Method for producing osteoblast cluster using ips cells

Abstract

To provide a novel method of producing an osteoblast cluster, capable of yielding an osteoblast cluster having a high bone regeneration ability through the use of iPS cells as the source material.SOLUTION: Provided is a method of producing an osteoblast cluster from iPS cells, the method including the steps of: (1) inducing formation of an embryoid by subjecting undifferentiated iPS cells to non-adherent culture; (2) inducing differentiation of the iPS cells into mesodermal cells by subjecting the embryoid of the iPS cells obtained in the step (1) to non-adherent culture; and (3) inducing differentiation into osteoblasts by subjecting the mesodermal cells of the iPS cells obtained in the step (2) to non-adherent culture, wherein the steps (1) and (2) are each performed using a culture vessel comprising a bottom surface and a circular side wall standing upright from the bottom surface, the bottom surface having a plurality of depressed portions disposed independently of each other.SELECTED DRAWING: None

Description

[Technical field]

[0001] [CROSS REFERENCE TO RELATED APPLICATIONS] This application claims priority based on Japanese Patent Application No. 2019-033277, filed on February 26, 2019, the entire disclosure of which is incorporated herein by reference. The present invention relates to a method for producing an osteoblast mass using iPS cells. [Background technology]

[0002] There is a great demand for artificial bone and bone substitute materials to fill in the gaps in bone caused by bone tumor removal, comminuted fractures, bone defects due to fixation of rheumatoid arthritis, and bone loss due to alveolar ridge resorption.

[0003] Currently, non-resorbable materials such as hydroxyapatite and resorbable materials such as β-tertiary calcium phosphate, which are used clinically as artificial bone and bone substitute materials, have problems such as lack of osteoinductivity compared to autogenous bone, and the prognosis of surgical treatment is not necessarily good. In addition, hybrid artificial bone and bone substitute materials that combine artificial bone and growth factor proteins such as BMP (Bone Morphogenetic Protein), which are hoped for as next-generation types, have not been able to achieve sufficient bone regeneration effects because they do not have the "extracellular matrix" that is important for bone tissue regeneration.

[0004] Under these circumstances, the present inventor has succeeded in producing a bone regeneration agent that uses stem cells as a raw material, contains inactivated cell masses, and is characterized in that the inactivated cell masses contain at least calcified material and extracellular matrix (Patent Documents 1 and 2). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] WO2015 / 064705 [Patent Document 2] WO2018 / 181960 [Non-patent literature]

[0006] [Non-Patent Document 1] Stem Cell Reports Vol. 2, 751-760, June 3, 2014 Summary of the Invention [Problem to be solved by the invention]

[0007] An objective of the present invention is to provide a novel method for producing an osteoblast mass, which is capable of obtaining an osteoblast mass having high bone regeneration ability using iPS cells as a raw material. [Means for solving the problem]

[0008] As a result of intensive research under the above circumstances, the present inventors have unexpectedly found that in a method for producing an osteoblast mass using undifferentiated iPS cells as a raw material, which comprises a step of inducing embryoid body formation, a step of inducing differentiation into mesodermal cells, and a step of inducing differentiation into osteoblasts, by utilizing microspace culture in (1) the step of inducing embryoid body formation and (2) the step of inducing differentiation into mesodermal cells, an osteoblast mass with extremely high bone regeneration ability can be obtained. Based on this new finding, the present inventors further investigated the culture conditions, etc., and completed the present invention.

[0009] Thus, the present invention provides the following methods, osteoblast masses, etc.: Item 1. (1) A step of inducing the formation of embryoid bodies by non-adherent culture of undifferentiated iPS cells; (2) performing non-adherent culture of the embryoid bodies of the iPS cells obtained in the above step (1) to induce differentiation of the iPS cells into mesodermal cells; and (3) A method for producing an osteoblast mass from iPS cells, comprising a step of non-adherently culturing mesodermal cells of the iPS cells obtained in the above step (2) and inducing differentiation into osteoblasts, The method, wherein steps (1) and (2) are carried out using a culture vessel having a bottom surface and an annular side wall extending upright from the bottom surface, the bottom surface having a plurality of recesses provided independently of one another.

[0010] Item 2. The method according to Item 1, wherein at least one of the plurality of recesses has a circle equivalent diameter of 200 to 900 μm and a depth of 200 to 1000 μm.

[0011] Item 3. The method according to item 1 or 2, wherein the openings of the plurality of recesses have a substantially circular shape.

[0012] Item 4. The method according to any one of Items 1 to 3, wherein the iPS cells are human iPS cells or mouse iPS cells.

[0013] Item 5. The method according to Item 4, wherein the culture time in the step (1) is 0.625 to 3.5 days.

[0014] Item 6. The method according to any one of Items 1 to 5, wherein the culture in the step (2) is carried out in the presence of at least one agent selected from the group consisting of a Wnt signal activator and a Hedgehog signal inhibitor.

[0015] Item 7. The method according to Item 6, wherein the Wnt signal activator is at least one selected from the group consisting of CHIR99021, 6-bromoindirubin-3'-oxime, kenpaullone, SB-216763, SKL2001, deoxycholic acid, WAY-316606, NSC-693868, lysinine, 7-oxo-β-sitosterol, IM-12, HLY78 and retinoic acid.

[0016] Item 8. The method according to Item 6 or 7, wherein the hedgehog signal inhibitor is at least one selected from the group consisting of cyclopamine, AY9944, GANT58, GANT61, jervine, SANT-1, SANT-2, U18666A, veratramine, vismodegib, Cur-61414, lobotomycin, JK184 and HPI-4.

[0017] Item 9. The method according to any one of Items 1 to 8, wherein the culture in the step (3) is carried out in the presence of at least one compound selected from the group consisting of a hypoxia-mimetic compound, a statin compound, and retinoic acid.

[0018] Item 10. The method according to any one of Items 1 to 9, which comprises, prior to the step (1), a step of culturing undifferentiated iPS cells without using feeder cells.

[0019] Item 11. The step (1) is carried out at a cell concentration of 1.5 × 10 5 ~3.5×10 5 11. The method according to any one of items 1 to 10, which is carried out by placing a suspension of undifferentiated iPS cells at 100 cells / ml in a culture vessel and culturing the same.

[0020] Item 12. The method according to any one of Items 1 to 11, wherein the step (2) is carried out using a culture vessel having at least one well, and the step (3) is carried out by placing 1 to 10 wells of a culture solution containing the mesodermal cells obtained in the step (2) in the culture vessel and culturing the cells.

[0021] Item 13. The method according to any one of Items 1 to 12, wherein the culture in the step (1) is carried out in the presence of a ROCK inhibitor, and the culture in the step (2) and the step (3) is carried out in the presence of retinoic acid.

[0022] Item 14. A cell mass which is an osteoblast cell mass derived from a human iPS cell and has a ferret diameter of 1 to 4 mm.

[0023] Item 15. A cell cluster according to item 14, which is obtained by the method according to any one of items 1 to 13. Effect of the Invention

[0024] According to the present invention, a novel method for producing an osteoblast mass can be provided, which is capable of obtaining an osteoblast mass having high bone regeneration ability using iPS cells as a raw material. [Brief description of the drawings]

[0025] [Figure 1]A method for inducing mouse iPS cells into osteoblastic cell masses. Embryoid bodies were induced from mouse iPS cells using a low-adhesion plate with a microscopic space shape and multiple recesses on the bottom of the well, Elplasia (registered trademark) (Kuraray, Japan), to produce osteoblastic cell masses. Elplasia (registered trademark) plates with different diameters of the recess openings (400 μm: Elp400, 500 μm: Elp500, 900 μm: Elp900) were used to examine the effect of these differences on the induction of osteoblastic cell masses. [Diagram 2] Top: Phase contrast micrographs of mouse iPS cells seeded in Elp400, Elp500, and Elp900 and cultured in ES medium for two days. Bottom: Enlarged photographs of one well in each of the Elp400, Elp500, and Elp900 in the middle. [Diagram 3] Left: Ferret diameter of iPS cell clusters during osteoblast differentiation induction period (0-35 days) using Elp400, Elp500, and Elp900 (n=3, *P<0.01: ANOVA with Tukey's multiple-comparison test). Right: Photographs of representative iPS cell clusters in Elp400, Elp500, and Elp900 during the same period. [Figure 4] Cell viability in iPS cell clusters. The viability was examined using a live / dead cell simultaneous staining kit (LIVE / DEAD® Viability / Cytotoxicity Kit) at the start of osteoblast differentiation induction using Elp400, Elp500, and Elp900 (day 0) and 14 days later (day 14). Green indicates live cells, and red indicates dead cells. [Diagram 5] Real-time RT-PCR analysis of the expression of osteoblast-specific marker genes (Runx2, Osterix, Collagen 1a1, Bone sialoprotein, Osteopontin, Osteocalcin) in cell masses 10 days after induction of osteoblast differentiation using Elp400, Elp500, and Elp900 (n=3, *P<0.05: ANOVA with Tukey's multiple-comparison test). [Figure 6]Hematoxylin and eosin (HE) staining and von Kossa and methylene blue double staining images of cell mass sections 35 days after osteoblast differentiation induction using Elp400, Elp500, and Elp900. [Figure 7] A method for inducing human iPS cells into osteoblastic masses. Embryoid bodies and mesoderm were induced from human iPS cells using the Elplasia (registered trademark) low-adhesion plate (Elp500), which has multiple recesses with a diameter of 500 μm on the bottom of the well, to produce osteoblastic masses. As a comparative control, a normal low-adhesion culture dish was used without using Elplasia (registered trademark). [Figure 8] Human iPS cells were induced to develop into embryoid bodies and mesodermal cells using low-adhesion culture dishes or Elp500, and then osteoblast differentiation was induced for 30 days, after which the number of cell clusters in the culture flask was counted. By using Elp500, the efficiency of osteoblast cluster production from human iPS cells increased by about 9 times (n=5). [Figure 9] Von Kossa and methylene blue double stained images of cell cluster sections from human iPS cell clusters that were induced to differentiate into osteoblasts for 30 to 90 days after being induced to become embryoid bodies and mesodermal cells using Elp500. [Figure 10] Real-time RT-PCR analysis of the expression of osteoblast-specific marker genes (Runx2, Osterix, Collagen 1a1, Osteocalcin) in human iPS cell clumps that were induced to differentiate into embryoid bodies or mesodermal cells using a regular low-adhesion culture dish (low-adhesion culture dish) or Elp500 (Elplasia (registered trademark)) and then induced to differentiate into osteoblasts for 30 days, and in undifferentiated human iPS cells (undifferentiated iPS cells) immediately prior to embryoid body culture (n=3, *P<0.05: ANOVA with Tukey's multiple-comparison test). [Figure 11]The results of real-time RT-PCR analysis of the expression of undifferentiated marker genes (Nanog), mesoderm (mesenchymal stem cell) / osteoblast precursor cell marker genes (Brachyury, Runx2, Osterix), and osteoblast-specific genes (Collagen 1a1, Osteocalcin) in human iPS cell clumps that were induced to differentiate into embryoid bodies and mesodermal cells using Elp500 and then induced to differentiate into osteoblasts for 60 days, and in undifferentiated human iPS cells just before embryoid body culture, are shown (n=3). [Figure 12] Analysis of the components of human iPS cell-derived osteoblastic cell masses using FTIR. Human iPS cell masses were induced to differentiate into embryoid bodies and mesodermal cells using Elp500, and then induced to differentiate into osteoblasts for 0 to 60 days. After drying, the cells were analyzed by FTIR. Human freeze-dried bone (FDBA) was used as a control. The arrows indicate the FTIR spectrum peaks (Am I, Am II, PO4 3-, CO3 2-) of the original bone tissue. [Figure 13] (A) Ferret diameter of human iPS cell clumps (n=25) induced to differentiate into embryoid bodies and mesodermal cells using Elp500, followed by osteoblast differentiation induction for 3-30 days. Thirty days after osteoblast differentiation induction, cell clumps of various sizes with ferret diameters of approximately 0.5-3 μm were observed (inset). (B) Cell clumps 30 days after osteoblast differentiation induction were divided into sizes with ferret diameters of 0.5-1 mm or less, 1-2 mm or less, and 2-3 mm or less, and HE stained images (left column) and von Kossa and methylene blue double stained images (right column) of representative cell clump sections from each group are shown. Larger cell clumps show more pronounced calcification. [Figure 14] Photograph (A) of a human iPS cell mass that was induced to develop into embryoid bodies and mesodermal cells using Elp500, and then induced to differentiate into osteoblasts for 120 days, and (B) a photograph of the same mass after freeze-drying. [Figure 15] HE staining images and micro-CT images taken 4 weeks after implanting (A) the human iPS cell-derived freeze-dried osteoblast mass shown in Figure 14 or (B) human freeze-dried bone (FDBA) into a 5 mm diameter bone defect created in a rat skull. [Figure 16]1 shows a microspace culture vessel 1 in a typical embodiment of the present invention. [Figure 17] 17 shows a cross-sectional view of a plane perpendicular to the microspace culture vessel 1 and including the dotted line AB in FIG. [Figure 18] An enlarged view of region 4 on bottom surface 2 in FIG. 16 is shown. [Figure 19] 19 shows a cross-sectional view of region 4 shown in FIG. [Figure 20] 1 shows an enlarged view of region 4 in an embodiment in which recess 6 has a regular hexagonal shape. [Figure 21] FIG. 1 shows a schematic diagram illustrating an embodiment in which one cell cluster fits in each well of a microspace culture vessel 1. [Figure 22] 1 shows an outline of a seesaw-type bioreactor used in the examples. [Figure 23] FIG. 1 shows a schematic diagram of a culture flask that can be used for shaking culture. [Figure 24] This shows the method for inducing human iPS cells into osteoblast masses and the conditions for examining the number of cells used. [Diagram 25] The figure shows the number of cell aggregates formed per flask on day 30 of osteoblast differentiation induction. Number of seeded cells: The number of cells seeded per well of a 24-well Elplasia (registered trademark) culture plate in the embryoid body formation step. Wells: The number of wells of mesodermal cell culture transferred to one flask to start the osteoblast differentiation induction step. [Figure 26] The ferret diameter of the cell mass on day 30 of osteoblast differentiation induction (n=10) is shown. Number of seeded cells: The number of cells seeded in one well of a 24-well Elplasia (registered trademark) culture plate in the embryoid body formation process. Well: The number of wells of mesodermal cell culture transferred to one flask to start the osteoblast differentiation induction process. [Figure 27]The results of real-time RT-PCR analysis of the expression of osteoblast-specific marker genes (Runx2 and Osteocalcin) in cell masses on days 0 and 30 of osteoblast differentiation induction are shown (n=3, *P<0.05: ANOVA with Tukey's multiple-comparison test). Different letters indicate significant differences. Number of seeded cells: The number of cells seeded into one well of a 24-well Elplasia (registered trademark) culture plate in the embryoid body formation process. Wells: The number of wells of mesodermal cell culture transferred to one flask to start the osteoblast differentiation induction process. [Figure 28] The HE stained images (left column images for each condition) and von Kossa and methylene blue double stained images (right column images for each condition) of the cell masses 30 days after osteoblast differentiation induction under each condition are shown. Number of seeded cells: The number of cells seeded in one well of a 24-well Elplasia (registered trademark) culture plate in the embryoid body formation process. 1 to 8 wells: The number of wells of mesodermal cell culture transferred to one flask to start the osteoblast differentiation induction process. [Figure 29] In the production of osteoblastic cell clusters using human iPS cells cultured in a feeder cell-free environment, HE staining images (left column) and von Kossa and methylene blue double staining images (right column) of osteoblastic cell clusters with and without the addition of 1 μM retinoic acid to mesoderm differentiation-inducing medium and osteoblast differentiation-inducing medium are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] Method for producing osteoblast mass The present invention (1) a step of inducing the formation of embryoid bodies by non-adherent culture of undifferentiated iPS cells; (2) performing non-adherent culture of the embryoid bodies of the iPS cells obtained in the above step (1) to induce differentiation of the iPS cells into mesodermal cells; and (3) A step of inducing differentiation of mesodermal cells from the iPS cells obtained in the above step (2) into osteoblasts by non-adherent culture. A method for producing an osteoblast mass from an iPS cell comprising: The steps (1) and (2) are carried out using a culture vessel having a bottom surface and an annular side wall extending upright from the bottom surface, the bottom surface having a plurality of recesses provided independently of one another. to provide.

[0027] In the present invention, non-adhesive culture means culture in a state in which adhesion of cells to the bottom surface of a culture vessel (for example, the bottom surface and wall surface) is suppressed. In the present invention, non-adhesive culture includes shaking culture, stationary culture using a non-adhesive culture vessel in which adhesion of cells to the bottom surface of a culture vessel is suppressed (for example, a non-adhesive culture dish, a non-adhesive well, a non-adhesive flask, a three-dimensional culture plate, a cell aggregate preparation vessel, etc.). As the non-adhesive culture vessel, a vessel subjected to low-adhesive surface treatment by phospholipid gel, hydrogel, microfabrication, etc. can be used. In addition, in the present invention, the above-mentioned non-adhesive culture vessel may be used for shaking culture, or a culture vessel that is not non-adhesive may be used. When performing shaking culture, the method is not particularly limited, but for example, it can be performed using a seesaw-type bioreactor as shown in FIG. 22. In addition, the inclination angle of shaking culture is not particularly limited, but is preferably 1° to 40°, more preferably 5° to 35°, and even more preferably 10° to 30° with respect to the horizontal direction. The amplitude of the shaking culture is not particularly limited, but may be, for example, about 0.1 to 20 cm. The period of shaking is not particularly limited, but may be, for example, about 0.01 to 1.00 Hz. In FIG. 22, the inclination angle is 10° and the amplitude is 5.5 cm. The width of the table (a component of the seesaw-type bioreactor) on which the culture flask is placed is not particularly limited, and for example, a table having a width in the range of 20 to 50 cm, 30 to 40 cm, etc. can be used. The table culture flask is not particularly limited, but may be, for example, a table having a growth area of ​​5 to 200 cm. 2 , 10~60cm 2 , 15~35cm 2 In the case of shaking culture, the cell concentration at the start of the culture is not particularly limited, but may be in the range of 100 / growth area of ​​25 cm. 2 When using a culture flask, 1 × 10 2 ~1×108 Approximately 1×10 cells / flask is preferable. 6 ~7×10 6 Approximately cells / flask is more preferable.

[0028] Microspace culture vessel The present invention is characterized in that the differentiation induction step into embryonic cells (step (1)) and the differentiation induction step into mesodermal cells (step (2)) are carried out in a culture vessel comprising a bottom surface and an annular side wall erected from the bottom surface, the bottom surface having a plurality of recesses provided independently of one another. In the present invention, a culture vessel comprising a bottom surface and an annular side wall erected from the bottom surface, the bottom surface having a plurality of recesses provided independently of one another is sometimes referred to as a microspace culture vessel. Similarly, culture using a microspace culture vessel is sometimes referred to as a microspace culture.

[0029] Hereinafter, a typical embodiment of the present invention will be described with reference to the drawings. First, FIG. 16 shows a microspace culture vessel 1 in a typical embodiment of the present invention. The microspace culture vessel 1 includes a bottom surface 2 and an annular side wall 3 erected from the bottom surface. Therefore, the microspace culture vessel 1 can also be said to include a well 5 composed of the bottom surface 2 and the annular side wall 3 erected from the bottom surface. The annular side wall 3 is not limited to an opening and a bottom surface having a substantially circular shape as shown in FIG. 16, and may be, for example, a polygon (triangle, quadrangle (e.g., square, rectangle, etc., parallelogram, trapezoid, etc.)), pentagon, hexagon, etc.).

[0030] FIG. 17 shows a cross-sectional view of a plane perpendicular to the microspace culture vessel 1 including the dotted line AB in FIG. 16. Note that, as in the preferred embodiment shown in FIG. 17, the material constituting the wall surface and the material constituting the bottom surface may be different (in the case of FIG. 17, the bottom surface is transparent and the wall surface is made of a non-transparent material (for example, colored black or the like). FIG. 18 shows an enlarged view of region 4 on the bottom surface 2 in FIG. 16. FIG. 19 shows a cross-sectional view of region 4 shown in FIG. 18 including the dotted line CD along a plane perpendicular to the approximate plane constituted by the microspace culture vessel 1. As shown in FIG. 18, the bottom surface 2 of the microspace culture vessel 1 in FIG. 16 is made of independent The micro-space culture vessel 1 has a plurality of recesses 6 arranged in a line. In this specification, the recesses formed on the bottom surface of the micro-space culture vessel (and the wells provided in the micro-space culture vessel) may be referred to as micro-wells or micro-wells. In the present invention, the shape of the recesses 6 is not particularly limited as long as it has a bottom surface, and examples thereof include those in which the shape of the opening 7 is an approximate shape (for example, a circle as shown in FIG. 18), a polygonal shape (a triangle, a quadrangle (for example, a square, a rectangle, etc., a parallelogram, a trapezoid, etc.)), a pentagon, a hexagon, etc.). In the present invention, the opening 7 means a portion formed by connecting the highest points of the side walls 9 in one recess 6 (in the case of FIG. 19, the opening is parallel to the approximate plane formed by the main body of the micro-space culture vessel 1). In the present invention, the recesses 6 form a micro-space for culturing cells. In the present invention, the circle-equivalent diameter 1 in at least one of the plurality of recesses 6 (preferably 80% or more of the number of recesses 6, more preferably 90% or more, typically all of the recesses 6) is preferably 200 to 900 μm, more preferably 400 to 700 μm, and even more preferably 450 to 550 μm. In the present invention, the circle-equivalent diameter 1 means the diameter of the inscribed circle of a plane figure formed by the intersection points of a surface parallel to the approximately flat surface constituted by the microspace culture vessel 1 and the side wall 9 (for example, the circle-equivalent diameter 1 in the case where the plane figure is a regular hexagon is as shown in FIG. 20). When the "plane figure formed by the intersection points of a surface parallel to the approximately flat surface constituted by the microspace culture vessel 1 and the side wall 9" varies depending on the depth of the recess, in the present invention, the circle-equivalent diameter 1 indicates the maximum value among them.

[0031] FIG. 19 shows a cross-sectional view of a surface perpendicular to the approximately flat surface constituted by the microspace culture vessel 1, including the dotted line CD in FIG. 18. In the present invention, the bottom surface 8 of the recess 6 may be curved (for example, round bottom) as shown in FIG. 19, or may be flat. In addition, the side wall 9 may be parallel as shown in FIG. 19, or may be tapered (for example, tapered with the opening side wide and the bottom side narrow). In the present invention, the depth d of at least one of the multiple recesses 6 (preferably 80% or more of the number of recesses 6, more preferably 90% or more, typically all of the recesses 6) is preferably 200 to 1000 μm, more preferably 300 to 800 μm, and even more preferably 400 to 700 μm. In the present invention, when the surface constituting the opening 7 of the recess and the surface constituting the bottom surface 8 are not parallel and / or the bottom surface is curved, the depth of the recess 6 refers to the distance from the position on the bottom surface of the recess farthest from the opening to the opening.

[0032] In the present invention, the volume of the space defined by the recess 6 (the space defined by the opening 7, the bottom surface 8, and the side wall 9) is not particularly limited, but each recess 6 is preferably 0.02 to 0.55 mm 3 More preferably, the thickness is 0.04 to 0.35 mm. 3 and more preferably 0.07 to 0.15 mm 3 It is preferable that at least one of the plurality of wells 6 (preferably 80% or more of the number of wells 6, more preferably 90% or more, and typically all of them) constitutes a space of the above-mentioned volume. In the present invention, the wells preferably have a dimension such that one to two (preferably one) iPS cell clusters can be accommodated in each well (e.g., FIG. 21).

[0033] The material constituting the microspace culture vessel 1 is not particularly limited, and examples thereof include those made of resins such as acrylic resins, polystyrene resins, acrylic-styrene resins, polycarbonate resins, melamine resins, polyglycolic acid, polylactic acid, polyester resins, polyimide, polyvinyl alcohol resins, ethylene-vinyl alcohol resins, thermoplastic elastomers, polyvinyl chloride resins, silicone resins, and combinations of these resins.

[0034] In order to culture the cells or cell aggregates while maintaining the state of being arranged in the recesses, the culture using the microspace culture vessel 1 is typically performed by stationary culture. Therefore, it is preferable that at least a part of the bottom surface 2 and / or side wall 3 of the microspace culture vessel 1, particularly the bottom surface 2, is non-adhesive to cells so that the cells or cell aggregates do not adhere to these. There is no particular limitation on the method for making the wall surface non-adhesive to cells, but for example, a method of applying a non-adhesive to a cell to form a hydrophilic phase on at least a part of the wall surface is conceivable. Examples of the non-adhesive to cells include hydrophilic polymers such as polyethylene glycol, polymers having a betaine structure, phospholipid-containing polymers, and polyhydroxyethyl (meth)acrylate polymers.

[0035] Although the present invention has been described above using drawings showing typical embodiments, the present invention is not limited to those using the culture medium shown in the drawings. For example, the microspace culture vessel 1 is not limited to a rectangular plate as shown in FIG. 16, but may be, for example, a circular plate.

[0036] (1) Induction of embryoid body formation The method of the present invention comprises the step of subjecting undifferentiated iPS cells to non-adherent culture and inducing the formation of embryoid bodies.

[0037] The iPS cells used as the raw material can be those produced by introducing a nuclear reprogramming substance into somatic cells. Examples of iPS cells include those derived from mammals such as humans, mice, rats, monkeys, dogs, pigs, cows, cats, goats, sheep, rabbits, guinea pigs, and hamsters, and are preferably derived from humans, mice, rats, monkeys, dogs, and the like, and more preferably from humans or mice.

[0038] Somatic cells that can be used as starting materials for producing iPS cells may be any cells other than germ cells, and examples of such cells include oral mucosal cells (e.g., gingival fibroblasts, buccal mucosa fibroblasts, gingival epithelial cells, buccal mucosa epithelial cells, etc.), keratinizing epithelial cells (e.g., keratinizing epidermal cells, etc.), mucosal epithelial cells (e.g., epithelial cells of the tongue surface, etc.), exocrine gland epithelial cells (e.g., mammary gland cells, etc.), hormone-secreting cells (e.g., adrenal medullary cells, etc.), metabolic and storage cells (e.g., hepatic cells, etc.), luminal epithelial cells that form the interface (e.g., type I alveolar cells, etc.), luminal epithelial cells of the inner duct (e.g., blood Examples of the somatic cell source include endothelial cells, endothelial cells, etc.), ciliated cells with transport function (e.g., airway epithelial cells, etc.), cells for secreting extracellular matrix (e.g., fibroblasts, etc.), contractile cells (e.g., smooth muscle cells, etc.), blood and immune system cells (e.g., T lymphocytes, etc.), cells related to sensation (e.g., rod cells, etc.), autonomic nervous system neurons (e.g., cholinergic neurons, etc.), supporting cells of sensory organs and peripheral neurons (e.g., satellite cells, etc.), nerve cells and glial cells of the central nervous system (e.g., astrocytes, etc.), pigment cells (e.g., retinal pigment epithelial cells, etc.), and their precursor cells (tissue precursor cells, etc.). There is no particular limitation on the degree of differentiation of the cells, and both undifferentiated precursor cells (including somatic stem cells) and terminally differentiated mature cells can be used as the source of somatic cells in the present invention. Examples of undifferentiated precursor cells include tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.

[0039] In the present invention, the "nuclear reprogramming substance" refers to any substance (group) capable of inducing iPS cells from somatic cells, such as a proteinaceous factor or a nucleic acid encoding the same (including a form incorporated in a vector), or a low molecular weight compound. When the nuclear reprogramming substance is a proteinaceous factor or a nucleic acid encoding the same, preferred examples include the following combinations (hereinafter, only the names of the proteinaceous factors are given): [1] Oct3 / 4, Klf4, c-Myc [2] Oct3 / 4, Klf4, c-Myc, Sox2 (wherein Sox2 can be replaced by Sox1, Sox3, Sox15, Sox17, or Sox18. Klf4 can be replaced by Klf1, Klf2, or Klf5. Furthermore, c-Myc can be replaced by T58A (active mutant), N-Myc, or L-Myc.) [3] Oct3 / 4, Klf4, c-Myc, Sox2, Fbx15, Nanog, Eras, ECAT15-2, TclI, β-catenin (active mutant S33Y) [4] Oct3 / 4, Klf4, c-Myc, Sox2, TERT, SV40 Large T antigen (hereinafter SV40LT) [5] Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E6 [6] Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E7 [7] Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV6 E6, HPV16 E7 [8] Oct3 / 4, Klf4, c-Myc, Sox2, TERT, Bmil (see WO2007 / 069666 (but for the substitution of Sox2 with Sox18 and the substitution of Klf4 with Klf1 or Klf5 in the combination of [2] above, see Nature Biotechnology, 26, 101-106 (2008)). For the combination of "Oct3 / 4, Klf4, c-Myc, Sox2", see also Cell, 126, 663-676 (2006) and Cell, 131, 861-872 (2007). For the combination of "Oct3 / 4, Klf2 (or Klf5), c-Myc, Sox2", see also Nat. Cell Biol., 11, 197-203 (2009). For the combination of "Oct3 / 4, Klf4, c-Myc, Sox2, hTERT, SV40LT", see Nature, 451, 141-146 (2008). [9] Oct3 / 4, Klf4, Sox2 (Nature Biotechnology, 26, 101-106 (2008))

[10] Oct3 / 4, Sox2, Nanog, Lin28 (Science, 318, 1917-1920 (2007))

[11] Oct3 / 4, Sox2, Nanog, Lin28, hTERT, SV40LT (see Stem Cells, 26, 1998-2005 (2008))

[12] Oct3 / 4, Klf4, c-Myc, Sox2, Nanog, Lin28 (Cell Research (2008) 600-603)

[13] Oct3 / 4, Klf4, c-Myc, Sox2, SV40LT (see also Stem Cells, 26, 1998-2005 (2008))

[14] Oct3 / 4, Klf4 (see Nature 454:646-650 (2008), Cell Stem Cell, 2:525-528(2008))

[15] Oct3 / 4, c-Myc (see Nature 454:646-650 (2008))

[16] Oct3 / 4, Sox2 (Nature, 451, 141-146 (2008), see WO2008 / 118820)

[17] Oct3 / 4, Sox2, Nanog (see WO2008 / 118820)

[18] Oct3 / 4, Sox2, Lin28 (see WO2008 / 118820)

[19] Oct3 / 4, Sox2, c-Myc, Esrrb (where Essrrb can be replaced by Esrrg; see Nat. Cell Biol., 11, 197-203 (2009))

[20] Oct3 / 4, Sox2, Esrrb (see Nat. Cell Biol., 11, 197-203 (2009))

[21] Oct3 / 4, Klf4, L-Myc

[22] Oct3 / 4, Nanog

[23] Oct3 / 4

[24] Oct3 / 4, Klf4, c-Myc, Sox2, Nanog, Lin28, SV40LT (Science, 324: 797-801 (2009))

[25] Oct3 / 4, Klf4, Sox2, members of the GLIS family (e.g., GLIS1, GLIS2, GLIS3, etc., preferably GLIS1 (GLIS family zinc finger 1). See WO2010 / 098419, WO2011 / 102531)

[26] Oct3 / 4, Klf4, Sox2, members of the IRX family (e.g., IRX1, IRX2, IRX3, IRX4, IRX5, IRX6, etc., preferably IRX6 (iroquois homeobox protein 6). See WO2010 / 098419)

[27] Oct3 / 4, Klf4, Sox2, members of the PTX family (e.g., PITX1, PITX2, PITX3, etc., preferably PITX2 (paired-like homeodomain transcription factor 2). Three isoforms (isoforms a, b, and c) are known for PITX2. Any isoform may be used, but isoform b is particularly preferred. See WO2010 / 098419)

[28] Oct3 / 4, Klf4, Sox2, DMRTB1 (DMRT-like family B with proline-rich C-terminal 1, see WO2010 / 098419)

[0040] In the above [1]-

[28] , other Oct family members, such as Oct1A and Oct6, can be used instead of Oct3 / 4. Also, other Sox family members, such as Sox7, can be used instead of Sox2 (or Sox1, Sox3, Sox15, Sox17, Sox18). Furthermore, other Lin family members, such as Lin28b, can be used instead of Lin28.

[0041] In addition, combinations that do not fall under the above [1]-

[28] but contain all of the components of any of them and further contain any other substances may also be included in the category of "nuclear reprogramming substances" in the present invention. In addition, under conditions in which the somatic cells to be subjected to nuclear reprogramming endogenously express some of the components of any of the above [1]-

[28] at a level sufficient for nuclear reprogramming, combinations of only the remaining components excluding those components may also be included in the category of "nuclear reprogramming substances" in the present invention.

[0042] Among these combinations, at least one, preferably two or more, more preferably three or more selected from Oct3 / 4, Sox2, Klf4, c-Myc, Nanog, Lin28 and SV40LT are given as preferred examples of nuclear reprogramming substances.

[0043] Human cDNA sequence information for each of the above nuclear reprogramming substances can be obtained by referring to the NCBI accession numbers described in WO2007 / 069666 or WO2010 / 098419 (Nanog is referred to as "ECAT4" in the publication. Human cDNA sequence information for Lin28, Lin28b, Esrrb, Esrrg and L-Myc can be obtained by referring to the NCBI accession numbers described in Table 1 below), and those skilled in the art can easily isolate these cDNAs.

[0044] [Table 1]

[0045] Furthermore, human cDNA sequence information for GLIS family members, IRX family members, PTX family members, and DMRTB1 can be obtained by referring to the NCBI accession numbers listed in Table 2 below.

[0046] [Table 2]

[0047] Furthermore, natural or artificial mutant proteins that have 90% or more, preferably 95% or more, more preferably 98% or more, and particularly preferably 99% or more identity to each of the above amino acid sequences and have the same nuclear reprogramming ability as the wild-type protein as an alternative factor to Klf4, and nucleic acids encoding the same can also be used as nuclear reprogramming substances that replace Klf4 in the present invention.

[0048] When a protein factor itself is used as the nuclear reprogramming substance, the obtained cDNA is inserted into an appropriate expression vector, which is then introduced into a host cell, and the recombinant protein factor can be prepared by culturing the cell and recovering the recombinant protein factor from the culture. On the other hand, when a nucleic acid encoding a protein factor is used as the nuclear reprogramming substance, the obtained cDNA is inserted into a virus vector, a plasmid vector, an episomal vector, or the like to construct an expression vector, which is then subjected to the nuclear reprogramming step.

[0049] The nuclear reprogramming substance can be introduced into somatic cells using any method used in the technical field to which the present invention pertains, such as Patent Document 1 (WO2015 / 64705).

[0050] Furthermore, iPS cells may be those obtained by selecting lines that do not significantly express factors such as C4ORF51, HHLA1, ABHD12B, and ZNF541 as indicators of differentiation resistance (see WO2013 / 014929).

[0051] Furthermore, the iPS cells may be, for example, cultured together with feeder cells that supply liquid factors necessary for cell survival, proliferation, maintenance of undifferentiated state, etc. and serve as a scaffold for cell adhesion, and the feeder cells are appropriately removed before inducing embryoid body formation. In another embodiment of the present invention, from the viewpoint of promoting the efficiency of producing osteoblast masses (capable of obtaining a greater number of osteoblast masses), culturing iPS cells without using feeder cells is preferable to the above-mentioned method using feeder cells.

[0052] This step can be carried out by non-adherently culturing these undifferentiated iPS cells in the liquid medium used to induce the formation of embryoid bodies using the microspace culture vessel described above.

[0053] As the medium, a medium for primate ES / iPS cell culture can be appropriately used. In the present invention, the medium for ES cell culture may be simply referred to as ES medium. Examples of the medium for primate ES / iPS cell culture include RCHEMD001 manufactured by REPROCELL; NutriStem manufactured by Biological Industries; Essential 6 Medium manufactured by ThemoFisher Scientific; StemFit AK02N medium or StemFlex medium manufactured by Ajinomoto Co., Inc. Such a medium may contain growth factors such as FGF (fibroblast growth factors). These growth factors may be used alone or in combination of two or more. In addition, the medium may optionally contain additives that can be used when culturing cells such as stem cells. Specific examples of such additives include fetal bovine serum, amino acids (e.g., L-glutamine, etc.), ROCK inhibitors (e.g., Y-27632), and antibiotics (e.g., penicillin, streptomycin, amphotericin B, etc.). In the present invention, it is preferable to use a ROCK inhibitor or the like as an additive. In this step, undifferentiated iPS cells are not directly cultured in a mesodermal cell induction medium as in Non-Patent Document 1, but rather, by growing undifferentiated iPS cells into embryoid bodies once, cell death can be suppressed in the next stage of induction into mesodermal cells. Therefore, in the method of the present invention, the embryoid body formation step in step (1) is intended to stop at the formation of embryoid bodies without substantially inducing mesodermal cells. Therefore, a medium not containing an inducer for mesodermal cells is typically used as the medium used in step (1).

[0054] In a typical embodiment of the present invention, this step is carried out by suspending undifferentiated iPS cells in the above-mentioned medium and placing and retaining the suspension in the well of the culture vessel. The number of undifferentiated iPS cells in the suspension when placed in the well of the culture vessel is not limited, but from the viewpoint of promoting the efficiency of producing osteoblast masses, the cell concentration is, for example, 0.5×10 5 ~7.5×10 5cells / ml is preferred, 1.5×10 5 ~3.5×10 5 The preferred cell concentration is typically shown as a value when 2 ml of cell suspension is added per well, as in the experimental examples. The number of undifferentiated iPS cells to be added per well when arranging in the recess of the culture vessel is not limited, but from the viewpoint of promoting the efficiency of producing osteoblast masses, for example, 1×10 5 ~15×10 5 cells are preferred, 3 × 10 5 ~7×10 5 The preferred number of undifferentiated iPS cells is typically shown as a value when a plate with the dimensions of a 24-well microspace shape low-adhesion plate [Elplasia (registered trademark) (Corning, catalog number 4441: microwell size diameter 500 μm, depth 400 μm, number of recesses 554 to 580 cells / well)] used in Experimental Example 3 is used. The number of undifferentiated iPS cells to be placed in each recess of the culture vessel is not limited, but from the viewpoint of promoting the production efficiency of osteoblast mass, for example, 100 to 3000 cells is preferred, and 500 to 1200 cells is more preferred. The culture time in this step is, for example, preferably about 0.5 to 3.5 days, more preferably 0.625 to 2.5 days, and more preferably 0.875 to 1.25 days. The culture time in this step is, for example, preferably about 12 to 84 hours, more preferably about 15 to 60 hours, and more preferably about 21 to 30 hours. By setting the culture time in this step within the above range, it is possible to obtain the final osteoblast mass in a solid shape, not a bag-like shape, which is preferable. The culture temperature in this step is not particularly limited, and is preferably, for example, 30 to 42°C, more preferably 35 to 39°C. The culture in this step is preferably carried out in an atmosphere of 3 to 10% CO2. In the present invention, since the culture in this step (1) uses a microspace culture vessel, this step is typically carried out by static culture in order to maintain the state in which the cells or cell masses are arranged in the wells of the microspace culture vessel.

[0055] (2) Induction of differentiation into mesodermal cells The method of the present invention comprises the step of non-adherently culturing the embryoid bodies of the iPS cells obtained in the above step (1) and inducing differentiation of the iPS cells into mesodermal cells.

[0056] As the medium used in this step, a medium suitable for inducing differentiation of mesodermal cells can be appropriately used. Examples of such a medium include DMEM medium (manufactured by Nacalai Tesque, Inc.), DMEM / F12 medium (manufactured by Thermo Fisher Scientific, Inc.), Neurobasal medium medium (manufactured by Thermo Fisher Scientific, Inc.), RPMI 1640 medium (manufactured by Thermo Fisher Scientific, Inc.), Stemline (registered trademark) II hematopoietic stem cell growth medium (manufactured by Sigma-Aldrich, Inc.), etc. These media may be used alone or in combination of two or more types.

[0057] In order to promote differentiation into mesoderm, it is preferable to add a Wnt signal activator to the medium used in this step. Examples of Wnt signal activators include, but are not limited to, CHIR99021, 6-bromoindirubin-3'-oxime (BIO), Kenpaullone, SB-216763, SKL2001, deoxycholic acid, WAY-316606, NSC-693868, ricinine, 7-oxo-β-sitosterol, IM-12, HLY78, and retinoic acid (e.g., all-trans-retinoic acid (FUJIFILM Wako Pure Chemical Industries, Ltd.)), and CHIR99021 is preferred. These Wnt signal activators may be used alone or in combination of two or more. In a preferred embodiment of the present invention, it is preferable to use retinoic acid in combination with a Wnt signal activator other than retinoic acid. When retinoic acid is added, the amount of retinoic acid to be added is not particularly limited, but the final concentration in the medium used in this step is preferably, for example, 0.01 to 10 μM, and more preferably 0.1 to 5 μM.

[0058] When a Wnt signal activator is added, the amount to be added is not particularly limited, but the final concentration in the medium used in this step is, for example, preferably 1 to 100 μM, more preferably 10 to 50 μM.

[0059] In order to promote differentiation into mesoderm, it is preferable to add a hedgehog signal inhibitor to the medium used in this step. Examples of hedgehog signal inhibitors include, but are not limited to, cyclopamine, AY9944, GANT58, GANT61, jervine, SANT-1, SANT-2, U18666A, veratramine, vismodegib, Cur-61414, robotnikinin, JK184, HPI-4, etc., and cyclopamine is preferred. These hedgehog signal inhibitors may be used alone or in combination of two or more.

[0060] When a hedgehog signal inhibitor is added, the amount added is not particularly limited, but the final concentration in the medium used in this step is, for example, preferably 1 to 100 μM, more preferably 1 to 10 μM.

[0061] In the present invention, it is preferable to use both a Wnt signal activator and a hedgehog signal inhibitor.

[0062] As described above in "Means for solving the problems," the present invention was completed based on the new finding that the shape of the cell mass becomes hollow and bag-like in the method described in Patent Document 1, which involves culturing in ES medium for two days, adding retinoic acid and culturing for another two days, and culturing in osteoblast differentiation-inducing medium, and the method was completed by further improving the method to solve the problem. Therefore, the method of the present invention excludes a culture step using a medium containing only retinoic acid as a component capable of inducing differentiation into mesoderm after the step of inducing embryoid body formation.

[0063] The medium may optionally contain additives that can be used during cell culture, such as fetal bovine serum, amino acids (e.g., L-glutamine, etc.), and antibiotics (e.g., penicillin, streptomycin, amphotericin B, etc.).

[0064] In addition, the medium may contain commercially available cell culture supplements as additives for cell culture. Examples of such supplements include N-2 Supplement (manufactured by Thermo Fisher Scientific), B-27 Supplement (manufactured by Thermo Fisher Scientific), Insulin, Transferrin, Selenium Solution (manufactured by Thermo Fisher Scientific), Wnt3a (manufactured by R&D Systems), Activin A (manufactured by R&D Systems), and BMP4 (manufactured by Peprotech). These supplements may be used alone or in combination of two or more. By carrying out the above-mentioned mesodermal cell differentiation induction step between the above-mentioned (1) embryoid body formation induction step and the below-mentioned (3) osteoblast differentiation induction step, a solid cell mass can be obtained, especially when human iPS cells are used as a raw material.

[0065] The method of the present invention is a method for producing a cell mass of osteoblasts. Therefore, this mesodermal cell differentiation induction step is also performed by non-adherent culture. In the present invention, since the culture in this step (2) uses a microspace culture vessel, this step is typically performed by static culture in order to maintain the state in which the cells or cell masses are arranged in the wells of the microspace culture vessel.

[0066] In a typical embodiment of the present invention, this step is carried out by placing and holding the medium containing the embryoid bodies obtained in step (1) in the recess of the culture vessel. The culture time in this step is, for example, preferably 0.125 to 10 days, more preferably 1 to 8 days, and more preferably 3 to 6 days. The culture time in this step is, for example, preferably about 3 to 240 hours, more preferably about 24 to 192 hours, and more preferably about 72 to 144 hours. The culture temperature in this step is not particularly limited, and is, for example, preferably 30 to 42°C, and more preferably 35 to 39°C. The culture in this step is preferably carried out in an atmosphere of 3 to 10% CO2.

[0067] (3) Induction of osteoblast differentiation The method of the present invention comprises the step of non-adherently culturing the mesodermal cells of the iPS cells obtained in the above step (2) and inducing their differentiation into osteoblasts.

[0068] As the medium used in this step, a medium suitable for inducing differentiation into osteoblasts can be appropriately used. Examples of such a medium include DMEM medium (e.g., sodium pyruvate-free DMEM medium manufactured by Nacalai Tesque, Inc.); αMEM medium (e.g., αMEM medium manufactured by Nacalai Tesque, Inc.), etc. These media may be used alone or in combination of two or more types.

[0069] In this step, the medium may contain a differentiation promoter for osteoblasts. Examples of the differentiation promoter for osteoblasts include ascorbic acid, β-glycerophosphate, dexamethasone, BMP-2, hydrocortisone hemisuccinate, and retinoic acid (e.g., all-trans-retinoic acid). Ascorbic acid may be ascorbic acid-2-phosphate or a salt thereof. Moreover, hydrocortisone hemisuccinate may be used as a differentiation inducer instead of or in addition to dexamethasone. These differentiation promoters for osteoblasts may be used alone or in combination of two or more.

[0070] When ascorbic acid is added, the amount is not particularly limited, but the final concentration in the medium used in this step is preferably, for example, 50 to 300 μM, more preferably 150 to 200 μM. When β-glycerophosphate is added, the amount is not particularly limited, but the final concentration in the medium used in this step is preferably, for example, 1 to 100 mM, more preferably 5 to 15 mM. When dexamethasone is added, the amount is not particularly limited, but the final concentration in the medium used in this step is preferably, for example, 0.001 to 10 μM, more preferably 0.01 to 1.0 μM. When retinoic acid is added, the amount is not particularly limited, but the final concentration in the medium used in this step is preferably, for example, 0.01 to 10 μM, more preferably 0.1 to 5 μM.

[0071] From the viewpoint of calcification of osteoblasts, it is preferable to further add a hypoxia mimetic compound to the medium in this step. Examples of hypoxia mimetic compounds include desferrioxamine (DFX) and cobalt chloride (CoCl2). These hypoxia mimetic compounds may be used alone or in combination of two or more.

[0072] From the viewpoint of calcification of osteoblasts, it is preferable to further add a statin compound to the medium in this step. Examples of the statin compound include atorvastatin, fluvastatin, simvastatin, lovastatin, pitavastatin, pravastatin, and rosuvastatin. These statin compounds may be used alone or in combination of two or more.

[0073] The medium may optionally contain additives that can be used during cell culture, such as fetal bovine serum, amino acids (e.g., L-glutamine, etc.), and antibiotics (e.g., penicillin, streptomycin, amphotericin B, etc.).

[0074] The method of the present invention is a method for producing a cell mass of osteoblasts. Therefore, this mesodermal cell differentiation induction step is also performed by non-adherent culture. Specific embodiments of non-adherent culture include those mentioned above. In this step (induction of differentiation into osteoblasts), shaking culture or the like is preferred from the viewpoint of promoting differentiation by mechanical stimulation.

[0075] In a typical embodiment of the present invention, this step comprises suspending the mesodermal cells of the iPS cells obtained in the above step (2) in the above medium and then culturing the cells in a culture vessel, for example, a 25 cm 2 The culture is carried out by placing the cells in a low-adhesion flask (Greiner bio-one, growth area) and culturing them. In the present invention, the amount of mesodermal cells of iPS cells in the medium at the start of the culture in step (3) is not limited, but from the viewpoint of promoting the production efficiency of osteoblast masses, for example, it is preferable to add mesodermal cells contained in the culture solution for 1 to 10 wells of the culture vessel used in the culture in step (2) per 10 ml of medium, more preferably to add mesodermal cells for 1 to 5 wells of the culture vessel, and more preferably to add mesodermal cells for 2 to 4 wells of the culture vessel. The preferred amount of mesodermal cells of iPS cells is typically shown as a value when a plate with the dimensions of a 24-well microspace low-adhesion plate used in Experimental Example 3 [Elplasia (registered trademark) (Corning, catalog number 4441: microwell size diameter 500 μm, depth 400 μm, number of recesses 554 to 580 per well)] is used. Also, it is preferable to add mesodermal cells contained in the culture solution for 580 to 5800 wells of the culture vessel used in the culture in step (2), more preferably to add mesodermal cells for 580 to 2900 wells, and even more preferably to add mesodermal cells for 1160 to 2320 wells. For the same purpose, 2 to 20 ml, preferably 2 to 10 ml, more preferably 4 to 8 ml of the mesodermal cell suspension obtained in step (2) using the 24-well culture vessel is added to a 25 cm 2It is preferable to carry out step (3) by transferring the cells into a low-adhesion flask and replacing the medium with 10 ml of the osteoblast differentiation-inducing medium. The culture time in this step is, for example, preferably about 1 to 90 days, more preferably about 7 to 60 days, and more preferably about 21 to 50 days. The culture time in this step is, for example, preferably about 24 to 2160 hours, more preferably about 168 to 1440 hours, and more preferably about 504 to 1200 hours. The culture temperature in this step is not particularly limited, and is, for example, preferably 30 to 42°C, and more preferably 35 to 39°C. The culture in this step is preferably carried out in an atmosphere of 3 to 10% CO2.

[0076] According to the present invention, due to the above-mentioned structural features, an osteoblast mass with a high degree of calcification can be obtained. Furthermore, as described above, according to the present invention, an osteoblast mass with a high bone regeneration ability can be obtained. Therefore, for example, by using the osteoblast mass obtained according to the present invention as a raw material, subjecting it to an appropriate inactivation treatment, and then embedding it in a defective part of a bone, new bone can be formed to fill the defective part (void), so that the present invention is very useful. Therefore, the present invention also provides embodiments such as a method for promoting calcification of iPS cell-derived osteoblasts (or cell mass), a method for improving the bone induction ability of iPS cell-derived osteoblasts (or cell mass), and a method for providing a stimulus (spatial environment around the cells) that induces self-organization into bone to iPS cells during culture. The culture vessels, materials, and various conditions in these methods are the same as those described above.

[0077] Osteoblast mass By carrying out the method of the present invention using human iPS cells as a raw material, an osteoblast mass having a diameter of 0.5 to 5 mm can be obtained. An osteoblast mass derived from human iPS cells and having such dimensions has not been reported so far, and is a novel osteoblast mass. In addition, an osteoblast mass having the above-mentioned diameter is very useful because of its high bone regeneration ability. The diameter of the osteoblast mass is preferably in the range of 0.5 to 5 mm, more preferably in the range of 1 to 4 mm, and even more preferably in the range of 1 to 3 mm.

[0078] Method for producing bone regeneration agent The present invention relates to a process for producing an osteoblast cell mass from an iPS cell by the above-mentioned method, and a process for inactivating the osteoblast cell mass. Also provided is a method for producing a bone regenerating agent, comprising:

[0079] The iPS cells used as the raw material in the process of producing an osteoblast mass, and the treatments and the like required in the process of producing an osteoblast mass are as described above.

[0080] The method of the present invention includes a step of inactivating the osteoblast mass obtained by the above-mentioned step.

[0081] The inactivation method is not particularly limited, but examples thereof include freeze-drying, heat treatment, high-pressure treatment, acid or alkali solution treatment, high-pressure steam sterilization, radiation sterilization, gas sterilization, and electromagnetic wave treatment. The conditions for freeze-drying are not particularly limited, and known methods can be used. In addition, for example, pre-freezing may be performed before freeze-drying. The temperature for pre-freezing is not particularly limited, but for example, about -20 to -12°C is preferable. The freeze-drying temperature is not particularly limited, but for example, about -100 to -5°C is preferable. In addition, the freeze-drying pressure is not particularly limited, but for example, 600 Pa or less is preferable, and 50 Pa or less is more preferable. Specific freeze-drying conditions include, for example, a method in which the temperature is fixed at -10°C and the air pressure is gradually lowered to 5 to 20 Pa at the same time as the freeze-drying is started. According to the present invention, a bone regenerating agent having a high calcification degree and high bone regenerating ability can be obtained. In one embodiment, the present invention also provides a bone regenerating agent obtained by the above-mentioned production method.

[0082] The present invention will be described in more detail below with reference to examples and comparative examples, but the present invention is not limited to these. EXAMPLES

[0083] Experiment 1: Search for the optimal microscopic space size to induce iPS cells into osteoblastic clusters "method" 1.1. Cultivation of mouse iPS cells For the experiment, we used an iPS cell line established from mouse gingival fibroblasts [PLoS ONE, 5 (9): e12743, 2010]. These mouse iPS cells were cultured in ES medium [15% fetal bovine serum (Gibco / Life Technologies, Grand Island, NY, USA), 2 mM L-Glutamine (Wako Pure Chemical Industries, Osaka), 1 × 10 -4 M nonessential amino acids (Life Technologies, Grand Island, NY, USA), 1 × 10 -4 iPS cell clumps were maintained and cultured on mitomycin C-treated SNLP76.7-4 feeder cells in Dulbecco's modified Eagle's medium (DMEM: 4.5 g / L glucose, no sodium pyruvate; Nacalai Tesque, Kyoto) containing M 2-mercaptoethanol (Life Technologies, Grand Island, NY, USA), 50 U penicillin, and 50 μg / ml streptomycin (Wako Pure Chemical Industries, Ltd.).

[0084] 1.2. Creation of osteoblastic cell clusters from mouse iPS cells using low-adhesion plates with micro-spaced geometry The mouse iPS cell mass cultured as described above was treated with 0.25% trypsin containing 1 mM EDTA (Wako Pure Chemical Industries, Ltd.) to break down into single cells, and the cell suspension (3.9 × 10 6 The method for producing osteoblastic cell masses from mouse iPS cells in this experiment is shown in Figure 1.

[0085] The incubator used was a low-attachment plate, Elplasia (registered trademark) (Kuraray, Japan), with microspaces of different sizes (FIG. 1) on the bottom of each well of a 6-well plate: Elp400; Cat. #RB 400 560 NA 6: diameter 400 μm, depth 560 μm Elp500; Cat. #RB 500 700 NA 6: diameter 500 μm, depth 700 μm Elp900; Cat. #RB 900 700 NA 6: diameter 900 μm, depth 700 μm 2 ml of the above cell suspension was seeded into each well and cultured for 2 days to induce the formation of embryoid bodies (Figure 2).

[0086] After 2 days of culture, the medium in the wells was replaced with ES medium containing 1 μM all-trans retinoic acid (RA; Wako Pure Chemical Industries, Ltd.), and the cells were cultured for an additional 3 days. The medium was then replaced with osteoblast differentiation induction medium [α-MEM medium (Nacalai Tesque) containing 15% FBS (Gibco / Life Technologies), 0.1 μM dexamethasone (Sigma-Aldrich, St. Louis, MO, USA), 10 mM β-glycerophosphate (Sigma-Aldrich), 50 μg / ml ascorbic acid-2-phosphate (Sigma-Aldrich), 1% antibiotic-antimycotic (100 units / ml penicillin, 100 μg / ml streptomycin, 250 ng / ml amphotericin B (Gibco / Life Technologies)] and cultured for up to 35 days. Half of the medium was replaced every 2 days. The time point when culture was started in osteoblast differentiation induction medium was defined as “day 0 of osteoblast differentiation induction.”

[0087] "result" 1.3.Effect of microspace diameter on osteoblast cluster size The iPS cell suspension was added to wells of each microspace size, and the cell cluster size (Ferret diameter) after 5 days of culture (0 days of osteoblast differentiation induction) was calculated using Image J image analysis software. As a result, the average Ferret diameters in the samples of the Elp400 group, Elp500 group, and Elp900 group cultured in each microspace were approximately 187.6, 242.5, and 328.8 μm, respectively, and the sizes of the Elp500 group and Elp900 group were significantly larger than that of the Elp400 group. During the 35 days after shifting to osteoblast differentiation induction medium, the size of the cell clusters in the Elp400 group and Elp500 group gradually increased. On the other hand, the cell cluster size in the Elp900 group increased until 28 days of induction, but decreased over the 35th day (Figure 3: left).

[0088] When the cell clusters of each group during osteoblast differentiation induction were observed under a phase-contrast microscope, it was observed that the cell clusters of the Elp400 and Elp900 groups gradually lost their smooth contours and began to collapse from day 21 to day 28 of induction. On the other hand, the cell clusters of the Elp500 group remained as cell clusters without collapsing until day 35 of induction (Figure 3: right).

[0089] The viability of cells in the cell masses of each group was examined using a live / dead simultaneous staining kit (LIVE / DEAD® Viability / Cytotoxicity Kit, Molecular Probes / Thermo Fisher Scientific, Eugene, OR, USA). As a result, many red cells indicating dead cells were observed in the Elp400 group and the Elp900 group 14 days after osteoblast differentiation induction. In particular, the center of the cell mass in the Elp900 group was red, and most of the cells inside the cell mass were dead. On the other hand, the cell mass in the Elp500 group was composed of green cells indicating live cells from the start of induction until 14 days after induction, and almost no red dead cells were observed (Figure 4).

[0090] 1.4.Effect of microspace diameter on osteoblast differentiation of cell aggregates Ten days after osteoblast differentiation induction, the expression of osteoblast-specific marker genes (Runx2, Osterix, Collagen 1a1, Bone sialoprotein, Osteopontin, Osteocalcin) in the cell masses of each group was analyzed by SYBR Green real-time RT-PCR (Thunderbird® SYBR® qPCR Mix, TOYOBO). The base sequences of the primers used in the SYBR Green real-time RT-PCR are as follows. 18s rRNA was used as an internal standard. Runx2 forward primer: 5'- CGGGCTACCTGCCATCAC -3'Runx2 reverse primer: 5'- GGCCAGAGGCAGAAGTCAGA -3'Osterix forward primer: 5'- CTCGTCTGACTGCCTGCCTAG -3'Osterix reverse primer: 5'- GCGTGGATGCCTGCCTTGTA -3'Collagen 1a1 forward primer: 5'- TGTCCCAACCCCCAAAGAC -3'Collagen 1a1 reverse primer: 5'- CCCTCGACTCCTACATCTTCTGA -3'Osteocalcin forward primer: 5'- CCGGGAGCAGTGTGAGCTTA -3'Osteocalcin reverse primer: 5'- CCGGGAGCAGTGTGAGCTTA -3'Osteopontin forward primer: 5'- TCTCCTTGCGCCACAGAATG -3'Osteopontin reverse primer: 5'- TCCTTAGACTCACCGCTCTT -3'Bone sialoprotein forward primer: 5'- CGGAGGAGACAACGGAGAAG -3'Bone sialoprotein reverse primer: 5'- GTAAGTGTCGCCACGAGGCT -3'18s rRNA forward primer: 5'- GTAACCCGTTGAACCCCATT -3'18s rRNA reverse primer: 5'- CCATCCAATCGGTAGTAGCG -3' As a result, the expression of all these genes in the Elp500 group was significantly higher than those in the Elp400 and Elp900 groups (FIG. 5).

[0091] In addition, 35 days after induction of osteoblast differentiation, sections were prepared from the cell masses of each group, and stained with HE or with von Kossa and methylene blue for histological observation. As a result of HE staining, most of the cells in the Elp400 and Elp900 groups were dead and had lost their nuclei, and the cell clusters appeared to be crumbling. On the other hand, in the cell clusters of the Elp500 group, the formation of a layered cell structure was observed, and osteoblasts were observed to be forming bone-like tissue in the outer layer. As a result of double staining with von Kossa and methylene blue, although black-stained calcification was observed throughout the cell clusters of the Elp400 and Elp900 groups, they appeared brittle and crumbling without any cellular components, suggesting the possibility that calcification accompanied by cell death had occurred. On the other hand, in the Elp500 group, abundant extracellular matrix accompanied by calcification was observed in the inner layer of the cell structure, and bone-like tissue accompanied by partial calcification was also formed in the outer layer (Figure 6).

[0092] 1.5. Summary of Experiment 1 From the above results, it was revealed that the use of the Elplasia (registered trademark) (Elp500) microscopic low-adhesion plate with a 500 μm diameter depression enables efficient production of three-dimensional osteoblast masses from mouse iPS cells. In addition, it was shown that the use of Elp400 or Elp900 with 400 μm or 900 μm diameter depressions made it difficult to produce osteoblast masses containing living cells from mouse iPS cells.

[0093] Experiment 2: Effect of concave microspaces (Elp500) on osteoblast mass induction from human iPS cells "method" 2.1. Cultivation of human iPS cells For the experiment, we used a human dermal fibroblast-derived iPS cell line (409B2: RIKEN BRC CELL BANK). SNLP76.7-4 cells (provided by Dr. Allan Bradley of the Sanger Institute, UK) were used as feeder cells. SNLP76.7-4 feeder cells were seeded on a 10 cm cell culture plate (coated with 0.1% gelatin) and cultured in DMEM medium (sodium pyruvate-free: Nacalai Tesque) containing 7% fetal bovine serum (FBS: Japan Bioserum, Lot # JBS-011501), 2 mM L-Glutamine (Thermo Fisher Scientific), 50 U penicillin, and 50 μg / ml streptomycin (Thermo Fisher Scientific). The medium was changed every 2 days. Before culturing iPS cells, SNLP76.7-4 feeder cells were treated with 12 μg / ml Mitomycin C (Nacalai Tesque) for 2.5 hours and plated at 1.5 × 10 cells / well on a 10 cm cell culture plate (coated with 0.1% gelatin). 6 iPS cells were seeded on the SNLP76.7-4 feeder cells at a density of 100 cells / dish. They were then cultured in Primates ES Medium (REPROCELL) containing 4 ng / ml human basic FGF (REPROCELL). The medium was changed every other day. The method for producing osteoblast masses from human iPS cells in this experiment is shown in FIG.

[0094] 2.2. Embryoid body formation The iPS cells were washed with phosphate-buffered saline (PBS), and 1 ml of CTK solution (0.25% trypsin, 0.1 mg / ml collagenase IV, 10 mMCaCl2, 20% KSR) was added and treated at 37°C for 1 minute. The CTK solution was then aspirated and 1 ml of PBS was added. The PBS was removed, and only the feeder cells that had detached from the culture plate were aspirated and removed as much as possible. The adherent iPS cells remaining on the culture plate were then collected using 4 ml of ES medium. This cell suspension (number of iPS cells in the suspension: 6.25 × 10 52 ml of the solution (iPS cells / ml) was transferred to one well of a microspace low-attachment plate Elplasia (registered trademark) (Elp500: Kuraray, Cat.# RB 500 700 NA24) with a 500 μm diameter recess (554 to 580 cells per well) on the bottom of each well of a 24-well plate (number of iPS cells placed per well: 12.5 × 10 5 The formation of embryoid bodies was induced by culturing the cells on low-adhesion culture dishes (Nunc Non-Treated Multidishes, Thermo Fisher Scientific) for one day. As a control, a group was set up in which embryoid body culture and mesoderm induction were performed without Elp500 using low-adhesion culture dishes (Nunc Non-Treated Multidishes, Thermo Fisher Scientific).

[0095] 2.3. Induction of differentiation into mesodermal cells One day after the formation of embryoid bodies, the ES medium was replaced with 2 ml of mesoderm differentiation induction medium (a 1:1 mixture of DMEM / F12 (Thermo Fisher Scientific) and Neurobasal medium (Thermo Fisher Scientific) containing 2% B-27 Supplement (Thermo Fisher Scientific), 1% N-2 Supplement (Thermo Fisher Scientific), 30 μM CHIR99021 (Wako Pure Chemical Industries, Ltd.), and 5 μM cyclopamine (Enzo Life science)) and cultured for 5 days. The medium was replaced every 2 days.

[0096] 2.4. Induction of osteoblast differentiation After induction of mesoderm differentiation, cell masses for 8 wells (16 ml of culture medium) were removed from Elplasia (registered trademark) and suspended in 10 ml of osteoblast differentiation induction medium [DMEM medium (sodium pyruvate-free: Nacalai Tesque, Kyoto) containing 15% FBS (Thermo Fisher Scientific), 0.1 μM dexamethasone (Sigma Aldrich), 10 mM β-glycerophosphate (Sigma Aldrich), 50 μg / ml ascorbic acid-2-phosphate (Sigma Aldrich), 100 units / ml penicillin, 100 μg / ml streptomycin, and 250 ng / ml amphotericin B (Thermo Fisher Scientific)] and cultured in low-adhesion flasks (Greiner bio-one, growth area: 25 cm 2 The low-adhesion culture was performed for up to 30 days while shaking on a seesaw-type bioreactor (10° inclination, 0.33Hz cycle, 32cm table width, 5.5cm amplitude) (BC-700: BIO CRAFT) using a 100% alcohol-based shaker. The medium was changed every 7 days.

[0097] 2.5. Evaluation of differentiation induction into osteoblasts Thirty days after induction of osteoblast differentiation, the expression of genes specific to osteoblast differentiation (Osterix, Collagen 1a1, Runx2, and Osteocalcin) was analyzed using SYBR Green real-time RT-PCR (Thunderbird® SYBR® qPCR Mix, TOYOBO). In addition, the expression of undifferentiated marker genes (Nanog), osteoblast precursor cell marker genes (Brachyury, Runx2), and osteoblast marker genes (Osterix, Collagen 1a1, Osteocalcin) up to 60 days after osteoblast differentiation induction was analyzed by SYBR Green real-time RT-PCR (Thunderbird (registered trademark) SYBR (registered trademark) qPCR Mix, TOYOBO). The base sequences of the primers used in the SYBR Green real-time RT-PCR are as follows. GAPDH was used as an internal standard. Runx2 forward primer: 5'-CAGACCAGCAGCACTCCATA-3'Runx2 reverse primer: 5'-CAGCGTCAACACCATCATTC-3'Osterix forward primer: 5'-AAGCTGATCTGGTGGTGCAT-3'Osterix reverse primer: 5'-GACTCCACAAAGGGCATGAT-3'Collagen 1a1 forward primer: 5'-GTGCTAAAGGTGCCAATGGT-3'Collagen 1a1 reverse primer: 5'-CTCCTCGCTTTCCTTCCTCT-3'Osteocalcin forward primer: 5'-CACTCCTCGCCCTATTGGC-3'Osteocalcin reverse primer: 5'-CCCTCCTGCTTGGACACAAAG-3'Nanog forward primer: 5'- AACTGGCCGAAGAATAGCAA-3'Nanog reverse primer: 5'- TGCACCAGGTCTGAGTGTTC-3'Brachury forward primer: 5'-CAGTCAGTACCCCAGCCTGT-3'Brachury reverse primer: 5'-ACTGGCTGTCCACGATGTCT-3'GAPDH forward primer: 5'-GAAGGTGAAGGTCGGAGTCA-3'GAPDH reverse primer: 5'-GAAGATGGTGATGGGATTTC-3' Furthermore, the obtained specimens were stained with HE and double stained with von Kossa and methylene blue for histochemical observation. In addition, the components of the iPS cell clumps were analyzed using Fourier transform infrared spectroscopy (FT-IR). All iPS cell clumps were collected, fixed in 10% neutral buffered formalin, washed with distilled water, and then stepwise dehydrated with ethanol (30%, 70%, 90%, 100%). After replacing with fresh ethanol (100%), the clumps were left to stand in a dryer at 37°C for 12 hours. FT-IR analysis was performed on the dried cell samples using the potassium bromide (KBr) plate method. For the analysis, an FT-IR measurement device: FT / IR-6300ST (JASCO Corporation) was used, with a scan range of 650-4000 cm. -1 , resolution: 2 cm -1 The infrared absorption spectrum pattern was analyzed by integrating 1000 times.

[0098] 2.6. Preparation of iPS cell-derived bone substitute After 120 days from the induction of osteoblast differentiation, the osteoblast mass was washed with PBS and soaked in 10 ml of PBS at 4°C overnight. The next day, the osteoblast mass was removed and transferred to a 6 cm cell culture dish and pre-frozen overnight in a -80°C freezer. The dish was then placed in a freeze-dryer (VD-250R; Taitec) and freeze-dried overnight to inactivate the cells, producing an iPS cell-derived bone filler. The dish containing the bone filler was covered with a lid, sealed with a seal, and stored in a moisture-proof cabinet (glass desiccator).

[0099] 2.7. Implantation into a rat cranial bone defect model Ten-week-old SD rats (Slc:SD; Japan SLC Co., Ltd.) were given general anesthesia, and the scalp was peeled off to form a periosteal flap, and a 5 mm diameter defect was created on the left and right sides of the sagittal suture of the skull. The skull defect was created using an animal surgery engine and a trephine burr (Implatex, Tokyo) under water injection. A freeze-dried iPS cell mass was embedded in the skull defect, covered with periosteum, and the scalp was sutured. The rats were then kept under specific pathogen-free conditions with free access to water and contact.

[0100] "result" 2.8. Efficiency of osteoblast mass production The number of osteoblastic cell masses obtained from 80% confluent iPS cells in a 10 cm cell culture plate on day 30 of osteoblast differentiation induction using the method described in 2.2. to 2.4. above was calculated. As a result, the number was 5.7 ± 0.77 when using a low-adhesion culture dish, whereas the number was 46.2 ± 8.8 when using Elp500, demonstrating that the production efficiency was significantly increased by using Elp500 to produce embryoid bodies (Figure 8).

[0101] 2.9.Evaluation of three-dimensional osteoblast masses created using Elp500 Sections were prepared from human iPS cell clusters that were induced to differentiate into embryoid bodies and mesodermal cells using Elp500, and then induced to differentiate into osteoblasts for 30 days, and were double stained with von Kossa and methylene blue. Histological observations showed partial calcification within the cell cluster 30 days after osteoblast differentiation induction (Figure 9, top). Furthermore, when osteoblast differentiation induction was performed for 60 and 90 days, the calcified areas within the cell cluster increased (Figure 9, middle and bottom). On the other hand, no calcification was observed in human iPS cell clusters that were induced to differentiate into embryoid bodies and mesodermal cells using a low-adhesion culture dish, and then induced to differentiate into osteoblasts for 30 days, but partial calcification was observed 60 days after osteoblast differentiation induction. Therefore, it was revealed that the time required for human iPS cell clusters to become calcified can be shortened by using Elp500. Furthermore, the osteoblast-specific marker genes Runx2, SP7, Collagen 1a1, and osteocalcin were expressed at significantly higher levels in cell masses prepared using Elp500 on the 30th day after osteoblast differentiation induction than in the case of using low-adhesion culture dishes (Figure 10). During the process of inducing differentiation of human iPS cells into embryoid bodies, mesoderm, and osteoblasts (Figure 7), the expression of the undifferentiated marker gene (Nanog), marker genes indicating mesoderm (mesenchymal stem cells) to osteoblast precursor cells (Brachyury, Runx2, Osterix), and osteoblast-specific genes (Collagen 1a1, Osteocalcin) was analyzed by real-time RT-PCR (Figure 11). As a result, the expression of Nanog, which was highly expressed in iPS cells before embryoid body culture, was significantly reduced by mesoderm induction and almost disappeared by the 5th day of induction. The expression of Brachyury, Runx2, and Osterix genes peaked after mesoderm induction and at the early stage of osteoblast differentiation induction, and then the expression of Osterix, Collagen 1a1, and Osteocalcin genes increased over time until 60 days after differentiation induction. After inducing embryoid bodies and mesodermal cells using Elp500, human iPS cell clumps that underwent osteoblast differentiation induction for 0 to 60 days were dried and then subjected to component analysis using FTIR analysis. As a result, human iPS cell clump samples that underwent osteoblast differentiation induction for 30 days or more showed FTIR spectrum peaks that were close to those of original bone tissue (human freeze-dried bone) (Figure 12). After inducing human iPS cell clusters to embryoid bodies and mesodermal cells using Elp500, osteoblast differentiation was induced for 3 to 30 days. The results showed that the cell clusters 30 days after osteoblast differentiation induction had various sizes of cell clusters with ferret diameters ranging from 0.66 mm to 2.68 mm (Fig. 13A). These cell clusters 30 days after osteoblast differentiation induction were divided into sizes of 0.5 to less than 1 mm, 1 to less than 2 mm, and 2 to 3 mm according to the ferret diameter, and the extent of calcification was evaluated using von Kossa staining after sectioning. The cell clusters of 2 to 3 mm showed the most significant calcification (Fig. 13B), suggesting that the larger the cell cluster, the more mature the osteoblast cluster formed.

[0102] 2.10.Evaluation of bone regeneration ability of osteoblastic cell masses created using Elp500 A cell mass prepared using Elp500 on the 120th day after induction of osteoblast differentiation was freeze-dried by the method described in 2.6. (FIG. 14). This freeze-dried osteoblast mass or human freeze-dried bone (FDBA) for comparison was implanted into a 5 mm diameter bone defect created in a rat skull. Four weeks after implantation of the iPS cell-derived freeze-dried osteoblast mass, histological images of tissue sections stained with HE staining showed that the bone defect had been filled by new bone formation, and bone remodeling with cement lines was observed around the implanted osteoblast mass. Micro-CT analysis also showed that the bone defect was completely filled by new bone that was continuous with the surrounding existing bone (Figure 15A). On the other hand, in the HE staining image 4 weeks after implantation of FDBA, FDBA was surrounded by immature fibrous tissue, and no mature new bone formation was observed. However, almost no new bone formation was observed at the defect site, and the defect remained almost unchanged (FIG. 15B).

[0103] 2.11. Summary From the above, it was revealed that when preparing three-dimensional osteoblastic masses from human iPS cells, in the process of inducing embryoid bodies and mesodermal cells, the use of concave microspaces, especially Elp500 with a specific concave size, not only increases the production efficiency in terms of time and quantity compared to the use of a normal low-adhesion culture dish, but also induces more mature osteoblastic masses. In addition, among the cell masses prepared in this process, the cell masses with a ferret diameter of 2 to 3 mm on the 30th day after osteoblast differentiation induction showed particularly advanced calcification, suggesting that they were more mature osteoblastic masses. Furthermore, the freeze-dried human iPS cell-derived osteoblastic mass showed superior bone regeneration ability compared to the existing bone substitute material (FDBA), indicating that it can be used as a bone substitute material to promote the regeneration of bone defects.

[0104] Experiment 3: Effect of iPS cell culture in a feeder cell-free environment on osteoblast cluster formation "method" 3.1. Human iPS cells For the experiments, a human dermal fibroblast-derived iPS cell line (409B2: RIKEN BRC CELL BANK) was used.

[0105] 3.2. Culture of human iPS cells on feeder cells (feeder group) SNLP76.7-4 feeder cells were used as feeder cells in the same manner as in Experiment 2. After Mitomycin C treatment, human iPS cells were seeded on the feeder cells and cultured in Primates ES Medium (REPROCELL) containing 4 ng / ml human basic FGF (REPROCELL). Medium was changed every day.

[0106] 3.3. Human iPS cell culture in a feeder cell-free environment Human iPS cell colonies that had been maintained and cultured on feeder cells were harvested in a culture medium containing StemFit® AK02N medium (ES medium: Ajinomoto Co., Inc.) supplemented with 10 μM Y-27632 (Wako Pure Chemical Industries, Ltd.), and then plated on a 10 cm cell culture plate coated with laminin; iMatrix-511 silk (nippi) at 8.0 × 10 4 The cells were seeded at a density of 100 cells / dish. The next day, the medium was changed to ES medium and maintained / cultured to obtain feeder cell-free culture. The medium was changed once every two days.

[0107] 3.4. Creation of osteoblastic clusters from human iPS cells using low-adhesion plates with micro-spaced geometry The method for producing osteoblast masses from human iPS cells in this experiment is shown in FIG.

[0108] 3.4.1.Induction of embryoid body formation The incubator used was a 24-well low-attachment plate with a fine spatial shape, Elplasia (registered trademark) (Corning, Cat # 4441: fine well size: diameter 500 μm, depth 400 μm, number of recesses: 554 to 580 per well). The human iPS cells cultured on the feeder cells were prepared as a cell suspension in ES medium (REPROCELL) according to the method of Experiment 2 (number of iPS cells in the suspension: 6.25 × 10 5 cells / ml), and the number of cells seeded per well of the Elplasia® plate was 12.5 × 10 5 2 ml of cells was added per well (feeder-used group: condition 0). Human iPS cell colonies cultured in a feeder cell-free environment were treated with TrypleSelect (Thermo Fisher Scientific) to produce single cells, and cell suspensions were prepared in ES medium (StemFit medium) under the following three conditions.

[0109] Condition 1 6.25×10 5 cells / ml Condition 2 3.125×10 5 cells / ml Condition 3 1.563×10 5 cells / ml The cell suspension cultured on feeder cells (condition 0) and the cell suspensions prepared in a feeder cell-free environment under conditions 1 to 3 were added in an amount of 2 ml to each well of the culture plate, and the number of cells per well was set as follows:

[0110] Condition 0 12.5×10 5 cells / well Condition 1 12.5×10 5 cells / well Condition 2 6.25×10 5 cells / well Condition 3 3.125×10 5 cells / well Condition 0 was cultured in ES medium (REPROCELL), and conditions 1 to 3 were cultured in ES medium (StemFit medium) for one day to induce the formation of embryoid bodies.

[0111] 3.4.2. Induction of differentiation into mesodermal cells After one day of embryoid body culture, the medium was replaced with mesoderm differentiation induction medium (a 1:1 mixture of DMEM / F12 (Thermo Fisher Scientific) and Neurobasal medium (Thermo Fisher Scientific) containing 2% B-27 Supplement (Thermo Fisher Scientific), 1% N-2 Supplement (Thermo Fisher Scientific), 30 μM CHIR99021 (Wako Pure Chemical Industries, Ltd.), and 5 μM cyclopamine (Enzo Life science)) for each condition, as in Experiment 2, and cultured for 5 days. Half of the medium was replaced every 2 days.

[0112] 3.4.3. Induction of differentiation into osteoblasts After induction of mesodermal differentiation for 5 days, cell clusters contained in the number of wells indicated in the following conditions A to D were removed from the Elplasia (registered trademark) plates under each condition and transferred to low-adhesion flasks (Greiner bio-one, growth area: 25 cm 2 ) was moved.

[0113] Condition A 8 wells / 1 flask (16 ml culture medium) Condition B 4 wells / 1 flask (8 ml of culture medium) Condition C 2 wells / 1 flask (4 ml of culture medium) Condition D 1 well / 1 flask (2 ml of culture medium) For the group cultured on feeder cells (condition 0), cells from 8 wells of an Elplasia® plate were transferred to one flask (condition 0+condition A). The medium in each flask was replaced with 10 ml of osteoblast differentiation medium [α-MEM medium (Nacalai Tesque) containing 15% FBS (Gibco / Life Technologies), 0.1 μM dexamethasone (Sigma-Aldrich, St. Louis, MO, USA), 10 mM β-glycerophosphate (Sigma-Aldrich), 50 μg / ml ascorbic acid-2-phosphate (Sigma-Aldrich), and 1% antibiotic-antimycotic (100 units / ml penicillin, 100 μg / ml streptomycin, and 250 ng / ml amphotericin B)], and the cells were cultured for 30 days while shaking on a seesaw-type bioreactor (10° inclination, 0.33 Hz cycle, table width 32 cm, amplitude 5.5 cm) (BC-700: BIO CRAFT). Half of the medium was replaced every three days. The time point when the culture was started in the osteoblast differentiation-inducing medium was designated as "day 0 of osteoblast differentiation induction."

[0114] 3.5. Evaluation of differentiation induction into osteoblasts Thirty days after induction of osteoblast differentiation, the number of cell masses in each condition group was counted, and the size (ferret diameter) was calculated using ImageJ image analysis software (registered trademark NIH). In addition, the expression of osteoblast-specific marker genes (Runx2 and Osteocalcin) in the cell masses of each group 30 days after osteoblast differentiation induction was analyzed by SYBR Green real-time RT-PCR (Thunderbird® SYBR® qPCR Mix, TOYOBO). GAPDH was used as an internal standard. The primers used were the same as those in Experiment 2. Thirty days after induction of osteoblast differentiation, sections were prepared from the cell masses of each group, and stained with HE or with von Kossa and methylene blue for histochemical observation.

[0115] 3.6. Effect of adding retinoic acid to induction medium on osteoblast cluster formation In the experimental system using human iPS cells in the above feeder cell-free environment, 10 μM Y-27632 was added to the ES medium (StemFit medium) used for inducing the formation of embryoid bodies in the above 3.4.1. In addition, 1 μM retinoic acid (Wako Pure Chemical Industries) was added to the mesoderm differentiation induction medium in the above 3.4.2 and the osteoblast differentiation induction medium in the above 3.4.3, and osteoblast mass formation was induced under condition 2 and condition B. The mineralization and maturity of the cell mass 30 days after the induction of differentiation into osteoblasts were evaluated by HE staining and double staining with von Kossa and methylene blue. "result" 3.7. Effect of feeder cell-free culture of iPS cells and number of seeded cells on the number of osteoblast clusters formed Thirty days after osteoblast differentiation induction, the number of cell clusters formed per flask in the feeder culture group (condition 0 + condition A) was 56, whereas in the feeder cell-free culture, the number of seeded cells was 12.5 × 10 5 100 cells / well (condition 1) in the 8 wells / flask group (condition 1 + condition A) and 93 cells / well (condition 1 + condition B) in the 4 wells / flask group. 6.25 × 10 cells seeded. 5 Cells / well (condition 2) were 139 in the 8-well / 1 flask group (condition 2 + condition A) and 103 in the 4-well / 1 flask group (condition 2 + condition B), with seeding cell numbers of 3.125 × 10 5 The number of cells / well (condition 3) in the 8 wells / flask group was 103 (condition 3 + condition A), in the 4 wells / flask group was 112 (condition 3 + condition B), and in the 2 wells / flask group (condition 3 + condition C) was 126. In other words, in the feeder cell-free culture groups under these conditions, the number of osteoblast masses formed was significantly increased, even though the number of cells used in the embryoid body formation step and osteoblast differentiation induction step was the same or less than in the feeder culture group (condition 0 + condition A) (Figure 25).

[0116] 3.8. Effect of feeder cell-free culture of iPS cells and number of seeded cells on the size of osteoblast clusters Thirty days after osteoblast differentiation induction, the ferret diameter of the cell mass in the feeder culture group tended to be larger than that in the feeder cell-free culture group. On the other hand, the seeding cell number of the feeder cell-free culture group was 6.25 × 105 Cells / well group (condition 2) and seeded cell number 3.125 x 10 5 The cells / well group (condition 3) was more uniform with less variation in size (Figure 26).

[0117] 3.9. Effect of feeder cell-free culture of iPS cells and number of seeded cells on osteoblast differentiation of cell aggregates Thirty days after induction of osteoblast differentiation, the expression of osteoblast-specific marker genes (Runx2 and Osteocalcin) in the cell masses of the feeder cell-free culture group tended to be higher than that of the cell masses of the feeder culture group (condition 0 + condition A). In particular, in the embryoid body formation process, the seeding cell number of iPS cells cultured in a feeder cell-free environment was 6.25 × 10 5 cells / well (condition 2) and 3.125 x 10 5 In the cells / well (condition 3) group, a significant increase in the expression of these genes was observed under all of conditions A to D in the osteoblast differentiation induction step (FIG. 27).

[0118] 3.10.Effect of feeder cell-free culture of iPS cells and number of seeded cells on mineralization of osteoblast clusters Thirty days after osteoblast differentiation induction, the number of seeded cells in the feeder cell-free culture was 6.25 × 10 compared to the cell mass in the feeder culture group (condition 0 + condition A). 5 Cells / well (condition 2) 8 wells / 1 flask group (condition 2 + condition A) and 4 wells / 1 flask group (condition 2 + condition B), seeding cell number 3.125 × 10 5 The cell masses in the 8 wells / 1 flask group (condition 3 + condition A), 4 wells / 1 flask group (condition 3 + condition B), and 2 wells / 1 flask group (condition 3 + condition C) with cells / well (condition 3) had significantly larger internal calcification areas and appeared more mature as osteoblast masses (Figure 28).

[0119] 3.11. Effect of adding retinoic acid to induction medium on osteoblast cluster formation from iPS cells In the production of osteoblastic cell clusters using iPS cells in a feeder cell-free environment, the addition of 10 μM Y-27632 to the ES medium for embryoid body culture and 1 μM retinoic acid to the mesoderm differentiation-inducing medium and osteoblast differentiation-inducing medium resulted in significant mineralization in the inner and outer layers of the cell cluster 30 days after osteoblast induction, and a more mature and uniform bone-like tissue was obtained than when these were not added (Figure 29).

[0120] Summary By using feeder cell-free culture rather than feeder culture during the proliferation stage of human iPS cells, osteoblastic cell masses could be efficiently produced from a small number of cells. In particular, in the embryoid body formation process, human iPS cells were cultured in a feeder cell-free environment at 6.25 × 10 per well. 5 In the embryoid body formation process, 3.125 × 10 human iPS cells were cultured in a feeder cell-free environment per well. 5 When the cells were seeded and the culture medium containing mesodermal cells from 8, 4, or 2 wells was transferred to a single flask for the osteoblast differentiation induction step, not only were a larger number of osteoblast clusters obtained, but also more mature osteoblast clusters were obtained.

Claims

1. (1) inducing the formation of embryoid bodies by non-adherent culture of undifferentiated iPS cells; (2) a step of non-adherently culturing the embryoid bodies of the iPS cells obtained in the above step (1) to induce differentiation of the iPS cells into mesodermal cells; and (3) A step of inducing differentiation of mesodermal cells from the iPS cells obtained in the above step (2) into osteoblasts by non-adherent culture. A method for producing an osteoblast mass from an iPS cell, comprising: The method, wherein steps (1) and (2) are carried out using a culture vessel having a bottom surface and an annular side wall extending upright from the bottom surface, the bottom surface having a plurality of recesses provided independently of one another.

2. The method according to claim 1, wherein at least one of the plurality of recesses has a circle equivalent diameter of 200 to 900 μm and a depth of 200 to 1000 μm.

3. The method of claim 1 , wherein the openings of the plurality of recesses are generally circular in shape.

4. The method of claim 1 , wherein the iPS cells are human iPS cells or mouse iPS cells.

5. The method according to claim 4, wherein the culture time in the step (1) is 0.625 to 3.5 days.

6. The method according to claim 1, wherein the culture in step (2) is carried out in the presence of at least one member selected from the group consisting of a Wnt signal activator and a Hedgehog signal inhibitor.

7. The method according to claim 6, wherein the Wnt signal activator is at least one selected from the group consisting of CHIR99021, 6-bromoindirubin-3'-oxime, Kenpaullone, SB-216763, SKL2001, deoxycholic acid, WAY-316606, NSC-693868, lysinine, 7-oxo-β-sitosterol, IM-12, HLY78, and retinoic acid.

8. The method according to claim 6, wherein the hedgehog signal inhibitor is at least one selected from the group consisting of cyclopamine, AY9944, GANT58, GANT61, jervine, SANT-1, SANT-2, U18666A, veratramine, vismodegib, Cur-61414, lobotonikine, JK184 and HPI-4.

9. The method according to claim 1, wherein the culturing in step (3) is carried out in the presence of at least one compound selected from the group consisting of a hypoxia-mimetic compound and a statin compound.

10. The method according to claim 1 , further comprising, prior to step (1), culturing undifferentiated iPS cells without the use of feeder cells.

11. The step (1) is carried out at a cell concentration of 1.5×10 5 ~3.5×10 5 The method according to claim 10, which is carried out by placing a suspension of undifferentiated iPS cells at 100 cells / ml in a culture vessel and culturing the same.

12. The method according to claim 11, wherein the step (2) is carried out using a culture vessel having at least one well, and the step (3) is carried out by placing 1 to 10 wells of the culture solution containing the mesodermal cells obtained in the step (2) in the culture vessel and culturing the cells.

13. The method according to claim 1, wherein the culture in step (1) is carried out in the presence of a ROCK inhibitor, and the culture in steps (2) and (3) is carried out in the presence of retinoic acid.

14. 2. An osteoblast cell mass obtained by the method according to claim 1, which is an osteoblast cell mass derived from human iPS cells and has a ferret diameter of 1 to 4 mm.

Images