Polynucleotide libraries having controlled stoichiometry and synthesis thereof

Abstract

To provide polynucleotide libraries having controlled stoichiometry and synthesis methods thereof.SOLUTION: Provided herein are compositions, methods and systems relating to libraries of polynucleotides having preselected stoichiometry with regard to species of polynucleotides such that the libraries allow for predetermined application outcomes, e.g., controlled representation after amplification and uniform enrichment after binding to target sequences. Further provided herein are polynucleotide probes and applications thereof for uniform and accurate next generation sequencing.SELECTED DRAWING: Figure 1A

Description

[Technical field]

[0001] <Cross reference> This application claims the benefit of U.S. Provisional Patent Application No. 62 / 424,302, filed November 18, 2016, U.S. Provisional Patent Application No. 62 / 548,307, filed August 21, 2017, and U.S. Provisional Patent Application No. 62 / 558,666, filed September 14, 2017, each of which is incorporated by reference in its entirety herein.

[0002] <Sequence Listing> This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on November 13, 2017, has the file name 44854-730_601_SL.txt and is 5,304 bytes in size. [Background technology]

[0003] Highly efficient chemical gene synthesis with high fidelity and low cost has a central role in biotechnology and medicine, and in basic biological research. De novo gene synthesis is a powerful tool for basic biological research and biotechnological applications. Although various methods are known for the synthesis of relatively short fragments on a small scale, these techniques often suffer from problems in terms of scalability, automation, speed, accuracy, and cost.

[0004] <Incorporation by reference> All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Summary of the Invention

[0005] Provided herein is a polynucleotide library comprising at least 5000 polynucleotides, each of which is present in an amount such that following hybridization with a genomic fragment and sequencing of the hybridized genomic fragment, the polynucleotide library provides at least 30-fold read depth of at least 90 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment. Provided herein is a polynucleotide library providing at least 30-fold read depth of at least 95 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment. Provided herein is a polynucleotide library providing at least 30-fold read depth of at least 98 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment. Provided herein is a polynucleotide library providing at least 90 percent unique reads for the bases of the genomic fragment. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 95 percent unique reads for the bases of the genomic fragments. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 90 percent of the bases of the genomic fragments with a read depth within about 1.5 times the average read depth. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 95 percent of the bases of the genomic fragments with a read depth within about 1.5 times the average read depth.Further provided herein is a polynucleotide library, the polynucleotide library providing at least 90 percent of genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth. Further provided herein is a polynucleotide library, the polynucleotide library providing at least about 80 percent of genomic fragments having a repeat or secondary structure sequence percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth. Further provided herein is a polynucleotide library, the genomic fragments each being about 100 bases to about 500 bases in length. Further provided herein is a polynucleotide library, the polynucleotide library providing at least about 80 percent of the at least 5000 polynucleotides represented in an amount within at least about 1.5 times the average representation for the polynucleotide library. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 30 percent of the at least 5000 polynucleotides comprising polynucleotides having a GC percentage of 10 to 30 percent or 70 to 90 percent. Further provided herein is a polynucleotide library, wherein at least about 15 percent of the at least 5000 polynucleotides comprise polynucleotides having a percentage of repetitive or secondary structure sequences between 10 percent and 30 percent, or between 70 percent and 90 percent. Further provided herein is a polynucleotide library, wherein the at least 5000 polynucleotides encode at least 1000 genes. Further provided herein is a polynucleotide library, wherein the polynucleotide library comprises at least 100,000 polynucleotides. Further provided herein is a polynucleotide library, wherein the polynucleotide library comprises at least 700,000 polynucleotides.Further provided herein is a polynucleotide library, wherein the at least 5000 polynucleotides comprise at least one exon sequence. Further provided herein is a polynucleotide library, wherein the at least 700,000 polynucleotides comprise at least one set of polynucleotides that collectively comprise a single exon sequence. Further provided herein is a polynucleotide library, wherein the at least 700,000 polynucleotides comprise at least 150,000 sets.

[0006] Provided herein is a polynucleotide library, the polynucleotide library comprising at least 5000 polynucleotides, each of the polynucleotides being about 20 to 200 bases in length, the plurality of polynucleotides encoding sequences from each exon for at least 1000 preselected genes, each polynucleotide comprising a molecular tag, each of the at least 5000 polynucleotides being present in an amount such that following hybridization with the genomic fragments and sequencing of the hybridized genomic fragments, the polynucleotide library provides at least 30-fold read depth of at least 90 percent of the bases of the genomic fragments under conditions for a maximum theoretical read depth of 55-fold for the bases of the genomic fragments. Also provided herein is a polynucleotide library, the polynucleotide library provides at least 30-fold read depth of at least 95 percent of the bases of the genomic fragments under conditions for a maximum theoretical read depth of 55-fold for the bases of the genomic fragments. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 30-fold read depth for at least 98 percent of the bases of the genomic fragments under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragments. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 90 percent unique reads for the bases of the genomic fragments. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 95 percent unique reads for the bases of the genomic fragments. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 90 percent of the bases of the genomic fragments having a read depth within about 1.5-fold of the average read depth. Further provided herein is a polynucleotide library, the polynucleotide library providing at least 95 percent of the bases of the genomic fragments having a read depth within about 1.5-fold of the average read depth.Further provided herein is a polynucleotide library, the polynucleotide library providing more than 90 percent of genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times of the average read depth. Further provided herein is a polynucleotide library, the polynucleotide library providing more than about 80 percent of genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times of the average read depth. Further provided herein is a polynucleotide library, the genomic fragments each having a length of about 100 bases to about 500 bases. Further provided herein is a polynucleotide library, the polynucleotide library providing more than about 80 percent of the at least 5000 polynucleotides are represented in an amount within at least about 1.5 times of the average representation for the polynucleotide library. Further provided herein is a polynucleotide library, the polynucleotide library providing more than 30 percent of the at least 5000 polynucleotides include polynucleotides having a GC percentage of 10 to 30 percent or 70 to 90 percent. Further provided herein is a polynucleotide library, wherein more than 15 percent of the at least 5000 polynucleotides comprise polynucleotides having a percentage of repetitive or secondary structure sequences between 10 percent and 30 percent, or between 70 percent and 90 percent. Further provided herein is a polynucleotide library, wherein the polynucleotide library comprises at least 100,000 polynucleotides. Further provided herein is a polynucleotide library, wherein the polynucleotide library comprises at least 700,000 polynucleotides. Further provided herein is a polynucleotide library, wherein the at least 700,000 polynucleotides comprise at least one set of polynucleotides that collectively comprise a single exon sequence.Further provided herein is a polynucleotide library, wherein the at least 700,000 polynucleotides comprise at least 150,000 sets.

[0007] Provided herein is a method for generating a polynucleotide library, the method comprising: providing a predetermined sequence encoding at least 5000 polynucleotides; synthesizing at least 5000 polynucleotides; and amplifying at least 5000 polynucleotides with a polymerase to form a polynucleotide library, wherein more than about 80 percent of the at least 5000 polynucleotides are represented in abundance within at least about 2-fold of the average representation for the polynucleotide library. Further provided herein is a method, wherein more than about 80 percent of the at least 5000 polynucleotides are represented in abundance within at least about 1.5-fold of the average representation for the polynucleotide library. Further provided herein is a method, wherein more than 30 percent of the at least 5000 polynucleotides include polynucleotides having a GC ratio of 10 to 30 percent or 70 to 90 percent. Further provided herein is a method, wherein more than 15 percent of the at least 5000 polynucleotides include polynucleotides having a repeat sequence or secondary structure sequence ratio of 10 to 30 percent or 70 to 90 percent. Further provided herein is a method, wherein the polynucleotide library has a total error rate of less than 1 in 800 bases compared to a predetermined sequence without error correction. Further provided herein is a method, wherein the predetermined sequence encodes at least 700,000 polynucleotides. Further provided herein is a method, wherein the synthesis of at least 5000 polynucleotides is performed in a structure having a surface, the surface comprising a plurality of clusters. Each cluster comprises a plurality of loci, and each of the at least 5000 polynucleotides extends from a different locus of the plurality of loci. Further provided herein is a method, wherein the plurality of loci comprises up to 1000 loci per cluster. Further provided herein is a method, wherein the plurality of loci comprises up to 200 loci per cluster.

[0008] Provided herein is a method for amplifying a polynucleotide library, the method comprising: obtaining an amplification distribution for at least 5000 polynucleotides; clustering the at least 5000 polynucleotides of the amplification distribution into two or more bins based on at least one sequence feature, the sequence feature being percent GC content, percent repetitive sequence content, or percent secondary structure content; matching the relative frequency of the polynucleotides in at least one bin to generate a polynucleotide library with a preselected representation; synthesizing a polynucleotide library with a preselected representation; and amplifying the polynucleotide library with a preselected representation. Further provided herein is a method, in which at least one sequence feature is percent GC content. Further provided herein is a method, in which at least one sequence feature is percent secondary structure content. Further provided herein is a method, in which at least one sequence feature is percent repetitive sequence content. Further provided herein is a method, in which the repetitive sequence content comprises a sequence with three or more adenines. Further provided herein is a method, in which the repetitive sequence content comprises a repetitive sequence at at least one end of the polynucleotide. In the method provided herein further, the polynucleotides are clustered into bins based on the affinity of one or more polynucleotide sequences to bind target sequences.In the method provided herein further, the number of sequences in the bottom 30 percent of a bin has at least 50% more representation in downstream applications after adjustment compared to the number of sequences in the bottom 30 percent of a bin before adjustment.In the method provided herein further, the number of sequences in the top 30 percent of a bin has at least 50% more representation in downstream applications after adjustment compared to the number of sequences in the top 30 percent of a bin before adjustment.

[0009] Provided herein is a method for sequencing genomic DNA, the method comprising: contacting a plurality of genomic fragments with any of the polynucleotide libraries described herein; enriching at least one genomic fragment that binds to the library to generate at least one enriched target polynucleotide; and sequencing the at least one enriched target polynucleotide. Further provided herein is a method, the plurality of enriched target polynucleotides comprises a cDNA library. Further provided herein is a method, the at least 5000 polynucleotides are about 80 to about 200 bases in length. Further provided herein is a method, each of the genomic fragments is about 100 bases to about 500 bases in length. Further provided herein is a method, the contacting is performed in solution. Further provided herein is a method, the at least 5000 polynucleotides are at least partially complementary to the genomic fragments. In further provided herein, the method of isolating comprises (i) capturing the hybridization pairs of polynucleotide / genomic fragment on a solid support; and (ii) releasing the plurality of genomic fragments to generate enriched target polynucleotides. In further provided herein, the method of sequencing results in at least 30-fold read depth of at least 95 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment. In further provided herein, the method of sequencing results in at least 30-fold read depth of at least 98 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment. In further provided herein, the method of sequencing results in at least 90 percent unique reads for the bases of the genomic fragment. In further provided herein, the method of sequencing results in at least 95 percent unique reads for the bases of the genomic fragment.Further provided herein is a method, wherein the sequencing results in at least 90 percent of the bases of the genomic fragments having a read depth within about 1.5 times the average read depth. Further provided herein is a method, wherein the sequencing results in at least 95 percent of the bases of the genomic fragments having a read depth within about 1.5 times the average read depth. Further provided herein is a method, wherein the sequencing results in at least 90 percent of the genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent having a read depth within about 1.5 times the average read depth. Further provided herein is a method, wherein the sequencing results in at least about 80 percent of the genomic fragments having a repeat or secondary structure percentage of 10 to 30 percent or 70 to 90 percent having a read depth within about 1.5 times the average read depth. Further provided herein is a method, wherein at least about 80 percent of the at least 5000 polynucleotides are represented in an amount within at least about 1.5 times the average representation for the polynucleotide library. Further provided herein are methods, wherein at least 30 percent of the at least 5000 polynucleotides comprise polynucleotides having a GC percentage of 10 to 30 percent or 70 to 90 percent. Further provided herein are methods, wherein at least 15 percent of the at least 5000 polynucleotides comprise polynucleotides having a repeat or secondary structure percentage of 10 to 30 percent or 70 to 90 percent. Further provided herein are methods, wherein the at least 5000 polynucleotides encode at least 1000 genes. Further provided herein are methods, wherein the polynucleotide library comprises at least 100,000 polynucleotides. Further provided herein are methods, wherein the polynucleotide library comprises at least 700,000 polynucleotides.Further provided herein are methods, wherein the at least 5000 polynucleotides comprise at least one exon sequence. Further provided herein are methods, wherein the at least 700,000 polynucleotides comprise at least one set of polynucleotides that collectively comprise a single exon sequence. Further provided herein are methods, wherein the at least 700,000 polynucleotides comprise at least 150,000 sets. [Brief description of the drawings]

[0010] [Figure 1A] A schematic workflow is shown, including application of an initial polynucleotide library, measuring bias from the application output, designing and synthesizing a second controlled stoichiometry polynucleotide library, and applying the second polynucleotide library to generate a desired display output. [Figure 1B] 1 shows a schematic for enriching target polynucleotides in a target-binding polynucleotide library. [Figure 1C] A typical workflow for enriching and sequencing nucleic acid samples is depicted. [Diagram 2] 1 depicts a schematic of the generation of a polynucleotide library from cluster amplification. [Figure 3A] Represents a pair of polynucleotides for targeting and enrichment. The polynucleotides include complementary target binding (insertion) sequences and a primer binding site. [Figure 3B] Represents a pair of polynucleotides for targeting and enrichment. The polynucleotides include a complementary target sequence binding (insertion) sequence, a primer binding site, and a non-target sequence. [Figure 4A] Refers to a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the target sequence is shorter than the polynucleotide binding region, and the polynucleotide binding region (or insert sequence) is offset relative to the target sequence and further binds to a portion of an adjacent sequence. [Figure 4B]Represents a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the length of the target sequence is equal to or less than the polynucleotide binding region, and the polynucleotide binding region is centered on the target sequence and further binds to a portion of an adjacent sequence. [Figure 4C] Represents a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the target sequence is slightly longer than the polynucleotide binding region, and the polynucleotide binding region is centered over the target sequence with buffer regions on each side. [Figure 4D] Describes a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the target sequence is longer than the polynucleotide binding region, and the binding regions of the two polynucleotides overlap to span the target sequence. [Figure 4E] Describes a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the target sequence is longer than the polynucleotide binding region, and the binding regions of the two polynucleotides overlap to span the target sequence. [Figure 4F] This represents a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the target sequence is longer than the polynucleotide binding regions, and the binding regions of the two polynucleotides do not overlap to span the target sequence, leaving a gap (405). [Figure 4G] Represents a form of polynucleotide binding to a target sequence of a larger polynucleotide, where the target sequence is longer than the polynucleotide binding region, and the binding regions of the three polynucleotides overlap to span the target sequence. [Diagram 5] FIG. 1 shows a process diagram demonstrating a typical processing workflow for gene synthesis as disclosed herein. [Figure 6] 1 illustrates an example computer system. [Figure 7] FIG. 1 is a block diagram illustrating the architecture of a computer system. [Figure 8]1 is a diagram illustrating a network configured to incorporate multiple computer systems, multiple mobile phones and personal digital assistants, and network attached storage (NAS). [Figure 9] FIG. 1 is a block diagram of a multi-processor computer system that uses a shared virtual address memory capacity. [Figure 10] Image of a plate with 256 clusters, each cluster having 121 loci from which polynucleotides extend. [Figure 11A] Plot of polynucleotide representation across the plate (polynucleotide frequency vs. abundance, e.g., measured absorbance) from the synthesis of 29,040 unique polynucleotides from 240 clusters, each cluster having 121 polynucleotides. [Figure 11B] Plot of polynucleotide frequency versus abundance absorbance (measured absorbance) measurements across each individual cluster, with control clusters identified by boxes. [Figure 12] A plot of polynucleotide frequency versus abundance (measured absorbance) measurements across four distinct clusters. [Figure 13A] Plot of frequency versus error rate across the plate from the synthesis of 29,040 unique polynucleotides from 240 clusters, each cluster having 121 polynucleotides. [Figure 13B] A plot of polynucleotide error rate versus frequency measurements across each individual cluster, with control clusters identified by boxes. [Figure 14] A plot of polynucleotide frequency versus error rate measurements across the four clusters. [Figure 15] A plot of the number of polynucleotides versus GC content as a percent measure per polynucleotide. [Figure 16]Results from PCR with two different polymerases are provided. Each chart represents the number of polynucleotides (0-2,000) versus the observed frequency (measured in numbers per 100,000, from 0-35). [Figure 17] 1 provides a chart with quantification of the homogeneity of the recorded amplified polynucleotide populations. [Figure 18] 1 depicts a plot demonstrating the effect of overamplification on sequence dropout. [Figure 19] 1 depicts a plot of the percentage of GC content (per 100,000 reads) per polynucleotide frequency in unamplified and amplified populations of polynucleotides. [Figure 20] A plot of the percentage of GC content (per 100,000 reads) per polynucleotide frequency for two separate runs after cluster amplification. [Figure 21A] 1 is a plot of the percentage of GC content per polynucleotide frequency for a GC-balanced library of polynucleotides. [Figure 21B] 1 is a plot of the percentage of GC content per polynucleotide frequency for extremely high and low GC bias libraries of polynucleotides. [Figure 21C] 1 is a plot of the percentage of GC content per polynucleotide frequency for moderately high and low GC biased libraries of polynucleotides. [Figure 21D] 1 is a plot of the percentage of GC content per polynucleotide frequency for a low GC biased library of polynucleotides. [Figure 21E] 1 is a plot of the percentage of GC content per polynucleotide frequency for a high GC-biased library of polynucleotides. [Figure 22] FIG. 1 is a plot of the percentage of GC content per polynucleotide frequency for a theoretical 13,000plex polynucleotide library with sequences containing 15% to 85% GC content. [Diagram 23]1 is a plot of polynucleotide number versus polynucleotide frequency (per 100,000 reads) for a GC-balanced polynucleotide library. [Figure 24A] 1 is a plot showing the amount of sampling required to obtain 80% sequencing coverage for a GC balanced polynucleotide library compared to the theoretical maximum for a monodisperse library. [Figure 24B] 1 is a plot showing the amount of sampling required to obtain 90% sequencing coverage for a GC balanced polynucleotide library compared to the theoretical maximum for a monodisperse library. [Diagram 25] 1 is a plot of polynucleotide number versus polynucleotide frequency (number per 1,000,000 reads) for a library containing polynucleotides 80 nucleotides in length. [Figure 26] A plot of polynucleotide number versus polynucleotide frequency (number per 1,000,000 reads) for a library containing polynucleotides 120 nucleotides in length. [Figure 27] 1 is a plot showing the average frequency of polynucleotides (per 1,000,000 reads) for both GC balanced polynucleotide libraries of 80 and 120 nucleotides in length. [Figure 28] 1 depicts plots showing the effect of PCR amplification cycle number, GC content, and choice of DNA polymerase on polynucleotide sequence representation. [Figure 29] 1 is a plot of sequence dropout as a function of amplification cycles for two different high-fidelity polymerases. [Diagram 30] 1 depicts a plot showing the effect of different DNA polymerases on sequence display. The same polynucleotide library was amplified for 15 cycles using DNA polymerase 1 or DNA polymerase 2. [Figure 31A]Represents the amount of sequencing required to achieve any read depth for a target sequence using an exome probe library without controlled stoichiometry. [Figure 31B] 1 shows the sequence-wide reduction required to achieve a given read depth for a target sequence using an exome probe library with controlled stoichiometry compared to an exome probe library without controlled stoichiometry. [Figure 32A] FIG. 13 is a plot of the percentage of bases with 1x, 20x or 30x sequencing read depth (X coverage) for both comparator exome probe kit A and controlled stoichiometry probe library 1. [Figure 32B] A plot of the percentage of bases with 1x or 10x sequencing read depth (X coverage), normalized over 4.5 Gb of sequencing, for the Comparator Exome Probe Kit and the Controlled Stoichiometry Probe Library 1 panel. [Diagram 33] 1 depicts different scales of synthesis of polynucleotide probe libraries as a function of the number of polynucleotides in the library. [Diagram 34] 13 depicts a comparison of coverage (number of bases) as a function of read depth for the comparator array-based probe library versus the controlled stoichiometry probe library 2. [Figure 35A] 1 shows a comparison between coverage as a function of read depth for the Comparator Array-based probe library versus the controlled stoichiometry probe library 2 for targets with GC content of 10-30% and 30-50%. [Figure 35B] 1 shows a comparison between coverage as a function of read depth for the Comparator Array-based Probe Library vs. Controlled Stoichiometry Probe Library 2 for targets with GC content greater than 50-70% and greater than 30-50%. [Figure 36A]1 shows a comparison between percent (%) of target ratio of comparator array-based probe library and 0.1x, 1x, and 3x concentrations of controlled stoichiometry probe library 3. [Figure 36B] A comparison between the read depth of the comparator array-based probe library and 0.1x, 1x, and 3x concentrations of the controlled stoichiometry probe library 4 is shown. [Figure 37] A comparison between the percentage of unique reads and target bases at 1×, 20×, and 30× read depths for the comparator exome kit versus the controlled stoichiometry probe library 4 is shown. [Figure 38] A comparison between the percentage of bases covered and targeted bases at 1X, 20X, and 30X read depths for the comparator exome kit versus the controlled stoichiometry probe library 4 is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The present disclosure employs, unless otherwise indicated, conventional molecular biology techniques that are within the skill of the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0012] Provided herein is a method for designing, synthesizing and controlling the stoichiometry of a large polynucleotide library. When a first population of polynucleotides is subjected to a preliminary application step, e.g., for amplification, and gene synthesis, as a complementary probe for enrichment, the subsequent amplification reaction of the population of polynucleotides may result in a biased representation output due to mutations in the polynucleotide sequence, with certain polynucleotides being more abundantly represented than others. Figure 11A. The resulting bias observed from this preliminary application output is measured and used to control the first population of polynucleotides with a preselected stoichiometry, e.g., the relative frequency of the polynucleotides in the population, taking into account any number of sequence features, such as GC content, repeat sequences, trailing adenines, secondary structure, affinity to target sequence binding, or modified nucleotides. After modifying the stoichiometry of the polynucleotides, a second population of polynucleotides is designed and synthesized with a preselected stoichiometry to correct the undesired bias effect associated with the application step. In some examples, subjecting the second controlled stoichiometric population of polynucleotides to an application step, such as PCR amplification, results in a balanced output, such as an amplified polynucleotide population with highly uniform representation, or a heterogeneous representation with a preselected transition in representation, etc. See the bottom chart of FIG. 1A. In some examples, the methods described herein include controlling the sequence representation of the polynucleotide probes such that the polynucleotide population provides a highly uniform target sequence capture frequency (FIG. 1B). For example, a sample of polynucleotides (100) includes a target polynucleotide (101). Contacting the sample (100) with a target binding polynucleotide (103) under appropriate conditions (102) results in the formation of a hybridization pair (104), which is separated from non-target polynucleotides in the sample (100). Denaturation and separation of the pair (104) releases enriched target polynucleotides (107) for downstream applications, such as sequencing.Further provided herein are de novo synthesized polynucleotides used in hybridization to genomic DNA as examples in the context of a sequencing process. In the first step of a typical sequencing workflow (FIG. 1C), a nucleic acid sample (108) containing a target polynucleotide is fragmented by mechanical or enzymatic cleavage to form a library of fragments (109). Adapters (115), optionally including primer sequences and / or barcodes, are attached to form an adapter-labeled library (110). This library is then optionally amplified and hybridized to a target-binding polynucleotide (117) that hybridizes to the target polynucleotide, along with a blocking polynucleotide (116) that prevents hybridization of the target-binding polynucleotide (117) to the adapter (115). Capture of the target polynucleotide-target binding polynucleotide hybridization pair (112) and removal of the target binding polynucleotide (117) allows for the isolation / enrichment of the target polynucleotide (113), which is then optionally amplified and sequenced (114).

[0013] definition

[0014] Throughout this disclosure, numerical characteristics are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity, and should not be construed as an inflexible limitation on the scope of the embodiments. Thus, the description of a range should be considered to specifically disclose all possible subranges, together with each individual numerical value within the range to one tenth of the unit of the lower limit, unless the context clearly dictates otherwise. For example, the description of a range such as 1 to 6 should be considered to specifically disclose each individual value within that range, such as 1.1, 2, 2.3, 5, and 5.9, together with subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may be independently included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limits in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.

[0015] The terms used herein are for the purpose of describing only certain embodiments and are not intended to limit the embodiments. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise. It is further understood that the terms "comprise" and / or "comprising", as used herein, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0016] Unless specifically stated or clear from the context, as used herein, the term "about" with respect to a number or range of numbers is understood to mean + / - 10% of the stated number, or 10% below the stated lower limit and 10% above the stated upper limit of the value stated in the range.

[0017] As used herein, the terms "preselected sequence," "predefined sequence," or "predetermined sequence" are used interchangeably. The terms mean that the sequence of the polymer is known and selected prior to the synthesis or assembly of the polymer. In particular, the various aspects of the invention are described herein primarily in connection with the preparation of nucleic acid molecules, and the sequence of the oligonucleotides or polynucleotides is known and selected prior to the synthesis or assembly of the nucleic acid molecules.

[0018] The term "nucleic acid" encompasses double-stranded or triple-stranded nucleic acids, as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the strands of the nucleic acid need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid sequences, when provided, are written in the 5' to 3' direction unless otherwise indicated. The methods described herein provide for the production of isolated nucleic acids. The methods described herein additionally provide for the production of isolated and purified nucleic acids. When provided, the length of a polynucleotide is given in number of bases, and is abbreviated as nt (nucleotides), bp (bases), kb (kilobases), or Gb (gigabases), etc.

[0019] Provided herein are methods and compositions for the generation of synthetic (i.e., de novo synthesized or chemically synthesized) polynucleotides. The terms oligonucleic acid, oligonucleotide, oligo, and polynucleotide are defined as synonymous throughout. The synthetic polynucleotide libraries described herein can include a plurality of polynucleotides that collectively encode one or more genes or gene fragments. In some examples, the polynucleotide libraries include coding or non-coding sequences. In some examples, the polynucleotide libraries encode a plurality of cDNA sequences. The reference gene sequence on which the cDNA sequences are based may include introns, but the cDNA sequences exclude introns. The polynucleotides described herein can encode genes or gene fragments from organisms. Exemplary organisms include, but are not limited to, prokaryotes (e.g., bacteria) and eukaryotes (e.g., mice, rabbits, humans, and non-human primates). In some examples, the polynucleotide libraries include one or more polynucleotides, each of which encodes sequences for a number of exons. Each polynucleotide in the library described herein may code for a different sequence, i.e., a non-identical sequence.In some examples, each polynucleotide in the library described herein comprises at least one portion that is complementary to the sequence of another polynucleotide in the library.The polynucleotide sequences described herein may comprise DNA or RNA, unless otherwise specified.The polynucleotide library described herein may comprise at least 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 30,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, or more than 1,000,000 polynucleotides.The polynucleotide libraries described herein may have 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 30,000, 50,000, 100,000, 200,000, 500,000, or 1,000,000 polynucleotides. The polynucleotide libraries described herein may include 10-500, 20-1000, 50-2000, 100-5000, 500-10,000, 1,000-5,000, 10,000-50,000, 100,000-500,000, or 50,000-1,000,000 polynucleotides. The polynucleotide libraries described herein can contain about 370,000; 400,000; 500,000, or more different polynucleotides.

[0020] Provided herein are methods and compositions for synthetic (i.e., de novo synthesized) genes. Libraries containing synthetic genes may be constructed by a variety of methods, such as PCA / non-PCA gene assembly methods or hierarchical gene assembly methods, described in more detail elsewhere herein, in which two or more double-stranded polynucleotides are combined (stitched together) to generate larger DNA units (i.e., chassis). Libraries of large constructs may include polynucleotides at least 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 400, 500 kb in length, or longer. Large constructs may be limited by independently selected upper limits of about 5000, 10000, 20000, or 50000 base pairs. Synthesis of any number of polypeptide segments encoding nucleotide sequences, including sequences encoding nonribosomal peptides (NRPs), sequences encoding nonribosomal peptide synthetase (NRPS) modules, and synthetic variants, polypeptide segments of other regulatory proteins such as antibodies, polypeptide segments from other protein families that contain non-coding DNA or RNA, such as regulatory sequences, e.g., promoters, transcription factors, enhancers, siRNAs, shRNAs, RNAi, miRNAs, small nucleolar RNAs derived from microRNAs, or functional or structural DNA or RNA units of interest.The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, intergenic DNA, loci defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, siRNA (short interfering RNA), small hairpin RNA (shRNA), microRNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA), which is the DNA representation of messenger RNA (mRNA), usually obtained by reverse transcription or amplification of mRNA; DNA molecules produced by synthesis or amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. The cDNA encoding the gene or gene fragment referred to herein may include at least one region encoding an exon sequence without the intervening intron sequence found in the corresponding genomic sequence. Alternatively, the genomic sequence corresponding to the cDNA may lack intron sequence in the first place.

[0021] De novo synthesis of small polynucleotide populations for amplification reactions.

[0022] Methods for the synthesis of polynucleotides from a surface, e.g., a plate, are described herein. In some examples, polynucleotides are synthesized on clusters of loci for polynucleotide extension, released, and then subjected to an amplification reaction, e.g., PCR. A typical workflow for the synthesis of polynucleotides from clusters is shown in FIG. 2. A silicon plate (201) contains a number of clusters (203). Within each cluster are a number of loci (221). Polynucleotides are de novo synthesized (207) on the plate (201) from the clusters (203). The polynucleotides are cleaved (211) and removed (213) from the plate to form a population of released polynucleotides (215). The population of released polynucleotides (215) is then amplified (217) to form a library of amplified polynucleotides (219).

[0023] In the methods provided herein, the synthesis of polynucleotides amplified on clusters provides improved control over polynucleotide expression, compared to the amplification of polynucleotides over the entire surface of structures without such cluster structure.In some examples, the amplification of polynucleotides synthesized from the cluster structured surface of the locus for polynucleotide expansion allows overcoming the negative effects on expression caused by the repeated synthesis of large polynucleotide populations.Exemplary negative effects on expression caused by the repeated synthesis of large polynucleotide populations include, but are not limited to, amplification bias due to high / low GC content, repetitive sequences, trailing adenines, secondary structures, affinity to target sequence binding, or modified nucleotides in polynucleotide sequences.

[0024] In contrast to the amplification of polynucleotides across a plate without cluster structure, cluster amplification can result in a tighter distribution around the mean value.For example, when 100,000 reads are randomly sampled, an average of 8 reads per sequence will produce a library with a distribution of about 1.5X from the mean value.In some cases, single cluster amplification results in at most about 1.5X, 1.6X, 1.7X, 1.8X, 1.9X, or 2.0X from the mean value.In some cases, single cluster amplification results in at least about 1.0X, 1.2X, 1.3X, 1.5X, 1.6X, 1.7X, 1.8X, 1.9X, or 2.0X from the mean value.

[0025] Compared to plate-wide amplification, the cluster amplification method described herein can result in a polynucleotide library that requires less sequencing for equivalent sequence representation. In some examples, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% less sequencing is required. In some examples, up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, up to 70%, up to 80%, up to 90%, or up to 95% less sequencing is required. Sometimes less than 30% sequencing is required after cluster amplification compared to plate-wide amplification. In some examples, polynucleotide sequencing is verified by a high-performance sequence reading device, such as by next-generation sequencing. The sequencing of the sequencing library can be performed by any suitable sequencing technology, including but not limited to single molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination reaction (e.g. Sanger) sequencing, +S sequencing, or sequencing by synthesis. The number of times that a single nucleotide or polynucleotide is identified or "read" is defined as sequencing depth or read depth. In some cases, read depth is referred to as coverage in fold units, for example 55-fold (or 55X) coverage, and optionally describes the percentage of bases.

[0026] In some cases, compared to the amplification over the whole plate, the amplification from the cluster structure results in fewer dropouts or sequences that are not detected after sequencing the amplification products. The dropouts can be AT and / or GC. In some cases, the number of dropouts is at most about 1%, 2%, 3%, 4%, or 5% of the polynucleotide population. In some cases, the number of dropouts is 0.

[0027] The clusters described herein comprise a collection of separate, non-overlapping loci for polynucleotide synthesis. The clusters can comprise about 50-1000, 75-900, 100-800, 125-700, 150-600, 200-500, or 300-400 loci. In some examples, each cluster comprises 121 loci. In some examples, each cluster comprises about 50-500, 50-200, 100-150 loci. In some examples, each cluster comprises at least about 50, 100, 150, 200, 500, 1000, or more loci. In some examples, a single plate contains 100, 500, 10000, 20000, 30000, 50000, 100000, 500000, 700000, 1000000, or more loci. A locus can be a spot, well, microwell, channel, or post. In some examples, each cluster has at least 1X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, or more redundant distinct features that support the expansion of polynucleotides having identical sequences.

[0028] Design of polynucleotide libraries with controlled stoichiometry

[0029] Provided herein are methods for the design and synthesis of polynucleotide libraries, in which the amount (or stoichiometry) of each polynucleotide species (i.e., having a sequence different from other polynucleotides in the library) is adjusted to a predetermined amount such that the desired outcome is controlled for downstream applications. Provided herein, therefore, are methods for the controlled and predetermined modification of polynucleotide species stoichiometry. For example, the polynucleotide species distribution after an amplification reaction can be controlled for use with the methods described herein. The polynucleotide species distribution is preselected to provide highly uniform capture of target sequences, for example, using a panel of polynucleotides for hybridization-based assays for sequencing analysis, etc. Additionally, the methods described herein provide for designing polynucleotide libraries of sequences with one or more sequence features that typically result in non-uniform amplification or capture products attributable to certain "problematic" polynucleotide sequences, where the "problematic" polynucleotide sequences include one or more characteristics that are related to the generation of bias in the application of the polynucleotide library. Exemplary "problematic" polynucleotide sequence characteristics for stoichiometry control using the methods described herein include, but are not limited to, high or low GC or AT content, repetitive sequences, trailing adenines, secondary structure, affinity for target sequence binding (for amplification, enrichment or detection), stability, melting temperature, biological activity, ability to assemble into larger fragments, sequences containing modified nucleotides or nucleotide analogs, or other polynucleotide characteristics for generating a second polynucleotide library of sequences based on predicted or experimental data. In some examples, a library of sequences is obtained for stoichiometry control and organized or clustered into two or more pre-determined groups (bins) based on one or more sequence features. In some examples, the two or more bins represent individual unique sequences.In some examples, the bins represent a range of values ​​based on one or more defined sequence features, each including at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or at least 99% of the total sequences. In some examples, the bins represent a range of values, each including at most 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or less than 100% of the total sequences. In one example, the bins may be defined by %GC, with many bins representing 25-75% in 5% increments (e.g., 25-29%, 30-34%, 35-39%, etc.), some bins representing less than 25%, and some bins representing more than 75% GC content. An abundance value is assigned for each bin, representing the molecular stoichiometry for all sequences in each bin. In some examples, abundance values ​​are initially set to 100, resulting in equal representation of sequences per bin. In some examples, stoichiometry is controlled by using the obtained applied bias data to increase, decrease, or maintain the abundance value for each bin. Other methods of fitting sequence abundances to match a specification are also used. In some examples, a pre-obtained distribution is used to determine the initial abundance values.

[0030] In some examples, the applied bias data is obtained by a predictive algorithm. The applied bias data may be obtained empirically or from uncontrolled or pre-controlled stoichiometric libraries. For example, the applied bias data is obtained from the amplification of a polynucleotide library; the frequency of polynucleotides per bin after amplification is plotted against the %GC bin to set the amplification bias as a function of %GC content. In other examples, the applied bias data is obtained from next generation sequencing (NGS) data after enrichment of target sequences with a polynucleotide probe library; the reads per target gene are used to sort the probe sequences into bins; the reads per target gene are plotted against the number of NGS read bins to set the NGS sequencing bias as a function of polynucleotide probe sequences. In other examples, the applied bias data may be obtained from a cell assay output, such as fluorescence, after treatment of cells with a vector containing a polynucleotide library; the reads per sequence identified in the fluorescent cells are used to sort the probe sequences into bins; the reads per sequence are plotted against the number of read bins to set the bias as a function of polynucleotide probe sequences.

[0031] After controlling the stoichiometry, the modified sequence library is synthesized to generate a controlled stoichiometry library of polynucleotides.In some examples, the controlled stoichiometry library is used for downstream applications.In some examples, data from downstream applications using the controlled stoichiometry polynucleotide library is used to perform additional rounds of stoichiometric modification of the library.

[0032] Generation of polynucleotide libraries with controlled stoichiometry of GC content

[0033] Provided herein is a method for synthesizing a polynucleotide library with defined characteristics, such as GC content, repeat sequences, trailing adenines, secondary structure, affinity to target sequence binding, or modified nucleotides to generate a second population of polynucleotides based on predicted or experimental data. For example, if a polynucleotide library is selected for synthesis to result in a defined GC content after amplification, adjusting the species representation for polynucleotides in the library in the synthesis step depending on the GC content results in improved polynucleotide representation after amplification. The GC content of the polynucleotide library can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 95% or more. In some examples, the GC content of the polynucleotide library is at most 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or less than 100%. In some cases, the GC content is in the range of about 5-95%, 10-90%, 30-80%, 40-75%, or 50-70%.

[0034] The polynucleotide libraries described herein may be adapted for their GC content. In some examples, the polynucleotide library favors high GC content. For example, a library is designed with an increased polynucleotide frequency having a GC content ranging from about 40% to about 90%. In some examples, the polynucleotide library includes low GC content. For example, a library is designed with an increased polynucleotide frequency having a GC content ranging from about 10% to about 60%. The library can be designed to favor high and low GC content. For example, a library can be designed with an increased polynucleotide frequency having a GC content ranging primarily from about 10% to about 30%, and from about 70% to about 90%. In some examples, the library favors uniform GC content. For example, the polynucleotide frequency is uniform with a GC content ranging from about 10% to about 90%. In some examples, the library includes polynucleotides with a GC percentage ranging from about 10% to about 95%. In some examples, the libraries described herein include polynucleotides with more than 30% distinct polynucleotides, with a GC percentage between 10% and 30%, or between 70% and 90%. In some examples, the libraries described herein include polynucleotides with less than about 15% distinct polynucleotides, with a GC percentage between 10% and 30%, or between 60% and 90%.

[0035] In some cases, the generation of a polynucleotide library having a specified GC content occurs by combining at least two polynucleotide libraries having different GC contents.In some examples, at least 2, 3, 4, 5, 6, 7, 10, or more than 10 polynucleotide libraries are combined to generate a population of polynucleotides having a specified GC content.In some cases, 2, 3, 4, 5, 6, 7, or 10 or less polynucleotide libraries are combined to generate a population of non-identical polynucleotides having a specified GC content.

[0036] In some examples, the GC content is adapted by synthesis of fewer or more polynucleotides per cluster. For example, at least 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more than 1000 non-identical polynucleotides are synthesized on a single cluster. In some cases, about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or less non-identical polynucleotides are synthesized on a single cluster. In some examples, 50-500 non-identical polynucleotides are synthesized on a single cluster. In some examples, 100-200 non-identical polynucleotides are synthesized on a single cluster. In some examples, about 100, about 120, about 125, about 130, about 150, about 175, or about 200 non-identical polynucleotides are synthesized on a single cluster.

[0037] In some cases, GC content is adapted by synthesizing non-identical polynucleotides of variable length.For example, the length of each of the synthesized non-identical polynucleotides can be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000 nucleotides or more.The length of the synthesized non-identical polynucleotides can be at most or at most about 2000, 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each of the synthesized non-identical polynucleotides can be 10-2000, 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, and 19-25.

[0038] Generation of polynucleotide libraries with controlled stoichiometry of repetitive sequence content - Patents.com

[0039] The polynucleotide libraries described herein can be synthesized with a specified distribution of repetitive sequences. In some instances, tailoring the polynucleotide library for repetitive sequence content results in improved polynucleotide representation.

[0040] The repeat sequence may be a single nucleotide repeat or a block of two or more nucleotides repeat. In some examples, the repeat sequence is at least 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 nucleotides. In some examples, the repeat sequence is at most 2, 3, 4, 5, 6, 7, 8, 9, or at most 10 nucleotides. In some examples, the block of nucleotides comprises at least 2, 3, 4, 5, 10, 15, 25, 50, 100, 200, 500, or at least 1000 nucleotides. In some examples, the block of nucleotides comprises at most 2, 3, 4, 5, 10, 15, 25, 50, 100, 200, 500, or at most 1000 nucleotides. The repeat sequence may be located at an internal or terminal position of a larger synthetic polynucleotide. The terminal position may be near the 5', 3', or both the 5' and 3' ends of the polynucleotide. In some examples, the repeat sequence is within at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 nucleotides of the terminal. In some examples, the repeat sequence is within at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or at most 10 nucleotides of the terminal. In some examples, the repeat nucleotide is an adenine. In some examples, the repeat sequence is located at a polynucleotide terminus, such as a polyadenine terminus.

[0041] The repetitive sequence content of the polynucleotide library can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95%. In some examples, the repetitive sequence content of the polynucleotide library is at most 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or less than 100%. In some cases, the repetitive sequence content is in the range of about 5-95%, 10-90%, 30-80%, 40-75%, or 50-70%.

[0042] Polynucleotide libraries can be adapted with respect to their repetitive sequence content. In some examples, polynucleotide libraries favor high repetitive sequence content. For example, libraries are designed with an increased polynucleotide frequency having a repetitive sequence content ranging from about 40% to about 90%. In some examples, polynucleotide libraries include low repetitive sequence content. For example, libraries are designed with an increased polynucleotide frequency having a repetitive sequence content ranging from about 10% to about 60%. Libraries can be designed to favor high and low repetitive sequence content. For example, libraries can be designed with an increased polynucleotide frequency having a repetitive sequence content primarily ranging from about 10% and about 30%, and from about 70% to about 90%. In some examples, libraries favor uniform repetitive sequence content. For example, polynucleotide frequency is uniform with a repetitive sequence content ranging from about 10% to about 90%. In some examples, libraries include polynucleotides with a repetitive sequence percentage of about 10% to about 95%. In some examples, the libraries described herein include polynucleotides with more than 30% distinct polynucleotides with a percentage of repeat sequences between 10% and 30% or between 70% and 90%. In some examples, the libraries described herein include polynucleotides with less than about 15% distinct polynucleotides with a percentage of repeat sequences between 10% and 30% or between 60% and 90%.

[0043] In some cases, the generation of a polynucleotide library having a specified repeat sequence content occurs by combining at least two polynucleotide libraries having different repeat sequence contents.In some examples, at least 2, 3, 4, 5, 6, 7, 10, or more than 10 polynucleotide libraries are combined to generate a population of polynucleotides having a specified repeat sequence content.In some cases, 2, 3, 4, 5, 6, 7, or 10 or less polynucleotide libraries are combined to generate a population of non-identical polynucleotides having a specified repeat sequence content.

[0044] In some instances, the repeat sequence content is accommodated by synthesis of fewer or more polynucleotides per cluster. For example, at least 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more than 1000 non-identical polynucleotides are synthesized on a single cluster. In some instances, about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or less non-identical polynucleotides are synthesized on a single cluster. In some instances, 50-500 non-identical polynucleotides are synthesized on a single cluster. In some instances, 100-200 non-identical polynucleotides are synthesized on a single cluster. In some examples, about 100, about 120, about 125, about 130, about 150, about 175, or about 200 non-identical polynucleotides are synthesized on a single cluster.

[0045] In some cases, the repeat sequence content is accommodated by synthesizing non-identical polynucleotides of variable length.For example, the length of each of the synthesized non-identical polynucleotides can be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000 nucleotides or more.The length of the synthesized non-identical polynucleotides can be at most or at most about 2000, 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each of the synthesized non-identical polynucleotides can be 10-2000, 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, and 19-25.

[0046] Generation of polynucleotide libraries with controlled stoichiometry of secondary structure content - Patents.com

[0047] The polynucleotide libraries described herein can be synthesized with a specified secondary structure content. In some instances, tailoring the polynucleotide library for secondary structure content results in improved polynucleotide representation.

[0048] A secondary structure can include three or more nucleotides in one or more polynucleotide strands that form a structure such as a helix (e.g., an alpha helix), a beta sheet, a stem loop, a pseudoknot, a homodimer, or a heterodimer. A stem loop can be a hairpin loop, an internal loop, a bulge, or a multiloop. The type of secondary structure and their ability to form can be predicted from sequence data. Folding or hybridization of a linear sequence into a secondary structure can occur while the polynucleotide is attached to the solid support or after splitting into solution.

[0049] The secondary structure content of the polynucleotide library can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95%. In some examples, the secondary structure content of the polynucleotide library is at most 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or less than 100%. In some cases, the secondary structure content is in the range of about 5-95%, 10-90%, 30-80%, 40-75%, or 50-70%.

[0050] Polynucleotide libraries can be tailored for their secondary structure content. In some examples, polynucleotide libraries favor high secondary structure content. For example, libraries are designed with increased polynucleotide frequency with secondary structure content ranging from about 40% to about 90%. In some examples, polynucleotide libraries include low secondary structure content. For example, libraries are designed with increased polynucleotide frequency with secondary structure content ranging from about 10% to about 60%. Libraries can be designed to favor high and low secondary structure content. For example, libraries can be designed with increased polynucleotide frequency with secondary structure content ranging primarily from about 10% to about 30%, and from about 70% to about 90%. In some examples, libraries favor uniform secondary structure content. For example, polynucleotide frequency is uniform with secondary structure content ranging from about 10% to about 90%. In some examples, libraries include polynucleotides with a secondary structure percentage ranging from about 10% to about 95%. In some examples, the libraries described herein include polynucleotides with more than 30% distinct polynucleotides having a percentage of secondary structure between 10% and 30% or between 70% and 90%. In some examples, the libraries described herein include polynucleotides with less than about 15% distinct polynucleotides having a percentage of secondary structure between 10% and 30% or between 60% and 90%.

[0051] In some cases, the generation of a polynucleotide library having a specified secondary structure content occurs by combining at least two polynucleotide libraries having different repeat sequence contents.In some examples, at least 2, 3, 4, 5, 6, 7, 10, or more than 10 polynucleotide libraries are combined to generate a population of polynucleotides having a specified secondary structure content.In some cases, 2, 3, 4, 5, 6, 7, or 10 or less polynucleotide libraries are combined to generate a population of non-identical polynucleotides having a specified secondary structure content.

[0052] In some instances, the secondary structure content is accommodated by synthesis of fewer or more polynucleotides per cluster. For example, at least 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or 1000 or more non-identical polynucleotides are synthesized on a single cluster. In some instances, about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or less non-identical polynucleotides are synthesized on a single cluster. In some instances, 50-500 non-identical polynucleotides are synthesized on a single cluster. In some instances, 100-200 non-identical polynucleotides are synthesized on a single cluster. In some examples, about 100, about 120, about 125, about 130, about 150, about 175, or about 200 non-identical polynucleotides are synthesized on a single cluster.

[0053] In some cases, secondary structure content is adapted by synthesizing non-identical polynucleotides of variable length.For example, the length of each of the synthesized non-identical polynucleotides can be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000 nucleotides or more.The length of the synthesized non-identical polynucleotides can be at most or at most about 2000, 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each of the synthesized non-identical polynucleotides can be 10-2000, 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, and 19-25.

[0054] Generation of polynucleotide libraries with controlled stoichiometry of sequence content

[0055] In some instances, polynucleotide libraries are synthesized with a specified distribution of desired polynucleotide sequences. In some instances, tailoring the polynucleotide library for enrichment of specific desired sequences results in improved results for downstream applications.

[0056] One or more specific sequences can be selected based on their evaluation in downstream applications.In some examples, the evaluation is the binding affinity to target sequence for amplification, enrichment, or detection, stability, melting temperature, biological activity, ability to assemble into larger fragments, or other properties of polynucleotides.In some examples, the evaluation is experimental or predicted from previous experiments and / or computer algorithms.

[0057] The selected sequences of the polynucleotide library may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% of the sequences. In some examples, the selected sequences of the polynucleotide library are at most less than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the sequences. In some cases, the selected sequences are in the range of about 5-95%, 10-90%, 30-80%, 40-75%, or 50-70% of the sequences.

[0058] The polynucleotide library is adapted to the frequency of each selected sequence. In some examples, the polynucleotide library favors more selected sequences. For example, libraries are designed with an increased polynucleotide frequency of selected sequences ranging from about 40% to about 90%. In some examples, the polynucleotide library includes a low number of selected sequences. For example, libraries are designed with an increased polynucleotide frequency of selected sequences ranging from about 10% to about 60%. The library can be designed to favor higher and lower frequencies of selected sequences. In some examples, the library favors uniform sequence representation. For example, the polynucleotide frequency is uniform with respect to the frequency of selected sequences ranging from about 10% to about 90%. In some examples, the library includes polynucleotides with a selected sequence frequency of about 10% to about 95% of the sequences.

[0059] In some cases, the generation of a polynucleotide library having a specified frequency of selected sequences occurs by combining at least two polynucleotide libraries having different frequencies of selected sequences. In some examples, at least 2, 3, 4, 5, 6, 7, 10, or more than 10 polynucleotide libraries are combined to generate a population of polynucleotides having a specified frequency of selected sequences. In some cases, no more than 2, 3, 4, 5, 6, 7, or 10 polynucleotide libraries are combined to generate a population of non-identical polynucleotides having a specified frequency of selected sequences.

[0060] In some examples, the frequency of the selected sequences is matched by synthesis of fewer or more polynucleotides per cluster. For example, at least 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more than 1000 non-identical polynucleotides are synthesized on a single cluster. In some cases, about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or less non-identical polynucleotides are synthesized on a single cluster. In some examples, 50-500 non-identical polynucleotides are synthesized on a single cluster. In some examples, 100-200 non-identical polynucleotides are synthesized on a single cluster. In some examples, about 100, about 120, about 125, about 130, about 150, about 175, or about 200 non-identical polynucleotides are synthesized on a single cluster.

[0061] In some cases, the frequency of selected sequences is adapted by synthesizing non-identical polynucleotides of variable length.For example, the length of each of the synthesized non-identical polynucleotides can be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000 nucleotides or more.The length of the synthesized non-identical polynucleotides can be at most or at most about 2000, 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each of the synthesized non-identical polynucleotides can be 10-2000, 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, and 19-25.

[0062] Polynucleotide Probe Structure

[0063] A polynucleotide probe library can be used to enrich for a particular target sequence in a larger population of sample polynucleotides. In some examples, each of the polynucleotide probes includes a target binding sequence complementary to one or more target sequences, one or more non-target binding sequences, and one or more primer binding sites, such as a universal primer binding site. In some examples, the complementary or at least partially complementary target binding sequences bind (hybridize) to the target sequences. The primer binding sites, such as the universal primer binding sites, facilitate simultaneous amplification of all members of the probe library, or a subpopulation of members. In some examples, the probes further include a barcode or index sequence. A barcode is a nucleic acid sequence that allows some feature of the polynucleotide associated with the barcode to be identified. After sequencing, the barcode region provides an index to identify the feature or sample source associated with the coding region. Barcodes can be designed of any suitable length to allow a sufficient degree of discrimination, for example, at least about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or more bases in length. Multiple barcodes, such as about 2, 3, 4, 5, 6, 7, 8, 9, 10, or more barcodes, may be used on the same molecule, optionally separated by non-barcode sequences. In some embodiments, each barcode in the plurality of barcodes differs from other barcodes in the plurality in at least three base positions, such as at least about 3, 4, 5, 6, 7, 8, 9, 10, or more positions. In some examples, the polynucleotide is bound to one or more molecular (or affinity) tags, such as small molecules, peptides, antigens, metals, or proteins, to form a probe for subsequent capture of a target sequence of interest. In some examples, two probes having hybridizable complementary target binding sequences form a double-stranded probe pair.

[0064] The probes described herein may be complementary to a target sequence that is a sequence in a genome. The probes described herein may be complementary to a target sequence that is an exome sequence in a genome. The probes described herein may be complementary to a target sequence that is an intron sequence in a genome. In some examples, the probe comprises a target binding sequence that is complementary to the target sequence and at least one non-target binding sequence that is not complementary to the target. In some examples, the target binding sequence of the probe is about 120 nucleotides in length, or at least 10, 15, 20, 25, 50, 75, 100, 110, 120, 125, 140, 150, 160, 175, 200, 300, 400, 500, 500 or more nucleotides in length. The target binding sequence is in some examples 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200 or less, or 500 or less nucleotides in length. The target binding sequence of the probe, in some examples, is about 120 nucleotides in length, or about 10, 15, 20, 25, 40, 50, 60, 70, 80, 85, 87, 90, 95, 97, 100, 105, 110, 115, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, The target binding sequence may be about 20 to about 400 nucleotides in length, or about 30 to about 175, about 40 to about 160, about 50 to about 150, about 75 to about 130, about 90 to about 120, or about 100 to about 140 nucleotides in length. The non-target binding sequences of the probes are, in some instances, at least about 20 nucleotides in length, or at least about 1, 5, 10, 15, 17, 20, 23, 25, 50, 75, 100, 110, 120, 125, 140, 150, 160, 175, or more than about 175 nucleotides in length.The non-target binding sequences are no more than about 5, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, or no more than about 200 nucleotides in length. The non-target binding sequences of the probes are no more than about 20 nucleotides in length, or no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, or about 200 nucleotides in length. In some examples, the non-target binding sequence is about 1 to about 250 nucleotides in length, or about 20 to about 200, about 10 to about 100, about 10 to about 50, about 30 to about 100, about 5 to about 40, or about 15 to about 35 nucleotides in length. The non-target binding sequence often includes a sequence that is not complementary to the target sequence and / or includes a sequence that is not used to bind a primer. In some examples, the non-target binding sequence includes a repeat of a single nucleotide, e.g., polyadenine, polythymidine. The probe often includes none or at least one non-target binding sequence. In some examples, the probe includes one or two non-target binding sequences. The non-target binding sequence may be adjacent to one or more target binding sequences in the probe. For example, the non-target binding sequence is at the 5' or 3' end of the probe. In some examples, the non-target binding sequence is attached to a molecular tag or spacer.

[0065] In some examples, the non-target binding sequence can be a primer binding site. The primer binding sites are often each at least about 20 nucleotides in length, or about 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or at least about 40 nucleotides in length. In some examples, each primer binding site is about 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 or less, or about 40 or less nucleotides in length. In some examples, each primer binding site is about 10 to about 50 nucleotides in length, or about 15 to about 40, about 20 to about 30, about 10 to about 40, about 10 to about 30, about 30 to about 50, or about 20 to about 60 nucleotides in length. In some examples, the polynucleotide probe comprises at least two primer binding sites. In some examples, the primer binding sites may be universal primer binding sites, where all probes contain identical primer binding sequences at these locations. In some examples, a pair of polynucleotides targeting a specific sequence and its reverse complement (e.g., a region of genomic DNA) is represented in Figure 3A as (300), and includes a first target binding sequence (301), a second target binding sequence (302), a first non-target binding sequence (303), and a second non-target binding sequence (304). For example, a pair of polynucleotide probes complementary to a specific sequence (e.g., a region of genomic DNA).

[0066] In some examples, the target binding sequence (301) is the reverse complement of the first and second target binding sequences (302). In some examples, both target binding sequences are chemically synthesized prior to amplification. In an alternative configuration, a pair of polynucleotide probes targeting a specific sequence and its reverse complement (e.g., a region of genomic DNA) is represented in FIG. 3B as (305) and includes a first target binding sequence (301), a second target binding sequence (302), a first non-target binding sequence (303), a second non-target binding sequence (304), a third non-target binding sequence (306), and a fourth non-target binding sequence (307). In some examples, the target binding sequence (301) is the reverse complement of the first and second target binding sequences (302). In some examples, one or more of the non-target binding sequences includes polyadenines or polythymidines.

[0067] In some examples, both probes in the pair are labeled with at least one molecular tag. In some examples, PCR is used to introduce a molecular tag onto the probe during amplification (via a primer that includes the molecular tag). In some examples, the molecular tag includes one or more biotin, folate, polyhistidine, FLAG tag, glutathione, or other molecular tags that match a standard. In some examples, the probe is labeled at the 5' end. In some examples, the probe is labeled at the 3' end. In some examples, both the 5' and 3' ends are labeled with molecular tags. In some examples, the 5' end of the first probe in the pair is labeled with at least one molecular tag, and the 3' end of the second probe in the pair is labeled with at least one molecular tag. In some examples, a spacer is present between the one or more molecular tags and the nucleic acid of the probe. In some examples, the spacer may include an alkyl, polyol or polyamino chain, a peptide, or a polynucleotide. In some examples, the solid support used to capture the probe target nucleic acid is a bead or a surface. The solid support in some examples includes glass, plastic, or other material that can include a capture moiety that binds a molecular tag. In some examples, the beads are magnetic beads. For example, a biotin-labeled probe is captured with a magnetic bead that includes streptavidin. The probe is contacted with a library of nucleic acids to allow binding of the probe to the target sequence. In some examples, a blocking polynucleic acid is added to prevent binding of the probe to one or more adapter sequences attached to the target nucleic acid. In some examples, the blocking polynucleic acid includes one or more nucleic acid analogs. In some examples, the blocking polynucleic acid has uracil instead of thymine at one or more positions.

[0068] The probes described herein may comprise a complementary target binding sequence that binds to one or more target nucleic acid sequences. In some examples, the target sequence is any DNA or RNA nucleic acid sequence. In some examples, the target sequence may be longer than the probe insert. In some examples, the target sequence may be shorter than the probe insert. In some examples, the target sequence may be the same length as the probe insert. For example, the length of the target sequence is at least or at least about 2, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 1000, 2000, 5,000, 12,000, 20,000 nucleotides or more. The length of the target sequence can be at most, or at most about 20,000, 12,000, 5,000, 2,000, 1,000, 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 2 nucleotides or less. The length of the target sequence can range from 2 to 20,000, 3 to 12,000, 5 to 5, 5000, 10 to 2,000, 10 to 1,000, 10 to 500, 9 to 400, 11 to 300, 12 to 200, 13 to 150, 14 to 100, 15 to 50, 16 to 45, 17 to 40, 18 to 35, and 19 to 25. The probe sequence can be a target sequence associated with a particular gene, disease, regulatory pathway, or other biological function consistent with the specification.

[0069] In some examples, a single probe insert (403) is complementary to one or more target sequences (402) in a larger polynucleic acid (Figures 4A-4G). A typical target sequence is an exon. In some examples, one or more probes target a single target sequence (Figures 4A-4G). In some examples, a single probe may target multiple target sequences. In some examples, the target binding sequence of a probe targets both the target sequence (402) and an adjacent sequence (401) (Figures 4A and 4B). In some examples, a first probe targets a first region and a second region of the target sequence, and a second probe targets a second region and a third region of the target sequence (Figures 4D and 4E). In some examples, multiple probes target a single target sequence, and the target binding sequences of the multiple probes include one or more sequences that overlap in terms of complementarity to regions of the target sequence (Figure 4G). In some examples, the probe inserts do not overlap in terms of complementarity to regions of the target sequence. In some examples, at least 2, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 1000, 2000, 5,000, 12,000, 20,000, or more than 20,000 probes target a single target sequence. In some examples, no more than 4 probes directed to a single target sequence overlap, or no more than 3, 2, 1, or 0 probes targeting a single target sequence overlap. In some examples, one or more probes do not target all bases of the target sequence, leaving one or more gaps (Figures 4C and 4F). In some examples, the gap is near the middle of the target sequence (405) (Figure 4F). In some examples, the gap (404) is at the 5' or 3' end of the target sequence (Figure 4C). In some examples, the gap is 6 nucleotides in length. In some examples, the gap is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40 or less than 50 nucleotides in length. In some examples, the gap is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40 or at least 50 nucleotides in length.In some examples, the length of the gap is within a length of 1-50, 1-40, 1-30, 1-20, 1-10, 2-30, 2-20, 2-10, 3-50, 3-25, 3-10, or 3-8 nucleotides. In some examples, a set of probes targeting a sequence does not overlap regions between the probes in the set when hybridized to a complementary sequence. In some examples, a set of probes targeting a sequence does not have any gaps between the probes in the set when hybridized to a complementary sequence. Probes can be designed to maximize uniform binding to the target sequence. In some examples, probes are designed to minimize target binding sequences with high or low GC content, secondary structure, repeats / palindromes, or other sequence features that interfere with the probe binding to the target. In some examples, a single probe can target multiple target sequences.

[0070] The probe libraries described herein may include at least 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, or more than 1,000,000 probes. The probe libraries may have no more than 10, 20, 50, 100, 200, 500, 1,000, 20,000, 50,000, 100,000, 200,000, 500,000, or no more than 1,000,000 probes. A probe library may contain between 10 and 500, between 20 and 1000, between 50 and 2000, between 100 and 5000, between 500 and 10,000, between 1,000 and 5,000, between 10,000 and 50,000, between 100,000 and 500,000, or between 50,000 and 1,000,000 probes. A probe library may contain about 370,000; 400,000; 500,000, or more different probes.

[0071] Next-generation sequencing applications

[0072] The downstream application of polynucleotide library can include next-generation sequencing.For example, enrichment of target sequence with controlled stoichiometric polynucleotide probe library results in more efficient sequencing.The performance of polynucleotide library to capture or hybridize to target can be defined by many different metrics that describe efficiency, precision and accuracy. For example, Picard metrics may include variables including HS libraries (the number of unique molecules in the library that correspond to the target site, calculated from read pairs), average target coverage (the percentage of bases that reach a particular coverage level), coverage depth (the number of reads that contain any nucleotide), fold enrichment (the number of sequence reads that map uniquely to the target / total samples multiplied by the total sample length / target length), percent off bait bases (the percentage of bases that do not correspond to a base in the probe / bait), available bases on the target, AT or GC dropout rate, "fold 80 base penalty" (the fold over-coverage required to bring 80 percent of non-zero targets up to the average coverage level), percent 0 covered targets, PF reads (the number of reads that pass a quality filter), percent selected bases (the sum of bases on the bait and bases near the bait divided by the total aligned bases), percent replicates, or other variables that match specifications.

[0073] Read depth (sequencing depth, or sampling) represents the total number of times that a second nucleic acid fragment ("read") is obtained for a sequence. Theoretical read depth is defined as the expected number of times the same nucleotide is read, assuming that the reads are perfectly distributed across an idealized genome. Read depth is expressed as a function of % coverage (or coverage width). For example, 10 million reads of a perfectly distributed 1 million base genome theoretically results in a 10X read depth of 100% of the sequence. Experimentally, more reads (higher theoretical read depth, or oversampling) may be required to obtain a desired read depth for a percentage of the target sequence. Enrichment of the target sequence with a controlled stoichiometric probe library increases the efficiency of downstream sequencing, since fewer total reads are required to obtain experimental results with an acceptable number of reads over a desired % of the target sequence. For example, in some instances, a theoretical read depth of 55x of the target sequence results in at least 30x coverage of at least 90% of the sequence. In some examples, a theoretical read depth of 55x or less of the target sequence results in a read depth of at least 30x of at least 80% of the sequence. In some examples, a theoretical read depth of 55x or less of the target sequence results in a read depth of at least 30x of at least 95% of the sequence. In some examples, a theoretical read depth of 55x or less of the target sequence results in a read depth of at least 30x of at least 98% of the sequence. In some examples, a theoretical read depth of 55x or less of the target sequence results in a read depth of at least 20x of at least 98% of the sequence. In some examples, a theoretical read depth of 55x or less of the target sequence results in a read depth of at least 5x of at least 98% of the sequence. Increasing the concentration of the probe during hybridization with the target can result in an increase in read depth. In some examples, the concentration of the probe is increased to at least 1.5x, 2.0x, 2.5x, 3x, 3.5x, 4x, 5x, or 5x or more.In some instances, increasing the probe concentration results in a 1000% increase or a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 500%, 750%, 1000%, or greater than 1000% increase in read depth. In some instances, increasing the probe concentration by up to 3X results in a 1000% increase in read depth.

[0074] On-target ratio represents the proportion of sequencing reads that correspond to the desired target sequence. In some examples, the controlled stoichiometric polynucleotide probe library results in an on-target ratio of at least 30%, or at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or at least 90%. Increasing the concentration of the polynucleotide probe during contact with the target nucleic acid results in an increase in the on-target ratio. In some examples, the concentration of the probe is increased by at least 1.5x, 2.0x, 2.5x, 3x, 3.5x, 4x, 5x, or 5x or more. In some examples, increasing the probe concentration results in an increase of at least 20%, or an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, or at least 500% in on-target binding. In some instances, increasing the probe concentration by 3X results in a 20% increase in the on-target ratio.

[0075] Coverage uniformity is sometimes calculated as the read depth as a function of the identity of the target sequence. Higher coverage uniformity results in fewer sequencing reads being required to obtain the desired read depth. For example, the characteristics of the target sequence may affect the read depth, such as high or low GC or AT content, repetitive sequences, trailing adenines, secondary structure, affinity for target sequence binding (amplification, enrichment, or detection), stability, melting temperature, biological activity, ability to assemble into larger fragments, sequences containing modified nucleotides or nucleotide analogs, or other characteristics of the polynucleotide. Enrichment of the target sequence with a controlled stoichiometric polynucleotide probe library results in higher coverage uniformity after sequencing. In some examples, 95% of the sequences have a read depth that is within 1x of the average library read depth, or within 0.1, 0.2, 0.5, 0.7, 1, 1.2, 1.5, 1.7, or about 2x of the average library read depth. In some examples, 80%, 85%, 90%, 95%, 97% or 99% of the sequences have a read depth that is within 1x of the average.

[0076] Enriching target nucleic acids in a polynucleotide probe library

[0077] The probe libraries described herein may be used in a variety of downstream applications to enrich target polynucleotides in a population of sample polynucleotides. In some examples, a sample is obtained from one or more sources, and a population of sample polynucleotides is isolated using conventional techniques known in the art. The sample is obtained from a biological source, such as (by way of non-limiting example) saliva, blood, tissue, skin, or a completely synthetic source. A plurality of polynucleotides obtained from the sample are fragmented, end-repaired, and adenylated to form double-stranded sample nucleic acid fragments. In some examples, end-repair is performed by treatment with one or more enzymes, such as T4 DNA polymerase, Klenow enzyme, and T4 polynucleotide kinase, in a suitable buffer. Nucleotide overhangs that facilitate ligation to adapters are added, in some examples using 3' to 5' Exo-Minus Klenow fragment and dATP.

[0078] Adapters may be ligated to both ends of the sample polynucleotide fragments with a ligase, such as T4 ligase, to generate a library of adapter-labeled polynucleotide strands, and the adapter-labeled polynucleotide library is amplified with a primer, such as a universal primer. In some examples, the adapters are Y-shaped adapters that include one or more primer binding sites, one or more grafting regions, and one or more index regions. In some examples, one or more index regions are present on each strand of the adapter. In some examples, the grafting regions are complementary to the flow cell surface and facilitate next-generation sequencing of the sample library. In some examples, the Y-shaped adapters include partially complementary sequences. In some examples, the Y-shaped adapters include a single thymidine overhang that hybridizes to the overhanging adenine of the double-stranded adapter-labeled polynucleotide strands. The Y-shaped adapters may include modified nucleic acids that are resistant to cleavage. For example, a phosphorothioate backbone is used to attach the overhanging thymidine to the 3' end of the adapter. The library of double-stranded sample nucleic acid fragments is then denatured in the presence of an adapter blocker. The adapter blocker minimizes off-target hybridization of the probes to the adapter sequences (in place of the target sequences) present on the adapter-labeled polynucleotide strands. Denaturation is performed at 96°C in some examples, or at about 85, 87, 90, 92, 95, 97, 98, or about 99°C. The polynucleotide target library (probe library) is denatured in the hybridization solution at 96°C, 85, 87, 90, 92, 95, 97, 98, or 99°C in some examples. The denatured adapter-labeled polynucleotide library and hybridization solution are incubated for a suitable period and at a suitable temperature to allow the probes to hybridize with complementary target sequences. In some examples, a suitable hybridization temperature is about 45-80°C, or at least 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90°C. In some examples, the hybridization temperature is 70°C.In some examples, suitable hybridization times are 16 hours, or at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 hours, or more, or about 12-20 hours. A binding buffer is then added to the hybridized adaptor-labeled polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized adaptor-labeled polynucleotide probes. The solid support is washed with a buffer to remove unbound polynucleotides before an elution buffer is added to the enriched labeled polynucleotide fragments from the solid support. In some examples, the solid support is washed twice, or one, two, three, four, five, or six times. The enriched library of adaptor-labeled polynucleotide fragments is amplified, and the enriched library is sequenced.

[0079] A plurality of nucleic acids (i.e., genomic sequences) may be obtained from a sample and fragmented, optionally end-repaired, and adenylated. Adapters are ligated to both ends of the polynucleotide fragments to generate a library of adapter-labeled polynucleotide strands, and the adapter-labeled polynucleotide library is amplified. The adapter-labeled polynucleotide library is then denatured at elevated temperature, preferably 96°C, in the presence of an adapter blocker. The polynucleotide target library (probe library) is denatured in a hybridization solution at elevated temperature, preferably about 90-99°C, and bound to the denatured labeled polynucleotide library in a hybridization solution at about 45-80°C for about 10-24 hours. A binding buffer is then added to the hybridized adapter-labeled polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized adapter-labeled polynucleotide probes. Prior to adding an elution buffer to release the enriched adaptor-labeled polynucleotide fragments from the solid support, the solid support is washed one or more times, preferably about 2-5 times, with the buffer to remove unbound polynucleotides. The enriched library of adaptor-labeled polynucleotide fragments is amplified, and the library is then sequenced. Alternative experimental variables such as incubation time, temperature, reaction volume / concentration, number of washes, or other variables consistent with standards may also be used in the method.

[0080] The population of polynucleotides may be enriched prior to the adaptor ligation reaction. In one example, a plurality of polynucleotides are obtained from a sample, fragmented, optionally end-repaired, and denatured at elevated temperatures, preferably 90-99°C. A polynucleotide target library (probe library) is denatured in a hybridization solution at elevated temperatures, preferably about 90-99°C, and bound to the denatured labeled polynucleotide library in the hybridization solution at about 45-80°C for about 10-24 hours. A binding buffer is then added to the hybridized adaptor-labeled polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized adaptor-labeled polynucleotide probes. Prior to adding an elution buffer to release the enriched adaptor-labeled polynucleotide fragments from the solid support, the solid support is washed one or more times, preferably about 2-5 times, with a buffer to remove unbound polynucleotides. The enriched polynucleotide fragments are then polyadenylated, adapters are ligated to both ends of the polynucleotide fragments to generate a library of adapter-labeled polynucleotide strands, and the adapter-labeled polynucleotide library is amplified. The adapter-labeled polynucleotide library is then sequenced.

[0081] The polynucleotide target library may also be used to filter out undesired sequences from a plurality of polynucleotides by hybridizing to undesired fragments. For example, a plurality of polynucleotides are obtained from a sample, fragmented, optionally end-repaired, and adenylated. Adapters are ligated to both ends of the polynucleotide fragments to generate a library of adapter-labeled polynucleotide strands, and the adapter-labeled polynucleotide library is amplified. Alternatively, the adenylation and adapter ligation steps are instead performed after enrichment of the sample polynucleotides. The adapter-labeled polynucleotide library is then denatured at elevated temperature, preferably 90-99°C, in the presence of an adapter blocker. A polynucleotide filtering library (probe library) designed to remove undesired non-target sequences is denatured in a hybridization solution at elevated temperature, preferably about 90-99°C, and combined with the denatured labeled polynucleotide library in a hybridization solution at about 45-80°C for about 10-24 hours. A binding buffer is then added to the hybridized adaptor-labeled polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized adaptor-labeled polynucleotide probes. The solid support is washed one or more times, preferably for about 1-5 hours, with the buffer to elute the unbound adaptor-labeled polynucleotide fragments. The enriched library of unbound adaptor-labeled polynucleotide fragments is amplified, and the amplified library is then sequenced.

[0082] Highly parallel de novo nucleic acid synthesis

[0083] Described herein is a platform approach that utilizes miniaturization, parallelization, and vertical integration of end-to-end processes from polynucleotide synthesis to gene assembly in nanowells on silicon to create an innovative synthesis platform. The devices described herein provide the same footprint as a 96-well plate, and the silicon synthesis platform can increase throughput by 100-1,000 fold compared to traditional synthesis methods, producing up to approximately 1,000,000 polynucleotides in a single highly parallel run. In some examples, a single silicon plate described herein provides synthesis of approximately 6,100 non-identical polynucleotides. In some examples, each of the non-identical polynucleotides is in a cluster. A cluster can contain 50-500 non-identical polynucleotides.

[0084] The method described herein provides for the synthesis of a library of polynucleotides, each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library includes sequences encoding variants of at least a single codon, such that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are produced by standard translation processes. The synthesized specific modifications in the nucleic acid sequence can be introduced by overlapping or by incorporating nucleotide changes into blunt-ended polynucleotide primers. Alternatively, the population of polynucleotides collectively encodes a long nucleic acid (e.g., a gene) and variants thereof. In this configuration, the population of polynucleotides can be hybridized and subjected to standard molecular biology techniques to transform the long nucleic acid (e.g., a gene) and variants thereof. When the long nucleic acid (e.g., a gene) and variants thereof are expressed in a cell, a variant protein library is generated. Similarly, methods are provided for the synthesis of mutant libraries encoding RNA sequences (e.g., miRNA, shRNA, and mRNA) or DNA sequences (e.g., enhancer, promoter, UTR, and terminator regions). Further provided herein are downstream applications for mutants selected from libraries synthesized using the methods described herein. Downstream applications include identification of mutant nucleic acid or protein sequences with improved biologically relevant function, such as altered biochemical affinity, enzymatic activity, cellular activity, and for the treatment or prevention of disease conditions.

[0085] substrate

[0086] Provided herein is a substrate comprising a plurality of clusters, where each cluster comprises a plurality of loci that support attachment and synthesis of polynucleotides. The term "locus" as used herein refers to a discrete region on a structure that provides support for a polynucleotide encoding a single predetermined sequence extending from a surface. In some examples, the locus is on a two-dimensional surface, such as a substantially flat surface. In some examples, the locus refers to a discrete raised or recessed site on a surface, such as a well, microwell, channel, or post. In some examples, the surface of the locus comprises a material that is actively functionalized to attach at least one nucleotide for polynucleotide synthesis, or preferably a population of identical nucleotides for the synthesis of a population of polynucleotides. In some examples, the polynucleotide refers to a population of polynucleotides that encode the same nucleic acid sequence. In some examples, the surface of the device encompasses one or more surfaces of the substrate.

[0087] Provided herein are structures that can include a surface that supports synthesis of multiple polynucleotides having different predetermined sequences at addressable locations on a common solid support. In some cases, the device can be configured to synthesize multiple polynucleotides having different predetermined sequences at addressable locations on a common solid support. ,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000, or more non-identical polynucleotides. In some instances, the device may be 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 75,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000 In some embodiments, the polynucleotides provide support for the synthesis of polynucleotides encoding 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000, or more distinct sequences. In some examples, at least some of the polynucleotides have an identical sequence or are configured to be synthesized with an identical sequence.

[0088] Provided herein are methods and devices for the production and growth of polynucleotides of about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 bases in length. In some examples, the length of the polynucleotide formed is about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or 225 bases in length. The polynucleotide can be at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 bases in length. The polynucleotide can be 10-225 bases in length, 12-100 bases in length, 20-150 bases in length, 20-130 bases in length, or 30-100 bases in length.

[0089] In some examples, polynucleotides are synthesized at separate loci of the substrate, with each locus supporting the synthesis of a population of polynucleotides. In some examples, each locus supports the synthesis of a population of polynucleotides having a different sequence than the population of polynucleotides grown at another locus. In some examples, the loci of the device are located in multiple clusters. In some examples, the device includes at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000, or more clusters. In some examples, the device may be configured to: 2,000;5,000;10,000;100,000;200,000;300,000;400,000;500,000;600,000;700,000;800,000;900,000;1,000,000;1,100,000;1,200,000;1,300,000;1,400,000;1,500,000;1,600,000;1,700,000;1,800,000;1,900,000;2,000,000;300,000;400,0 In some examples, the device comprises about 10,000 distinct loci, in which case the device may comprise 00; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci. The amount of loci within a single cluster is varied in different cases. In some examples, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500, 1000, or more loci. In some examples, each cluster includes about 50-500 loci. In some examples, each cluster includes about 100-200 loci.In some examples, each cluster includes between about 100 and 150 loci. In some examples, each cluster includes about 109, 121, 130, or 137 loci. In some examples, each cluster includes about 19, 20, 61, 64, or more loci.

[0090] The number of distinct polynucleotides synthesized on a device can depend on the number of distinct loci available in the substrate. In some cases, the density of loci within a cluster of devices can be greater than 1 mm 2 At least or about 1 locus per mm 2 10 loci per mm 2 25 loci per mm 2 50 loci per mm 2 65 loci per mm 2 75 loci per mm 2 100 loci per mm 2 130 loci per mm 2 150 loci per mm 2 175 loci per mm 2 200 loci per mm 2 300 loci per mm 2 400 loci per mm 2 500 loci per mm 2 In some instances, the device may contain 1,000 loci per mm, or more. 2 About 500mm from 2 Approximately 10 loci per mm 2 From about 400 mm 2 Approximately 25 loci per mm 2 Approximately 500 mm from 2 Approximately 50 loci per mm 2 About 500mm from 2 Approximately 100 loci per mm 2 Approximately 500 mm from 2 Approximately 150 loci per mm 2 From about 250 mm 2 Approximately 10 loci per mm2 From about 250 mm 2 Approximately 50 loci per mm 2 From about 200 mm 2 Approximately 10 loci per mm 2 From about 200 mm 2 The cluster comprises about 50 loci per cluster. In some examples, the distance from the center of two adjacent loci in the cluster is about 10 μm to about 500 μm, about 10 μm to about 200 μm, or about 10 μm to about 100 μm. In some examples, the distance from the center of two adjacent loci is greater than about 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, or 100 μm. In some examples, the distance from the center of two adjacent loci is less than about 200 μm, 150 μm, 100 μm, 80 μm, 70 μm, 60 μm, 50 μm, 40 μm, 30 μm, 20 μm, or 10 μm. In some examples, the width of each locus is about 0.5 μm, 1 μm, 2 μm, 3 μm, 4 μm, 5 μm, 6 μm, 7 μm, 8 μm, 9 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, or 100 μm. In some examples, the width of each locus is about 0.5 μm to 100 μm, about 0.5 μm to 50 μm, about 10 μm to 75 μm, or about 0.5 μm to 50 μm.

[0091] In some cases, the density of clusters within a device is as high as 100 mm 2 At least or about 1 cluster per 10 mm 2 1 cluster per 5mm 2 1 cluster per 4mm 2 1 cluster per 3mm 2 1 cluster per 2mm 2 1 cluster per 1mm 2 1 cluster per 1mm 2 Clusters of 2 per 1mm 2 Clusters of 3 per 1mm 2 Clusters of 4 per 1mm 2 Clusters of 5 per 1mm 2In some instances, the device may have 10 clusters per mm, 50 clusters per mm, or more. 2 Approximately 1 cluster per mm 2 In some examples, the distance from the center of two adjacent clusters is less than about 50 μm, 100 μm, 200 μm, 500 μm, 1000 μm, 2000 μm, or 5000 μm. In some examples, the distance from the center of two adjacent clusters is about 50 μm to about 100 μm, about 50 μm to about 200 μm, about 50 μm to about 300 μm, about 50 μm to about 500 μm, and about 100 μm to about 2000 μm. In some examples, the distance from the center of two adjacent clusters is about 0.05 mm to about 50 mm, about 0.05 mm to about 10 mm, about 0.05 mm to about 5 mm, about 0.05 mm to about 4 mm, about 0.05 mm to about 3 mm, about 0.05 mm to about 2 mm, about 0.1 mm to 10 mm, about 0.2 mm to 10 mm, about 0.3 mm to about 10 mm, about 0.4 mm to about 10 mm, about 0.5 mm to 10 mm, about 0.5 mm to about 5 mm, or about 0.5 mm to about 2 mm. In some examples, each cluster has a diameter or width along one dimension of about 0.5 to 2 mm, about 0.5 to 1 mm, or about 1 to 2 mm. In some examples, each cluster has a diameter or width along one dimension of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In some examples, each cluster has an inner diameter or width along one dimension of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0092] The device may be approximately the size of a standard 96-well plate, for example, about 100-200 mm by about 50-150 mm. In some examples, the device has a diameter of less than about 1000 mm, 500 mm, 450 mm, 400 mm, 300 mm, 250 mm, 200 mm, 150 mm, 100 mm, or 50 mm. In some examples, the diameter of the device is about 25 mm to 1000 mm, about 25 mm to about 800 mm, about 25 mm to about 600 mm, about 25 mm to about 500 mm, about 25 mm to about 400 mm, about 25 mm to about 300 mm, or about 25 mm to about 200. Non-limiting examples of device sizes include about 300 mm, 200 mm, 150 mm, 130 mm, 100 mm, 76 mm, 51 mm, and 25 mm. In some examples, the device is at least about 100 mm2; 200 mm2; 2 ;500mm 2 ;1,000mm 2 ;2,000mm 2 ;5,000mm 2 ;10,000mm 2 ;12,000mm 2 ;15,000mm 2 ;20,000mm 2 ;30,000mm 2 ;40,000mm 2 ;50,000mm 2, or has a larger planar area. In some examples, the thickness of the device is about 50 mm to about 2000 mm, about 50 mm to about 1000 mm, about 100 mm to about 1000 mm, about 200 mm to about 1000 mm, or about 250 mm to about 1000 mm. Non-limiting examples of device thicknesses include about 275 mm, 375 mm, 525 mm, 625 mm, 675 mm, 725 mm, 775 mm, and 925 mm. In some examples, the thickness of the device varies with diameter and depends on the composition of the substrate. For example, a device comprising a material other than silicon has a different thickness than a silicon device of the same diameter. The thickness of the device is determined by the mechanical strength of the material used and must be sufficient to support its own weight without cracking during handling. In some examples, the structure includes a plurality of devices described herein.

[0093] Surface material

[0094] Provided herein are devices that include a surface, the surface modified to support polynucleotide synthesis at pre-determined locations, with resulting low error rates, low dropout rates, high yields, and high oligo display. In some embodiments, the surface of the device for polynucleotide synthesis provided herein is fabricated from a variety of materials that can be modified to support new polynucleotide synthesis reactions. In some cases, the device is sufficiently conductive, e.g., capable of forming a uniform electric field across all or a portion of the device. The devices described herein may include flexible materials. Exemplary flexible materials include, but are not limited to, modified nylon, unmodified nylon, nitrocellulose, and polypropylene. The devices described herein may include rigid materials. Exemplary rigid materials include, but are not limited to, glass, fused silica, silicon, silicon dioxide, silicon nitride, plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and mixtures thereof, etc.), and metals (e.g., gold, platinum, etc.). The devices disclosed herein may be made from materials including silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamide, polydimethylsiloxane (PDMS), glass, or any combination thereof. In some cases, the devices disclosed herein are manufactured from a combination of materials listed herein or other suitable materials known in the art.

[0095] A list of tensile strengths for typical materials described herein is provided below: nylon (70 MPa), nitrocellulose (1.5 MPa), polypropylene (40 MPa), silicone (268 MPa), polystyrene (40 MPa), agarose (1-10 MPa), polyacrylamide (1-10 MPa), polydimethylsiloxane (PDMS) (3.9-10.8 MPa). The solid carriers described herein may have a tensile strength of 1-300, 1-40, 1-10, 1-5, or 3-11 MPa. The solid carriers described herein may have a tensile strength of about 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 25, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 270, or more MPa. In some examples, the devices described herein include a solid support for polynucleotide synthesis in the form of a flexible material that can be stored on a continuous loop or reel, such as a tape or flexible sheet.

[0096] Young's modulus measures the resistance of a material to elastic (recoverable) deformation under load. A list of Young's moduli for stiffness of exemplary materials described herein is provided below: nylon (3 GPa), nitrocellulose (1.5 GPa), polypropylene (2 GPa), silicone (150 GPa), polystyrene (3 GPa), agarose (1-10 GPa), polyacrylamide (1-10 GPa), polydimethylsiloxane (PDMS) (1-10 GPa). The solid carriers described herein can have a Young's modulus of 1-500, 1-40, 1-10, 1-5, or 3-11 GPa. The solid supports described herein may have a Young's modulus of about 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 25, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 400, 500 GPa, or more. Flexibility and stiffness are inversely related, so a flexible material has a low Young's modulus and its shape changes significantly under load.

[0097] In some cases, the devices disclosed herein include a silicon dioxide base and a silicon oxide surface. Alternatively, the devices may include a silicon oxide base. The surfaces of the devices provided herein may be textured, thereby increasing the total surface area for polynucleotide synthesis. The devices disclosed herein may include at least 5%, 10%, 25%, 50%, 80%, 90%, 95%, or 99% silicon. The devices disclosed herein may be fabricated from silicon on insulator (SOI) wafers.

[0098] Surface Architecture

[0099] Provided herein are devices that include raised and / or submerged features. One advantage of having such features is an increased surface area that supports polynucleotide synthesis. In some examples, devices with raised and / or submerged features are referred to as three-dimensional substrates. In some examples, the three-dimensional device includes one or more channels. In some examples, one or more loci include channels. In some examples, the channels are available for deposition of reagents by a deposition device, such as a polynucleotide synthesizer. In some examples, reagents and / or fluids are collected into a larger well in fluid communication with one or more channels. For example, the device includes multiple channels corresponding to multiple loci with a cluster, and the multiple channels are in fluid communication with one well of the cluster. In some methods, a library of polynucleotides is synthesized at multiple loci of the cluster.

[0100] In some examples, the structure is configured to allow for flow control and mass transfer pathway control for polynucleotide synthesis on the surface. In some examples, the device configuration allows for control and even distribution of mass transfer pathways, chemical exposure times, and / or washing effects during polynucleotide synthesis. In some examples, the device configuration allows for increased response rates, for example, by providing sufficient volume for polynucleotide growth such that the volume displaced by growing polynucleotides does not exceed 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% of the initial available volume available or suitable for polynucleotide growth. In some examples, the three-dimensional structure allows for management of fluid flow to allow rapid exchange of chemical exposure.

[0101] Provided herein are methods for synthesizing DNA in amounts of 1 fM, 5 fM, 10 fM, 25 fM, 50 fM, 75 fM, 100 fM, 200 fM, 300 fM, 400 fM, 500 fM, 600 fM, 700 fM, 800 fM, 900 fM, 1 pM, 5 pM, 10 pM, 25 pM, 50 pM, 75 pM, 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, or more. In some examples, the polynucleotide library may span the length of about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the genes. The genes may be altered by up to about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100%.

[0102] The non-identical polynucleotides may collectively encode sequences for at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100% of the genes. In some examples, the polynucleotides may encode 50%, 60%, 70%, 80%, 85%, 90%, 95%, or more of the sequences of the genes. In some examples, the polynucleotides may encode 80%, 85%, 90%, 95%, or more of the sequences of the genes.

[0103] In some examples, isolation is achieved by physical structures. In some examples, isolation is achieved by differential functionalization of the surface to create active and passive areas for polynucleotide synthesis. Differential functionalization is also achieved by alternating hydrophobicity across the device surface, thereby creating a water contact angle effect that causes beading or wetting of the deposited reagents. Larger structures can be utilized to reduce splashing and cross-contamination of separate polynucleotide synthesis locations with reagents in adjacent spots. In some examples, an apparatus such as a polynucleotide synthesizer is used to deposit reagents at separate polynucleotide synthesis locations. Substrates with three-dimensional features are configured in a manner that allows synthesis of polynucleotides (e.g., greater than about 10,000) with low error rates (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000, 1:3,000, 1:5,000, or 1:10,000). In some examples, the device is sized to fit over 1 mm 2 In some embodiments, the invention includes a method for manufacturing a semiconductor device, the method comprising the steps of:

[0104] The channels of the device may have the same or different width, height, and / or volume as another well of the substrate. The channels of the device may have the same or different width, height, and / or volume as another channel of the substrate. In some examples, the width of the cluster is about 0.05 mm to about 50 mm, about 0.05 mm to about 10 mm, about 0.05 mm to about 5 mm, about 0.05 mm to about 4 mm, about 0.05 mm to about 3 mm, about 0.05 mm to about 2 mm, about 0.05 mm to about 1 mm, about 0.05 mm to about 0.5 mm, about 0.05 mm to about 0.1 mm, about 0.1 mm to 10 mm, about 0.2 mm to 10 mm, about 0.3 mm to about 10 mm, about 0.4 mm to about 10 mm, about 0.5 mm to 10 mm, about 0.5 mm to about 5 mm, or about 0.5 mm to about 2 mm. In some examples, the width of the well containing the cluster is from about 0.05 mm to about 50 mm, from about 0.05 mm to about 10 mm, from about 0.05 mm to about 5 mm, from about 0.05 mm to about 4 mm, from about 0.05 mm to about 3 mm, from about 0.05 mm to about 2 mm, from about 0.05 mm to about 1 mm, from about 0.05 mm to about 0.5 mm, from about 0.05 mm to about 0.1 mm, from about 0.1 mm to 10 mm, from about 0.2 mm to 10 mm, from about 0.3 mm to about 10 mm, from about 0.4 mm to about 10 mm, from about 0.5 mm to 10 mm, from about 0.5 mm to about 5 mm, from about 0.5 mm to about 2 mm. In some examples, the width of the cluster is about 5 mm, 4 mm, 3 mm, 2 mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm, 0.08 mm, 0.07 mm, 0.06 mm, or 0.05 mm, or less than these values. In some examples, the width of the cluster is about 1.0 to 1.3 mm. In some examples, the width of the cluster is about 1.150 mm. In some examples, the width of the well is about 5 mm, 4 mm, 3 mm, 2 mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm, 0.08 mm, 0.07 mm, 0.06 mm, or 0.05 mm, or less than these values. In some examples, the width of the well is about 1.0 to 1.3 mm. In some examples, the width of the well is about 1.150 mm. In some examples, the width of the cluster is about 0.08 mm. In some examples, the width of the well is about 0.08 mm.The width of the cluster may refer to the cluster within a two- or three-dimensional matrix.

[0105] In some examples, the height of the wells is about 20 μm to about 1000 μm, about 50 μm to about 1000 μm, about 100 μm to about 1000 μm, about 200 μm to about 1000 μm, about 300 μm to about 1000 μm, about 400 μm to about 1000 μm, or about 500 μm to about 1000 μm. In some examples, the height of the wells is less than about 1000 μm, less than about 900 μm, less than about 800 μm, less than about 700 μm, or less than about 600 μm.

[0106] In some examples, the device includes a plurality of channels corresponding to a plurality of loci in the cluster, and the height or depth of the channels is about 5 μm to about 500 μm, about 5 μm to about 400 μm, about 5 μm to about 300 μm, about 5 μm to about 200 μm, about 5 μm to about 100 μm, about 5 μm to about 50 μm, or about 10 μm to about 50 μm. In some examples, the height of the channels is less than 100 μm, less than 80 μm, less than 60 μm, less than 40 μm, or less than 20 μm.

[0107] In some examples, the diameter of the channel, locus (e.g., in a substantially planar substrate) or both the channel and locus (e.g., in a three-dimensional structure device where the locus corresponds to the channel) is about 1 μm to about 1000 μm, about 1 μm to about 500 μm, about 1 μm to about 200 μm, about 1 μm to about 100 μm, about 5 μm to about 100 μm, or about 10 μm to about 100 μm, such as about 90 μm, 80 μm, 70 μm, 60 μm, 50 μm, 40 μm, 30 μm, 20 μm, or 10 μm. In some examples, the diameter of the channel, locus, or both the channel and locus is less than about 100 μm, 90 μm, 80 μm, 70 μm, 60 μm, 50 μm, 40 μm, 30 μm, 20 μm, or 10 μm. In some examples, the distance from the center of two adjacent channels, loci, or a channel and locus is about 1 μm to about 500 μm, about 1 μm to about 200 μm, about 1 μm to about 100 μm, about 5 μm to about 200 μm, about 5 μm to about 100 μm, about 5 μm to about 50 μm, or about 5 μm to about 30 μm, e.g., about 20 μm.

[0108] Surface modification

[0109] In various examples, surface modification is utilized to chemically and / or physically alter a surface by an additive or subtractive process to alter one or more chemical and / or physical properties of the device surface or selected sites or regions of the device surface. For example, surface modification includes, but is not limited to, (1) altering the wettability of the surface, (2) functionalizing the surface, i.e., providing, modifying, or replacing surface functional groups, (3) defunctionalizing the surface, i.e., removing surface functional groups, (4) otherwise altering the chemical composition of the surface, e.g., by etching, (5) increasing or decreasing the roughness of the surface, (6) providing a coating on the surface, e.g., providing a coating that exhibits wettability different from that of the surface, and / or (7) depositing particles on the surface.

[0110] In some examples, the addition of a chemical layer (called an adhesion promoter) on top of the surface promotes structured patterning of loci on the surface of the substrate. Exemplary surfaces for the application of adhesion promoters include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some examples, the adhesion promoter is a chemical with a high surface energy. In some examples, a second chemical layer is deposited on the surface of the substrate. In some examples, the second chemical layer has a low surface energy. In some examples, the surface energy of the chemical layer coated on the surface supports localization of the droplet to the surface. Depending on the pattern arrangement selected, the proximity of the loci and / or the area of ​​fluid contact at the loci can be altered.

[0111] In some examples, the device surface or resolved locus on which nucleic acids or other moieties are deposited, for example for polynucleotide synthesis, is smooth or substantially planar (e.g., two-dimensional) or has irregularities such as raised or recessed features (e.g., three-dimensional features). In some examples, the device surface is modified with one or more distinct layers of compounds. Such modified layers of interest include, but are not limited to, inorganic and organic layers, such as metals, metal oxides, polymers, small organic molecules, etc. Non-limiting polymer layers include peptides, proteins, nucleic acids or mimetics thereof (e.g., peptide nucleic acids, etc.), polysaccharides, phospholipids, polyurethanes, polyesters, polycarbonates, polyureas, polyamides, polyethyleneamines, polyarylene sulfides, polysiloxanes, polyimides, polyacetates, and other suitable compounds described herein or otherwise known in the art. In some examples, the polymer is a heteropolymer. In some examples, the polymer is a homopolymer. In some examples, the polymer includes or is attached to a functional moiety.

[0112] In some examples, the decomposed loci of the device are functionalized with one or more moieties that increase and / or decrease surface energy. In some examples, the moieties are chemically inert. In some examples, the moieties are configured to support a desired chemical reaction, such as one or more processes in a polynucleotide synthesis reaction. The surface energy, i.e., hydrophobicity, of the surface is a factor for determining the affinity of nucleotides to attach onto the surface. In some examples, a method for functionalizing the device includes (a) providing a device having a surface that includes silicon dioxide; and (b) silanizing the surface using a suitable silanizing agent, such as an organofunctional alkoxysilane molecule, as described herein or otherwise known in the art.

[0113] In some examples, the organofunctional alkoxysilane molecules include dimethylchloro-octodecyl-silane, methyldichloro-octodecyl-silane, trichloro-octodecyl-silane, trimethyl-octodecyl-silane, triethyl-octodecyl-silane, or any combination thereof. In some examples, the surfaces of the device are functionalized with polyethylene / polypropylene (functionalized by gamma irradiation or chromic acid oxidation and reduction to a hydroxyalkyl surface), highly crosslinked polystyrene-divinylbenzene (derivatized by chloromethylation and aminated to a benzylamine functional surface), nylon (terminal aminohexyl groups are directly reactive), or etched with reduced polytetrafluoroethylene. Other methods and functionalizing agents are described in U.S. Patent No. 5,474,796, which is incorporated herein by reference in its entirety.

[0114] In some instances, the surface of the device is functionalized by contact with a derivatization composition comprising a mixture of silanes under reaction conditions effective to couple the silanes to the device surface, typically via reactive hydrophilic moieties present on the device surface. Silane treatment generally results in covering the surface with organofunctional alkoxysilane molecules by self-assembly.

[0115] As currently known in the art, various siloxane functionalizing agents, for example to lower or increase surface energy, may further be used. Organofunctional alkoxysilanes may be classified according to their organofunctionality.

[0116] Provided herein are devices that may include a patterning of an agent capable of binding to a nucleoside. In some examples, the device may be coated with an active agent. In some examples, the device may be coated with a passive agent. Exemplary active agents for inclusion in the coating materials described herein include, but are not limited to, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (HAPS), 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, 3-glycidoxypropyltrimethoxysilane (GOPS), 3-iodo-propyltrimethoxysilane, butyl-aldehyde-trimethoxysilane, dimeric secondary aminoalkylsiloxanes, (3-aminopropyl) ... )-diethoxy-methylsilane, (3-aminopropyl)-dimethyl-ethoxysilane, and (3-aminopropyl)-trimethoxysilane, (3-glycidoxypropyl)-dimethyl-ethoxysilane, glycidoxy-trimethoxysilane, (3-mercaptopropyl)-trimethoxysilane, 3-4 epoxycyclohexyl-ethyltrimethoxysilane, and (3-mercaptopropyl)-methyl-dimethoxysilane, allyltrichlorochlorosilane, 7-oct-1-enyltrichlorochlorosilane, or bis(3-trimethoxysilylpropyl)amine.

[0117] Exemplary passive agents for inclusion in the coating materials described herein include, but are not limited to, perfluorooctyltrichlorosilane; tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane; 1H,1H,2H,2H-fluorooctyltriethoxysilane (FOS); trichloro(1H,1H,2H,2H-perfluorooctyl)silane; tert-butyl-[5-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)indol-1-yl]-dimethyl-silane; CYTOP™; Fluorinert™; perfluorooctyltrichlorosilane; perfluorooctyltrichlorosilane (PFOTCS); perfluorooctyldimethylchlorosilane (PFODCS); perfluorodecyltriethoxysilane (PFDTES); pentafluorophenyl-dimethylpropylchloro-silane (PFPTES); perfluorooctyltriethoxysilane; perfluorooctyltrimethoxysilane; octylchlorosilane; dimethylchloro-octodecyl-silane; methyldichloro-octodecyl-silane; trichloro-octodecyl-silane; trimethyl-octodecyl-silane; triethyl-octodecyl-silane; or octadecyltrichlorosilane.

[0118] In some examples, the functionalizing agent includes a hydrocarbon silane, such as octadecyltrichlorosilane, hi some examples, the functionalizing agent includes 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl / trimethoxysilane, and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide.

[0119] Polynucleotide Synthesis

[0120] The disclosed method for polynucleotide synthesis may include a process that includes phosphoramidite chemistry. In some examples, polynucleotide synthesis includes a step of coupling a base with a phosphoramidite. Polynucleotides may include a step of coupling a base by deposition of phosphoramidites under coupling conditions, where the same base is optionally deposited with the phosphoramidite more than once, i.e., double coupling. Polynucleotide synthesis may include capping of unreacted sites. In some examples, capping is optional. Polynucleotide synthesis may also include an oxidation or oxidation step. Polynucleotide synthesis may include degradation, detritylation, and sulfurization. In some examples, polynucleotide synthesis includes either oxidation or sulfurization. In some examples, at or between steps during the polynucleotide synthesis reaction, the device is washed, for example, using tetrazole or acetonitrile. The time frame for any one step in the phosphoramidite synthesis method may be less than about 2 minutes, 1 minute, 50 seconds, 40 seconds, 30 seconds, 20 seconds, and 10 seconds.

[0121] Polynucleotide synthesis using the phosphoramidite method may include the subsequent addition of phosphoramidite building blocks (e.g., nucleoside phosphoramidites) to a growing polynucleotide chain for the formation of a phosphite triester bond. Phosphoramidite polynucleotide synthesis proceeds in a 3' to 5' direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some examples, each synthesis cycle includes a coupling step. The phosphoramidite bond involves the formation of a phosphite triester bond between an activated nucleoside phosphoramidite and a nucleoside attached to a substrate, for example, by a linker. In some examples, the nucleoside phosphoramidite is provided to the device in an activated state. In some examples, the nucleoside phosphoramidite is provided to the device with an activator. In some examples, the nucleoside phosphoramidite is provided to the device in 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 or more times excess over the nucleoside bound to the substrate. In some examples, the addition of the nucleoside phosphoramidite is carried out in an anhydrous environment, for example, in anhydrous acetonitrile. Following the addition of the nucleoside phosphoramidite, the device is optionally washed. In some examples, the coupling step is repeated one or more additional times, optionally with a washing step between the addition of the nucleoside phosphoramidite to the substrate. In some examples, the polynucleotide synthesis method used herein comprises one, two, three or more consecutive coupling steps. Prior to coupling, the device-bound nucleoside is often deprotected by removal of a protecting group, which serves to prevent polymerization. A common protecting group is 4,4'-dimethoxytrityl (DMT).

[0122] Following coupling, phosphoramidite polynucleotide synthesis methods optionally include a capping step, in which the growing polynucleotide is treated with a capping agent. The capping step is useful for blocking unreacted substrate-bound 5'-OH groups from further chain elongation after coupling, thereby preventing the formation of polynucleotides with internal base deletions. In addition, 1H-tetrazole-activated phosphoramidites can react to a small extent with the O6 position of guanosine. Without being bound by theory, upon oxidation with I2 / water, this by-product will undergo depurination, presumably via O6-N7 migration. The depurinated site will eventually be cleaved during the final deprotection of the polynucleotide, thus reducing the yield of the full-length product. The O6 modification can be removed by treatment with a capping reagent prior to oxidation with I2 / water. In some instances, the inclusion of a capping step during polynucleotide synthesis reduces the error rate compared to synthesis without capping. In one example, the capping step involves treating the substrate-bound polynucleotides with a mixture of acetic anhydride and 1-methylimidazole.Following the capping step, the device is optionally washed.

[0123] In some examples, following addition of the nucleoside phosphoramidites, and optionally after capping and one or more washing steps, the growing nucleic acid bound to the device is oxidized. The oxidation step involves oxidation of the phosphite triester to a tetracoordinate phosphate triester, which is a protected precursor of the naturally occurring phosphodiester internucleoside linkage. In some examples, oxidation of the growing polynucleotide is accomplished by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation can be carried out under anhydrous conditions, for example, using tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following the oxidation. A second capping step allows drying of the device, since residual water from possible oxidation can inhibit subsequent coupling. After oxidation, the device and growing polynucleotide are optionally washed. In some instances, the oxidation step is replaced with a sulfurization step to obtain polynucleotide phosphorothioates, where a capping step can be performed after sulfurization. Many reagents allow efficient sulfur transfer, including but not limited to 3-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N'N'-tetraethylthiuram disulfide (TETD).

[0124] To allow subsequent cycles of nucleoside incorporation to occur via coupling, the protected 5' end of the growing polynucleotide bound to the device is removed, resulting in the primary hydroxyl group reacting with the next nucleoside phosphoramidite. In some instances, the protecting group is DMT, and degradation occurs with trichloroacetic acid in dichloromethane. Detritylation for extended periods or with stronger acid solutions than recommended may result in increased depurination of the polynucleotide bound to the solid carrier, thus reducing the yield of the desired full-length product. The disclosed methods and compositions described herein provide controlled degradation conditions that limit undesired depurination reactions. In some instances, the polynucleotide bound to the device is washed after degradation. In some instances, efficient washing after degradation contributes to the synthesis of polynucleotides with low error rates.

[0125] Methods for polynucleotide synthesis typically include a repeated sequence of the following steps: application of a protected monomer to an activated functionalized face (e.g., locus) for ligation with either the activated face, a linker, or a previously deprotected monomer; deprotection of the applied monomer to make it reactive with the subsequently applied protected monomer; and application of another protected monomer for ligation. One or more intermediate steps include oxidation or sulfurization. In some examples, one or more washing steps precede or follow one or all of the steps.

[0126] Methods for phosphoramidite-based polynucleotide synthesis include a series of chemical steps. In some examples, one or more steps of the synthesis method involve cycling of reagents, where one or more steps of the method include application of reagents useful for the process to a device. For example, the reagents are cycled through a series of liquid deposition and vacuum drying steps. For substrates that include three-dimensional features such as wells, microwells, channels, etc., the reagents are optionally passed through one or more regions of the device via the wells and / or channels.

[0127] The method and system described herein relate to a polynucleotide synthesis device for the synthesis of polynucleotides. The synthesis may be performed in parallel. For example, at least or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides may be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel can be 2-100000, 3-50000, 4-10000, 5-1000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, 30-35. Those skilled in the art will recognize that the total number of polynucleotides synthesized in parallel can be within any range bounded by any of these values, for example, 25-100. The total number of polynucleotides synthesized in parallel can be within any range defined by any of the values ​​that serve as the endpoints of the range. The total molar mass of the polynucleos synthesized in the device or the molar mass of each of the polynucleos can be at least, or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles, or more. The length of each of the polynucleotides in the device, or the average length of the polynucleotides, can be at least, or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more.The length of each of the polynucleotides in the device, or the average length thereof, can be at most, or at most, about 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each of the polynucleotides in the device, or the average length thereof, can be between 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25. One of skill in the art will recognize that the length of each of the polynucleotides in the device, or the average length thereof, can be within any range bounded by any of these values, for example, 100-300. The length of each of the polynucleotides in the device, or the average length thereof, can be within any range defined by any of the values ​​that serve as the endpoints of the range.

[0128] The method of polynucleotide synthesis on the surface provided herein allows for rapid synthesis.For example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides or more are synthesized per hour.Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or their analog / modified versions.In some examples, a library of polynucleotides is synthesized in parallel on a substrate. For example, a device comprising about or at least about 100; 1,000; 10,000; 30,000; 75,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 decomposed loci can support synthesis of at least as many distinct polynucleotides, with polynucleotides encoding distinct sequences being synthesized at the decomposed loci. In some examples, the polynucleotide library is synthesized on the device in less than about 3 months, 2 months, 1 month, 3 weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, or less, with low error rates as described herein. In some examples, larger nucleic acids assembled from polynucleotide libraries synthesized with low error rates using substrates and methods described herein are prepared in less than about 3 months, 2 months, 1 month, 3 weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, or less.

[0129] In some examples, the methods described herein provide for the generation of a library of polynucleotides comprising mutant polynucleotides that differ at multiple codon sites. In some examples, the polynucleotides can have one site, two sites, three sites, four sites, five sites, six sites, seven sites, eight sites, nine sites, ten sites, eleven sites, twelve sites, thirteen sites, fourteen sites, fifteen sites, sixteen sites, seventeen sites, eighteen sites, nineteen sites, twenty sites, thirty sites, forty sites, fifty sites, or more mutant codon sites.

[0130] In some instances, one or more of the mutation codon sites may be contiguous. In some instances, one or more of the mutation codon sites may be non-contiguous and separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codons.

[0131] In some instances, a polynucleotide may contain multiple sites of mutant codon sites, where all of the mutant codon sites are adjacent to each other, forming a mutant codon site spread. In some instances, a polynucleotide may contain multiple sites of mutant codon sites, where none of the mutant codon sites are adjacent to each other. In some instances, a polynucleotide may contain multiple sites of mutant codon sites, where some of the mutant codon sites are adjacent to each other, forming a mutant codon site spread, and some of the mutant codon sites are not adjacent to each other.

[0132] Referring to Figure 5, Figure 5 illustrates a typical processing workflow for the synthesis of nucleic acids (e.g., genes) from shorter polynucleotides. The workflow is generally divided into the following phases: (1) de novo synthesis of single-stranded polynucleotide libraries, (2) splicing of polynucleotides to form larger fragments, (3) error correction, (4) quality control, and (5) shipping. Prior to de novo synthesis, the intended nucleic acid sequence or a group of nucleic acid sequences is preselected. For example, a group of genes is preselected for production.

[0133] Once a large polynucleotide for production is selected, a predetermined library of polynucleotides is designed for de novo synthesis. Various suitable methods are known for the production of high density polynucleotide arrays. In an example workflow, a device surface layer (501) is provided. In an example, the surface chemistry is modified to improve the polynucleotide synthesis process. Areas of low surface energy are generated to repel liquids, while areas of high surface energy are generated to attract liquids. The surface itself may be planar in shape or may have variations in shape, such as protrusions or microwells that increase in surface area. In an example workflow, selected high surface energy molecules serve the dual function of supporting DNA chemistry, as disclosed in International Publication No. WO / 2015 / 021080, which application is incorporated herein by reference in its entirety.

[0134] In situ preparation of polynucleotide arrays is performed on solid supports and utilizes a single nucleotide extension process to extend multiple oligomers in parallel. A material deposition device, such as a polynucleotide synthesizer, is designed to release reagents in a stepwise manner such that multiple polynucleotides are extended in parallel, one reagent at a time to generate oligomers with a predetermined nucleic acid sequence (502). In some instances, the polynucleotides are cleaved from the surface at this stage. Cleavage includes gas cleavage, for example with ammonia or methylamine.

[0135] The generated polynucleotide library is placed in a reaction chamber. In this typical workflow, the reaction chamber (also called a "nanoreactor") is a silicon-coated well that contains PCR reagents and is lowered onto the polynucleotide library (503). Reagents are added to release the polynucleotides from the substrate before or after sealing the polynucleotides (504). In a typical workflow, the polynucleotides are released after sealing the nanoreactor (505). Once released, the single-stranded polynucleotide fragments hybridize to span the entire length of the DNA. Partial hybridization (505) is possible because each of the synthetic polynucleotides is designed to contain a small portion that overlaps at least one other polynucleotide in the population.

[0136] After hybridization, the PCR reaction is initiated. During polymerase cycles, polynucleotides anneal to complementary fragments and gaps are filled by the polymerase. Each cycle increases the length of the various fragments, depending randomly on whether the polynucleotides find each other. Complementarity between the fragments allows complete, large spans of double-stranded DNA to be formed (506).

[0137] After PCR is completed, the nanoreactor is separated from the device (507) and placed for interaction with a device with primers for PCR (508). After sealing, the nanoreactor is exposed to PCR (309) and the larger nucleic acid is amplified. After PCR (510), the nanochamber is opened (511), error correction reagents are added (512), the chamber is sealed (513), and an error correction reaction occurs (514) to remove poorly complementary mismatched base pairs and / or strands from the double-stranded PCR amplification product. The nanoreactor is opened and split (515). The error-corrected product is then exposed to additional processing steps such as PCR and molecular barcoding, and packaged (522) for shipping (523).

[0138] In some instances, quality control measurements are performed. After error correction, quality control steps include, for example, interacting the wafer with sequencing primers for amplification of the error-corrected product (516), sealing the wafer in a chamber containing the error-corrected amplification product (517), and performing additional cycles of amplification (518). The nanoreactor is opened (519), and the products are pooled (520) and sequenced (521). After a control decision of acceptable quality is made, the packaged product (522) is approved for shipment (523).

[0139] In some examples, nucleic acids generated by a workflow such as in Figure 5 are subjected to mutagenesis using overlapping primers as disclosed herein. In some examples, a library of primers is generated by in situ preparation on a solid support and utilizes a single nucleotide extension process to extend multiple oligomers in parallel. A material deposition device such as a polynucleotide synthesizer is designed to release reagents in a stepwise manner such that multiple polynucleotides are extended in parallel, one reagent at a time to generate oligomers having a predetermined nucleic acid sequence (502).

[0140] Large polynucleotide libraries have a low error rate.

[0141] The average error rate for polynucleotides synthesized in libraries using the provided systems and methods can be less than 1 in 1000, less than 1 in 1250, less than 1 in 1500, less than 1 in 2000, less than 1 in 3000, or less frequently. In some examples, the average error rate for polynucleotides synthesized in libraries using the provided systems and methods is less than 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, 1 / 1000, 1 / 1100, 1 / 1200, 1 / 1250, 1 / 1300, 1 / 1400, 1 / 1500, 1 / 1600, 1 / 1700, 1 / 1800, 1 / 1900, 1 / 2000, 1 / 3000, or less. In some examples, the average error rate for polynucleotides synthesized in libraries using the provided systems and methods is less than 1 / 1000.

[0142] In some examples, the total error rate for polynucleotides synthesized in libraries using the provided systems and methods is less than 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, 1 / 1000, 1 / 1100, 1 / 1200, 1 / 1250, 1 / 1300, 1 / 1400, 1 / 1500, 1 / 1600, 1 / 1700, 1 / 1800, 1 / 1900, 1 / 2000, 1 / 3000, or lower, compared to a predetermined sequence. In some examples, the total error rate for polynucleotides synthesized in libraries using the provided systems and methods is less than 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, or 1 / 1000. In some examples, the total error rate for polynucleotides synthesized in libraries using the provided systems and methods is less than 1 / 1000.

[0143] In some examples, error correction enzymes can be used on polynucleotides synthesized in libraries using the provided methods and systems that can be used. In some examples, the total error rate for polynucleotides with error correction can be less than 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, 1 / 1000, 1 / 1100, 1 / 1200, 1 / 1300, 1 / 1400, 1 / 1500, 1 / 1600, 1 / 1700, 1 / 1800, 1 / 1900, 1 / 2000, 1 / 3000, or less, compared to a predetermined sequence. In some examples, the total error rate for polynucleotides synthesized in libraries using the provided systems and methods can be less than 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, or less than 1 / 1000, compared to a predetermined sequence. In some examples, the total error rate for error correction for polynucleotides synthesized in a library using the systems and methods provided can be less than 1 / 1000.

[0144] Error rates can limit the value of gene synthesis for the generation of libraries of gene variants. At an error rate of 1 / 300, approximately 0.7% of clones in a 1500 base pair gene will be correct. Since most errors from polynucleotide synthesis result in frameshift mutations, more than 99% of the clones in such libraries will not produce full-length proteins. By reducing the error rate by 75%, the fraction of correct clones will increase by 40-fold. The methods and compositions of the present disclosure allow for large-scale oligonucleotides with lower error rates than commonly observed gene synthesis methods, both due to the improved quality of synthesis and the applicability of error correction methods that are enabled by the massively parallel and time-efficient method. Thus, the library may have no insertions, deletions, substitutions, or deletions of bases throughout the entire library, or over 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99% or more of the library. , 1 / 8000, 1 / 9000, 1 / 10000, 1 / 12000, 1 / 15000, 1 / 20000, 1 / 25000, 1 / 30000, 1 / 40000, 1 / 50000, 1 / 60000, 1 / 70000, 1 / 80000, 1 / 90000, 1 / 100000, 1 / 125000, 1 / 150000, 1 / 200000, 1 / 300000, 1 / 400000, 1 / 500000, 1 / 600000, 1 / 700000, 1 / 800000, 1 / 900000, 1 / 1000000, or less.The disclosed methods and compositions further relate to large scale synthetic polynucleotide and gene libraries with low error rates associated with at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99% or more of the polynucleotides or genes in at least a subset of the libraries associated with error-free sequences compared to predetermined / preselected sequences. In some examples, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99% or more of the polynucleotides or genes in an isolated amount in a library have the same sequence. In some instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99% or more of the polynucleotides or genes have the same sequence, associated with 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more similarity or identity. In some instances, the error rate associated with a particular locus on a polynucleotide or gene is optimized.Thus, any of the multiple selected loci of one or more polynucleotides or genes as part of a large library may each be 1 / 300, 1 / 400, 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, 1 / 1000, 1 / 1250, 1 / 1500, 1 / 2000, 1 / 2500, 1 / 3000, 1 / 4000, 1 / 5000, 1 / 6000, 1 / 7000, 1 / 8000, 1 / 9000, 1 / 10000, 1 / 12000, 1 / 14000, 1 / 16000, 1 / 2000, 1 / 3000, 1 / 4000, 1 / 5000, 1 / 6000, 1 / 7000, 1 / 8000, 1 / 9000, 1 / 10000, 1 / 12 ... In some embodiments, the present invention may have an error rate of less than 1 / 15000, 1 / 20000, 1 / 25000, 1 / 30000, 1 / 40000, 1 / 50000, 1 / 60000, 1 / 70000, 1 / 80000, 1 / 90000, 1 / 100000, 1 / 125000, 1 / 150000, 1 / 200000, 1 / 300000, 1 / 400000, 1 / 500000, 1 / 600000, 1 / 700000, 1 / 800000, 1 / 900000, 1 / 1000000, or even lower. In various examples, such error-optimized loci include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 7000, 7500, 7600, 7700, 780 The sequence may include 00, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000, 50000, 75000, 100000, 500000, 1000000, 2000000, 3000000, or more loci. The error-optimized loci are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4 The present invention may be distributed among 00, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000, 75000, 100000, 500000, 1 million, 2 million, 3 million, 4 million, 5 million, 6 million, 7 million, 8 million, 9 million, 10 million, 10 million, 15 million, 20 million, 25 million, 30 million, 40 million, 50 million, 60 million, 70 million, 80 million, 90 million, 10 million, 30 million, 40 million, 50 million, 60 million, 70 million, 80 million, 90 million,

[0145] The error rate may be achieved with or without error correction. The error rate may be achieved across the entire library, or across 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99% or more of the library.

[0146] Computer Systems

[0147] Any of the systems described herein may be operatively connected to a computer and automated through a computer, either locally or remotely. In various examples, the methods and systems of the present disclosure further include software programs and their use in a computer system. Thus, computer control for synchronization of dispense / vacuum / refill functions, such as orchestration and synchronization of material deposition device movement, dispense operations, and vacuum activation, is within the scope of the present disclosure. The computer system may be programmed to interface user-specific base sequences and positions of the material deposition device to deliver the correct reagent to a particular region of the substrate.

[0148] The computer system (600) illustrated in FIG. 6 may be understood as a logical device that can read instructions from a medium (611) and / or a network port (605), which may optionally be connected to a server (609) having a fixed medium (612). A system such as the one illustrated in FIG. 6 may include a CPU (601), a disk drive (603), optional input devices such as a keyboard (615) and / or a mouse (616), and an optional monitor (607). Data communication may arrive through the illustrated communication medium to a server at a local or remote location. The communication medium may include any means of transmitting and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection may provide communication through the World Wide Web. It is envisioned that data related to the present disclosure may be transmitted through such a network or connection for receipt and / or verification by a party (622) as illustrated in FIG. 6.

[0149] FIG. 7 is a block diagram illustrating a first example architecture of a computer system (700) that can be used in connection with an example example of the present disclosure. As shown in FIG. 7, the example computer system can include a processor (702) for processing instructions. Non-limiting examples of processors include: Intel Xeon™ processors, AMD Opteron™ processors, Samsung 32-bit RISC ARM 1176JZ(F)-Sv1.0™ processors, ARM Cortex-A8 Samsung S5PC100™ processors, ARM Cortex-A8 Apple A4™ processors, Marvell PXA 930™ processors, or functionally equivalent processors. Multiple threads of execution can be used for parallel processing. In some examples, multiple processors, or processors with multiple cores, can also be used in a single computer system or in a cluster, or distributed throughout a system including multiple computers, mobile phones, and / or personal data assistant devices over a network.

[0150] As illustrated in FIG. 7, a high speed cache (704) may be connected to or incorporated into the processor (702) to provide high speed memory for instructions or data that have been recently or frequently used by the processor (702). The processor (702) is connected to a north bridge (706) by a processor bus (708). The north bridge (706) is connected to a random access memory (RAM) (710) by a memory bus (712) and manages access to the RAM (710) by the processor (702). The north bridge (706) is also connected to a south bridge (714) by a chipset bus (716). The south bridge (714) is in turn connected to a peripheral bus (718). The peripheral bus may be, for example, a PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge, often referred to as the processor chipset, manage data transfers between the processor, RAM, and peripheral components on the peripheral bus (718). In some alternative architectures, the northbridge functionality may be incorporated into the processor instead of using a separate northbridge chip. In some examples, the system (700) may include an accelerator card (722) attached to the peripheral bus (718). The accelerator may include a field programmable gate array (FPGA) or other hardware for accelerating specific processes. For example, the accelerator may be used for adaptive data reconstruction or to evaluate algebraic expressions used in extended configuration processing.

[0151] Software and data may be stored in external storage (724) and loaded into RAM (710) and / or cache (704) for use by the processor. System (700) includes an operating system for managing system resources, non-limiting examples of which include Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally equivalent operating systems, as well as application software running on the operating system for managing data storage and optimization according to example cases of the present disclosure. In this example, system (700) also includes network interface cards (NICs) (720) and (721) connected to the peripheral bus for providing a network interface to external storage, such as network attached storage (NAS), and other computer systems usable for distributed parallel processing.

[0152] FIG. 8 illustrates a network 800 including multiple computer systems 802a and 802b, multiple mobile phones and personal data assistants 802c, and network attached storage (NAS) 804a and 804b. In an exemplary embodiment, systems 802a, 802b, and 802c can manage data storage and optimize data access for data stored in network attached storage (NAS) 804a and 804b. Mathematical models can be applied to the data and evaluated using distributed parallel processing across computer systems 802a and 802b, and mobile phone and personal data assistant system 802c. Computer systems 802a and 802b, and mobile phone and personal data assistant system 802c can also provide parallel processing for adaptive data restructuring of data stored in network attached storage (NAS) 804a and 804b. FIG. 8 illustrates only one example, and a wide variety of other computer architectures and systems may be used with various examples of the present disclosure. For example, a blade server may be used to provide parallel processing. Processor blades may be connected through a backplane to provide parallel processing. Storage may also be connected to the backplane, or may be connected through another network interface as network attached storage (NAS). In some example cases, processors may maintain separate memory spaces and send data through a network interface, backplane, or other connector for parallel processing by other processors. In other examples, some or all of the processors may use a shared virtual address memory space.

[0153] FIG. 9 is a block diagram of a multiprocessor computer system (900) using a shared virtual address memory space according to an example case. The system includes multiple processors (902a-f) that can access a shared memory subsystem (904). The system incorporates multiple programmable hardware memory algorithm processors (MAPs) (906a-f) into the memory subsystem (904). Each MAP (906a-f) can include memory (908a-f) and one or more field programmable gate arrays (FPGAs) (910a-f). The MAPs provide configurable functional units, whereby specific algorithms or portions of algorithms can be provided to the FPGAs (910a-f) for processing in close cooperation with the respective processors. For example, the MAPs can be used to evaluate algebraic expressions over a data model, and in the example case, to perform adaptive data restructuring. In this example, each MAP is globally accessible by all processors for these purposes. In one configuration, each MAP can use direct memory access (DMA) to access associated memory (908a-f), allowing it to perform tasks independently of and asynchronously with its respective microprocessor (902a-f). In this configuration, a MAP can feed results directly to another MAP for pipelined and parallel execution of algorithms.

[0154] The above computer architectures and systems are merely examples, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems may be used in connection with the example cases, including systems using any combination of general processors, coprocessors, FPGAs and other programmable logic devices, systems on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements. In some examples, all or part of the computer system may be implemented in software or hardware. Any type of data storage media may be used in connection with the example cases, including random access memory, hard drives, flash memory, tape drives, disk arrays, network attached storage (NAS), and other local or distributed data storage devices and systems.

[0155] In example cases, the computer system may be implemented using software modules executed in any of the above or other computer architectures and systems. In other examples, the functionality of the system may be implemented partially or fully in firmware, programmable logic devices such as field programmable gate arrays (FPGAs) as referenced in FIG. 9, systems on chips (SOCs), application specific integrated circuits (ASICs), or other processing and logic elements, etc. For example, the Set Processor and Optimizer may be implemented with hardware acceleration through the use of a hardware accelerator card, such as the accelerator card (722) illustrated in FIG. 7.

[0156] Additional Methods and Compositions

[0157] Provided herein is a method for generating a polynucleotide library, the method comprising: providing a predetermined sequence encoding at least about 5000 non-identical polynucleotides; providing a structure having a surface, the surface comprising a plurality of clusters; synthesizing at least about 5000 non-identical polynucleotides, each of the at least 5000 non-identical polynucleotides extending a different locus; and amplifying the at least 5000 non-identical polynucleotides to form a polynucleotide library, wherein more than about 80 percent of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 2-fold of the average representation for the polynucleotide library.Further provided herein is a method, wherein more than about 80 percent of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the polynucleotide library.Further provided herein is a method, wherein more than about 90 percent of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 2-fold of the average representation for the polynucleotide library. Further provided herein are methods in which more than about 90 percent of the at least 5000 non-identical polynucleotides are represented within at least about 1.5-fold of the average representation for the polynucleotide library. Further provided herein are methods in which the polynucleotide library contains fewer dropouts compared to amplification products from methods using structures with non-clustered locus faces. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides contain polynucleotides with at least about 10% GC ratio. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides contain polynucleotides with at most 95% GC ratio. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides contain polynucleotides with about 10% to about 95% GC ratio.Further provided herein are methods in which more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides with a GC percentage of 10% to 30% or 70% to 90%. Further provided herein are methods in which less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides with a GC percentage of 10% to 30% or 60% to 90%. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides comprise polynucleotides with a repeat sequence percentage of at least about 10%. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides comprise polynucleotides with a repeat sequence percentage of at most 95%. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides comprise polynucleotides with a repeat sequence percentage of about 10% to about 95%. Further provided herein are methods in which more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides with a repeat sequence percentage of 10% to 30% or 70% to 90%. Further provided herein are methods in which less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides with a repeat sequence percentage of 10% to 30% or 60% to 90%. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides comprise polynucleotides with a secondary structure percentage of at least about 10%. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides comprise polynucleotides with a secondary structure percentage of at most 95%. Further provided herein are methods in which the at least about 5000 non-identical polynucleotides comprise polynucleotides with a secondary structure percentage of about 10% to about 95%. Further, in the methods provided herein, greater than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a percentage of secondary structure between 10% and 30% or between 70% and 90%.Further provided herein is a method, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure percentage of 10% to 30% or 60% to 90%. Further provided herein is a method, wherein the polynucleotide library encodes a variant library. Further provided herein is a method, wherein the at least 5000 non-identical polynucleotide library encodes at least one gene. Further provided herein is a method, wherein the at least 5000 non-identical polynucleotide library encodes at least 50 genes. Further provided herein is a method, wherein the polynucleotide library encodes at least one gene. Further provided herein is a method, wherein the polynucleotide library encodes at least a portion of an antibody, enzyme, or peptide. Further provided herein is a method, wherein the polynucleotide library has a total error rate of less than 1 in 500 bases compared to a predetermined sequence without error correction. Further provided herein is a method, wherein the polynucleotide library has a total error rate of less than 1 in 1000 bases compared to a predetermined sequence without error correction. Further provided herein are methods, wherein the predetermined sequences encode at least 700,000 non-identical polynucleotides. Further provided herein are methods, wherein each cluster comprises 50 to about 500 loci for polynucleotide synthesis. Further provided herein are methods, wherein each cluster comprises up to about 500 loci for polynucleotide synthesis.

[0158] Provided herein is a method for generating a polynucleotide library, the method includes: providing a predetermined sequence encoding at least about 5000 non-identical polynucleotides; providing a structure having a surface, the surface comprising a plurality of clusters; synthesizing at least about 5000 non-identical polynucleotides, each of the at least 5000 non-identical polynucleotides extending a different locus; and amplifying at least 5000 non-identical polynucleotides to form a polynucleotide library, the polynucleotide library having a correct sequence ratio of greater than 75% after the amplification reaction.Further provided herein is a method, the polynucleotide library having a correct sequence ratio of greater than 85% after the amplification reaction.Further provided herein is a method, the at least about 5000 non-identical polynucleotides include polynucleotides having a GC ratio of at least about 10%.Further provided herein is a method, the at least about 5000 non-identical polynucleotides include polynucleotides having a GC ratio of at most 95%. Further provided herein, the at least about 5000 non-identical polynucleotides comprise polynucleotides with a GC percentage of about 10% to about 95%. Further provided herein, the at least about 5000 non-identical polynucleotides comprise more than about 30% polynucleotides with a GC percentage of 10% to 30% or 70% to 90%. Further provided herein, the at least about 5000 non-identical polynucleotides comprise less than about 15% polynucleotides with a GC percentage of 10% to 30% or 60% to 90%. Further provided herein, the polynucleotide library comprises fewer dropouts compared to the amplification products from the method using a structure with a surface of non-clustered loci. Further provided herein, the polynucleotide library encodes a variant library. Further provided herein, the polynucleotide library encodes at least one gene.Further provided herein is a method, wherein the polynucleotide library encodes at least a portion of an antibody, enzyme, or peptide. Further provided herein is a method, wherein the polynucleotide library has a total error rate of less than 1 in 500 bases compared to a predetermined sequence without error correction. Further provided herein is a method, wherein the polynucleotide library has a total error rate of less than 1 in 1000 bases compared to a predetermined sequence without error correction. Further provided herein is a method, wherein the predetermined sequence encodes at least 700,000 non-identical polynucleotides. Further provided herein is a method, wherein the at least 5000 non-identical polynucleotides encode at least one gene. Further provided herein is a method, wherein the at least 5000 non-identical polynucleotides encode at least 50 genes. Further provided herein is a method, wherein each cluster comprises 50 to about 500 loci for polynucleotide synthesis. Further provided herein is a method, wherein each cluster comprises up to about 500 loci for polynucleotide synthesis.

[0159] Provided herein is a nucleic acid library comprising at least 5000 non-identical polynucleotides, wherein the at least 5000 non-identical polynucleotides are amplification products of synthesized polynucleotides, and wherein more than about 80% of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 2-fold of the average representation for the nucleic acid library. Further provided herein is a nucleic acid library, wherein more than about 80% of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the nucleic acid library. Further provided herein is a nucleic acid library, wherein more than about 90% of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 2-fold of the average representation for the nucleic acid library. Further provided herein is a nucleic acid library, wherein more than about 90% of the at least 5000 non-identical polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the nucleic acid library. Further provided herein is a nucleic acid library, wherein the nucleic acid library comprises fewer dropouts compared to amplification products from a method using a structure having faces of non-clustered loci. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC percentage of at least about 10%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC percentage of at most 95%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC percentage of about 10% to about 95%. Further provided herein is a nucleic acid library, wherein more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC percentage of 10% to 30% or 70% to 90%. Further provided herein is a nucleic acid library, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC percentage of 10% to 30% or 60% to 90%.Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence percentage of at least about 10%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence percentage of at most 95%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence percentage of about 10% to about 95%. Further provided herein is a nucleic acid library, wherein more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence percentage of 10% to 30% or 70% to 90%. Further provided herein is a nucleic acid library, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence percentage of 10% to 30% or 60% to 90%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure percentage of at least about 10%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure percentage of at most 95%. Further provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure percentage of about 10% to about 95%. Further provided herein is a nucleic acid library, wherein more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure percentage of 10% to 30% or 70% to 90%. Further provided herein is a nucleic acid library, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure percentage of 10% to 30% or 60% to 90%. Further provided herein is a nucleic acid library, wherein the polynucleotide library encodes a variant library.Further provided herein is a nucleic acid library, wherein the at least 5000 non-identical polynucleotides encode at least one gene. Further provided herein is a nucleic acid library, wherein the at least 5000 non-identical polynucleotides encode at least 50 genes. Further provided herein is a nucleic acid library, wherein the polynucleotide library encodes at least a portion of an antibody, an enzyme, or a peptide. Further provided herein is a nucleic acid library, wherein the predetermined sequences encode at least 700,000 non-identical polynucleotides.

[0160] Provided herein is a nucleic acid library comprising at least 5000 non-identical polynucleotides, wherein the GC content is controlled, and the library provides a correct sequence ratio of greater than 75% after an amplification reaction. Provided herein is a nucleic acid library having a correct sequence ratio of greater than 85% after an amplification reaction. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC ratio of at least about 10%. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC ratio of at most 95%. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC ratio of about 10% to about 95%. Provided herein is a nucleic acid library, wherein more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC ratio of 10% to 30% or 70% to 90%. Further provided herein is a nucleic acid library, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a GC percentage of 10% to 30%, or 60% to 90%.

[0161] Provided herein is a nucleic acid library comprising at least 5000 non-identical polynucleotides, wherein the repeat sequence content is controlled, and the library provides a sequence accuracy ratio of greater than 75% after an amplification reaction. Provided herein is a nucleic acid library, wherein the polynucleotide library has a sequence accuracy ratio of greater than 85% after an amplification reaction. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence ratio of at least about 10%. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence ratio of at most 95%. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence ratio of about 10% to about 95%. Provided herein is a nucleic acid library, wherein more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence ratio of 10% to 30% or 70% to 90%. Further provided herein is a nucleic acid library, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a percentage of repeat sequences between 10% and 30%, or between 60% and 90%.

[0162] Provided herein is a nucleic acid library comprising at least 5000 non-identical polynucleotides, wherein the secondary structure content encoded by the at least 5000 non-identical polynucleotides is preselected, and the library provides a correct sequence ratio of greater than 75% after an amplification reaction. Provided herein is a nucleic acid library, wherein the nucleic acid library has a correct sequence ratio of greater than 85% after an amplification reaction. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure ratio of at least about 10%. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure ratio of at most 95%. Provided herein is a nucleic acid library, wherein the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure ratio of about 10% to about 95%. Provided herein is a nucleic acid library, wherein more than about 30% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a secondary structure ratio of 10% to 30% or 70% to 90%. Further provided herein is a nucleic acid library, wherein less than about 15% of the at least about 5000 non-identical polynucleotides comprise polynucleotides having a repeat sequence ratio of 10% to 30% or 60% to 90%. Further provided herein is a nucleic acid library encoding a variant library. Further provided herein is a nucleic acid library encoding at least one gene. Further provided herein is a nucleic acid library encoding at least a portion of an antibody, enzyme, or peptide. Further provided herein is a nucleic acid library having a total error rate of less than 1 in 500 bases compared to a predetermined sequence without error correction. Further provided herein is a nucleic acid library having a total error rate of less than 1 in 1000 bases compared to a predetermined sequence without error correction. Further provided herein is a nucleic acid library, wherein the predetermined sequence encodes at least 700,000 non-identical polynucleotides.Further provided herein is a nucleic acid library, wherein the at least 5000 non-identical polynucleotides encode at least one gene. Further provided herein is a nucleic acid library, wherein the at least 5000 non-identical polynucleotides encode at least 50 genes.

[0163] Provided herein is a method for amplifying a polynucleotide library, the method comprising: obtaining an amplification distribution for at least 5000 non-identical polynucleotides; clustering the at least 5000 non-identical polynucleotides of the amplification distribution into two or more bins based on at least one sequence feature; and adjusting the representation for synthesis of each of the non-identical polynucleotides based on the frequency count of the at least 5000 non-identical polynucleotides in each of the two or more bins to generate a polynucleotide library with a preselected representation; synthesizing the polynucleotide library with the preselected representation; and amplifying the polynucleotide library with the preselected representation. Further provided herein is a method, in which the at least one sequence feature is a percent GC content. Further provided herein is a method, in which the at least one sequence feature is a percent repetitive sequence content. Further provided herein is a method, in which the at least one sequence feature is a percent secondary structure content. Further provided herein is a method, in which the repetitive sequence comprises three or more adenines. Further provided herein is a method, in which the repetitive sequence is at one or both ends of the polynucleotide. In further provided herein, the polynucleotides are clustered into bins based on the affinity of one or more polynucleotide sequences to bind target sequences. In further provided herein, the number of sequences in the bottom 30% of a bin has at least 50% more representation in downstream applications after adjustment compared to the number of sequences in the bottom 30% of a bin before adjustment. In further provided herein, the number of sequences in the top 30% of a bin has at least 50% more representation in downstream applications after adjustment compared to the number of sequences in the top 30% of a bin before adjustment. In further provided herein, the amplification distribution is obtained empirically. In further provided herein, the amplification distribution is obtained through a predictive algorithm. In some examples, the adjustment comprises controlling the stoichiometry of the polynucleotides in the library.

[0164] Provided herein is a nucleic acid library comprising at least 100,000 non-identical polynucleotides, each non-identical polynucleotide encoding at least one different exome sequence, and at least about 80% of the at least 100,000 non-identical polynucleotides are each present in the polynucleotide library at an amount within 2x of the average frequency for each non-identical polynucleotide in the library. Also provided herein is a nucleic acid library, the nucleic acid library is an amplicon library, and at least about 80% of the non-identical polynucleotides are each present in the amplicon library at an amount within 2x of the average frequency for each non-identical polynucleotide in the library. Also provided herein is a nucleic acid library, the library is sequenced at a theoretical read depth of up to 55 times, resulting in at least 90% of the bases having a read depth of at least 30 times. Also provided herein is a nucleic acid library, the library is sequenced at a theoretical read depth of up to 55 times, resulting in at least 98% of the bases having a read depth of at least 10 times.

[0165] Provided herein is a method for synthesizing a polynucleotide library, the method comprising: (a) providing at least 100,000 non-identical polynucleotides with predetermined sequences, each non-identical polynucleotide encoding one or more portions of genomic DNA; (b) synthesizing at least 100,000 non-identical polynucleotides; and (c) amplifying at least 100,000 non-identical polynucleotides to generate a library of polynucleotides, wherein at least about 75% of the polynucleotides of the library are error-free compared to the predetermined sequences for the at least 100,000 non-identical polynucleotides.Further provided herein is a method, in which the polynucleotide library is an amplicon library, and at least about 80% of the plurality of non-identical polynucleotides are present in the amplicon library at an amount within 2x of the average frequency for the non-identical polynucleotides of the library.Further provided herein is a method, in which each non-identical polynucleotide encodes one or more exons.Further provided herein is a method, in which each amplified non-identical polynucleotide comprises at least one molecular tag.

[0166] Provided herein is a method for synthesis of a polynucleotide library, the method comprising: (a) amplifying a first library of at least 2,000 non-identical polynucleotides; (b) determining the distribution of sequences in the first library as a function of one or more sequence features; and (c) modifying the relative proportions of sequences in the first library based on the distribution of sequences to generate a second library, whereby 2.5x or less sampling of the second library results in at least 80% coverage. Further provided herein is a method, wherein the one or more sequence features comprises percent GC content. Further provided herein is a method, wherein the one or more sequence features comprises percent repeat content. Further provided herein is a method, wherein the one or more sequence features comprises percent secondary structure content. Further provided herein is a method, wherein the one or more sequence features comprises sequencing coverage. Further provided herein is a method, wherein 1.7x or less sampling results in at least 80% sequencing coverage. Further provided herein is a method, wherein 2.5x or less sampling results in at least 90% sequencing coverage. Further provided herein are methods, the method further comprising synthesizing a second library. Further provided herein are methods, the method further comprises amplifying the second library. Further provided herein are methods, the library comprises at least 5,000 polynucleotides. Further provided herein are methods, the library comprises at least 10,000 polynucleotides. Further provided herein are methods, the library comprises at least 30,000 polynucleotides.

[0167] Provided herein is a method for target enrichment, comprising: contacting a library of at least 2,000 non-identical double-stranded polynucleotides with a population of sample polynucleotides comprising a target nucleic acid, each of the at least 2,000 non-identical polynucleotides comprising (5' to 3') a first non-target sequence and a second non-target sequence, and an insert sequence complementary to one or more target nucleic acid sequences; capturing a target nucleic acid sequence that hybridizes to one or more of the at least 2,000 non-identical polynucleotides on a solid support; and releasing the captured target nucleic acid to generate a target polynucleotide library. Further provided herein is a method, in which each polynucleotide further comprises at least one molecular tag. Further provided herein is a method, in which each non-identical sequence further comprises a primer binding site. Further provided herein is a method, in which the first non-target sequence is located at the 5' end of the polynucleotide, and the second non-target sequence is located at the 3' end of the polynucleotide. Further provided herein are methods, wherein the one or more molecular tags are attached to the 5' end of the polynucleotide. Further provided herein are methods, wherein the one or more molecular tags are attached to the 3' end of the polynucleotide. Further provided herein are methods, wherein the one or more molecular tags and the polynucleotide are linked by a spacer. Further provided herein are methods, wherein the insertion sequence is complementary to at least one exon. Further provided herein are methods, wherein the one or more molecular tags are biotin, folic acid, polyhistidine, FLAG tag, or glutathione. Further provided herein are methods, wherein the one or more molecular tags are two biotin molecules. Further provided herein are methods, wherein the solid support is a magnetic bead. Further provided herein are methods, wherein the first non-target sequence and the second non-target sequence are 20-40 bases in length. Further provided herein are methods, wherein the insertion sequence is 90-200 bases in length. Further provided herein are methods, wherein the library comprises at least 5,000 polynucleotides.Further provided herein are methods wherein the library comprises at least 10,000 polynucleotides.Further provided herein are methods wherein the library comprises at least 30,000 polynucleotides.

[0168] Provided herein is a probe library comprising a plurality of partially complementary double-stranded polynucleotides, each comprising: a first polynucleotide comprising a first non-target sequence and a second non-target sequence, and a first insert sequence complementary to one or more target nucleic acid sequences; a second polynucleotide comprising the first non-target sequence and a second non-target sequence, and a second insert sequence complementary to the first insert sequence, wherein the first polynucleotide and the second polynucleotide are partially hybridized. Further provided herein is a library, wherein each strand of the double-stranded polynucleotide further comprises at least two molecular tags. Further provided herein is a library, wherein the first non-target sequence and the second non-target sequence are not complementary. Further provided herein is a library, wherein the first non-target sequence is located at the 5' end of the polynucleotide, and the second non-target sequence is located at the 3' end of the polynucleotide. Further provided herein is a library, wherein one or more molecular tags are attached to the 5' end of the polynucleotide. Further provided herein is a library, wherein the one or more molecular tags are attached to the 3' end of the polynucleotide. Further provided herein is a library, wherein the one or more molecular tags and the polynucleotide are linked by a spacer. Further provided herein is a library, wherein the insertion sequence is complementary to at least one exon. Further provided herein is a library, wherein the one or more molecular tags are biotin, folic acid, polyhistidine, FLAG tag, or glutathione. Further provided herein is a library, wherein the one or more molecular tags are two biotin molecules. Further provided herein is a library, wherein the solid support is a magnetic bead. Further provided herein is a library, wherein the first non-target sequence and the second non-target sequence are 20-40 bases in length. Further provided herein is a library, wherein the insertion sequence is 90-200 bases in length.

[0169] Provided herein is a method for designing a probe library, the method comprising: obtaining a library of target sequences; and designing a library of insert sequences that are complementary to the target sequences, the designing comprising: if the target sequence is shorter in length than the insert sequence, generating an insert sequence that is complementary to the target sequence; if the target sequence is shorter in length than the insert sequence+X, generating an insert sequence that is at least partially complementary to the target sequence; or if the target sequence is longer than the insert sequence+X, generating a set of insert sequences that are at least partially complementary to a common target sequence, where X is the number of consecutive bases that are not targeted by the insert sequence; repeating step (b) for each target sequence in the library to generate a library of insert sequences. Further provided herein is a method, in which X is less than 30 nucleotides. Further provided herein is a method, in which X is less than 10 nucleotides. Further provided herein is a method, in which X is about 6 nucleotides.

[0170] Provided herein is a method for next-generation sequencing, the method comprising: contacting a sample containing a plurality of target polynucleotides with a library described herein; enriching at least one target polynucleotide that binds to the library; and sequencing the at least one enriched target polynucleotide.

[0171] Provided herein is a method for next-generation sequencing, the method comprising: contacting a sample containing a plurality of polynucleotides with a library described herein; separating at least one polynucleotide in the sample that binds to the library from at least one polynucleotide that does not bind to the library; and sequencing the at least one polynucleotide that does not bind to the library. EXAMPLES

[0172] The following examples are given for the purpose of illustrating various embodiments of the present invention and are not intended to limit the present invention in any manner. The examples, together with the methods described herein, are currently representative of preferred embodiments, are exemplary, and are not intended to limit the scope of the present invention. Modifications therein and other uses encompassed within the spirit of the present invention as defined by the scope of the claims will occur to those skilled in the art.

[0173] Example 1: Substrate surface functionalization

[0174] The substrate was functionalized to support the attachment and synthesis of libraries of polynucleotides. The substrate surface was first wet cleaned using a piranha solution containing 90% H2SO4 and 10% H2O2 for 20 min. The substrate was rinsed in several beakers with DI water, held under a gooseneck plug of DI water for 5 min, and dried with N2. The substrate was then immersed in NH4OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a pistol, immersed in each of these three successive beakers with DI water for 1 min, and then rinsed again with DI water using a pistol. The device was then plasma cleaned by exposing the substrate surface to O2. Plasma etching was performed with O2 at 250 watts for 1 min in downstream mode using a SAMCO PC-300 instrument.

[0175] The cleaned substrate surface was actively functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P deposition oven system with the following parameters: 0.5-1 Torr, 70°C for 60 minutes, vaporizer at 135°C. The substrate surface was resist coated using a Brewer Science 200X spin coater. SPR™ 3612 photoresist was spin coated onto the substrate at 2500 rpm for 40 seconds. The substrate was pre-baked at 90°C for 30 minutes on a Brewer hotplate. The substrate was exposed to photolithography using a Karl Suss MA6 mask aligner. The substrate was exposed for 2.2 seconds and developed with MSF 26A for 1 minute. The remaining developer was rinsed with a pistol and the substrate was immersed in water for 5 minutes. The substrates were baked in an oven for 30 minutes at 100°C and then visually inspected for lithographic defects using a Nikon L200. A descum process was used to remove the remaining resist using a SAMCO PC-300 tool for O2 plasma etching at 250 watts for 1 minute.

[0176] The substrate surface was passively functionalized with 100 μl of perfluorooctyltrichlorosilane solution mixed with 10 μL of light mineral oil. The substrate was placed in the chamber and pumped for 10 minutes, after which the pump was valved off and allowed to stand for 10 minutes. The chamber was vented to air. Resist stripping was performed by immersing the substrate in 500 mL of NMP twice for 5 minutes at 70°C using sonication at maximum power (9 on the Crest system). The substrate was then immersed in 500 mL of isopropanol for 5 minutes at room temperature using sonication at maximum power. The substrate was immersed in 300 mL of 200 proof ethanol and blown dry with N2. The functionalized surface was activated to act as a support for polynucleotide synthesis.

[0177] Example 2: Synthesis of 50-mer sequences on a polynucleotide synthesis device

[0178] The two-dimensional polynucleotide synthesis device was assembled into a flow cell, which was then connected to a flow cell (Applied Biosystems (ABI394 DNA Synthesizer)). The two-dimensional polynucleotide synthesis device was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (Gelest) and used to synthesize a typical polynucleotide of 50 bp ("50-mer polynucleotide") using the polynucleotide synthesis method described herein.

[0179] The 50-mer sequence is as set forth in SEQ ID NO.:1.5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (SEQ ID NO.:1), where # represents thymidine-succinylhexanamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker that allows release of the polynucleotide from the surface during deprotection.

[0180] The synthesis was carried out according to the protocol in Table 1 and on an ABIABI synthesizer using standard DNA synthesis chemistry (coupling, capping, oxidation and degradation).

[0181] [Table 1-1]

[0182] [Table 1-2]

[0183] The phosphoramidite / activator combination was delivered similarly to the bulk delivery of reagents through a flow cell, with no drying step being performed as the environment remained "wet" with reagents throughout.

[0184] To allow for faster flows, the flow restrictor was removed from the ABI 394 synthesizer. Without flow restrictors, the flow rates for amidite (0.1M in ACN), activator (0.25M benzoylthiotetrazole ("BTT"; 30-3070-xx from GlenResearch) in ACN, and OX (0.02M I2 in 20% pyridine 10% water, and 70% THF) were approximately ~100uL / sec, for acetonitrile ("ACN") and capping reagent (a 1:1 mixture of CapA and CapB, where CapA is acetic anhydride in THF / pyridine and CapB is 16% 1-methylimidizole in THF), and for Deblock (3% dichloroacetic acid in toluene) were approximately ~300uL / sec (compared to ~50uL / sec for all reagents with flow restrictors). The time it took for the oxidant to be completely pushed out was observed, the timing of the chemical flow times was adjusted accordingly, and an extra ACN wash was introduced between different chemicals. After polynucleotide synthesis, the chip was deprotected with gaseous ammonia at 75 psi overnight. Five drops of water were applied to the surface to recover the polynucleotides. The recovered polynucleotides were then analyzed on a BioAnalyzer mini RNA chip (data not shown).

[0185] Example 3: Synthesis of 100-mer sequences on a polynucleotide synthesis device

[0186] Using the same process as described in Example 2 for the synthesis of the 50-mer sequence, a 100-mer oligonucleotide ("100-mer polynucleotide"; 5'CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3', where # denotes thymidine-succinylhexanamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.:2) was synthesized on two different silicon chips, the first one functionalized uniformly with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide and the second one functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the polynucleotides extracted from the surfaces were analyzed on a BioAnalyzer instrument (data not shown).

[0187] All 10 samples from the two chips were further PCR amplified using the forward primer (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO.:3) and reverse primer (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO.:4) in 50 uL PCR mixture (25 uL NEB Q5 master mix, 2.5 uL 10 uM forward primer, 2.5 uL 10 uM reverse primer, 1 uL polynucleotide extracted from the surface, and up to 50 uL water) with the following thermal cycling program: 98C, 30 seconds 98C, 10 sec; 63C, 10 sec; 72C, 10 sec; repeat for 12 cycles 72C, 2 minutes

[0188] The PCR products were also analyzed on a BioAnalyzer (data not shown) and demonstrated a sharp peak at the 100-mer position. The PCR amplified samples were then cloned and Sanger sequenced. Table 2 summarizes the Sanger sequencing results for samples taken from spots 1-5 from chip 1 and spots 6-10 from chip 2.

[0189] [Table 2]

[0190] Thus, the high quality and uniformity of the synthetic polynucleotides was replicated on two chips using different surface chemistries. Overall, 89%, corresponding to 233 out of 262 sequenced 100-mers, were perfect sequences without errors.

[0191] Finally, Table 3 summarizes the error profile for sequences obtained from polynucleotide samples from spots 1-10.

[0192] [Table 3]

[0193] Example 4: Parallel assembly of 29,040 unique polynucleotides

[0194] As shown in FIG. 10, a structure was fabricated with 256 clusters (1005) each containing 121 loci on a flat silicon plate (1001). A close-up of the clusters is shown (1010) with the 121 loci. Loci from 240 of the 256 clusters provided attachment and support for the synthesis of polynucleotides with distinct sequences. Polynucleotide synthesis was performed by phosphoramidite chemistry using the general method from Example 3. Loci from 16 of the 256 clusters were control clusters. The overall distribution of the 29,040 unique polynucleotides synthesized (240×121) is shown in FIG. 11A. The polynucleotide library was synthesized with high uniformity. 90% of the sequences were present in the signal within 4× of the average, allowing for 100% representation. The distribution was measured per cluster, as shown in FIG. 11B. The distribution of unique polynucleotides synthesized in four representative clusters is shown in Figure 12. At the global level, all polynucleotides run were present, and 99% of the polynucleotides had abundances that were within 2x of the mean, indicating uniformity of synthesis. This same finding was consistent at the per-cluster level.

[0195] The error rate of each polynucleotide was determined using an Illumina MiSeq gene sequencer. The error rate distribution for 29,040 unique polynucleotides is shown in Figure 13A, with an average of 1 in 500 bases, and some error rates as low as 1 in 800 bases. The distribution was measured per cluster, as shown in Figure 13B. The error rate distribution of unique polynucleotides in four representative clusters is shown in Figure 14. A library of 29,040 unique polynucleotides was synthesized within 20 hours.

[0196] Analysis of GC percentage versus polynucleotide representation across all 29,040 unique polynucleotides showed that synthesis was uniform regardless of GC content. FIG.

[0197] Example 5: PCR Amplification of Synthesized Polynucleotide Libraries

[0198] 9,996 polynucleotides, each 100 bases long, of varying GC content randomized sequences, 20-80% GC content, were designed and synthesized on a structure with a similar configuration as described in Example 3. To determine the effect of PCR amplification on GC representation, the polynucleotide population was amplified for either 6 or 20 cycles using a high fidelity DNA polymerase (DNA polymerase 1). Alternatively, to determine whether polymerase selection has an effect on the overall sequence representation after amplification, two other high fidelity PCR enzymes were used to amplify the polynucleotide population for 6, 8, 10, or 15 cycles. After PCR amplification, samples were prepared for next generation sequencing and sequenced on an Illumina MiSeq platform. 150 bp SE reads were generated to an approximate read depth of 100X. Raw FASTQ files were analyzed. Polynucleotide representation by either 6, 10, or 15 cycles of polymerase is represented in Figure 16. The uniformity of polynucleotide representation was assessed for various diseases and is summarized in Table 4.

[0199] [Table 4]

[0200] The number of dropouts for each amplified polynucleotide population was quantified versus amplification cycles for which the fraction of the population fell below an average threshold of 10% as shown in Figure 15. Polymerase 1 dropouts grew rapidly, whereas polymerase 2 dropouts remained relatively constant.

[0201] The effect of overamplification on GC distribution was evaluated. Figure 18. In general, polynucleotides with GC content between 30% and 70% followed a fitted curve, Y=X, and increased in frequency with more cycles. Polynucleotides with GC content greater than 70% were generally slightly more frequent after 20 cycles, whereas polynucleotides with GC content less than 30% were generally slightly more frequent after 6 cycles.

[0202] Example 6: Comparison of polynucleotide representation from whole plate amplification with parallel polynucleotide cluster amplification

[0203] Polynucleotides were synthesized on a structure with 256 clusters each containing 121 loci on a flat silicon plate, as shown in Figure 10. Polynucleotide synthesis was performed by phosphoramidite chemistry using the general method from Example 3. Polynucleotides on the structure were cleaved and assembled.

[0204] Polynucleotides were combined and amplified across the plate. After amplification, there was significant GC bias and variance from the mean value represented by the line seen in Figure 19. As a result, more sequencing was required and there were more dropouts.

[0205] The distribution of polynucleotides from the amplification of the clusters can be seen in Figure 20. For run 1 and run 2, the frequency distribution from the mean (line) was about 8, and the variance from the mean was about 1.7X. The GC percentage ranged from 17% to 94%. Figure 23 and Figure 20 illustrate that the reproducible and polynucleotide populations show a dramatic reduction in GC bias (Figure 20). In addition, there were 0 dropouts, and 30% less sequencing was required.

[0206] Example 7: Polynucleotide libraries synthesized with varying GC content

[0207] A library of 13,000 polynucleotide sequences containing GC content ranging from about 15% to about 85% was preselected for synthesis (FIG. 22). The first polynucleotide library was synthesized on the structure, and synthesis was performed by phosphoramidite chemistry using the general method from Example 3. The polynucleotides on the structure were cut and combined after amplification to generate a PCR-biased library of polynucleotides. The polynucleotide sequences in the library were binned according to GC content, and the stoichiometry of each bin was adapted to account for the observed GC bias generated by PCR amplification. For example, polynucleotides containing higher or lower GC content have a higher initial concentration that evens out the stoichiometric representation after amplification. This effectively reduces or eliminates the PCR GC bias from the amplification step. The second polynucleotide library was synthesized on the structure, and synthesis was performed by phosphoramidite chemistry using the general method from Example 3. Structural polynucleotides were cut, combined, and subsequently amplified to generate a highly uniform library of polynucleotides (Figure 23) with uniform GC representation after amplification (Figure 21A). One advantage of a GC-balanced library is that less sampling is required for a desired sampling coverage. For example, sampling for 80% and 90% coverage of the library approached the theoretical minimum for a monodisperse library (Figures 24A and 24B). Polynucleotide libraries were further synthesized that favored both high and low GC content to varying degrees (Figures 21B and 21C, respectively). Polynucleotide libraries were further synthesized that favored low GC content (Figure 21D) or high GC content (Figure 21E).

[0208] Example 8: GC-balanced polynucleotide library synthesized with 80-mer and 120-mer polynucleotide lengths

[0209] A library containing approximately 20,000 unique polynucleotides, each 80 nucleic acids long, was designed, GC balanced, and synthesized on structure using the general method of Example 7; synthesis was performed by phosphoramidite chemistry using the general method from Example 3. A similar library containing polynucleotides, each 120 nucleic acids long, was also synthesized (Figure 26). Both libraries showed a highly uniform distribution, with >99% unique sequences identified. The libraries also showed uniformity across the distribution of GC content, had high concordance across replicates (Figure 27), and had a small number of polynucleotides at the tails that were subject to noise.

[0210] Example 9: GC content assessment after repeated amplification of polynucleotide libraries

[0211] A polynucleotide library consisting of 9,996 unique polynucleotides containing 20-80% GC content, each 100 bases long, was structurally synthesized by phosphoramidite chemistry using the general method from Example 3. The library was amplified for either 8 or 15 PCR cycles with two different high-fidelity DNA polymerases, and the frequency of polynucleotides in the population was compared between these two conditions (Figure 28). The identity line (dashed black line) indicates polynucleotides of equal frequency in the population after either 8 or 15 PCR cycles. Compared to 8 cycles of amplification, sequences above the identity line are over-represented in the population after 15 cycles, and sequences below the line are under-represented in the population after 15 cycles. In this case, polymerase 1 shows GC bias with increasing PCR cycles. Compared to 8 cycles of amplification, after 15 cycles of amplification, over-representation was observed for high GC sequences (>70% GC, medium grey) and under-representation of low GC sequences (<30% GC, darkest grey). In addition, the large variation in enrichment within similar GC percentages suggests that factors other than GC content, such as hairpin formation or homopolymer stretches, may affect amplification bias. Polymerase 2 did not show the same sequence representation bias.

[0212] Example 10: Dropout and display assessment after repeated amplification of polynucleotide libraries

[0213] The bias introduced by amplification with different DNA polymerase enzymes was investigated. The polynucleotide library of Example 9 was amplified for 6, 8, 10, or 15 cycles with either DNA polymerase 1 (Figure 29, dark line) or DNA polymerase 2 (Figure 29, light line). Increasing PCR cycles correlated with the dropout frequency of polynucleotide sequences. Dropout frequency is defined as sequences with an abundance less than 10% of the average. The extent of this effect depended on the DNA polymerase used for amplification. A larger portion of sequences dropped out after amplification with DNA polymerase 1 (approximately 20 times more dropouts at 15 cycles) compared to amplification with DNA polymerase 2. Different polymerases may be optimal for amplification of different library sequences depending on GC content, length, and sequence complexity.

[0214] Libraries amplified for 15 PCR cycles with each DNA polymerase were studied in more detail to assess the representation of polynucleotide sequences (Figure 30). Amplification of the polynucleotide library with DNA polymerase 1 resulted in more than 20-fold sequence dropout after 15 PCR cycles (Figure 29). The distribution of polynucleotides amplified with DNA polymerase 1 was greater than the distribution of polynucleotides amplified with DNA polymerase 2. The polynucleotide distribution of the library amplified with DNA polymerase 1 had 64% of the sequences present within 1.5-fold of the mean. When the same libraries were amplified with DNA polymerase 2, >89% of sequences were present within 1.5-fold of the average, indicating that libraries amplified with DNA polymerase 2 have much lower bias than those amplified with DNA polymerase 1. Bias introduced into libraries amplified with DNA polymerase 1 increases the screening effort required to cover the polynucleotide library.

[0215] Example 11: Use of Controlled Stoichiometry Polynucleotide Libraries to Target the Exome Using Next Generation Sequencing (NGS)

[0216] A first polynucleotide cDNA targeting library (probe library) containing up to 370,000 or more non-identical polynucleotides overlapping one or more gene exons is structurally designed and synthesized by phosphoramidite chemistry using the general method from Example 3. The polynucleotides are conjugated to molecular tags, such as biotin, using PCR (or directly during solid phase synthesis) to form probes for subsequent capture of target exons of interest. The probes are hybridized to sequences in a library of genomic nucleic acid and separated from unbound sequences. Unbound probe was washed away leaving a target library enriched for cDNA sequences. The enriched libraries are then sequenced using NGS, and the reads for each predicted gene are measured as a function of the cDNA probe used to target the gene.

[0217] In some examples, the read frequency of the target sequence is affected by the abundance of the target sequence, probe binding, secondary structure, or other factors that reduce the representation after sequencing of the target sequence regardless of enrichment. The stoichiometry control of the polynucleotide library is performed by modifying the stoichiometry of the first polynucleotide cDNA target library to obtain a second polynucleotide cDNA target library, increasing the stoichiometry for the polynucleotide probe sequence resulting in fewer reads. This second cDNA target library is structurally designed and synthesized by phosphoramidite chemistry using the general method from Example 3, and is used to enrich the sequence exons of the target genomic DNA library as described above.

[0218] Example 12: Multiple Repetitions of Stoichiometry Control Using Exome Probe Libraries

[0219] The exome probe library was synthesized and tested using the general method of Example 11. A large number of stoichiometric modifications were repeated, resulting in a controlled stoichiometric probe library, Library 1. Compared to some comparator exome enrichment kits, this results in significantly fewer sequencing reads to obtain the desired coverage of the target. For accurate sequencing, a read depth of at least 30x of 90% of the target exome bases is desirable, and oversequencing (theoretical read depth, read depth greater than 30x) is often required to compensate for uniformity issues. The controlled stoichiometric exome probe library can achieve a read depth of 30x of 90% of the target bases with a theoretical read depth of 55x (Figure 32A), which is significantly less sequencing coverage and faster sequence throughput than required by other comparator exome enrichment kits (samples per run, Table 5). When normalized to 4.5 Gb of sequencing, the controlled stoichiometry probe library delivered >95% of all target bases at 10x read depth, which was significantly higher than other comparator exome probe kits (Figure 32B).

[0220] [Table 5]

[0221] Example 13: Generation of Hybridization Panels

[0222] Polynucleotide targeted libraries were prepared using the general method of Example 11 targeting specific genes, diseases, panel combinations, or custom exomes. Reaction sizes were 10 3 and probe panel sizes ranged from about 80 to about 900,000 probes (Figure 33).

[0223] Example 14: Generation of a 70,000 Probe Panel

[0224] A polynucleotide target library (probe library) containing 70,000 non-identical polynucleotides was structurally designed and synthesized by phosphoramidite chemistry using the general method from Example 3, and by controlled GC using the general method of Example 11 to generate Library 2. The read distribution after sequencing is shown in Figure 34, and the GC bin target coverage is shown in Figures 35A and 35B.

[0225] Example 15: Generation of a 2,544 probe panel

[0226] A polynucleotide target library (probe library) containing 2,544 non-identical polynucleotides was structurally designed and synthesized by phosphoramidite chemistry using the general method from Example 3 and by controlled stoichiometry using the general method of Example 11 to generate Library 3. The accuracy ratio is shown in Figure 36A and the coverage ratio is shown in Figure 36B. Target enrichment in Library 3 resulted in both accuracy ratio and coverage ratio higher than comparator array-based kit #2.

[0227] Example 16: Sample preparation and enrichment using polynucleotide targeted libraries

[0228] Genomic DNA (gDNA) is obtained from the sample, enzymatically fragmented in cleavage buffer, end-repaired, and 3' adenylated. Adapters are ligated to both ends of the genomic DNA fragments to generate a library of adapter-labeled gDNA strands, and the adapter-labeled DNA library is amplified with a high-fidelity polymerase. The gDNA library is then denatured to single strands at 96°C in the presence of an adapter blocker. The polynucleotide target library (probe library) is denatured in hybridization solution at 96°C and combined with the denatured labeled gDNA library in hybridization solution at 70°C for 16 hours. Binding buffer is then added to the hybridized labeled gDNA probes, and the biotinylated probes are captured using magnetic beads containing streptavidin. A magnet is used to separate the beads, and the beads are washed three times with buffer to remove unbound adapters, gDNA, and adapter blocker before adding an elution buffer to release the enriched labeled gDNA fragments from the beads. To obtain sufficient yield for cluster generation, the enriched library of labeled gDNA fragments is amplified with a high-fidelity polymerase, and the library is then sequenced using an NGS instrument.

[0229] Example 17: General sample preparation and enrichment using polynucleotide targeted libraries

[0230] A plurality of polynucleotides are obtained from a sample, fragmented, optionally end-repaired, and adenylated. Adapters are ligated to both ends of the polynucleotide fragments to generate a library of adapter-labeled polynucleotide strands, and the adapter-labeled polynucleotide library is amplified. The adapter-labeled polynucleotide library is then denatured at elevated temperature, preferably 96°C, in the presence of an adapter blocker. The polynucleotide target library (probe library) is denatured in a hybridization solution at elevated temperature, preferably about 90-99°C, and bound to the denatured labeled polynucleotide library in the hybridization solution at about 45-80°C for about 10-24 hours. A binding buffer is then added to the hybridized adapter-labeled polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized adapter-labeled polynucleotide probes. The solid support is washed one or more times, preferably about 2-5 times, with a buffer to remove unbound polynucleotides before adding an elution buffer to release the concentrated adapter-labeled polynucleotide fragments from the solid support. The enriched library of adaptor-labeled polynucleotide fragments is amplified and then the library is sequenced.

[0231] Example 18: General enrichment prior to labeling using a polynucleotide target library

[0232] A plurality of polynucleotides are obtained from a sample, fragmented, and optionally end-repaired. The fragmented polynucleotide sample is then denatured at an elevated temperature, preferably 96°C. A polynucleotide target library (probe library) is denatured in a hybridization solution at an elevated temperature, preferably about 90-99°C, and bound to the denatured labeled polynucleotide library in a hybridization solution at about 45-80°C for about 10-24 hours. A binding buffer is then added to the hybridized polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized fragmented polynucleotide probes. The solid support is washed one or more times, preferably about 2-5 times, with a buffer to remove unbound polynucleotides before adding an elution buffer to release the enriched polynucleotide fragments from the solid support. The enriched polynucleotides are adenylated, adapters are ligated to both ends of the polynucleotides to generate an enriched library of adapter-labeled polynucleotide strands, and the adapter-labeled polynucleotide library is amplified. The enriched library of adapter-labeled polynucleotide fragments is then sequenced.

[0233] Example 19: General sample preparation and filtering using a polynucleotide targeted library

[0234] A plurality of polynucleotides are obtained from a sample, fragmented, optionally end-repaired, and adenylated. Adapters are ligated to both ends of the polynucleotide fragments to generate a library of adaptor-labeled polynucleotide strands, and the adaptor-labeled polynucleotide library is amplified. The adaptor-labeled polynucleotide library is then denatured at elevated temperature, preferably 96°C, in the presence of an adaptor blocker. A polynucleotide filtering library (probe library) designed to remove undesired non-target sequences is denatured in a hybridization solution at elevated temperature, preferably about 90-99°C, and bound to the denatured labeled polynucleotide library in a hybridization solution at about 45-80°C for about 10-24 hours. A binding buffer is then added to the hybridized adaptor-labeled polynucleotide probes, and a solid support containing a capture moiety is used to selectively bind the hybridized adaptor-labeled polynucleotide probes. The solid support is washed one or more times, preferably about 1-5 times, with a buffer to elute the target adaptor-labeled polynucleotide fragments. The enriched library of target adaptor-labeled polynucleotide fragments is amplified and the library is then sequenced.

[0235] Example 20: Preparation of a 160-mer probe library

[0236] A library containing at least 1000 probes is synthesized on the structure and synthesis is performed by phosphoramidite chemistry using the general method from Example 3. Each probe is double-stranded, with each strand of the probe containing a 120 nucleotide target binding sequence complementary to the target. Each probe contains a 20 nucleotide forward priming site and a 20 nucleotide reverse priming site. Each strand of the probe is labeled at the 5' position with two biotin molecules.

[0237] Example 21: Preparation of a 210-mer probe library containing non-target binding sequences

[0238] A library containing at least 1000 probes is synthesized on the structure and synthesis is performed by phosphoramidite chemistry using the general method from Example 3. Each probe is double-stranded, with each strand of the probe containing a 120 nucleotide target binding sequence complementary to the target. Each probe further contains a 20 nucleotide forward primer binding site, a 20 nucleotide reverse primer binding site, a 25 nucleotide 5' non-target binding sequence, and a 25 nucleotide 3' non-target binding sequence containing a polyadenine. Each strand of the probe is labeled at the 5' position with two biotin molecules.

[0239] Example 22: 210-mer probe targeting exon 1 of human HLA

[0240] A library containing at least 1000 probes is synthesized on the structure and synthesis is performed by phosphoramidite chemistry using the general method from Example 3. Each probe is double-stranded, with each strand of the probe containing a 120 nucleotide target binding sequence complementary to a region of exon 1 of human HLA. Each probe further contains a 20 nucleotide forward primer binding site, a 20 nucleotide reverse primer binding site, a 25 nucleotide 5' non-target binding sequence, and a 25 nucleotide 3' non-target binding sequence containing a polyadenine. Each strand of the probe is labeled at the 5' position with two biotin molecules.

[0241] Example 22: Methods for designing non-overlapping probe libraries

[0242] At least 100 target sequences are provided and sorted into distinct categories based on length, compared to the desired length of the complementary probe target binding sequence. For example, the categories include, but are not limited to, (a) targets shorter than the insertion length, (b) targets shorter than or equal to the insertion length + X, and (c) targets longer than the insertion length + X, where X is the desired length of the gap that is not targeted by the probe. Target sequences in category (a) are targeted with target binding sequences that are centered or aligned to the left or right side of the target sequence, depending on the complexity of the non-targeted regions (repeats, high / low GC, palindromic sequences, etc.) where the insertion is also complementary. Target sequences in category (b) are targeted in the same manner as category (a), where X is the desired length of the gap that is not targeted by the target binding sequence. For targets in category (c), the total length of the target is divided by the length of the target binding sequence and rounded up to the nearest integer value to represent the number of target binding sequences required to fully target all of the target sequences to generate an insertion set for the target sequence. Optionally, the number of target binding sequences may be reduced after reduction, and the gap between the target binding sequences is less than the desired gap length Y. This entire process is then repeated for each target sequence to form an insertion library. The target binding sequences in the library are then modified by adding one or more non-target sequences, including one or more priming sequences, the library is structurally synthesized, the synthesis being carried out by phosphoramidite chemistry using the general method from Example 3, and the probes are labeled with molecular tags.

[0243] Example 23: Design methods for overlapping probe libraries

[0244] At least 100 target sequences are provided and sorted into distinct categories based on length, compared to the desired length of the complementary probe target binding sequence. For example, the categories include, but are not limited to, (a) targets shorter than the insertion length, (b) targets shorter than or equal to the insertion length + X, and (c) targets longer than the insertion length + X, where X is the desired length of the gap that is not targeted by the probe. Target sequences in category (a) are targeted with target binding sequences that are centered or aligned to the left or right side of the target sequence, depending on the complexity of the non-targeted regions (repeats, high / low GC, palindromic sequences, etc.) where the insertion is also complementary. Target sequences in category (b) are targeted in the same manner as category (a), where X is the desired length of the gap that is not targeted by the target binding sequence. For targets in category (c), the total length of the target is divided by the length of the target binding sequence and rounded up to the nearest integer value to represent the number of target binding sequences required to fully target all of the target sequences. Complementary target binding sequences are then spaced (optionally uniformly) across the target sequence, allowing overlap to generate an insertion set for the target sequence. This entire process is then repeated for each target sequence to form an insertion library. The target binding sequences in the library are then modified by adding one or more non-target sequences, including one or more priming sequences, the library is structurally synthesized, synthesis is performed by phosphoramidite chemistry using the general method from Example 3, and the probes are labeled with molecular tags.

[0245] Example 24: Design methods for mixed probe libraries

[0246] Probe libraries are synthesized according to the general methods of Examples 22 and 23, with modifications. Sets containing non-overlapping, overlapping, or mixed (overlapping and non-overlapping) insertions are generated for each target sequence.

[0247] Example 25: Polynucleotide probes for exon targeting

[0248] Polynucleotide probes may target exons within a genome, and genes may contain multiple exons, for example, the human leukocyte antigen (HLA) gene contains seven exons, three of which are depicted in Table 6.

[0249] [Table 6] For any exon, various combinations of target and non-target binding sequences may be used to design probes of various configurations and lengths. Non-limiting probe designs targeting HLA exon 1 are shown as examples in Table 7, and the sequence of a single-stranded probe is shown. The sizes of the non-target and target binding sequences, and the total probe length are listed in Table 8.

[0250] [Table 7]

[0251] [Table 8] Various configurations of multiple probes may be used to cover any exon, for example human HLA exon 2. Probes containing SEQ ID: 9 or 10 contain one set and target human HLA exon 2, but both leave gaps in the target exon and do not contain overlapping sequences (see FIG. 4F). Probes containing SEQ ID: 11 target HLA exon 2 and contain target binding sequences that overlap with SEQ ID: 9 and 10 (see FIG. 4G). Probes each containing SEQ ID: 15 or 16 contain a set, target human HLA exon 5, and do not target overlapping regions of the target or non-target regions. Probes corresponding to SEQ ID: 8-16 are synthesized on structure, and synthesis is performed by phosphoramidite chemistry using the general method from Example 3, and are optionally labeled with at least one molecular tag, such as biotin.

[0252] Example 26: Genomic DNA capture using a polynucleotide probe library

[0253] A polynucleotide target library containing at least 500,000 non-identical polynucleotides targeting the human exome was structurally designed and synthesized by phosphoramidite chemistry using the general method from Example 3 and controlled stoichiometry using the general method of Example 11 to generate Library 4. The polynucleotides were then labeled with biotin and dissolved to create an exome probe library solution. A dried indexed library pool was obtained from a genomic DNA (gDNA) sample using the general method of Example 16.

[0254] The exome probe library solution, hybridization solution, blocker mix A, and blocker mix B were mixed by pulse vortexing for 2 seconds. The hybridization solution was heated at 65°C for 10 minutes or until all precipitate was dissolved, then allowed to warm to room temperature on the benchtop for an additional 5 minutes. 20 μL of hybridization solution and 4 μL of exome probe library solution were added to a thin-walled PCR 0.2 mL strip tube and mixed gently with a pipette. The combined hybridization solution / exome probe solution was heated in a thermal cycler at 95°C for 2 minutes, with a lid temperature of 105°C, and quickly cooled on ice for at least 10 minutes. The solution was then allowed to cool to room temperature on the benchtop for 5 minutes. While the hybridization solution / exome probe library solution was cooling, water was added to 9 μl for each genomic DNA sample, and 5 μl of blocker mix A and 2 μL of blocker mix B were added to the dried indexed library pool in the thin-walled PCR 0.2 mL strip tube. The solutions were then mixed gently with a pipette. The pooled library / blocker tubes were heated at 95°C for 5 minutes in a thermal cycler with a lid temperature of 105°C, then allowed to come to room temperature on the benchtop for no more than 5 minutes before proceeding to the next step. The hybridization mix / probe solution was mixed with a pipette and added to the total 24 μL of the pooled library / blocker tube. All capture reaction wells were mixed gently with a pipette to avoid creating bubbles. The tubes were pulse spun to ensure the sample tubes were tightly sealed. The capture / hybridization reactions were heated in a PCR thermocycler at 70°C for 16 hours with a lid temperature of 85°C.

[0255] Binding buffer, wash buffer 1, and wash buffer 2 were heated at 48°C until all precipitate was dissolved in solution. 700 μL of wash buffer 2 was aliquoted per capture and preheated to 48°C. Streptavidin-conjugated beads and DNA purification beads were equilibrated at room temperature for at least 30 minutes. Polymerase and amplification primers such as KAPA HiFi HotStart ReadyMix were thawed on ice. Once the reagents were thawed, pulse vortexed for 2 seconds. 500 μL of 80 percent ethanol was prepared per capture reaction. Streptavidin-conjugated beads were pre-equalized to room temperature and vortexed until homogenized. 100 μL of streptavidin-conjugated beads were added to a 1.5 mL microcentrifuge tube per capture reaction. 200 μL of binding buffer was added to each tube and each tube was mixed with a pipette until homogenized. The tubes were placed on a magnetic stand. The streptavidin-bound beads were pelleted within 1 minute. The tube was removed and the clear supernatant was discarded, making sure not to disturb the bead pellet. The tube was removed from the magnetic stand and the wash was repeated two additional times. After the third wash, the tube was removed and the clear supernatant was discarded. A final 200 μL of binding buffer was added and the beads were resuspended by vortexing until homogenous.

[0256] After completing the hybridization reaction, the lid of the thermal cycler was opened and the entire volume of the capture reaction was quickly transferred (36-40 μL) to the washed streptavidin washed beads. The mixture was mixed at room temperature for 30 minutes on a shaker, rocker, or rotator at a speed sufficient to keep the capture reaction / streptavidin-coupled bead solution homogenous. The capture reaction / streptavidin-coupled bead solution was removed from the mixer and pulse-spun to ensure all the solution was at the bottom of the tube. The sample was placed on a magnetic stand to pellet the streptavidin-coupled beads, leaving a clear supernatant within 1 minute. The clear supernatant was removed and discarded. The tube was removed from the magnetic stand and 200 μL of wash buffer was added at room temperature, then mixed with a pipette until homogenized. The tube was pulse-spun to ensure all the solution was at the bottom of the tube. The thermal cycler was programmed with the following conditions (Table 9).

[0257] The heated lid temperature was set at 105°C.

[0258] [Table 9]

[0259] Amplification primers (2.5 μL) and a polymerase such as KAPA HiFi HotStart ReadyMix (25 μL) were added to the tube containing the water / streptavidin-conjugated bead slurry and the tube was mixed with a pipette. The tube was then split into two reactions. The tube was pulse-spun and transferred to a thermal cycler, and the cycling program in Table 9 was started. Upon completion of the thermal cycler program, the samples were removed from the block and immediately submitted to purification. DNA purification beads, pre-equilibrated to room temperature, were vortexed until homogenized. 90 μL (1.8x) of homogenized DNA purification beads were added to the tube and vortexed to mix well. The tube was incubated at room temperature for 5 minutes and placed on a magnetic stand. The DNA purification beads were pelleted, leaving a clear supernatant within 1 minute. The clear supernatant was discarded, and the tube was left on the magnetic stand. The DNA purification bead pellet was washed with 200 μL of freshly prepared 80 percent ethanol, incubated for 1 minute, and removed and discarded the ethanol each time. The wash was repeated once while keeping the tube on the magnetic stand, for a total of two washes. All remaining ethanol was removed and discarded with a 10 μL pipette, ensuring that the DNA purification bead pellet was not disturbed. The DNA purification bead pellet was air-dried on the magnetic stand for 5-10 min or until the pellet was dry. The tube was removed from the magnetic stand, 32 μL of water was added, pipetted until homogenized, and incubated at room temperature for 2 min. The tube was placed on the magnetic stand for 3 min or until the beads were completely pelleted. 30 μL of clear supernatant was collected and transferred to a clean thin-walled PCR 0.2 mL strip tube, ensuring that the DNA purification bead pellet was not disturbed. The average fragment length was ~375 bp to ~425 bp, using a range set of 150 bp to 1000 bp on the analytical instrument. Ideally, the final concentration value is at least ~15 ng / μL. Each capture was quantified and verified using next generation (NGS).

[0260] A summary of the NGS metrics compared to the comparator exome capture kit (Comparator Kit D) is shown in Table 10, Table 11, and Figure 37. Library 4 has probes (baits) that correspond to a higher exon target rate than Comparator Kit D. This results in less sequencing to obtain comparable quality and coverage of target sequences using Library 4.

[0261] [Table 10]

[0262] [Table 11]

[0263] A comparison of overlapping target sites for both Kit D and Library 4 (total reads normalized to 96X coverage) is shown in Table 12 and Figure 37. Library 4 was processed with 8 samples per hybridization and Kit D was processed with 2 samples per hybridization. Additionally, single nucleotide polymorphism and in-frame deletion calls from overlapping regions for both libraries were compared against high confidence regions identified from the "Genome in a Bottle" NA12878 reference data (Table 13). Library 4 performed similarly or better (higher indel accuracy) than Kit D in identifying SNPs and indels.

[0264] [Table 12]

[0265] [Table 13]

[0266] Precision represents the ratio of true calls to the total (true or false) positive calls. Sensitivity represents the ratio of true positive calls to the total (true positives and false negatives).

[0267] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be utilized in practicing the invention. The following claims define the scope of the invention, and it is intended to cover methods and structures within the scope of these claims, and their equivalents.

Claims

1. A polynucleotide library, the polynucleotide library comprising at least 5,000 polynucleotides, each of the at least 5,000 polynucleotides being present in an amount such that following hybridization to a genomic fragment and sequencing of the hybridized genomic fragment, the polynucleotide library provides a read depth of at least 30-fold for at least 90 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment.

2. The polynucleotide library of claim 1, wherein the polynucleotide library provides a read depth of at least 30 times for at least 95 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55 times for the bases of the genomic fragment.

3. The polynucleotide library of claim 1, wherein the polynucleotide library provides a read depth of at least 30-fold for at least 98 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment.

4. The polynucleotide library of claim 1 , wherein the polynucleotide library provides at least 90 percent unique reads for bases of genomic fragments.

5. The polynucleotide library of claim 1 , wherein the polynucleotide library provides at least 95 percent unique reads for bases of genomic fragments.

6. 2. The polynucleotide library of claim 1, wherein the polynucleotide library provides at least 90 percent of the bases of genomic fragments having a read depth within about 1.5-fold of the average read depth.

7. 2. The polynucleotide library of claim 1, wherein the polynucleotide library provides at least 95 percent of the bases of genomic fragments having a read depth within about 1.5 times the average read depth.

8. The polynucleotide library of claim 1, wherein the polynucleotide library provides at least 90 percent of genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth.

9. The polynucleotide library of claim 1, wherein the polynucleotide library provides at least about 80 percent of genomic fragments having a percentage of repetitive or secondary structure sequences of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth.

10. 2. The polynucleotide library of claim 1, wherein each of the genomic fragments is from about 100 bases to about 500 bases in length.

11. 2. The polynucleotide library of claim 1, wherein at least about 80 percent of the at least 5,000 polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the polynucleotide library.

12. 2. The polynucleotide library of claim 1, wherein at least 30 percent of the at least 5,000 polynucleotides comprise polynucleotides having a GC percentage of 10 percent to 30 percent or 70 percent to 90 percent.

13. 2. The polynucleotide library of claim 1, wherein at least about 15 percent of the at least 5,000 polynucleotides comprise polynucleotides having a percentage of repeat or secondary structure sequences of 10 to 30 percent or 70 to 90 percent.

14. 2. The polynucleotide library of claim 1, wherein the at least 5,000 polynucleotides encode at least 1,000 genes.

15. The polynucleotide library of claim 1 , wherein the polynucleotide library comprises at least 100,000 polynucleotides.

16. The polynucleotide library of claim 1 , wherein the polynucleotide library comprises at least 700,000 polynucleotides.

17. 2. The polynucleotide library of claim 1, wherein at least 5,000 polynucleotides comprise at least one exon sequence.

18. 17. The polynucleotide library of claim 16, wherein the at least 700,000 polynucleotides comprise at least one set of polynucleotides that collectively comprise a single exon sequence.

19. 20. The polynucleotide library of claim 18, wherein the at least 700,000 polynucleotides comprise at least 150,000 sets.

20. 1. A polynucleotide library, the polynucleotide library comprising at least 5,000 polynucleotides, each of the polynucleotides being about 20-200 bases in length, the plurality of polynucleotides encoding sequences from each exon for at least 1,000 preselected genes, each polynucleotide comprising a molecular tag, and each of the at least 5,000 polynucleotides being present in an amount such that following hybridization to a genomic fragment and sequencing of the hybridized genomic fragment, the polynucleotide library provides at least a 30-fold read depth of at least 90 percent of the bases of the genomic fragment under conditions for a maximum theoretical read depth of 55-fold for the bases of the genomic fragment.

21. The polynucleotide library of claim 20, wherein the polynucleotide library provides a read depth of at least 30 times for at least 95 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55 times for the bases of the genomic fragment.

22. The polynucleotide library of claim 20, wherein the polynucleotide library provides a read depth of at least 30 times the bases of at least 98 percent of the genomic fragments under conditions for a theoretical read depth of up to 55 times the bases of the genomic fragments.

23. 21. The polynucleotide library of claim 20, wherein the polynucleotide library provides at least 90 percent unique reads for bases of genomic fragments.

24. 21. The polynucleotide library of claim 20, wherein the polynucleotide library provides at least 95 percent unique reads for bases of genomic fragments.

25. 21. The polynucleotide library of claim 20, wherein the polynucleotide library provides at least 90 percent of the bases of genomic fragments having a read depth within about 1.5-fold of the average read depth.

26. 21. The polynucleotide library of claim 20, wherein the polynucleotide library provides at least 95 percent of the bases of genomic fragments having a read depth within about 1.5-fold of the average read depth.

27. 21. The polynucleotide library of claim 20, wherein the polynucleotide library provides more than 90 percent of genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth.

28. The polynucleotide library of claim 20, wherein the polynucleotide library provides more than about 80 percent of genomic fragments having a percentage of repetitive or secondary structure sequences of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth.

29. 21. The polynucleotide library of claim 20, wherein each of the genomic fragments is from about 100 bases to about 500 bases in length.

30. 21. The polynucleotide library of claim 20, wherein greater than about 80 percent of the at least 5,000 polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the polynucleotide library.

31. 21. The polynucleotide library of claim 20, wherein more than 30 percent of the at least 5,000 polynucleotides comprise polynucleotides having a GC percentage of 10 to 30 percent or 70 to 90 percent.

32. 21. The polynucleotide library of claim 20, wherein more than about 15 percent of the at least 5,000 polynucleotides comprise polynucleotides having a percentage of repetitive or secondary structure sequences of 10 to 30 percent or 70 to 90 percent.

33. 21. The polynucleotide library of claim 20, wherein the polynucleotide library comprises at least 100,000 polynucleotides.

34. 21. The polynucleotide library of claim 20, wherein the polynucleotide library comprises at least 700,000 polynucleotides.

35. 35. The polynucleotide library of claim 34, wherein the at least 700,000 polynucleotides comprise at least one set of polynucleotides that collectively comprise a single exon sequence.

36. 36. The polynucleotide library of claim 35, wherein the at least 700,000 polynucleotides comprise at least 150,000 sets.

37. 1. A method for generating a polynucleotide library, the method comprising: a. providing a predetermined sequence encoding at least 5000 polynucleotides; b. synthesizing at least 5000 polynucleotides; and c. amplifying at least 5,000 polynucleotides with a polymerase to form a polynucleotide library, wherein greater than about 80 percent of the at least 5,000 polynucleotides are represented in abundance within at least about two-fold of the average representation for the polynucleotide library; A method comprising:

38. 38. The method of claim 37, wherein greater than about 80 percent of the at least 5,000 polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the polynucleotide library.

39. 38. The method of claim 37, wherein more than 30 percent of the at least 5,000 polynucleotides comprise polynucleotides having a GC percentage of 10 percent to 30 percent or 70 percent to 90 percent.

40. 38. The method of claim 37, wherein more than about 15 percent of the at least 5,000 polynucleotides comprise polynucleotides having a percentage of repetitive or secondary structure sequences of 10 to 30 percent or 70 to 90 percent.

41. 38. The method of claim 37, wherein the polynucleotide library has a total error rate of less than 1 in 800 bases compared to a predetermined sequence without error correction.

42. 38. The method of claim 37, wherein the predetermined sequence encodes at least 700,000 polynucleotides.

43. 38. The method of claim 37, wherein synthesis of the at least 5,000 polynucleotides is performed in a structure having a face, the face comprising a plurality of clusters, each cluster comprising a plurality of loci; and each of the at least 5,000 polynucleotides extends from a different one of the plurality of loci.

44. 44. The method of claim 43, wherein the plurality of loci comprises up to 1000 loci per cluster.

45. 44. The method of claim 43, wherein the plurality of loci comprises up to 200 loci per cluster.

46. 1. A method for amplification of a polynucleotide library, the method comprising: a. obtaining an amplification distribution for at least 5000 polynucleotides; b. clustering at least 5000 polynucleotides of the amplification distribution into two or more bins based on at least one sequence feature, the sequence feature being percent GC content, percent repetitive sequence content, or percent secondary structure content; c. adapting the relative frequency of the polynucleotides in at least one bin to generate a polynucleotide library having a preselected representation; d. synthesizing a polynucleotide library having a preselected representation; and e. amplifying the polynucleotide library having the preselected representation; A method comprising:

47. 47. The method of claim 46, wherein at least one sequence feature is percent GC content.

48. 47. The method of claim 46, wherein at least one sequence feature is percent secondary structure content.

49. 47. The method of claim 46, wherein at least one sequence feature is percent repeat content.

50. 50. The method of claim 49, wherein the repetitive sequence content includes sequences having three or more adenines.

51. 50. The method of claim 49, wherein the repetitive sequence content comprises repetitive sequences at at least one end of the polynucleotide.

52. 47. The method of claim 46, wherein the polynucleotides are clustered into bins based on the affinity of one or more polynucleotide sequences for binding a target sequence.

53. 47. The method of claim 46, wherein the number of sequences in the bottom 30 percent of the bin has at least 50% more representation in downstream applications after adjustment compared to the number of sequences in the bottom 30 percent of the bin before adjustment.

54. 47. The method of claim 46, wherein the number of sequences in the top 30 percent of the bins has at least 50% more representation in downstream applications after adjustment compared to the number of sequences in the top 30 percent of the bins before adjustment.

55. 1. A method for sequencing genomic DNA, the method comprising: (a) contacting a plurality of genomic fragments with a library according to any one of claims 1-36; (b) enriching at least one genomic fragment that binds to the library to generate at least one enriched target polynucleotide; and (c) sequencing at least one enriched target polynucleotide; A method comprising:

56. 56. The method of claim 55, wherein the plurality of enriched target polynucleotides comprises a cDNA library.

57. 56. The method of claim 55, wherein the at least 5000 polynucleotides are from about 80 to about 200 bases in length.

58. 56. The method of claim 55, wherein each of the genomic fragments is from about 100 bases to about 500 bases in length.

59. 56. The method of claim 55, wherein the contacting step is carried out in solution.

60. 56. The method of claim 55, wherein at least 5000 polynucleotides are at least partially complementary to the genomic fragment.

61. 56. The method of claim 55, wherein the isolating comprises: (i) capturing polynucleotide / genomic fragment hybridization pairs on a solid support; and (ii) releasing a plurality of genomic fragments to generate enriched target polynucleotides.

62. 56. The method of claim 55, wherein the sequencing results in a read depth of at least 30 times for at least 95 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55 times for the bases of the genomic fragment.

63. 56. The method of claim 55, wherein the sequencing results in a read depth of at least 30-fold for at least 98 percent of the bases of the genomic fragment under conditions for a theoretical read depth of up to 55-fold for the bases of the genomic fragment.

64. 56. The method of claim 55, wherein the sequencing results in at least 90 percent unique reads for the bases of the genomic fragment.

65. 56. The method of claim 55, wherein the sequencing results in at least 95 percent unique reads for the bases of the genomic fragment.

66. 56. The method of claim 55, wherein the sequencing results in at least 90 percent of the bases of the genomic fragment having a read depth within about 1.5 times the average read depth.

67. 56. The method of claim 55, wherein the sequencing results in at least 95 percent of the bases of the genomic fragment having a read depth within about 1.5 times the average read depth.

68. 56. The method of claim 55, wherein the sequencing results in at least 90 percent of genomic fragments having a GC percentage of 10 to 30 percent or 70 to 90 percent with a read depth within about 1.5 times the average read depth.

69. 56. The method of claim 55, wherein the sequencing results in at least about 80 percent of genomic fragments having a percentage of repeat or secondary structure sequences between 10 percent and 30 percent or between 70 percent and 90 percent having a read depth within about 1.5 times the average read depth.

70. 56. The method of claim 55, wherein at least about 80 percent of the at least 5,000 polynucleotides are represented in an amount within at least about 1.5-fold of the average representation for the polynucleotide library.

71. 56. The method of claim 55, wherein at least 30 percent of the at least 5,000 polynucleotides comprise polynucleotides having a GC percentage of 10 percent to 30 percent or 70 percent to 90 percent.

72. 56. The method of claim 55, wherein at least about 15 percent of the at least 5,000 polynucleotides comprise polynucleotides having a percentage of repetitive or secondary structure sequences of 10 to 30 percent or 70 to 90 percent.

73. 56. The method of claim 55, wherein the at least 5000 polynucleotides encode at least 1000 genes.

74. 56. The method of claim 55, wherein the polynucleotide library comprises at least 100,000 polynucleotides.

75. 56. The method of claim 55, wherein the polynucleotide library comprises at least 700,000 polynucleotides.

76. 56. The method of claim 55, wherein the at least 5,000 polynucleotides comprise at least one exon sequence.

77. 76. The method of claim 75, wherein the at least 700,000 polynucleotides comprise at least one set of polynucleotides that collectively comprise a single exon sequence.

78. 78. The method of claim 77, wherein the at least 700,000 polynucleotides comprise at least 150,000 sets.

Images