Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome
Patent Information
- Application Number
- JP2024192906
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-09-14
- Filing Date
- 2024-11-01
- Publication Date
- 2025-10-31
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
【0008】 さらなる実施形態では、本開示のmRNA治療技術は、脂質ナノ粒子(LNP)送達システムを介して、UGT1A1ポリペプチドをコードするmRNAの送達も特徴とする。本開示は、UGT1A1ポリペプチドをコードするmRNAと組み合わせ、そして、インビボで投与した場合に改善した特性、例えば、細胞取り込み、細胞内輸送、及び/またはエンドソーム放出、またはエンドソームエスケープを有するイオン化可能な脂質をベースとしたLNPを特徴とする。本開示のLNP製剤は、LNPのインビボ投与に関連する免疫原性の抑制も実証している。
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 62 / 731,467, filed September 14, 2018, the entire contents of which are incorporated herein by reference.
[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on September 11, 2019, is titled 458l7-0050WO1_SL.txt and is 116,205 bytes in size. [Background technology]
[0003] Crigler-Najjar syndrome type 1 (CN-1) is an autosomal recessive metabolic disorder characterized by abnormal accumulation of bilirubin in the blood due to an inability to conjugate bilirubin with glucuronic acid to produce a water-soluble conjugate that can be excreted from the body (a process called glucuronidation). Total serum bilirubin levels in CN-1 patients typically range from 20 to 45 mg / dL. Infants develop severe jaundice within the first few days of life and persist thereafter. Some affected infants develop kernicterus and die within the first few weeks or months of life, whereas others survive with minimal or no neurological effects.
[0004] The estimated incidence of CN-1 is 1 in 1,000,000, affecting men and women equally. Current treatment for CN-1 is daily phototherapy (e.g., 10 hours / day). Although daily phototherapy effectively suppresses hyperbilirubinemia during the first few years of life, its effectiveness decreases later in life, and liver transplantation remains the only fully effective treatment. Therefore, improved therapies for treating CN-1 are needed.
[0005] The major gene related to CN-1 is the uridine diphosphate glycosyltransferase 1 family polypeptide A1 (ugt1A1) gene (NM_000463.2; NP_000454.1). The ugt1a1 gene encodes the UGT1A1 polypeptide (also known as bilirubin uridine diphosphate glucuronosyltransferase), which plays a key role in the glucuronidation of bilirubin. The biological function of UGT1A1 is to conjugate bilirubin to glucuronic acid, thereby producing a water-soluble complex that allows the conjugated bilirubin to be excreted from the body. UGT1A1 is localized in the endoplasmic reticulum and is primarily present in hepatocytes. The precursor form of human UGT1A1 is 533 amino acids long, and the mature form is 508 amino acids long, resulting in the cleavage of the 25-amino acid signal sequence.
[0006] Mutations in the ugt1a1 gene result in complete or partial loss of UGT1A1 function, leading to abnormal bilirubin accumulation and the associated signs and symptoms described above. For example, variants in the ugt1a1 gene in CN-1 patients result in complete loss of UGT1A1 activity. Given the limitations of existing treatments for CN-1, there is a significant need to address the need for improved treatments for UGT1A1-related disorders. Summary of the Invention [Means for solving the problem]
[0007] The present disclosure provides messenger RNA (mRNA) therapeutics for the treatment of Crigler-Najjar syndrome type 1 (CN-1). Because this technology provides for the intracellular delivery of mRNA encoding a uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) polypeptide and subsequent de novo synthesis of a functional UGT1A1 polypeptide within the target cell, the mRNA therapeutics of the present invention are particularly suitable for the treatment of CN-1. The present invention features the incorporation of modified nucleotides into therapeutic mRNA to (1) minimize unwanted immune activation (e.g., the innate immune response associated with the in vivo introduction of exogenous nucleic acid) and (2) optimize the efficiency of mRNA translation into protein. Exemplary embodiments of the present disclosure feature a combination of nucleotide modifications that suppress the innate immune response and sequence optimization within the open reading frame (ORF) of the therapeutic mRNA encoding the UGT1A1 polypeptide to enhance protein expression.
[0008] In further embodiments, the disclosed mRNA therapeutic technology also features delivery of mRNA encoding a UGT1A1 polypeptide via a lipid nanoparticle (LNP) delivery system. The disclosure features ionizable lipid-based LNPs combined with mRNA encoding a UGT1A1 polypeptide and having improved properties, such as cellular uptake, intracellular trafficking, and / or endosomal release or endosomal escape, when administered in vivo. The disclosed LNP formulations have also demonstrated reduced immunogenicity associated with in vivo administration of LNPs.
[0009] In certain aspects, the present disclosure relates to compositions and delivery formulations comprising polynucleotides, e.g., ribonucleic acid (RNA), e.g., mRNA, encoding UGT1A1 polypeptides, and methods of administering the same to treat CN-1 in a human subject in need thereof.
[0010] The present disclosure provides a pharmaceutical composition comprising a lipid nanoparticle-encapsulated mRNA comprising an open reading frame (ORF) encoding a UGT1A1 polypeptide, the composition being suitable for administration to a human subject in need of treatment for CN-1.
[0011] The present disclosure further provides a pharmaceutical composition comprising: (a) (i) an open reading frame (ORF) encoding a UGT1A1 polypeptide, wherein the ORF comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof, and (ii) an mRNA comprising an untranslated region (UTR) comprising a microRNA (miRNA) binding site; and (b) a delivery agent, wherein the pharmaceutical composition is suitable for administration to a human subject in need of treatment for CN-1.
[0012] In certain embodiments, the pharmaceutical composition or polynucleotide is administered intravenously. In some cases, the pharmaceutical composition or polynucleotide is administered at a dose of 0.1 mg / kg to 2.0 mg / kg. In some cases, the pharmaceutical composition or polynucleotide is administered at a dose of 0.1 mg / kg to 1.5 mg / kg. In some cases, the pharmaceutical composition or polynucleotide is administered at a dose of 0.1 mg / kg to 1.0 mg / kg. In some cases, the pharmaceutical composition or polynucleotide is administered at a dose of 0.1 mg / kg to 0.5 mg / kg.
[0013] In one aspect, the disclosure features a pharmaceutical composition including an mRNA, wherein the mRNA includes an open reading frame (ORF) encoding a human uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) polypeptide, wherein administration of the composition to a human subject in need thereof, in a single intravenous dose: (i) increases the level of UGT1A1 activity in liver tissue to at least 10% of the normal UGT1A1 activity level for at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, or at least 21 days after administration. , by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%; (ii) increase the level of UGT1A1 activity in liver tissue by at least 1, compared to a baseline UGT1A1 activity level in a human subject, or a reference UGT1A1 activity level in a human subject with Crigler-Najjar syndrome type 1 (CN-1), for at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, or at least 21 days after administration.(iii) increase the blood, plasma, and / or serum level of bilirubin by 5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, or at least 50-fold; (iv) increase the blood, plasma, and / or serum level of bilirubin by at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, or at least 21 days after administration, compared to the baseline blood, plasma, and / or serum level of bilirubin in a human subject or a reference blood, plasma, and / or serum bilirubin level in a human subject with CN-1. (iv) reduces the blood, plasma, and / or serum level of bilirubin by at least 1.0%, compared to the baseline blood, plasma, and / or serum level of bilirubin in a human subject or a reference blood, plasma, and / or serum bilirubin level in a patient with CN-1 for at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, or at least 21 days after administration.and / or (v) reduce blood, plasma, and / or serum levels of bilirubin by at least 6 hours, 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, or at least 21 days are sufficient to reduce CN-1 to less than 0.1 mg / dL, 0.2 mg / dL, 0.3 mg / dL, 0.4 mg / dL, 0.5 mg / dL, 0.6 mg / dL, 0.7 mg / dL, 0.8 mg / dL, 0.9 mg / dL, 1.0 mg / dL, 1.5 mg / dL, 2.0 mg / dL, 2.5 mg / dL, 3.0 mg / dL, 4.0 mg / dL, 5.0 mg / dL, 7.5 mg / dL, or 10.0 mg / dL in human patients with CN-1.
[0014] In some embodiments, the UGT1A1 polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In some cases, the ORF has at least 79%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12.
[0015] In some embodiments, the mRNA comprises a microRNA (miR) binding site. In some cases, the microRNA is expressed in immune cells of the hematopoietic system or cells that express TLR7 and / or TLR8 and secrete proinflammatory cytokines and / or chemokines. In some cases, the microRNA binding site is for a microRNA selected from the group consisting of miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27, miR-26a, or any combination thereof. In some cases, the microRNA binding site is for a microRNA selected from the group consisting of miR126-3p, miR-142-3p, miR-142-5p, miR-155, or any combination thereof. In some cases, the microRNA binding site is a miR-142-3p binding site. In some cases, the microRNA binding site is in the 3'UTR of the mRNA.
[0016] In some embodiments, the mRNA comprises a 3'UTR, wherein the 3'UTR comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 3'UTR sequence of SEQ ID NO: 150, 151, or 178.
[0017] In some embodiments, the 3'UTR comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 3'UTR of SEQ ID NO:4, SEQ ID NO:111, SEQ ID NO:150, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:195, or SEQ ID NO:196.
[0018] In some embodiments, the mRNA comprises a 5'UTR, wherein the 5'UTR comprises a nucleic acid sequence that is at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 5'UTR sequence of SEQ ID NO:3.
[0019] In some embodiments, the mRNA comprises a 5'UTR, wherein the 5'UTR comprises a nucleic acid sequence that is at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 5'UTR sequence of SEQ ID NO:3, SEQ ID NO:39, SEQ ID NO:193, or SEQ ID NO:194.
[0020] In some embodiments, the mRNA comprises a 5'-end cap. In some cases, the 5'-end cap comprises Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, a 5' methyl G cap, or an analog thereof. In some cases, the mRNA comprises a polyA region. In some cases, the polyA region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 nucleotides in length. In some cases, the poly A region has a length of about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides.
[0021] In some embodiments, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some cases, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (Ψ), N1-methylpseudouracil (m1Ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof. In some cases, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils are chemically modified to N1-methylpseudouracil.
[0022] In some embodiments, the pharmaceutical composition of any one of claims 1-19 further comprises a delivery agent. In some cases, the delivery agent comprises lipid nanoparticles comprising: (a) (i) Compound II, (ii) cholesterol, and (iii) PEG-DMG, or Compound I; (b) (i) Compound VI, (ii) cholesterol, and (iii) PEG-DMG, or Compound I; (c) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG, or Compound I; (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG, or Compound I; (e) (i) Compound II, (ii) cholesterol, and (iii) Compound I; or (f) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I.
[0023] In some embodiments, the human subject has Crigler-Najjar syndrome type 1 (CN-1).
[0024] In another aspect, the disclosure features a polynucleotide comprising a messenger RNA (mRNA), the polynucleotide comprising: (i) a 5' UTR; (ii) an open reading frame (ORF) encoding a human uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) polypeptide, the ORF having at least 79%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12; (iii) a stop codon; and (iv) a 3' UTR.
[0025] In some embodiments, the UGT1A1 polypeptide consists of the amino acid sequence of SEQ ID NO:1.
[0026] In some embodiments, the mRNA comprises a microRNA (miR) binding site. In some cases, the microRNA is expressed in immune cells of the hematopoietic system or cells that express TLR7 and / or TLR8 and secrete proinflammatory cytokines and / or chemokines. In some cases, the microRNA binding site is for a microRNA selected from the group consisting of miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27, miR-26a, or any combination thereof. In some cases, the microRNA binding site is for a microRNA selected from the group consisting of miR126-3p, miR-142-3p, miR-142-5p, miR-155, or any combination thereof. In some cases, the microRNA binding site is a miR-142-3p binding site. In some cases, the microRNA binding site is in the 3'UTR of the mRNA.
[0027] In some embodiments, the 3'UTR comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 3'UTR of SEQ ID NO: 150, 151, or 178.
[0028] In some embodiments, the 3'UTR comprises a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 3'UTR of SEQ ID NO:4, SEQ ID NO:111, SEQ ID NO:150, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:195, or SEQ ID NO:196.
[0029] In some embodiments, the 5'UTR comprises a nucleic acid sequence that is at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 5'UTR sequence of SEQ ID NO:3.
[0030] In some embodiments, the 5'UTR comprises a nucleic acid sequence that is at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the 5'UTR sequence of SEQ ID NO:3, SEQ ID NO:39, SEQ ID NO:193, or SEQ ID NO:194.
[0031] In some embodiments, the mRNA comprises a 5'-end cap. In some cases, the 5'-end cap comprises Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, a 5' methyl G cap, or an analog thereof. In some cases, the mRNA comprises a polyA region. In some cases, the polyA region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 nucleotides in length. In some cases, the poly A region has a length of about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides.
[0032] In some embodiments, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some cases, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (Ψ), N1-methylpseudouracil (m1Ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof. In some cases, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils are chemically modified to N1-methylpseudouracil.
[0033] In some embodiments, the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 14-27.
[0034] In another aspect, the disclosure features a polynucleotide comprising a messenger RNA (mRNA) comprising: (i) a 5' end cap; (ii) a 5' UTR comprising the nucleic acid sequence of SEQ ID NO: 3; (iii) an open reading frame (ORF) encoding a uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) polypeptide of SEQ ID NO: 1, wherein the ORF comprises a sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12; (iv) a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 111, 150, 151, 175, or 178; and (vi) a poly A region.
[0035] In another aspect, the disclosure features a polynucleotide comprising an mRNA comprising: (i) a 5' end cap; (ii) a 5' UTR comprising the nucleic acid sequence of SEQ ID NO: 3, 39, 193, or 194; (iii) an ORF encoding the UGT1A1 polypeptide of SEQ ID NO: 1, wherein the ORF comprises a sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12; (iv) a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 4, 111, 150, 175, 177, 178, 195, or 196; and (vi) a polyA region.
[0036] In some cases, the 5' end cap comprises Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methyl G cap, or an analog thereof.
[0037] In some cases, the polyA region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length. In some cases, the polyA region has a length of about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides.
[0038] In some embodiments, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some cases, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (Ψ), N1 methylpseudouracil (m1Ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof.
[0039] In some embodiments, the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 14-27.
[0040] In some embodiments, the 5'-end cap comprises Cap1 and all uracils in the polynucleotide are N1-methylpseudouracils.
[0041] In some embodiments, the polyA region is 100 nucleotides in length.
[0042] In another aspect, the disclosure features a pharmaceutical composition including a polynucleotide disclosed herein and a delivery agent. In some cases, the delivery agent includes lipid nanoparticles including: (a) (i) Compound II, (ii) cholesterol, and (iii) PEG-DMG, or Compound I; (b) (i) Compound VI, (ii) cholesterol, and (iii) PEG-DMG, or Compound I; (c) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG, or Compound I; (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG, or Compound I; (e) (i) Compound II, (ii) cholesterol, and (iii) Compound I; or (f) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I.
[0043] In another aspect, the disclosure features a method for expressing a uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) polypeptide in a human subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition or polynucleotide described herein.
[0044] In another aspect, the disclosure features a method of treating, preventing, or delaying the onset and / or progression of Crigler-Najjar syndrome type 1 (CN-1) in a human subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition or polynucleotide described herein.
[0045] In another aspect, the disclosure features a method of increasing uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) activity in a human subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition or polynucleotide described herein.
[0046] In another aspect, the disclosure features a method of lowering bilirubin levels in a human subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition or polynucleotide described herein.
[0047] In certain embodiments of the above methods, 24 hours after administering the pharmaceutical composition or polynucleotide to the subject, the subject's bilirubin level is reduced by at least about 100%, at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, or at least about 10% compared to baseline bilirubin in the subject.
[0048] In certain embodiments of the above methods, 24 hours after administering the pharmaceutical composition or polynucleotide to the subject, the subject has a bilirubin level of less than 0.1 mg / dL, less than 0.2 mg / dL, less than 0.3 mg / dL, less than 0.4 mg / dL, less than 0.5 mg / dL, less than 0.6 mg / dL, less than 0.7 mg / dL, less than 0.8 mg / dL, less than 0.9 mg / dL, less than 1.0 mg / dL, less than 1.5 mg / dL, less than 2.0 mg / dL, less than 2.5 mg / dL, less than 3.0 mg / dL, less than 4.0 mg / dL, less than 5.0 mg / dL, less than 7.5 mg / dL, or less than 10.0 mg / dL.
[0049] In certain embodiments of the above methods, the level of bilirubin is reduced in the subject's blood.
[0050] In certain embodiments of the above method, the bilirubin is total bilirubin.
[0051] In certain embodiments of the above methods, the reduction in bilirubin levels persists for at least 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 96 hours, 120 hours, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, or 21 days after administration of the pharmaceutical composition or polynucleotide.
[0052] In certain embodiments of the above methods, 24 hours after administering the pharmaceutical composition or polynucleotide to the subject, the subject's UGT1A1 activity is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% of the UGT1A1 activity of a normal individual. In certain cases, UGT1A1 activity is increased in the subject's heart, liver, brain, or skeletal muscle. In certain cases, the increased UGT1A1 activity persists for at least 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 96 hours, 120 hours, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, or 21 days after administration of the pharmaceutical composition or polynucleotide.
[0053] In certain embodiments of the above methods, the subject is administered about once a week, about once every two weeks, or about once a month.
[0054] In certain embodiments of the above methods, the pharmaceutical composition or polynucleotide is administered intravenously. [Brief explanation of the drawings]
[0055] [Figure 1] 1 is a graph showing the levels of human UGT1A1 in the spleen of individual rats administered modified codon-optimized mRNA encoding human UGT1A1 with (hUGT1A1_003, SEQ ID NO: 28 (G5 chemical structure)) or without (hUGT1A1_002, SEQ ID NO: 18 (G5 chemical structure)) the miRNA-142 target site in the 3'UTR, or modified non-codon-optimized mRNA encoding human UGT1A1, mRNA encoding luciferase (hUGT1A1_001, SEQ ID NO: 29 (G5 chemical structure)), or phosphate-buffered saline (PBS) as a control. [Figure 2] 1 is a graph showing total bilirubin levels (mg / dL) in plasma collected from Gunn rats administered the constructs described herein at the time points indicated. For a description of hUGT1A1_001, hUGT1A1_002, hUGT1A1_003, and rUGT1A1, see Example 16 below. [Figure 3] 1 is a graph showing total bilirubin levels (mg / dL) in plasma collected from Gunn rats administered the constructs described herein at the time points indicated. For a description of hUGT1A1_001, hUGT1A1_002, hUGT1A1_003, and rUGT1A1, see Example 16 below. [Figure 4] 1 is a graph showing the levels of total bilirubin (mg / dL) in plasma collected from Gunn rats administered the constructs described herein at the time points indicated. For a description of hUGT1A1_001, hUGT1A1_002, hUGT1A1_004, and hUGT1A1_007, see Example 18, infra. [Figure 5] 1 is a graph showing total bilirubin levels (mg / dL) in plasma collected from Gunn rats administered the constructs described herein at the time points indicated. For a description of hUGT1A1_001, hUGT1A1_002, hUGT1A1_007, and hUGT1A1_009, see Example 18 below. [Figure 6] 1 is a graph showing total bilirubin (mg / dL) levels in serum collected at the indicated time points from Gunn rats treated with phototherapy (10 hours / day) or 0.2 mg / kg of hUGT1A1_002 (SEQ ID NO: 18 (G5 chemical structure)); PBS and untreated rats served as controls. Data for untreated and phototherapy rats were obtained from a different experiment than data for PBS- and hUGT1A1_002-treated rats. DETAILED DESCRIPTION OF THE INVENTION
[0056] The present disclosure provides an mRNA therapy for the treatment of Crigler-Najjar syndrome type 1 (CN-1). CN-1 is an autosomal recessive metabolic disorder characterized by abnormal accumulation of bilirubin in the blood due to an inability to conjugate bilirubin to glucuronic acid to produce a water-soluble conjugate that can be excreted from the body (a process called glucuronidation). This accumulation of bilirubin (typically in the range of 20-45 mg / dL in serum) can lead to neurological damage, among other symptoms. The primary gene associated with CN-1 is uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (ugt1A1), which encodes the enzyme UGT1A1. CN-1 is caused by mutations in the ugt1A1 gene. mRNA therapy is particularly suitable for the treatment of CN-1 because it provides for the intracellular delivery of mRNA encoding UGT1A1 and subsequent de novo synthesis of functional UGT1A1 polypeptide within target cells. After the mRNA is delivered to the target cell, the desired UGT1A1 protein is expressed by the cell's own translational machinery, so that a fully functional UGT1A1 protein replaces the defective or missing protein.
[0057] One of the challenges associated with delivering nucleic acid-based therapeutics (e.g., mRNA therapeutics) in vivo stems from the innate immune response that can occur when the body's immune system encounters foreign nucleic acids. Foreign mRNA can activate the immune system through recognition via toll-like receptors (TLRs), particularly TLR7 / 8, which are activated by single-stranded RNA (ssRNA). In non-immune cells, recognition of foreign mRNA can occur via retinoic acid-inducible gene I (RIG-I). Immune recognition of foreign mRNA results in undesirable cytokine effects, such as interleukin-1β (IL-1β) production, tumor necrosis factor-α (TNF-α) distribution, and a strong type I interferon (type I IFN) response. The present disclosure features the incorporation of various modified nucleotides into therapeutic mRNA to minimize immune activation and optimize the efficiency of mRNA translation into protein. Certain embodiments feature a combination of nucleotide modifications to reduce the innate immune response and sequence optimization to enhance protein expression, particularly within the open reading frame (ORF) of the therapeutic mRNA encoding UGT1A1.
[0058] Additionally, certain embodiments of the mRNA therapy technology of the present disclosure feature delivery of mRNA encoding UGT1A1 via a lipid nanoparticle (LNP) delivery system. Lipid nanoparticles (LNPs) are an ideal platform for safely and effectively delivering mRNA to target cells. LNPs have the unique ability to deliver nucleic acids through mechanisms involving cellular uptake, intracellular trafficking, and endosomal release or endosomal escape. The present invention features ionic lipid-based LNPs combined with mRNA encoding UGT1A1 that have improved properties when administered in vivo. Without being bound by theory, it is believed that the ionic lipid-based LNP formulations of the present invention have improved properties, such as cellular uptake, intracellular trafficking, and / or endosomal release or endosomal escape. For example, LNPs administered via a systemic route (e.g., intravenous (IV) administration) in a first administration may accelerate the clearance of LNPs injected later, for example, in additional administrations. This phenomenon, known as accelerated blood clearance (ABC), is a significant issue, particularly when replacing a defective enzyme (e.g., UGT1A1) in a therapeutic setting. This explains why repeated administration of mRNA therapeutics is often necessary to maintain necessary levels of the enzyme in target tissues in subjects (e.g., subjects suffering from CN-1). The problem of repeated administration can be addressed on several levels. Efficient delivery by mRNA manipulation and / or LNP can result in increased levels and / or enhanced duration of protein (e.g., UGT1A1) expression after administration of the first dose, which in turn allows for an extended time between the first and subsequent administrations. The ABC phenomenon is known to be, at least in part, transient in nature, with the underlying immune response resolving after sufficient time has passed since systemic administration. Thus, in one aspect, the mRNA therapeutics of the present disclosure combat the ABC phenomenon by extending the duration of protein expression and / or activity after systemic delivery.Furthermore, LNPs can be engineered to avoid immune sensing and / or recognition, thus further avoiding ABC upon subsequent or repeated administration. Exemplary embodiments of the present disclosure feature LNPs that have been engineered to reduce ABC.
[0059] 1. Uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) Uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) is a metabolic enzyme that plays a key role in the glucuronidation of bilirubin. The biological function of UGT1A1 is to conjugate bilirubin with glucuronic acid, thereby producing a water-soluble complex that allows its excretion from the body (a process called glucuronidation). UGT1A1 is primarily found in the endoplasmic reticulum of hepatocytes.
[0060] The most serious health problem involving UGT1A1 is Crigler-Najjar syndrome type 1 (CN-1), an autosomal recessive metabolic disorder characterized by abnormal accumulation of bilirubin in patients' blood. Mutations within the UGT1A1 gene lead to total or partial loss of UGT1A1 function, which, if left untreated, can have irreversible consequences, including neurological defects.
[0061] The coding sequence (CDS) for the wild-type UGT1A1 reference mRNA sequence is listed in the NCBI Reference Sequence Database (RefSeq) under accession number NM_000463.2 ("Homo sapiens UDP-glucuronosyltransferase family 1 member A1 (UGT1A1), mRNA"). The wild-type UGT1A1 reference protein sequence is listed in the RefSeq database under accession number NP_000454.1 ("UDP-glucuronosyltransferase 1-1 precursor [Homo sapiens]"). The UGT1A1 protein is 533 amino acids long. Note that the specific nucleic acid sequence encoding the reference protein sequence in the RefSeq sequence is the coding sequence (CDS) as shown in the respective RefSeq database entry.
[0062] In certain aspects, the present disclosure provides a polynucleotide (e.g., RNA, e.g., mRNA) comprising a nucleotide sequence (e.g., an open reading frame (ORF)) encoding a UGT1A1 polypeptide. In some embodiments, the UGT1A1 polypeptide of the present invention is a wild-type full-length human UGT1A1 protein. In some embodiments, the UGT1A1 polypeptide of the present invention is a variant, peptide, or polypeptide comprising substitutions and insertions, and / or additions, deletions, and / or covalent modifications relative to the wild-type UGT1A1 sequence. In some embodiments, sequence tags or amino acids can be added to the sequences encoded by the polynucleotides of the present invention (e.g., at the N- or C-terminus), for example, for positional restriction. In some embodiments, amino acid residues located at the carboxy-, amino-, or internal regions of the polypeptides of the present invention can be optionally deleted to obtain fragments.
[0063] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) comprising a nucleotide sequence (e.g., ORF) of the invention encodes a substitution variant of human UGT1A1, which can include one, two, three, or more substitutions. In some embodiments, the substitution variant can include one or more conservative amino acid substitutions. In other embodiments, the variant is an insertion variant. In other embodiments, the variant is a deletion variant.
[0064] UGT1A1 protein fragments, functional protein domains, variants, and homologous proteins (orthologs) are also within the scope of the UGT1A1 polypeptides of the present disclosure. Exemplary polypeptides encoded by the polynucleotides of the present invention include, but are not limited to, those set forth in SEQ ID NO:1.
[0065] 2. Polynucleotides and Open Reading Frames (ORFs) The present invention features mRNA for use in the treatment or prevention of CN-1. When the mRNA featured for use in the present invention is administered to a subject, it encodes human UGT1A1 protein in vivo. Accordingly, the present invention relates to polynucleotides, e.g., mRNAs, comprising an open reading frame of linked nucleosides encoding human UGT1A1 (SEQ ID NO: 1), functional fragments thereof, and fusion proteins comprising UGT1A1. In particular, the present invention provides sequence-optimized polynucleotides comprising nucleotides encoding the polypeptide sequence of human UGT1A1, or sequences having high sequence identity to these sequence-optimized polynucleotides.
[0066] In certain aspects, the present invention provides a polynucleotide (e.g., an RNA such as an mRNA) comprising a nucleotide sequence (e.g., an ORF) encoding one or more UGT1A1 polypeptides. In some embodiments, the encoded UGT1A1 of the present invention is: (i) a full-length UGT1A1 polypeptide (e.g., one having the same or essentially the same length as wild-type UGT1A1; e.g., human UGT1A1); (ii) a functional fragment of UGT1A1 as described herein (e.g., a sequence that is shorter than UGT1A1 (e.g., a deletion of a carboxy, amino terminal, or internal region); however, still retains UGT1A1 enzymatic activity); (iii) variants thereof (e.g., full-length or truncated UGT1A1 proteins with one or more amino acid substitutions, e.g., variants that retain all or most of the UGT1A1 activity of the polypeptide with respect to the reference protein (e.g., amino acid Ala46 of SEQ ID NO: 1 substituted with aspartic acid (A46D), amino acid Asp70 of SEQ ID NO: 1 substituted with glutamic acid (D70E), amino acid Ser157 of SEQ ID NO: 1 substituted with glycine (S157G), and amino acid Ser381 of SEQ ID NO: 1 substituted with glycine (S381G), or any naturally occurring or artificial variant known in the art)); or (iv) It can be selected from the group consisting of: (i) a fusion protein comprising the full-length UGT1A1 protein (e.g., SEQ ID NO: 1), or a variant thereof; and (ii) a heterologous protein.
[0067] In certain embodiments, the encoded UGT1A1 polypeptide is a mammalian UGT1A1 polypeptide, such as a human UGT1A1 polypeptide, a functional fragment, or a variant thereof.
[0068] In some embodiments, introduction of a polynucleotide (e.g., RNA, e.g., mRNA) of the present invention into a cell increases the UGT1A1 protein expression level and / or detectable UGT1A1 enzyme activity level in the cell by, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%, compared to the UGT1A1 protein expression level and / or detectable UGT1A1 enzyme activity level in the cell before administration of the polynucleotide of the present invention. UGT1A1 protein expression level and / or UGT1A1 enzyme activity level can be measured according to methods known in the art. In some embodiments, the polynucleotide is introduced into a cell in vitro. In some embodiments, the polynucleotide is introduced into a cell in vivo.
[0069] In some embodiments, a polynucleotide (eg, RNA, eg, mRNA) of the invention comprises a nucleotide sequence (eg, ORF) encoding wild-type human UGT1A1, eg, (SEQ ID NO:1).
[0070] Polynucleotides (e.g., RNA, e.g., mRNA) of the invention comprise codon-optimized nucleic acid sequences, wherein the open reading frame (ORF) of the codon-optimized nucleic acid sequence is derived from a wild-type UGT1A1 sequence (e.g., wild-type human UGT1A1). For example, in a polynucleotide of the invention comprising a sequence-optimized ORF encoding UGT1A1, the corresponding wild-type sequence is native human UGT1A1. Similarly, in a sequence-optimized mRNA encoding a functional fragment of human UGT1A1, the corresponding wild-type sequence is the corresponding fragment from human UGT1A1.
[0071] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence encoding a UGT1A1 having the full-length sequence of human UGT1A1 (i.e., including the initiator methionine: amino acids 1-533).
[0072] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a mutant UGT1A1 polypeptide. In some embodiments, a polynucleotide of the invention comprises an ORF encoding a UGT1A1 polypeptide that comprises at least one point mutation in the UGT1A1 amino acid sequence and maintains UGT1A1 enzymatic activity. In some embodiments, the mutant UGT1A1 polypeptide has at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the UGT1A1 activity of the corresponding wild-type UGT1A1 (set forth in SEQ ID NO: 1). In some embodiments, a polynucleotide (eg, an RNA, eg, an mRNA) of the invention comprising an ORF encoding a mutant UGT1A1 polypeptide is sequence-optimized.
[0073] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide comprising mutations that do not alter UGT1A1 enzymatic activity. Such mutant UGT1A1 polypeptides can be referred to as functionally neutral. In some embodiments, the polynucleotide comprises an ORF encoding a mutant UGT1A1 polypeptide comprising one or more functionally neutral point mutations.
[0074] In some embodiments, the mutant UGT1A1 polypeptide has greater UGT1A1 enzymatic activity than the corresponding wild-type UGT1A1. In some embodiments, the mutant UGT1A1 polypeptide provides UGT1A1 activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% greater than the activity of the corresponding wild-type UGT1A1 (i.e., the same UGT1A1 protein but without the mutation(s)).
[0075] In some embodiments, polynucleotides (e.g., RNA, e.g., mRNA) of the invention comprise a nucleotide sequence (e.g., ORF) encoding a functional UGT1A1 fragment, e.g., wherein one or more fragments correspond to a polypeptide subsequence of a wild-type UGT1A1 polypeptide and maintain UGT1A1 enzymatic activity. In some embodiments, the UGT1A1 fragments have at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the UGT1A1 enzymatic activity of the corresponding full-length UGT1A1. In some embodiments, polynucleotides (e.g., RNA, e.g., mRNA) of the invention comprising an ORF encoding a functional UGT1A1 fragment are sequence-optimized.
[0076] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 fragment that has greater UGT1A1 enzymatic activity than a corresponding full-length UGT1A1. Thus, in some embodiments, the UGT1A1 fragment has at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% greater UGT1A1 activity than the UGT1A1 activity of the corresponding full-length UGT1A1.
[0077] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 fragment that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25% shorter than wild-type UGT1A1.
[0078] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., the sequence set forth in SEQ ID NO: 1, a functional fragment, or a variant thereof), which nucleotide sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence of SEQ ID NOs: 2 or 5-12.
[0079] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 2, and 5-12.
[0080] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the present invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof), wherein the nucleotide sequence has 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 70% to 95%, 80% to 95%, 70% to 85%, 75% to 90%, 80% to 95%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12.
[0081] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof), wherein the nucleotide sequence is 70% to 90% identical; 75% to 85% identical; 76% to 84% identical; 77% to 83% identical; 77% to 82% identical; or 78% to 81% identical to the sequence of SEQ ID NO: 2, or 5-12.
[0082] In some embodiments, the polynucleotides (e.g., RNA, e.g., mRNA) of the invention are from about 900 to about 100,000 nucleotides (e.g., 900-1,000, 900-1,100, 900-1,200, 900-1,300, 900-1,400, 900-1,500, 1,000-1,100, 1,000-1,100, 1,000-1,200, 1,000-1,300, 1,000-1,400, 00, 1,000–1,500, 1,187–1,200, 1,187–1,400, 1,187–1,600, 1,187–1,800, 1,187–2,000, 1,187–3,000, 1,187–5,000, 1,187–7,000, 1,187–10,000, 1,187–25,000, 1,187–50,000, 1,187–70,000, or 1,187–100,000).
[0083] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof), wherein the length of the nucleotide sequence (e.g., ORF) is at least 500 nucleotides in length (e.g., at least about 500, 600, 700, 80, 900, 1,000, 1,050, 1,100, 1,187, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, 2,900, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 7 ,900, 3,000, 3,100, 3,200, 3,300, 3,400, 3,500, 3,600, 3,700, 3,800, 3,900, 4,000, 4,100, 4,200, 4,300, 4,400, 4,500, 4,600, 4,700, 4,800, 4,900, 5,000, 5,100, 5,200, 5,300, 5,400, 5, 500, 5,600, 5,700, 5,800, 5,900, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or more, or up to 100,000 nucleotides in length (and inclusive).
[0084] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof) and further comprises at least one non-coding nucleic acid sequence, e.g., a microRNA binding site. In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention further comprises a 5'-UTR (e.g., selected from the sequences of SEQ ID NOs: 3, 88-102, and 165-167, or selected from the sequences of SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 193, and SEQ ID NO: 194) and a 3'-UTR (e.g., selected from the sequences of SEQ ID NOs: 104-112, 150, 151, and 178, or selected from the sequences of SEQ ID NO: 4, SEQ ID NO: 111, SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 195, and SEQ ID NO: 196). In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12. In further embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) comprises a 5'-end cap (e.g., Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methyl G cap, or an analog thereof) and a polyA-tail region (e.g., about 100 nucleotides in length). In further embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) comprises a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 111, 112, 150, 151, and 178, or any combination thereof. In further embodiments, the polynucleotide (e.g., RNA, e.g., mRNA) comprises a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4, 111, 150, 175, 177, 178, 195, and 196, or any combination thereof. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 4.In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 111. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 151. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 150. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 175. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 177. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 178. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 195. In some embodiments, the mRNA comprises a 3' UTR comprising the nucleic acid sequence of SEQ ID NO: 196. In some embodiments, the mRNA comprises a poly-A tail. In some cases, the poly-A tail is 50-150 (SEQ ID NO:198), 75-150 (SEQ ID NO:199), 85-150 (SEQ ID NO:200), 90-150 (SEQ ID NO:201), 90-120 (SEQ ID NO:202), 90-130 (SEQ ID NO:203), or 90-150 (SEQ ID NO:201) nucleotides in length. In some cases, the poly-A tail is 100 nucleotides in length (SEQ ID NO:204).
[0085] In some embodiments, a polynucleotide (eg, RNA, eg, mRNA) of the invention comprising a nucleotide sequence (eg, ORF) encoding a UGT1A1 polypeptide is single-stranded or double-stranded.
[0086] In some embodiments, a polynucleotide of the invention comprising a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof) is DNA or RNA. In some embodiments, a polynucleotide of the invention is RNA. In some embodiments, a polynucleotide of the invention is or functions as an mRNA. In some embodiments, the mRNA comprises a nucleotide sequence (e.g., ORF) that encodes at least one UGT1A1 polypeptide and that can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded UGT1A1 polypeptide.
[0087] In some embodiments, a polynucleotide (e.g., an RNA, e.g., an mRNA) of the invention comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof, see, e.g., SEQ ID NOs: 2 and 5-12), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil. In certain embodiments, all uracils in the polynucleotide are N1-methylpseudouracil. In other embodiments, all uracils in the polynucleotide are 5-methoxyuracil. In some embodiments, the polynucleotide further comprises an miRNA-binding site, e.g., an miRNA-binding site that binds miR-142 and / or an miRNA-binding site that binds miR-126.
[0088] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) disclosed herein is formulated with a delivery agent comprising, for example, a compound having Formula (I), e.g., any of Compounds 1-232, e.g., Compound II; a compound having Formula (III), (IV), (V), or (VI), e.g., any of Compounds 233-342, e.g., Compound VI; or a compound having Formula (VIII), e.g., any of Compounds 419-428, e.g., Compound I, or any combination thereof. In some embodiments, the delivery agent comprises Compound II, DSPC, cholesterol, and Compound I or PEG-DMG, e.g., in a molar ratio of about 50:10:38.5:1.5. In some embodiments, the delivery agent may comprise Compound VI, DSPC, cholesterol, and Compound I or PEG-DMG, e.g., about 30 to about 60 mole % Compound II or VI (or a related suitable amino lipid) (e.g., 30 to 40, 40 to 45, 45 to 50, 50 to 55, or 55 to 60 mole % Compound II or VI (or a related suitable amino lipid)), about 5 to about 20 mole % phospholipid (or a related suitable phospholipid, or "helper lipid") (e.g., 5 to 10, 10 to 20 mole % phospholipid (or a related suitable phospholipid, or "helper lipid"), 15, or 15-20 mol%), about 20 to about 50 mol% cholesterol (or related sterol, or "non-cationic" lipid) (e.g., about 20-30, 30-35, 35-40, 40-45, or 45-50 mol%) cholesterol (or related sterol, or "non-cationic" lipid), and about 0.05 to about 10 mol% PEG lipid (or other suitable PEG lipid) (e.g., 0.05-1, 1-2, 2-3, 3-4, 4-5, 5-7, or 7-10 mol%) PEG lipid (or other suitable PEG lipid). Exemplary delivery agents can include, for example, molar ratios of 47.5:10.5:39.0:3.0, or 50:10:38.5:1.5.In certain instances, exemplary delivery agents include, for example, 47.5:10.5:39.0:3, 47.5:10:39.5:3, 47.5:11:39.5:2, 47.5:10.5:39.5:2.5, 47.5:11:39:2.5, 48.5:10:38.5:3, 48.5:10.5:39:2, 48.5:10.5:38.5:2.5, 48.5: In some embodiments, the delivery agent comprises Compound II or VI, DSPC, cholesterol, and Compound I or PEG-DMG in a molar ratio of, for example, about 47.5:10.5:39.0:3.0. In some embodiments, the delivery agent comprises Compound II or VI, DSPC, cholesterol, and Compound I or PEG-DMG, for example, in a molar ratio of about 50:10:38.5:1.5.
[0089] In some embodiments, the polynucleotide of the present disclosure is an mRNA comprising a 5'-end cap (e.g., Cap1), a 5' UTR (e.g., SEQ ID NO: 3), an ORF sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12, a 3' UTR (e.g., SEQ ID NOs: 111, 150, 151, or 178), and a poly-A tail (e.g., about 100 nucleotides in length), wherein all uracils in the polynucleotide are N1-methylpseudouracil. In some embodiments, the delivery agent comprises Compound II or Compound VI as an ionic lipid and PEG-DMG or Compound I as a PEG lipid.
[0090] In some embodiments, a polynucleotide of the disclosure comprises a 5' end cap (e.g., Cap 1), a 5' UTR (e.g., SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 193, or SEQ ID NO: 194), an ORF sequence selected from the group consisting of SEQ ID NOs: 2, 5-11, and 25, a 3' UTR (e.g., SEQ ID NO: 4, SEQ ID NO: 111, SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 195, or SEQ ID NO: 196), and a poly-A tail (e.g., an mRNA comprising about 100 nucleotides in length, wherein all uracils in the polynucleotide are N1-methylpseudouracil or 5-methoxyuracil). In some embodiments, the delivery agent comprises Compound II or Compound VI as the ionizable lipid and PEG-DMG or Compound I as the PEG lipid.
[0091] 3. Signal sequence Polynucleotides (e.g., RNA, e.g., mRNA) of the invention can also include nucleotide sequences encoding additional features that facilitate transport of the encoded polypeptide to a therapeutically relevant site. One such feature that aids in protein transport is a signal sequence, or targeting sequence. The peptides encoded by these signal sequences are known by various names, such as targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (e.g., RNA, e.g., mRNA) includes a nucleotide sequence (e.g., ORF) encoding a signal peptide operably linked to a nucleotide sequence encoding a UGT1A1 polypeptide described herein.
[0092] In some embodiments, the "signal sequence" or "signal peptide" is a polynucleotide or polypeptide, optionally incorporated at the 5' (or N-terminus) of a coding region or polypeptide, respectively, and approximately 30-210, e.g., approximately 45-80 or 15-60 nucleotides (e.g., approximately 20, 30, 40, 50, 60, or 70 amino acids) in length. Addition of these sequences results in transport of the encoded polypeptide to a desired site, e.g., the endoplasmic reticulum or mitochondria, via one or more targeting pathways. Some signal peptides are cleaved from the protein, e.g., by a signal peptidase, after the protein has been transported to the desired site.
[0093] In some embodiments, a polynucleotide of the invention comprises a nucleotide sequence encoding a UGT1A1 polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a heterologous signal peptide.
[0094] 4. Fusion Proteins In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention can comprise two or more nucleic acid sequences (e.g., ORFs) encoding polypeptides of interest. In some embodiments, a polynucleotide of the invention comprises a single ORF encoding a UGT1A1 polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, a polynucleotide of the invention can comprise two or more ORFs, e.g., a first ORF encoding a UGT1A1 polypeptide (a first polypeptide of interest), a functional fragment, or a variant thereof, and a second ORF expressing a second polypeptide of interest. In some embodiments, two or more polypeptides of interest can be genetically fused, i.e., two or more polypeptides can be encoded by the same ORF. In some embodiments, the polynucleotide can comprise a nucleic acid sequence encoding a linker (e.g., a G4S (SEQ ID NO: 86) peptide linker or another linker known in the art) between two or more polypeptides of interest.
[0095] In some embodiments, a polynucleotide (eg, RNA, eg, mRNA) of the invention can include two, three, four, or more ORFs, each of which expresses a polypeptide of interest.
[0096] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention can include a first nucleic acid sequence (e.g., a first ORF) that encodes a UGT1A1 polypeptide and a second nucleic acid sequence (e.g., a second ORF) that encodes a second polypeptide of interest.
[0097] Linkers and cleavable peptides In certain embodiments, the mRNA of the present disclosure encodes two or more UGT1A1 domains, or heterologous domains, referred to herein as a multimeric construct. In certain embodiments of such multimeric constructs, the mRNA further encodes a linker located between each domain. The linker can be, for example, a cleavable linker or a protease-sensitive linker. In certain embodiments, the linker is selected from the group consisting of an F2A linker, a P2A linker, a T2A linker, an E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, also known as 2A peptides, has been described in the art (see, e.g., Kim, J. Het al. (2011) PLoS ONE 6:e18556). In certain embodiments, the linker is an F2A linker. In certain embodiments, the linker is a GGGS (SEQ ID NO: 197) linker. In certain embodiments, the linker is a (GGGS)n (SEQ ID NO: 190) linker, where n=2, 3, 4, or 5. In certain embodiments, the multimeric construct contains three domains with an intervening linker and has the structure: domain-linker-domain-linker-domain, e.g., UGT1A1 domain-linker-UGT1A1 domain-linker-UGT1A1 domain.
[0098] In one embodiment, the cleavable linker is an F2A linker (e.g., having the amino acid sequence GSGVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 186)). In other embodiments, the cleavable linker is a T2A linker (e.g., having the amino acid sequence GSGGEGRGSLLTCGDVEENPGP (SEQ ID NO: 187)), a P2A linker (e.g., having the amino acid sequence GSGATNFSLKQAGDVEENPGP (SEQ ID NO: 188)), or an E2A linker (e.g., having the amino acid sequence GSGQCTNYALLKLAGDVESNPGP (SEQ ID NO: 189)). Those of skill in the art will appreciate that other art-recognized linkers may be suitable for use in the constructs of the invention (e.g., encoded by polynucleotides of the invention). Similarly, those of skill in the art will appreciate that other multicistronic constructs are suitable for use in the invention. In exemplary embodiments, the construct design results in approximately equimolar amounts of intracellular antibodies and / or domains thereof encoded by the constructs of the invention.
[0099] In one embodiment, the self-cleaving peptide may be, but is not limited to, a 2A peptide. Various 2A peptides are known and available in the art, including, for example, foot-and-mouth disease virus (FMDV) 2A peptide, equine rhinitis A virus 2A peptide, Thosea asigna virus 2A peptide, and porcine teschovirus-1 2A peptide. The 2A peptide is used by multiple viruses to produce two proteins from a single transcript by ribosomal skipping, where the normal peptide bond is disrupted in the 2A peptide sequence, resulting in the production of two discontinuous proteins from a single translation event. By way of example, but not limited to, the 2A peptide may have the protein sequence of SEQ ID NO: 188, a fragment thereof, or a variant thereof. In one embodiment, the 2A peptide cleaves between the final glycine and the final proline. As another example, but not limited to, a polynucleotide of the present invention may include a polynucleotide sequence encoding a 2A peptide having the protein sequence of a fragment or variant of SEQ ID NO: 188. One example of a polynucleotide sequence encoding a 2A peptide is: GGAAGCGGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCU (SEQ ID NO: 191). In one exemplary embodiment, the 2A peptide is encoded by the following sequence: 5'-UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAAACAAACUCU UAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAUCCAGGTCCACUC-3' (SEQ ID NO: 192). The polynucleotide sequence of the 2A peptide may be modified or codon optimized by methods described herein and / or known in the art.
[0100] In one embodiment, this sequence can be used to separate the coding regions for two or more polypeptides of interest. By way of example, and not limitation, the sequence encoding the F2A peptide can be between a first coding region A and a second coding region B (A-F2Apep-B). The presence of the F2A peptide results in cleavage of one long protein between the glycine and proline at the end of the F2A peptide sequence (NPGP (SEQ ID NO: 205) cleavage to yield NPG and P), resulting in the generation of separate protein A (21 amino acids from the F2A peptide bond, terminating at NPG) and separate protein B (1 amino acid from the F2A peptide bond, P). Similarly, for the other 2A peptides (P2A, T2A, and E2A), the presence of the peptide in a long protein results in cleavage between the glycine and proline at the end of the 2A peptide sequence (SEQ ID NO: 205) to yield NPG and P). Protein A and protein B can be peptides or polypeptides (eg, UGT1A1 polypeptides, such as full-length human UGT1A1) that serve the same or different purposes.
[0101] 5. Sequence Optimization of the Nucleotide Sequence Encoding the UGT1A1 Polypeptide In some embodiments, polynucleotides (e.g., RNA, e.g., mRNA) of the invention are sequence-optimized. In some embodiments, polynucleotides (e.g., RNA, e.g., mRNA) of the invention include a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide, optionally a nucleotide sequence (e.g., ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, the 5'UTR or 3'UTR optionally comprising at least one microRNA-binding site, an optional nucleotide sequence encoding a linker, a polyA tail, or any combination thereof, wherein the ORF(s) are sequence-optimized.
[0102] A sequence-optimized nucleotide sequence encoding a UGT1A1 polypeptide, e.g., a codon-optimized mRNA sequence, is a sequence that contains at least one synonymous nucleobase substitution relative to a reference sequence (e.g., a wild-type nucleotide sequence encoding a UGT1A1 polypeptide).
[0103] A sequence-optimized nucleotide sequence can be partially or completely different in sequence from a reference sequence. For example, a reference sequence encoding polyserine, which is commonly encoded by UCU codon, can be sequence-optimized by substituting 100% of its nucleic acid bases (substituting A for U at position 1, G for C at position 2, and C for U at position 3 for each codon) to obtain a sequence encoding polyserine, which would be commonly encoded by AGC codon. The overall pairwise alignment between the reference polyserine nucleic acid sequence and the sequence-optimized polyserine nucleic acid sequence yields a sequence identity percentage of 0%. However, the identity of the protein products derived from both sequences is 100%.
[0104] Some sequence optimization (sometimes referred to as codon optimization) methods are known in the art (and are described in detail below) and can be useful for achieving one or more desired results. These results can include, for example, matching codon frequencies in a particular tissue target and / or host organism to ensure proper folding; biasing G / C content to increase mRNA stability or reduce secondary structure; minimizing tandem repeat codons or base runs that may impair gene construction or gene expression; customizing transcriptional and translational control regions; inserting or removing protein transport sequences; removing / adding post-translational modification sites in the encoded protein (e.g., glycosylation sites); adding, removing, or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translation rates to allow proper folding of various domains of a protein; and / or reducing or eliminating problematic secondary structures within a polynucleotide. Sequence optimization tools, algorithms, and services are known in the art, examples of which include, but are not limited to, services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), and / or proprietary methods.
[0105] Table 1 shows the codon options for each amino acid. Table 1. Codon choices TIFF2025028860000002.tif188153
[0106] In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a sequence-optimized nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide, functional fragment, or variant thereof, wherein the UGT1A1 polypeptide, functional fragment, or variant encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to a UGT1A1 polypeptide, functional fragment, or variant encoded by a reference nucleotide sequence that is not sequence-optimized), such as improved properties relating to expression efficiency after in vivo administration. Such properties include, but are not limited to, improved nucleic acid stability (e.g., mRNA stability), increased translation efficiency in target tissues, reduced number of expressed truncated proteins, improved folding or prevention of misfolding of expressed proteins, reduced toxicity of the expressed product, reduced cell death due to the expressed product, and increased and / or reduced protein aggregation.
[0107] In some embodiments, the sequence-optimized nucleotide sequence (e.g., ORF) is codon-optimized for expression in a human subject to obtain structural and / or chemical characteristics that avoid one or more problems in the art, e.g., characteristics useful for optimizing the formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming expression thresholds; improving expression rate; improving half-life and / or protein concentration; optimizing protein localization; and avoiding adverse biological responses, such as immune responses and / or degradation pathways.
[0108] In some embodiments, a polynucleotide of the invention comprises a nucleotide sequence (e.g., a nucleotide sequence (e.g., ORF) encoding a UGT1A1 polypeptide, a nucleotide sequence (e.g., ORF) encoding another polypeptide of interest, a 5′-UTR, a 3′-UTR, a microRNA binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is; (i) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a UGT1A1 polypeptide) with an alternative codon to increase or decrease the uridine content, thereby generating a uridine-modified sequence; (ii) replacing at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a UGT1A1 polypeptide) with an alternative codon that has a higher codon frequency in a synonymous codon set; (iii) replacing at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a UGT1A1 polypeptide) with an alternative codon to increase the G / C content; or (iv) a combination thereof.
[0109] In some embodiments, the sequence-optimized nucleotide sequence (eg, an ORF encoding a UGT1A1 polypeptide) has at least one improved characteristic with respect to a reference nucleotide sequence.
[0110] In some embodiments, the sequence optimization method is multiparameter and includes one, two, three, four, or more of the methods disclosed herein and / or other optimization methods known in the art.
[0111] Features that may be beneficial in some embodiments of the present invention include those that can be encoded adjacent to or within a region of the polynucleotide, and can be located upstream (5'), downstream (3'), or within the region encoding the UGT1A1 polypeptide. These regions can be incorporated into the polynucleotide before and / or after sequence optimization of the protein-coding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, polyA tails, and detectable tags, as well as multiple cloning sites that may have XbaI recognition.
[0112] In some embodiments, polynucleotides of the invention comprise a 5'UTR, a 3'UTR, and / or a microRNA-binding site. In some embodiments, the polynucleotide comprises two or more 5'UTRs and / or 3'UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more microRNA-binding sites, which can be the same or different sequences. Any portion of the 5'UTR, 3'UTR, and / or microRNA-binding site can be sequence-optimized (including none), and can independently include one or more different structural or chemical modifications before and / or after sequence optimization.
[0113] In some embodiments, after optimization, the polynucleotides are reconstituted into vectors, such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes, and transformed. For example, when high copy plasmid-like or chromosomal structures are generated by the methods described herein, the optimized polynucleotides can be reconstituted and transformed into chemically competent E. coli, yeast, Neurospora, maize, Drosophila, etc.
[0114] 6. Sequence-optimized nucleotide sequence encoding UGT1A1 polypeptide In some embodiments, a polynucleotide of the invention comprises a sequence-optimized nucleotide sequence encoding a UGT1A1 polypeptide disclosed herein, hi some embodiments, a polynucleotide of the invention comprises an open reading frame (ORF) encoding a UGT1A1 polypeptide, wherein the ORF is sequence-optimized.
[0115] Exemplary sequence-optimized nucleotide sequences encoding human full-length UTG1A1 are set forth as SEQ ID NOs: 2, and 5-12. In some embodiments, the sequence-optimized UGT1A1 sequences, fragments, and variants thereof are used to practice the methods disclosed herein.
[0116] In some embodiments, a polynucleotide of the disclosure, e.g., a polynucleotide comprising an mRNA nucleotide sequence encoding a UGT1A1 polypeptide, comprises from the 5' to 3' end: (i) a 5' cap provided herein, e.g., Cap1; (ii) a 5'UTR of a sequence provided herein, e.g., SEQ ID NO: 3; (iii) an open reading frame encoding a UGT1A1 polypeptide, for example, a sequence-optimized nucleic acid sequence encoding a UGT1A1 set forth in SEQ ID NOs: 2 or 5-12; (iv) at least one stop codon (if not present, at the 5′ end of the 3′UTR); (v) a 3'UTR of a sequence provided herein, e.g., SEQ ID NO: 150, 151, or 178; and (vi) a polyA tail as described above. In some embodiments, a polynucleotide of the disclosure, e.g., a polynucleotide comprising an mRNA nucleotide sequence encoding a UGT1A1 polypeptide, comprises from the 5' to 3' end: (i) a 5' cap provided herein, e.g., Cap1; (ii) a 5'UTR of a sequence provided herein, e.g., SEQ ID NO: 3, 39, 193, or 194; (iii) an open reading frame encoding a UGT1A1 polypeptide, for example, a sequence-optimized nucleic acid sequence encoding a UGT1A1 set forth in SEQ ID NOs: 2 or 5-12; (iv) at least one stop codon (if not present, at the 5′ end of the 3′UTR); (v) a 3'UTR of a sequence provided herein, e.g., SEQ ID NO: 4, 111, 150, 175, 177, 178, 195, or 196; and (vi) a polyA tail as described above. In certain embodiments, all uracils in the polynucleotide are N1-methylpseudouracil (G5). In certain embodiments, all uracils in the polynucleotide are 5-methoxyuracil (G6).
[0117] The sequence-optimized nucleotide sequences disclosed herein differ from the corresponding wild-type nucleotide acid sequences and from other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.
[0118] In some embodiments, the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence (e.g., encoding a UGT1A1 polypeptide, functional fragment, or variant thereof) is altered (e.g., decreased) relative to the percentage of uracil or thymine nucleobases in a reference wild-type nucleotide sequence. Such sequences are referred to as uracil-modified sequences or thymine-modified sequences. The percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in the sequence by the total number of nucleotides, then multiplying by 100. In some embodiments, the sequence-optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence-optimized nucleotide sequence of the present invention is greater than the uracil or thymine content in the reference wild-type sequence, while still maintaining a beneficial effect, e.g., enhanced expression and / or reduced Toll-like receptor (TLR) response, compared to the reference wild-type sequence.
[0119] Methods for optimizing codon usage are known in the art. For example, the ORF of any one or more of the sequences set forth herein may be codon-optimized. In some embodiments, codon optimization may be used to match the codon frequency in the target and host organisms to ensure proper folding; bias the GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene constructs or expression; customize transcriptional and translational control regions; insert or remove protein transport sequences; remove / add post-translational modification sites in the encoded protein (e.g., glycosylation sites); add, remove, or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust the translation rate to allow various domains of the protein to fold properly; or reduce or eliminate problematic secondary structures within a polynucleotide. Codon optimization tools, algorithms, and services are known in the art, including, but not limited to, services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using an optimization algorithm.
[0120] 7. Characterization of Sequence-Optimized Nucleic Acids In some embodiments of the invention, a polynucleotide (e.g., RNA, e.g., mRNA) comprising a sequence-optimized nucleic acid disclosed herein that encodes a UGT1A1 polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property is improved relative to a non-sequence-optimized nucleic acid.
[0121] As used herein, "expression characteristics" refers to the characteristics of a nucleic acid sequence either in vivo (e.g., the translational efficacy of a synthetic mRNA after administration to a subject in need thereof) or in vitro (e.g., the translational efficacy of a synthetic mRNA tested in an in vitro model system). Expression characteristics include, but are not limited to, the amount of protein produced by an mRNA encoding a UGT1A1 polypeptide after administration, and the amount of soluble or other functional protein produced. In some embodiments, the sequence-optimized nucleic acids disclosed herein can be assessed according to the viability of cells expressing a protein encoded by a sequence-optimized nucleic acid sequence (e.g., RNA, e.g., mRNA) encoding a UGT1A1 polypeptide disclosed herein.
[0122] In certain embodiments, a plurality of sequence-optimized nucleic acids (e.g., RNA, e.g., mRNA) disclosed herein that contain codon substitutions relative to a non-optimized reference nucleic acid sequence can be functionally characterized to functionally measure a property of interest, e.g., expression profile, in an in vitro model system or in vivo in a target tissue or cell.
[0123] a. Optimization of inherent properties of nucleic acid sequences In some embodiments of the present invention, the desired properties of the polynucleotide are inherent properties of the nucleic acid sequence. For example, a nucleotide sequence (e.g., RNA, e.g., mRNA) can be sequence-optimized for in vivo or in vitro stability. In some embodiments, the nucleotide sequence can be sequence-optimized for expression in a specific target tissue or cell. In some embodiments, the nucleic acid sequence is sequence-optimized to prevent degradation of the sequence by endonucleases and exonucleases, thereby increasing its plasma half-life.
[0124] In other embodiments, the nucleic acid sequences are sequence-optimized to enhance their resistance to hydrolysis in solution, e.g., to extend the time that the sequence-optimized nucleic acid, or a pharmaceutical composition comprising the sequence-optimized nucleic acid, can be stored under aqueous conditions with minimal degradation.
[0125] In other embodiments, the sequence-optimized nucleic acids can be optimized to have increased resistance to hydrolysis under dry storage conditions, e.g., to extend the time that the sequence-optimized nucleic acids can be stored after lyophilization with minimal degradation.
[0126] b. Nucleic acid sequences optimized for protein expression In some embodiments of the present invention, the desired property of the polynucleotide is the expression level of the UGT1A1 polypeptide encoded by the sequence-optimized sequence disclosed herein. Protein expression levels can be measured using one or more expression systems. In some embodiments, expression can be measured in a cell culture system, e.g., CHO cells or HEK293 cells. In some embodiments, expression can be measured using an in vitro expression system prepared from an extract of viable cells, such as rabbit reticulocyte lysate, or prepared from a collection of purified individual components. In other embodiments, protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.
[0127] In some embodiments, it may be desirable to express the protein in a solution form. Thus, in some embodiments, a reference sequence may be sequence-optimized to obtain a sequence-optimized nucleic acid sequence with an optimized level of protein expressed in a soluble form. The level of protein expression, as well as other characteristics such as solubility, aggregation level, and the presence of truncation products (i.e., fragments resulting from proteolysis, hydrolysis, or translational defects), can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.).
[0128] c. Optimizing the viability of target tissues or target cells In some embodiments, expression of the heterologous therapeutic protein encoded by the nucleic acid sequence may have adverse effects in the target tissue or cell, reducing protein yield or reducing the quality of the expression product (e.g., due to the presence of protein fragments in inclusion bodies or precipitation of the expressed protein), or may cause toxicity.
[0129] Thus, in some embodiments of the present invention, sequence optimization of a nucleic acid sequence disclosed herein, e.g., a nucleic acid sequence encoding a UGT1A1 polypeptide, can be used to increase the viability of a target cell expressing a protein encoded by the sequence-optimized nucleic acid.
[0130] Expression of heterologous proteins can also be harmful to cells transfected with nucleic acid sequences for autologous or xenotransplantation. Thus, in some embodiments of the present disclosure, sequence optimization of the nucleic acid sequences disclosed herein can be used to increase the viability of target cells expressing proteins encoded by the sequence-optimized nucleic acids. Changes in cell or tissue viability, toxicity, and other physiological responses can be measured according to methods known in the art.
[0131] d. Decreased immune and / or inflammatory response In some cases, administration of a sequence-optimized nucleic acid encoding a UGT1A1 polypeptide, or a functional fragment thereof, can elicit an immune response that could be attributable to (i) a therapeutic agent (e.g., an mRNA encoding a UGT1A1 polypeptide), or (ii) an expression product of such a therapeutic agent (e.g., a UGT1A1 polypeptide encoded by the mRNA), or (iv) a combination thereof. Thus, in some embodiments of the present disclosure, sequence optimization of the nucleic acid sequences (e.g., mRNA) disclosed herein can be used to reduce an immune or inflammatory response elicited by administration of a nucleic acid encoding a UGT1A1 polypeptide or by an expression product of UGT1A1 encoded by such a nucleic acid.
[0132] In some embodiments, the inflammatory response can be measured by detecting elevated levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA. The term "inflammatory cytokine" refers to a cytokine that is elevated in an inflammatory response. Examples of inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1, also known as GROα, interferon-γ (IFNγ), tumor necrosis factor α (TNFα), interferon-γ-induced protein 10 (IP-10), or granulocyte colony-stimulating factor (G-CSF). The term "inflammatory cytokine" also includes other cytokines associated with inflammatory responses known in the art, such as interleukin-1 (IL-1), interleukin-8 (IL-8), interleukin-12 (IL-12), interleukin-13 (IL-13), interferon α (IFN-α), and the like.
[0133] 8. Modified nucleotide sequences encoding UGT1A1 polypeptides In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the invention comprises a chemically modified nucleobase, e.g., a chemically modified uracil, e.g., pseudouracil, N1-methylpseudouracil, 5-methoxyuracil, etc. In some embodiments, the mRNA is a uracil-modified sequence comprising an ORF encoding a UGT1A1 polypeptide, wherein the mRNA comprises a chemically modified nucleobase, e.g., a chemically modified uracil, e.g., pseudouracil, N1-methylpseudouracil, or 5-methoxyuracil.
[0134] In certain aspects of the present invention, when a modified uracil base is attached to a ribose sugar, as in the case of a polynucleotide, the resulting modified nucleoside or nucleotide is referred to as a modified uridine. In some embodiments, the uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% modified uracil. In one embodiment, the uracil in the polynucleotide is at least 95% modified uracil. In another embodiment, the uracil in the polynucleotide is 100% modified uracil.
[0135] In embodiments where the uracils in the polynucleotide are at least 95% modified uracils, the overall uracil content can be adjusted so that the mRNA provides appropriate protein expression levels while eliciting little or no immune response. In some embodiments, the uracil content of the ORF can be about 100%, about 150%, about 100% to about 110%, about 105% to about 115%, about 110% to about 120%, about 115% to about 125%, about 120% to about 130%, about 125% to about 135%, about 130% to about 140%, about 135% to about 145%, or about 140% to about 150% (U TM In other embodiments, the uracil content of the ORF is TM In some embodiments, the uracil content of the ORF encoding the UGT1A1 polypeptide is about 121% to about 136%, or 123% to 134% of the U TM %, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the total amino acid sequence. In this context, the term "uracil" can refer to modified uracil and / or naturally occurring uracil.
[0136] In some embodiments, the uracil content in the ORF of an mRNA encoding a UGT1A1 polypeptide of the present invention is less than about 30%, about 25%, about 20%, about 15%, or about 10% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is about 10% to about 20% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is about 10% to about 25% of the total nucleobase content in the ORF. In one embodiment, the uracil content in the ORF of an mRNA encoding a UGT1A1 polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to modified uracil and / or naturally occurring uracil.
[0137] In further embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide having modified uracils and modulated uracil content has an increased cytosine (C), guanine (G), or guanine / cytosine (G / C) content (absolute or relative). In some embodiments, the overall increase in C, G, or G / C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the wild-type ORF. In some embodiments, the G, C, or G / C content in an ORF is less than or equal to the theoretical maximum G, C, or G / C content (G TMX %, C TMX %, or G / C TMX% of the total G and / or C content of a given gene. In some embodiments, the increase in G and / or C content (absolute or relative) described herein can be achieved by substituting synonymous codons with low G, C, or G / C content with codons with higher C, G, or G / C content. In other embodiments, the increase in G and / or C content (absolute or relative) can be achieved by substituting synonymous codons ending in U with codons ending in G or C.
[0138] In further embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide of the present invention comprises modified uracil and has an adjusted uracil content, containing fewer uracil pairs (UU), uracil triplets (UUU), and / or uracil adolpants (UUUU) than the corresponding wild-type nucleotide sequence encoding a UGT1A1 polypeptide. In some embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide of the present invention does not contain uracil pairs, uracil triplets, and / or uracil adolpants. In some embodiments, the number of uracil pairs, uracil triplets, and / or uracil adolpants occurring in the ORF of an mRNA encoding a UGT1A1 polypeptide is reduced below a certain threshold, for example, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or fewer. In certain embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide of the invention contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non-phenylalanine uracil pairs and / or triplets. In other embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide does not contain any non-phenylalanine uracil pairs and / or triplets.
[0139] In further embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide of the present invention comprises modified uracil and has an adjusted uracil content, containing fewer uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding a UGT1A1 polypeptide, hi some embodiments, the ORF of an mRNA encoding a UGT1A1 polypeptide of the present invention comprises a uracil-rich cluster that is shorter in length than the corresponding uracil-rich cluster in the corresponding wild-type nucleotide sequence encoding a UGT1A1 polypeptide.
[0140] In another embodiment, use less frequent alternative codons.At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99% or 100% of the codons in the ORF encoding the UGT1A1 polypeptide of the modified uracil-containing mRNA are respectively replaced with the alternative codons that have a lower codon frequency than the codon frequency of the replacement codon in the synonymous codon set.Also, the ORF has an adjusted uracil content as described above. In some embodiments, at least one codon in the ORF of an mRNA encoding a UGT1A1 polypeptide is replaced with an alternative codon that has a codon frequency that is lower than the codon frequency of the replacement codon in the synonymous codon set.
[0141] In some embodiments, when the uracil content is adjusted, the ORF of the modified uracil-containing mRNA encoding a UGT1A1 polypeptide exhibits a higher UGT1A1 expression level than the corresponding wild-type mRNA when administered to mammalian cells. In some embodiments, the mammalian cells are mouse cells, rat cells, or rabbit cells. In other embodiments, the mammalian cells are monkey cells or human cells. In some embodiments, the human cells are HeLa cells, BJ fibroblasts, or peripheral blood mononuclear cells (PBMCs). In some embodiments, UGT1A1 is expressed at a higher level than the corresponding wild-type mRNA when the mRNA is administered to mammalian cells in vivo. In some embodiments, the mRNA is administered to a mouse, rabbit, rat, monkey, or human. In one embodiment, the mouse is a null mouse. In some embodiments, the mRNA is administered to mice at about 0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, or 0.2 mg / kg, or about 0.5 mg / kg. In some embodiments, the mRNA is administered intravenously or intramuscularly. In other embodiments, the UGT1A1 polypeptide is expressed when the mRNA is administered to mammalian cells in vitro. In some embodiments, expression is increased by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold. In other embodiments, expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.
[0142] In some embodiments, adjusting the uracil content results in an ORF of a modified uracil-containing mRNA encoding a UGT1A1 polypeptide exhibiting increased stability. In some embodiments, the mRNA exhibits increased stability in cells compared to the stability of the corresponding wild-type mRNA under the same conditions. In some embodiments, the mRNA exhibits increased stability, including improved resistance to nucleases, thermal stability, and / or stabilization of secondary structure. In some embodiments, the increased stability of the mRNA is measured by determining the half-life of the mRNA (e.g., in plasma, serum, cells, or tissue samples) and / or determining the area under the curve (AUC) of protein expression by the mRNA over time (e.g., in vitro or in vivo). An mRNA is identified as having increased stability if the half-life and / or AUC is greater than the half-life and / or AUC of the corresponding wild-type mRNA under the same conditions.
[0143] In some embodiments, the mRNAs of the present disclosure induce a detectably reduced immune response (e.g., innate or acquired) compared to the immune response elicited by the corresponding wild-type mRNA under the same conditions. In other embodiments, the mRNAs of the present disclosure induce a detectably reduced immune response (e.g., innate or acquired) compared to the immune response elicited by an mRNA encoding a UGT1A1 polypeptide but not containing modified uracil under the same conditions, or compared to the immune response elicited by an mRNA encoding a UGT1A1 polypeptide and containing modified uracil but with an unmodified uracil content under the same conditions. The innate immune response is manifested by increased expression of proinflammatory cytokines, activation of intracellular PRRs (e.g., RIG-I, MDA5), cell death, and / or termination or reduction of protein translation. In some embodiments, a reduced innate immune response can be measured by the expression or activity levels of type I interferons (e.g., IFN-α, IFN-β, IFN-κ, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN-ζ), or the expression of interferon-regulated genes such as toll-like receptors (e.g., TLR7 and TLR8), and / or by reduced cell death following one or more administrations of an mRNA of the invention to cells.
[0144] In some embodiments, expression of type 1 interferon by mammalian cells in response to an mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to the corresponding wild-type mRNA, an mRNA encoding a UGT1A1 polypeptide but without modified uracil, or an mRNA encoding a UGT1A1 polypeptide and with modified uracil but with an unmodified uracil content. In some embodiments, the interferon is IFN-β. In some embodiments, the frequency of cell death resulting from administration of an mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or greater than 95% reduced compared to the frequency of cell death observed with the corresponding wild-type mRNA, an mRNA encoding a UGT1A1 polypeptide but without modified uracil, or an mRNA encoding a UGT1A1 polypeptide and with modified uracil but with an unmodified uracil content. In some embodiments, the mammalian cell is a BJ fibroblast. In other embodiments, the mammalian cell is a splenocyte. In some embodiments, the mammalian cell is a mouse or rat cell. In other embodiments, the mammalian cell is a human cell. In one embodiment, the mRNA of the present disclosure does not substantially elicit an innate immune response in a mammalian cell into which the mRNA has been introduced.
[0145] 9. Methods for modifying polynucleotides The present disclosure includes modified polynucleotides, including the polynucleotides described herein (e.g., polynucleotides, e.g., mRNAs, comprising a nucleotide sequence encoding a UGT1A1 polypeptide). Such modified polynucleotides can be chemically and / or structurally modified. When a polynucleotide of the invention is chemically and / or structurally modified, the polynucleotide can be referred to as a "modified polynucleotide."
[0146] The present disclosure provides modified nucleosides and modified nucleotides for polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding UGT1A1 polypeptides. A "nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose), or a derivative thereof, in combination with an organic base (e.g., a purine or pyrimidine), or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized by any useful method, for example, chemical, enzymatic, or recombinant methods to include one or more modified or unnatural nucleosides. A polynucleotide can contain one or more regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotide will contain regions of nucleotides.
[0147] The modified polynucleotides disclosed herein can comprise a variety of distinct modifications. In some embodiments, the modified polynucleotides comprise one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, the modified polynucleotides, when introduced into a cell, can exhibit one or more desirable properties compared to an unmodified polynucleotide, such as improved cellular protein expression, reduced immunogenicity, or reduced degradation.
[0148] In some embodiments, a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide) is structurally modified. As used herein, a "structural" modification refers to the insertion, deletion, duplication, inversion, or randomization of two or more linked nucleosides in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds are necessarily broken and rearranged to result in the structural modification, the structural modification is chemical in nature and is therefore a chemical modification. However, the structural modification will result in a different nucleotide sequence. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G." The same polynucleotide can also be structurally modified from "ATCG" to "ATCCCG." In this case, the dinucleotide "CC" is inserted, resulting in the structural modification of the polynucleotide.
[0149] Therapeutic compositions of the present disclosure, in some embodiments, include at least one nucleic acid (e.g., RNA) having an open reading frame encoding UGT1A1 (e.g., SEQ ID NOs: 2, or 5-12), wherein the nucleic acid includes nucleotides and / or nucleosides that can be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure include modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally occurring or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include art-recognized modifications to the sugar, backbone, or nucleobase moieties of the nucleotide and / or nucleoside.
[0150] In some embodiments, the naturally occurring modified nucleotides or nucleotides of the present disclosure are those that are commonly known or recognized in the art. Examples of such naturally occurring modified nucleotides and nucleotides include, but are not limited to, those found in the widely recognized MODOMICS database.
[0151] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of the present disclosure are generally known or art-recognized. Examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published U.S. applications PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367, the entire contents of which are incorporated herein by reference, but are not limited thereto.
[0152] In some embodiments, at least one RNA (e.g., mRNA) of the present disclosure is not chemically modified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues, such as those present in transcribed RNA (e.g., A, G, C, or U). In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides, such as those present in DNA (e.g., dA, dG, dC, or dT).
[0153] Thus, the nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) can include standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.
[0154] Nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) in some embodiments comprise a variety (two or more) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid comprises one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.
[0155] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids), when introduced into a cell or organism, exhibit reduced degradation in the cell or organism compared to unmodified nucleic acids comprising standard nucleotides and nucleosides, respectively.
[0156] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids), when introduced into a cell or organism, may exhibit reduced immunogenicity (e.g., reduced innate response) in the cell or organism, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides, respectively.
[0157] Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) in some embodiments contain non-naturally occurring modified nucleotides introduced during or after nucleic acid synthesis to achieve a desired function or property. The modifications can be on the internucleotide linkage, the purine or pyrimidine base, or the sugar. The modifications can be introduced at the end of the chain or anywhere else in the chain using chemical synthesis or using polymerase enzymes. Any region of a nucleic acid can be chemically modified.
[0158] The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids). A "nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose), or a derivative thereof, in combination with an organic base (e.g., a purine or pyrimidine), or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized by any useful method, e.g., chemically, enzymatically, or recombinantly, to include one or more modified or unnatural nucleosides. A nucleic acid can include one or more regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid would include a region of nucleotides.
[0159] Modified nucleotide base pairing includes not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed with and / or between nucleotides containing non-standard or modified bases, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between a non-standard base and a standard base, or between two complementary non-standard base structures, such as in nucleic acids having at least one chemical modification. One example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker may be incorporated into the nucleic acids of the present disclosure.
[0160] In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) include N1-methyl-pseudouridine (mIΨ), 1-ethyl-pseudouridine (eIΨ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (Ψ). In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) include 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, the polyribonucleotide includes, but is not limited to, a combination of at least two (e.g., two, three, four or more) of the foregoing modified nucleobases, including chemical modifications.
[0161] In some embodiments, an RNA nucleic acid of the present disclosure comprises an N1-methyl-pseudouridine (m1Ψ) substitution at one or more, or all, uridine positions of the nucleic acid.
[0162] In some embodiments, the RNA nucleic acids of the present disclosure comprise N1-methyl-pseudouridine (m1Ψ) substitutions at one or more, or all, uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more, or all, cytidine positions of the nucleic acid.
[0163] In some embodiments, the RNA nucleic acids of the present disclosure contain pseudouridine (Ψ) substitutions at one or more, or all, uridine positions of the nucleic acid.
[0164] In some embodiments, the RNA nucleic acids of the present disclosure comprise pseudouridine (Ψ) substitutions at one or more, or all, of the uridine positions of the nucleic acid, and 5-methylcytidine substitutions at one or more, or all, of the cytidine positions of the nucleic acid.
[0165] In some embodiments, an RNA nucleic acid of the present disclosure includes a uridine at one or more, or all, uridine positions of the nucleic acid.
[0166] In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) with a particular modification. For example, a nucleic acid can be uniformly modified with N1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are substituted with N1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified with every type of nucleoside residue present in the sequence, e.g., by substitution with modified residues such as those described above.
[0167] The nucleic acid of the present disclosure may be partially or completely modified throughout the entire length of the molecule. For example, one or more or all of a given type of nucleotide (for example, purine or pyrimidine, or one or more or all of A, G, U, C) may be uniformly modified in the nucleic acid of the present disclosure or in a given sequence region thereof (for example, in mRNA, including or excluding poly-A tail). In some embodiments, all nucleotides X in the nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, and X may be any one of the nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.
[0168] The nucleic acids may be present in an amount ranging from about 1% to about 100% (relative to the total nucleotide content or to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 10 ... Between 100% and 100%, 20% and 25%, 20% and 50%, 20% and 60%, 20% and 70%, 20% and 80%, 20% and 90%, 20% and 95%, 20% and 100%, 50% and 60%, 50% and 70%, 50% and 80%, 50% and 90%, 50% and 95%, 50% and 100%, 70% and 80%, 70% and 90%, 70% and 95%, 70% and 100%, 80% and 90%, 80% and 95%, 80% and 100%, 90% and 95%, 90% and 100%, and 95% and 100% may contain modified nucleotides. It is understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.
[0169] The nucleic acid can have at least 1% and up to 100% modified nucleotides, or any intermediate percentage, e.g., at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acid can have modified pyrimidines, such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are substituted with modified uracils (e.g., 5-substituted uracils). The modified uracils can be substituted with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the nucleic acid are substituted with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines may be substituted with a compound having a single unique structure, or may be substituted with multiple compounds having different structures (e.g., two, three, four, or more unique structures).
[0170] 10. Untranslated Regions (UTRs) Translation of a polynucleotide containing an open reading frame encoding a polypeptide can be regulated and controlled by a variety of mechanisms conferred by various cis-acting nucleic acid structures. For example, naturally occurring cis-acting RNA elements that form hairpins or other higher-order (e.g., pseudoknot) intramolecular mRNA secondary structures can confer translational control activity to a polynucleotide, where the RNA element affects or regulates the initiation of polynucleotide translation, particularly when the RNA element is located in the 5' UTR, approximating the 5' cap structure (Pelletier and Sonenberg (1985) Cell 40(3):515-526; Kozak (1986) Proc Natl Acad Sci 83:2850-2854).
[0171] An untranslated region (UTR) is a nucleic acid portion of a polynucleotide before the start codon (5'UTR) and after the stop codon (3'UTR) that is not translated. In some embodiments, a polynucleotide of the invention (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprising an open reading frame (ORF) encoding a UGT1A1 polypeptide further comprises a UTR (e.g., a 5'UTR or a functional fragment thereof, a 3'UTR or a functional fragment thereof, or a combination thereof).
[0172] Cis-acting RNA elements can also affect translation elongation and are involved in numerous frameshifting events (Namy et al., (2004) Mol Cell 13(2):157-168). Internal ribosome entry sequences (IRES) represent another type of cis-acting RNA element, which is typically located in the 5'UTR but has also been reported to be found within the coding region of naturally occurring mRNAs (Holcik et al. (2000) Trends Genet 16(10):469-473). In cellular mRNAs, IRESs often coexist with 5'-cap structures, conferring to mRNAs the functional ability to translate under conditions in which cap-dependent translation is impaired (Gebauer et al., (2012) Cold Spring Harb Perspect Biol 4(7):a012245). Another type of naturally occurring cis-acting RNA element comprises an upstream open reading frame (uORF). Naturally occurring uORFs occur singly or in multiples within the 5'UTR of many mRNAs and typically negatively affect the translation of downstream major ORFs (with the notable exception of GCN4 mRNA in yeast and ATF4 mRNA in mammals, where the uORF acts to promote translation of the downstream major ORF under conditions of increased eIF2 phosphorylation (Hinnebusch (2005) Annu Rev Microbiol 59:407-450)). Further exemplary translational regulatory activities conferred by components, structures, elements, motifs, and / or specific sequences comprising a polynucleotide (e.g., mRNA) include, but are not limited to, mRNA stabilization or destabilization (Baker & Parker (2004) Curr Opin Cell Biol 16(3):293-299), translational activation (Villalba et al., (2011) Curr Opin Genet Dev 21(4):452-457), and translational repression (Blumer et al., (2002) Meeh Dev 110(1-2):97-112).Studies have shown that naturally occurring cis-acting RNA elements can confer their respective functions when used to modify heterologous polynucleotides by introduction (Goldberg-Cohen et al., (2002) J Biol Chem 277(16):13635-13640).
[0173] Modified polynucleotides containing functional RNA elements The present disclosure provides synthetic polynucleotides (e.g., RNA elements) comprising modifications that confer a desired translational control activity. In some embodiments, the disclosure provides a polynucleotide comprising a 5' untranslated region (UTR), a start codon, a full-length open reading frame encoding a polypeptide, a 3' UTR, and at least one modification, wherein the at least one modification confer a desired translational control activity, e.g., a modification that promotes and / or enhances translational fidelity of mRNA translation. In some embodiments, the desired translational control activity is a cis-acting regulatory activity. In some embodiments, the desired translational control activity is an increase in the residence time of the 43S pretranscriptional complex (PIC) or ribosome at or proximal to the start codon. In some embodiments, the desired translational control activity is an increase in the initiation of polypeptide synthesis at or from the start codon. In some embodiments, the desired translational control activity is an increase in the amount of polypeptide translated from the full-length open reading frame. In some embodiments, the desired translational control activity is an increase in the fidelity of start codon decoding by the PIC or ribosome. In some embodiments, the desired translational control activity is inhibiting or reducing readthrough by the PIC or ribosome. In some embodiments, the desired translational control activity is reducing the rate at which the PIC or ribosome decodes the start codon. In some embodiments, the desired translational control activity is inhibiting or reducing the initiation of polypeptide synthesis at any codon in an mRNA other than the start codon. In some embodiments, the desired translational control activity is inhibiting or reducing the amount of polypeptide translated from any open reading frame in an mRNA other than the full-length open reading frame. In some embodiments, the desired translational control activity is inhibiting or reducing the production of aberrant translation products. In some embodiments, the desired translational control activity is a combination of one or more of the above translational control activities.
[0174] Thus, the present disclosure provides polynucleotides, e.g., mRNAs, that include RNA elements that include sequences and / or RNA secondary structure(s) that provide a desired translational control activity as described herein. In some aspects, the mRNAs include RNA elements that include sequences and / or RNA secondary structure(s) that promote and / or enhance the translational fidelity of mRNA translation. In some aspects, the mRNAs include RNA elements that include sequences and / or RNA secondary structure(s) that provide a desired translational control activity, such as inhibiting or reducing readthrough. In some aspects, the present disclosure provides mRNAs that include RNA elements that include sequences and / or RNA secondary structure(s) that inhibit and / or reduce readthrough, thereby promoting the translational fidelity of the mRNA.
[0175] In some embodiments, the RNA element comprises natural and / or modified nucleotides. In some embodiments, the RNA element consists of a sequence of bound nucleotides, or derivatives or analogs thereof, that provide the desired translational regulatory activity, as described herein. In some embodiments, the RNA element comprises a sequence of bound nucleotides, or derivatives or analogs thereof, that form or fold into a stable RNA secondary structure, wherein the RNA secondary structure provides the desired translational regulatory activity, as described herein. RNA elements can be identified and / or characterized based on the primary sequence of the element (e.g., a GC-rich element), by the RNA secondary structure formed by the element (e.g., a stem-loop), by the location of the element within the RNA molecule (e.g., location within the 5'UTR of an mRNA), by the biological function and / or activity of the element (e.g., a "translational enhancer element"), and any combination thereof.
[0176] In some aspects, the disclosure provides mRNAs having one or more structural modifications that inhibit readthrough and / or promote translational fidelity of mRNA translation, wherein at least one of the structural modifications is a GC-rich RNA element. In some aspects, the disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element, or a derivative or analog thereof, comprising a sequence of binding nucleotides upstream of a Kozak consensus sequence in the 5' UTR of the mRNA. In one embodiment, the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In another embodiment, the GC-rich RNA element is located 15-30, 15-20, 15-25, 10-15, or 5-10 nucleotides upstream of the Kozak consensus sequence. In another embodiment, the GC-rich RNA element is located immediately adjacent to a Kozak consensus sequence in the 5'UTR of the mRNA.
[0177] In any of the above or related aspects, the present disclosure provides GC-rich RNA elements, derivatives or analogs thereof, comprising a sequence of 3-30, 5-25, 10-20, 15-20, about 20, about 15, about 12, about 10, about 7, about 6, or about 3 nucleotides linked in any order, wherein the sequence composition is 70-80% cytosine, 60-70% cytosine, 50%-60% cytosine, 40-50% cytosine, or 30-40% cytosine bases. In any of the above or related aspects, the present disclosure provides GC-rich RNA elements, derivatives or analogs thereof, comprising a sequence of 3-30, 5-25, 10-20, 15-20, about 20, about 15, about 12, about 10, about 7, about 6, or about 3 nucleotides linked in any order, wherein the sequence composition is about 80% cytosine, about 70% cytosine, about 60% cytosine, about 50% cytosine, about 40% cytosine, or about 30% cytosine.
[0178] In any of the above or related aspects, the present disclosure provides a GC-rich RNA element, derivative or analog thereof, comprising a sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides linked in any order, wherein the sequence composition is 70-80% cytosine, 60-70% cytosine, 50%-60% cytosine, 40-50% cytosine, or 30-40% cytosine. In any of the above or related aspects, the present disclosure provides GC-rich RNA elements, derivatives or analogs thereof, comprising a sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides linked in any order, wherein the sequence composition is about 80% cytosine, about 70% cytosine, about 60% cytosine, about 50% cytosine, about 40% cytosine, or about 30% cytosine.
[0179] In some embodiments, the present disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element, or a derivative or analog thereof, comprising a sequence of bound nucleotides upstream of a Kozak consensus sequence in the 5'UTR of the mRNA, wherein the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream from the Kozak consensus sequence in the 5'UTR of the mRNA, and wherein the GC-rich RNA element comprises a GC-rich RNA element, or a derivative or analog thereof, comprising a sequence of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19, or 20 nucleotides bound in any order, wherein the sequence composition is >50% cytosines. In some embodiments, the sequence composition is >55% cytosine, >60% cytosine, >65% cytosine, >70% cytosine, >75% cytosine, >80% cytosine, >85% cytosine, or >90% cytosine.
[0180] In other aspects, the disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element, or a derivative or analog thereof, comprising a sequence of binding nucleotides upstream of a Kozak consensus sequence in the 5'UTR of the mRNA, wherein the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) from the Kozak consensus sequence in the 5'UTR of the mRNA. ), and the GC-rich RNA element comprises a sequence of about 3 to 30, 5 to 25, 10 to 20, 15 to 20, or about 20, about 15, about 12, about 10, about 6, or about 3 nucleotides, or a derivative or analog thereof, wherein the sequence comprises a repeating GC motif, wherein the repeating GC motif is [CCG]n, where n=1 to 10 (SEQ ID NO:206), n=2 to 8 (SEQ ID NO:207), n=3 to 6 (SEQ ID NO:208), or n=4 to 5 (SEQ ID NO:209). In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=1, 2, 3, 4, or 5 (SEQ ID NO:210). In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=1, 2, or 3. In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=1. In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=2. In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=3. In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=4 (SEQ ID NO:211). In some embodiments, the sequence comprises a repeating GC motif [CCG]n, where n=5 (SEQ ID NO:212).
[0181] In another aspect, the disclosure provides a modified mRNA comprising at least one modification, wherein the at least one modification is a GC-rich RNA element, or a derivative or analog thereof, comprising a sequence of binding nucleotides upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, wherein the GC-rich RNA element comprises any one of the sequences set forth in Table 2. In one embodiment, the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream from the Kozak consensus sequence in the 5' UTR of the mRNA. In another embodiment, the GC-rich RNA element is located 15-30, 15-20, 15-25, 10-15, or 5-10 nucleotides upstream from the Kozak consensus sequence. In another embodiment, the GC-rich RNA element is located immediately adjacent to the Kozak consensus sequence in the 5' UTR of the mRNA.
[0182] In other aspects, the disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element comprising sequence V1 [CCCCGGCGCC (SEQ ID NO:43)] set forth in Table 2 upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, or a derivative or analog thereof. In some embodiments, the GC-rich element comprises sequence V1 set forth in Table 2 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises sequence V1 set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases upstream from the Kozak consensus sequence in the 5' UTR of the mRNA. In other embodiments, the GC-rich element comprises sequence V1 set forth in Table 2 located 1 to 3, 3 to 5, 5 to 7, 7 to 9, 9 to 12, or 12 to 15 bases upstream from the Kozak consensus sequence in the 5' UTR of the mRNA.
[0183] In other aspects, the disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element comprising sequence V2 [CCCCGGC (SEQ ID NO:44)] set forth in Table 2 upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, or a derivative or analog thereof. In some embodiments, the GC-rich element comprises sequence V2 set forth in Table 2 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises sequence V2 set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases upstream from the Kozak consensus sequence in the 5' UTR of the mRNA. In other embodiments, the GC-rich element comprises sequence V2 set forth in Table 2 located 1 to 3, 3 to 5, 5 to 7, 7 to 9, 9 to 12, or 12 to 15 bases upstream from the Kozak consensus sequence in the 5' UTR of the mRNA.
[0184] In other aspects, the disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element comprising a sequence EK [GCCGCC (SEQ ID NO: 42)] set forth in Table 2 upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, or a derivative or analog thereof. In some embodiments, the GC-rich element comprises a sequence EK set forth in Table 2 located immediately adjacent to and upstream of a Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises a sequence EK set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases upstream from the Kozak consensus sequence in the 5' UTR of the mRNA. In other embodiments, the GC-rich element comprises a sequence EK set forth in Table 2 located 1 to 3, 3 to 5, 5 to 7, 7 to 9, 9 to 12, or 12 to 15 bases upstream from the Kozak consensus sequence in the 5' UTR of the mRNA.
[0185] In yet another aspect, the present disclosure provides modified mRNAs comprising at least one modification, wherein the at least one modification is a GC-rich RNA element comprising sequence V1 [CCCCGGCGCC (SEQ ID NO: 43)] set forth in Table 2 upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, or a derivative or analog thereof, wherein the 5' UTR comprises the following sequence shown in Table 2: GGGAAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA (SEQ ID NO: 85). One of skill in the art will understand that every U in the RNA sequences described herein becomes a T in the corresponding template DNA sequence, e.g., DNA template or construct, from which the mRNA of the present disclosure is transcribed, e.g., via IVT.
[0186] In some embodiments, the GC-rich element comprises sequence V1 set forth in Table 2 located immediately adjacent to and upstream of a Kozak consensus sequence in a 5' UTR sequence set forth in Table 2. In some embodiments, the GC-rich element comprises sequence V1 set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases upstream from a Kozak consensus sequence in the 5' UTR of an mRNA, wherein the 5' UTR comprises the following sequence set forth in Table 2: GGGAAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA (SEQ ID NO: 85).
[0187] In other embodiments, the GC-rich element comprises sequence V1 set forth in Table 2 located 1 to 3, 3 to 5, 5 to 7, 7 to 9, 9 to 12, or 12 to 15 bases upstream from a Kozak consensus sequence in the 5' UTR of an mRNA, wherein the 5' UTR comprises the following sequence shown in Table 2: GGGAAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA (SEQ ID NO: 85).
[0188] In some embodiments, the 5'UTR comprises the following sequence shown in Table 2: GGGAAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 39). Table 2 TIFF2025028860000003.tif118168
[0189] In another aspect, the present disclosure provides a modified mRNA comprising at least one modification, wherein the at least one modification is a GC-rich RNA element comprising a stable RNA secondary structure comprising a sequence of nucleotides linked in an order that forms a hairpin or stem-loop, or a derivative or analog thereof. In one embodiment, the stable RNA secondary structure is upstream of a Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides upstream from the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 20, about 15, about 10, or about 5 nucleotides upstream from the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 5, about 4, about 3, about 2, or about 1 nucleotide upstream from the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 15-30, about 15-20, about 15-25, about 10-15, or about 5-10 nucleotides upstream from the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located 12-15 nucleotides upstream from the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure has a delta G of about -30 kcal / mol, about -20 to -30 kcal / mol, about -20 kcal / mol, about -10 to -20 kcal / mol, about -10 kcal / mol, or about -5 to -10 kcal / mol.
[0190] In another embodiment, the modification is operably linked to an open reading frame encoding the polypeptide, wherein the modification and the open reading frame are heterologous.
[0191] In another embodiment, the sequence of the GC-rich RNA element consists exclusively of guanine (G) and cytosine (C) nucleobases.
[0192] RNA elements that confer the desired translational regulatory activity described herein can be identified and characterized using known techniques, such as ribosome profiling. Ribosome profiling is a technique that allows for the determination of the location of PICs and / or ribosomes bound to mRNA (see, e.g., Ingolia et al., (2009) Science 324(5924):218-23, incorporated herein by reference). This technique is based on the protection of regions or segments of mRNA from nuclease digestion by PICs and / or ribosomes. Protection results in the generation of 30-bp fragments of RNA called "footprints." The sequence and frequency of RNA footprints can be analyzed by methods known in the art (e.g., RNA-seq). Footprints are generally concentrated at the A site of the ribosome. If PICs or ribosomes are present at specific locations or points along the mRNA, footprints generated at these locations will be relatively common. Studies have shown that PICs and / or ribosomes generate more footprints at positions that indicate decreased processivity, and fewer footprints at positions that indicate increased processivity (Gardin et al., (2014) eLife 3:e03735). In some embodiments, the residence or occupancy time of PICs or ribosomes at distinct positions or locations along a polynucleotide comprising any one or more of the RNA elements described herein is determined by ribosome profiling.
[0193] A UTR can be homologous or heterologous to the coding region in a polynucleotide. In some embodiments, a UTR is homologous to an ORF encoding a UGT1A1 polypeptide. In some embodiments, a UTR is heterologous to an ORF encoding a UGT1A1 polypeptide. In some embodiments, the polynucleotide comprises two or more 5' UTRs, or functional fragments thereof, each of which has the same or a different nucleotide sequence. In some embodiments, the polynucleotide comprises two or more 3' UTRs, or functional fragments thereof, each of which has the same or a different nucleotide sequence.
[0194] In some embodiments, the 5'UTR or a functional fragment thereof, the 3'UTR or a functional fragment thereof, or any combination thereof, is sequence optimized.
[0195] In some embodiments, the 5'UTR or a functional fragment thereof, the 3'UTR or a functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, for example, N1-methylpseudouracil, or 5-methoxyuracil.
[0196] UTRs can have characteristics that provide a regulatory role, e.g., stabilization, localization, and / or increased or decreased translation efficiency. Polynucleotides containing UTRs can be administered to cells, tissues, or organisms, and one or more regulatory characteristics can be measured using routine methods. In some embodiments, functional fragments of the 5' or 3' UTR comprise one or more regulatory functions of the full-length 5' or 3' UTR, respectively.
[0197] Naturally occurring 5' UTRs possess characteristics that play a role in translation initiation. They possess signatures, such as the Kozak sequence, which is commonly known to be involved in the process by which ribosomes initiate translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO: 87), where R is a purine (adenine or guanine) (AUG) three bases upstream from the start codon, followed by another "G." 5' UTRs are also known to form secondary structures involved in elongation factor binding.
[0198] Polynucleotide stability and protein production can be increased by manipulating features commonly found in genes abundantly expressed in specific target organs. For example, introduction of the 5' UTR of liver-expressed mRNAs, such as albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII, can enhance polynucleotide expression in hepatocyte cell lines or the liver. Similarly, 5'UTRs from other tissue-specific mRNAs can be used to enhance expression in muscle (e.g., MyoD, myosin, myoglobin, myogenin, herculin), endothelial cells (e.g., Tie-1, CD36), myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), leukocytes (e.g., CD45, CD18), adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin), and lung epithelial cells (e.g., SP-A / B / C / D).
[0199] In some embodiments, UTRs are selected from a family of transcripts in which proteins share a common function, structure, feature, or characteristic. For example, the encoded polypeptide can belong to a protein family that is expressed (i.e., shares at least one function, structure, feature, location, origin, or expression pattern) in a particular cell, tissue, or development at a certain time. UTRs from either a gene or mRNA can be exchanged with any other UTRs from proteins of the same or different families to create new polynucleotides.
[0200] In some embodiments, the 5'UTR and 3'UTR can be heterologous. In some embodiments, the 5'UTR can be from a different species than the 3'UTR. In some embodiments, the 3'UTR can be from a different species than the 5'UTR.
[0201] Co-owned International Patent Application PCT / US2014 / 021522 (Publication WO / 2014 / 164253, the entire contents of which are incorporated herein by reference) provides a list of exemplary UTRs that can be used in the polynucleotides of the invention as flanking regions to the ORFs.
[0202] Exemplary UTRs of the present application include: globin, e.g., alpha or beta globin (e.g., Xenopus, mouse, rabbit, or human globin); strong Kozak translation initiation signal; CYBA (e.g., human cytochrome b-245 alpha polypeptide); albumin (e.g., human albumin 7); HSD17B4 (hydroxysteroid (17-beta) dehydrogenase); viruses (e.g., tobacco etch virus (TEV), Venezuelan equine encephalitis virus (VEEV), dengue virus, cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE))); 1); hepatitis virus (e.g., hepatitis B virus), Sindbis virus, or PAV (barley yellow dwarf virus); heat shock protein (e.g., hsp70); translation initiation factor (e.g., eIF4G); glucose transporter (e.g., hGLUT1 (human glucose transporter 1)); actin (e.g., human α or β actin); GAPDH; tubulin; histone; citric acid cycle enzyme; topoisomerase (e.g., 5'UTR of TOP gene (oligopyrimidine tract) lacking 5'TOP motif); ribosomal protein Large 32 (L32); ribosomal protein (e.g., human or mouse ribosomal protein such as rps9); ATP synthase (e.g., ATP5A1 or mitochondrial H +- β subunit of ATP synthase; growth hormone (e.g., bovine (bGH) or human (hGH)); elongation factor (e.g., elongation factor 1 alpha 1 (EEF1A1)); manganese superoxide dismutase (MnSOD); myocyte enhancer factor 2A (MEF2A); β-F1-ATPase, creatine kinase, myoglobin, granulocyte colony-stimulating factor (G-CSF); collagen (e.g., collagen type I, alpha 2 (Col1A2), collagen type I, alpha 1 (Col1A1), collagen type VI, alpha 2 (Col6 A2), collagen type VI, alpha 1 (Col6A1); ribophorin (e.g., ribophorin I (RPNI)), low-density lipoprotein receptor-related protein (e.g., LRP1); cardiotrophin-like cytokine factor (e.g., Nnt1), calreticulin (Calr); procollagen-lysine; 2-oxoglutarate 5-dioxygenase 1 (Plod1); and one or more 5' UTRs and / or 3' UTRs derived from the nucleic acid sequence of nucleobindin (e.g., Nucb1).
[0203] In some embodiments, the 5'UTR is selected from the group consisting of a β-globin 5'UTR; a 5'UTR containing a strong Kozak translation initiation signal; a cytochrome b-245 alpha polypeptide (CYBA) 5'UTR; a hydroxysteroid (17-beta) dehydrogenase (HSD17B4) 5'UTR; a tobacco etch virus (TEV) 5'UTR; a Venezuelan equine encephalitis virus (TEEV) 5'UTR; a 5' proximal open reading frame of rubella virus (RV) RNA encoding a nonstructural protein; a dengue virus (DEN) 5'UTR; a heat shock protein 70 (Hsp70) 5'UTR; an eIF4G 5'UTR; a GLUT1 5'UTR; functional fragments thereof, and any combination thereof.
[0204] In some embodiments, the 3'UTR is selected from the group consisting of beta globin 3'UTR; CYBA 3'UTR; albumin 3'UTR; growth hormone (GH) 3'UTR; VEEV 3'UTR; hepatitis B virus (HBV) 3'UTR; alpha-globin 3'UTR; DEN 3'UTR; PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; elongation factor 1 alpha 1 (EEF1A1) 3'UTR; manganese superoxide dismutase (MnSOD) 3'UTR; beta subunit of mitochondrial H(+)-ATP synthase (beta-mRNA) 3'UTR; GLUT1 3'UTR; MEF2A 3'UTR; beta-F1-ATPase 3'UTR; functional fragments thereof, and combinations thereof.
[0205] The wild-type UTR from any gene or mRNA can be incorporated into the polynucleotide of the present invention.In some embodiments, UTR can be changed with respect to wild-type or natural UTR, for example, by changing the orientation or position of UTR relative to ORF, or by incorporating additional nucleotides, deleting nucleotides, swapping or rearranging nucleotides, to generate variant UTR.In some embodiments, the variant of 5' or 3' UTR can be utilized, for example, the variant of wild-type UTR, or the variant that one or more nucleotides are added to or removed from the end of UTR.
[0206] Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, the entire contents of which are incorporated herein by reference.
[0207] The UTR, or a portion thereof, can be placed in the same orientation as in the transcript from which it was selected, or the orientation or position can be changed. Thus, the 5' and / or 3' UTR can be inverted, shortened, extended, or used in combination with one or more other 5' or 3' UTRs.
[0208] In some embodiments, the polynucleotide comprises multiple UTRs, such as duplicated, tripled, or quadrupled 5' or 3' UTRs. For example, a duplicated UTR comprises two copies of the same UTR, either in tandem or substantially in tandem. For example, a duplicated beta-globin 3' UTR can be used (see US2010 / 0129877, the entire contents of which are incorporated herein by reference).
[0209] In certain embodiments, polynucleotides of the invention comprise a 5'UTR and / or a 3'UTR selected from any of the UTRs disclosed herein. In some embodiments, the 5'UTR is: 5'UTR-001 (upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 3); 5'UTR-002 (upstream UTR) (GGGAGAUCAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 89); 5'UTR-003 (upstream UTR) (see WO2016 / 100812); 5'UTR-004 (upstream UTR) (GGGAGACAAGCUUGGCAUUCCGGUACUGUUGGUAAAGCCACC) (SEQ ID NO: 90); 5'UTR-005 (upstream UTR) (GGGAGAUCAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 91); 5'UTR-006 (upstream UTR) (see WO2016 / 100812); 5'UTR-007 (upstream UTR) (GGGAGACAAGCUUGGCAUUCCGGUACUGUUGGUAAAGCCACC) (SEQ ID NO: 92); 5'UTR-008 (upstream UTR) (GGGAAUUAACAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 93); 5'UTR-009 (upstream UTR) (GGGAAAUUAGACAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 94); 5'UTR-010, upstream (GGGAAAUAAGAGAGUAAAGAACAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 95); 5'UTR-011 (upstream UTR) (GGGAAAAAAGAGAGAAAAGAAGACUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 96); 5'UTR-012 (upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAUAUAUAAGAGCCACC) (SEQ ID NO: 97); 5'UTR-013 (upstream UTR) (GGGAAAUAAGAGACAAAACAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 98); 5'UTR-014 (upstream UTR) (GGGAAAUUAGAGAGUAAAGAACAGUAAGUAGAAUUAAAAGAGCCACC) (SEQ ID NO: 99); 5'UTR-015 (upstream UTR) (GGGAAAUAAGAGAGAAUAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 100); 5'UTR-016 (upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAAUUAAGAGCCACC) (SEQ ID NO: 101); 5'UTR-017 (upstream UTR); or (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUUUAAGAGCCACC) (SEQ ID NO: 102); 5'UTR-018 (upstream UTR) 5'UTR (UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 88).
[0210] In some embodiments, the 3'UTR is: 142-3p 3'UTR (UTR containing miR142-3p binding site) (UGAUAAUAGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 104); 142-3p 3'UTR (UTR containing miR142-3p binding site) (UGAUAAUAGGCUGGAGCCUCGGUGGCUCCAUAAAGUAGGAAACACUACACAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 105); or 142-3p 3'UTR (UTR containing the R142-3p binding site) (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUCCAUAAAGUAGGAAACACUACAUGGGCCUCCCCCCAGCCCCUCCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 106); 142-3p 3'UTR (UTR containing miR142-3p binding site) (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGUCCAUAAAGUAGGAAACACUACACCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 107); 142-3p 3'UTR (UTR containing miR142-3p binding site) (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCUCCAUAAAGUAGGAAACACUACACUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 108); 142-3p 3'UTR (UTR containing miR142-3p binding site) (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCUCCAUAAAGUAGGAAACACUACAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 109); 142-3p 3'UTR (UTR containing miR142-3p binding site) (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUUCCAUAAAGUAGGAAACACUACACUGAGUGGGCGGC) (SEQ ID NO: 110); 3'UTR-018 (see SEQ ID NO: 150); 3'UTR (miR142 and miR126 binding site variant 1) (UGAUAAUAGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCCCCUUCCUGCACCCGUACCCCCCGCAUUAUUACUCACGGUACGAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 111) 3'UTR (miR142 and miR126 binding site variant 2) (UGAUAAUAGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCGCAUUAUUACUCACGGUACGAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 112); or 3'UTR (miR142-3p binding site variant 3) UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCUCCAUAAAGUAGGAAACACUACAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 176).
[0211] In certain embodiments, the 5'UTR and / or 3'UTR sequences of the present invention comprise a nucleotide sequence that is at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of a 5'UTR sequence comprising any of SEQ ID NOs: 3, 88-102, or 165-167, and / or a 3'UTR sequence comprising any of SEQ ID NOs: 104-112, 150, 151, or 178, and any combination thereof.
[0212] In certain embodiments, the 5'UTR and / or 3'UTR sequences of the present invention comprise a nucleotide sequence that is at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of a 5'UTR sequence comprising any of SEQ ID NO:3, SEQ ID NO:39, SEQ ID NO:193, or SEQ ID NO:194, and / or a 3'UTR sequence comprising any of SEQ ID NO:4, SEQ ID NO:111, SEQ ID NO:150, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:195, or SEQ ID NO:196, and any combination thereof.
[0213] In some embodiments, the 5' UTR comprises an amino acid sequence set forth in Table 4B (SEQ ID NO:3, SEQ ID NO:39, SEQ ID NO:193, or SEQ ID NO:194). In some embodiments, the 3' UTR comprises an amino acid sequence set forth in Table 4B (SEQ ID NO:4, SEQ ID NO:111, SEQ ID NO:150, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:195, or SEQ ID NO:196). In some embodiments, the 5' UTR comprises an amino acid sequence set forth in Table 4B (SEQ ID NO:3, SEQ ID NO:39, SEQ ID NO:193, or SEQ ID NO:194) and the 3' UTR comprises an amino acid sequence set forth in Table 4B (SEQ ID NO:4, SEQ ID NO:111, SEQ ID NO:150, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:195, or SEQ ID NO:196).
[0214] Polynucleotides of the invention can comprise a combination of features. For example, the ORF can be flanked by a 5' UTR containing a strong Kozak translation initiation signal and / or a 3' UTR containing an oligo(dT) sequence for templated addition of a polyA tail. The 5' UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment derived from the same and / or different UTRs (see, e.g., US2010 / 0293625, the entire contents of which are incorporated herein by reference).
[0215] Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the invention. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of the invention. Incorporation of an intron sequence can increase protein production and even polynucleotide expression levels. In some embodiments, the polynucleotides of the invention contain an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1):189-193, the entire contents of which are incorporated herein by reference). In some embodiments, the polynucleotides contain an IRES instead of a 5'UTR sequence. In some embodiments, the polynucleotides contain an ORF and a viral capsid sequence. In some embodiments, the polynucleotides contain a synthetic 5'UTR in combination with a non-synthetic 3'UTR.
[0216] In some embodiments, the UTR may also include at least one translation enhancer polynucleotide, a translation enhancer element(s) (collectively referred to as "TEE"), which refers to a nucleic acid sequence that increases the amount of polypeptide or protein produced from a polynucleotide. By way of example, but not limitation, a TEE may be located between the transcription promoter and the start codon. In some embodiments, the 5'UTR includes a TEE.
[0217] In one embodiment, a TEE is a conserved element within a UTR that can facilitate translational activity of a nucleic acid, such as, but not limited to, cap-dependent or cap-independent translation.
[0218] 11. MicroRNA (miRNA) binding site Polynucleotides of the invention can include regulatory elements, such as microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudoreceptors for endogenous nucleic acid binding molecules, and combinations thereof. In some embodiments, polynucleotides containing such regulatory elements are referred to as comprising a "sensor sequence."
[0219] In some embodiments, a polynucleotide of the invention (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). The incorporation or incorporation of the miRNA binding site(s) regulates the polynucleotide of the invention, and in turn, the polypeptide encoded therefrom, based on tissue- and / or cell-type-specific expression of naturally occurring miRNAs.
[0220] The present invention also provides pharmaceutical compositions and formulations comprising any of the polynucleotides. In some embodiments, the composition or formulation further comprises a delivery agent.
[0221] In some embodiments, the composition or formulation can comprise a polynucleotide comprising a sequence-optimized nucleic acid sequence disclosed herein that encodes a polypeptide. In some embodiments, the composition or formulation can comprise a polynucleotide (e.g., an RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence-optimized nucleic acid sequence disclosed herein that encodes a polypeptide. In some embodiments, the polynucleotide further comprises an miRNA binding site, e.g., a miRNA binding site that binds to the miRNA.
[0222] miRNAs, e.g., naturally occurring miRNAs, are 19-25 nucleotide-long non-coding RNAs that bind to polynucleotides and down-regulate gene expression by reducing their stability or inhibiting their translation. The miRNA sequence includes a "seed" region, i.e., the sequence of positions 2-8 of the mature miRNA. The miRNA seed can include positions 2-8 or 2-7 of the mature miRNA.
[0223] MicroRNAs are enzymatically derived from regions of RNA transcripts that fold back on themselves to form short hairpin structures, often referred to as pre-miRNAs (precursor miRNAs). Pre-miRNAs typically have a two-nucleotide overhang at their 3' end, a 3' hydroxyl group, and a 5' phosphate group. This precursor mRNA is processed in the nucleus and subsequently transported to the cytoplasm, where it is further processed by DICER (an RNase III enzyme) to form mature microRNAs of approximately 22 nucleotides. The mature microRNAs are then incorporated into ribonucleoproteins to form RNA-induced silencing complexes (RISCs), which mediate gene silencing. The art-accepted nomenclature for mature miRNAs generally designates the arm of the pre-miRNA from which the mature miRNA is derived, with "5p" indicating that the microRNA is derived from the 5' arm of the pre-miRNA hairpin and "3p" indicating that the microRNA is derived from the 3' end of the pre-miRNA hairpin. A miR designated by a number herein can refer to either of two mature microRNAs derived from opposite arms (e.g., either the 3p or 5p microRNA) of the same pre-miRNA. All miRs referred to herein are intended to include both the 3p and 5p arms / sequences unless specifically specified with a 3p or 5p designation.
[0224] As used herein, the term "microRNA (miRNA or miR) binding site" refers to a sequence within a polynucleotide, e.g., within a DNA or within an RNA transcript, including the 5'UTR and / or 3'UTR, that has complementarity to all or a portion of a region of a miRNA sufficient to interact with, associate with, or bind to the miRNA. In some embodiments, a polynucleotide of the invention comprises an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, the 5'UTR and / or 3'UTR of a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises one or more miRNA binding site(s).
[0225] An miRNA-binding site that is sufficiently complementary to an miRNA refers to a degree of complementarity that is sufficient to promote miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide. In exemplary embodiments of the present invention, an miRNA-binding site that is sufficiently complementary to an miRNA refers to a degree of complementarity that is sufficient to promote miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RISC)-mediated mRNA cleavage. The miRNA-binding site can be complementary to, for example, a miRNA sequence that is 19-25 nucleotides long, a miRNA sequence that is 19-23 nucleotides long, or a miRNA sequence that is 22 nucleotides long. The miRNA-binding site can be complementary to only a portion of the miRNA, e.g., one, two, three, or four nucleotides shorter than the full length of a naturally occurring miRNA sequence, or one, two, three, or four nucleotides shorter than the naturally occurring miRNA sequence. If the desired modulation is mRNA degradation, it is preferred that the complementarity be full or complete (e.g., full or complete complementarity over all or a significant portion of the length of the naturally occurring miRNA).
[0226] In some embodiments, the miRNA binding site comprises a sequence that has complementarity (e.g., partial or complete complementarity) with the miRNA seed sequence. In some embodiments, the miRNA binding site comprises a sequence that has complete complementarity with the miRNA seed sequence. In some embodiments, the miRNA binding site comprises a sequence that has complementarity (e.g., partial or complete complementarity) with the miRNA sequence. In some embodiments, the miRNA binding site comprises a sequence that has complete complementarity with the miRNA sequence. In some embodiments, the miRNA binding site has complete complementarity with the miRNA sequence, but for one, two, or three nucleotide substitutions, terminal additions, and / or terminal truncations.
[0227] In some embodiments, the miRNA-binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA-binding site is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotide(s) shorter than the corresponding miRNA at the 5' end, 3' end, or both. In still other embodiments, the microRNA-binding site is 2 nucleotides shorter than the corresponding microRNA at the 5' end, 3' end, or both. A miRNA-binding site that is shorter than the corresponding miRNA can still degrade an mRNA incorporating one or more of the miRNA-binding sites or prevent translation of the mRNA.
[0228] In some embodiments, the miRNA-binding site binds to a corresponding mature miRNA that is part of an active RISC that includes Dicer. In another embodiment, binding of the miRNA-binding site to the corresponding miRNA in the RISC degrades the mRNA containing the miRNA-binding site or prevents the mRNA from being translated. In some embodiments, the miRNA-binding site is sufficiently complementary to the miRNA that the RISC complex containing the miRNA degrades the polynucleotide containing the miRNA-binding site. In other embodiments, the incomplete complementarity of the miRNA-binding site causes the RISC complex containing the miRNA to induce instability in the polynucleotide containing the miRNA-binding site. In another embodiment, the incomplete complementarity of the miRNA-binding site causes the RISC complex containing the miRNA to repress transcription of the polynucleotide containing the miRNA-binding site.
[0229] In some embodiments, the miRNA binding site has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mismatch(es) with respect to the corresponding miRNA.
[0230] In some embodiments, the miRNA binding site has at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 contiguous nucleotides complementary to at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 contiguous nucleotides of the corresponding miRNA, respectively.
[0231] Engineering one or more miRNA-binding sites into a polynucleotide of the present invention allows the polynucleotide to be targeted for degradation or translational downregulation when the corresponding miRNA is available. This reduces off-target effects during polynucleotide delivery. For example, if a polynucleotide of the present invention is not intended for delivery to a tissue or cell but ultimately results in the aforementioned tissue or cell, miRNAs abundant in the tissue or cell can be engineered into the 5' UTR and / or 3' UTR of the polynucleotide to inhibit the expression of a gene of interest. Thus, in some embodiments, incorporating one or more miRNA-binding sites into an mRNA of the present disclosure can reduce the risk of off-target effects during nucleic acid molecule delivery and / or enable tissue-specific control of the expression of the polypeptide encoded by the mRNA. In yet other embodiments, incorporating one or more miRNA-binding sites into an mRNA of the present disclosure can modulate an immune response during nucleic acid delivery in vivo. In further embodiments, one or more miRNA binding sites can be incorporated into the mRNA of the present disclosure to modulate the accelerated blood clearance (ABC) of the lipid-containing compounds and compositions described herein.
[0232] Conversely, removing miRNA binding sites from a naturally occurring polynucleotide sequence can increase protein expression in particular tissues, e.g., removing a binding site for a particular miRNA from a polynucleotide can improve protein expression in tissues or cells that contain the miRNA.
[0233] Modulation of expression in multiple tissues can be achieved by the introduction or removal of one or more miRNA binding sites, e.g., one or more distinct miRNA binding sites. The decision to remove or insert miRNA binding sites can be made based on miRNA expression patterns and / or profiling in tissues and / or cells in a pathological and / or disease state. The identification of miRNAs, miRNA binding sites, and their expression patterns, as well as their roles in biology, have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh, Curr Opin Hematol 2011 18:171-176; Contreras and Rao, Leukemia 2012 26:404-413 (2011 Dec 20. doi:10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al., Cell 2007 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403; and all references therein, the entire contents of each of which are incorporated herein by reference).
[0234] Examples of tissues in which miRNAs are known to regulate protein expression by regulating mRNA include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).
[0235] Specifically, miRNAs are known to be differentially expressed in immune cells (also known as hematopoietic cells), such as antigen-presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, and natural killer cells. Immune cell-specific miRNAs are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and even undesirable immune responses after gene therapy and tissue / organ transplantation. Immune cell-specific miRNAs also regulate many aspects of hematopoietic cell (immune cell) development, proliferation, differentiation, and apoptosis. For example, miR-142 and miR-146 are expressed exclusively in immune cells, particularly myeloid dendritic cells. It has been demonstrated that immune responses to polynucleotides can be blocked by adding miR-142 binding sites to the 3'UTR of polynucleotides, allowing for improved stability of gene transfer within tissues and cells. miR-142 efficiently degrades exogenous polynucleotides within antigen-presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., Blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5), 585-591; Brown BD, et al., Blood, 2007, 110(13):4144-4152, the entire contents of each of which are incorporated herein by reference).
[0236] An antigen-mediated immune response can refer to an immune response elicited by a foreign antigen that is processed by antigen-presenting cells upon entry into an organism and presented on the surface of the antigen-presenting cells. T cells can recognize the presented antigen and induce cytotoxic elimination of cells expressing the antigen. By introducing a miR-142 binding site into the 5'UTR and / or 3'UTR of the polynucleotide of the present invention and selectively suppressing gene expression in antigen-presenting cells through miR-142-mediated degradation, antigen presentation in antigen-presenting cells (e.g., dendritic cells) can be restricted, thereby preventing an antigen-mediated immune response after polynucleotide delivery. The polynucleotide is then stably expressed in target tissues or cells without inducing cytotoxic elimination.
[0237] In one embodiment, a polynucleotide of the invention can be engineered with binding sites for miRNAs known to be expressed in immune cells, particularly antigen-presenting cells, thereby suppressing expression of the polynucleotide in antigen-presenting cells through miRNA-mediated RNA degradation and thereby suppressing antigen-mediated immune responses. Expression of the polynucleotide is maintained in non-immune cells that do not express immune cell-specific miRNAs. For example, in some embodiments, to prevent immunogenic responses to liver-specific proteins, any miR-122 binding sites can be removed and the 5'UTR and / or 3'UTR of a polynucleotide of the invention can be engineered with miR-142 (and / or miR-146) binding sites.
[0238] To further drive selective degradation and suppression in APCs and macrophages, the polynucleotides of the present invention can comprise additional negative regulatory elements in the 5'UTR and / or 3'UTR, either alone or in combination with the miR-142 and / or miR-146 binding sites. By way of example, but not limitation, the additional negative regulatory element is a constitutive attenuation element (CDE).
[0239] As immune cell-specific miRNAs, hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-l--3p, hsa-let-7f--2-5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p,miR-29b-2-5p, miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, mi R-345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, mi These include, but are not limited to, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR-548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p, and miR-99b-5p. Furthermore, novel miRNAs can be identified in immune cells by microarray hybridization and microtome analysis (see, e.g., Jima DD et al., Blood, 2010, 116:e118-e127; Vaz C et al., BMC Genomics, 2010, 11, 288, the entire contents of each of which are incorporated herein by reference).
[0240] MiRNAs known to be expressed in the liver include, but are not limited to, miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-1249, miR-129-5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p, and miR-939-5p. The expression of the polynucleotide in the liver can be regulated by introducing or deleting a miRNA binding site derived from a liver-specific miRNA into or from a polynucleotide of the present invention. The liver-specific miRNA binding site can also be engineered alone or in combination with an immune cell (e.g., APC) miRNA binding site in the polynucleotide of the present invention.
[0241] miRNAs known to be expressed in the lung include let-7a-2-3p, let-7a-3p, let-7a-5p, miR-126-3p, miR-126-5p, miR-127-3p, miR-127-5p, miR-130a-3p, miR-130a-5p, miR-130b-3p, miR-130b-5p, miR-133a, miR-133b, and miR-134. Examples of miRNA binding sites include, but are not limited to, miR-18a-3p, miR-18a-5p, miR-18b-3p, miR-18b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-296-3p, miR-296-5p, miR-32-3p, miR-337-3p, miR-337-5p, miR-381-3p, and miR-381-5p. Expression of a polynucleotide in the lung can be regulated by introducing or removing miRNA binding sites derived from lung-specific miRNAs into the polynucleotides of the present invention. Lung-specific miRNA binding sites can be engineered independently or can be incorporated into the polynucleotides of the present invention in combination with miRNA binding sites for immune cells (e.g., APCs).
[0242] MiRNAs known to be expressed in the heart include, but are not limited to, miR-1, miR-133a, miR-133b, miR-149-3p, miR-149-5p, miR-186-3p, miR-186-5p, miR-208a, miR-208b, miR-210, miR-296-3p, miR-320, miR-451a, miR-451b, miR-499a-3p, miR-499a-5p, miR-499b-3p, miR-499b-5p, miR-744-3p, miR-744-5p, miR-92b-3p, and miR-92b-5p. The expression of the polynucleotide in the heart can be regulated by introducing or removing a miRNA binding site derived from cardiac-specific microRNA into the polynucleotide of the present invention. The cardiac-specific miRNA binding site can be engineered alone or in combination with the miRNA binding site of immune cells (e.g., APCs) in the polynucleotide of the present invention.
[0243] Known miRNAs expressed in the nervous system include, but are not limited to, miR-124-5p, miR-125a-3p, miR-125a-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1271-3p, miR-1271-5p, miR-128, miR-132-5p, miR-135a-3p, miR-135a-5p, miR-135b-3p, miR-135b-5p, miR-137, miR-139-5p, miR-139-3p, miR-149-3p, miR-149-5p, miR-153, miR-181c-3p, miR-181c-5p, miR-183-3p, miR-183-5p, miR-190a, miR-190b, miR-212-3p, miR-212-5p, miR-219-1-3p, miR-219-2-3p, miR-23a-3p, miR-23a-5p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR-30c-5p, miR-30d-3p, miR-30d-5p, miR-329, miR-342-3p, miR-3665, miR-3666, miR-380-3p, miR-380-5p, miR-383, miR-410, miR-425-3p, miR-425-5p, miR-454-3p, miR-454-5p, miR-483, miR-510, miR-516a-3p, miR-548b-5p, miR-548c-5p, miR-571, miR-7-1-3p, miR-7-2-3p, miR-7-5p, miR-802, miR-922, miR-9-3p, and miR-9-5p.Furthermore, miRNAs abundant in the nervous system include miR-132-3p, miR-132-3p, miR-148b-3p, miR-148b-5p, miR-151a-3p, miR-151a-5p, miR-212-3p, miR-212-5p, miR-320b, miR-320e, miR-323a-3p, miR-323a-5p, miR-324-5p, miR-325, miR-326, and miR-327. Examples of miR-specific miRs include, but are not limited to, miR-8 and miR-922. MiRs specifically expressed in neuroglial cells include, but are not limited to, miR-1250, miR-219-1-3p, miR-219-2-3p, miR-219-5p, miR-23a-3p, miR-23a-5p, miR-3065-3p, miR-3065-5p, miR-30e-3p, miR-30e-5p, miR-32-5p, miR-338-5p, and miR-657. Expression of a polynucleotide in the nervous system can be regulated by introducing or removing a miRNA binding site derived from a CNS-specific miRNA into or from a polynucleotide of the present invention. Nervous system-specific miRNA binding sites can also be engineered alone or in combination with miRNA binding sites for immune cells (e.g., APCs) in the polynucleotides of the present invention.
[0244] miRNAs known to be expressed in the pancreas include, but are not limited to, miR-105-3p, miR-105-5p, miR-184, miR-195-3p, miR-195-5p, miR-196a-3p, miR-196a-5p, miR-214-3p, miR-214-5p, miR-216a-3p, miR-216a-5p, miR-30a-3p, miR-33a-3p, miR-33a-5p, miR-375, miR-7-1-3p, miR-7-2-3p, miR-493-3p, miR-493-5p, and miR-944. Expression of a polynucleotide in the pancreas can be regulated by introducing or deleting a miRNA binding site derived from a pancreas-specific miRNA into or from a polynucleotide of the present invention. The pancreas-specific miRNA binding site can also be engineered alone or in combination with an immune cell (e.g., APC) miRNA binding site in the polynucleotide of the present invention.
[0245] MiRNAs known to be expressed in the kidney include miR-122-3p, miR-145-5p, miR-17-5p, miR-192-3p, miR-192-5p, miR-194-3p, miR-194-5p, miR-20a-3p, miR-20a-5p, miR-204-3p, miR-204-5p, miR-210, miR-216a-3p, miR-216a- Examples of miRNA binding sites include, but are not limited to, miR-296-3p, miR-30a-3p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR-30c-5p, miR-324-3p, miR-335-3p, miR-335-5p, miR-363-3p, miR-363-5p, and miR-562. Kidney-specific miRNA binding sites can be introduced into or removed from the polynucleotides of the present invention to regulate the expression of the polynucleotide in the kidney. Kidney-specific miRNA binding sites can also be engineered alone or in combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the present invention.
[0246] MiRNAs known to be expressed in muscle include, but are not limited to, let-7g-3p, let-7g-5p, miR-1, miR-1286, miR-133a, miR-133b, miR-140-3p, miR-143-3p, miR-143-5p, miR-145-3p, miR-145-5p, miR-188-3p, miR-188-5p, miR-206, miR-208a, miR-208b, miR-25-3p, and miR-25-5p. Expression of a polynucleotide in muscle can be regulated by introducing or removing miRNA binding sites from muscle-specific miRNAs into or from a polynucleotide of the invention. Muscle-specific miRNA binding sites can also be engineered alone or in combination with immune cell (e.g., APC) miRNA binding sites in the polynucleotides of the invention.
[0247] miRNAs are also differentially expressed in various cell types, including, but not limited to, endothelial cells, epithelial cells, and adipocytes.
[0248] miRNAs known to be expressed in endothelial cells include let-7b-3p, let-7b-5p, miR-100-3p, miR-100-5p, miR-101-3p, miR-101-5p, miR-126-3p, miR-126-5p, miR-1236-3p, miR-1236-5p, miR-130a-3p, miR-130a-5p, miR-17-5p, miR-17-3p, miR-18a-3p, miR-18a-5p, miR-19a-3p, miR-19a-5p, miR-19b-1-5p, miR-19b-2-5p, miR-19b-3p, and miR-20a miR-361-3p, miR-361-5p, miR-421, miR-424-3p, miR-424-5p, miR-513a-5p, miR-92a-1-5p, miR-92a-2-5p, miR-92a-3p, miR-92b-3p, and miR-92b-5p. Deep sequencing analysis has revealed many novel miRNAs in endothelial cells (e.g., Voellenkle C et al., RNA, 2012, 18, 472-484, the entire contents of which are incorporated herein by reference). By introducing or deleting miRNA binding sites derived from endothelial cell-specific miRNAs into or from the polynucleotides of the present invention, expression of the polynucleotides in endothelial cells can be regulated.
[0249] MiRNAs known to be expressed in epithelial cells include let-7b-3p, let-7b-5p, miR-1246, miR-200a-3p, miR-200a-5p, miR-200b-3p, miR-200b-5p, miR-200c-3p, miR-200c-5p, miR-338-3p, miR-429, miR-451a, miR-451b, miR-494, and miR-8, which are specific to respiratory ciliated epithelial cells. Examples of miRNAs that can be used include, but are not limited to, miR-02, miR-34a, miR-34b-5p, miR-34c-5p, miR-449a, miR-449b-3p, miR-449b-5p, the let-7 family miRs specific to lung epithelial cells, miR-133a, miR-133b, and miR-126, miR-382-3p and miR-382-5p specific to kidney epithelial cells, and miR-762 specific to corneal epithelial cells. Expression of a polynucleotide in epithelial cells can be regulated by introducing or deleting an miRNA binding site derived from an epithelial cell-specific miRNA into or from a polynucleotide of the present invention.
[0250] In addition, a large group of miRNAs is abundant in embryonic stem cells and regulates stem cell self-renewal as well as the development and / or differentiation of various cell lineages, such as neural, cardiac, hematopoietic, skin, osteogenic, and muscle cells (e.g., Kuppusamy KT et al., Curr. Mol Med, 2013, 13(5), 757-764; Vidigal JA and Ventura A, Semin Cancer Biol. 2012, 22(5-6), 428-436; Goff LA et al., PLoS One, 2009, 4:e7192; Morin RD et al., Genome Res, 2008, 18, 610-621; Yoo JK et al., Stem Cells Dev. 2012, 21(11), 2049-2057, the entire contents of each of which are incorporated herein by reference).The miRNAs enriched in embryonic stem cells include let-7a-2-3p, let-a-3p, let-7a-5p, let7d-3p, let-7d-5p, miR-103a-2-3p, miR-103a-5p, miR-106b-3p, miR-106b-5p, miR-1246, miR-1275, miR-138-1-3p, miR-138-2-3p, miR-138-5p, miR-154-3p, and miR-154-5p. , miR-200c-3p, miR-200c-5p, miR-290, miR-301a-3p, miR-301a-5p, miR-302a-3p, miR-302a-5p, miR-302b-3p, miR- 302b-5p, miR-302c-3p, miR-302c-5p, miR-302d-3p, miR-302d-5p, miR-302e, miR-367-3p, miR-367-5p, miR-369-3p, miR-369-5p, miR-370, miR-371, miR-373, miR-380-5p, miR-423-3p, miR-423-5p, miR-486-5p, miR-520c-3p, miR-54 8e, miR-548f, miR-548g-3p, miR-548g-5p, miR-548i, miR-548k, miR-5481, miR-548m, miR-548n, miR-548o-3p, miR-5 Examples of miR-48o-5p include, but are not limited to, miR-548p, miR-664a-3p, miR-664a-5p, miR-664b-3p, miR-664b-5p, miR-766-3p, miR-766-5p, miR-885-3p, miR-885-5p, miR-93-3p, miR-93-5p, miR-941, miR-96-3p, miR-96-5p, miR-99b-3p, and miR-99b-5p. Many of the predicted novel miRNAs have been discovered by deep sequencing in human embryonic stem cells (e.g., Morin RD et al., Genome Res, 2008, 18, 610-621; Goff LA et al., PLoS One, 2009, 4:e7192; Bar M et al., Stem cells, 2008, 26, 2496-2505; the entire contents of each of which are incorporated herein by reference).
[0251] In some embodiments, miRNAs are selected based on their expression and abundance in immune cells of the hematopoietic lineage, e.g., B cells, T cells, macrophages, dendritic cells, and cells known to express TLR7 / TLR8 and / or be capable of secreting cytokines, such as endothelial cells and platelets. Thus, in some embodiments, the miRNA set includes miRs that may be responsible for part of the immunogenicity of these cells, such that incorporation of the corresponding miR sites within a polynucleotide (e.g., mRNA) of the invention may lead to destabilization of mRNAs and / or repression of translation from these mRNAs in specific cell types. Representative examples include, but are not limited to, miR-142, miR-144, miR-150, miR-155, and miR-223, which are specific to many hematopoietic cells; miR-142, miR150, miR-16, and miR-223, which are expressed in B cells; miR-223, miR-451, miR-26a, and miR-16, which are expressed in precursor hematopoietic cells; and miR-126, which is expressed in plasmacytoid dendritic cells, platelets, and endothelial cells. For further discussion of tissue expression of miRs, see, e.g., Teruel-Montoya, R. et al. (2014) PLoS One 9:102259; Landgraf, P. et al. (2007) Cell 129:1401-1414; Bissels, U. et al. (2009) RNA 15:2375-2384. Incorporation of any one miR site (e.g., miR-142, which is abundant in both B cells and dendritic cells) in the 3'UTR and / or 5'UTR can mediate such effects in multiple cell types of interest.
[0252] In some embodiments, it may be beneficial to target the same cell type with multiple miRs, and to incorporate binding sites for both the 3p and 5p arms when they are abundant (e.g., both miR-142-3p and miR142-5p are abundant in hematopoietic stem cells). Thus, in certain embodiments, the polynucleotides of the invention contain binding sites for two or more (e.g., two, three, four, or more) miRs from the group consisting of: (i) miR-142, miR-144, miR-150, miR-155, and miR-223 (expressed in many hematopoietic cells); or (ii) miR-142, miR-150, miR-16, and miR-223 (expressed in B cells); or miR-223, miR-451, miR-26a, and miR-16 (expressed in progenitor hematopoietic cells).
[0253] In some embodiments, it may be beneficial to combine different miRs to simultaneously target multiple cell types of interest (e.g., miR-142 and miR-126 for targeting multiple cells in the hematopoietic lineage and endothelial cells). Thus, for example, in certain embodiments, a polynucleotide of the invention comprises two or more (e.g., two, three, four, or more) miRNA binding sites, where: (i) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155, or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets, or endothelial cells (e.g., miR-142, miR-144, miR-150, miR-155, or miR-223). (ii) at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16, or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets, or endothelial cells (e.g., miR-126); or (iii) at least one of the miRs targets prohematopoietic cells (e.g., miR-223, miR-451, miR- (iv) at least one of the miRs targets a cell of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155, or miR-223) and at least one of the miRs targets a B cell (e.g., miR-142, miR-150, miR-155, or miR-223). , miR-16, or miR-223), and at least one of the miRs targets plasmacytoid dendritic cells, platelets, or endothelial cells (e.g., miR-126), or any other possible combination of the four classes of miR binding sites (i.e., those targeting the hematopoietic lineage, those targeting B cells, those targeting precursor hematopoietic cells, and / or those targeting plasmacytoid dendritic cells / platelets / endothelial cells).
[0254] In one embodiment, for modulating an immune response, a polynucleotide of the invention can comprise one or more miRNA-binding sequences that bind to one or more miRs expressed in conventional immune cells or any cells that express TLR7 and / or TLR8 and secrete proinflammatory cytokines and / or chemokines (e.g., immune cells of peripheral lymphoid organs, and / or splenocytes, and / or endothelial cells). It has now been discovered that incorporating one or more miRs expressed in conventional immune cells or any cells that express TLR7 and TLR8 and secrete proinflammatory cytokines and / or chemokines (e.g., immune cells of peripheral lymphoid organs, and / or splenocytes, and / or endothelial cells) into mRNA reduces or inhibits immune cell activation (e.g., B cell activation as measured by the frequency of activated B cells) and / or cytokine production (e.g., production of IL-6, IFN-γ, and / or TNFα). Furthermore, it has recently been discovered that incorporating one or more miRs expressed in conventional immune cells or in any cells that express TLR7 and TLR8 and secrete proinflammatory cytokines and / or chemokines (e.g., immune cells in peripheral lymphoid organs, and / or splenocytes, and / or endothelial cells) into mRNA can reduce or inhibit the anti-drug antibody (ADA) response against the target protein encoded by the mRNA.
[0255] In another embodiment, to modulate accelerated blood clearance of a polynucleotide delivered in a lipid-containing compound or composition, a polynucleotide of the invention can include one or more miR-binding sequences that bind to one or more miRNAs expressed in conventional immune cells or any cells that express TLR7 and / or TLR8 and secrete proinflammatory cytokines and / or chemokines (e.g., immune cells in peripheral lymphoid organs, splenocytes, and / or endothelial cells). It has now been discovered that incorporating one or more miR-binding sites into mRNA reduces or inhibits accelerated blood clearance (ABC) of the lipid-containing compound or composition used to deliver the mRNA. Furthermore, it has recently been discovered that incorporating one or more miR binding sites into mRNA reduces serum levels of anti-PEG anti-IgM (e.g., reduces or inhibits acute production of IgM that recognizes polyethylene glycol (PEG) by B cells) and / or reduces or inhibits proliferation and / or activation of plasmacytoid dendritic cells following administration of a lipid-containing compound or a composition containing mRNA.
[0256] In some embodiments, the miR sequence can correspond to any known microRNA expressed in immune cells, including, but not limited to, those taught in U.S. Patent Application Publication Nos. US2005 / 0261218 and US2005 / 0059005, the entire contents of which are incorporated by reference herein. Examples of miRs expressed in immune cells include, but are not limited to, miRs expressed in splenocytes, myeloid cells, dendritic cells, plasmacytoid dendritic cells, B cells, T cells, and / or macrophages. For example, miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, and miR-27 are expressed in myeloid cells, miR-155 is expressed in dendritic cells, B cells, and T cells, miR-146 is upregulated in macrophages upon TLR stimulation, and miR-126 is expressed in plasmacytoid dendritic cells. In certain embodiments, the miR(s) are abundantly or preferentially expressed in immune cells. For example, miR-142 (miR-142-3p and / or miR-142-5p), miR-126 (miR-126-3p and / or miR-126-5p), miR-146 (miR-146-3p and / or miR-146-5p), and miR-155 (miR-155-3p and / or miR155-5p) are abundantly expressed in immune cells. These microRNA sequences are known in the art, and therefore, those skilled in the art can easily design binding or target sequences to which these microRNAs bind based on Watson-Crick complementarity.
[0257] Thus, in various embodiments, a polynucleotide of the invention comprises at least one microRNA binding site for a miR selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24, and miR-27. In another embodiment, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells. In various embodiments, a polynucleotide of the invention comprises one to four (1, 2, 3, or 4) miR binding sites for microRNAs expressed in immune cells. In another embodiment, a polynucleotide of the invention comprises three miR binding sites. These miR binding sites can correspond to a microRNA selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24, miR-27, and combinations thereof. In one embodiment, the polynucleotide of the invention comprises two or more (e.g., two, three, four) copies of the same miR binding site expressed in immune cells, for example, two or more copies of a miR binding site selected from the group of miRs consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24, and miR-27.
[0258] In one embodiment, the polynucleotide of the present invention comprises three copies of the same miR binding site. In certain embodiments, the use of three copies of the same miR binding site can exhibit advantageous properties compared to the use of a single miR binding site. Examples of 3'UTR sequences comprising three miR binding sites include, but are not limited to, SEQ ID NO: 155 (three miR-142-3p binding sites) and SEQ ID NO: 157 (three miR-142-5p binding sites).
[0259] In another embodiment, the polynucleotide of the present invention comprises two or more (e.g., two, three, or four) copies of at least two different miR binding sites expressed in immune cells. Examples of 3'UTR sequences comprising two or more different miR binding sites include, but are not limited to, SEQ ID NO: 152 (one miR-142-3p binding site and one miR-126-3p binding site), SEQ ID NO: 158 (two miR-142-5p binding sites and one miR-142-3p binding site), and SEQ ID NO: 161 (two miR-155-5p binding sites and one miR-142-3p binding site).
[0260] In another embodiment, a polynucleotide of the invention comprises at least two miR binding sites for a microRNA expressed in immune cells, wherein one of the miR binding sites is for miR-142-3p. In various embodiments, a polynucleotide of the invention comprises binding sites for miR-142-3p and miR-155 (miR-155-3p or miR-155-5p), miR-142-3p and miR-146 (miR-146-3 or miR-146-5p), or miR-142-3p and miR-126 (miR-126-3p or miR-126-5p).
[0261] In another embodiment, a polynucleotide of the invention comprises at least two miR binding sites for a microRNA expressed in immune cells, wherein one of the miR binding sites is for miR-126-3p. In various embodiments, a polynucleotide of the invention comprises binding sites for miR-126-3p and miR-155 (miR-155-3p or miR-155-5p), miR-126-3p and miR-146 (miR-146-3p or miR-146-5p), or miR-126-3p and miR-142 (miR-142-3p or miR-142-5p).
[0262] In another embodiment, a polynucleotide of the invention comprises at least two miR binding sites for a microRNA expressed in an immune cell, wherein one of the miR binding sites is for miR-142-5p. In various embodiments, a polynucleotide of the invention comprises binding sites for miR-142-5p and miR-155 (miR-155-3p or miR-155-5p), miR-142-5p and miR-146 (miR-146-3 or miR-146-5p), or miR-142-5p and miR-126 (miR-126-3p or miR-126-5p).
[0263] In yet another embodiment, a polynucleotide of the invention comprises at least two miR binding sites for a microRNA expressed in an immune cell, wherein one of the miR binding sites is for miR-155-5p. In various embodiments, a polynucleotide of the invention comprises binding sites for miR-155-5p and miR-142 (miR-142-3p or miR-142-5p), miR-155-5p and miR-146 (miR-146-3 or miR-146-5p), or miR-155-5p and miR-126 (miR-126-3p or miR-126-5p).
[0264] miRNAs can also regulate complex biological processes such as angiogenesis (e.g., miR-132) (Anand and Cheresh, Curr Opin Hematol 2011 18:171-176). In the polynucleotides of the present invention, miRNA binding sites involved in such processes can be removed or introduced to customize the expression of the polynucleotide to biologically relevant cell types or related biological processes. In this regard, the polynucleotides of the present invention are defined as auxotrophic polynucleotides.
[0265] In some embodiments, a polynucleotide of the invention comprises an miRNA binding site, wherein the miRNA binding site comprises one or more nucleotide sequences selected from Table 3 that comprise one or more copies of any one or more of the miRNA binding site sequences. In some embodiments, a polynucleotide of the invention further comprises at least one, two, three, four, five, six, seven, eight, nine, ten, or more of the same or different miRNA binding sites selected from Table 3, including any combination thereof.
[0266] In some embodiments, the miRNA-binding site binds to or is complementary to miR-142. In some embodiments, the miR-142 comprises SEQ ID NO: 114. In some embodiments, the miRNA-binding site binds to miR-142-3p or miR-142-5p. In some embodiments, the miR-142-3p-binding site comprises SEQ ID NO: 116. In some embodiments, the miR-142-5p-binding site comprises SEQ ID NO: 118. In some embodiments, the miRNA-binding site comprises a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 116 or SEQ ID NO: 118.
[0267] In some embodiments, the miRNA-binding site binds to or is complementary to miR-126. In some embodiments, the miR-126 comprises SEQ ID NO: 119. In some embodiments, the miRNA-binding site binds to miR-126-3p or miR-126-5p. In some embodiments, the miR-126-3p-binding site comprises SEQ ID NO: 121. In some embodiments, the miR-126-5p-binding site comprises SEQ ID NO: 123. In some embodiments, the miRNA-binding site comprises a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 121 or SEQ ID NO: 123.
[0268] In one embodiment, the 3'UTR comprises two miRNA binding sites, wherein the first miRNA binding site binds miR-142 and the second miRNA binding site binds miR-126. In a particular embodiment, the 3'UTR that binds miR-142 and miR-126 comprises, consists of, or consists essentially of the sequence of SEQ ID NO: 163. Table 3. miR-l42, miR-l26, and miR-l42 and miR-l26 binding sites TIFF2025028860000004.tif152166
[0269] In some embodiments, miRNA binding sites are inserted into polynucleotides of the invention at any position of the polynucleotide (e.g., the 5'UTR and / or the 3'UTR). In some embodiments, the 5'UTR comprises an miRNA binding site. In some embodiments, the 3'UTR comprises an miRNA binding site. In some embodiments, the 5'UTR and the 3'UTR comprise miRNA binding sites. An insertion into a polynucleotide can occur at any site within the polynucleotide, so long as the insertion of the miRNA binding site into the polynucleotide does not prevent translation of a functional polypeptide in the absence of the corresponding miRNA; and in the presence of the miRNA, the insertion of the miRNA binding site into the polynucleotide and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing translation of the polynucleotide.
[0270] In some embodiments, the miRNA binding site is inserted at least about 30 nucleotides downstream from the stop codon of the ORF in a polynucleotide of the invention comprising an ORF. In some embodiments, the miRNA binding site is inserted at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codon of the ORF in a polynucleotide of the invention. In some embodiments, the miRNA binding site is inserted about 10 to about 100 nucleotides, about 20 to about 90 nucleotides, about 30 to about 80 nucleotides, about 40 to about 70 nucleotides, about 50 to about 60 nucleotides, or about 45 to about 65 nucleotides downstream from the stop codon of the ORF in the polynucleotide of the present invention.
[0271] In some embodiments, the miRNA binding site is inserted into the 3'UTR immediately after the stop codon of the coding region of a polynucleotide of the invention, e.g., an mRNA. In some embodiments, if there are multiple copies of the stop codon in the construct, the miRNA binding site is inserted immediately after the last stop codon. In some embodiments, the miRNA binding site is inserted further downstream of the stop codon, in which case there are 3'UTR bases between the stop codon and the miR binding site. In some embodiments, three examples of possible insertion sites for a miR in the 3'UTR include, but are not limited to, SEQ ID NOs: 162, 163, and 164, which each show 3'UTR sequences with the miR-142-3p site inserted into one of three different possible insertion sites in the 3'UTR.
[0272] In some embodiments, one or more miRNA binding sites can be located at one or more possible insertion sites in the 5'UTR. For example, three examples of possible insertion sites for miR in the 5'UTR include, but are not limited to, SEQ ID NOs: 165, 166, and 167, which each show a 5'UTR sequence with the miR-142-3p site inserted at one of three different possible insertion sites in the 5'UTR.
[0273] In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon, and at least one microRNA binding site is located within 1-100 nucleotides of the 3'UTR after the stop codon. In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon, and at least one microRNA binding site for a miR expressed in an immune cell is located within 30-50 nucleotides of the 3'UTR after the stop codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a stop codon, and at least one microRNA binding site for a miR expressed in an immune cell is located within at least 50 nucleotides of the 3'UTR after the stop codon. In other embodiments, the codon-optimized open reading frame encoding the polypeptide of interest includes a stop codon, and at least one microRNA binding site for an miR expressed in immune cells is located in the 3' UTR immediately following the stop codon, within 15-20 nucleotides of the 3' UTR after the stop codon, or within 70-80 nucleotides of the 3' UTR after the stop codon. In other embodiments, the 3' UTR includes two or more miRNA binding sites (e.g., two to four miRNA binding sites), and a spacer region (e.g., 10-100, 20-70, or 30-50 nucleotides in length) can be present between each miRNA binding site. In another embodiment, the 3' UTR includes a spacer region between the end of the miRNA binding site(s) and the polyA tail nucleotides. For example, a spacer region 10-100 nucleotides, 20-70 nucleotides, or 30-50 nucleotides in length can be present between the end of the miRNA binding site(s) and the start of the polyA tail.
[0274] In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a start codon and at least one microRNA binding site is located in the 5'UTR 1-100 nucleotides before (upstream) the start codon. In one embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a start codon and at least one microRNA binding site for a miR expressed in immune cells is located in the 5'UTR 10-50 nucleotides before (upstream) the start codon. In another embodiment, the codon-optimized open reading frame encoding the polypeptide of interest comprises a start codon and at least one microRNA binding site for a miR expressed in immune cells is located in the 5'UTR at least 25 nucleotides before (upstream) the start codon. In other embodiments, the codon-optimized open reading frame encoding the polypeptide of interest includes a start codon, and at least one microRNA-binding site for a miR expressed in immune cells is located in the 5' UTR immediately before the start codon, or 15-20 nucleotides before the start codon, or 70-80 nucleotides before the start codon. In other embodiments, the 5' UTR includes two or more miRNA-binding sites (e.g., 2-4 miRNA-binding sites), where a spacer region (e.g., 10-100, 20-70, or 30-50 nucleotides in length) can be present between each miRNA-binding site.
[0275] In one embodiment, the 3'UTR contains two or more stop codons, with at least one miRNA binding site located downstream of the stop codon. For example, the 3'UTR can contain one, two, or three stop codons. Examples of triple stop codons that can be used include, but are not limited to, UGAUAAUAG (SEQ ID NO: 124), UGAUAGUAA (SEQ ID NO: 125), UAAUGAUAG (SEQ ID NO: 126), UGAUAAUAA (SEQ ID NO: 127), UGAUAGUAG (SEQ ID NO: 128), UAAUGAUGA (SEQ ID NO: 129), UAAUAGUAG (SEQ ID NO: 130), UGAUGAUGA (SEQ ID NO: 131), UAAUAAUAA (SEQ ID NO: 132), and UAGUAGUAG (SEQ ID NO: 133). Within the 3'UTR, for example, one, two, three, or four miRNA binding sites, e.g., miR-142-3p binding sites, can be located immediately adjacent to the stop codon(s) or any number of nucleotides downstream from the final stop codon. If the 3'UTR contains multiple miRNA binding sites, these binding sites can be positioned adjacent to each other (i.e., in order) within the construct, or alternatively, spacer nucleotides can be positioned between each binding site.
[0276] In one embodiment, the 3'UTR contains three stop codons with a single miR-142-3p binding site located downstream from the third stop codon. Examples of 3'UTR sequences with three stop codons and a single miR-142-3p binding site located at different positions downstream from the last stop codon are shown in, but not limited to, SEQ ID NOs: 151, 162, 163, and 164. Table 4A. 5'UTR, 3'UTR, miR sequences, and miR binding sites TIFF2025028860000005.tif215164 TIFF2025028860000006.tif191164 TIFF2025028860000007.tif171164 TIFF2025028860000008.tif162164 TIFF2025028860000009.tif184164 TIFF2025028860000010.tif159164 Stop codon = bold miRl42-3p binding site = underlined miRl26-3p binding site = bold underline miRl55-5p binding site = italics miRl42-5p binding site = bold and underlined in italics Table 4B. Exemplary Preferred UTRs JPEG2025028860000011.jpg124170 TIFF2025028860000012.tif145166
[0277] In one embodiment, a polynucleotide of the invention comprises a 5' UTR, a codon-optimized open reading frame encoding a polypeptide of interest, a 3' UTR comprising at least one miRNA binding site for an miR expressed in an immune cell, and a 3' tail region of binding nucleosides. In various embodiments, the 3' UTR comprises one to four, at least two, one, two, three, or four miRNA binding sites for miRs expressed in immune cells, preferably miRs abundantly or preferentially expressed in immune cells.
[0278] In one embodiment, at least one miRNA expressed in an immune cell is a miR-142-3p microRNA binding site. In one embodiment, the miR-142-3p microRNA binding site comprises the sequence set forth in SEQ ID NO: 116. In one embodiment, the 3'UTR of an mRNA comprising the miR-142-3p microRNA binding site comprises the sequence set forth in SEQ ID NO: 134.
[0279] In one embodiment, at least one miRNA expressed in immune cells is a miR-126 microRNA binding site. In one embodiment, the miR-126 binding site is a miR-126-3p binding site. In one embodiment, the miR-126-3p microRNA binding site comprises the sequence set forth in SEQ ID NO: 121. In one embodiment, the 3'UTR of an mRNA of the present invention comprising a miR-126-3p microRNA binding site comprises the sequence set forth in SEQ ID NO: 149.
[0280] Exemplary sequences of miRs that can bind to the microRNA binding site(s) of the present disclosure include: miR-142-3p (SEQ ID NO: 115), miR-142-5p (SEQ ID NO: 117), miR-146-3p (SEQ ID NO: 135), miR-146-5p (SEQ ID NO: 136), miR-155-3p (SEQ ID NO: 137), miR-155-5p (SEQ ID NO: 138), miR-126-3p (SEQ ID NO: 120), miR-126-5p (SEQ ID NO: 122), ... Examples of suitable miR sequences include, but are not limited to, miR-16-3p (SEQ ID NO: 139), miR-16-5p (SEQ ID NO: 140), miR-21-3p (SEQ ID NO: 141), miR-21-5p (SEQ ID NO: 142), miR-223-3p (SEQ ID NO: 143), miR-223-5p (SEQ ID NO: 144), miR-24-3p (SEQ ID NO: 145), miR-24-5p (SEQ ID NO: 146), miR-27-3p (SEQ ID NO: 147), and miR-27-5p (SEQ ID NO: 148). Other suitable miR sequences expressed in immune cells (e.g., abundantly or preferentially expressed in immune cells) are known and available in the art, for example, in the University of Manchester microRNA database, miRBase. Sites that bind to any of the above-described miRs can be designed based on Watson-Crick complementarity to the miR, generally 100% complementarity to the miR, and inserted into the mRNA constructs of the present disclosure as described herein.
[0281] In another embodiment, the polynucleotides of the invention (e.g., and mRNAs, e.g., their 3'UTRs) can comprise at least one miRNA binding site, thereby reducing or inhibiting accelerated blood clearance of PEG, e.g., by B cells, by reducing or inhibiting IgM production, and / or reducing or inhibiting pDC proliferation and / or activation, and can comprise at least one miRNA binding site for regulating tissue expression of the encoded protein of interest.
[0282] miRNA gene regulation can be influenced by the sequences surrounding the miRNA, including, but not limited to, the species of the surrounding sequence, the type of sequence (heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements within the surrounding sequence, and / or structural elements within the surrounding sequence. miRNAs can be influenced by the 5' UTR and / or 3' UTR. By way of example, and not limitation, a non-human 3' UTR can increase the regulatory effect that a miRNA sequence has on the expression of a polypeptide of interest compared to a human 3' UTR of the same sequence type.
[0283] In one embodiment, other regulatory and / or structural elements in the 5'UTR can affect miRNA-mediated gene regulation. One example of a regulatory and / or structural element is a structured IRES (internal ribosome entry site) in the 5'UTR, which is required for the binding of translation elongation factors to initiate protein translation. Binding of EIF4A2 to this secondary structural element in the 5'UTR is required for miRNA-mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, the entire contents of which are incorporated herein by reference). To enhance microRNA-mediated gene regulation, the polynucleotide of the present invention can further comprise this structured 5'UTR.
[0284] At least one miRNA binding site can be engineered into the 3' UTR of a polynucleotide of the present invention. In this regard, the 3' UTR of a polynucleotide of the present invention can be engineered with at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding site can be engineered into the 3' UTR of a polynucleotide of the present invention. In one embodiment, the miRNA binding sites incorporated into a polynucleotide of the present invention can be the same or different miRNA sites. Combinations of various miRNA binding sites incorporated into a polynucleotide of the present invention can include combinations in which two or more copies of any of the different miRNA sites are incorporated. In another embodiment, the miRNA binding sites incorporated into a polynucleotide of the present invention can target the same or different tissues in the body. By way of example, and not limitation, the introduction of tissue-, cell-type-, or disease-specific miRNA binding sites into the 3'UTR of a polynucleotide of the invention can reduce expression in specific cell types (e.g., myeloid cells, endothelial cells, etc.).
[0285] In one embodiment, an miRNA binding site can be engineered into a polynucleotide of the present invention near the 5' end of the 3'UTR, approximately halfway between the 5' and 3' ends of the 3'UTR, and / or near the 3' end of the 3'UTR. By way of example, and not limitation, an miRNA binding site can be engineered near the 5' end of the 3'UTR and approximately halfway between the 5' and 3' ends of the 3'UTR. By way of another example, and not limitation, an miRNA binding site can be engineered near the 3' end of the 3'UTR and approximately halfway between the 5' and 3' ends of the 3'UTR. By way of yet another example, and not limitation, an miRNA binding site can be engineered near the 5' end of the 3'UTR and approximately halfway between the 5' and 3' ends of the 3'UTR.
[0286] In another embodiment, the 3'UTR can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to the miRNA, the miRNA seed sequence, and / or the miRNA sequence adjacent to the seed sequence.
[0287] In some embodiments, expression of a polynucleotide of the invention can be controlled by incorporating at least one sensor sequence into the polynucleotide and formulating the polynucleotide for administration. By way of example and not limitation, a polynucleotide of the invention can be targeted to a tissue or cell by incorporating an miRNA binding site into the polynucleotide and incorporating the polynucleotide into lipid nanoparticles that include ionizable lipids, including any of the lipids described herein.
[0288] The polynucleotides of the present invention can also be engineered for enhanced targeted expression in specific tissues, cell types, or biological states based on the expression patterns of miRNAs in different tissues, cell types, or biological states. By incorporating tissue-specific miRNA binding sites, the polynucleotides of the present invention can be designed for optimal protein expression in tissues or cells, or in terms of biological states.
[0289] In some embodiments, polynucleotides of the present invention can be designed to incorporate miRNA binding sites that are 100% identical to a known miRNA seed sequence or that are less than 100% identical to the miRNA seed sequence. In some embodiments, polynucleotides of the present invention can be designed to incorporate miRNA binding sites that are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a known miRNA seed sequence. The miRNA seed sequence can be partially mutated to reduce miRNA binding affinity, resulting in reduced down-regulation of the polynucleotide. Essentially, the degree of match or mismatch between the miRNA binding site and the miRNA seed can act as a variable resistor to fine-tune the ability of the miRNA to regulate protein expression. In addition, mutations within the non-seed region of the miRNA binding site can also affect the ability of the miRNA to regulate protein expression.
[0290] In one embodiment, the miRNA sequence can be incorporated into the loop of the stem-loop.
[0291] In another embodiment, the miRNA seed sequence can be incorporated within the loop of the stem-loop, and the miRNA binding site can be incorporated within the 5' stem or 3' stem of the stem-loop.
[0292] In one embodiment, miRNA sequences in the 5'UTR can be used to stabilize the polynucleotides of the invention described herein.
[0293] In another embodiment, the use of an miRNA sequence in the 5' UTR of a polynucleotide of the invention can reduce access to a translation initiation site, such as, but not limited to, a start codon. See, for example, Matsuda et al., PLoS One. 2010 11(5):e15057, the entire contents of which are incorporated herein by reference. This study reduced access to the first start codon (AUG) using an antisense locked nucleic acid (LNA) oligonucleotide around the start codon and an exon junction complex (EJC) (-4 to +37, with the A of the AUG codon at +1). Matsuda demonstrated that altering the sequence around the start codon using an LNA or EJC affects the efficiency, length, and structural stability of the polynucleotide. The polynucleotide of the invention can reduce access to the translation initiation site by including an miRNA sequence near the translation initiation site, rather than the LNA or EJC sequence described by Matsuda et al. The translation initiation site can be located before, after, or within the miRNA sequence. By way of example, and not limitation, the translation initiation site can be located within the miRNA sequence, e.g., the seed sequence or binding site.
[0294] In some embodiments, the polynucleotide of the present invention can include at least one miRNA to reduce antigen presentation by antigen-presenting cells. The miRNA can be a complete miRNA sequence, a miRNA seed sequence, a miRNA sequence (without a seed), or a combination thereof. By way of example and not limitation, the miRNA incorporated into the polynucleotide of the present invention can be specific to the hematopoietic system. By way of another example and not limitation, the miRNA incorporated into the polynucleotide of the present invention to reduce antigen presentation is miR-142-3p.
[0295] In some embodiments, the polynucleotides of the present invention can comprise at least one miRNA to reduce expression of the encoded polypeptide in a tissue or cell of interest. By way of example, but not limited to, the polynucleotides of the present invention can comprise at least one miR-142-3p binding site, miR-142-3p seed sequence, miR-142-3p binding site (without seed), miR-142-5p binding site, miR-142-5p seed sequence, miR-142-5p binding site (without seed), miR-146 binding site, miR-146 seed sequence, and / or miR-146 binding site (without seed sequence).
[0296] In some embodiments, the polynucleotides of the present invention contain at least one miRNA binding site in the 3'UTR for selective degradation of mRNA therapeutics in immune cells, thereby suppressing undesirable immunogenic responses caused by therapeutic delivery. By way of example, and not limitation, the miRNA binding site can increase the instability of the polynucleotides of the present invention in antigen-presenting cells. Examples of these miRNAs include, but are not limited to, mir-142-5p, mir-142-3p, mir-146a-5p, and mir-146-3p.
[0297] In one embodiment, a polynucleotide of the invention comprises at least one miRNA sequence within a region of the polynucleotide that is capable of interacting with an RNA binding protein.
[0298] In some embodiments, a polynucleotide (e.g., an RNA, e.g., an mRNA) of the invention comprises (i) a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a UGT1A1 polypeptide (e.g., a wild-type sequence, a functional fragment, or a variant thereof), and (ii) an miRNA-binding site (e.g., an miRNA-binding site that binds miR-142) and / or an miRNA-binding site that binds miR-126.
[0299] 12.3'UTR In certain embodiments, a polynucleotide of the invention (eg, a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide of the invention) further comprises a 3'UTR.
[0300] The 3'UTR is the section of an mRNA immediately following the translation termination codon and often contains regulatory regions that influence gene expression after transcription. Regulatory regions within the 3'UTR can affect mRNA polyadenylation, translation efficiency, localization, and stability. In one embodiment, a 3'UTR useful in the present invention contains a binding site for a regulatory protein or microRNA.
[0301] In certain embodiments, 3' UTRs useful in the polynucleotides of the invention comprise a 3' UTR selected from the group consisting of SEQ ID NOs: 151, and 104-112, or any combination thereof. In certain embodiments, 3' UTRs useful in the polynucleotides of the invention comprise a 3' UTR selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 111, SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 195, and SEQ ID NO: 196, or any combination thereof. In some embodiments, a 3' UTR comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 111 and 112, or any combination thereof. In some embodiments, a 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, a 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 111. In some embodiments, a 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 112. In some embodiments, a 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 150. In some embodiments, a 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 151. In some embodiments, the 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 175. In some embodiments, the 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 177. In some embodiments, the 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 178. In some embodiments, the 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 195. In some embodiments, the 3' UTR comprises the nucleic acid sequence of SEQ ID NO: 196.
[0302] In certain embodiments, 3'UTR sequences useful in the present invention comprise a nucleotide sequence that is at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 3'UTR sequences selected from the group consisting of SEQ ID NOs: 104-112, 150, 151, and 178, or any combination thereof.
[0303] In certain embodiments, a 3'UTR sequence useful in the present invention comprises a nucleotide sequence that is at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 3'UTR sequences selected from the group consisting of SEQ ID NO:4, SEQ ID NO:111, SEQ ID NO:150, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:195, or SEQ ID NO:196, or any combination thereof.
[0304] 13.5' capped region The present invention also includes polynucleotides that include both a 5' cap and a polynucleotide of the invention (eg, a polynucleotide that includes a nucleotide sequence that encodes a UGT1A1 polypeptide).
[0305] The 5' cap structure of native mRNA is involved in nuclear export, increases mRNA stability, and binds to mRNA cap-binding protein (CBP), which is responsible for mRNA stability and translational competence within the cell through the association of CBP with poly(A)-binding protein, thereby forming mature circular mRNA species. The cap also aids in the removal of 5'-proximal introns during mRNA splicing.
[0306] Endogenous mRNA molecules can be 5'-end capped to generate a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue and the 5'-terminal transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars at the 5' end of the mRNA and / or the terminal pre-transcribed nucleotide can also optionally be 2'-O-methylated. 5' decapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.
[0307] In some embodiments, a polynucleotide of the invention (eg, a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide) incorporates a cap moiety.
[0308] In some embodiments, the inclusion of a non-hydrolyzable cap structure in a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide) prevents decapping and extends mRNA half-life. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphorodiester bond, modified nucleotides can be used during the capping reaction. For example, vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used in conjunction with α-thio-guanosine nucleotides according to the manufacturer's instructions to generate phosphorothioate linkages in the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, can also be used.
[0309] Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugar of the 5'-terminus and / or penultimate nucleotide of a polynucleotide (as described above) on the 2'-hydroxyl group of the sugar ring. Several different 5'-cap structures can be used to generate the 5'-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, retain cap function but differ in their chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap. Cap analogs can be synthesized chemically (i.e., non-enzymatically) or enzymatically and / or attached to the polynucleotides of the invention.
[0310] For example, an anti-reverse cap analog (ARCA) cap can include two guanines linked by 5'-5'-triphosphate groups, where one guanine has an N7 methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine (m 7 The capped polynucleotide contains an N7- and 3'-O-methylated guanine (which can be equivalently referred to as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanine becomes attached to the 5'-terminal nucleotide of the capped polynucleotide. The N7- and 3'-O-methylated guanine provides the terminal portion of the capped polynucleotide.
[0311] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, mCAP). 7 Gm-ppp-G).
[0312] In some embodiments, the cap is a dinucleotide cap analog. By way of example, and not limitation, the dinucleotide cap analog can be modified at different phosphate positions with boranophosphate or phosphoroselenoate groups, such as the dinucleotide cap analogs described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference.
[0313] In another embodiment, the cap is a cap analog, which is an N7-(4-chlorophenoxyethyl)-substituted dinucleotide form of a cap analog known in the art and / or described herein. Examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide forms of cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m 3’-O Examples of suitable cap analogs include, but are not limited to, G(5')ppp(5')G cap analogs (see, for example, the various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574, the entire contents of which are incorporated herein by reference). In another embodiment, the cap analog of the present invention is a 4-chloro / bromophenoxyethyl analog.
[0314] Although cap analogs allow for simultaneous capping of polynucleotides, or regions thereof, in in vitro transcription reactions, up to 20% of transcripts can remain uncapped. This, and furthermore, structural differences between the cap analog and the endogenous 5' cap structure of nucleic acids produced via the endogenous cellular transcription machinery, can result in reduced translational competence and reduced cellular stability.
[0315] Polynucleotides of the present invention (e.g., polynucleotides comprising a nucleotide sequence encoding a UGT1A1 polypeptide) can also be enzymatically capped after production (whether by IVT or chemical synthesis) to generate highly authentic 5' cap structures. As used herein, the phrase "highly authentic" refers to characteristics that closely reflect or mimic, structurally or functionally, endogenous or wild-type characteristics. That is, "highly authentic" characteristics are representative of endogenous, wild-type, native, or physiological cellular function and / or structure, as compared to prior art synthetic characteristics or analogs, or are superior in one or more respects to corresponding endogenous, wild-type, native, or physiological characteristics. Examples of highly authentic 5' cap structures of the present invention include, but are not limited to, enhanced cap-binding protein binding, extended half-life, reduced susceptibility to 5' endonucleases, and / or reduced 5' decapping, particularly as compared to synthetic 5' cap structures known in the art (or as compared to wild-type, native, or physiological 5' cap structures). For example, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can generate a standard 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanine cap nucleotide, where the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl, relative to other 5'-cap analog structures known in the art. Such a structure is referred to as the Cap 1 structure. This cap results in improved translational competence, enhanced cellular stability, and reduced activation of cellular inflammatory cytokines, compared to other 5'-cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (Cap 0), 7mG(5')ppp(5')N1mpNp (Cap 1), and 7mG(5')-ppp(5')N1mpN2mp (Cap 2).
[0316] By way of example, and not limitation, capping of polynucleotides after production can be highly efficient, resulting in capping of nearly 100% of the polynucleotides, as opposed to approximately 80% when a cap analog is attached to the polynucleotide during an in vitro transcription reaction.
[0317] According to the present invention, the 5'-end cap can comprise an endogenous cap or a cap analog. According to the present invention, the 5'-end cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
[0318] 14. Poly A tail In some embodiments, a polynucleotide of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide) further comprises a poly-A tail. In further embodiments, terminal groups can be incorporated onto the poly-A tail for stabilization. In other embodiments, the poly-A tail comprises a des-3' hydroxyl tail.
[0319] To increase stability, long chains of adenine nucleotides (poly-A tails) can be added to polynucleotides, such as mRNA molecules, during RNA processing. Shortly after transcription, the 3' end of the transcript is cleaved, freeing a 3' hydroxyl. Poly-A polymerase then adds a chain of adenine nucleotides to the RNA. This process, called polyadenylation, adds poly-A tails, for example, approximately 80 to approximately 250 residues in length (including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues in length). In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO: 204).
[0320] A polyA tail can also be added after the construct has been exported from the nucleus.
[0321] According to the present invention, terminal groups can be incorporated onto the polyA tail for stabilization. Polynucleotides of the present invention can include des-3' hydroxyl tails. They can also include structural residues or 2'-O-methyl modifications, as taught in Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005), the entire contents of which are incorporated herein by reference.
[0322] The polynucleotides of the invention can be designed to encode transcripts with alternative poly(A) tail structures, including histone mRNAs. According to Norbury, "terminal uridylation has also been detected on human replication-dependent histone mRNAs. Turnover of these mRNAs is thought to be important in preventing the potential accumulation of toxic histones after chromosomal DNA replication is complete or inhibited. These mRNAs are distinguished by the lack of a 3' poly(A) tail; instead, their function is carried out by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP); the latter performs the same function as PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology, AOP, published online 29 August 2013, doi:10.1038 / nrm3645), the entire contents of which are incorporated herein by reference.
[0323] The unique length of the polyA tail provides certain advantages to the polynucleotides of the present invention. Generally, when present, the length of the polyA tail is greater than 30 nucleotides in length. In another embodiment, the polyA tail is greater than 35 nucleotides in length (e.g., at least about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides in length or longer).
[0324] In some embodiments, the polynucleotide, or a region thereof, is about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 10 These ranges include: 0-1,500, 100-2,000, 100-2,500, 100-3,000, 500-750, 500-1,000, 500-1,500, 500-2,000, 500-2,500, 500-3,000, 1,000-1,500, 1,000-2,000, 1,000-2,500, 1,000-3,000, 1,500-2,000, 1,500-2,500, 1,500-3,000, 2,000-3,000, 2,000-2,500, and 2,500-3,000.
[0325] In some embodiments, the polyA tail is designed relative to the length of the entire polynucleotide or the length of a particular region of the polynucleotide, which can be based on the length of a coding region, the length of a particular feature or region, or the length of the final product expressed from the polynucleotide.
[0326] In this regard, the polyA tail can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% longer than the polynucleotide or feature thereof. Alternatively, the polyA tail can be engineered as part of the polynucleotide to which it belongs. In this regard, the polyA tail can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the total length of the construct, or the length of a region of the construct or the total length of the construct minus the polyA tail. Furthermore, conjugation of engineered binding sites for polyA binding proteins and polynucleotides can enhance expression.
[0327] Additionally, modified nucleotides at the 3' end of the polyA tail can be used to link multiple different polynucleotides together via their 3' ends via PABP (polyA binding protein). Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and 7 days post-transfection.
[0328] In some embodiments, polynucleotides of the invention are designed to contain a poly-AG quartet region. G-quartets are cyclic hydrogen-bonded arrays of four guanine nucleotides formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated into the end of a poly-A tail. The resulting polynucleotides are assayed for stability, protein production, and other parameters, including half-life at various time points. It has been discovered that poly-AG quartets result in protein production from mRNAs that are at least 75% equivalent to mRNAs identified using a 120-nucleotide-only poly-A tail (SEQ ID NO: 214).
[0329] 15. Start codon region The present invention also includes polynucleotides that include both a start codon region and a polynucleotide described herein (e.g., a polynucleotide that includes a nucleotide sequence that encodes a UGT1A1 polypeptide). In some embodiments, polynucleotides of the invention can have a region that is similar to, or functions similarly to, a start codon region.
[0330] In some embodiments, translation of a polynucleotide can be initiated at a codon other than the start codon AUG. Translation of a polynucleotide can be initiated at alternative start codons, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178, and Matsuda and Mauro PLoS ONE, 2010 5:11, the entire contents of each of which are incorporated herein by reference).
[0331] By way of example, and not limitation, translation of a polynucleotide may begin at the alternative start codon ACG. As another example, and not limitation, translation of a polynucleotide may begin at the alternative start codon CTG or CUG. As yet another example, and not limitation, translation of a polynucleotide may begin at the alternative start codon GTG or GUG.
[0332] Nucleotides adjacent to the codon that initiates translation, such as, but not limited to, the initiation codon or alternative initiation codons, are known to affect the translation efficiency, length, and / or structure of a polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 2010 5:11, the entire contents of which are incorporated herein by reference.) By masking any of the nucleotides adjacent to the codon that initiates translation, the translation initiation position, translation efficiency, length, and / or structure of a polynucleotide can be altered.
[0333] In some embodiments, a masking agent can be used near a start codon or an alternative start codon to mask or conceal the codon, thereby reducing the probability of translation initiation at the masked start codon or alternative start codon. Examples of masking agents include, but are not limited to, antisense locked nucleic acid (LNA) polynucleotides and exon junction complexes (EJCs) (see, e.g., Matsuda and Mauro, "Masking Agents LNA Polynucleotides and EJCs" (PLoS ONE, 2010 5:11), the entire contents of which are incorporated herein by reference).
[0334] In another embodiment, a masking agent can be used to mask the start codon of a polynucleotide, thereby increasing the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask the first start codon, or an alternative start codon, to increase the likelihood that translation will initiate on a start codon, or an alternative start codon, downstream from the masked start codon or alternative start codon.
[0335] In some embodiments, the start codon or alternative start codon can be located within the perfect complement to the miRNA binding site. The perfect complement to the miRNA binding site can help control the translation, length, and / or structure of the polynucleotide, similar to a masking agent. By way of example, and not limitation, the start codon or alternative start codon can be located in the middle of the perfect complement to the miRNA binding site. The start codon or alternative start codon can be located after the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, or twenty-first nucleotide.
[0336] In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence to initiate translation of the polynucleotide at a codon other than the start codon. Translation of the polynucleotide can be initiated at the codon following the removed start codon, at a downstream start codon, or at an alternative start codon. By way of example, and not limitation, the start codon ATG or AUG can be removed as the first three nucleotides of a polynucleotide sequence to initiate translation at a downstream start codon or an alternative start codon. To control, or attempt to control, translation initiation, polynucleotide length, and / or polynucleotide structure, a polynucleotide sequence from which the start codon has been removed can further include at least one masking agent for the downstream start codon and / or the alternative start codon.
[0337] 16.Stop codon region The present invention also includes polynucleotides comprising both a stop codon region and a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide). In some embodiments, a polynucleotide of the present invention can comprise at least two stop codons before the 3' untranslated region (UTR). For DNA, the codons can be selected from TGA, TAA, and TAG, and for RNA, the stop codons can be selected from UGA, UAA, and UAG. In some embodiments, a polynucleotide of the present invention comprises the stop codon TGA for DNA or the stop codon UGA for RNA and one additional stop codon. In further embodiments, the additional stop codon can be TAA or UAA. In another embodiment, a polynucleotide of the present invention comprises three consecutive stop codons, four stop codons, or more stop codons.
[0338] 17. Polynucleotides containing mRNA encoding UGT1A1 polypeptides In certain embodiments, a polynucleotide of the disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a UGT1A1 polypeptide, comprises, from 5' to 3': (i) the 5′ cap described above; (ii) a 5′UTR, such as the sequence described above; (iii) an ORF encoding a human UGT1A1 polypeptide, e.g., an ORF having at least 79%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12; (iv) at least one stop codon; (v) a 3'UTR, such as the sequence described above; and (vi) a polyA tail as described above.
[0339] In some embodiments, the polynucleotide further comprises an miRNA-binding site, e.g., an miRNA-binding site that binds to miRNA-142. In some embodiments, the 5' UTR comprises the miRNA-binding site. In some embodiments, the 3' UTR comprises the miRNA-binding site.
[0340] In some embodiments, a polynucleotide of the disclosure comprises a nucleotide sequence that encodes a polypeptide sequence that is at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the protein sequence of wild-type human UGT1A1 (SEQ ID NO: 1).
[0341] In some embodiments, a polynucleotide of the present disclosure, e.g., a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5' cap as described above, e.g., CAP1; (2) a 5' UTR; (3) an ORF with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 and 5-12; (3) a stop codon; (4) a 3' UTR; and (5) a poly A tail as described above, e.g., a poly A tail of about 100 residues.
[0342] Exemplary UGT1A1 nucleotide constructs are set forth below:
[0343] SEQ ID NO:14 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:2, and the 3' UTR of SEQ ID NO:151.
[0344] SEQ ID NO:15 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:2, and the 3' UTR of SEQ ID NO:150.
[0345] SEQ ID NO:16 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:2, and the 3' UTR of SEQ ID NO:178.
[0346] SEQ ID NO:17 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:5, and the 3' UTR of SEQ ID NO:151.
[0347] SEQ ID NO:18 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:5, and the 3' UTR of SEQ ID NO:150.
[0348] SEQ ID NO:19 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:6, and the 3' UTR of SEQ ID NO:151.
[0349] SEQ ID NO:20 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:6, and the 3' UTR of SEQ ID NO:150.
[0350] SEQ ID NO:21 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:7, and the 3' UTR of SEQ ID NO:151.
[0351] SEQ ID NO:22 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:7, and the 3' UTR of SEQ ID NO:150.
[0352] SEQ ID NO:23 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:8, and the 3' UTR of SEQ ID NO:150.
[0353] SEQ ID NO:24 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:9, and the 3' UTR of SEQ ID NO:150.
[0354] SEQ ID NO:25 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:10, and the 3' UTR of SEQ ID NO:150.
[0355] SEQ ID NO:26 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:11, and the 3' UTR of SEQ ID NO:150.
[0356] SEQ ID NO:27 consists of, from the 5' to 3' end: the 5' UTR of SEQ ID NO:3, the UGT1A1 nucleotide ORF of SEQ ID NO:12, and the 3' UTR of SEQ ID NO:150.
[0357] In certain embodiments, in constructs having SEQ ID NOs: 14-27, all uracils therein are replaced with N1-methylpseudouracil.
[0358] In some embodiments, a polynucleotide of the disclosure, e.g., a polynucleotide comprising an mRNA nucleotide sequence encoding a UGT1A1 polypeptide, comprises (1) a 5' cap as described above, e.g., CAP1, (2) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 14-27, and (3) a poly-A tail as described above, e.g., a poly-A tail of about 100 residues. In certain embodiments, in the construct having SEQ ID NOs: 14-27, all uracils therein are replaced with N1-methylpseudouracil. Table 5 - Modified mRNA constructs containing an ORF encoding human UGT1A1 (Constructs #1-#14 each contain a Cap1 5'-end cap and a 3'-end polyA region) TIFF2025028860000013.tif244163
[0359] 18. Methods for producing polynucleotides The present disclosure also provides methods for producing a polynucleotide of the invention (eg, a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide), or a complement thereof.
[0360] In some aspects, polynucleotides (e.g., RNA, e.g., mRNA) encoding the UGT1A1 polypeptides disclosed herein can be constructed using in vitro transcription (IVT). In other aspects, polynucleotides (e.g., RNA, e.g., mRNA) encoding the UGT1A1 polypeptides disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer.
[0361] In other aspects, polynucleotides (e.g., RNA, e.g., mRNA) encoding the UGT1A1 polypeptides disclosed herein are produced using host cells. In certain aspects, polynucleotides (e.g., RNA, e.g., mRNA) encoding the UGT1A1 polypeptides disclosed herein are produced by a combination of one or more of IVT, chemical synthesis, host cell expression, or any other method known in the art.
[0362] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof can be substituted, in whole or in part, for the naturally occurring nucleosides present in a candidate nucleotide sequence and incorporated into a sequence-optimized nucleotide sequence (e.g., an RNA, e.g., an mRNA) encoding a UGT1A1 polypeptide. The resulting polynucleotide, e.g., an mRNA, can then be tested for its ability to produce a protein and / or to produce a therapeutic outcome.
[0363] a. In vitro transcription / enzyme synthesis The polynucleotides of the invention disclosed herein (e.g., polynucleotides comprising a nucleotide sequence encoding a UGT1A1 polypeptide) can be transcribed using an in vitro transcription (IVT) system. This system generally includes a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase. The NTPs can be selected from those described herein, including, but not limited to, natural and non-natural (modified) NTPs. The polymerase can be selected from, but is not limited to, T7 RNA polymerase, T3 RNA polymerase, and mutant polymerases, for example, from polymerases capable of incorporating the polynucleotides disclosed herein. See U.S. Patent Application Publication No. US20130259923, the entire contents of which are incorporated herein by reference.
[0364] Any number of RNA polymerases or variants can be used to synthesize the polynucleotides of the present invention. The RNA polymerase can be modified by inserting or deleting amino acids in the RNA polymerase sequence. By way of example, and not limitation, the RNA polymerase can be modified to exhibit an increased ability to incorporate 2'-modified nucleotide triphosphates compared to unmodified RNA polymerases (see International Publication No. WO2008078180 and U.S. Patent No. 8,101,385, the entire contents of which are incorporated herein by reference).
[0365] Variants can be obtained by evolving RNA polymerases, optimizing the amino acid and / or nucleic acid sequences of RNA polymerases, and / or using other methods known in the art. By way of example, and not limitation, T7 RNA polymerase variants can be evolved using the continuous directed evolution system described by Esvelt et al. (Nature 472:499-503 (2011), the entire contents of which are incorporated herein by reference), whereby T7 The RNA polymerase clones may contain at least one mutation, including, but not limited to, lysine at position 93 substituted with threonine (K93T), I4M, A7T, E63V, V64D, A65E, D66Y, T76N, C125R, S128R, A136T, N165S, G175R, H176L, Y178H, F182L, L196F, G198V, D208Y, E222K, S228A, Q239R, T243N, G259D, M267I, G280 C, H300R, D351A, A354S, E356D, L360P, A383V, Y385C, D388Y, S397R, M401T, N410S, K450R, P451T, G452V, E484A, H523L, H524N, G542V, E565K, K577E, K577M, N601S, S684Y, L699I, K713E, N748D, Q754R, E775K, A827V, D851N, or L864F. As another example, and without limitation, a T7 RNA polymerase variant can encode at least the mutations described in U.S. Patent Application Publication Nos. 20100120024 and 20070117112, the entire contents of which are incorporated by reference herein. RNA polymerase variants include, but are not limited to, substitution variants, conservative amino acid substitutions, insertion variants, and / or deletion variants.
[0366] In one aspect, the polynucleotides may be designed to be recognized by a wild-type or variant RNA polymerase, and thereby modified to contain sites or regions of sequence variation from the wild-type or parent polynucleotide.
[0367] Polynucleotide or nucleic acid synthesis reactions can be carried out enzymatically using polymerases. Polymerases catalyze the formation of phosphodiester bonds between nucleotides within a polynucleotide, or nucleic acid, chain. Currently known DNA polymerases can be divided into different families based on amino acid sequence comparisons and crystal structure analysis. The DNA polymerase I (pol I), or A, family, which includes the Klenow fragment of E. coli, Bacillus DNA polymerase I, Thermus aquaticus (Taq) DNA polymerase, and T7 RNA and DNA polymerases, is one of the most studied of these families. Another large family is the DNA polymerase α (pol α), or B, family, which includes all eukaryotic replicative DNA polymerases and the polymerases from phages T4 and RB69. Although they use similar catalytic mechanisms, these families of polymerases differ in their substrate specificity, efficiency of substrate analog incorporation, extent and rate of primer extension, mode of DNA synthesis, exonuclease activity, and sensitivity to inhibitors.
[0368] DNA polymerases are also selected based on their optimal reaction conditions, such as reaction temperature, pH, and template and primer concentrations. In some cases, a combination of multiple DNA polymerases is used to achieve the desired DNA fragment size and synthesis efficiency. For example, Cheng et al. increased the pH, added glycerol and dimethyl sulfoxide, decreased the denaturation time, increased the extension time, and utilized a second thermostable DNA polymerase with 3' to 5' exonuclease activity to effectively amplify cloned inserts and long targets of human genomic DNA (Cheng et al., PNAS 91:5695-5699 (1994)), the entire contents of which are incorporated herein by reference. RNA polymerases derived from bacteriophages T3, T7, and SP6 are widely used to prepare RNA for biochemical and biophysical studies. RNA polymerases, capping enzymes, and polyA polymerases are disclosed in co-pending International Publication WO2014 / 028429, the entire contents of which are incorporated herein by reference.
[0369] In one embodiment, the RNA polymerase that can be used to synthesize the polynucleotides of the present invention is Syn5 RNA polymerase (see Zhu et al., Nucleic Acids Research 2013, doi:10.1093 / nar / gkt1193, the entire contents of which are incorporated herein by reference). Syn5 RNA polymerase was recently characterized from the marine cyanophage Syn5 by Zhu et al., who also identified the promoter sequence (see Zhu et al., Nucleic Acids Research 2013, the entire contents of which are incorporated herein by reference). Zhu et al. found that Syn5 RNA polymerase catalyzes RNA synthesis over a wider range of temperatures and salinities than T7 RNA polymerase. In addition, they found that the requirements for the initiating nucleotide in the promoter are less stringent for Syn5 RNA polymerase than for T7 RNA polymerase, making Syn5 RNA polymerase a promising candidate for RNA synthesis.
[0370] In one embodiment, Syn5 RNA polymerase can be used in the synthesis of polynucleotides described herein. By way of example, and not limitation, Syn5 RNA polymerase can be used in the synthesis of polynucleotides that require precise 3' ends.
[0371] In one embodiment, a Syn5 promoter can be used in polynucleotide synthesis. By way of example and not limitation, the Syn5 promoter can be 5'-ATTGGGCACCCGTAAGGG-3' (SEQ ID NO: 185 described by Zhu et al. (Nucleic Acids Research 2013)).
[0372] In one aspect, Syn5 RNA polymerase can be used to synthesize polynucleotides containing at least one chemical modification described herein and / or known in the art (see, e.g., incorporation of pseudo-UTP and 5Me-CTP as described in Zhu et al. Nucleic Acids Research 2013).
[0373] In one aspect, the polynucleotides described herein can be synthesized using Syn5 RNA polymerase, which has been purified using a modified and improved purification procedure described in Zhu et al. (Nucleic Acids Research 2013).
[0374] Various tools in genetic engineering are based on the enzymatic amplification of a target gene that serves as a template. The study of the sequence of individual genes or specific regions of interest, as well as other research needs, requires the generation of multiple copies of a target gene from a small sample of polynucleotides or nucleic acids. Such methods can be applied to the production of the polynucleotides of the present invention. For example, polymerase chain reaction (PCR), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), also known as transcription-mediated amplification (TMA), and / or rolling circle amplification (RCA) can be used to produce one or more regions of the polynucleotides of the present invention. Assembling polynucleotides or nucleic acids with ligases is also widely used.
[0375] b.Chemical synthesis Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, e.g., a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide). For example, a single DNA or RNA oligomer containing a codon-optimized nucleotide sequence encoding a particular isolated polypeptide can be synthesized. In other embodiments, several small oligonucleotides encoding portions of the desired polypeptide can be synthesized and then ligated. In some embodiments, the individual oligonucleotides generally contain 5' or 3' overhangs for complementary assembly.
[0376] The polynucleotides (e.g., RNA, e.g., mRNA) disclosed herein can be chemically synthesized using chemical synthesis methods known in the art, and possible nucleic acid base substitutions. See, for example, International Publication Nos. WO2014093924, WO2013052523, WO2013039857, WO2012135805, WO2013151671, U.S. Patent Application Publication No. 20130115272, or U.S. Patent Nos. 8,999,380 or 8,710,200, the entire contents of which are incorporated herein by reference.
[0377] C. Purification of polynucleotides encoding UGT1A1 Purification of polynucleotides described herein (e.g., polynucleotides comprising a nucleotide sequence encoding a UGT1A1 polypeptide) can include, but is not limited to, polynucleotide cleanup, quality assurance, and quality control. Cleanup can be performed by methods known in the art, such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), polyT beads, LNA™ OligoT capture probes (EXIQON® Inc., Vedbaek, Denmark), or HPLC-based purification methods, such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC).
[0378] The term "purified," when used with respect to a polynucleotide, such as a "purified polynucleotide," refers to separation from at least one contaminant. As used herein, a "contaminant" is any substance that renders another unsuitable, impure, or adulterated. Thus, purified polynucleotides (e.g., DNA and RNA) are present in a form or environment that is different from that in which they are found in nature or that is different from that in which they existed prior to being subjected to a treatment or purification method.
[0379] In some embodiments, purification of a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide) removes impurities that can reduce or eliminate an undesirable immune response, e.g., reduced cytokine activity.
[0380] In some embodiments, polynucleotides of the invention (e.g., polynucleotides comprising a nucleotide sequence encoding a UGT1A1 polypeptide) are purified prior to administration using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)).
[0381] In some embodiments, a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide) purified using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC, hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) exhibits increased expression of the encoded UGT1A1 protein compared to the expression level obtained with the same polynucleotide of the disclosure purified using a different purification method.
[0382] In some embodiments, the column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) purified polynucleotide comprises a nucleotide sequence encoding a UGT1A1 polypeptide containing one or more point mutations known in the art.
[0383] In some embodiments, the use of RP-HPLC purified polynucleotides increases the level of UGT1A1 protein expression in cells when introduced into those cells, e.g., by 10 to 100%, i.e., at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100%, relative to the level of UGT1A1 protein expression in the cells before the RP-HPLC purified polynucleotide was introduced into the cells or after the non-RP-HPLC purified polynucleotide was introduced into the cells.
[0384] In some embodiments, the use of RP-HPLC purified polynucleotides increases the level of expression of functional UGT1A1 protein in cells when introduced into those cells, e.g., by 10-100%, i.e., at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100%, relative to the level of functional expression of UGT1A1 protein in the cells before introduction of the RP-HPLC purified polynucleotide into the cells or after introduction of a non-RP-HPLC purified polynucleotide into the cells.
[0385] In some embodiments, the use of RP-HPLC purified polynucleotides increases detectable UGT1A1 activity in cells when introduced into those cells, e.g., by 10-100%, i.e., at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100%, relative to the level of functional UGT1A1 activity in the cells before introduction of the RP-HPLC purified polynucleotide into the cells or after introduction of a non-RP-HPLC purified polynucleotide into the cells.
[0386] In some embodiments, the purified polynucleotide is at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 96% pure, at least about 97% pure, at least about 98% pure, at least about 99% pure, or about 100% pure.
[0387] Quality assurance and / or quality control checks can be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC. In another embodiment, the polynucleotides can be sequenced by methods including, but not limited to, reverse transcriptase PCR.
[0388] d. Quantification of expressed polynucleotides encoding UGT1A1 In some embodiments, polynucleotides of the invention (e.g., polynucleotides comprising a nucleotide sequence encoding a UGT1A1 polypeptide), their expression products, and degradation products and metabolic products can be quantified according to methods known in the art.
[0389] In some embodiments, polynucleotides of the present invention can be quantified within exosomes or when originating from one or more bodily fluids. As used herein, "bodily fluid" includes peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's or pre-ejaculate fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menstrual blood, pus, sebum, vomit, vaginal fluid, mucosal secretions, fecal water, pancreatic juice, sinus lavage fluid, bronchopulmonary aspirate, blastocyst fluid, and umbilical cord blood. Alternatively, exosomes can be collected from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.
[0390] In exosome quantification, a sample of 2mL or less is obtained from a subject, and exosomes are isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunosorbent capture, affinity purification, microfluidic separation, or a combination thereof.In this analysis, the level or concentration of polynucleotide can be the expression level, presence, absence, cleavage, or alteration of the administered construct.Advantageously, the level is correlated with one or more clinical phenotypes or the assay of human disease biomarkers.
[0391] Assays can be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or a combination thereof, but exosomes can also be isolated using immunohistochemical methods, such as enzyme-linked immunosorbent assay (ELISA). Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunosorbent capture, affinity purification, microfluidic separation, or a combination thereof.
[0392] These methods provide researchers with the ability to monitor remaining or delivered polynucleotide levels in real time, which is possible because the polynucleotides of the present invention differ from endogenous forms due to structural or chemical modifications.
[0393] In some embodiments, the polynucleotides can be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). An example of a UV / Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). Quantified polynucleotides can be analyzed to determine whether the polynucleotides are sized appropriately, and the presence or absence of polynucleotide degradation can be confirmed. Polynucleotide degradation can be confirmed by methods such as, but not limited to, agarose gel electrophoresis, HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).
[0394] 19. Pharmaceutical Compositions and Formulations The invention provides pharmaceutical compositions and formulations comprising any of the polynucleotides. In some embodiments, the composition or formulation further comprises a delivery agent.
[0395] In some embodiments, the composition or formulation can include a polynucleotide comprising a sequence-optimized nucleic acid sequence disclosed herein that encodes a UGT1A1 polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., an RNA, e.g., an mRNA) that includes a polynucleotide (e.g., an ORF) that has significant sequence identity to a sequence-optimized nucleic acid sequence disclosed herein that encodes a UGT1A1 polypeptide. In some embodiments, the polynucleotide further comprises an miRNA binding site that binds to, for example, miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27, and miR-26a.
[0396] The pharmaceutical composition or formulation may optionally comprise one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. The pharmaceutical composition or formulation of the present invention may be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21 st ed., Lippincott Williams & Wilkins, 2005, the entire contents of which are incorporated herein by reference. In some embodiments, the compositions are administered to a human, human patient, or subject. For purposes of this disclosure, the phrase "active ingredient" generally refers to the polynucleotides to be delivered as described herein.
[0397] The formulations and pharmaceutical compositions described herein can be prepared by any method known in the art of pharmacology or hereafter developed. In general, such preparation methods include the step of bringing into association the active ingredient with the excipients and / or one or more other accessory ingredients, and then, if necessary and / or desired, dividing, shaping, and / or packaging the product into desired single- or multi-dose units.
[0398] Pharmaceutical compositions or formulations according to the present disclosure may be prepared, packaged, and / or sold in bulk, as single unit doses, and / or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject, and / or a convenient fraction of such a dosage, e.g., one-half or one-third of such a dosage.
[0399] The relative amounts of the active ingredient, pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure can vary depending on the specific characteristics, size, and / or condition of the subject being treated, as well as the route by which the composition is to be administered.
[0400] In some embodiments, the compositions and formulations described herein can contain at least one polynucleotide of the invention. By way of example, and not limitation, the compositions or formulations can contain one, two, three, four, or five polynucleotides of the invention. In some embodiments, the compositions or formulations described herein can contain multiple polynucleotides. In some embodiments, the compositions or formulations can contain linear and circular forms of the polynucleotides. In other embodiments, the compositions or formulations can contain circular polynucleotides and in vitro transcribed (IVT) polynucleotides. In yet other embodiments, the compositions or formulations can contain IVT polynucleotides, chimeric polynucleotides, and circular polynucleotides.
[0401] Although the description of pharmaceutical compositions and formulations provided herein primarily relates to pharmaceutical compositions and formulations suitable for administration to humans, those skilled in the art will appreciate that such compositions are generally suitable for administration to any other animal, e.g., non-human animals, e.g., non-human mammals.
[0402] The present invention provides pharmaceutical formulations comprising a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide). The polynucleotides described herein can be formulated with one or more excipients to: (1) enhance stability; (2) increase cell transfection; (3) enable sustained or delayed release (e.g., from a polynucleotide depot formulation); (4) modify biodistribution (e.g., target the polynucleotide to a particular tissue or cell type); (5) increase translation of the encoded protein in vivo; and / or (6) modify the release profile of the encoded protein in vivo. In some embodiments, the pharmaceutical formulation further comprises a delivery agent comprising, e.g., a compound having Formula (I), e.g., any of Compounds 1-232, e.g., Compound II; a compound having Formula (III), (IV), (V), or (VI), e.g., any of Compounds 233-342, e.g., Compound VI; or a compound having Formula (VIII), e.g., any of Compounds 419-428, e.g., Compound I, or any combination thereof. In some embodiments, the delivery agent comprises Compound II, DSPC, cholesterol, and Compound I or PEG-DMG, for example, in a molar ratio of about 50:10:38.5:1.5. In some embodiments, the delivery agent comprises Compound II, DSPC, cholesterol, and Compound I or PEG-DMG, for example, in a molar ratio of about 47.5:10.5:39.0:3.0. In some embodiments, the delivery agent comprises Compound VI, DSPC, cholesterol, and Compound I or PEG-DMG, for example, in a molar ratio of about 50:10:38.5:1.5. In some embodiments, the delivery agent comprises Compound VI, DSPC, cholesterol, and Compound I or PEG-DMG, for example, in a molar ratio of about 47.5:10.5:39.0:3.0.
[0403] Pharmaceutically acceptable excipients used herein include, but are not limited to, any and all solvents, dispersion media, or other liquid vehicles, dispersing or suspending aids, diluents, granulating and / or dispersing agents, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, binders, lubricants or oils, coloring agents, sweeteners or flavoring agents, stabilizers, antioxidants, antibacterial or antifungal agents, osmolality adjusting agents, pH adjusting agents, buffers, chelating agents, cryoprotectants, and / or bulking agents, suitable for the particular dosage form desired. Techniques for preparing various excipients and compositions for formulating pharmaceutical compositions are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006), the entire contents of which are incorporated herein by reference).
[0404] Exemplary diluents include, but are not limited to, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, and the like, and / or combinations thereof.
[0405] Exemplary granulating and / or dispersing agents include, but are not limited to, starch, pregelatinized or microcrystalline starch, alginic acid, guar gum, agar, poly(vinylpyrrolidone), (Providone), cross-linked poly(vinylpyrrolidone) (Crospovidone), cellulose, methylcellulose, carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, and the like, and / or combinations thereof.
[0406] Exemplary surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrus, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN® 80], sorbitan monopalmitate [SPAN® 40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ® 30]), PLUORINC® F68, POLOXAMER® 188, and the like, and / or combinations thereof.
[0407] Exemplary binders include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, and the like, and combinations thereof.
[0408] Oxidation is a potential degradation pathway for mRNA, especially for liquid mRNA formulations.To prevent oxidation, antioxidants can be added to the formulation.Exemplary antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof.
[0409] Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, edetate disodium, fumaric acid, malic acid, phosphoric acid, edetate sodium, tartaric acid, edetate trisodium, and the like, and combinations thereof.
[0410] Exemplary antibacterial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, and the like, and combinations thereof.
[0411] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), and the like, and combinations thereof.
[0412] In some embodiments, the pH of the polynucleotide solution is maintained at pH 5 to pH 8 to enhance stability. Exemplary buffers for controlling pH include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, and / or combinations thereof.
[0413] Exemplary lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, and the like, and combinations thereof.
[0414] The pharmaceutical compositions or formulations described herein can contain a cryoprotectant that stabilizes the polynucleotides described herein during freezing. Exemplary cryoprotectants include, but are not limited to, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, and the like, and combinations thereof.
[0415] The pharmaceutical compositions or formulations described herein can include bulking agents in the lyophilized polynucleotide formulation to achieve a "pharmaceutically elegant" solid form, stabilizing the lyophilized polynucleotide during extended storage (e.g., 36 months). Exemplary bulking agents of the present invention include, but are not limited to, sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof.
[0416] In some embodiments, the pharmaceutical composition or formulation further comprises a delivery agent. Delivery agents of the present disclosure may include, but are not limited to, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, cells transfected with polynucleotides, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof.
[0417] 20. Delivery Agents a. Lipid compounds The present disclosure provides pharmaceutical compositions with advantageous properties. The lipid compositions described herein can be advantageously used in lipid nanoparticle compositions for delivering therapeutic and / or prophylactic agents, such as mRNA, to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have lower immunogenicity compared to reference lipids (e.g., MC3, KC2, or DLinDMA). For example, formulations comprising the lipids disclosed herein and a therapeutic or prophylactic agent, such as mRNA, exhibit an increased therapeutic index compared to corresponding formulations comprising a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.
[0418] In certain embodiments, the present application provides: (a) a polynucleotide comprising a nucleotide sequence encoding a UGT1A1 polypeptide; and (b) providing a pharmaceutical composition comprising a delivery agent;
[0419] Lipid nanoparticle formulations In some embodiments, the nucleic acids of the invention (e.g., UGT1A1 mRNA) are formulated in lipid nanoparticles (LNPs). Lipid nanoparticles generally comprise an ionic cationic lipid, a non-cationic lipid, a sterol, and a PEG lipid component along with the nucleic acid cargo of interest. Lipid nanoparticles of the invention can be produced using components, compositions, and methods commonly known in the art. See, for example, PCT / US2016 / 052352, PCT / US2016 / 068300, PCT / US2017 / 037551, PCT / US2015 / 027400, PCT / US2016 / 047406, PCT / US2016000129, PCT / US2016 / 014280, PCT / US201 See PCT / US2016 / 069491, PCT / US2016 / 069610, ...610, PCT / US2016 / 069491, PCT / US2016 / 069491, PCT / US2016 / 069491, PCT / US2016 / 069491, PCT / US2016 / 06949
[0420] Nucleic acids of the present disclosure (e.g., UGT1A1 mRNA) are typically formulated in lipid nanoparticles, which in some embodiments comprise at least one ionic cationic lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.
[0421] In some embodiments, the lipid nanoparticles comprise 20-60% ionic cationic lipid by molar ratio. For example, the lipid nanoparticles may comprise 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, 30-40%, 40-60%, 40-50%, or 50-60% ionic cationic lipid by molar ratio. In some embodiments, the lipid nanoparticles comprise 20%, 30%, 40%, 50, or 60% ionic cationic lipid by molar ratio.
[0422] In some embodiments, the lipid nanoparticles comprise 5-25% non-cationic lipid by molar ratio. For example, the lipid nanoparticles may comprise 5-20%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, or 20-25% non-cationic lipid by molar ratio. In some embodiments, the lipid nanoparticles comprise 5%, 10%, 15%, 20%, or 25% non-cationic lipid by molar ratio.
[0423] In some embodiments, the lipid nanoparticles contain sterols at a molar ratio of 25-55%. For example, the lipid nanoparticles may contain sterols at a molar ratio of 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45-50%, or 50-55%. In some embodiments, the lipid nanoparticles contain sterols at a molar ratio of 25%, 30%, 35%, 40%, 45%, 50%, or 55%.
[0424] In some embodiments, the lipid nanoparticles contain 0.5-15% PEG-modified lipids by molar ratio. For example, the lipid nanoparticles may contain 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10%, or 10-15% by molar ratio. In some embodiments, the lipid nanoparticles contain 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG-modified lipids by molar ratio.
[0425] In some embodiments, the lipid nanoparticles comprise 20-60% ionic cationic lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid in a molar ratio.
[0426] ionic lipids In some embodiments, the ionic lipids of the present disclosure comprise a compound of formula (I): TIFF2025028860000014.tif2858 or an N-oxide thereof, or a salt thereof, or one or more isomers thereof, wherein: R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR", or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is hydrogen, C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH2) nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R , -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -N(R)S(O)2R8, -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, and each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)-M″-C(O)O—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O)—, —SS—, an aryl group, and a heteroaryl group, wherein M″ is a bond, C 1-13 Alkyl or C 2-13 is alkenyl; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8 is C 3-6 Selected from the group consisting of carbocycle and heterocycle; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6Alkenyl, C 3-6 Selected from the group consisting of carbocyclic, and heterocyclic; Each R is independently C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3-15 Alkyl, and C 3-15 alkenyl; Each R * independently, C 1-12 Alkyl, and C 2-12 alkenyl; Each Y is independently C 3-6 It is a carbocyclic ring; Each X is independently selected from the group consisting of F, Cl, Br, and I, and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13, where R4 is -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), (i) when n is 1, 2, 3, 4, or 5, Q is not -N(R), or (ii) when n is 1 or 2, Q is not a 5-, 6-, or 7-membered heterocycloalkyl.
[0427] In certain embodiments, as a subset of compounds of formula (I), compounds of formula (IA): TIFF2025028860000015.tif3183 or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M'; R is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) nQ, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 For example, Q is selected from the group consisting of -NHC(S)N(R)2, -NHC(O ...
[0428] In certain embodiments, as a subset of compounds of formula (I), compounds of formula (IB): TIFF2025028860000016.tif3983 or an N-oxide thereof, or a salt or isomer thereof, wherein all variables are as defined herein. For example, m is selected from 5, 6, 7, 8, and 9; R4 is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R and R are independently selected from H, C 1-14 Alkyl, and C 2-14For example, Q is selected from the group consisting of -NHC(S)N(R)2, -NHC(O ...
[0429] In certain embodiments, as a subset of compounds of formula (I), compounds of formula (II): TIFF2025028860000017.tif3596 or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; M1 is a bond or M'; R4 is hydrogen, unsubstituted C 1- Alkyl, or -(CH2) n Q, where n is 2, 3, or 4, and Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl.
[0430] In one embodiment, the compound of formula (I) is a compound of formula (IIa): TIFF2025028860000018.tif34107 or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as described herein.
[0431] In another embodiment, the compound of formula (I) is a compound of formula (IIb): TIFF2025028860000019.tif34109 or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as described herein.
[0432] In another embodiment, the compound of formula (I) is a compound of formula (IIc) or (IIe): TIFF2025028860000020.tif28124 or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as described herein.
[0433] In another embodiment, the compound of formula (I) is a compound of formula (IIf): TIFF2025028860000021.tif4197 or an N-oxide thereof, or a salt or isomer thereof, wherein M is —C(O)O— or —OC(O)—; M″ is C 1-6 Alkyl or C 2-6 alkenyl, and R and R are independently C 5-14 Alkyl, and C 5-14 alkenyl, wherein n is selected from 2, 3, and 4.
[0434] In a further embodiment, the compound of formula (I) is a compound of formula (IId): TIFF2025028860000022.tif4967, or an N-oxide thereof, or a salt or isomer thereof, wherein n is 2, 3, or 4, and m, R′, R″, and R2 through R6 are as described herein. For example, each of R2 and R3 is independently C 5-14 Alkyl, and C 5-14 It may be selected from the group consisting of alkenyl.
[0435] In a further embodiment, the compound of formula (I) is a compound of formula (IIg): TIFF2025028860000023.tif3463 or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M1 is a bond or M'; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M"-C(O)O-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; and R2 and R3 are independently selected from H, C 1-14 Alkyl, and C 2-14 For example, M" is selected from the group consisting of C 1-6 Alkyl (e.g., C 1-4 alkyl), or C 2-6 Alkenyl (e.g., C 2-4 alkenyl). For example, R2 and R3 are independently C 5―14 Alkyl, and C 5-14 alkenyl.
[0436] In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. Patent Application Nos. 62 / 220,091, 62 / 252,316, 62 / 253,433, 62 / 266,460, 62 / 333,557, 62 / 382,740, 62 / 393,940, 62 / 471,937, 62 / 471,949, 62 / 475,140, and 62 / 475,166, and PCT Application No. PCT / US2016 / 052352.
[0437] In some embodiments, the ionic lipid is selected from compounds 1-280 described in US Patent Application No. 62 / 475,166.
[0438] In some embodiments, the ionic lipid is TIFF2025028860000024.tif33108 (Compound II), or a salt thereof.
[0439] In some embodiments, the ionic lipid is TIFF2025028860000025.tif33108 (Compound III), or a salt thereof.
[0440] In some embodiments, the ionic lipid is TIFF2025028860000026.tif33107 (Compound IV), or a salt thereof.
[0441] In some embodiments, the ionic lipid is TIFF2025028860000027.tif31108 (Compound V), or a salt thereof.
[0442] The central amine moiety of a lipid according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIIf), or (IIg) can be protonated at physiological pH. Thus, the lipid can have a positive or partial positive charge at physiological pH. Such lipids can be referred to as cationic or ionic (amino) lipids. Alternatively, the lipid can be zwitterionic, i.e., a neutral molecule having both positive and negative charges.
[0443] In some aspects, the ionic lipids of the present disclosure are compounds of formula (III): TIFF2025028860000028.tif35103, or a salt or isomer thereof, wherein: W is TIFF2025028860000029.tif2970, Ring A is TIFF2025028860000030.tif3993, t is 1 or 2; A1 and A2 are each independently selected from CH or N; Z is CH2 or absent, where if Z is CH2, then dotted lines (1) and (2) each represent a single bond, and if Z is absent, then dotted lines (1) and (2) are both absent; R1, R2, R3, R4, and R5 are independently C 5-20 Alkyl, C 5-20 Alkenyl, -R"MR', -R * YR”, -YR”, and -R * Select from the group consisting of "OR"; R x1 and R x2 are each independently H or C 1-3 is alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M * is C1-C6 alkyl; W 1 and W 2 are each independently selected from the group consisting of -O- and -N(R6)-; Each R6 is independently H and C 1-5 selected from the group consisting of alkyl; X 1 , X 2 , and X 3 are independently a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, or -(CH2) n -C(O)-, -C(O)-(CH2) n -, -(CH2) n -C(O)O-, -OC(O)-(CH2) n -, -(CH2) n -OC(O)-, -C(O)O-(CH2) n -, -CH(OH)-, -C(S)-, and -CH(SH)-; Each Y is independently C 3-6 It is a carbocyclic ring; Each R * independently, C 1-12 Alkyl, and C 2-12alkenyl; Each R is independently C 1-3 Alkyl, and C 3-6 Selected from the group consisting of carbocycles; Each R' is independently C 1-12 Alkyl, C 2-12 selected from the group consisting of alkenyl, and H; Each R" is independently C 3-12 Alkyl, C 3-12 alkenyl, and -R * MR′; and n is an integer from 1 to 6; Ring A is If the file is TIFF2025028860000031.tif3343, i)X 1 , X 2 , and X 3 is not —CH—; and / or ii) At least one of R1, R2, R3, R4, and R5 is -R"MR'.
[0444] In some embodiments, the compound has any of formulas (IIIa1)-(IIIa8): TIFF2025028860000032.tif3694(IIIa1), TIFF2025028860000033.tif3695(IIIa2), TIFF2025028860000034.tif3695(IIIa3), TIFF2025028860000035.tif2794(IIIa4), TIFF2025028860000036.tif2794(IIIa5'), TIFF2025028860000037.tif2594(IIIa6), TIFF2025028860000038.tif2594(IIIa7), or TIFF2025028860000039.tif2386(IIIa8).
[0445] In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. Patent Application Nos. 62 / 271,146, 62 / 338,474, 62 / 413,345, and 62 / 519,826, and PCT Application No. PCT / US2016 / 068300.
[0446] In some embodiments, the ionic lipid is selected from compounds 1-156 described in US Patent Application No. 62 / 519,826.
[0447] In some embodiments, the ionic lipid is selected from compounds 1-16, 42-66, 68-76, and 78-156 described in US Patent Application No. 62 / 519,826.
[0448] In some embodiments, the ionizable lipid is TIFF2025028860000040.tif23106 (Compound VI), or a salt thereof.
[0449] In some embodiments, the ionizable lipid is (Compound VII), or a salt thereof.
[0450] The central amine moiety of a lipid according to formula (III), (IIIa1), (IIIa2), (IIIa3), (IIIa4), (IIIa5), (IIIa6), (IIIa7), or (IIIa8) can be protonated at physiological pH. Thus, the lipid can have a positive or partial positive charge at physiological pH. Such lipids can be referred to as cationic or ionic (amino) lipids. Lipids can also be zwitterionic, i.e., neutral molecules with both positive and negative charges.
[0451] phospholipids The lipid composition of the lipid nanoparticle compositions disclosed herein can include one or more phospholipids, such as one or more saturated or (poly)unsaturated phospholipids, or a combination thereof. Generally, a phospholipid comprises a phospholipid moiety and one or more fatty acid moieties.
[0452] The phospholipid moiety can be, for example, but is not limited to, selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.
[0453] The fatty acid moiety can be selected from the group consisting of, for example, but not limited to, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.
[0454] Certain phospholipids can facilitate fusion with membranes. For example, cationic phospholipids can interact with one or more negatively charged phospholipids in membranes (e.g., cell membranes or intracellular membranes). The fusion of phospholipids with membranes allows one or more components (e.g., therapeutic agents) of lipid-containing compositions (e.g., LNPs) to pass through the membrane, for example, allowing one or more components to be delivered to target tissues.
[0455] Non-natural phospholipid species are also contemplated, including natural species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. For example, phospholipids can be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, the alkyne group undergoes copper-catalyzed cycloaddition when exposed to azide. Such reactions are useful for functionalizing the lipid bilayer of nanoparticle compositions to promote membrane permeation or cell recognition, or for conjugating nanoparticle compositions to useful components, such as targeting or imaging moieties (e.g., dyes).
[0456] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include phosphosphingolipids such as sphingomyelin.
[0457] In some embodiments, the phospholipids of the present invention are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexanoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0) PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexanoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.
[0458] In certain embodiments, phospholipids that are useful or potentially useful in the present invention are analogs or variants of DSPC. In certain embodiments, phospholipids that are useful or potentially useful in the present invention are compounds of formula (IV): TIFF2025028860000041.tif2337 or a salt thereof, wherein: Each R 1 are independently optionally substituted alkyl; or optionally, two R 1 are joined together with the intervening atoms to form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl; or optionally, three R 1 is joined together with the intervening atoms to form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula: TIFF2025028860000042.tif1961; L 2 Each instance of may independently be a bond or an optionally substituted C 1-6 alkylene, optionally substituted C 1-6 One methylene unit of alkylene is O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ) with optional substitution; R 2 Each instance of may independently be an optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30 alkynyl; optionally, R 2 one or more methylene units in the formula (I) are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NRN C(O), -NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), -C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), -S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O; R N each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; p is 1 or 2; However, the compound has the formula: Provided that it is not a compound of TIFF2025028860000043.tif2447, where R 2Each instance of is independently an unsubstituted alkyl, an unsubstituted alkenyl, or an unsubstituted alkynyl.
[0459] In some embodiments, the phospholipid may be one or more of the phospholipids described in US Patent Application No. 62 / 520,530.
[0460] i) Phospholipid head modification In certain embodiments, phospholipids useful or potentially useful in the present invention contain a modified phospholipid head (e.g., a modified choline group). In certain embodiments, the phospholipid with the modified head is DSPC, or an analog thereof, with a modified quaternary amine. For example, in embodiments of formula (IV), R 1 At least one of R is not methyl. 1 In certain embodiments, the compound of formula (IV) is a compound of one of the following formulae: TIFF2025028860000044.tif42126 or a salt thereof, wherein: each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and Each v is independently 1, 2, or 3.
[0461] In certain embodiments, the compound of formula (IV) is a compound of formula (IV-a): TIFF2025028860000045.tif2344 or a salt thereof.
[0462] In certain embodiments, the phospholipid that is useful or potentially useful in the present invention comprises a cyclic moiety instead of a glyceride moiety.In certain embodiments, the phospholipid that is useful in the present invention is DSPC or its analogue, which has a cyclic moiety instead of a glyceride moiety.In certain embodiments, the compound of formula (IV) is a compound of formula (IV-b): TIFF2025028860000046.tif2449 or a salt thereof.
[0463] Phospholipid tail modification In certain embodiments, the phospholipids useful or potentially useful in the present invention comprise modified tails. In certain embodiments, the phospholipids useful or potentially useful in the present invention are DSPCs or analogs thereof with modified tails. As used herein, "modified tails" can refer to tails with shorter or longer aliphatic chains, branched aliphatic chains, substituted aliphatic chains, aliphatic chains in which one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof. For example, in certain embodiments, the compound of (IV) is a compound of formula (IV-a) or a salt thereof, wherein R 2 At least one example of 1-30 R is alkyl 2 are examples of each of the R 2 one or more methylene units in the formula (I) are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NRN C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, -S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O.
[0464] In certain embodiments, the compound of formula (IV) is a compound of formula (IV-c): TIFF2025028860000047.tif2666 or a salt thereof, wherein: each x is independently an integer from 0 to 30, inclusive; and Each instance of G is independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), -NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), -C(=NR N ), C(=NR N )N(R N), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), -S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O. Each possibility represents a separate embodiment of the present invention.
[0465] In certain embodiments, phospholipids that are or may be potentially useful...
Claims
1. (i) 5′UTR; (ii) an open reading frame encoding the human uridine diphosphate glycosyltransferase 1 family, polypeptide A1 (UGT1A1) polypeptide of SEQ ID NO:1 and comprising the nucleic acid sequence of SEQ ID NO:2; (iii) a stop codon; and (iv) 3′UTR A polynucleotide comprising a messenger RNA (mRNA) comprising:
2. 2. The polynucleotide of claim 1, wherein the mRNA comprises a 3' untranslated region (UTR) comprising the nucleic acid sequence set forth in SEQ ID NO:
178.
3. The polynucleotide of claim 1 or 2, wherein the mRNA comprises a 5'-end cap.
4. 4. The polynucleotide of claim 3, wherein the 5'-end cap comprises Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, a 5' methyl G cap, or an analog thereof.
5. The polynucleotide according to any one of claims 1 to 4, wherein the mRNA comprises a polyA region.
6. The polynucleotide of claim 5 , wherein the mRNA comprises a polyA region that is at least about 100 nucleotides in length.
7. 7. The polynucleotide of any one of claims 1 to 6, wherein the mRNA comprises at least one chemically modified nucleobase selected from the group consisting of pseudouracil (Ψ), N1-methylpseudouracil (m1Ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof.
8. The polynucleotide of claim 7, wherein all uracils in the mRNA are N1-methylpseudouracils.
9. A pharmaceutical composition comprising the polynucleotide of any one of claims 1 to 8 and a delivery agent.
10. 10. The pharmaceutical composition of claim 9, wherein the pharmaceutical composition comprises lipid nanoparticles.
11. The pharmaceutical composition of claim 10, wherein the lipid nanoparticles comprise ionic lipids, structured lipids, phospholipids and polyethylene glycol (PEG)-modified lipids.
12. The ionic lipid is Compound II: 【Chemistry 1】 (Compound II) or a salt thereof, The structural lipid is cholesterol, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); The PEG-modified lipid is PEG-DMG or Compound I: 【Chemistry 2】 (Compound I) The pharmaceutical composition of claim 11, wherein
13. The pharmaceutical composition of claim 12, wherein the phospholipid is DSPC and the PEG-modified lipid is Compound I.
14. 14. The polynucleotide of any one of claims 1 to 8 or the pharmaceutical composition of any one of claims 9 to 13 for use in a method for treating, preventing or delaying the onset and / or progression of Crigler-Najjar syndrome type 1 (CN-1) in a human subject in need thereof.
15. 15. The polynucleotide or pharmaceutical composition of claim 14, wherein the polynucleotide or pharmaceutical composition is administered to the human subject about once a week, about once every two weeks, or about once a month.
16. 16. The polynucleotide or pharmaceutical composition of claim 14 or 15, wherein the polynucleotide or pharmaceutical composition is administered intravenously.