method according to claim 1, wherein in step 2, a primer set according to claim 12 and a probe according to claim 13 are used.

21. The method according to claim 1, characterized in that in step 2, the primer set according to claim 18 is used.

Images