Method for cell manipulation, composition for cell manipulation, and cell proliferation inhibitor

Abstract

To provide a method for cell manipulation as a novel chemotherapy capable of artificially promoting cellular senescence and calcification in malignant meningioma to stop its growth by controlling common signaling and metabolic pathways involved in tumor growth regulation, independent of whether the tumor is benign or malignant, as well as a composition for cell manipulation and a cell proliferation inhibitor.SOLUTION: The present invention provides a method for cell manipulation, a composition for cell manipulation, and a cell proliferation inhibitor that suppress BMP within a cell or enhance GREM2 activity to promote the calcification process in the cell.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for promoting cellular calcification of tumor cells, mainly in meningiomas, and inhibiting cell proliferation for therapeutic application, and to a cytostatic drug. [Background technology]

[0002] Meningiomas are the most common brain tumors, accounting for approximately one-third of central nervous system tumors. Meningiomas arise from arachnoid cells that are firmly attached to the dura mater, and in 25% to 50% of cases, they affect the surrounding bones, causing bone changes such as hyperostosis and ballooning. However, most meningiomas are benign brain tumors, and it has been found that meningiomas with calcification in the tumor do not expand and grow slowly. On the other hand, meningiomas without calcification are malignant and difficult to treat. Malignant atypical meningiomas (AM) and anaplastic meningiomas (AnM) frequently recur, with a 5-year survival rate of 67.5% for AM and 55.6% for AnM. These meningiomas may involve the base of the skull or surrounding blood vessels, or may infiltrate into the brain, making total tumor removal impossible. In addition, incomplete resection or radiation therapy significantly reduces the 5-year progression-free survival rate. Therefore, these treatments have limitations, and in particular in cases of repeated recurrence, tumors may become malignant, requiring adjuvant therapy such as chemical therapy other than surgical treatment.

[0003] As a chemical treatment technique for meningioma, for example, Patent Document 1 discloses a pharmaceutical composition for treating meningioma, which contains as an active ingredient a substance that exerts cytotoxicity against WT1-expressing cells or a substance that has activity to induce cytotoxicity against WT1-expressing cells. The substance that exerts cytotoxicity against WT1-expressing cells is, for example, a substance selected from the group consisting of "cells having WT1-expressing cell-specific cytotoxic activity" and "antibodies that specifically recognize WT1-expressing cells". The substance that has activity to induce cytotoxicity against WT1-expressing cells is, for example, a substance selected from the group consisting of "WT1", "WT1-derived peptide", "cells presenting WT1-derived peptide", "receptor that specifically recognizes WT1-expressing cells", and "nucleic acid encoding a receptor that specifically recognizes WT1-expressing cells". This technology targets the WT1 gene, which is highly expressed in various cancers, and induces cytotoxicity in WT1-expressing cells, with the aim of using it as a therapeutic drug for these cancers. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2013-116891 A Summary of the Invention [Problem to be solved by the invention]

[0005] As mentioned above, surgical treatment is difficult for malignant meningiomas that do not show calcification within the tumor. Conventional treatments were limited to surgery and radiation therapy, but in cases where removal was difficult or radiation was ineffective, there was no other treatment option available. Therefore, there is a strong demand for chemical treatments, but although new classification methods for meningiomas have been developed through analysis of gene mutations and methylation, the metabolic changes caused by these genetic changes have not been identified, and therefore the metabolic pathways and metabolic products that can be targeted by chemotherapy have not been identified.No chemotherapy has been found that can accurately control the growth of meningioma tumor tissue.

[0006] The technology of Patent Document 1 is capable of exerting damage on cancer cells expressing WT1, but there is a strong demand for a technology that is particularly effective against meningiomas and can precisely control the growth of meningioma tumor cells.

[0007] The present inventors have focused on the fact that calcification occurs in benign meningiomas, suppressing their growth. If the mechanisms related to meningioma growth and calcification can be controlled, it may be possible to prevent benign meningiomas from transforming into malignant forms, and to inhibit the growth of malignant meningiomas or transform them into a state similar to benign meningiomas. Therefore, the present inventors have further researched the mechanisms that can control the growth of meningiomas, regardless of whether they are benign or malignant. They have explored the signaling and metabolic pathways of malignant and benign meningiomas, and have conducted research into the metabolic pathways involved in cell growth.

[0008] The present invention has been made in consideration of the above-mentioned circumstances, and aims to provide a method for manipulating cells, a composition for cell manipulation, and a cell proliferation inhibitor as a new chemotherapy that can artificially induce cellular senescence and calcification in malignant meningiomas and stop their proliferation by controlling common signal pathways and metabolic pathways that can control the proliferation of tumors regardless of whether they are benign or malignant. [Means for solving the problem]

[0009] In order to solve the above problems, the present invention has the following aspects. The first aspect of the present invention is A method of manipulating cells by inhibiting BMP or increasing the activity of GREM2 in the cells to promote calcification of the cells.

[0010] A second aspect of the present invention is The method of manipulating the cells of the first aspect comprises administering to said cells an inhibitor of the BMP signaling pathway.

[0011] A third aspect of the present invention is A method of engineering a cell of the first or second aspect, comprising causing said cell to express serotonin or a serotonin receptor and reduce NADH / NAD+.

[0012] A fourth aspect of the present invention is This is a method of engineering the cells of the first aspect, which comprises introducing a gene that causes expression of GREM2 into the cells.

[0013] A fifth aspect of the present invention is A composition for cell manipulation that contains a BMP inhibitor or a component that increases the expression of GREM2 and promotes cell mineralization.

[0014] A sixth aspect of the present invention is a method for producing a composition comprising the steps of: The composition for cell manipulation according to the fifth aspect is a cytostatic drug.

[0015] A seventh aspect of the present invention is a method for producing a composition comprising the steps of: The sixth aspect of the cytostatic agent is for the treatment of meningioma. Effect of the Invention

[0016] According to the present invention, by controlling common signal pathways and metabolic pathways that can control the proliferation of tumors regardless of whether they are benign or malignant, a method for manipulating cells, a composition for cell manipulation, and a cell proliferation inhibitor can be obtained as a new chemotherapy that can artificially induce cellular senescence and calcification in malignant meningiomas and stop their proliferation. [Brief description of the drawings]

[0017] [Figure 1] FIG. 1 is a photograph showing the results of immunostaining of primary cultured meningioma cells in this example. [Diagram 2]FIG. 1 is a graph showing the results of a WST-8 assay with the addition of K02288 to benign tumor cultured cells in this example. [Diagram 3] FIG. 1 is a graph showing the results of a WST-8 assay with the addition of K02288 to cultured malignant tumor cells in this example. [Figure 4] FIG. 1 is a photograph showing the results of Alizarin Red S staining of meningioma cells in this example. [Diagram 5] FIG. 1 is a photographic diagram showing the expression of GREM2 using clinical samples from this example. [Figure 6] FIG. 1 is a graph showing the correlation between the expression level of GREM2 and the proliferation rate in this embodiment. [Figure 7] FIG. 1 is a graph showing the results of cell proliferation in IOMM-lee and HKB-MM cells in which GREM2 was forcibly expressed in this embodiment. [Figure 8] FIG. 1 shows a histogram of cell cycle distribution in this example. [Figure 9] FIG. 9 shows the proportion of each cell cycle analyzed from the histograms in FIG. [Figure 10] FIG. 1 shows an overview of the results of expression analysis in this example. [Figure 11] FIG. 1 shows the results of measuring NADH / NAD+, ATP and serotonin, which are end products of tryptophan metabolism using the BMP inhibitor of this example. [Figure 12] FIG. 1 shows an outline of the results of another expression analysis in this example. [Figure 13] FIG. 1 is a photograph showing the results of Ki-67 / DAPI immunostaining in this example. [Figure 14] FIG. 1 is a photograph showing the results of SPiDER-bGal staining in this example. [Figure 15] FIG. 1 is a schematic diagram in which the results of this example are plotted on a scheme of tryptophan metabolism. [Figure 16] FIG. 13 is a photograph of IOMM-Lee administered Lindostat in this example. [Figure 17] FIG. 1 is a photograph showing administration of LDN193189 to MZ1150M of this example. [Figure 18] FIG. 1 is a photograph showing administration of LDN193189 to MZ1149M of this example. [Figure 19] FIG. 1 is a photograph showing administration of LDN193189 to MZ1146M of this example. [Figure 20] FIG. 1 is a photograph showing administration of LDN193189 to MZ1142M of this example. [Figure 21] FIG. 1 is a photograph showing administration of LDN193189 to MZ1123M of this example. [Figure 22] This is a photograph of IOMM-lee administered with LDN193189 in this example. [Diagram 23] FIG. 1 is a photograph showing administration of LDN193189 to HKB-MM in this example. [Figure 24] FIG. 1 is a photograph showing administration of LDN193189 to MZ857M in this example. [Diagram 25] FIG. 1 is a graph showing the sensitivity of LDN-193189 and K02288 of this example to ALK3. [Figure 26] FIG. 1 is a graph showing the number of calcifications caused by LDN-193189 in this example. [Figure 27] FIG. 13 is a graph showing the number of cells in which calcification occurred due to LDN-193189 in MZ991AO of the present example. [Figure 28] FIG. 1 is a photograph showing administration of LDN193189 to MZ991AO in this example. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] The method for manipulating cells, the composition for manipulating cells, and the cell proliferation inhibitor according to the present invention will be described below with reference to embodiments, although the present invention is not limited to the following embodiments.

[0019] [Methods for manipulating cells] The method of manipulating cells of this embodiment inhibits BMP or increases GREM2 activity in the cells to promote calcification of the cells.

[0020] The cells of this embodiment may be cells of any organism, but are animal cells, particularly human cells, in this embodiment. Furthermore, the cells may be either cells within an organism or cultured cells.

[0021] Manipulating cells specifically includes controlling, especially inhibiting, cell proliferation, and includes direct or indirect manipulation. The cells referred to here are mainly tumor cells, regardless of whether they are benign or malignant. Furthermore, the tumor refers to tumors, particularly those that occur mainly in cancer-related diseases, but is particularly a tumor having cells that undergo calcification due to cellular aging and proliferation inhibition, particularly meningiomas.

[0022] (BMP Inhibition) "Inhibiting intracellular BMP" broadly refers to the action of inhibiting the function of BMP (Bone Morphogenetic Protein) protein. For example, this includes the action of binding to BMP and inhibiting its function. In addition, this also includes the action of inhibiting the expression of the BMP protein itself, or inhibiting the function of BMP by decomposing it, etc. It has been reported that BMP signals play a role in bone metabolism and may lead to the development of meningiomas, changes in adjacent bones, and tumor growth. BMP4, a member of the BMP family, is upregulated in colorectal cancer, and knockdown of BMP4 reduces the tumor growth ability of colorectal cancer cells, which is thought to be related to cell proliferation.

[0023] The method for manipulating cells in this embodiment may be performed by administering an inhibitor of the BMP signaling pathway to the cells. Examples of inhibitors of the BMP signaling pathway include various BMP inhibitors. For example, antibodies against BMP and other substances that directly bind to BMP are included. Substances that directly bind to BMP also include GREM2, which will be described later. In this embodiment, for example, examples of BMP inhibitors include K02288 (CAS: 1431985-92-0) and the like. In addition, compounds that induce calcification at lower concentrations include LDN-193189 (CAS: 1062368-24-4). LDN-193189 is conventionally known as an ALK2 and ALK3 inhibitor. LDN-193189 can induce calcification in a concentration-dependent manner and in a target malignancy-dependent manner. In addition, administration of Lindostat, an IDO1 inhibitor, also induces some calcification.

[0024] The method of manipulating cells of this embodiment may involve expressing serotonin or a serotonin receptor in the cells and decreasing NADH / NAD+, thereby mimicking the inhibition of the BMP signaling pathway. The present inventors have found that the decrease in intracellular BMP signaling is accompanied by a decrease in NADH and NAD+ and an increase in serotonin, which occurs due to increased expression of serotonin receptors or increased expression of enzymes involved in serotonin production in the tryptophan metabolic pathway.

[0025] (Increased activity of GREM2) Increasing the activity of GREM2 in cells broadly refers to the action of increasing or amplifying the activity of the GREM2 protein. For example, it includes the action of overexpressing GREM2 in cells to increase it. Other actions include administering GREM2 and inhibiting the degradation of GREM2 in cells. It also includes other actions that amplify the biological activity of GREM2. GREM2 (Gremlin2) has been reported to be one of the factors involved in the malignant transformation of meningiomas by bioinformatics analysis. It is a protein located on chr.1q43 and known to belong to the CAN (cerberus and dan) subfamily, characterized by an eight-membered C-terminal cystine knot. Detailed studies, including crystal analysis, have shown that the antagonistic effect of the secreted glycoprotein encoded by the GREM2 gene is to form a complex with Growth / differentiation factor 5 (GDF5) and inhibit BMP signaling by binding to the receptor BMPR1A. In other words, the action of increasing intracellular GREM2 by overexpression or administration also acts as an inhibitor of the BMP receptor.

[0026] The activity of GREM2 in a cell may be increased by introducing a gene that expresses GREM2 into the cell. The introduction of the gene that expresses GREM2 may be performed by genome editing or by introducing an external gene such as a plasmid.

[0027] The method of manipulating cells of this embodiment promotes cellular calcification by inhibiting the above-mentioned BMP or increasing the activity of GREM2. The inhibition of BMP or the increase in the activity of GREM2 promotes cell calcification. In addition, the inhibition of cell proliferation, so-called cell senescence, also occurs. This phenomenon prevents malignant tumor cells from degenerating into benign tumors, or prevents benign tumor cells from degenerating into malignant tumors, so that cell senescence and cell proliferation inhibition can be controlled.

[0028] [Composition for cell manipulation] The composition for cell manipulation of this embodiment contains a BMP inhibitor or a component that increases the expression of GREM2, and promotes cell calcification. The BMP inhibitor and the component that increases the expression of GREM2 may be those described above according to the method for manipulating cells. The cell manipulation composition can be used in the method of manipulating cells as described above.

[0029] [Cytostatic drugs] The cell proliferation inhibitor of this embodiment includes the aforementioned composition for cell manipulation. The cytostatic drug may contain other components suitable for inhibiting cell proliferation in addition to the above-mentioned composition for cell manipulation. For example, it may contain components appropriate for the type of cells to be administered and the form of administration.

[0030] The cytostatic drug of this embodiment can be used to treat diseases associated with cell proliferation, such as tumor-related diseases, particularly cancer. The disease cancer is preferably a cancer accompanied by cellular calcification. Here, the term "treatment" broadly includes medical treatment of diseases, such as amelioration of symptoms, prevention, and treatment of prognosis of diseases. When the cell proliferation inhibitor of this embodiment is used for treatment, it may contain other ingredients suitable for the treatment.

[0031] The cytostatic drug of this embodiment may be for treating meningioma. The cytostatic drug for treating meningioma may contain other ingredients suitable for the treatment.

[0032] (Effects of this embodiment) According to the present embodiment, by controlling common signal pathways and metabolic pathways that can control the proliferation of tumors regardless of whether they are benign or malignant, a method for manipulating cells, a composition for manipulating cells, and a cell proliferation inhibitor can be obtained as a new chemotherapy that can artificially induce cellular senescence and calcification in malignant meningiomas and stop their proliferation.

[0033] Conventional treatments for meningiomas consisted only of surgery and radiation therapy, but in cases where removal was difficult or radiation therapy was ineffective, there was no other treatment option available. In addition, although new classification methods for meningiomas have been developed through analysis of gene mutations and methylation, the metabolic changes caused by these genetic alterations have not been identified, and therefore metabolic pathways and metabolic products that can be targeted by chemotherapy have not been identified. For example, although some genes and proteins that may be related to cell proliferation in meningiomas were identified at the DNA level, there were many aspects that were not clear, such as how the mechanisms leading to the RNA and protein functions and metabolism of that DNA were involved in the various reductions in meningiomas.

[0034] The present inventors have explored the signal transduction pathways and metabolic pathways of malignant and benign meningiomas, and identified metabolic pathways involved in cell proliferation. As shown in the Examples below, we observed changes in the phenotype of meningioma cells by using an inhibitor of the BMP signal transduction pathway and by forcibly expressing an inhibitor of the same signal pathway (GREM2). To identify the mechanism that causes the phenotypic change, we performed comprehensive analysis using microarrays and quantified the metabolites of the target metabolic pathways identified as a result.

[0035] As a result, overexpression of GREM2 and administration of BMP inhibitors suppressed cell proliferation. From a comprehensive analysis to understand the mechanism, we found that overexpression of GREM2 and administration of BMP inhibitors shifted tryptophan metabolism from kynurenin / NAD+ / NADH production to serotonin production, and at the same time, expression of inhibitory serotonin receptors increased. The decrease in NAD+ / NADH production led to a decrease in oxidative phosphorylation, which in turn led to a decrease in ATP production. As a result, we found that inhibition of the BMP pathway led to cell senescence, and in malignant meningiomas, caused growth arrest and calcification. In addition, we downloaded gene expression analysis data from clinical samples of benign and malignant meningiomas published in the public database GREIN, and performed enrichment analysis, and found that the expression of genes involved in oxidative phosphorylation changed depending on the level of GREM2 expression. This finding allowed us to secure the data from the tumor cell lines obtained in the laboratory with clinical sample data.

[0036] There have been no reports to date of the finding that malignant meningiomas can be artificially induced to undergo cellular senescence and calcification to stop their proliferation, and this embodiment proposes a new chemotherapy for malignant meningiomas that tend to recur repeatedly. This discovery provides a new treatment for meningioma patients, for whom no effective chemotherapy had previously been found, and makes it possible to control tumor growth.

[0037] (Another aspect of this embodiment) This embodiment also includes the following aspects. Another aspect of the present embodiment is the use of the cell engineering method of the present embodiment for the treatment of meningioma. Another aspect of the present embodiment is the use of the cell manipulation method of the present embodiment for cell testing. Another aspect of the present embodiment is a method of treating meningioma using the cell manipulation composition of the present embodiment. Another aspect of this embodiment is the use of the cell manipulation composition of this embodiment for the manufacture of a cytostatic drug. Another aspect of this embodiment is a method for treating meningioma using the cytostatic drug of this embodiment. EXAMPLES

[0038] Examples will be given below, but the present invention is not limited to the Examples.

[0039] (Test Example 1) (Verification of the relationship between BMP signaling and cell proliferation and calcification) Human meningioma cells were isolated from surgical tissues of patients treated at our hospital between April 1, 2019 and March 31, 2022, and established as cell lines. Meningioma cells were cultured using the conditional reprogramming (CR) method on collagen-coated 10 cm culture dishes in a humidified incubator at 37°C under an atmosphere of 5% CO2 and 95% air. Meningioma cells were cultured using this method in 67 cases. These cells could be cultured for approximately six months in all cases, except for three cases in which culture was abandoned due to contamination. Anaplastic meningioma MZ857M, which will be described later, could be passaged for more than two years.

[0040] First, the morphology of meningioma cells was observed by immunostaining. Meningioma cells were plated on Matsunami glass in a 96-well plate at 1 × 10 per well. 4 The cells were plated at a density of 1 / 4 and cultured overnight. After fixation with ice-cold methanol, the cells were permeabilized with 0.1% phosphate-buffered saline / Tween and blocked with 1% bovine serum albumin. Primary antibodies were then added and stained overnight at 4°C. After incubation, secondary antibodies consisting of Alexa Fluor 488 or Alexa Fluor 555 conjugated with goat anti-rabbit or goat anti-mouse immunoglobulin G at a ratio of 1:500 were added and incubated for 1 h at room temperature in the dark. The cells were mounted with 4',6-diamidino-2-phenylindole-containing capsules and photographed under a fluorescent microscope (ZEISS Axio Imager.A1; ZEISS Japan, Tokyo, Japan). The primary antibodies used were VIM (vimentin) (M0725, 1:1 dilution) purchased from Agilent Technology (Santa Clara, CA, USA) and BMPR1A (38-6000, 1:100 dilution) purchased from Thermo Fisher Scientific (Waltham, MA, USA).

[0041] Figure 1 is a photograph showing the results of immunostaining of primary cultured meningioma cells. (a) is a merge of the three immunostainings described below, (b) shows staining with VIM (vimentin, cytoskeleton) antibody, (c) shows staining with BMPR1A (BMP receptor) antibody, and (d) shows staining with DAPI (nucleic acid). As shown in the figure, the scale bars are all 200 μm. Primary meningioma cells exhibited a highly characteristic branched morphology and were shown to express BMP receptors.

[0042] The effect of the BMP inhibitor K02288 on these cultured cells was examined. Three cases of WHO grade 1 benign tumor cells (MZ821M, MZ840M, and MZ842M) were examined. As malignant tumor cells, we examined one grade 3 case (MZ857M) and two commercially available meningioma cell lines (IOMM-Iee, HKB-MM) of grade 3. HKB-MM and IOMM-lee were cultured by standard methods. K02288 was purchased from Selleck (Tokyo, Japan).

[0043] Cell proliferation was verified by water-soluble tetrazolium salt (WST-8) assay. After initial seeding and culturing of tumor cells as described above, the culture medium was removed and replaced with medium containing various concentrations of K02288. After 3 and 7 days of culture, 20 μl of WST-8 dye (Cell Counting Kit-8; Dojindo Co., Ltd., Kumamoto, Japan) was added to each well. After 3 hours, the plates were read at 450 nm / 655 nm. Half-maximal inhibitory concentration (IC50) calculations were performed in the same manner by incubating cells with several concentrations of K02288 for 3 days. IC50 values ​​were calculated by linear regression of viability versus drug concentration using GraphPad PRISM7 software.

[0044] FIG. 2 is a graph showing the results of WST-8 assay with the addition of K02288 to benign tumor cultured cells. FIG. 3 is a graph showing the results of WST-8 assay with the addition of K02288 to cultured malignant tumor cells. K02288 inhibited cell proliferation regardless of cell grade (benign or malignant). Since the IC50 was 30μM, the involvement of the BMP receptor ALK3 (BMPR1A) was suggested, taking into account the inhibitory concentration.

[0045] Next, we investigated whether K02288 induces calcification in meningioma (malignant) tumor cells. Alizarin Red S staining was performed to stain calcified and bone tissue. 5The cells were seeded in 6-well plates at a concentration of 100 / mL. When the meningioma cells were 70% confluent, they were split into 2–3 wells. 30 μM K02288 was added to standard medium for 30 days. During staining, the cells were washed twice with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde (PFA) four times for 10 min, washed three times with deionized water, and stained with 1% Alizarin Red (Sigma-Aldrich), and excess dye was removed by washing with PBS.

[0046] Figure 4 is a photograph showing the results of Alizarin Red S staining of meningioma cells. (a) and (b) show commercially available HKB-MM malignant tumor cells, and (c) shows the staining results of anaplastic meningioma MZ857M primary cultured in this example. Both were culture media supplemented with 30 μM K02288. In (a), a core-shaped calcification has occurred in the center of the photograph, surrounded by tumor cells. In (b) and (c), a large area in the middle of the photograph is stained heavily with alizarin red, indicating the occurrence of large-scale calcification. K02288 not only inhibited proliferation, but also induced a morphology similar to that commonly seen in benign brain tumors called whorls, and the interesting result was that calcification of tumor cells was observed.

[0047] (Test Example 2) (Verification of upstream factors of BMP signaling) Since the BMP inhibitor K02288 showed similar inhibitory effects on all tumor cells regardless of their malignancy, we hypothesized that the difference in proliferation rate between benign and malignant tumors may be influenced by the expression of upstream factors that control BMP signaling. A keyword search on Pubmed for BMP and meningioma revealed that GREM2 was found to be an upstream factor. Therefore, we investigated the expression and localization of GREM2 in clinical samples.

[0048] A total of 87 clinical samples were analyzed by the following methods as performed in the pathology laboratory. Hematoxylin and eosin (HE) staining was performed by standard methods. Immunoperoxidase staining was performed using the Envision kit (Dako) according to the manufacturer's instructions with minor modifications. Briefly, the sections were placed in 0.01 M citrate buffer, heated in a microwave oven (700 W) for 10 min, and endogenous peroxidase activity was blocked with 0.5% hydrogen peroxidase in methanol for 30 min. The sections were then incubated with primary antibodies for 12 h at 4°C. The sections were then washed with PBS and incubated with secondary antibodies for 10 min at room temperature. They were then reacted with 0.02% 3.30-diaminobenzidine. As the primary antibody, GREM2 antibody (13892-1-AP, diluted 1:100) purchased from Proteintech (Rosemont, Illinois, USA) was used.

[0049] Figure 5 is a photograph showing the expression of GREM2 using clinical samples, (a) and (b) show immunostaining with GREM2 antibody, and (c) and (d) show HE staining of the same area. These were grade 1 clinical samples, and although some tumors were diffusely expressed in the tumor cells as shown in (a), GREM2 was strongly expressed mainly around the psammoma body and in the sites of whorl formation. On the other hand, in grades 2 and 3, almost no expression was observed by immunohistochemistry (not shown).

[0050] Next, RNA in tumor cells was analyzed for GREM2 expression. RNA extraction, cDNA synthesis, and quantitative PCR (qPCR) analysis were performed as follows. RNA from tumor cells was extracted using the RNeasy Plus Mini Kit (QIAGEN, Germantown, MD, USA). For cDNA synthesis, RNA was reverse transcribed from random hexamers using the SuperScript™ VILO™ cDNA Synthesis Kit (Invitrogen, Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA). Real-time qPCR was then performed in triplicate using SYBR™ Green Realtime PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific) in StepOne Plus or Quant3 (Applied Biosystems, Thermo Fisher Scientific) to measure mRNA abundance. PCR was performed in a volume of 20 μl containing 2 μl of cDNA, 300 μM of each primer, and 10 μl of 2× PCR master mix under the following conditions: 95°C for 10 min, followed by 40 cycles of annealing / extension at 95°C for 15 s and 60°C for 1 min. Data were normalized to the amount of human 18S rRNA, and values ​​are expressed as the mean ± SD of 2-ΔΔCt in triplicate assays.

[0051] For each sample, MIB-1L.I. (proliferation rate) was detected. Ki-67 (M7240, 1:50 dilution) antibody was purchased from Agilent Technology (Santa Clara, CA, USA). The primers for GREM2 used for amplification were: (SEQ ID NO: 1) GREM2-Fw: atcccctcgccttacaagga (SEQ ID NO: 2) GREM2-R: tcttgcaccagtcactcttga It was.

[0052] Figure 6 is a graph showing the correlation between the expression level of GREM2 and the proliferation rate. Of the 87 clinical samples, 27 samples had an MIB-1 L.I. value of more than 7 (high proliferation rate), and 60 samples had an MIB-1 L.I. value of 7 or less. As shown in the figure, GREM2 RNA expression showed a strong inverse correlation with the proliferation rate.

[0053] (Test Example 3) (Relationship between GREM2 overexpression and proliferation) To examine the effect of overexpression of GREM2, GREM2 was forcedly expressed in the commercially available anaplastic meningioma cells (IOMM-lee, HKB-MM), and proliferation assays were performed. Forced expression of GREM2 was performed under the following plasmid preparation and gene transfer conditions. Plasmid preparation and gene transfer Wild-type human GREM2 was synthesized (Thermo Fisher Scientific, Waltham, MA, USA) and cloned into pcDNA3.1. Empty vector or pcDNA3.1-GREM2 was transfected into the above-mentioned malignant meningioma cells IOMM-lee and HKB-MM by electroporation, and stable cell lines were obtained by drug selection.

[0054] The cell proliferation was verified by the water-soluble tetrazolium salt (WST-8) assay as in Test Example 1. Figure 7 is a graph showing the cell proliferation results of IOMM-lee and HKB-MM cells forced to express GREM2. (a) IOMM-lee and (b) HKB-MM cells show the number of days of culture after induction of GREM2 expression and proliferation (absorbance). Compared to cells transfected with an empty vector (empty), cells expressing GREM2 showed a reduced proliferation rate. In both IOMM-lee and HKB-MM cells, the proliferation ability was reduced by approximately half.

[0055] Cell cycle analysis was also performed on IOMM-lee cells. A Cell Cycle Phase Determination Kit (Cayman Chemical, Ann Arbor, MI, USA) was used for cell cycle analysis. Briefly, harvested cells were washed twice with buffer and fixed overnight at -20°C. Cells were washed twice with ice-cold phosphate-buffered saline and stained with propidium iodide / RNase staining buffer in the dark for 30 min at room temperature. Cells were then analyzed using a flow cytometer (Guava® EasyCyte™ Mini, Luminex Japan, Tokyo, Japan). Histograms of cell cycle distribution were generated from 5000 events per sample, and data were analyzed using Guava® Cell Cycle software.

[0056] FIG. 8 shows a histogram of cell cycle distribution. FIG. 9 shows the proportion of each cell cycle (G1, S, G2 / M, subG1) analyzed from the histogram in FIG. These results suggest that GREM2 expression increased the number of sub-G1 cells, i.e., increased the proportion of cells in the pre-proliferative phase of the cell cycle, thereby suppressing cell proliferation.

[0057] (Test Example 4) (Search for genes involved in GREM2 expression) We comprehensively analyzed which genes are affected by BMP signaling to cause the change in proliferation rate induced by GREM2 expression.

[0058] Gene expression analysis was performed as follows. The same mRNA expression analysis as in Test Example 2 was performed, and the fragmented cDNA was amplified and biotin-labeled using a biotin labeling system (GeneChipTM WT PLUS Reagent Kit, Thermo Fisher Scientific). The labeled probe was hybridized to the Human Genome Clariom(TM) D Array (Thermo Fisher Scientific) using a GeneChip(TM) Scanner 3000 7G (Affymetrix(R), Thermo Fisher Scientific). mRNA expression data was extracted from the image files using GeneSpring GX 14.9.1 (Agilent Technologies, Santa Clara, CA, USA). Normalization and calculation of expression values ​​were performed using the GeneSpring system.

[0059] In silico expression analysis was performed as follows: Gene expression data (GSE 101638) obtained by RNA sequencing was downloaded from the public database GEO RNA-seq Experiments Interactive Navigator (GREIN) (http: / / www.ilincs.org / apps / grein / ?gse=). The GeneChip™ System data and the downloaded data were analyzed by gene set enrichment analysis (GSEA) (http: / / www.broad.mit.edu / GSEA) using MSigDB (v2023) to determine the significance of predefined gene sets by comparing the correlation between expression and class distinction with other random situations. The significance threshold was a nominal P value < 0.05 or a false discovery rate q value < 0.25.

[0060] FIG. 10 shows an overview of the results of expression analysis. When I downloaded the GMT file from the GSEA gene sets with the keyword ALK and analyzed it, serotonin-related genes were picked up. When I searched for the GMT with the keyword serotonin and reanalyzed it, 1 GOMF_G_PROTEIN_COUPLED_SEROTONIN_RECEPTOR_ACTIVITY 2 GOMF_SEROTONIN_RECEPTOR_ACTIVITY 3 GOBP_SEROTONIN_RECEPTOR_SIGNALING_PATHWAY The expression levels of these three gene sets were significantly increased by overexpression of GREM2. Of the top five genes that make up this geneset, HTR5A, HTR1F, and HTR1B are all inhibitory serotonin receptors that have the effect of reducing intracellular cAMP ((a) in the figure).

[0061] Next, to investigate the ability to produce ligand serotonin, we searched for GMT with the keyword tryptophan and performed GSEA analysis. 1 GOBP_TRYPTOPHAN_CATABOLIC_PROCESS_TO_KYNURENINE 2 WP_TRYPTOPHAN_CATABOLISM_LEADING_TO_NAD_PRODUCTION It was found that the concentration of β-glucose was significantly decreased ((b) and (c) in the figure).

[0062] Next, the end products of tryptophan metabolism induced by a BMP inhibitor (K02288), serotonin, NADH / NAD+, and ATP, were measured. Adenosine triphosphate (ATP) and NAD / NADH assays were performed as follows. Intracellular ATP / NAD / NADH were measured using the ATP assay kit-luminescence (A550) and NAD / NADH assay kit-WST (N509) (Dojindo) according to the manufacturer's instructions. ATP levels were calculated using a Beckman-Coulter DTX-800 spectrophotometer and accompanying software (Beckman Coulter, Brea, CA, USA). For NAD / NADH measurements, plates were read at 450 nm.

[0063] ELISA for measuring serotonin was performed as follows. Meningioma cells treated with or without 30 μM K02288 for 72 h were homogenized by sonication in ice-cold phosphate-buffered saline, and then centrifuged at 10,000 g for 5 min. Intracellular serotonin was measured using a serotonin ELISA kit (KA2518, Abnova, Taipei, Taiwan) according to the manufacturer's instructions and under the conditions indicated. The standard was the serotonin standard provided with the kit. After stopping the reaction, OD450 and OD620 values ​​were read using a SpectraMax iD3 Multi-Mode Microplate Reader (Molecular Devices, San Jose, CA, USA).

[0064] 11 shows the results of measuring the end products of tryptophan metabolism, NADH / NAD+, ATP, and serotonin, using a BMP inhibitor (K02288). (a) shows the results of measuring NAD+, (b) shows the results of measuring NADH, (c) shows the results of measuring ATP, and (d) shows the results of measuring serotonin. As shown in the figure, BMP inhibitors decreased NADH / NAD+ and ATP and increased serotonin.

[0065] (Test Example 5) (Search for coenzymes involved in GREM2 expression) Because NADH / NAD+ are essential coenzymes for oxidative phosphorylation, we used clinical samples to examine whether the level of GREM2 expression would alter the enzymes involved in oxidative phosphorylation. FIG. 12 shows an outline of the results of expression analysis. As in the expression analysis of Test Example 4, RNA-seq data of 42 meningiomas was downloaded from the public database GREIN (GSE101638), and the average expression level of GREM2 was calculated. The data were classified into two groups: 32 cases with expression levels higher than the average, and 10 cases with expression levels lower than the average. When this data was analyzed using the GSEA hallmark gene sets, the expression of enzymes related to oxidative phosphorylation was significantly increased in the group with low GREM2 expression (nominal p-value < 0.05, FDR q-value: 0.027). Furthermore, when the two groups were analyzed using GMT serotonin used in the array analysis, similar to the results of the array, 1 GOBP_SEROTONIN_RECEPTOR_SIGNALING_PATHWAY 2 GOMF_SEROTONIN_RECEPTOR_ACTIVITY 3 GOMF_G_PROTEIN_COUPLED_SEROTONIN_RECEPTOR_ACTIVITY 4 WP_SEROTONIN_RECEPTOR_2_AND_ELKSRFGATA4_SIGNALING 5 WP_SEROTONIN_HTR1_GROUP_AND_FOS_PATHWAY The expression of these five gene sets was significantly increased in the group with high GREM2 expression.

[0066] (Test Example 6) (Analysis of senescence by suppression of BMP signal) We hypothesized that the suppression of GREM2 expression, NADH / NAD+, and ATP by BMP inhibitors, and the increase in sub-G1 in the cell cycle may be due to senescence caused by the suppression of BMP signaling, so we performed a senescence assay using various markers.

[0067] Ki-67 / DAPI immunostaining was performed in the same manner as in Test Example 1, using the same Ki-67 antibody as in Test Example 2, and culturing meningioma cells for 5 days with or without the addition of 30 μM K02288. SPiDER-bGal staining was performed as follows. Meningioma cells were cultured for 5 days with or without 30 μM K02288. The cells were washed twice with 2 ml of Hanks' HEPES buffer. SPiDER-βGal (SG02, Dojindo) working solution (1 μmol / l) was added to the culture dish and incubated at 37°C for 15 min. The dye was washed off and observed under a fluorescent microscope.

[0068] FIG. 13 is a photograph showing the results of Ki-67 / DAPI immunostaining. It was shown that inhibition of the BMP signal reduced Ki-67 staining (light color in the figure). FIG. 14 is a photograph showing the results of SPiDER-bGal staining. It was shown that inhibition of BMP signaling increased the expression of b-gal. These results demonstrated that inhibition of BMP signaling induces senescence.

[0069] (Summary of the results of Test Examples 1-5) FIG. 15 shows a schematic diagram in which these results are plotted on a scheme of tryptophan metabolism. The amount of GREM2 determines the direction in which tryptophan is metabolized. In cases where there is little GREM2 and a tendency toward malignant tumors, NAD+ and ATP increase, and the TCA cycle and oxidative phosphorylation pathways increase, leading to the de novo pathway (right side of the figure). On the other hand, when a BMP inhibitor is added and the tumor becomes benign, NAD+ and ATP are decreased and serotonin is increased. A similar pathway occurs when GREM2, an upstream inhibitor of BMP signaling, is increased.

[0070] Regarding the results of the above examples, there have been no reports to date that BMP signal inhibitors or their inhibitors are involved in cellular senescence. In addition, although there are morphological studies of meningioma calcification and psammoma bodies in the literature, there have been no reports of artificially inducing calcification in malignant meningiomas in vitro. In this example, we reproduced the process in which a whorl formed around a small calcification, which then grew into a large calcified lesion, by controlling BMP signaling, even in malignant meningioma, and demonstrated that the detailed underlying mechanism is cellular senescence due to a shift in tryptophan metabolism.

[0071] In this example, GREM2 was expressed in a large amount in samples with low MIB-1 in grade 1, as in previous reports, and was hardly expressed in samples with high MIB-1 in grades 2 and 3. Moreover, the strong expression was observed around the psammoma body and in the area of ​​whorl formation, suggesting that BMP signaling is strongly related to the calcification and proliferation ability of tumors. To verify this hypothesis, GREM2, which suppresses BMP signaling, was overexpressed in three malignant meningioma lines, and proliferation was suppressed as expected. The cell cycle showed an increase in sub-G1 in both GREM2-overexpressing cells and BMP inhibitors, suggesting that the cells may be leaning toward cellular senescence. Comprehensive expression analysis using microarrays to investigate the detailed mechanism showed that the decrease in BMP signaling due to GREM2 overexpression 1) increased the expression of inhibitory serotonin receptors, and 2) reduced the expression of enzymes involved in kinurenine / NAD+ / NADH production in the tryptophan metabolic pathway and increased the expression of enzymes involved in serotonin production. As a result, NADH and NAD+ decreased, and serotonin increased.

[0072] The action of serotonin is said to be determined mainly by the properties of the receptor, and it is known that an increase in the inhibitory serotonin receptors shown in this example leads to a decrease in intracellular cAMP. NAD+ is an important redox coenzyme present in all living cells. NAD+ plays a central role in redox reactions, acting as an important coenzyme for enzymes that promote reduction and oxidation reactions by transporting electrons from one reaction to another, and as a cosubstrate for other enzymes such as sirtuins and polyadenosine diphosphate ribose polymerase (PARP). A decrease in NAD+ levels leads to a reliance on glycolysis for ATP production, since oxidative phosphorylation does not function in energy production. However, since cAMP is required for the activation of phosphofructokinase-1 (PFK1), which is required for the conversion of fructose 6-phosphate to fructose 1,6-bisphosphate in the glycolytic pathway, it is easy to predict that a decrease in cAMP due to an increase in inhibitory serotonin receptors will make it difficult for even glycolysis to obtain sufficient energy. As expected, ATP production was reduced by GREM2 expression and BMP inhibitors. Since a decrease in NAD+ levels and ATP production ability is known as a marker of cell aging, we performed a senescence assay and confirmed that senescence was induced by suppression of BMP signaling.

[0073] Furthermore, to verify these experimental results through expression analysis of large-scale clinical samples, the inventors used RNA-seq data of clinical samples published in GREIN to classify subjects into groups with high and low GREM2 expression, and performed enrichment analysis using GSEA, demonstrating that the level of GREM2 expression changes the expression of genes involved in oxidative phosphorylation and the expression of inhibitory serotonin receptors.

[0074] In this example, comprehensive metabolome analysis was not performed, but as shown by comprehensive expression analysis, GREM2 and BMP inhibitors shifted kinurenine / NAD+ production to serotonine production, and caused cellular senescence and calcification, which are consistent with the results of previous metabolome analysis. Talari et al. performed mass spectrometry on metabolites of meningiomas and reported that Grade 1 had a higher serotonin content and a lower kinurenine content than Grade 2.3. In addition, detailed mass spectrometry results showed that clusters with high expression of tryptophan metabolites, including kynurenic acid, had a significantly worse prognosis than clusters with low expression. These previous reports support the inventors' results that tumor proliferation ability changes due to a shift in the tryptophan metabolic pathway.

[0075] In this example, we have demonstrated the previously unknown underlying mechanism by which metabolites accumulate, and have proposed a new treatment that induces cellular senescence and calcification in malignant meningiomas.

[0076] In conclusion, GREM2 / BMP signaling controls cellular senescence by shifting tryptophan metabolism and regulating the expression of NAD+ / NADH, serotonin, and inhibitory serotonin receptors. These findings suggest that the signaling pathway involved in tryptophan metabolism may be a novel therapeutic target for inducing cellular senescence.

[0077] (Test Example 6) We administered Lindostat, an IDO1 inhibitor, to malignant meningioma IOMM-Lee to examine whether calcification occurs by inhibiting only the kynurenine production system. Three weeks after administration of 13 μM Lindostat, calcification and bone tissue staining with Alizarin Red S were performed under the same conditions as in Test Example 1. Figure 16 shows photographs of IOMM-Lee after administration of Lindostat. (a) and (c) are untreated controls, and (b) and (d) are images taken 3 weeks after administration of Lindostat. The magnification of the objective lens in (a), (c), and (d) is x4, and the magnification of the objective lens in (b) is x10.

[0078] As shown in the figure, when Lindrostat was administered to malignant meningioma IOMM-lee, it was able to induce a small amount of calcification in 3 weeks. However, no calcification was observed in HKB-MM (not shown). Compared to the administration of K02288, the number of calcifications was clearly smaller when Lindrostat was administered, suggesting that although Lindrostat alone induces cellular senescence to some extent, it may not be complete.

[0079] (Test Example 7) We used the low molecular weight compound LDN193189, which is said to have more specific ALK3 inhibition than K02288, to examine whether calcification occurs. Using cells from benign meningiomas (MZ1150M, MZ1149M, MZ1146) and malignant meningiomas (MZ1142M, MZ1123M), we administered 13 μM Lindostat and, after 3 weeks, performed calcification and Alizarin Red S staining, which stains bone tissue, under the same conditions as in Test Example 1. Figure 17 shows photographs of MZ1150M treated with LDN193189. The objective lens magnifications for (a) and (b) are x4. Figure 18 shows photographs of MZ1149M treated with LDN193189. The objective lens magnification for (a) and (b) is x4. The degree of calcification varied, with some large calcifications observed. Figure 19 shows photographs of MZ1146M treated with LDN193189. The objective lens magnifications for (a) and (b) are x4. Figure 20 is a photograph of MZ1142M treated with LDN193189. The objective lens magnification is x4. Figure 21 shows photographs of MZ1123M treated with LDN193189. The objective lens magnification for (a) and (b) is x4. 17 to 21, the locations where the red signals of Alizarin Red S were observed are indicated by white arrows in the figures.

[0080] As shown in the figure, in benign meningiomas (MZ1150M, MZ1149M, MZ1146M), LDN193189 was able to induce numerous calcifications at a low concentration (0.3μM) and for a short period (3 weeks). On the other hand, in malignant meningiomas (MZ1142M, MZ1123M), calcifications could be induced at the same concentration and for the same period, but the number and size of the calcifications were clearly small, so we decided to consider testing under different conditions of concentration and treatment time.

[0081] (Test Example 8) Malignant meningiomas (IOMM-lee, HKB-MM, MZ857M) were used, and LDN193189 was administered at various concentrations and times under the same conditions as in Test Example 1, and calcification and bone tissue were stained with Alizarin Red S. Figure 22 shows photographs of IOMM-lee cells treated with LDN193189. (a)(c)(e) were administered at a concentration of 0.6 μM, and (b)(d) were administered at a concentration of 1.0 μM. The cells were stained and observed one month later. The objective lens magnification for (a)(b)(c)(d)(e) was x4. Figure 23 is a photograph of LDN193189 administered to HKB-MM. It was administered at a concentration of 0.6 μM, and stained and observed one month later. The magnification of the objective lens was x4. Figure 24 shows photographs of MZ857M treated with LDN193189. (a) was administered at a concentration of 0.6 μM, and (b) and (c) were administered at a concentration of 0.3 μM. The cells were stained and observed one month later. The objective lens magnification for (a), (b), and (c) was x4. 22 to 24, the locations where the red signals of Alizarin Red S were observed are indicated by white arrows in the figures.

[0082] As shown in the figure, malignant meningiomas (IOMM-lee, HKB-MM) showed numerous calcifications after one month of treatment with LDN193189 at 0.6μM and 1μM. MZ857M was also a malignant meningioma, but the same amount of calcification was observed after one month of treatment with 0.3μM and 0.6μM. Conventionally, LDN193189 is thought to exhibit more specific inhibition of ALK3 than K02288. As a result, it was thought that calcification could be induced at a fairly low concentration.

[0083] These results indicate that inhibition of ALK3 is effective in inducing calcification (cell senescence) regardless of whether the tumor is benign or malignant, and suggest that meningiomas, which account for one-third of brain tumors, are the target of treatment. LDN193189 is considered to be a promising compound because it has the same effect as K02288 at a concentration of 1 / 30-1 / 50.

[0084] FIG. 25 is a graph showing the sensitivity of LDN-193189 and K02288 to ALK3. The data from the cell-free assay of LDN-193189 and K02288, published in Sanvitale CE, et al. PLoS One. 2013, 8(4), e62721, are plotted and compared. As shown in the figure, the sensitivity of LDN-193189 to ALK3 is 5 to 7 times higher than that of K02288.

[0085] (Test Example 9) Using malignant meningioma IOMM-lee, various concentrations of LDN-193189 were applied for one month, and the number of cells in which calcification occurred was compared. Staining was performed in the same manner as in Test Example 1, and the number of calcified cells was counted. In addition, three lines each of benign (grade 1: MZ1150M, MZ1149M, MZ1146M) and malignant (grade 2.3: MZ1142M, MZ1123M, MZ857M) meningiomas were prepared and treated with 0.3 μM LDN-193189 for three weeks. They were then stained in the same manner and the number of calcifications was counted. 26 is a graph showing the number of calcifications by LDN-193189. (a) shows the results of IOMM-lee, and (b) shows the results of meningioma grades 1, 2, and 3.

[0086] As shown in the figure, the number of calcifications in the malignant meningioma IOMM-lee increased in a concentration-dependent manner. Interestingly, even without the drug, calcification occurred naturally when the cells were maintained at confluence. It is thought that calcification occurs after the cells reach confluence, going through quiescence due to contact inhibition and then falling into senescence. LDN-193189 is thought to have the effect of promoting this process. When we examined whether there was a difference in the number of calcifications between benign and malignant meningiomas using the same amount of drug over the same period, we found that benign meningiomas showed more calcifications than malignant meningiomas.

[0087] (Test Example 10) A test similar to that in Test Example 9 was performed using the anaplastic oligodendroglioma cell line MZ991AO established in the inventors' laboratory. Oligodendroglioma is a grade 2 tumor that occasionally exhibits calcification, and when it becomes malignant it becomes an anaplastic oligodendroglioma (grade 3). 27 is a graph showing the number of calcifications induced by LDN-193189 in MZ991AO. LDN-193189 was applied in the same manner as in Test Example 8, staining was performed in the same manner as in Test Example 1, and the number of calcifications was counted. 28 is a photograph of MZ991AO administered with LDN193189. Alizarin Red S staining, which stains calcified and bone tissue, was performed under the same conditions as in Test Example 1. The stained areas are shown in bright colors in the figure.

[0088] As shown in Figure 28, LDN-193189 caused calcification in the anaplastic oligodendroglioma cell line MZ991AO. Moreover, as shown in Figure 27, the frequency of calcification was concentration-dependent. From these results, it is believed that BMP signaling via BMPR1A (ALK3) is involved in proliferation not only in meningiomas but also in brain tumors with calcification, and the development of drug therapy utilizing cell senescence is believed to be effective for more patients.

[0089] Although several embodiments of the present invention have been described above, these embodiments are presented as examples and are not intended to limit the scope of the invention. These embodiments can be implemented in various other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their modifications are included in the scope of the invention and its equivalents described in the claims, as well as in the scope and spirit of the invention. [Industrial Applicability]

[0090] According to the present invention, by controlling common signal pathways and metabolic pathways that can control the proliferation of tumors regardless of whether they are benign or malignant, a method for manipulating cells, a composition for cell manipulation, and a cell proliferation inhibitor can be obtained as a new chemotherapy that can artificially induce cellular senescence and calcification in malignant meningiomas and stop their proliferation.

Claims

1. A method of engineering a cell to promote calcification of said cell by inhibiting BMP or increasing activity of GREM2 in said cell.

2. The method of manipulating cells according to claim 1 , further comprising administering to said cells an inhibitor of the BMP signaling pathway.

3. 3. A method for manipulating a cell according to claim 1 or 2, comprising causing the cell to express serotonin or a serotonin receptor and reducing NADH / NAD+.

4. The method of manipulating cells according to claim 1 , comprising introducing a gene that causes expression of GREM2 into the cells.

5. A composition for cell manipulation, comprising a BMP inhibitor or a component that increases expression of GREM2, and promotes mineralization of cells.

6. A cytostatic drug comprising the cell manipulation composition of claim 5.

7. The cytostatic drug according to claim 6, which is for the treatment of meningioma.

Images