Application of Paraprevir drug targeting FOXRED2 pathway in tumor

Through a drug screening system combined with software structure simulation and virtual screening, Paritaprevir, a small molecule inhibitor that specifically inhibits FOXRED2, was screened out. Through the method of targeting FOXRED2, the drug resistance and long-term efficacy in liver cancer treatment were solved, and new treatment principles and targets were achieved, providing new ideas for cancer treatment.

CN120168635APending Publication Date: 2025-06-20UNIV OF SCI & TECH OF CHINA
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202311749313.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-19
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The prior art has problems that drug resistance and long-term efficacy have yet to be evaluated in the treatment of liver cancer, and the development cycle of new drugs is long, costly and risky.

Method used

Through a drug screening system combined with software structure simulation and virtual screening, the small molecule inhibitor Paritaprevir, which specifically inhibits FOXRED2, was selected, and it was determined by functional experiments as the most effective inhibitor, and then targeted FOXRED2 to inhibit tumor development.

Benefits of technology

It has realized the new treatment principles for liver cancer, expanded the field of treatment of Paritaprevir drugs, provided new targets and strategies, and provided new ideas for cancer diagnosis, treatment and prognosis evaluation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0004615284890000011
    Figure HDA0004615284890000011
Patent Text Reader

Abstract

The invention provides a medicine composition for treating cancer. The medicine composition comprises an inhibitor for inhibiting FOXRED2 protein expression and application of Paraprevir in preparation of a medicine for treating cancer. According to the application disclosed by the invention, the new indication of the hepatitis C medicine paritaprevir for inhibiting the malignant process of the liver cancer HCC is found for the first time, the treatment field of the medicine in the liver cancer is expanded, and a theoretical basis is provided for developing a new target spot for treating the liver cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of tumor diagnosis and treatment, and specifically relates to the application of Paritaprevir drug targeting FOXRED2 pathway in tumors, and more specifically relates to drug screening of Paritaprevir (Chinese name: Paritaprevir), a small molecule inhibitor specifically targeting FOXRED2, thereby inhibiting FOXRED2 function and treating tumors. Background Art

[0002] Cancer is a major challenge facing human health, especially at a time when life expectancy has been greatly extended, and cancer has become one of the main causes of death in humans. Improving the prognosis of liver cancer is a major issue that needs to be urgently addressed in the field of oncology. Most studies explore new drugs that can be used to treat liver cancer by analyzing the molecular mechanisms of liver cancer. However, the development cycle of new drugs is long, the investment is large, and the risk is high. There is a long and difficult process from testing in multiple models to the clinical use of drugs. Compared with the development of new anticancer drugs, the new use of old drugs has the huge advantages of high efficiency, low cost and good safety. Therefore, the practice of screening or modifying existing drugs is often more economical and effective. On the one hand, it can greatly shorten the approval cycle of clinical drugs, and on the other hand, it will also reduce the probability of unknown toxic side effects.

[0003] Paritaprevir (Chinese name: paliprevir) is a second-generation protease inhibitor, generally used as one of the components of combination therapy for the treatment of chronic hepatitis C caused by hepatitis C virus (HCV) infection [1]. Since 2011, the treatment options for chronic hepatitis C have significantly improved with the development of direct-acting antiviral drugs such as paliprevir. As a new generation of direct-acting hepatitis C virus antiviral drugs, paliprevir has better sustained virological response (SVR) rates, higher barriers to resistance, fewer side effects and lower drug burden compared to older drugs such as boceprevir, telaprevir, peginterferon and ribavirin. By combining multiple antiretroviral drugs into a fixed-dose product, multiple stages of the viral life cycle can be targeted while reducing the risk of developing resistant viral strains. Paliprevir is able to prevent viral replication by inhibiting the NS3 / 4A serine protease that is a signature of hepatitis C virus (HCV). After viral replication and translation of HCV genetic material into individual polypeptides, nonstructural protein 3 (NS3) and its activation cofactor nonstructural protein 4A (NS4A) are responsible for cleaving the genetic material into the following structural and nonstructural proteins required for mature virus assembly: NS3, NS4A, NS4B, NS5A and NS5B, thereby preventing viral replication and synthesis by inhibiting the viral protease NS3 / 4A [2].

[0004] However, due to the limited follow-up time of paritaprevir, its long-term efficacy still needs to be further evaluated. In addition, some patients may experience virological response failure after treatment with paritaprevir, which may be related to drug-resistant mutations, and new drug-resistant mutations may also be induced by the selective pressure of the drug during treatment [3]. A clinical trial also confirmed that among 57 patients with genotype 1a HCV infection who relapsed or were insensitive to treatment after treatment, 30 had drug-resistant strains with single substitutions at the drug target. Among the patients with resistance, NS5A inhibitor resistance was the most persistent and could last up to 48 weeks after treatment [4]. This suggests that some strains of HCV may have strong drug resistance to paritaprevir, indicating that the therapeutic effect of paritaprevir varies among different patient subtypes. Therefore, further exploring the mechanism of action of paritaprevir is of profound significance for solving problems such as drug resistance and long-term efficacy. Repurposing old drugs is a current frontier hot issue in the field of cancer treatment. Exploring new key molecules targeted by paritaprevir in liver cancer to achieve stronger killing ability against tumors plays an important role in the early diagnosis and timely treatment of cancer. Summary of the Invention

[0005] Based on previous research, the present invention proposes a research idea of repurposing old drugs. By screening known drugs based on the function of targeting FOXRED2, a screening system for known drugs is designed by analyzing the protein conformation of FOXRED2 through software, and further screening for new functions of known drugs or new uses in tumors. The present invention analyzes and screens specific inhibitors from the FDA-approved small molecule drug library, and analyzes the new effects and new targets of the drugs in liver cancer. The present invention also analyzes the process by which the FOXRED2-specific inhibitor slows down tumor development by inhibiting the function of FOXRED2, which will provide new ideas for the research of repurposing old drugs and the treatment of cancer.

[0006] Aiming at one or more problems existing in the prior art, the present invention provides a drug screening system based on the combination of software structure simulation and virtual screening. Finally, the most effective FOXRED2-specific inhibitor, paritaprevir, is determined through functional experiments, and FOXRED2 has also become a new therapeutic target for paritaprevir in the treatment of liver cancer. The present invention elaborates in detail the new therapeutic principle of paritaprevir, expanding the therapeutic field of this drug. Specifically, by targeting FOXRED2 to exert an anti-tumor effect, it provides new theories and new mechanisms for the occurrence and development of cancer, and at the same time provides new targets and new strategies for the diagnosis, treatment, and prognosis evaluation of cancer based on the function of paritaprevir targeting the FOXRED2 protein.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] On the one hand, the present invention provides a pharmaceutical composition for treating cancer, characterized in that the pharmaceutical composition comprises an inhibitor that inhibits the expression of FOXRED2 protein.

[0009] In some embodiments, the inhibitor that inhibits the expression of FOXRED2 protein is siRNA.

[0010] In some embodiments, the inhibitor that inhibits the expression of FOXRED2 protein is an inhibitor targeting the substrate binding site of FOXRED2 protein.

[0011] In some embodiments, the inhibitor that inhibits the expression of FOXRED2 protein is Paritaprevir.

[0012] On the other hand, the present invention provides the use of Paritaprevir in the preparation of a drug for treating cancer.

[0013] In some embodiments, the cancer is a cancer with high expression of FOXRED2.

[0014] In some embodiments, the cancer is liver cancer, breast cancer, cervical cancer, esophageal cancer, lung cancer, prostate cancer, melanoma, gastric cancer, lymphoma or thymic cancer.

[0015] In some embodiments, the cancer is liver cancer.

[0016] In some embodiments, the liver cancer is HepG2, PLC or HUH7 cell line.

[0017] On the other hand, the present invention provides a method for treating cancer, characterized in that the method comprises administering an effective amount of Paritaprevir to a subject.

[0018] In some embodiments, Paritaprevir promotes apoptosis of cancer cells.

[0019] On the other hand, the present invention provides a method for screening an inhibitor of FOXRED2 protein, characterized in that the method comprises the following steps:

[0020] a. Obtain the structure of FOXRED2;

[0021] b. Identify the NADH or FMN substrate binding region of FOXRED2 protein;

[0022] c. Screen candidate drugs targeting the NADH or FMN substrate binding region of FOXRED2 protein;

[0023] d. Screen an inhibitor of FOXRED2 protein based on the functional detection of FOXRED2 protein.

[0024] The present invention provides a method for screening specific inhibitors of FOXRED2 protein activity, which is characterized in that the method includes obtaining the structural characteristics of FOXRED2 protein using protein structure simulation software or obtaining the fine protein structure of FOXRED2 by means of structure analysis, including X-ray crystallography, cryo-electron microscopy, and nuclear magnetic resonance techniques; identifying the key sites of FOXRED2 protein activity, targeting the NADH or FMN substrate binding region of FOXRED2 protein as the pocket, and screening out a list of potential candidate drugs through virtual screening software such as AutoDock VINA; and determining the most effective small molecule inhibitor for FOXRED2 based on the detection method of FOXRED2 protein function.

[0025] On the other hand, the present invention provides a method for developing a new therapeutic target for the drug paritaprevir, which is characterized in that the method includes detecting the cell growth status of different liver cancer cells after being treated with the drug by cell proliferation and cell viability determination, and determining whether the drug is suitable for treatment according to the FOXRED2 protein expression level. When the protein expression level of FOXRED2 detected by Western blot, immunohistochemistry, or enzyme-linked immunosorbent assay is significantly higher than that of the control group, the sample can be judged as suitable for treatment with the paritaprevir drug.

[0026] In some embodiments, the control group is a healthy sample without cancer cells.

[0027] In some embodiments, paritaprevir targets the key site where the FOXRED2 protein binds to the NADH substrate to exert its function, thereby inhibiting the tumor-promoting effect of FOXRED2.

[0028] The present invention discovers for the first time a new indication that the hepatitis C drug paritaprevir inhibits the malignant progression of liver cancer HCC, expands the therapeutic field of this drug in liver cancer, and provides a theoretical basis for developing new therapeutic targets for liver cancer.

[0029] Through cell biology experiments and mouse experiments, the present invention discovers a new application of the drug paritaprevir, which also plays an anti-tumor role in the development of hepatocellular carcinoma (HCC). The new target for its application in liver cancer is FOXRED2. Preliminary studies in normal cell lines and liver cancer cell lines have found that the protein expression level of FOXRED2 is significantly up-regulated in liver cancer cell lines compared with normal cells; further, the present invention discovers that the expression level of FOXRED2 is different in different liver cancer cell lines, which is crucial for the selective treatment of paritaprevir. Subsequently, the present invention combines cell proliferation experiments and the NRAS / shP53 / SB13 mouse orthotopic liver cancer induction model and discovers that the drug paritaprevir can significantly inhibit the pro-cancer effect exerted by the FOXRED2 protein, thereby achieving the effect of resisting tumor development. This suggests that the FOXRED2 protein in the present invention has the potential for cancer auxiliary diagnosis, treatment or prognosis evaluation, and the new target of FOXRED2 targeted by the drug paritaprevir is crucial for the prevention and treatment of liver cancer clinically. Further, the cancers detected and treated in the present invention include liver cancer, but should not be limited to liver cancer, but should be widely applicable to all cancer types with high expression of the FOXRED2 protein, such as breast cancer, cervical cancer, esophageal cancer, lung cancer, prostate cancer, melanoma, gastric cancer, lymphoma, thymoma.

[0030] Definition

[0031] HepG2: Human hepatoblastoma, which was isolated and established from the primary hepatoblastoma of a 15-year-old Caucasian boy in Argentina in 1979. This cell line is epithelial-like; adherent and clustered growth; grows relatively fast, with a passage cycle of 1-2 days; low metastasis; poor tumorigenicity in nude mice; AFP positive; HBsAg negative. This cell line has a relatively high degree of differentiation, and the biological transfer characteristics of metabolic enzymes in the cells are relatively complete, without the need to add an exogenous activation system. It remains stable in drug action-related research and will not change due to an increase in the number of passages. The biotransformation metabolic enzymes contained are homologous to human normal liver parenchymal cells.

[0032] Hep3B: Human liver cancer cell line, which likes to grow in clusters and adherently; it can form tumors in nude mice but basically does not metastasize, HBV positive, and integrates the complete HBV genome.

[0033] HUH7: Human liver cancer cell line, AFP positive, highly differentiated, cells are epithelial-like, adherent growth, characterized by HBV negative and susceptibility to hepatitis C virus.

[0034] PLC: A human hepatocellular carcinoma cell line that grows adherently in an epithelial-like manner, is AFP-positive, does not produce albumin; secretes HBsAg of the ad subtype without producing HBcAg or HBeAg and Dane particles, but can maintain the replication of HAV; this cell may contain the entire HBV genome, and its isoenzyme pattern and karyotype are homologous to humans; xenotransplantation in nude mice can cause tumors.

[0035] SNU-449: A human hepatocellular carcinoma cell line that grows adherently.

[0036] Dane particle: The infectious complete virus particle of HBV, which can be found in the serum of hepatitis B-infected patients. It was discovered by Dane in 1970, so it is called Dane particle.

[0037] Co-immunoprecipitation assay: A classic method for studying protein-protein interactions based on the specific interaction between an antibody and an antigen, and it is an effective method for determining the physiological interaction between two proteins in intact cells. When cells are lysed under non-denaturing conditions, many protein-protein interactions existing in intact cells are retained. When the antibody of protein A pre-immobilized on agarose is used to immunoprecipitate protein A, then protein B that binds to protein A in vivo can also be precipitated together.

[0038] VSVG: A viral membrane protein that can be used to convert the DNA of an exogenous gene expression vector into an infectious virus particle. In the viral life cycle, VSVG plays a key role in viral replication.

[0039] Δ8.9: Also known as delta 8.9, it is a second-generation lentiviral packaging helper plasmid carrying viral gag, pol, rev, and tat genes. Together with VSVG, it constitutes a second-generation lentiviral packaging system for packaging second-generation or third-generation lentiviral vector plasmids. These three plasmids form a three-plasmid system (i.e., the second-generation lentiviral system). Transfecting these three plasmids into cells such as 293T together for packaging recombinant lentiviruses, and infecting target cells with this lentivirus can achieve gene knockout, knockdown, and overexpression, etc.

[0040] Beneficial effects

[0041] Based on previous research, the present invention proposes a research idea of repurposing old drugs, analyzes the substrate-binding region of FOXRED2, and conducts precise screening of known drugs. Through screening and verification, the inventors confirmed that compared with the prior art, the drug paritaprevir also exerts an anti-tumor effect in the treatment of hepatocellular carcinoma (HCC), and verified that FOXRED2 can be used as a new target for paritaprevir to exert its effect in liver cancer, revealing that in addition to the original indication of anti-hepatitis C, paritaprevir also has new targets and uses in tumors, that is, it can block the binding of FOXRED2 to substrates with a very strong affinity. When treated with paritaprevir, this drug can competitively bind more substrates, resulting in a decrease in the binding of FOXRED2 to substrates and preventing more substrates from binding to FOXRED2, thereby inhibiting the function of FOXRED2. Experiments such as cell proliferation demonstrated that paritaprevir inhibited the function of the FOXRED2 molecule. For example, FOXRED2 can promote cell proliferation, but after treatment with paritaprevir, cell proliferation slowed down, etc. The remaining experiments all confirmed that paritaprevir significantly inhibited the function of FOXRED2 and ultimately led to the entry of liver cancer cells into the apoptosis program, inhibiting the malignant progression of liver cancer (inhibiting the proliferation of liver cancer cells, promoting cell apoptosis, causing liver cancer cells to die, FOXRED2 plays a role in tumor growth in mice, and the drug inhibits the function of FOXRED2, thereby inhibiting the tumor growth in mice), providing a new research idea for the treatment of liver cancer. Brief Description of the Drawings

[0042] Figure 1 Shows the determination of the virtual screening system and FOXRED2 specific inhibitors. Among them, A shows the virtual drug screening process; B shows the determination results of FOXRED2 specific inhibitors. The first column in the figure is the EV+DMSO group, and the second column is the FOXRED2+DMSO group. DMSO is added to both groups, but the difference between the two columns is the addition of FOXRED2. After overexpressing FOXRED2, the reduction of disulfide bonds was significantly promoted, so the OD value increased. The statistical test method is T-test, n = 3, where * represents a significant difference P < 0.05; ** represents a significant difference P < 0.01; *** represents a significant difference P < 0.001.

[0043] Figure 2 Shows the determination results of the IC50 value of the drug paritaprevir in liver cancer cells.

[0044] Figure 3Shows the effects of paritaprevir on the proliferation of normal cells and liver cancer cells. Among them, A shows the effect of paritaprevir on normal cells; B shows the effect of paritaprevir on liver cancer cell line HepG2. The statistical test method is T-test, n = 3, where * represents significant difference P < 0.05; ** represents significant difference P < 0.01; *** represents significant difference P < 0.001.

[0045] Figure 4 Shows the results of cell proliferation detection of liver cancer cells with different FOXRED2 expression levels. Among them, A shows the results of immunoblotting experiments to detect the expression levels of FOXRED2 in different liver cancer cell lines; B shows the effects of paritaprevir on FOXRED2 low-expression cell lines SNU-449 and Hep3B; C shows the effects of paritaprevir on FOXRED2 high-expression cell lines PLC and HUH7. The statistical test method is T-test, n = 3, where * represents significant difference P < 0.05; ** represents significant difference P < 0.01; *** represents significant difference P < 0.001.

[0046] Figure 5 Shows the effects of paritaprevir on the protein function of FOXRED2. Among them, A shows the effects of paritaprevir drugs after overexpressing or knocking down FOXRED2; B shows the effects of paritaprevir drugs on the accumulation of misfolded proteins in the endoplasmic reticulum; C shows the effects of paritaprevir on cell apoptosis. NTC and EV in the figure are both controls. NTC is the control for the knockdown group. EV is the control for the overexpression group. NTC: non-target-control; EV: empty-vector. The statistical test method is T-test, n = 3, where * represents significant difference P < 0.05; ** represents significant difference P < 0.01; *** represents significant difference P < 0.001.

[0047] Figure 6The expression of FOXRED2 in different cancer types in the TCGA database and the relationship between FOXRED2 and the prognosis of liver cancer patients are shown. Among them, A shows the performance of the transcriptional level of FOXRED2 in multiple cancers, and the expression level of FOXRED2 is higher than that of the normal group in multiple cancer types. B shows the situation in the specific cancer type of liver cancer. The high expression of FOXRED2 is positively correlated with the prognosis of liver cancer patients. The higher the expression level of FOXRED2, the worse the prognosis of liver cancer patients. In the figure, BRCA represents breast cancer, DLBC represents diffuse large B-cell lymphoma, ESCA represents esophageal cancer, LIHC represents hepatocellular carcinoma, LUSC represents lung squamous cell carcinoma, PRAD represents prostate adenocarcinoma, SKCM represents cutaneous melanoma, STAD represents gastric adenocarcinoma, and THYM represents thymic tumor. Detailed implementation mode

[0048] To make the objectives, technical solutions, and advantages of the present invention clearer and more understandable, the following further elaborates on the present invention in detail with reference to specific embodiments and the accompanying drawings.

[0049] The cells used in the examples were purchased from the ATCC cell bank (HepG2, catalog number HB8065; Hep3B, catalog number HB8064; SNU-449, catalog number CRL-2234; PLC, catalog number CRL-8024)

[0050] Example 1 Virtual drug screening for small molecule inhibitors specifically targeting FOXRED2

[0051] 1. Through software simulation of the structure combined with a virtual drug screening platform, potential candidate substrates were determined, and finally, the most effective small molecule inhibitor was determined by combining FOXRED2 function detection experiments

[0052] Method: By using the RoseTTAFold software and Uni-deep to simulate the structural characteristics of the FOXRED2 protein, analyze the protein conformation of FOXRED2, and determine the region where NADH or FMN substrates bind. Based on the NADH substrate binding region of the FOXRED2 molecule, and based on the idea of repurposing old drugs, the present invention simulated inhibitors in the small molecule drug library approved by the FDA that can bind with high affinity to this NADH binding pocket, and screened out a list of potential candidate drugs through virtual screening and AutoDock VINA. The list is as follows:

[0053] Table 1 Inhibitors that bind with high affinity to the NADH binding pocket of the FOXRED2 molecule

[0054]

[0055] Further, based on the detection experiment of the disulfide bond reduction function of FOXRED2, the most effective small molecule inhibitor for FOXRED2 was determined. Specifically, a liver cancer cell line expressing the misfolded protein CD3δ was amplified and cultured. The specific steps are as follows: First, construct a plasmid expressing the CD3δ protein (forward amplification primer: 5’-atggaacatagcacgtttctc-3’ (SEQ ID NO:4); reverse primer: 5’-cttgttccgagcccagtttcc-3’ (SEQ ID NO:5)), amplify the CD3δ sequence (SEQ ID NO:1) by PCR. The amplified CD3δ fragment needs to be homologous recombined with the pSin-puro vector (Addgene). Subsequently, the recombinant reaction product is transformed into competent Escherichia coli cells. Finally, the bacterial solution is evenly spread on a plate containing ampicillin resistance by the plate coating method, and the possible positive colonies are sent to the company for sequencing. After the sequencing results are correctly aligned, it can be used for experiments. Then, this plasmid is transfected into 293T cells, and finally lentivirus is produced. The specific steps for producing the virus are as follows: Use the PEI transfection reagent (polysciences, catalog number 23966-1) for transfection. Prepare a plasmid mixture in advance: The mixing system is: 1.5 mL Opti-MEM (Giboco) + 12 μg of the target plasmid + 6 μg of Δ8.9 + 1.5 μg of VSVG + 60 μL of PEI (DNA:PEI = 1:3 (μg / μL)). After pipetting and mixing evenly, let it stand at room temperature for 15 minutes. The plasmid mixture needs to be gently added drop by drop into the culture dish. After gently swirling evenly, place it in a 37 °C cell culture incubator. After culturing for 6-8 hours, aspirate the medium containing PEI, and add 10 mL of fresh pre-warmed DMEM medium at 37 °C. Be careful not to blow up the 293T cells when adding, place it in the cell culture incubator, and continue culturing for 48 hours. Then collect the culture medium supernatant as lentivirus. This lentivirus carries the CD3δ protein. Then, the lentivirus is added to the liver cancer cell HepG2, and this cell is infected with the lentivirus. After successful infection, a cell line expressing the misfolded protein CD3δ is obtained. Subsequently, different candidate drugs are used for treatment, and an immunoprecipitation experiment is carried out to precipitate the misfolded protein. After lysing the cells, a protein sample is obtained. The protein sample is reacted with the chemical reaction reagent 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) to generate the product trinitroresorcinol (TNB). The reaction process requires the use of sulfhydryl groups. At the same time, the TNB reaction product has a significant absorption peak at the OD412 wavelength, which can indirectly reflect the content of sulfhydryl groups and also indirectly reflect the degree of disulfide bond reduction.Therefore, the absorbance at OD412 was detected to reflect the degree of reduction of misfolded proteins [6,7] (Jakob R Winther, Colin Thorpe.Quantification of thiols and disulfides.BiochimBiophys Acta.2014 Feb;1840(2):838-46; MachikoSakoh-Nakatogawa, et al.Roles ofProtein-disulfide Isomerase-mediated Disulfide Bond Formation of Yeast Mnl1pin Endoplasmic Reticulum-associated Degradation.J Biol Chem.2009 May 1;284(18):11815-25).

[0056] Results: Through Figure 1 The screening process of A identified a batch of drugs that may inhibit the function of FOXRED2. Subsequently, through experimental verification, it was finally determined that paritaprevir (0339) is the most effective small molecule inhibitor by the experimental method of detecting the reduction of disulfide bonds in misfolded proteins. This indicates that the screening process for repurposing old drugs is feasible, and we have identified FOXRED2 as a new potential target for paritaprevir in the treatment of tumors, broadening the treatment field of paritaprevir.

[0057] Table 2 Results of OD412 determination

[0058] Group OD412 EV + DMSO 0.385 FOXRED2 + DMSO 0.95 FOXRED2 + 0283 0.758 FOXRED2 + 0726 0.821 FOXRED2 + 0286 0.506 FOXRED2 + 0339 0.412 FOXRED2 + 1554 0.498 FOXRED2 + 5795 0.526

[0059] Figure 1 The specific experimental values of B are shown in Table 2. We can see that when treated with DMSO simultaneously, overexpression of FOXRED2 can significantly promote the reduction of disulfide bonds, and the thiol content increases significantly. It increases from 0.385 (EV + DMSO) to 0.95 (FOXRED2 + DMSO). The statistical significance level between the two groups is P < 0.01. At the same time, by comparing different groups overexpressing FOXRED2, it can be seen that the decrease in the FOXRED2 + 0339 group is the most obvious compared to the FOXRED2 + DMSO group, decreasing from 0.95 to 0.412. The statistical significance level between these two groups is P < 0.01, indicating that the 0339 drug can significantly inhibit the function of FOXRED2, and the 0339 drug is the most effective among these drugs.

[0060] Example 2: IC50 value of paritaprevir in liver cancer cells

[0061] 1. Determine the IC50 of the drug paritaprevir in liver cancer cells by cell viability assay, and calculate the new applicable concentration of the drug in liver cancer cells

[0062] Method: The day before, inoculate the liver cancer cells HepG2 into a 96-well cell culture plate. After the cells are plated for 12 hours, use the gradient dilution method to add different concentrations of the drug ranging from 200 nM to 25,000 nM for treatment. Reserve 1 column of cells as the drug-free control and 1 column of wells as the cell-free medium control. After 48 hours of drug treatment, add 10 μL of CCK8 reagent to each well, incubate in the 37 °C incubator in the dark for 1 - 4 hours, use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance at 450 nm to characterize the relative number of cells, and then perform IC50 curve fitting and calculation using software

[0063] Result: Through curve fitting and calculation, we learned that the IC50 value of paritaprevir in liver cancer cells is approximately 2.4 μM, and paritaprevir can be reasonably used for treatment according to this concentration in the future

[0064] Example 3: Paritaprevir inhibits the proliferation of liver cancer cells

[0065] 1. Detect cell proliferation in the liver cancer cell line HepG2 and the normal cell line THLE3, use the paritaprevir drug to conduct a cell proliferation experiment to detect the effect of the paritaprevir drug on normal cells and liver cancer cells, and confirm the effect of the paritaprevir drug on the liver cancer proliferation rate by cell counting method

[0066] Method: Normal cells THLE3 (purchased from ATCC cell bank) and HepG2 liver cancer cells were cultured separately. Both types of cells were seeded into 6-well plates for cell culture. After the cells adhered for 12 h, they were treated with DMSO and paritaprevir drug respectively. The cell plates were counted every other day. The cell counting steps were as follows: The original culture medium was aspirated with a vacuum pump, and 5 mL of pre-warmed PBS was added to wash the cells to completely remove the culture medium and serum in the cells. 1 mL of 0.25% trypsin was added for digestion. The culture dish was shaken to ensure that the trypsin and cells were in full contact. The culture dish was placed in the cell culture incubator, taken out after timing for 3 - 6 minutes, and the edge of the culture dish was gently tapped. It was observed that the cells shook and slipped. If not observed, it was placed in the incubator for continued digestion for about 1 minute. After complete digestion, an appropriate amount of culture medium was added to pipette the cells. The cell number was estimated, and a certain volume of cell suspension was taken accordingly and diluted with a certain amount of culture medium. The diluted cell suspension was mixed with trypan blue dye solution at a volume ratio of 1:1. Then, 10 μL of the mixed solution was taken with a pipette and dropped onto the cell counting plate. Subsequently, it was observed and counted under a microscope. The cells in the 4 large areas were added up and divided by 4, and then multiplied by the final dilution factor and 10 4 , and the number of cells per mL of culture medium could be obtained. After 7 days, the cell numbers obtained by counting were plotted into a cell proliferation curve to compare the cell proliferation changes between the control group and the drug treatment group.

[0067] Results: As Figure 3 shown, in the liver cancer cell line HepG2, the proliferation rate of liver cancer cells was inhibited by the paritaprevir drug. However, in normal cells THLE3, neither the control nor the drug treatment affected the proliferation rate of the cells. In the detection of the proliferation rate of normal cells THLE3, when the cells were cultured until the seventh day, it was found that the number of cells in the DMSO group (that is, the group without drug treatment) on the seventh day was about 150,000, and the number of cells in the drug treatment group on the seventh day was about 130,000. When the two were compared, there was no statistically significant difference, and the P value was greater than 0.05, indicating that the addition of the drug treatment did not affect the proliferation rate of THLE3 cells. However, we could see the proliferation change of HepG2 cells. On the seventh day, the number of cells in the DMSO group was more than 300,000, but the number of cells in the drug treatment group was about 100,000. There was a significant difference between the two, indicating that the drug paritaprevir significantly inhibited the proliferation of HepG2 cells.

[0068] Results analysis: The above cell experiments showed that the paritaprevir drug significantly inhibited the proliferation of liver cancer cells and had no inhibitory effect on normal cells.

[0069] Example 4 The inhibition of liver cancer cell proliferation by paritaprevir drug depends on FOXRED2

[0070] 1. Western blot was used to detect the expression of FOXRED2 in various cell lines, and then Paritaprevir was used to treat these liver cancer cell lines with high or low expression of FOXRED2 to perform cell proliferation experiments.

[0071] Methods: Different liver cancer cells HepG2, Hep3B, HUH7, SNU-449, and PLC were plated in cell culture dishes and then grown in a CO2 cell culture incubator. When the cell density was above 90%, the cells were harvested and the cells in all culture dishes were collected into centrifuge tubes. The steps for collecting cells were as follows: Wash the cells twice with 10 mL of pre-cooled PBS, pour 5 mL of pre-cooled PBS into the culture dish, harvest the cells with a cell scraper into a pre-cooled 15 mL centrifuge tube, and rinse the culture dish with 5 mL of pre-cooled PBS to collect the residual cells. The 15 mL centrifuge tube was placed in a 4 degree Celsius low-temperature centrifuge at 3000 rpm for 5 minutes. The supernatant was aspirated and centrifuged quickly for a short time, and then the supernatant was discarded. The sediment at the bottom of the centrifuge tube was the cells. Subsequently, the cells of each component were broken by cell lysis buffer, and the cell contents (including proteins) were integrated into the cell lysis buffer. The protein quantitative adjustment of the cell lysate was carried out under the same conditions. Finally, the samples of each component with uniform protein content were detected and analyzed by Western bolt. The specific steps were as follows: after separating the proteins by SDS-PAGE electrophoresis, the proteins were transferred to a nitrocellulose membrane and the proteins were blocked with skim milk; monoclonal antibodies (primary antibodies) specifically binding to the two proteins FOXRED2 and ACTIN (Anti-FOXRED2, purchased from Sigma, Catalog No. HPA031611; Anti-Actin, purchased from PTG, Catalog No. 66009-1-AP) were used to fully bind to them, and then a secondary antibody specifically binding to the primary antibody (the secondary antibody is Anti-rabbit, purchased from BIORAD, Catalog No. 170-6515) was used to bind to them, and then chemical development and fixation were performed; the images were scanned and analyzed.

[0072] Subsequently, according to the experimental method in Example 3, the drug paritaprevir was used to treat these different liver cancer cells, and a cell proliferation experiment was performed to detect changes in the number of cells.

[0073] Results: Figure 4 As shown, Figure 4In Figure A, the expression level of FOXRED2 in the liver cancer cell lines Hep3B and SNU-449 is relatively low, while the expression level of FOXRED2 in the cell lines HepG2, PLC, and HUH7 is significantly increased. However, after treatment with the drug paritaprevir, it was found that the cell proliferation of liver cancer cells with high expression of FOXRED2 was significantly inhibited, while the change in cell proliferation of the cell lines with low expression of FOXRED2 was not obvious after drug treatment.

[0074] Taking the low-expression SNU-449 as an example, from the proliferation experiment, it can be seen that when the cells were cultured until the seventh day, the number of cells in the DMSO group (i.e., the group without drug treatment) was about 160,000 on the seventh day, and the number of cells in the drug-treated group was about 140,000 on the seventh day. When comparing the two, there was no statistically significant difference, and the P value was greater than 0.05, indicating that drug treatment did not affect the proliferation rate of SNU-449 cells. The same was true for Hep3B.

[0075] However, this was not the case for cells with high expression of FOXRED2. In the cell proliferation experiment conducted on cells with high expression of FOXRED2, such as PLC, it can be seen that on the seventh day, the number of cells in the DMSO group was more than 250,000, while the number of cells in the drug-treated group was about 100,000. There was a significant difference when comparing the two, indicating that the drug paritaprevir significantly inhibited the proliferation of PLC cells. The same was true for HUH7.

[0076] Result analysis: The drug paritaprevir inhibits the proliferation of liver cancer cells by targeting the FOXRED2 molecule. The expression level of FOXRED2 can determine the sensitivity to the drug paritaprevir, and only patients with a high expression level of FOXRED2 may obtain good therapeutic effects from treatment with the drug paritaprevir.

[0077] Example 5 The drug paritaprevir inhibits the function of the FOXRED2 protein, thereby inhibiting tumor growth

[0078] 1. The cell proliferation experiment was used to detect the basic function of the drug paritaprevir in inhibiting the promotion of cell proliferation by FOXRED2. Further, the immunoblotting experiment was used to detect that the drug can inhibit the function of FOXRED2 in transporting misfolded proteins in the endoplasmic reticulum, thereby promoting apoptosis of tumor cells.

[0079] Method: Overexpress or knockdown the FOXRED2 molecule in HepG2 liver cancer cells. First, construct plasmids for overexpressing or knocking down FOXRED2. Subsequently, transfer the plasmids into 293T cells to produce lentiviruses. Finally, use the lentiviruses to infect liver cancer cells. The specific steps are as follows: 1. Construct plasmids. The plasmid for overexpressing FOXRED2 was constructed as follows. Amplify the cDNA sequence (SEQ ID NO: 2) of the FOXED2 CDS region from a liver cancer cell line by PCR (forward primer for amplification: 5’-ATGGGCCTCTCCGCTGCGGCC-3’ (SEQ ID NO: 6)); reverse primer: 5’-GAGCTCCTCTTTGTTGCTATC-3’ (SEQ ID NO: 7)). The amplified FOXRED2 fragment needs to be homologous recombined with the pSin-puro vector. Subsequently, transform the recombinant reaction product into competent Escherichia coli cells. Finally, evenly spread the bacterial solution on a plate containing ampicillin resistance by the plate coating method. Send the possible positive colonies to the company for sequencing. After the sequencing results are correctly aligned, it can be used for experiments. The plasmid for overexpressing BIP-Flag was constructed as follows: Amplify the cDNA sequence (SEQ ID: NO: 3) of the BIP CDS region from a liver cancer cell line by PCR (forward primer: 5’-ATGAAGCTCTCCCTGGTGGCC-3’ (SEQ ID NO: 8); reverse primer: 5’-GATACAGCAGAAAAAGATGAGTTGTAG-3’ (SEQ ID NO: 9)). The amplified BIP fragment is homologous recombined with the vector, and then perform the same steps as the above plasmid construction. The plasmid for knocking down FOXRED2 was constructed as follows. Design specific primers for the FOXRED2 sequence. The forward primer sequence of ShFOXRED2 is 5’-CCTCAGACTTAACTCGGGAAA-3’ (SEQ ID NO: 11), and the reverse primer sequence is 5’-TTTCCCGAGTTAAGTCTGAGG-3’ (SEQ ID NO: 12). Similar to the construction of the above overexpression plasmid, ligate the products amplified by the forward and reverse primers of shFOXRED2 with the pLKO-puro vector (Addgene), and then perform the same steps as above, transformation, plating, colony PCR, and send the positive colonies to the company for sequencing. 2. Produce lentiviruses, which will express FOXRED2 or shFOXRED2. The specific steps for producing viruses are as follows: Use the PEI transfection reagent for transfection. Prepare a plasmid mixture in advance: The mixing system is: 1.5 mL Opti-MEM (Giboco) + 12 μg target plasmid + 6 μg Δ8.9 + 1.5 μg VSVG + 60 μL PEI (DNA:PEI = 1:3 (μg / μL)). After pipetting and mixing evenly, let it stand at room temperature for 15 minutes.The plasmid mixture needs to be gently added dropwise to the culture dish. After gently shaking, put it in a 37-degree Celsius cell culture incubator. After culturing for 6-8 hours, remove the culture medium with PEI and add 10mL of fresh 37-degree Celsius preheated DMEM culture medium. Be careful not to blow up the 293T cells when adding, put it in a cell culture incubator, continue to culture for 48 hours, and then collect the culture supernatant as lentivirus. Finally, the produced lentivirus is used to infect the liver cancer cells HepG2, so that the liver cancer cells successfully express the knockdown or overexpression of FOXRED2 protein. Subsequently, the stably passaged knockdown or overexpression of FOXRED2 cell lines were inoculated into cell well plates, and the number of cells was counted by cell counting every other day. After 7 days, the experimental data of each experiment was plotted into a cell growth curve to compare the changes in the number of cells in the DMSO and drug treatment groups.

[0080] For the detection of the specific function of paritaprevir in inhibiting FOXRED2, the immunoprecipitation experimental steps are as follows:

[0081] 1. Prepare cells: Passage the liver cancer cells HepG2 at 90%-100% density, and plate the cells expressing the misexpressed protein CD3δ required for the experiment (first infect the liver cancer cells HepG2 with a lentivirus expressing CD3δ, and then infect the above cells with a lentivirus expressing FOXRED2 or BIP protein, and finally successfully construct liver cancer cells HepG2 that stably express CD3δ and FOXRED2 / shFOXRED2 and BIP proteins), ensuring that the cell density is at least 90% when the cells are harvested.

[0082] 2. Collect cells and lyse: Use a cell scraper to transfer cells from the culture dish to a centrifuge tube, then centrifuge at low temperature for 5 minutes, remove the supernatant from the centrifuge tube, resuspend the cell pellet with 1 ml PBS, blow off the cell clumps and centrifuge again for 5 minutes. Place the centrifuge tube on ice and use an appropriate volume of IP lysis buffer.

[0083] Table 3 IP Lysate

[0084]

[0085] 3. Resuspend the cell pellet, and then place the centrifuge tube in a 4°C turntable and slowly rotate for 2 hours to lyse. Then centrifuge at 13000×g for 10 minutes at low temperature, and the supernatant after centrifugation is used as the protein supernatant.

[0086] 4. Pre-cleaning: Transfer the protein supernatant after the above centrifugation to a new centrifuge tube, add 20 μL of pre-cleaned Protein A / G Beads to remove some non-specific binding, and then place the centrifuge tube in a 4°C turntable and rotate slowly for 2 hours.

[0087] 5. Quantification: Take out the pre-washed centrifuge tube and centrifuge at 1500×g for 2 min. The supernatant is used as the protein supernatant. Quantify the protein using the Bradford method to determine the protein concentration. Take an appropriate amount of protein as the Input group, prepare the protein sample, and store it frozen at -20°C in a metal bath. From the remaining protein, take the same amount of protein as the IP group and transfer it to a new centrifuge tube. Finally, make up the liquid in the IP group centrifuge tube to 1 mL and continue the IP experiment.

[0088] 6. Primary antibody incubation: Add an appropriate volume of Anti-Flag or Anti-IgG antibody according to the protein amount in the IP group (1 μL of Anti-Flag or Anti-IgG can be added for 1 mg of protein amount). Then place the centrifuge tube on a rotator at 4°C and rotate overnight.

[0089] 7. Enrichment of the target protein BIP: The next day, take out the centrifuge tube incubated with the antibody overnight, add 20 μL of pre-washed Protein A / G Beads, and then place it on a rotator at 4°C and rotate slowly for 2 hours. Since the Beads can specifically bind to the Anti-Flag or Anti-IgG antibody in the centrifuge tube, the target protein BIP is enriched on the Beads at the same time.

[0090] 8. Washing the Beads: After incubating the Beads for two hours, take out the centrifuge tube and centrifuge at 1500×g for 2 min to remove the supernatant. Then wash the Beads with IP buffer and place it on a rotator at 4°C and rotate slowly for 10 min. Repeat this step 3 - 5 times.

[0091] 9. Metal bath boiling of proteins: After the washing is completed, the supernatant is completely removed, 40 μL of IP lysis buffer and 10 μL of loading buffer (when preparing 50 mL of loading buffer, 5 g of SDS, 250 mg of bromophenol blue, 25 mL of glycerol, and 12.5 mM Tris-HCl need to be added) are added, and then it is boiled on a 100 °C metal bath for 10 min. The protein sample is stored frozen at -20 °C in a refrigerator. Verification is carried out through immunoprecipitation experiments and immunoblotting experiments. In the immunoprecipitation experiment, the BIP molecule expressed intracellularly is precipitated by the target primary antibody FLAG, and the amount of misfolded proteins bound to the BIP molecule is detected to indirectly reflect the amount of misfolded proteins accumulated in the endoplasmic reticulum. The immunoblotting experiment is to treat cells overexpressing FOXRED2 under conditions of endoplasmic reticulum stress with the paritaprevir drug and detect apoptosis. CHOP is a marker in the occurrence of apoptosis. The specific steps are as follows: After separating the protein samples of the immunoprecipitation and immunoblotting experiments by SDS-PAGE electrophoresis, the proteins are transferred to a nitrocellulose membrane, and the proteins are blocked with skim milk; after being fully combined with different monoclonal antibodies (primary antibodies) (Anti-FOXRED2, purchased from Sigma, catalog number HPA031611; Anti-CHOP purchased from Proteintech, catalog number 15204-1-AP), they are then combined with a secondary antibody (Anti-rabbit, purchased from BIORAD, catalog number 170-6515) that specifically binds to the primary antibody, and then chemical development and fixation are carried out; after scanning the pictures, they are analyzed.

[0092] Results: As Figure 5 shown, Figure 5 In Figure A, we can see that the paritaprevir drug inhibits cell proliferation by targeting FOXRED2. Overexpression of FOXRED2 can significantly promote cell proliferation, but after treatment with the paritaprevir drug, the cell proliferation rate is significantly slowed down, indicating that the drug inhibits the role of FOXRED2 in promoting the proliferation of liver cancer cells. In addition, Figure 5 in Figure B, it can be found that the function of FOXRED2 itself in promoting the transport of misfolded proteins is inhibited after treatment with the drug, and a large amount of misfolded proteins accumulate on the BIP molecule after drug treatment. In the experimental group co-expressing FOXRED2 and BIP, in the group without drug treatment (lane 4), only a small amount of misfolded proteins bind to the BIP molecule, and most of them are transported out of the endoplasmic reticulum and degraded. However, in the group with drug treatment added (lane 5), compared with the previous group (lane 4), approximately 90% of the misfolded proteins accumulate on the BIP molecule and are not transported out of the endoplasmic reticulum. This result indicates that the function of FOXRED2 in promoting the transport of misfolded proteins is significantly inhibited by the drug.Figure 5 The C results showed that overexpression of FOXRED2 could reduce the occurrence of apoptosis in liver cancer cells. However, after treatment with the drug paritaprevir on this basis, apoptosis increased significantly, and the expression of the pro-apoptotic molecule CHOP increased, indicating that the drug inhibited the function exerted by FOXRED2, thereby causing tumor cell death.

[0093] Result analysis: These data all suggest that the drug paritaprevir inhibits tumor growth by precisely targeting the function of FOXRED2 that promotes the development of liver cancer. It indicates the new target and new use of paritaprevir, providing new ideas for the treatment of clinical tumors.

[0094] Sequence

[0095] SEQ ID NO:1 CD3δ nucleotide sequence

[0096] atggaacatagcacgtttctctctggcctggtactggctacccttctctcgcaagtgagccccttcaagatacctatagaggaacttgaggacagagtgtttgtgaattgcaataccagcatcacatgggtagagggaacggtgggaacactgctctcagacattacaagactggacctgggaaaacgcatcctggacccacgaggaatatataggtgtaatgggacagatatatacaaggacaaagaatctaccgtgcaagttcattatcgaatgtgccagagctgtgtggagctggatccagccaccgtggctggcatcattgtcactgatgtcattgccactctgctccttgctttgggagtcttctgctttgctggacatgagactggaaggctgtctggggctgccgacacacaagctctgttgaggaatgaccaggtctatcagcccctccgagatcgagatgatgctcagtacagccaccttggaggaaactgggctcggaacaag

[0097] SEQ ID NO:2 FOXRED2 nucleotide sequence

[0098]

[0099] SEQ ID NO: 3 BIP nucleotide sequence

[0100]

[0101] Forward primer for amplifying CD3δ, SEQ ID NO:4

[0102] 5’-atggaacatagcacgtttctc-3’

[0103] Reverse primer for amplifying CD3δ, SEQ ID NO:5

[0104] 5’-cttgttccgagcccagtttcc-3’

[0105] Forward primer for amplifying FOXED2, SEQ ID NO:6

[0106] 5’-ATGGGCCTCTCCGCTGCGGCC-3’

[0107] Reverse primer for amplifying FOXED2, SEQ ID NO:7

[0108] 5’-GAGCTCCTCTTTGTTGCTATC-3’

[0109] Forward primer for amplifying BIP, SEQ ID NO:8

[0110] 5’-ATGAAGCTCTCCCTGGTGGCC-3’

[0111] Reverse primer for amplifying BIP, SEQ ID NO:9

[0112] 5’-GATACAGCAGAAAAAGATGAGTTGTAG-3’

[0113] Forward primer sequence of ShFOXRED2, SEQ ID NO:10

[0114] 5’-CCTCAGACTTAACTCGGGAAA-3’

[0115] Reverse primer sequence of ShFOXRED2, SEQ ID NO:11

[0116] 5’-TTTCCCGAGTTAAGTCTGAGG-3’

[0117] Amino acid sequence of Flag, SEQ ID NO:12

[0118] DYKDDDDK

[0119] References

[0120] [1] Gillian M Keating. Ombitasvir / Paritaprevir / Ritonavir: A Review in Chronic HCV Genotype 4 Infection. Drugs. 2016. Aug;76(12):1203-11.

[0121] [2] Emma D Deeks. Ombitasvir / Paritaprevir / Ritonavir Plus Dasabuvir: A Review in Chronic HCV Genotype 1 Infection. Drugs. 2015 Jun;75(9):1027-38.

[0122] [3] Eleni Gigi, Vasileios I Lagopoulos, Eleni Bekiari. Hepatocellular carcinoma occurrence in DAA-treated hepatitis C virus patients: Correlated or incidental? A brief review. World J Hepatol. 2018 Sep 27;10(9):595-602.

[0123] [4] Fred Poordad, et al. Ombitasvir / paritaprevir / ritonavir and dasabuvir with or without sofosbuvir for patients with hepatitis C virus genotype 1 infection who failed a prior course of direct-acting antiviral therapy. J Med Virol. 2019. Jul;91(7):1307-1312

[0124] [5] Jakob R Winther, Colin Thorpe. Quantification of thiols and disulfides. Biochim Biophys Acta. 2014 Feb;1840(2):838-46.

[0125] [6] Machiko Sakoh-Nakatogawa, et al. Roles of Protein-disulfide Isomerase-mediated Disulfide Bond Formation of Yeast Mnl1p in Endoplasmic Reticulum-associated Degradation. J Biol Chem. 2009 May 1; 284(18): 11815-25.

[0126] The specific embodiments described above further elaborate on the objectives, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A pharmaceutical composition for treating cancer, characterized in that, The pharmaceutical composition comprises an inhibitor that inhibits the expression of FOXRED2 protein.

2. The pharmaceutical composition according to claim 1, characterized in that, The inhibitor that inhibits the expression of FOXRED2 protein is siRNA.

3. The pharmaceutical composition according to claim 2, characterized in that, The inhibitor that inhibits the expression of FOXRED2 protein is an inhibitor targeting the substrate binding site of FOXRED2 protein.

4. The pharmaceutical composition according to claim 3, characterized in that, The inhibitor that inhibits the expression of FOXRED2 protein is Paritaprevir.

5. Use of Paritaprevir in the preparation of a medicament for treating cancer.

6. The pharmaceutical composition according to any one of claims 1 - 4 or the use according to claim 5, characterized in that, The cancer is a cancer with high expression of FOXRED2.

7. The pharmaceutical composition or use according to claim 6, characterized in that, The cancer is liver cancer, breast cancer, cervical cancer, esophageal cancer, lung cancer, prostate cancer, melanoma, gastric cancer, lymphoma or thymic carcinoma.

8. The pharmaceutical composition or use according to claim 7, characterized in that, The cancer is liver cancer.

9. The pharmaceutical composition or use according to claim 8, characterized in that, The liver cancer is HepG2, PLC or HUH7 cell line.

10. The use according to any one of claims 5 - 9, characterized in that, Paritaprevir promotes apoptosis of cancer cells.

Citation Information

Cited By

  • Application of paridegravir in preparation of medicine for treating osteosarcoma

    CN122229846A

  • Application of paliprevir in the preparation of drugs for the treatment of osteosarcoma

    CN122229846B