Oligonucleotide compositions and methods thereof

Abstract

To provide designed oligonucleotide compositions, and methods thereof.SOLUTION: Provided is an oligonucleotide composition having controlled chirality, the oligonucleotide composition comprising a first plurality of oligonucleotides of a particular oligonucleotide type defined by: (1) a base sequence; (2) a backbone crosslinking pattern; (3) a backbone chiral center pattern; and (4) a backbone phosphorus modification pattern.SELECTED DRAWING: None

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application Nos. 62 / 239,839, filed October 9, 2015, 62 / 331,961, filed May 4, 2016, and 62 / 331,966, filed May 4, 2016, which are incorporated herein by reference. [Background technology]

[0002] Oligonucleotides are useful in therapeutic and diagnostic research and nanomaterial applications. Naturally occurring nucleic acids (e.g., unmodified DNA or RNA) have limited therapeutic use due to their instability to extracellular and intracellular nucleases and / or poor cell penetration and distribution. There is a need for new and improved oligonucleotides and oligonucleotide compositions, e.g., new antisense oligonucleotides, siRNA oligonucleotides and oligonucleotide compositions. Summary of the Invention

[0003] In particular, the present disclosure encompasses the recognition that structural elements of an oligonucleotide, e.g., base sequence, chemical modifications (e.g., sugar, base and / or internucleotide bridge modifications and patterns thereof), and / or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotide bridges) and / or patterns thereof), can significantly affect oligonucleotide properties, e.g., activity, toxicity, as may be mediated, for example, by protein binding characteristics, stability, ability to alter splicing, etc. In some embodiments, the present disclosure demonstrates that oligonucleotide compositions comprising oligonucleotides with controlled structural elements (e.g., controlled chemical modifications and / or controlled backbone stereochemistry patterns) confer unexpected properties, including, but not limited to, specific activity, toxicity, etc. In some embodiments, the present disclosure demonstrates that oligonucleotide properties, e.g., activity, toxicity, etc., can be tailored by chemical modifications (e.g., sugar, base, internucleotide bridge modifications, etc.), chiral structure (e.g., stereochemistry of chiral internucleotide bridges and patterns thereof), and / or combinations thereof.

[0004] In particular, in some embodiments, the present disclosure provides compositions and methods for altering the splicing of transcripts. Splicing of transcripts, such as pre-mRNA, is an essential step for transcripts to perform their biological functions in many higher eukaryotes. Defects and / or dysfunctions in the splicing process may affect biological functions and / or have pathological consequences. For example, many human genetic diseases are caused by mutations that cause splicing defects, and many diseases are associated with splicing defects that are not due to obvious mutations. In some embodiments, the present disclosure recognizes that targeted splicing, particularly targeted splicing by compositions comprising oligonucleotides with chemical modifications and / or stereochemical patterns described in the present disclosure, can effectively correct disease-related aberrant splicing and / or introduce and / or enhance beneficial splicing that results in desired products (e.g., mRNA, protein, etc.) that can repair, restore, or add new desired biological functions. For example, in some embodiments, inclusion of mutated exon 51 of DMD may cause frameshift, premature stop codon and / or deletion of one or more downstream exons. In some embodiments, the present disclosure provides compositions and methods for effectively skipping exon 51 of DMD to restore the reading frame, thereby producing a shorter, but partially functional, dystrophin. In some embodiments, the present disclosure provides compositions and methods for effectively skipping mutated exon 51 of DMD to restore the reading frame, thereby producing a shorter, but partially functional, dystrophin. In some embodiments, the compositions and methods provided can modify the splicing of a transcript to effectively reduce the amount of undesired splicing products.For example, in some embodiments, the provided compositions and methods effectively knock down genes by skipping one or more exons of pre-mRNA that results in mRNA with frameshift and / or premature termination codons. In some embodiments, such genes are mutant genes. Those skilled in the art will understand that the provided techniques (oligonucleotides, compositions, methods, etc.) can also be utilized to skip other DMD exons, or one or more exons of other transcripts, such as those described in U.S. Pat. No. 7,534,879 and incorporated herein by reference in accordance with the present disclosure, to treat certain diseases and / or conditions.

[0005] In some embodiments, the present disclosure encompasses the recognition that chemical modifications, stereochemistry, and combinations thereof can be used to improve the properties of oligonucleotide compositions, including, but not limited to, the ability to modulate splicing of transcripts. In some embodiments, the present disclosure provides chemical modifications and patterns thereof that are useful for improving transcription splicing by oligonucleotides.

[0006] In particular, the present disclosure shows that stereochemistry can be used to modulate splicing of transcripts with oligonucleotide compositions. In some embodiments, the present disclosure provides a combination of chemical modifications and stereochemistry that improves oligonucleotide properties, such as the ability to alter splicing of transcripts. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions that provide altered splicing that can result in one or more desired biological effects, such as increased production of a desired protein, knockdown of a gene by producing an mRNA with a frameshift mutation and / or a premature stop codon, knockdown of a gene expressing an mRNA with a frameshift mutation and / or a premature stop codon, etc., compared to a reference condition (e.g., absence of the composition, presence of a reference composition (e.g., a stereo-random composition of oligonucleotides with the same base sequence, the same chemical modification, etc., another stereoisomeric chirality-controlled oligonucleotide composition, etc.), and combinations thereof). In some embodiments, the chirality-controlled oligonucleotide compositions provided are surprisingly effective, compared to the reference condition. In some embodiments, the desired biological effect (e.g., as measured by an increase in the amount of desired mRNA, protein, etc., a decrease in the amount of undesirable mRNA, protein, etc.) is 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, or 100-fold.

[0007] The present disclosure recognizes the problem of providing oligonucleotide compositions and methods with reduced toxicity. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced toxicity. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced immune response. In some embodiments, the present disclosure recognizes that various toxicities induced by oligonucleotides are related to complement activation. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced complement activation. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced complement activation via alternative pathways. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced complement activation via traditional pathways. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced drug-induced vascular damage. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced injection site inflammation. In some embodiments, reduced toxicity can be assessed by one or more assays (e.g., assessing the amount of complete activation product, protein binding, etc., as described herein) that are well known and performed by those skilled in the art.

[0008] In some embodiments, the present disclosure provides oligonucleotides with enhanced antagonism of hTLR9 activity. In some embodiments, certain diseases (e.g., DMD) are associated with inflammation, for example in muscle tissue. In some embodiments, the provided technology (e.g., oligonucleotides, compositions, methods, etc.) provide both proteins with enhanced activity (e.g., by exon skipping of mutant exon 51 (or other exons depending on genotype) of DMD) and proteins with hTLR9 antagonist activity that may be beneficial for one or more conditions and / or diseases associated with inflammation. In some embodiments, the provided oligonucleotides and / or compositions thereof provide both exon skipping ability and hTLR9 antagonist activity. In some embodiments, oligonucleotides (e.g., lipid-conjugated oligonucleotides) comprising one or more lipid moieties provide unexpectedly high exon skipping efficiency and hTLR9 antagonist activity. In some embodiments, chirality-controlled oligonucleotide compositions comprising a predetermined amount of oligonucleotides (e.g., lipid-conjugated oligonucleotides) comprising one or more lipid moieties provide unexpectedly high exon skipping efficiency and hTLR9 antagonist activity.

[0009] In some embodiments, the present disclosure shows that oligonucleotide properties, such as activity, toxicity, etc., can be adjusted by chemical modification. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties, one or more natural phosphate bridges, or a combination thereof. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified internucleotide bridges, one or more modified sugar moieties, one or more natural phosphate bridges, or a combination thereof. For example, in some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties, and one or more natural phosphate bridges. In some embodiments, the disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties and one or more modified internucleotide bridges. In some embodiments, the disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties, one or more natural phosphate bridges and one or more modified internucleotide bridges. In some embodiments, the oligonucleotide composition comprising the first plurality of oligonucleotides provided has a predetermined amount of oligonucleotides in the first plurality of oligonucleotides, and is chirality controlled in that the oligonucleotides in the first plurality share a common stereochemical configuration at one or more chiral internucleotide bridges.For example, in some embodiments, the first plurality of oligonucleotides share a common stereochemical configuration at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more chiral internucleotide bridges, each of which is independently Rp or Sp. In some embodiments, the first plurality of oligonucleotides share a common stereochemical configuration at each of the chiral internucleotide bridges. In some embodiments, chiral internucleotide bridges in which a given amount of oligonucleotides in a composition share a common stereochemical configuration (independently Rp or Sp) are referred to as chirality-controlled internucleotide bridges. In some embodiments, a given amount of oligonucleotides of a provided composition (e.g., the first plurality of oligonucleotides of a particular example composition) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more chirality-controlled internucleotide bridges. In some embodiments, at least 5 internucleotide bridges are chirality-controlled. In some embodiments, at least 10 internucleotide bridges are chirality-controlled. In some embodiments, at least 10 internucleotide bridges are chirality-controlled. In some embodiments, each internucleotide bridge is chirality-controlled. In some embodiments, the first plurality of oligonucleotides has a wing-core-wing structure. In some embodiments, each wing region independently comprises one or more modified phosphate bridges and no native phosphate bridges, and the core comprises one or more modified internucleotide bridges and one or more native phosphate bridges.In some embodiments, each wing region independently comprises one or more natural phosphate bridges and optionally one or more modified internucleotide bridges, and the core comprises one or more modified internucleotide bridges and optionally one or more natural phosphate bridges. In some embodiments, each wing region independently comprises one or more natural phosphate bridges and one or more modified internucleotide bridges, and the core comprises one or more modified internucleotide bridges and one or more natural phosphate bridges. In some embodiments, each wing region independently comprises one or more natural phosphate bridges and one or more modified internucleotide bridges, and the core comprises one or more modified internucleotide bridges and no natural phosphate bridges. In some embodiments, the wing comprises a modified sugar moiety. In some embodiments, the modified internucleotide bridge is a phosphorothioate. In some embodiments, the modified internucleotide bridge is a substituted phosphorothioate. In some embodiments, the modified internucleotide bridge has a structure of Formula I described in this disclosure. In some embodiments, the modified sugar moiety is 2'-modified. In some embodiments, the 2'-modification is 2'-R. 1 In some embodiments, the 2'-modification is 2'-OR 1 In some embodiments, the 2'-modification is 2'-F. As described in more detail, the provided oligonucleotides may contain more than one type of sugar modification. In some embodiments, the provided oligonucleotides contain 2'-F and 2'-OR. 1In some embodiments, the provided compositions comprise both 2'-F and 2'-OMe modifications. In some embodiments, the provided oligonucleotides comprise both 2'-F and 2'-OMe modifications and both phosphorothioate and natural phosphate bridges. In some embodiments, the chiral internucleotide bridges, e.g., phosphorothioate bridges, respectively, have controlled chirality. In some embodiments, such provided compositions have low toxicity. In some embodiments, the provided compositions have low complement activation.

[0010] In some embodiments, the disclosure provides oligonucleotide compositions with improved protein binding profiles, e.g., reduced detrimental protein binding and / or increased beneficial protein binding. In some embodiments, the disclosure provides methods for improved delivery of oligonucleotide compositions, including providing oligonucleotide compositions with improved protein binding profiles. In some embodiments, the disclosure shows that protein binding by oligonucleotide compositions can be tuned by chemical modification, stereochemistry, or a combination thereof. In some embodiments, protein binding by oligonucleotide compositions can be tuned by incorporation of modified internucleotide bridges. In some embodiments, increasing the proportion of modified internucleotide bridges increases binding of the oligonucleotide to a particular protein. In some embodiments, replacing one or more modified internucleotide bridges with natural phosphate bridges decreases binding to a particular protein. In some embodiments, replacing one or more natural phosphate bridges with modified internucleotide bridges increases binding to a particular protein. In some embodiments, certain chemical modifications increase protein binding to a particular protein. In some embodiments, certain chemical modifications decrease protein binding to a particular protein. In some embodiments, different chemical modifications of the same type confer different protein binding. For example, in some embodiments, 2'-MOE reduces protein binding (eg, at least in a particular context, such as sequence, stereochemistry, etc.) compared to 2'-OMe.

[0011] In particular, the present disclosure embraces the recognition that a stereo-randomized oligonucleotide preparation comprises multiple distinct chemical moieties that differ from each other, for example, from each other in the stereochemical configuration of the individual backbone chiral centers in the oligonucleotide chain. Without controlling the stereochemistry of the backbone chiral centers, a stereo-randomized oligonucleotide preparation results in an uncontrolled composition that comprises an undetermined amount of oligonucleotide stereoisomers. These stereoisomers may have the same base sequence and / or chemical modifications, and these stereoisomers are at least different chemical moieties due to their different backbone stereochemistry and may have different properties (e.g., activity, toxicity, distribution, etc.) as shown herein. Among other things, the present disclosure provides chirality-controlled compositions that are or comprise a specific stereoisomer of an oligonucleotide of interest. In contrast to compositions that are not chirality-controlled, chirality-controlled compositions comprise a specific stereoisomer of an oligonucleotide in a predetermined amount. In some embodiments, a specific stereoisomer may be defined, for example, by its base sequence, its length, its backbone crosslinking pattern and its backbone chiral center pattern. As understood in the art, in some embodiments, a base sequence may refer to the identity and / or modification state of the nucleoside residues in an oligonucleotide (e.g., the identity and / or modification state of the sugar and / or base elements relative to the standard naturally occurring nucleotides, e.g., adenine, cytosine, guanosine, thymine and uracil) and / or the hybridization characteristics of such residues (i.e., the ability to hybridize to a specific complementary residue).In some embodiments, the present disclosure shows that the improved properties (e.g., improved activity, low toxicity, etc.) achieved by the inclusion and / or placement of specific chiral structures in oligonucleotides can be comparable to or better than those achieved by using chemical modifications, such as specific backbone crosslinks, residue modifications, etc. (e.g., by using specific types of modified phosphates [e.g., phosphorothioates, substituted phosphorothioates, etc.], sugar modifications [e.g., 2'-modifications, etc.], and / or base modifications [e.g., methylation, etc.]). In some embodiments, the present disclosure shows that chirality-controlled oligonucleotide compositions of oligonucleotides containing certain chemical modifications (e.g., 2'-F, 2'-OMe, phosphorothioate internucleotide crosslinks, lipid conjugation, etc.) exhibit unexpectedly high exon skipping efficiency.

[0012] In particular, the present disclosure shows that stereochemistry can be used to tailor the toxicity of oligonucleotide compositions. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions that have lower toxicity when compared to corresponding stereo-random (or non-chirality-controlled) oligonucleotide compositions of oligonucleotides with the same base sequence and chemical modification. In some embodiments, the more Rp chiral internucleotide bridges the oligonucleotide chirality-controlled oligonucleotide compositions have lower toxicity. In some embodiments, the one Rp chiral internucleotide bridge oligonucleotide composition has higher toxicity compared to other chirality-controlled oligonucleotide compositions and / or corresponding stereo-random oligonucleotide compositions of oligonucleotides with the same base sequence and chemical modification. In some embodiments, the one Rp chiral internucleotide bridge is in the middle of the sequence. In some embodiments, the one Rp chiral internucleotide bridge oligonucleotide composition has lower toxicity when compared to corresponding stereo-random oligonucleotide compositions of oligonucleotides with the same base sequence and chemical modification. In some embodiments, the chirality controlled oligonucleotide composition of the oligonucleotide containing one or more natural phosphate bridges at the 5'-end and / or 3'-end has low toxicity. In some embodiments, the chiral internucleotide bridge has the structure of formula I. In some embodiments, the chiral internucleotide bridge is a phosphorothioate bridge. In some embodiments, the chiral internucleotide bridge is a substituted phosphorothioate bridge.

[0013] In particular, the present disclosure recognizes that in some embodiments, the properties of an oligonucleotide (e.g., activity, toxicity, distribution, pharmacokinetics, etc.) can be adjusted by optimizing the pattern of chiral centers of the backbone, optionally in combination with the adjustment / optimization of one or more other features of the oligonucleotide (e.g., chemical modification, modification pattern, e.g., cross-linking pattern, nucleoside modification pattern, conjugation to lipids or other moieties, etc.). In some embodiments, the present disclosure recognizes that in some embodiments, the properties of an oligonucleotide (e.g., activity, toxicity, etc.) can be adjusted by optimizing the pattern of chiral centers of the backbone, optionally in combination with the adjustment / optimization of one or more other features of the oligonucleotide (e.g., chemical modification, modification pattern, e.g., cross-linking pattern, nucleoside modification pattern, etc.). In some embodiments, the present disclosure recognizes and shows that chemical modifications, e.g., modifications of nucleosides and internucleotide cross-links, can provide enhanced properties. In some embodiments, the present disclosure shows that the combination of chemical modifications and stereochemistry can provide unexpected and greatly improved properties (e.g., activity, toxicity, distribution, pharmacokinetics, etc.). In some embodiments, the present disclosure demonstrates that a combination of chemical modifications and stereochemistry can provide unexpected and vastly improved properties (e.g., activity, toxicity, distribution, pharmacokinetics, etc.). In some embodiments, chemical combinations (e.g., sugar, base and / or internucleotide bridge modifications) are combined with stereochemical patterns to provide oligonucleotides and compositions thereof with surprising enhanced properties including lower toxicity, better protein binding profiles, etc. In some embodiments, provided oligonucleotide compositions comprising a first plurality of oligonucleotides have controlled chirality, where the first plurality of oligonucleotides comprises a combination of one or more 2'-modifications of a sugar moiety, one or more natural phosphate bridges, and one or more chiral internucleotide bridges.In some embodiments, the provided oligonucleotide compositions comprising a first plurality of oligonucleotides are chirality controlled, the first plurality of oligonucleotides comprising a combination of one or more 2'-modifications of the sugar moiety, one or more natural phosphate bridges, and one or more chiral internucleotide bridges, and the 5'- and / or 3'-terminal internucleotide bridges are chiral. In some embodiments, the 5'- and 3'-terminal internucleotide bridges are both chiral. In some embodiments, the 5'- and 3'-terminal internucleotide bridges are both chiral and Sp. In some embodiments, the provided oligonucleotide compositions comprising a first plurality of oligonucleotides are chirality controlled, the first plurality of oligonucleotides comprising a combination of one or more 2'-modifications of the sugar moiety, one or more natural phosphate bridges, one or more chiral internucleotide bridges, and a stereochemical pattern of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, where m>2. In some embodiments, the chiral internucleotide bridge has the structure of Formula I. In some embodiments, the chiral internucleotide bridge is a phosphorothioate bridge. In some embodiments, the chiral internucleotide bridge is a substituted phosphorothioate bridge.

[0014] In some embodiments, the oligonucleotides provided comprise wing and core regions. In some embodiments, the oligonucleotides provided have a wing-core-wing structure, where the core region comprises one or more sugar moieties and / or internucleotide bridges that are not in the wing region. In some embodiments, the oligonucleotides provided have a wing-core-wing structure, where the core region comprises one or more sugar moieties and internucleotide bridges that are not in the wing region. In some embodiments, the oligonucleotides provided have a wing-core-wing structure, where the core region comprises one or more sugar moieties that are not in the wing region. In some embodiments, the oligonucleotides provided have a wing-core-wing structure, where the core region comprises one or more internucleotide bridges that are not in the wing region. In some embodiments, the core region comprises modified sugar moieties. In some embodiments, each sugar moiety of the core region is modified. Examples of sugar modifications are well known in the art and include, but are not limited to, those described in this disclosure. In some embodiments, the core comprises at least one internucleotide bridge that is chirality controlled (e.g., phosphorothioate in the Sp or Rp configuration) and at least one internucleotide bridge that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, the core comprises at least one internucleotide bridge that is a chirality controlled phosphorothioate in the Sp configuration and at least one internucleotide bridge that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, each wing region does not comprise a modified sugar moiety. In some embodiments, the core region comprises one or more natural phosphate bridges. In some embodiments, each internucleotide bridge after the core nucleoside is a natural phosphate bridge.In some embodiments, the wings include at least one internucleotide bridge with controlled chirality (e.g., phosphorothioate in the Sp or Rp configuration) and at least one internucleotide bridge that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wings include at least one internucleotide bridge that is a chirality-controlled phosphorothioate in the Sp configuration and at least one internucleotide bridge that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wings include one or more modified internucleotide bridges. In some embodiments, each internucleotide bridge after the core nucleoside is a modified internucleotide bridge. See, e.g., WV-1111. In some embodiments, the oligonucleotide includes at least one internucleotide bridge with controlled chirality (e.g., phosphorothioate in the Sp or Rp configuration) and at least one internucleotide bridge that is not chiral at the phosphorus of the bridge (e.g., phosphodiester or phosphorodithioate). In some embodiments, the oligonucleotide comprises at least one internucleotide bridge that is a phosphorothioate with controlled chirality in the Sp configuration and at least one internucleotide bridge that is not chiral at the phosphorus of the bridge (e.g., phosphodiester or phosphorodithioate).

[0015] In some embodiments, the oligonucleotides provided are blockmirs. In some embodiments, the oligonucleotides provided are altmers. In some embodiments, the oligonucleotides provided are altmers that include alternating blocks. In some embodiments, blockmirs or altmers can be defined by chemical modifications (which may or may not be present), such as base modifications, sugar modifications, internucleotide bridge modifications, stereochemistry, and the like.

[0016] In some embodiments, the oligonucleotides provided include blocks that include different internucleotide bridges. In some embodiments, the oligonucleotides provided include blocks that include modified internucleotide bridges and natural phosphate bridges. In some embodiments, the oligonucleotides provided include blocks that include different modified internucleotide bridges. In some embodiments, the oligonucleotides provided include alternating blocks that include different internucleotide bridges. In some embodiments, the oligonucleotides provided include alternating blocks that include modified internucleotide bridges and natural phosphate bridges. In some embodiments, the oligonucleotides provided include alternating blocks that include different modified internucleotide bridges. In some embodiments, the blocks that include modified internucleotide bridges have a pattern of backbone chiral centers as described herein. In some embodiments, each block that includes modified internucleotide bridges has the same pattern of backbone chiral centers. In some embodiments, the blocks that include modified internucleotide bridges have different patterns of backbone chiral centers. In some embodiments, the blocks that include modified internucleotide bridges have different lengths and / or modifications. In some embodiments, the blocks that include modified internucleotide bridges have the same length and / or modifications. In some embodiments, the blocks that include modified internucleotide bridges have the same length. In some embodiments, the blocks that contain modified internucleotide bridges have the same internucleotide bridges. In some embodiments, the provided oligonucleotides contain a first block (5'-block) at the 5'-end and a second block (3'-block) at the 3'-end, each independently containing one or more modified internucleotide bridges. In some embodiments, the 5'-block and the 3'-block each independently contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more modified internucleotide bridges. In some embodiments, the 5'-block comprises 4 or more modified internucleotide bridges. In some embodiments, the 5'-block comprises 5 or more modified internucleotide bridges. In some embodiments, the 5'-block comprises 6 or more modified internucleotide bridges. In some embodiments, the 5'-block comprises 7 or more modified internucleotide bridges. In some embodiments, the 3'-block comprises 4 or more modified internucleotide bridges. In some embodiments, the 3'-block comprises 5 or more modified internucleotide bridges. In some embodiments, the 3'-block comprises 6 or more modified internucleotide bridges. In some embodiments, the 3'-block comprises 7 or more modified internucleotide bridges. In some embodiments, the 5'-block and the 3'-block each independently comprise at least 4 modified internucleotide bridges. In some embodiments, the 5'-block and the 3'-block each independently comprise at least 5 modified internucleotide bridges. In some embodiments, the 5'-block and the 3'-block each independently comprise at least 6 modified internucleotide bridges. In some embodiments, the 5'-block and the 3'-block each independently comprise at least 7 modified internucleotide bridges. In some embodiments, the modified internucleotide bridges within a block are contiguous. In some embodiments, each bridge of the 5'-block is independently a modified internucleotide bridge. In some embodiments, each bridge of the 5'-block is independently a phosphorothioate bridge. In some embodiments, each bridge of the 5'-block is independently chirality controlled. In some embodiments, each bridge of the 5'-block is independently Sp. In some embodiments, each bridge of the 3'-block is independently a modified internucleotide bridge. In some embodiments, each bridge of the 3'-block is independently a phosphorothioate bridge.In some embodiments, each bridge of the 3'-block is independently chirality controlled. In some embodiments, each bridge of the 3'-block is Sp.

[0017] In some embodiments, the oligonucleotides provided include a block that includes a sugar modification. In some embodiments, the oligonucleotides provided include one or more blocks that include one or more 2'-F modifications (2'-F blocks). In some embodiments, the oligonucleotides provided include a block that includes consecutive 2'-F modifications. In some embodiments, the block includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive 2'-F modifications. In some embodiments, the block includes 4 or more 2'-F modifications. In some embodiments, the block includes 5 or more 2'-F modifications. In some embodiments, the block includes 6 or more 2'-F modifications. In some embodiments, the block includes 7 or more 2'-F modifications. In some embodiments, the oligonucleotides provided include one or more 2'-OR modifications. 1 One or more blocks containing modifications (2'-OR 1 In some embodiments, the oligonucleotides provided include a 2'-F block and a 2'-OR block. 1 In some embodiments, the oligonucleotides provided contain both alternating 2'-F and 2'-OR blocks. 1In some embodiments, provided oligonucleotides include a first 2'-F block at the 5'-terminus and a second 2'-F block at the 3'-terminus, each independently comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive 2'-F modifications. In some embodiments, each independently comprises 4 or more 2'-F modifications. In some embodiments, each independently comprises 5 or more 2'-F modifications. In some embodiments, each independently comprises 6 or more 2'-F modifications. In some embodiments, each independently comprises 7 or more 2'-F modifications. In some embodiments, provided oligonucleotides include a 5'-block, where each sugar moiety of the 5'-block comprises a 2'-F modification. In some embodiments, provided oligonucleotides include a 3'-block, where each sugar moiety of the 3'-block comprises a 2'-F modification. In some embodiments, the oligonucleotide so provided has one or more 2'-OR's between the 5' and 3' 2'-F blocks. 1 In some embodiments, the oligonucleotide so provided contains one or more 2'-OR blocks between the 5' and 3' 2'-F blocks, and optionally contains one or more 2'-F blocks. 1 block and one or more 2'-F blocks (e.g., WV-3407, WV-3408, etc.).

[0018] In some embodiments, the block is a stereochemical block. In some embodiments, the block is an Rp block, such that each internucleotide bridge of the block is an Rp. In some embodiments, the 5'-block is an Rp block. In some embodiments, the 3'-block is an Rp block. In some embodiments, the block is an Sp block, such that each internucleotide bridge of the block is an Sp. In some embodiments, the 5'-block is an Sp block. In some embodiments, the 3'-block is an Sp block. In some embodiments, the oligonucleotide provided comprises both an Rp block and an Sp block. In some embodiments, the oligonucleotide provided comprises one or more Rp but does not comprise an Sp block. In some embodiments, the oligonucleotide provided comprises one or more Sp but does not comprise an Rp block. In some embodiments, the oligonucleotide provided comprises one or more PO blocks, such that each internucleotide bridge is a natural phosphate bridge.

[0019] In some embodiments, the 5'-block is an Sp block and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block is an Sp block, where each internucleotide bridge is a modified internucleotide bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block is an Sp block, where each internucleotide bridge is a phosphorothioate bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block comprises 4 or more nucleoside units. In some embodiments, the 5'-block comprises 5 or more nucleoside units. In some embodiments, the 5'-block comprises 6 or more nucleoside units. In some embodiments, the 5'-block comprises 7 or more nucleoside units. In some embodiments, the 3'-block is an Sp block and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block is an Sp block, where each internucleotide bridge is a modified internucleotide bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block is an Sp block, where each internucleotide bridge is a phosphorothioate bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block comprises 4 or more nucleoside units. In some embodiments, the 3'-block comprises 5 or more nucleoside units. In some embodiments, the 3'-block comprises 6 or more nucleoside units. In some embodiments, the 3'-block comprises 7 or more nucleoside units.

[0020] In some embodiments, certain nucleosides in a region or oligonucleotide are followed by a particular type of internucleotide bridge, e.g., a natural phosphate bridge, a modified internucleotide bridge, an Rp chiral internucleotide bridge, an Sp chiral internucleotide bridge, etc. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by a natural phosphate bridge (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by a natural phosphate bridge (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by a natural phosphate bridge (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by a natural phosphate bridge (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by a natural phosphate bridge (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp. In some embodiments, A and G are followed by a natural phosphate bridge (PO). See, e.g., WV-1111, WV-1112, WV-XXX1, etc.

[0021] In some embodiments, provided oligonucleotides comprise alternating blocks comprising modified and unmodified sugar moieties. In some embodiments, the modified sugar moieties comprise 2'-modifications. In some embodiments, provided oligonucleotides comprise alternating 2'-OMe modified and unmodified sugar moieties. See, e.g., WV-1112, WV-1113, etc.

[0022] In some embodiments, oligonucleotides provided include alternating blocks that include different modified and / or unmodified sugar moieties. In some embodiments, oligonucleotides provided include alternating blocks that include different modified and unmodified sugar moieties. In some embodiments, oligonucleotides provided include alternating blocks that include different modified sugar moieties. In some embodiments, oligonucleotides provided include alternating blocks that include different modified sugar moieties, where the modified sugar moieties include different 2'-modifications. For example, in some embodiments, oligonucleotides provided include alternating blocks that include 2'-OMe and 2'-F, respectively. See, e.g., WV-1712, WV1713, WV-1714, etc.

[0023] In some embodiments, certain nucleosides in a region or oligonucleotide may be modified with different modifications, as compared to other types of nucleosides. In some embodiments, certain nucleosides in a region or oligonucleotide are modified with different modifications as compared to other types of nucleosides. For example, in some embodiments, pyrimidine nucleosides include 2'-F modifications and purine nucleosides include 2'-OMe modifications. In some other embodiments, pyrimidine nucleosides include 2'-OMe modifications and purine nucleosides include 2'-F modifications. In some embodiments, G and C have one type of sugar modification and A and U have another type of sugar modification. In some embodiments, G and C include 2'-OMe modifications and A and U include 2'-F modifications. In some embodiments, G and C include 2'-F modifications and A and U include 2'-OMe modifications.

[0024] In some embodiments, the internucleotide bridge after the unmodified sugar moiety is a modified internucleotide bridge. In some embodiments, the internucleotide bridge after the unmodified sugar moiety is a phosphorothioate bridge. In some embodiments, each internucleotide bridge after the unmodified sugar moiety is a modified internucleotide bridge. In some embodiments, each internucleotide bridge after the unmodified sugar moiety is a phosphorothioate bridge. In some embodiments, the internucleotide bridge after the modified sugar moiety is a natural phosphate bridge. In some embodiments, each internucleotide bridge after the modified sugar moiety is a natural phosphate bridge. See, e.g., WV-1111, WV1112, etc.

[0025] In some embodiments, provided oligonucleotides include one or more 2'-F modified sugar moieties where the 3'-internucleotide bridge is a modified internucleotide bridge. In some embodiments, the modified internucleotide bridge is phosphorothioate. In some embodiments, the modified internucleotide bridge is chirality controlled and is Rp. In some embodiments, the modified internucleotide bridge is chirality controlled and is Sp. In some embodiments, provided oligonucleotides include one or more 2'-OR modified sugar moieties where the 3'-internucleotide bridge is a modified natural phosphate bridge. 1 Contains a modified sugar moiety.

[0026] In some embodiments, the pattern of chiral centers of the provided scaffolds comprises repeating (Sp)m(Rp)n units, (Rp)n(Sp)m units, (Np)t(Rp)n(Sp)m units or (Sp)t(Rp)n(Sp)m units. In some embodiments, the repeating unit is (Sp)m(Rp)n. In some embodiments, the repeating unit is SpRp. In some embodiments, the repeating unit is SpSpRp. In some embodiments, the repeating unit is SpRpRp. In some embodiments, the repeating unit is RpRpSp. In some embodiments, the repeating unit is (Rp)n(Sp)m. In some embodiments, the repeating unit is (Np)t(Rp)n(Sp)m. In some embodiments, the repeating unit is (Sp)t(Rp)n(Sp)m.

[0027] In some embodiments, a pattern of backbone chiral centers is provided that includes (Rp / Sp)-(all Rp or all Sp)-(Rp / Sp). In some embodiments, a pattern of backbone chiral centers is provided that includes (Rp)-(all Sp)-(Rp). In some embodiments, a pattern of backbone chiral centers is provided that includes (Sp)-(all Sp)-(Sp). In some embodiments, a pattern of backbone chiral centers is provided that includes (Sp)-(all Rp)-(Sp). In some embodiments, a pattern of backbone chiral centers is provided that includes (Rp / Sp)-(repeat (Sp)m(Rp)n)-(Rp / Sp). In some embodiments, a pattern of backbone chiral centers is provided that includes (Rp / Sp)-(repeat SpSpRp)-(Rp / Sp).

[0028] In some embodiments, a pattern of backbone chiral centers is provided that is (Rp / Sp)-(all Rp or all Sp)-(Rp / Sp). In some embodiments, a pattern of backbone chiral centers is provided that is (Sp)-(all Sp)-(Sp). In some embodiments, each chiral internucleotide bridge is Sp. In some embodiments, a pattern of backbone chiral centers is provided that is (Rp)-(all Sp)-(Rp). In some embodiments, a pattern of backbone chiral centers is provided that is (Sp)-(all Rp)-(Sp). In some embodiments, a pattern of backbone chiral centers is provided that is (Rp / Sp)-(repeat(Sp)m(Rp)n)-(Rp / Sp). In some embodiments, a pattern of backbone chiral centers is provided that is (Rp / Sp)-(repeatSpSpRp)-(Rp / Sp).

[0029] In some embodiments, the present disclosure provides oligonucleotide compositions with reduced toxicity. In some embodiments, the present disclosure provides oligonucleotide compositions with improved protein binding profiles. In some embodiments, the present disclosure provides oligonucleotide compositions with improved binding to albumin. In some embodiments, the compositions provided are reduced toxicity and have improved binding to specific desired proteins. In some embodiments, the compositions provided are reduced toxicity and have improved binding to specific desired proteins. In some embodiments, the oligonucleotide compositions provided provide the same amount or significantly improved stability and / or activity, such as better target cleavage patterns, better target efficiency, better target specificity, etc.

[0030] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, (1) have a common base sequence that is complementary to a target sequence in the transcript; (2) An oligonucleotide composition is provided that comprises one or more modified sugar moieties and modified internucleotide bridges.

[0031] In some embodiments, the provided oligonucleotide compositions are characterized in that, upon contact with a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0032] In some embodiments, the reference condition is the absence of the composition. In some embodiments, the reference condition is the presence of the reference composition. Exemplary reference compositions comprising a plurality of reference oligonucleotides are broadly described in this disclosure. In some embodiments, the plurality of reference oligonucleotides have different structural elements (chemical modifications, stereochemistry, etc.) compared to the first plurality of oligonucleotides in the provided composition. In some embodiments, the reference composition is a stereo-random preparation of oligonucleotides having the same chemical modifications. In some embodiments, the reference composition is a mixture of stereoisomers, while the provided composition is a chirality-controlled oligonucleotide composition of one stereoisomer. In some embodiments, the plurality of reference oligonucleotides have the same base sequence as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same chemical modifications as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same sugar modifications as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same base modifications as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same internucleotide bridge modifications as the first plurality of oligonucleotides in the provided composition. In some embodiments, the reference oligonucleotides have the same stereochemistry as a first plurality of oligonucleotides in a provided composition, but have different chemical modifications, such as base modifications, sugar modifications, internucleotide bridge modifications, etc.

[0033] Examples of splicing systems are widely known in the art. In some embodiments, the splicing system is an in vivo or in vitro system that includes sufficient components to achieve splicing of the relevant target transcript. In some embodiments, the splicing system is or includes a spliceosome (e.g., its protein and / or RNA components). In some embodiments, the splicing system is or includes an organelle membrane (e.g., nuclear membrane) and / or an organelle (e.g., nucleus). In some embodiments, the splicing system is or includes a cell or a collection thereof. In some embodiments, the splicing system is or includes a tissue. In some embodiments, the splicing system is or includes an organism, e.g., an animal, e.g., a mammal, such as a mouse, rat, monkey, human, etc.

[0034] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, (1) have a common base sequence that is complementary to a target sequence in the transcript; (2) comprises one or more modified sugar moieties and modified internucleotide bridges; Provided is an oligonucleotide composition, characterized in that when the oligonucleotide composition contacts a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0035] In some embodiments, the present disclosure provides: (1) Nucleotide sequence; (2) skeletal cross-linking pattern; (3) the pattern of chiral centers in the framework; and (4) An oligonucleotide composition is provided that includes a first plurality of oligonucleotides of a particular oligonucleotide class defined by a pattern of backbone phosphorus modifications.

[0036] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: (1) Nucleotide sequence; (2) skeletal cross-linking pattern; (3) the pattern of chiral centers in the framework; and (4) Pattern of backbone phosphorus modification a first plurality of oligonucleotides of a particular oligonucleotide type defined by the composition has controlled chirality in that it is enriched for a particular oligonucleotide class as compared to a substantially racemic preparation of the oligonucleotide having the same base sequence; Provided is an oligonucleotide composition, characterized in that when the oligonucleotide composition contacts a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0037] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising one or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently comprises one or more modified internucleotide bridges and optionally one or more natural phosphate bridges, and the core region independently comprises one or more modified internucleotide bridges; or Oligonucleotide compositions are provided in which each wing region independently comprises one or more modified sugar moieties and the core region comprises one or more unmodified sugar moieties.

[0038] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising one or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently has a length of 2 or more bases and independently contains one or more modified internucleotide bridges and optionally one or more naturally occurring phosphate bridges; and Oligonucleotide compositions are provided in which the core regions independently have a length of two or more bases and independently contain one or more modified internucleotide bridges.

[0039] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising one or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently has a length of 2 or more bases and independently contains one or more modified internucleotide bridges and one or more naturally occurring phosphate bridges; and Oligonucleotide compositions are provided in which the core regions independently have a length of two or more bases and independently contain one or more modified internucleotide bridges.

[0040] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising two or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently has a length of 2 or more bases and independently contains one or more modified internucleotide bridges and one or more naturally occurring phosphate bridges; and Oligonucleotide compositions are provided in which the core regions independently have a length of two or more bases and independently contain one or more modified internucleotide bridges.

[0041] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising two wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently has a length of 2 or more bases and independently contains one or more modified internucleotide bridges and one or more naturally occurring phosphate bridges; the wing region to the 5'-end of the core region comprises at least one modified internucleotide bridge followed by a natural phosphate bridge in the wing; and the wing region to the 3'-end of the core region comprises at least one modified internucleotide bridge followed by a natural phosphate bridge in the wing; Oligonucleotide compositions are provided in which the core regions independently have a length of two or more bases and independently contain one or more modified internucleotide bridges.

[0042] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising a wing region and a core region; the first plurality of oligonucleotides have the same base sequence; the wing region is at least two bases in length and contains one or more modified internucleotide bridges and one or more naturally occurring phosphate bridges; the wing region is to the 5'-end of the core region and includes a natural phosphate bridge between the two nucleosides at its 3'-end, or the wing region is to the 3'-end of the core region and includes a natural phosphate bridge between the two nucleosides at its 5'-end; and Oligonucleotide compositions are provided in which the core regions independently have a length of two or more bases and independently contain one or more modified internucleotide bridges.

[0043] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising two wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently has a length of 2 or more bases and independently contains one or more modified internucleotide bridges and one or more naturally occurring phosphate bridges; the wing region to the 5'-end of the core region comprises a natural phosphate bridge between two nucleosides at its 3'-end; the wing region to the 3'-end of the core region comprises a natural phosphate bridge between two nucleosides at its 5'-end; and Oligonucleotide compositions are provided in which the core regions independently have a length of two or more bases and independently contain one or more modified internucleotide bridges.

[0044] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising one or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; Each wing region independently comprises one or more modified internucleotide bridges and optionally one or more natural phosphate bridges, and the core region independently comprises one or more modified internucleotide bridges; and Oligonucleotide compositions are provided in which each wing region independently comprises one or more modified sugar moieties and the core region comprises one or more unmodified sugar moieties.

[0045] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising one or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently comprises one or more modified internucleotide bridges and one or more naturally occurring phosphate bridges, and the core region independently comprises one or more modified internucleotide bridges; and Oligonucleotide compositions are provided in which each wing region independently comprises one or more modified sugar moieties and the core region comprises one or more unmodified sugar moieties.

[0046] In some embodiments, the disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides comprising: (1) have a common nucleotide sequence; (2) includes one or more wing regions and one core region; each wing region comprises at least one modified sugar moiety; and Oligonucleotide compositions are provided in which each core region contains at least one unmodified sugar moiety.

[0047] In some embodiments, the present disclosure provides: 1) consensus sequence and length; 2) a common pattern of skeletal bonds; and 3) Common patterns of skeletal chiral centers and wherein a given level of the oligonucleotides in the composition is a substantially pure preparation of a single oligonucleotide having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.

[0048] In some embodiments, the present disclosure provides: 1) consensus sequence and length; 2) a common pattern of skeletal bonds; and 3) common patterns of backbone chiral centers; wherein the composition is chirally controlled in that it is enriched for oligonucleotides of a particular oligonucleotide type relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length.

[0049] In some embodiments, the present disclosure provides: 1) consensus sequence and length; 2) a common pattern of skeletal bonds; and 3) Common patterns of skeletal chiral centers The present invention provides a chiral controlled oligonucleotide composition comprising oligonucleotides of a particular oligonucleotide type, characterized by:

[0050] Among other things, the present disclosure recognizes that combinations of oligonucleotide building blocks (e.g., patterns of chemical modifications, backbone linkages, backbone chiral centers, and / or backbone phosphorus modifications) can confer properties such as surprisingly improved biological activity. In some embodiments, the present disclosure provides oligonucleotide compositions comprising predetermined levels of oligonucleotides comprising one or more wing regions and a common core region, wherein: each wing region independently has a length of two or more bases, and independently and optionally contains one or more chiral internucleotide linkages; The core regions independently have a length of two or more bases, and independently contain one or more chiral internucleotide linkages, and the common core region comprises: 1) consensus sequence and length; 2) a common pattern of skeletal bonds; and 3) Common patterns of skeletal chiral centers has.

[0051] In some embodiments, the present disclosure provides an oligonucleotide composition comprising: a first plurality of oligonucleotides comprising two or more wing regions and a core region; the first plurality of oligonucleotides have the same base sequence; each wing region independently has a length of two or more bases and independently comprises one or more modified internucleotide bridges and one or more modified sugar moieties; and Oligonucleotide compositions are provided in which the core region independently has a length of two or more bases and independently contains one or more naturally occurring phosphate bridges.

[0052] In some embodiments, each wing region of a provided oligonucleotide independently comprises 3, 4, 5, 6, 7, 8, 9, 10, or more bases. In some embodiments, each wing region independently comprises 3 or more bases. In some embodiments, each wing region independently comprises 4 or more bases. In some embodiments, each wing region independently comprises 5 or more bases. In some embodiments, each wing region independently comprises 6 or more bases. In some embodiments, each wing region independently comprises 7 or more bases. In some embodiments, each sugar moiety of the wing is modified. In some embodiments, one modification is a 2'-modification. In some embodiments, one modification is a 2'-F. In some embodiments, one modification is a 2'-F. In some embodiments, one modification is a 2'-OR. 1 In some embodiments, each modification is a 2'-OR 1 In some embodiments, one modification is 2'-OR 1In some embodiments, each modification is 2'-OMe. In some embodiments, each modification is 2'-OMe. In some embodiments, each modification is 2'-MOE. In some embodiments, each modification is 2'-MOE. In some embodiments, the modification is an LNA sugar modification. In some embodiments, each modification is an LNA sugar modification. In some embodiments, each internucleotide bridge in the wing is a chiral internucleotide bridge. In some embodiments, each internucleotide bridge in the wing is an Sp chiral internucleotide bridge. In some embodiments, the chiral internucleotide bridge is a phosphorothioate bridge. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more modified internucleotide bridges. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more chiral internucleotide bridges. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more Sp chiral internucleotide bridges. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more Sp phosphorothioate bridges.

[0053] In some embodiments, the amount of oligonucleotide in the provided composition, such as the amount of a plurality of oligonucleotides (e.g., a first plurality of oligonucleotides, a plurality of reference oligonucleotides, etc.), is predetermined. For example, as will be readily understood by those skilled in the art, a provided oligonucleotide composition in which the chirality of a plurality of oligonucleotides (e.g., a first plurality of oligonucleotides) is controlled comprises a predetermined amount of such a plurality of oligonucleotides.

[0054] In some embodiments, oligonucleotides are provided that have a base sequence of UCAAGGAAGAUGGCAUUUCU. In some embodiments, oligonucleotides are provided that have a base sequence that includes UCAAGGAAGAUGGCAUUUCU and have a length of up to 30 bases. In some embodiments, oligonucleotides are provided that have a base sequence that includes UCAAGGAAGAUGGCAUUUCU and have a length of up to 40 bases. In some embodiments, oligonucleotides are provided that have a base sequence that includes UCAAGGAAGAUGGCAUUUCU and have a length of up to 50 bases. In some embodiments, oligonucleotides are provided that have a base sequence that includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and have a length of up to 30 bases. In some embodiments, oligonucleotides are provided that have a base sequence that includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and have a length of up to 40 bases. In some embodiments, oligonucleotides are provided that have a base sequence that includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and have a length of up to 50 bases. In some embodiments, provided oligonucleotides have a base sequence that has no more than 5 mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU and are up to 30 bases in length. In some embodiments, provided oligonucleotides have a base sequence that has no more than 5 mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU and are up to 40 bases in length. In some embodiments, provided oligonucleotides have a base sequence that has no more than 5 mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU and are up to 50 bases in length.

[0055] In some embodiments, the common base sequence of the plurality of oligonucleotides is UCAAGGAAGAUGGCAUUUCU. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, and the oligonucleotide has a length of up to 30 bases. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, and the oligonucleotide has a length of up to 40 bases. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, and the oligonucleotide has a length of up to 50 bases.

[0056] In some embodiments, the common base sequence of the plurality of oligonucleotides is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises a sequence having 5 or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center.In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases in length, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases in length, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center.

[0057] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotides have lengths up to 30 bases long and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotides have lengths up to 40 bases long and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotides have lengths up to 50 bases long and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises at least 15 contiguous bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises at least 15 contiguous bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises at least 15 contiguous bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration.In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least one chirality-controlled center that is phosphorothioate in the Sp configuration.

[0058] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU and the common pattern of backbone chiral centers comprises at least three chirality-controlled centers. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotides have lengths up to 30 bases long and the common pattern of backbone chiral centers comprises at least three chirality-controlled centers. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotides have lengths up to 40 bases long and the common pattern of backbone chiral centers comprises at least three chirality-controlled centers. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotides have lengths up to 50 bases long and the common pattern of backbone chiral centers comprises at least three chirality-controlled centers. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least three centers of chirality controlled. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least three centers of chirality controlled. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least three centers of chirality controlled. In some embodiments, the common base sequence comprises a sequence having 5 or fewer mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least three centers of chirality controlled.In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases in length, and the common pattern of backbone chiral centers comprises at least three centers of chirality controlled. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases in length, and the common pattern of backbone chiral centers comprises at least three centers of chirality controlled.

[0059] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration.In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 30 bases long, and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 40 bases long, and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence comprises a sequence having no more than five mismatches from the base sequence UCAAGGAAGAUGGCAUUUCU, the oligonucleotides have lengths up to 50 bases long, and the common pattern of backbone chiral centers comprises at least five chirality-controlled centers, each of which is a phosphorothioate in the Sp configuration. In some embodiments, a mismatch is a difference in base sequence or length when two sequences are maximally aligned and compared. As a non-limiting example, a mismatch is counted if there is a difference between a base at a particular position in one sequence and a base at a corresponding position in another sequence. Thus, for example, a mismatch is counted if there is a particular base (e.g., A) at one position in one sequence and a different base (e.g., G, C, or U) at the corresponding position on the other sequence. A mismatch is also counted if there is a base (e.g., A) at one position in one sequence and no base at the corresponding position on the other sequence (e.g., if the position is an abasic nucleotide that contains a phosphate-sugar backbone but no base) or if the position is skipped. A single-stranded nick in either sequence (or in the sense or antisense strand) may not be counted as a mismatch. For example, if one sequence contains the sequence 5'-AG-3' but the other sequence contains the sequence 5'-AG-3' with a single-stranded nick between A and G, a mismatch would not be counted. Base modifications are generally not considered mismatches.For example, if one sequence contains a C and the other sequence contains a modified C (eg, with a 2'-modification) at the same position, the mismatch will not be counted.

[0060] In some embodiments, the common pattern of backbone chiral centers is SSS, SSSS, SSSSS, SSSSSS, SSSSSSS, SOS, SSOSS, SSSOSSS, SSSSOSSSS, SSSSSOSSSSS, SSSSSSO SSSSSS, SSSSSSSOSSSSSSSS, SSSSSSSSOSSSSSSSS, SSSSSSSSSOSSSSSSSS, SOSOSOSOS, SSOSOSOSOSS, SSSOSOSOSSS, SSSSOSOSO SSSS, SSSSSOSOSOSSSSSS, SSSSSSOSOSOSSSSSS, SOSOSSOOS, SSOSOSSOOSS, SSSOSSOOSSS, SSSSOSSOOSSSS, SSSSSOSSOOSSSSS, SSSSSSOSSOOSSSSSS, SOSOOSOOS, SSOSOOSOOSS, SSSOSOOSOOSSS, SSSSOSOOSOOSSSS, SSSSOSOOSOOSSSSS, SSSSSSOSOOSO and OSSSSOS, SOSOSSOOS, SSOSOSSOOSO, SSSOSOSSOOSOS, SSSSOSOSSOOSOSS, SSSSSOSOSSOOSOSSS, SSSSSSOSOSSOOSOSSSS, SOSOOSOOSO, SSOSOOSOOSOS, SSSOSOOSOOSOS, SSSSOSOOSOOSOSS, SSSSSOSOOSOOSOSSS, SSSSSSOSOOSOOSOSSSS, SSOSOSSOO, SSSOSOSSOOS, SSSSOSOSSOOS, SSSSSOSOSSOOSS, SSSSSSOSOSSOOSSS, OSSSSSSOSOSSOSSOOSSS, OOSSSSSSOSOSSOSSOOS, OOSSSSSSOSOSSOOSS, OOSSSSSSOSOSSOOSSSS, OOSSSSSSOSOSSOOSSSSS, or OOSSSSSSOSOSSOOSSSSSS, wherein O is a non-chiral center and S is a chiral center of the Sp configuration.In some embodiments, the common pattern of backbone chiral centers is SSS, SSSS, SSSSS, SSSSSS, SSSSSSS, SOS, SSOSS, SSSOSSS, SSSSOSSSS, SSSSSOSSSSS, SSSSSSO SSSSSS, SSSSSSSOSSSSSSSS, SSSSSSSSOSSSSSSSS, SSSSSSSSSOSSSSSSSS, SOSOSOSOS, SSOSOSOSOSS, SSSOSOSOSSS, SSSSOSOSO SSSS, SSSSSOSOSOSSSSS, SSSSSSOSOSOSSSSSS, SOSOSSOOS, SSOSOSSOOSS, SSSOSSOOSSS, SSSSOSSOOSSSS, SSSSSOSSOOSSSSS, SSSSSSOSSOOSSSSSS, SOSOOSOOS, SSOSOOSOOSS, SSSOSOOSOOSSS, SSSSOSOOSOOSSSS, SSSSOSOOSOOSSSSSS, SSSSSSOSOOSOO and OOSSSSSSOSOSSOSS, wherein O is a non-chiral center and S is a chiral center of the Sp configuration. In some embodiments, the non-chiral center is selected from SSSSSS, SOSOSSOOS, SSOSOSSOOSO, SSSOSOSSOOSOS, SSSSOSOSSOOSOSS, SSSSSOSOSSOOSOSSS, SSSSSSOSOSSOOSOSSSS, SOSOOSOOSO, SSOSOOSOOSOS, SSSOSOOSOOSOS, SSSSOSOOSOOSOSS, SSSSSOSOOSOOSOSSS, SSSSSSOSOOSOOSOSSSS, SSOSOSSOO, SSSOSOSSOOS, SSSSOSOSSOOS, SSSSSOSOSSOOSS, SSSSSSOSOSSOSSOOSSS, OSSSSSSOSOSSOSSOOSSS, OOSSSSSSOSOSSOSSOOSS, OOSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOSSSS, OOSSSSSSOSOSSOOSSSSS, and OOSSSSSSOSOSSOOSSSSSS, where O is a non-chiral center and S is a chiral center of the Sp configuration. In some embodiments, the non-chiral center is a phosphodiester (natural phosphate bridge). In some embodiments, the chiral center of the Sp configuration is an Sp phosphorothioate bridge.

[0061] In some embodiments, the common pattern of backbone bridges comprises at least 10 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 11 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 12 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 13 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 14 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 15 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 16 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 17 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 18 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises at least 19 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises 19 or fewer modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises 18 or fewer modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises 17 or fewer modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises 16 or fewer modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises 15 or fewer modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises 14 or fewer modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises between 14 and 18 modified internucleotide bridges. In some embodiments, the common pattern of backbone bridges comprises between 13 and 19 modified internucleotide bridges.In some embodiments, the common pattern of backbone crosslinks comprises 12-20 modified internucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 11-21 modified internucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 0 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 1 phosphodieters. In some embodiments, the common pattern of backbone crosslinks comprises 2 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 3 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 4 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 5 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 6 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 7 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 0-7 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 1-6 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 2-5 phosphodiesters. In some embodiments, the common pattern of backbone bridges includes 3-4 phosphodiesters. In some embodiments, the common pattern of backbone bridges includes 1-6 phosphodiesters and 13-19 modified internucleotide bridges. In some embodiments, the phosphodiesters may be optionally contiguous or non-contiguous. In some embodiments, the modified internucleotide bridges may be optionally contiguous or non-contiguous.

[0062] In some embodiments, the common pattern of backbone crosslinks comprises at least 10 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 11 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 12 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 13 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 14 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 15 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 16 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 17 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 18 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 19 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 19 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 18 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 17 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 16 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 15 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 14 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 14-18 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 13-19 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 12-20 phosphorothioate crosslinks.In some embodiments, the common pattern of backbone crosslinks comprises 11-21 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 0 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 1 phosphodieters. In some embodiments, the common pattern of backbone crosslinks comprises 2 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 3 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 4 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 5 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 6 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 7 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 0-7 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 1-6 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 2-5 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks comprises 3-4 phosphodiesters. In some embodiments, a common pattern of backbone bridges includes 1-6 phosphodiester and 13-19 phosphorothioate bridges. In some embodiments, the phosphodiesters may be optionally contiguous or non-contiguous. In some embodiments, the phosphorothioate bridges may be optionally contiguous or non-contiguous.

[0063] In some embodiments, the common pattern of backbone chiral centers comprises at least 5 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 6 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 7 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 8 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 9 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 10 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 11 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 12 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 13 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 14 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 15 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 16 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 17 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 18 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises at least 19 internucleotide bridges in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 8 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 7 or fewer internucleotide bridges in the Rp configuration.In some embodiments, the common pattern of backbone chiral centers comprises 6 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 5 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 4 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 3 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 2 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 1 or fewer internucleotide bridges in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers comprises 8 or fewer internucleotide bridges that are not chiral (phosphodiesters as a non-limiting example). In some embodiments, the common pattern of backbone chiral centers comprises 7 or fewer internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises 6 or fewer internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises 5 or fewer internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises 4 or less internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises 3 or less internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises 2 or less internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises 1 or less internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises at least 10 internucleotide bridges in the Sp configuration and 8 or less internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers comprises at least 11 internucleotide bridges in the Sp configuration and 7 or less internucleotide bridges that are not chiral.In some embodiments, the common pattern of backbone chiral centers includes at least 12 internucleotide bridges in the Sp configuration and no more than 6 internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers includes at least 13 internucleotide bridges in the Sp configuration and no more than 6 internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers includes at least 14 internucleotide bridges in the Sp configuration and no more than 5 internucleotide bridges that are not chiral. In some embodiments, the common pattern of backbone chiral centers includes at least 15 internucleotide bridges in the Sp configuration and no more than 4 internucleotide bridges that are not chiral. In some embodiments, the internucleotide bridges in the Sp configuration may be contiguous or non-contiguous. In some embodiments, the internucleotide bridges in the Rp configuration may be contiguous or non-contiguous. In some embodiments, the non-chiral internucleotide bridges may be contiguous or non-contiguous.

[0064] The wings and core can be defined by any structural element. In some embodiments, the wings and core are defined by nucleoside modifications, with the wings including nucleoside modifications that are not present in the core region. In some embodiments, the oligonucleotides in the provided compositions have a wing-core structure of nucleoside modifications. In some embodiments, the oligonucleotides in the provided compositions have a core-wing structure of nucleoside modifications. In some embodiments, the oligonucleotides in the provided compositions have a wing-core-wing structure of nucleoside modifications. In some embodiments, the wings and core are defined by modifications of the sugar moiety. In some embodiments, the wings and core are defined by modifications of the base moiety. In some embodiments, each sugar moiety in the wing region has the same 2'-modification that is not found in the core region. In some embodiments, each sugar moiety in the wing region has the same 2'-modification that is different from any sugar modification in the core region. In some embodiments, each sugar moiety in the wing region has the same 2'-modification, and the core region has no 2'-modification. In some embodiments, when more than one wing is present, each sugar moiety in a wing region has the same 2'-modification, but the common 2'-modification in a first wing region may be the same or different from the common 2'-modification in a second wing region. In some embodiments, the wings and core are defined by the pattern of internucleotide bridges in the backbone. In some embodiments, the wings contain certain internucleotide bridges and / or patterns of internucleotide bridges that are not found in the core. In some embodiments, the wing regions contain both modified internucleotide bridges and natural phosphate bridges. In some embodiments, the internucleotide bridge at the 5'-end of the wing relative to the 5'-end of the core region is a modified internucleotide bridge. In some embodiments, the internucleotide bridge at the 3'-end of the wing relative to the 3'-end of the core region is a modified internucleotide bridge.In some embodiments, the modified internucleotide bridge is a chiral internucleotide bridge.

[0065] In some embodiments, the wings include at least three 2'-F modifications. In some embodiments, the wings include at least four 2'-F modifications. In some embodiments, the wings include at least five 2'-F modifications. In some embodiments, the wings include at least six 2'-F modifications. In some embodiments, the wings include at least three consecutive 2'-F modifications. In some embodiments, the wings include at least four consecutive 2'-F modifications. In some embodiments, the wings include at least five consecutive 2'-F modifications. In some embodiments, the wings include at least six consecutive 2'-F modifications. In some embodiments, the internucleotide bridge of each nucleotide unit having one of the consecutive 2'-F modifications is a modified internucleotide bridge. In some embodiments, the internucleotide bridge of each nucleotide unit having one of the consecutive 2'-F modifications is independently an Sp chiral internucleotide bridge. In some embodiments, the internucleotide bridge of each nucleotide unit having one of the consecutive 2'-F modifications is an Sp phosphorothioate bridge. In some embodiments, the core comprises a 2'-F modification, a 2'-OR 1In some embodiments, the core comprises any two or more of a 2'-F modification, a 2'-OMe modification, or a 2'-OH. In some embodiments, the core comprises any two or more of a 2'-F modification, a 2'-OMe modification, or a 2'-OH. In some embodiments, the core comprises at least one 2'-OMe modification. In some embodiments, the core comprises at least two 2'-OMe modifications. In some embodiments, the core comprises at least three 2'-OMe modifications. In some embodiments, the core comprises at least two 2'-OMe modifications. In some embodiments, the core comprises at least four 2'-OMe modifications. In some embodiments, the core comprises at least one 2'-F modification. In some embodiments, the core comprises at least two 2'-F modifications. In some embodiments, the core comprises at least three 2'-F modifications. In some embodiments, the core comprises at least two 2'-F modifications. In some embodiments, the core comprises at least four 2'-F modifications. In some embodiments, the core comprises at least one 2'-F modification and at least one 2'-OMe modification. In some embodiments, the core comprises at least one 2'-F modification and at least two 2'-OMe modifications. In some embodiments, the core comprises at least two 2'-F modifications and at least one 2'-OMe modification. In some embodiments, the core comprises at least two 2'-F modifications and at least two 2'-OMe modifications. In some embodiments, the 2'-F modifications in the core and / or wings are contiguous or non-contiguous. In some embodiments, the 2'-OMe modifications in the core and / or wings are contiguous or non-contiguous. In some embodiments, the 2'-OH in the core and / or wings are contiguous or non-contiguous. In some embodiments, the core comprises one or more native phosphate bridges.

[0066] In some embodiments, each wing comprises at least one chiral internucleotide bridge and at least one natural phosphate bridge. In some embodiments, each wing comprises at least one modified sugar moiety. In some embodiments, the sugar moiety of each wing is modified. In some embodiments, the sugar moiety of the wing is modified with a modification that is not present in the core region. In some embodiments, the wing region has only modified internucleotide bridges at one or both of its termini. In some embodiments, the wing region has only modified internucleotide bridges at its 5'-terminus. In some embodiments, the wing region has only modified internucleotide bridges at its 3'-terminus. In some embodiments, the wing region has only modified internucleotide bridges at its 5'-terminus and 3'-terminus. In some embodiments, the wing is to the 5'-terminus of the core and the wing has only modified internucleotide bridges at its 5'-terminus. In some embodiments, the wing is to the 5'-terminus of the core and the wing has only modified internucleotide bridges at its 3'-terminus. In some embodiments, the wing is to the 5'-end of the core and the wing has only modified internucleotide bridges at both its 5'-end and 3'-end. In some embodiments, the wing is to the 3'-end of the core and the wing has only modified internucleotide bridges at its 5'-end. In some embodiments, the wing is to the 3'-end of the core and the wing has only modified internucleotide bridges at its 3'-end. In some embodiments, the wing is to the 3'-end of the core and the wing has only modified internucleotide bridges at both its 5'-end and 3'-end.

[0067] In some embodiments, each internucleotide bridge in the core region is modified. In some embodiments, each internucleotide bridge in the core region is chiral. In some embodiments, the core region comprises a pattern of backbone chiral centers of (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments, the pattern of backbone chiral centers in the core region is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m. In some embodiments, the core region comprises a pattern of backbone chiral centers of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, where m>2. In some embodiments, the pattern of chiral centers in the backbone of the core region is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m or (Sp)t(Rp)n(Sp)m, where m > 2. In particular, in some embodiments, such patterns can provide or enhance controlled cleavage of a target sequence (e.g., an RNA sequence).

[0068] In some embodiments, the wings include at least 4 phosphorothioates (phosphorothioate bridges). In some embodiments, the wings include at least 5 phosphorothioates. In some embodiments, the wings include at least 6 phosphorothioates. In some embodiments, the core includes at least 2 phosphorothioates. In some embodiments, the core includes at least 3 phosphorothioates. In some embodiments, the core includes at least 4 phosphorothioates. In some embodiments, the core includes at least 5 phosphorothioates. In some embodiments, the core includes at least 6 phosphorothioates. In some embodiments, the core includes at least 2 phosphodiesters (natural phosphate bridges). In some embodiments, the core includes at least 3 phosphodiesters. In some embodiments, the core includes at least 4 phosphodiesters. In some embodiments, the core includes at least 5 phosphodiesters. In some embodiments, the core includes at least 6 phosphodiesters. In some embodiments, the core includes at least one phosphodiester and at least one phosphorothioate. In some embodiments, the core comprises at least one phosphodiester and at least two phosphorothioates. In some embodiments, the core comprises at least two phosphodiesters and at least one phosphorothioate. In some embodiments, the core comprises at least two phosphodiesters and at least two phosphorothioates. In some embodiments, the core comprises at least two phosphodiesters and at least two phosphorothioates. In some embodiments, the core comprises at least two phosphodiesters and at least three phosphorothioates. In some embodiments, the core comprises at least three phosphodiesters and at least two phosphorothioates. In some embodiments, the core comprises at least three phosphodiesters and at least three phosphorothioates.In some embodiments, the phosphodiesters in the core and / or one or both wings may be optionally contiguous or non-contiguous, hi some embodiments, the phosphorothioates in the core and / or one or both wings may be optionally contiguous or non-contiguous.

[0069] In some embodiments, the oligonucleotides in the provided compositions have a common pattern of backbone phosphorus modifications. In some embodiments, the provided compositions are chiral controlled oligonucleotide compositions in that they contain predetermined levels of oligonucleotides of individual oligonucleotide types, where the oligonucleotide types are: 1) Nucleotide sequence; 2) pattern of skeletal bonds; 3) the pattern of backbone chiral centers; and 4) Pattern of backbone phosphorus modification It is defined by:

[0070] As noted above and understood in the art, in some embodiments, the base sequence of an oligonucleotide may refer to the identity and / or modification state of the nucleoside residues (e.g., the sugar and / or base moieties, relative to standard natural nucleotides such as adenine, cytosine, guanosine, thymine and uracil) within the oligonucleotide, and / or the hybridization properties of such residues (i.e., the ability to hybridize with a specific complementary residue).

[0071] In some embodiments, a particular oligonucleotide type is 1A) Base identity; 1B) Base modification patterns; 1C) Glycosylation patterns; 2) pattern of skeletal bonds; 3) the pattern of backbone chiral centers; and 4) Pattern of backbone phosphorus modification It may be defined by: Thus, in some embodiments, oligonucleotides of a particular type may share the same bases but differ in their patterns of base modifications and / or sugar modifications, hi some embodiments, oligonucleotides of a particular type may share the same bases and patterns of base modifications (including, for example, the absence of base modifications), but differ in their patterns of sugar modifications.

[0072] In some embodiments, oligonucleotides of a particular type have the same base sequence (including length), the same pattern of chemical modifications to the sugar and base moieties, the same pattern of backbone linkages (e.g., the pattern of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triester linkages, and combinations thereof), the same pattern of backbone chiral centers (e.g., the pattern of chiral internucleotide linkage stereochemistry (Rp / Sp)), and the same pattern of backbone phosphorus modifications (e.g., -S - and -LR of formula I 1 They are chemically identical in that they have the same pattern of modifications to the internucleotide phosphorus atom (such as ribozyme A, ribozyme B, ribozyme C, ribozyme D, ribozyme F ...

[0073] In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality for oligonucleotides that contain multiple (e.g., more than 5, 6, 7, 8, 9, or 10) internucleotide bridges, particularly for oligonucleotides that contain multiple (e.g., more than 5, 6, 7, 8, 9, or 10) chiral internucleotide bridges. In some embodiments, in a stereo-random or racemic preparation of an oligonucleotide, at least one chiral internucleotide bridge is made with a diastereoselectivity of less than 90:10, 95:5, 96:4, 97:3, or 98:2. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral internucleotide bridge is made with a diastereoselectivity of greater than 90:10, 95:5, 96:4, 97:3, or 98:2. In some embodiments, in stereoselective or chirality-controlled preparations of oligonucleotides, each chiral internucleotide bridge is made with a diastereoselectivity of greater than 95:5. In some embodiments, in stereoselective or chirality-controlled preparations of oligonucleotides, each chiral internucleotide bridge is made with a diastereoselectivity of greater than 96:4. In some embodiments, in stereoselective or chirality-controlled preparations of oligonucleotides, each chiral internucleotide bridge is made with a diastereoselectivity of greater than 97:3. In some embodiments, in stereoselective or chirality-controlled preparations of oligonucleotides, each chiral internucleotide bridge is made with a diastereoselectivity of greater than 98:2. In some embodiments, in stereoselective or chirality-controlled preparations of oligonucleotides, each chiral internucleotide bridge is made with a diastereoselectivity of greater than 99:1.In some embodiments, the diastereoselectivity of a chiral internucleotide bridge in an oligonucleotide may be measured by a model reaction (e.g., production of a dimer under essentially the same or comparable conditions, where the dimer has the same internucleotide bridge as the chiral internucleotide bridge, the 5'-nucleoside of the dimer is the same as the nucleoside to the 5'-terminus of the chiral internucleotide bridge, and the 3'-nucleoside of the dimer is the same as the nucleoside to the 3'-terminus of the chiral internucleotide bridge).

[0074] In particular, the present disclosure provides oligonucleotide compositions and techniques for optimizing properties such as activity, toxicity, and the like. In some embodiments, the present disclosure provides methods for reducing the toxicity of oligonucleotides and compositions thereof. In some embodiments, the present disclosure provides methods for reducing immune responses associated with administration of oligonucleotides and compositions thereof (i.e., methods of administering oligonucleotide compositions in which an undesirable immune response to the oligonucleotides in the composition is reduced relative to that observed, for example, with a reference composition of nucleotides of comparable or identical nucleotide sequence). In some embodiments, the present disclosure provides methods for reducing complement activation associated with administration of oligonucleotides and compositions thereof. In some embodiments, the present disclosure provides methods for improving the protein binding profile of oligonucleotides and compositions thereof. In some embodiments, the present disclosure provides methods for increasing binding to specific proteins by oligonucleotides and compositions thereof. In some embodiments, the present disclosure provides methods for increasing binding to specific proteins by oligonucleotides and compositions thereof. In some embodiments, the present disclosure provides methods for increasing delivery of oligonucleotides and compositions thereof. In particular, the present disclosure embraces the recognition that optimal delivery of oligonucleotides to targets involves, in some embodiments, a balance between binding of the oligonucleotides to specific proteins so that they can be delivered to the desired location, and release of the oligonucleotides so that they can be appropriately released from the specific proteins to perform the desired function, such as, for example, hybridization with these targets, cleavage of these targets, inhibition of translation, or modulation of the transcription process.As exemplified herein, the present disclosure recognizes, among other things, that improvements in oligonucleotide properties can be achieved by chemical modifications and / or stereochemistry.

[0075] As described herein, the compositions and methods provided can change the splicing of transcripts.In some embodiments, the compositions and methods provided provide improved splicing patterns of transcripts compared to reference conditions selected from the group consisting of the absence of composition, the presence of reference composition, and combinations thereof.The improvement can be the improvement of any desired biological function.In some embodiments, for example, in DMD, the improvement is the production of mRNA that produces dystrophin protein with improved biological activity.In some other embodiments, for example, the improvement is the downregulation of STAT3, HNRNPH1 and / or KDR to reduce tumor progression, malignancy and angiogenesis by forced splicing-induced nonsense-mediated decay (DSD-NMD).

[0076] In some embodiments, the disclosure provides a method of altering splicing of a target transcript comprising administering a composition comprising a first plurality of oligonucleotides, wherein splicing of the target transcript is altered relative to a reference condition selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0077] In some embodiments, the disclosure provides a method for generating a set of spliced ​​products from a target transcript, the method comprising: The method includes contacting a splicing system comprising a target transcript with an oligonucleotide composition comprising a first plurality of oligonucleotides in a predetermined amount and for a predetermined time under conditions sufficient to produce a set of spliced ​​products that differs from the set produced under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0078] As is widely known in the art, many diseases and / or conditions are associated with transcription splicing. See, e.g., Garcia-Blanco et al., Alternative splicing in disease and therapy, Nat. Biotechnol. May 2004; 22(5): 535-46; Wang et al., Splicing in disease: disruption of the splicing code and the decoding machinery, Nat. Rev. Genet. October 2007; 8(10): 749-61; Havens et al., Targeting RNA splicing for disease therapy, Wiley Interdiscip. Rev. RNA. May-June 2013; 4(3): 247-66. In some embodiments, the present disclosure provides compositions and methods for treating or preventing disease.

[0079] In some embodiments, the disclosure provides a method for treating or preventing a disease comprising administering to a subject an oligonucleotide composition described herein.

[0080] In some embodiments, the present disclosure provides: (1) have a common base sequence that is complementary to a target sequence in the transcript; (2) administering to the subject an oligonucleotide composition comprising a first plurality of oligonucleotides comprising one or more modified sugar moieties and modified internucleotide bridges; The present invention provides a method for treating or preventing a disease, characterized in that when an oligonucleotide composition is contacted with a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0081] In some embodiments, the present disclosure provides: (1) Nucleotide sequence; (2) skeletal cross-linking pattern; (3) the pattern of chiral centers in the framework; and (4) Pattern of backbone phosphorus modification administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides of a particular oligonucleotide type defined by the composition has controlled chirality in that it is enriched for a particular oligonucleotide class relative to a substantially racemic preparation of the oligonucleotide having the same base sequence; The present invention provides a method for treating or preventing a disease, characterized in that when an oligonucleotide composition is contacted with a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0082] In some embodiments, the disease is one in which one or more spliced ​​transcripts are repaired, restored or introduce new beneficial functions after administering the provided composition.For example, in DMD, after skipping one or more exons, the function of dystrophin can be restored or partially restored through cleaved but (partially) active aspects.In some embodiments, the disease is one in which one or more spliced ​​transcripts are repaired and genes are effectively knocked down by changing the splicing of gene transcripts after administering the provided composition.

[0083] In some embodiments, the disease is Duchenne muscular dystrophy. In some embodiments, the disease is spinal muscular atrophy. In some embodiments, the disease is cancer.

[0084] In some embodiments, the disclosure provides a method of treating a disease by administering a composition comprising a first plurality of oligonucleotides sharing a common base sequence, the nucleotide sequence being complementary to a target sequence of a target transcript; The improvement includes using a stereocontrolled oligonucleotide composition that, when contacted with a transcript in a transcription splicing system, alters splicing of the transcript relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0085] In some embodiments, the disclosure provides a method of treating a disease by administering a composition comprising a first plurality of oligonucleotides sharing a common base sequence, the nucleotide sequence being complementary to a target sequence of a target transcript; The improvement includes using a stereocontrolled oligonucleotide composition that, when contacted with a transcript in a transcription splicing system, alters splicing of the transcript relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0086] In some embodiments, the common sequence comprises a sequence selected from Table A1. In some embodiments, the common sequence is a sequence selected from Table A1.

[0087] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: The present invention provides a method comprising administering an oligonucleotide composition comprising a first plurality of oligonucleotides having controlled chirality, the first plurality of oligonucleotides being an improvement characterized by reduced toxicity compared to a reference oligonucleotide composition of the same common nucleotide sequence.

[0088] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: The present invention provides a method for administering an oligonucleotide composition, wherein each oligonucleotide in a plurality of oligonucleotides comprises one or more modified sugar moieties, the improvement being characterized by reduced toxicity as compared to a reference oligonucleotide composition having the same common nucleotide sequence but lacking at least one of the one or more modified sugar moieties.

[0089] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: administering an oligonucleotide composition, wherein each oligonucleotide in the plurality of oligonucleotides comprises one or more natural phosphate bridges and one or more modified phosphate bridges; The improvement provides a method in which the oligonucleotide composition is characterized by reduced toxicity when tested in at least one assay in which the oligonucleotide is measured using a corresponding reference composition except that the oligonucleotide does not contain natural phosphate bridges.

[0090] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: The present invention provides a method for administering an oligonucleotide composition, wherein each oligonucleotide in a plurality of oligonucleotides comprises one or more modified sugar moieties, the improvement being characterized by reduced toxicity as compared to a reference oligonucleotide composition having the same common nucleotide sequence but lacking at least one of the one or more modified sugar moieties.

[0091] In some embodiments, the disclosure provides methods comprising administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides, each having a common base sequence and comprising a modified sugar moiety, wherein the oligonucleotide composition is characterized by low toxicity when tested in at least one assay measured with an otherwise corresponding reference composition comprising a plurality of reference oligonucleotides having the same common base sequence but that do not comprise a modified sugar moiety.

[0092] In some embodiments, the disclosure provides methods comprising administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides, each having a common base sequence and comprising one or more natural phosphate bridges and one or more modified phosphate bridges, wherein the oligonucleotide composition is characterized by low toxicity when tested in at least one assay measured using an otherwise corresponding reference composition comprising a plurality of reference oligonucleotides having the same common base sequence but not comprising the natural phosphate bridges.

[0093] In some embodiments, the disclosure provides methods comprising administering to a subject a chirality-controlled oligonucleotide composition, wherein the chirality-controlled oligonucleotide composition is characterized by low toxicity when tested in at least one assay measured using an otherwise corresponding reference oligonucleotide composition comprising an oligonucleotide having the same base sequence and comprising a different chirality-controlled or stereorandom oligonucleotide composition.

[0094] In some embodiments, the reduced toxicity is or comprises reduced complement activation. In some embodiments, the reduced toxicity comprises reduced complement activation. In some embodiments, the reduced toxicity is or comprises reduced complement activation. In some embodiments, the reduced toxicity comprises reduced complement activation via an alternative pathway.

[0095] In some embodiments, the oligonucleotides can induce a proinflammatory response. In some embodiments, the disclosure provides compositions and methods for reducing inflammation. In some embodiments, the disclosure provides compositions and methods for reducing a proinflammatory response. In some embodiments, the disclosure provides methods for reducing inflammation at an injection site using the compositions provided. In some embodiments, the disclosure provides methods for reducing drug-induced vascular damage using the compositions provided.

[0096] In some embodiments, the disclosure provides a method comprising administering a composition comprising a first plurality of oligonucleotides, the composition exhibiting reduced inflammation at an injection site compared to a reference composition comprising a plurality of oligonucleotides, each of the reference plurality of oligonucleotides also having a common base sequence but different from the first plurality of oligonucleotides: The individual oligonucleotides in the reference oligonucleotide plurality differ from each other in stereochemical configuration; and / or At least some of the oligonucleotides in the reference multiple oligonucleotides have a structure that is different from the structure represented by the multiple oligonucleotides of the composition; and / or The method is provided, wherein at least some of the oligonucleotides in the reference multiple oligonucleotides are structurally distinct in that they do not include wing and core regions.

[0097] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: The improvement includes administering an oligonucleotide comprising a first plurality of oligonucleotides, the oligonucleotide comprising the first plurality of oligonucleotides being characterized by reduced inflammation at the injection site as compared to a reference oligonucleotide composition of the same common nucleotide sequence.

[0098] In some embodiments, the disclosure provides a method comprising administering a composition comprising a first plurality of oligonucleotides, the composition exhibiting altered protein binding compared to a reference composition comprising a plurality of oligonucleotides, each of the reference plurality of oligonucleotides also sharing a common base sequence with the first plurality of oligonucleotides: The individual oligonucleotides in the reference oligonucleotide plurality differ from each other in stereochemical configuration; and / or At least some of the oligonucleotides in the reference multiple oligonucleotides have a structure that is different from the structure represented by the multiple oligonucleotides of the composition; and / or The method is provided, wherein at least some of the oligonucleotides in the reference multiple oligonucleotides are structurally distinct in that they do not include wing and core regions.

[0099] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: The improvement includes administering an oligonucleotide composition comprising a first plurality of oligonucleotides characterized by altered protein binding compared to a reference oligonucleotide composition of the same common nucleotide sequence.

[0100] In some embodiments, the disclosure provides a method comprising administering a composition comprising a first plurality of oligonucleotides, the composition exhibiting improved delivery compared to a reference composition comprising a plurality of oligonucleotides, each of the reference plurality of oligonucleotides also having a common base sequence but different from the first plurality of oligonucleotides: The individual oligonucleotides in the reference oligonucleotide plurality differ from each other in stereochemical configuration; and / or At least some of the oligonucleotides in the reference multiple oligonucleotides have a structure that is different from the structure represented by the multiple oligonucleotides of the composition; and / or The method is provided, wherein at least some of the oligonucleotides in the reference multiple oligonucleotides are structurally distinct in that they do not include wing and core regions.

[0101] In some embodiments, the disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, comprising: The improvement includes administering an oligonucleotide comprising a first plurality of oligonucleotides characterized by improved delivery compared to a reference oligonucleotide composition of the same common nucleotide sequence.

[0102] In some embodiments, the present disclosure provides a method for the treatment of cancer, comprising administering to the patient a therapeutically effective amount of any of the following: WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV In some embodiments, the present disclosure provides compositions comprising chirality-controlled oligonucleotide compositions selected from WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545 and WV-3546. In some embodiments, the present disclosure provides compositions comprising chirality-controlled oligonucleotide compositions selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528 and WV-2530. In some embodiments, the disclosure provides chirality-controlled oligonucleotide compositions of WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545, or WV-3546. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-887. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-892. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-896. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-1714. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2444.In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2445. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2526. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2527. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2528. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2530. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2531. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2578. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2580. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-2587. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3047. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3152. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3472. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3473. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3507. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3508. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3509. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3510.In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3511. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3512. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3513. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3514. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3515. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3545. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions of WV-3546. As will be readily appreciated by those of skill in the art, such chirality-controlled oligonucleotide compositions can be prepared by mixing a predetermined amount of WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2532, WV-2533, WV-2534, WV-2535, WV-2536, WV-2537, WV-2538, WV-2539, WV-3000, WV-3001, WV-3002, WV-3003, WV-3004, WV-3005, WV-3006, WV-3007, WV-3008, WV- 78, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-35 09, including WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545 or WV-3546.

[0103] In some embodiments, the disclosure provides compositions comprising controlled chirality oligonucleotide compositions, the sequences of which are selected from the group consisting of WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-25 80, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545 and WV-3546. In some embodiments, the disclosure provides compositions comprising chirality-controlled oligonucleotide compositions, the sequence of the oligonucleotides comprising or consisting of an oligonucleotide sequence selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528 and WV-2530.

[0104] In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-887. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-892. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-896. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-1714. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-2444. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-2445. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, wherein the oligonucleotide sequence comprises the sequence of WV-2526. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises the sequence of WV-2527. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises the sequence of WV-2528. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises the sequence of WV-2530. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises the sequence of WV-887. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises the sequence of WV-892. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises the sequence of WV-896.In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-1714. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2444. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2445. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2526. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2427. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2528. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2530. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2531. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2578. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-2587. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3047. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3152. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3472.In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3473. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3507. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3508. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3509. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3510. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3511. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the oligonucleotide sequence consists of the sequence of WV-3512. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide consists of the sequence of WV-3513. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide consists of the sequence of WV-3514. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide consists of the sequence of WV-3515. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide consists of the sequence of WV-3545. In some embodiments, the present disclosure provides a chirality controlled oligonucleotide composition, in which the sequence of the oligonucleotide consists of the sequence of WV-3546.

[0105] In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of a WV-887 sequence, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of a WV-892 sequence, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of a WV-896 sequence, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of a WV-1714 sequence, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of a WV-2444 sequence, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2445, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2526, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2527, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2528, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2530, and the composition further comprises a lipid.In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2531, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2578, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2580, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-2587, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3047, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3152, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3472, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3473, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3507, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3508, and the composition further comprises a lipid.In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3509, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3510, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3511, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3512, and the composition further comprises a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3513, and the composition further comprises a lipid. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3514, and the composition further comprises a lipid. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, in which the sequence of the oligonucleotide comprises or consists of the sequence of WV-3515, and the composition further comprises a lipid.

[0106] In some embodiments, the present disclosure provides a lipid-conjugated WV-887 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-892 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-896 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-1714 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2444 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2445 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2526 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2527 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2528 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2530 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2531 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2578 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2580 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-2587 chirality-controlled oligonucleotide composition.In some embodiments, the present disclosure provides a lipid-conjugated WV-3047 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-3152 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-3472 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-3473 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-3507 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-3508 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a lipid-conjugated WV-3509 chirality-controlled oligonucleotide composition. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of WV-3510 conjugated to a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of WV-3511 conjugated to a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of WV-3512 conjugated to a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of WV-3513 conjugated to a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of WV-3514 conjugated to a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of WV-3515 conjugated to a lipid. In some embodiments, the present disclosure provides a chirality-controlled oligonucleotide composition of an oligonucleotide selected from any of the tables.In some embodiments, the disclosure provides a chirality-controlled oligonucleotide composition of an oligonucleotide selected from any of the tables, wherein the oligonucleotide is conjugated to a lipid.

[0107] In some embodiments, the oligonucleotide is 25 bases or less in length. In some embodiments, the oligonucleotide is 25 bases or less in length. In some embodiments, the oligonucleotide is 30 bases or less in length. In some embodiments, the oligonucleotide is 35 bases or less in length. In some embodiments, the oligonucleotide is 40 bases or less in length. In some embodiments, the oligonucleotide is 45 bases or less in length. In some embodiments, the oligonucleotide is 50 bases or less in length. In some embodiments, the oligonucleotide is 55 bases or less in length. In some embodiments, the oligonucleotide is 60 bases or less in length.

[0108] In some embodiments, the lipid is a fatty acid. In some embodiments, the oligonucleotide is conjugated to the fatty acid. In some embodiments, the fatty acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more carbon atoms. In some embodiments, the fatty acid comprises 10 or more carbon atoms. In some embodiments, the fatty acid comprises 11 or more carbon atoms. In some embodiments, the fatty acid comprises 12 or more carbon atoms. In some embodiments, the fatty acid comprises 13 or more carbon atoms. In some embodiments, the fatty acid comprises 14 or more carbon atoms. In some embodiments, the fatty acid comprises 15 or more carbon atoms. In some embodiments, the fatty acid comprises 16 or more carbon atoms. In some embodiments, the fatty acid comprises 17 or more carbon atoms. In some embodiments, the fatty acid comprises 18 or more carbon atoms. In some embodiments, the fatty acid comprises 19 or more carbon atoms. In some embodiments, the fatty acid comprises 20 or more carbon atoms. In some embodiments, the fatty acid contains 21 or more carbon atoms. In some embodiments, the fatty acid contains 22 or more carbon atoms. In some embodiments, the fatty acid contains 23 or more carbon atoms. In some embodiments, the fatty acid contains 24 or more carbon atoms. In some embodiments, the fatty acid contains 25 or more carbon atoms. In some embodiments, the fatty acid contains 26 or more carbon atoms. In some embodiments, the fatty acid contains 27 or more carbon atoms. In some embodiments, the fatty acid contains 28 or more carbon atoms. In some embodiments, the fatty acid contains 29 or more carbon atoms. In some embodiments, the fatty acid contains 30 or more carbon atoms.

[0109] In some embodiments, the lipid is stearic acid or terbinal acid. In some embodiments, the lipid is stearic acid. In some embodiments, the lipid is terbinal acid.

[0110] In some embodiments, the lipid is an optionally substituted C 10 -C 80 wherein one or more methylene units are optionally independently selected from the group consisting of C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C 6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2 and is replaced by an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, each variable being independently defined and as described herein.

[0111] In some embodiments, the lipid is an optionally substituted C 10 -C 60 The aryl group may contain saturated or partially unsaturated aliphatic chains.

[0112] In some embodiments, the lipid is an optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0113] In some embodiments, the lipid optionally contains one or more C 1-4 C, which may be substituted with an aliphatic group 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0114] In some embodiments, the lipid is an optionally substituted C 10 -C 60 wherein one or more methylene units are optionally independently selected from the group consisting of C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C 6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2 and is replaced by an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, each variable being independently defined and as described herein.

[0115] In some embodiments, the lipid is an optionally substituted C 10 -C 60 The aryl group may contain saturated or partially unsaturated aliphatic chains.

[0116] In some embodiments, the lipid is an optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0117] In some embodiments, the lipid optionally contains one or more C 1-4 C, which may be substituted with an aliphatic group 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0118] In some embodiments, the lipid is an optionally substituted C 10 -C 40 wherein one or more methylene units are optionally independently selected from the group consisting of C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C 6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2 and is replaced by an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-, each variable being independently defined and as described herein.

[0119] In some embodiments, the lipid is an optionally substituted C 10 -C 60 The aryl group may contain saturated or partially unsaturated aliphatic chains.

[0120] In some embodiments, the lipid is an optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0121] In some embodiments, the lipid optionally contains one or more C 1-4 C, which may be substituted with an aliphatic group 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0122] In some embodiments, the lipid is an unsubstituted C 10 -C 80 It contains linear saturated or partially unsaturated aliphatic chains.

[0123] In some embodiments, the lipid contains no more than one optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0124] In some embodiments, the lipid comprises two or more optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0125] In some embodiments, the lipid is an unsubstituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0126] In some embodiments, the lipid contains no more than one optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0127] In some embodiments, the lipid comprises two or more optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0128] In some embodiments, the lipid is an unsubstituted C 10 -C 40 It contains linear saturated or partially unsaturated aliphatic chains.

[0129] In some embodiments, the lipid contains no more than one optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0130] In some embodiments, the lipid comprises two or more optionally substituted C 10 -C 60 It contains linear saturated or partially unsaturated aliphatic chains.

[0131] In some embodiments, the lipid is 10 -C 40 It contains linear saturated or partially unsaturated aliphatic chains.

[0132] In some embodiments, the lipid optionally contains one or more C 1-4 C, which may be substituted with an aliphatic group 10 -C 40 It contains linear saturated or partially unsaturated aliphatic chains.

[0133] In some embodiments, the lipid is selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid (DHA or cis-DHA), terbinal acid, and dilinoleyl.

[0134] In some embodiments, the lipid is not conjugated to the oligonucleotide.

[0135] In some embodiments, the lipid is conjugated to the oligonucleotide.

[0136] In some embodiments, the lipid is conjugated to the oligonucleotide using a linker. In some embodiments, the linker has the structure -L-. In some embodiments, the conjugate is A c -[-L LD -(R LD ) a ] b It has the structure:

[0137] In some embodiments, the present disclosure provides a method for the preparation of a c-[-L LD -(R LD ) a ] b or [(A c ) a -L LD ] b -R LD An oligonucleotide composition comprising a plurality of oligonucleotides having the structure: Where: A c is an oligonucleotide chain ([H] b -A c is an oligonucleotide); a is 1 to 1000; b is 1 to 1000; Each L LD is independently a linker moiety; Each R LD provides oligonucleotide compositions which are, independently, a lipid moiety or a targeting element.

[0138] In some embodiments, the present disclosure provides a method for the preparation of a c -[-L LD -(R LD ) a ] b or [(A c ) a -L LD ] b -R LD An oligonucleotide composition comprising a plurality of oligonucleotides having the structure: Where: A c is an oligonucleotide chain ([H] b -A c is an oligonucleotide); a is 1 to 1000; b is 1 to 1000; Each L LD each independently represents a covalent bond or an optionally substituted C 1 -C 80wherein one or more methylene units are optionally independently selected from the group consisting of T LD or C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C 6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2 with an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-; Each R LD are independently optionally substituted C 1 -C 80 wherein one or more methylene units are optionally independently selected from the group consisting of C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C 6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2with an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-; T LD teeth, [ka] The structure is W is O, S or Se; X, Y and Z each independently represent -O-, -S-, -N(-LR 1 )-or L; L is a covalent bond or an optionally substituted linear or branched C 1 -C 10 alkylene, and one or more methylene units of L are optionally independently selected from C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C 6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2 may be replaced with an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; R 1 is halogen, R, or optionally substituted C 1 -C 50 aliphatic, wherein one or more methylene units are optionally and independently selected from the group consisting of C 1 -C 6 Alkylene, C 1 -C 6 Alkenylene, -C≡C-, C 1 -C6 Heteroaliphatic moiety, -C(R') 2 -, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N (R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O) 2 -, -S(O) 2 N(R')-, -N(R')S(O) 2 may be replaced with an optionally substituted group selected from -, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; Each R' is independently -R, -C(O)R, -CO 2 R or -SO 2 R or; two R' together with the atoms between them form an optionally substituted aryl, carbocycle, heterocycle, or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, and heterocyclylene; Each R is independently hydrogen or C 1 -C 6 Oligonucleotide compositions are provided in which the optionally substituted group is selected from aliphatic, carbocyclyl, aryl, heteroaryl and heterocyclyl.

[0139] In some embodiments, [H] b -Ac, where b is 1 to 1000, is any one of the oligonucleotides in the table. b -Ac is an oligonucleotide in Table 2. In some embodiments, [H] b -Ac is an oligonucleotide in Table 3. In some embodiments, [H] b -Ac is an oligonucleotide in Table 4. In some embodiments, [H] b-Ac is an oligonucleotide of Table 4 that does not contain a lipid moiety.

[0140] In some embodiments, T LD The P in the * In some embodiments, the conjugate is c ) a -L LD ] b -R LD In some embodiments, the conjugate has the structure: c ) a -L LD -R LDIn some embodiments, a is 1 to 100. In some embodiments, a is 1 to 50. In some embodiments, a is 1 to 40. In some embodiments, a is 1 to 30. In some embodiments, a is 1 to 20. In some embodiments, a is 1 to 15. In some embodiments, a is 1 to 10. In some embodiments, a is 1 to 9. In some embodiments, a is 1 to 8. In some embodiments, a is 1 to 7. In some embodiments, a is 1 to 6. In some embodiments, a is 1 to 5. In some embodiments, a is 1 to 4. In some embodiments, a is 1 to 3. In some embodiments, a is 1 to 2. In some embodiments, a is 1. In some embodiments, a is 2. In some embodiments, a is 3. In some embodiments, a is 4. In some embodiments, a is 5. In some embodiments, a is 6. In some embodiments, a is 7. In some embodiments, a is 8. In some embodiments, a is 9. In some embodiments, a is 10. In some embodiments, a is greater than 10. In some embodiments, b is 1 to 100. In some embodiments, b is 1 to 50. In some embodiments, b is 1 to 40. In some embodiments, b is 1 to 50. In some embodiments, b is 1 to 30. In some embodiments, b is 1 to 20. In some embodiments, b is 1 to 15. In some embodiments, b is 1 to 10. In some embodiments, b is 1 to 9. In some embodiments, b is 1 to 8. In some embodiments, b is 1 to 7. In some embodiments, b is 1 to 6. In some embodiments, b is 1 to 5. In some embodiments, b is 1 to 4. In some embodiments, b is 1 to 3.In some embodiments, b is 1 to 2. In some embodiments, b is 1. In some embodiments, b is 2. In some embodiments, b is 3. In some embodiments, b is 4. In some embodiments, b is 5. In some embodiments, b is 6. In some embodiments, b is 7. In some embodiments, b is 8. In some embodiments, b is 9. In some embodiments, b is greater than 10. In some embodiments, the conjugate is A. c -L LD -R LD In some embodiments, A has the structure: c is conjugated via one or more of its sugar, base and / or internucleotide bridging moieties. In some embodiments, A c is conjugated via its 5'-OH (5'-O-). In some embodiments, A c is conjugated via its 3'-OH (3'-O-). In some embodiments, prior to conjugation, A c -(H) b (b is A c (which is an integer between 1 and 1000 depending on the valency of L) is an oligonucleotide described herein, e.g., an oligonucleotide described in any one of the Tables. LD In some embodiments, L LD In some embodiments, L LD is -C(O)NH-(CH 2 ) 6 -OP(=O)(S - In some embodiments, the -C(O)NH terminus is R LD and the -O-terminus is linked to an oligonucleotide, e.g., via the 5'-terminus or 3'-terminus. LD is an optionally substituted C 10 , C 15 , C16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 or C 25 ~C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 or C 80 In some embodiments, R LD is an optionally substituted C 10-80 In some embodiments, R LD is an optionally substituted C 20-80 In some embodiments, R LD is an optionally substituted C 10-70 In some embodiments, R LD is an optionally substituted C 20-70 In some embodiments, R LD is an optionally substituted C 10-60 In some embodiments, R LD is an optionally substituted C 20-60 In some embodiments, R LD is an optionally substituted C 10-50 In some embodiments, R LD is an optionally substituted C 20-50 In some embodiments, R LDis an optionally substituted C 10-40 In some embodiments, R LD is an optionally substituted C 20-40 In some embodiments, R LD is an optionally substituted C 10-30 In some embodiments, R LD is an optionally substituted C 20-30 In some embodiments, R LD is the unsubstituted C 10 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 or C 25 ~C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 or C 80 In some embodiments, R LD is the unsubstituted C 10-80 In some embodiments, R LD is the unsubstituted C 20-80 In some embodiments, R LD is the unsubstituted C 10-70 In some embodiments, R LD is the unsubstituted C 20-70 In some embodiments, R LDis the unsubstituted C 10-60 In some embodiments, R LD is the unsubstituted C 20-60 In some embodiments, R LD is the unsubstituted C 10-50 In some embodiments, R LD is the unsubstituted C 20-50 In some embodiments, R LD is the unsubstituted C 10-40 In some embodiments, R LD is the unsubstituted C 20-40 In some embodiments, R LD is the unsubstituted C 10-30 In some embodiments, R LD is the unsubstituted C 20-30 It is aliphatic.

[0141] In some embodiments, the chirality controlled oligonucleotide composition is any one of the compositions described above, further comprising one or more additional components.

[0142] In some embodiments, conjugation of lipids to oligonucleotides improves at least one property of the oligonucleotide. In some embodiments, the improved property includes increased activity (e.g., increased ability to induce desired skipping of deleterious exons), reduced toxicity, and / or improved distribution to tissues. In some embodiments, the tissue is muscle tissue. In some embodiments, the tissue is skeletal muscle, gastrocnemius muscle, triceps muscle, heart, or diaphragm. In some embodiments, the improved property includes reduced hTLR9 agonist activity. In some embodiments, the improved property includes hTLR9 antagonist activity. In some embodiments, the improved property includes increased hTLR9 antagonist activity.

[0143] Generally, the properties of the oligonucleotide compositions described herein can be evaluated using any suitable assay.The relative toxicity and / or protein binding properties of different compositions (e.g., stereocontrolled and non-stereocontrolled and / or different stereocontrolled compositions) are typically determined desirably in the same assay, in some embodiments substantially simultaneously, and in some embodiments with reference to historical results.

[0144] Those skilled in the art will be aware of and / or can readily develop suitable assays for particular oligonucleotide compositions. The present disclosure provides a description of particular assays, e.g., assays that may be useful for evaluating one or more characteristics of the behavior of an oligonucleotide composition, e.g., complement activation, injection site inflammation, protein binding, etc.

[0145] For example, particular assays that may be useful for assessing the toxicity and / or protein binding properties of an oligonucleotide composition may include any of the assays described and / or exemplified herein. definition

[0146] Aliphatic: As used herein, the term "aliphatic" or "aliphatic group" refers to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units, or a monocyclic or polycyclic hydrocarbon that is fully saturated or contains one or more unsaturated units, but is not aromatic (also referred to herein as "carbocyclic," "alicyclic," or "cycloalkyl"). In some embodiments, an aliphatic group contains 1-50 aliphatic carbon atoms. Unless otherwise specified, an aliphatic group contains 1-10 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-4 aliphatic carbon atoms. In yet other embodiments, an aliphatic group contains 1-3 aliphatic carbon atoms, and in yet other embodiments, an aliphatic group contains 1-2 aliphatic carbon atoms. In some embodiments, "alicyclic" (or "carbocycle" or "cycloalkyl") refers to a monocyclic or bicyclic ring system that is fully saturated or contains one or more unsaturated units, but is not aromatic, having one point of attachment to another molecule. 3 ~C 10 In some embodiments, "alicyclic" (or "carbocycle" or "cycloalkyl") refers to a monocyclic C ring that is fully saturated or contains one or more unsaturated units, but is not aromatic, with one point of attachment to another molecule. 3 ~C 6 represents a hydrocarbon. Suitable aliphatic groups include, but are not limited to, straight or branched chain, substituted or unsubstituted alkyl groups, alkenyl groups, alkynyl groups, and complexes thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0147] Alkylene: The term "alkylene" refers to a divalent alkyl group. An "alkylene chain" is a polymethylene group, i.e., -(CH 2 ) n-, where n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. The substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms have been replaced with a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0148] Alkenylene: The term "alkenylene" refers to a divalent alkenyl group. A substituted alkenylene group is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0149] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human, at any stage of development. In some embodiments, "animal" refers to a non-human animal, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically modified animal, and / or a clone.

[0150] Approximately: As used herein, the word "approximately" or "about" when describing a number is generally intended to include numbers within a range of 5%, 10%, 15%, or 20% in either direction (greater or less) of that number, unless otherwise stated or otherwise evident from the context (unless such number is less than 0% or more than 100% of its possible values). In some embodiments, use of the word "about" when describing dosage amounts means ±5 mg / kg / day.

[0151] Aryl: The term "aryl" used alone or as part of a larger moiety as "aralkyl", "aralkoxy", or "aryloxyalkyl" refers to monocyclic and bicyclic ring structures in which at least one ring of the structure is aromatic and each ring of the structure contains 3 to 7 ring members, with a total of 5 to 14 ring members. The term "aryl" may be used interchangeably with the term "aryl ring". In certain embodiments of the invention, "aryl" refers to aromatic ring structures including, but not limited to, phenyl, biphenyl, naphthyl, anthracyl, and the like, which may bear one or more substituents. Also included within the scope of the term "aryl" herein are groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl.

[0152] Characteristic portion: As used herein, the phrase "characteristic portion" of a protein or polypeptide includes a stretch or collection of stretches of amino acids that, taken together, are characteristic of the protein or polypeptide. Each such stretch will generally include at least two amino acids. Moreover, one of skill in the art will recognize that at least 5, 10, 15, 20 or more amino acids are usually required to be characteristic of a protein. Generally, a characteristic portion will share at least one functional characteristic with the relevant intact protein, in addition to the specific sequence homology described above.

[0153] Characteristic sequence: A "characteristic sequence" is a sequence that is found in all members of a family of polypeptides or nucleic acids and therefore can be used by those of skill in the art to define the members of the family.

[0154] Characteristic structural element: The term "characteristic structural element" refers to a distinct structural element (e.g., a backbone structure, a collection of pendant moieties, a sequence element, etc.) that is found in all members of a family of polypeptides, small molecules, or nucleic acids and thus can be used by those of skill in the art to define the members of that family.

[0155] Equivalent: The term "equivalent" is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit a comparison of the results obtained or the phenomena observed. In some embodiments, equivalent sets of conditions or circumstances are characterized by a plurality of substantially the same characteristics and one or a small number of altered characteristics. One skilled in the art will recognize that sets of conditions are equivalent to one another when they are characterized by a sufficient number and type of substantially the same characteristics such that the differences in the results obtained or the phenomena observed under the different sets of conditions or circumstances can justify a reasonable conclusion that the sets of conditions are caused by or exhibit differences in those characteristics that are altered.

[0156] Dosage regimen: As used herein, a "dosage regimen" or "treatment regimen" refers to a set of unit doses (usually one or more) that are administered separately to a subject, usually separated by a period of time. In some embodiments, a given therapeutic agent has a required dosing regimen that may include one or more doses. In some embodiments, a dosing regimen includes multiple doses, each of which is separated from each other by a period of the same length; in some embodiments, a dosing regimen includes multiple doses and at least two different periods that separate the separate doses. In some embodiments, all doses in a dosing regimen are the same unit dosage. In some embodiments, different doses in a dosing regimen are different amounts. In some embodiments, a dosing regimen includes a first dose at a first dosage, followed by one or more additional doses at a second dosage that is different from the first dosage. In some embodiments, a dosing regimen includes a first dose at a first dosage, followed by one or more additional doses at a second dosage that is the same as the first dosage.

[0157] Equivalent Agents: Upon reading this disclosure, one of skill in the art will recognize that the scope of agents useful in the context of the present invention is not limited to those specifically mentioned or exemplified herein. Specifically, one of skill in the art will recognize that active agents typically have a structure consisting of a backbone and pendant moieties attached thereto, and will therefore understand that simple alterations of such backbone and / or pendant moieties will not significantly alter the activity of the agent. For example, in some embodiments, replacement of one or more pendant moieties with groups of equivalent three-dimensional structure and / or chemical reactivity properties can produce substituted compounds or moieties equivalent to the parent reference compound or moiety. In some embodiments, addition or removal of one or more pendant moieties can produce substituted compounds equivalent to the parent reference compound. In some embodiments, alteration of the backbone structure, for example, by addition or removal of a small number of bonds (usually no more than 5, 4, 3, 2, or 1 bond, and often only single bonds), can produce substituted compounds equivalent to the parent reference compound. In many embodiments, equivalent compounds can be synthesized, for example, by the methods shown in the following general reaction schemes, or modifications thereof, using readily available materials, reagents and conventional or provided synthetic procedures, in which variations that are known per se but not mentioned herein can also be utilized.

[0158] Equivalent dosage: The term "equivalent dosage" is used herein to compare dosages of different pharmacoactive agents that produce the same biological result. Dosages of two different agents are considered "equivalent" to each other according to the present invention if they achieve a similar level or degree of biological result. In some embodiments, equivalent dosages of different pharmaceuticals used according to the present invention are determined using in vitro and / or in vivo assays described herein. In some embodiments, one or more lysosomotropic agents used according to the present invention are utilized at a dosage equivalent to that of a reference lysosomotropic agent; in some embodiments, such a reference lysosomotropic agent of interest is selected from the group consisting of small molecule allosteric activators (e.g., pyrazolpyrimidines), imminosugars (e.g., isofagomine), antioxidants (e.g., n-acetylcysteine), and regulators of cellular trafficking (e.g., Rab1a polypeptides).

[0159] Heteroaliphatic: The term "heteroaliphatic" refers to any of the following heteroaliphatic groups: C, CH, CH 2 , or C.H. 3 One or more units selected from independently represent an aliphatic group substituted with a heteroatom. In some embodiments, the heteroaliphatic group is a heteroalkyl. In some embodiments, the heteroaliphatic group is a heteroalkenyl.

[0160] Heteroaryl: The terms "heteroaryl" and "heteroar-", used alone or as part of a larger moiety, such as "heteroaralkyl" or "heteroaralkoxy", refer to a group having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 pi-electrons shared in a cyclic arrangement; and having 1 to 5 heteroatoms in addition to the carbon atoms. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and the quaternized form of any basic nitrogen. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. As used herein, the terms "heteroaryl" and "heteroar-" also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, where the radical or point of attachment is on the aromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic or bicyclic. The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring", "heteroaryl group", or "aromatic heterocycle", any of which includes rings that may be substituted. The term "heteroaralkyl" refers to an alkyl group substituted by a heteroaryl, where the alkyl and heteroaryl portions independently may be optionally substituted.

[0161] Heteroatom: The term "heteroatom" refers to one or more of oxygen, sulfur, nitrogen, phosphorus, boron, selenium, or silicon (any oxidized form of nitrogen, boron, selenium, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen; or a heterocycle, such as N (in 3,4-dihydro-2H-pyrrolyl), NH (in pyrrolidinyl), or NR + (including a substitutable nitrogen in N-substituted pyrrolidinyl).

[0162] Heterocycle: As used herein, the terms "heterocycle", "heterocyclyl", "heterocyclic radical", and "heterocyclic ring" are used interchangeably and refer to a stable 3- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is saturated or partially unsaturated and has, in addition to carbon atoms, one or more, preferably one to four, heteroatoms as described above. When used to refer to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. For example, a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur, or nitrogen, the nitrogen being N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or . + It can be NR (as in N-substituted pyrrolidinyl).

[0163] A heterocycle may be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any ring atom may be substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle", "heterocyclyl", "heterocyclyl ring", "heterocyclic group", "heterocyclic moiety", and "heterocyclic radical" are used interchangeably herein and include groups in which a heterocyclyl ring is fused to one or more aryl groups, heteroaryl groups, or aliphatic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl, where the radical or point of attachment is on the heterocyclyl ring. The heterocyclyl ring can be monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heterocyclyl, where the alkyl and heterocyclyl moieties may be independently substituted.

[0164] Intraperitoneal: As used herein, the phrases "intraperitoneal administration" and "administered intraperitoneally" have their art-recognized meaning to refer to administration of a compound or composition into the peritoneal membrane of a subject.

[0165] In vitro: As used herein, the term "in vitro" refers to events that take place not within a living organism (e.g., an animal, a plant, and / or a microorganism) but in an artificial environment, e.g., in a test tube or reactor, in cell culture, etc.

[0166] In vivo: As used herein, the term "in vivo" refers to events that take place within a living organism (e.g., an animal, a plant, and / or a microorganism).

[0167] Lower alkyl: The term "lower alkyl" means any of the C 1~4It represents a straight or branched chain alkyl group. Illustrative lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0168] Lower haloalkyl: The term “lower haloalkyl” refers to a C substituted with one or more halogen atoms. 1~4 It represents a straight or branched chain alkyl group.

[0169] Optionally substituted: As described herein, the compounds of the invention may include "optionally substituted" moieties. In general, the term "substituted", whether or not the term "may" is present, means that one or more hydrogens of the specified moiety are replaced with a suitable substituent. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, where one or more positions in any given structure may be the same or different at each position. Combinations of substituents contemplated by the present invention are preferably those that result in the production of stable or chemically feasible compounds. As used herein, the term "stable" refers to compounds that are substantially unchanged when in a state that allows for their preparation, detection, and, in certain embodiments, their recovery, purification, and use for one or more purposes disclosed herein.

[0170] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently halogen; -(CH 2 ) 0~4 R ○ ;-(CH 2 ) 0~4 OR ○ ;-O(CH 2 ) 0~4 R ○ , -O-(CH 2 ) 0~4 C(O)OR ○ ;-(CH 2 ) 0~4 CH(OR ○ ) 2 ;-(CH 2 ) 0~4 S.R. ○ ;R○ may be substituted with (CH 2 ) 0~4 Ph;R ○ may be substituted with (CH 2 ) 0~4 O(CH 2 ) 0~1 Ph;R ○ CH=CHPh, optionally substituted with R ○ may be substituted with (CH 2 ) 0~4 O(CH 2 ) 0~1 -Pyridyl; -NO 2 ;-CN;-N 3 ;(CH 2 ) 0~4 N(R ○ ) 2 ;-(CH 2 ) 0~4 N(R ○ )C(O)R ○ ;-N(R ○ )C(S)R ○ ;-(CH 2 ) 0~4 N(R ○ )C(O)NR ○ 2 ;N(R ○ )C(S)NR ○ 2 ;-(CH 2 ) 0~4 N(R ○ )C(O)OR ○ ;-N(R ○ )N(R ○ )C(O)R ○ ;N(R ○ )N(R ○ )C(O)NR ○ 2 ;N(R ○ )N(R ○ )C(O)OR ○ ;-(CH 2 ) 0~4 C(O)R ○ ;-C(S)R ○ ;-(CH 2 ) 0~4 C(O)OR ○ ;-(CH 2 ) 0~4C(O)SR ○ ;(CH 2 ) 0~4 C(O)OSiR ○ 3 ;-(CH 2 ) 0~4 OC(O)R ○ ;-OC(O)(CH 2 ) 0~4 SR-、SC(S)SR ○ ;-(CH 2 ) 0~4 SC(O)R ○ ;-(CH 2 ) 0~4 C(O)NR ○ 2 ;-C(S)NR ○ 2 ;-C(S)SR ○ ;-SC(S)SR ○ 、(CH 2 ) 0~4 OC(O)NR ○ 2 ;C(O)N(OR ○ )R ○ ;-C(O)C(O)R○;-C(O)CH2C(O)R○;-C(NOR○)R ○ ;(CH 2 ) 0~4 SSR ○ ;-(CH 2 ) 0~4 S(O) 2 R ○ ;-(CH 2 ) 0~4 S(O) 2 OR ○ ;-(CH 2 ) 0~4 OS(O) 2 R ○ ;-S(O) 2 NR ○ 2 ;(CH 2 ) 0~4 S(O)R ○ ;N(R ○ )S(O) 2 NR ○ 2 ;-N(R ○ )S(O) 2 R ○ ;-N(OR○ )R ○ ;-C(NH)NR ○ 2 ;-P(O) 2 R ○ ;P(O)R ○ 2 ;OP(O)R ○ 2 ;-OP(O)(OR ○ ) 2 ;-SiR○ 3 ;-(C 1~4 Linear or branched alkylene)ON(R ○ ) 2 ; or -(C 1~4 Linear or branched alkylene)C(O)ON(R ○ ) 2 (In the formula, each R ○ are optionally substituted as described below, and are independently hydrogen, C 1~6 Aliphatic, -CH 2 Ph, -O(CH 2 ) 0~1 Ph, -CH 2 -(5-6 membered heteroaryl ring) or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, notwithstanding the above definition, two independently occurring R ○ together with their intervening atoms, which may be substituted as described below, form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0171] R ○ The appropriate monovalent substituent (or two independently occurring R ○ (a ring formed by combining with the intervening atoms) are independently halogen, -(CH 2 ) 0~2 R ● , -(Halo R ● ), -(CH 2 ) 0~2 OH, -(CH 2 ) 0~2 OR ● , -(CH2 ) 0~2 CH(OR ● ) 2 ;O(Halo R ● ), -CN, -N 3 , -(CH 2 ) 0~2 C(O)R ● , -(CH 2 ) 0~2 C(O)OH, -(CH 2 ) 0~2 C(O)OR ● , -(CH 2 ) 0~2 S.R. ● , -(CH 2 ) 0~2 SH, -(CH 2 ) 0~2 NH 2 , -(CH 2 ) 0~2 NHR ● , -(CH 2 ) 0~2 NR ● 2 , -NO 2 , -SiR ● 3 , -OSiR ● 3 , C(O)SR ● , -(C 1~4 Straight or branched chain alkylene)C(O)OR ● , or -SSR ● (In the formula, each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and, independently, C 1~4 Aliphatic, -CH 2 Ph, -O(CH 2 ) 0~1 R is selected from the group consisting of a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. ○ Suitable divalent substituents on a saturated carbon atom of include ═O and ═S.

[0172] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include the following: =O, =S, =NNR* 2 , =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O) 2 R * , =NR * , =NOR * , -O(C(R * 2 )) 2~3 O-, or -S(C(R * 2 )) 2~3 S-(wherein each R * is hydrogen, the following substituted C 1~6 aliphatic, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents attached to adjacent substitutable carbons of an "optionally substituted" group include: -O(CR * 2 ) 2~3 O- (wherein each R * is hydrogen, the following substituted C 1~6 aliphatic, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0173] Suitable substituents on the aliphatic group of R* include halogen, -R ● , -(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH 2 , -NHR ● , -NR ● 2 , or -NO 2 (In the formula, each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and, independently, C 1~4 Aliphatic, -CH 2 Ph, -O(CH 2 )0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0174] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include -R † , -NR † 2 , -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH 2 C(O)R † , -S(O) 2 R † , S(O) 2 NR † 2 , -C(S)NR † 2 , -C(NH)NR † 2 , or -N(R † )S(O) 2 R † ;(In the formula, each R † are independently selected from halogen, the following optionally substituted C 1~6 an aliphatic, unsubstituted -OPh, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, notwithstanding the above definition, two independently occurring R † together with their intervening atoms form an unsubstituted 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0175] Suitable substituents on an aliphatic group of R† are independently halogen, -R●, -(haloR●), -OH, -OR●, -O(haloR●), -CN, -C(O)OH, -C(O)OR●, -NH2, -NHR●, -NR●2, or -NO2, where each R● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and is independently a C1-4 aliphatic, -CH2Ph, -O(CH2)0-1Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0176] Oral: As used herein, the phrases "oral administration" and "orally administered" refer to administration of a compound or composition by mouth and have their art-recognized meaning.

[0177] Parenteral: As used herein, the phrases "parenteral administration" and "parenterally administered" have their art-recognized meaning to refer to modes of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0178] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties as defined herein.

[0179] As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharma- ceutical acceptable carriers. In some embodiments, the active agent is present in a unit dosage suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to an appropriate population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including for oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes to be applied to the tongue; parenteral administration, e.g., as a sterile solution or suspension, or as a sustained release formulation, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; topical administration, e.g., as a cream, ointment, or sustained release patch or spray to be applied to the skin, lung, or buccal cavity; intravaginally or rectally, e.g., as a pessary, cream, or foam; sublingually; ophthalmically; transdermally; or intranasally, lung, and other mucosal surfaces.

[0180] Pharmaceutically acceptable: As used herein, the phrase "pharmacologically acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable for use in contact with the tissues of human beings and animals, within sound medical judgment, commensurate with a reasonable benefit / risk ratio and without excessive toxicity, irritation, allergic response, or other problem or complication.

[0181] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutical acceptable carrier" means a pharma- ceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in the transport or transfer from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which may serve as pharma- ceutically acceptable carriers include: sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0182] Pharmaceutically acceptable salt: As used herein, the term "pharmaceutical acceptable salt" refers to the salt of such a compound that is suitable for use in pharmaceutical context, i.e., that is suitable for use in contact with the tissues of humans and lower animals, within sound medical judgment, with a reasonable benefit / risk ratio, without undue harmfulness, irritation, allergic response, etc. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe pharmaceutical acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, tetrahydrofuransulf ... Examples of suitable salts include, but are not limited to, sulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, pharma- ceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed with counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkylsulfonates and arylsulfonates having 1-6 carbon atoms, as appropriate.

[0183] Prodrug: In general, a "prodrug," as the term is used herein, and as understood in the art, is an entity that, when administered to an organism, is metabolized in the body to deliver an active (e.g., therapeutic or diagnostic) agent of interest. Typically, such metabolism results in the removal of at least one "prodrug moiety" so that the active agent is produced. Various forms of "prodrugs" are well known in the art. Examples of such prodrug moieties include: a) Design of Prodrugs, edited by H. Bundgaard, (Elsevier, 1985) and Methods in Enzymology, 42:309-396, edited by K. Widder, et al. (Academic Press, 1985); b)Prodrugs and Targeted Delivery, edited by J. Rautio (Wiley, 2011); c)Prodrugs and Targeted Delivery, edited by J. Rautio (Wiley, 2011); d)A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen; e) Bundgaard, Chapter 5 “Design and Application of Prodrugs”, by H. Bundgaard, p. 113-191 (1991); f) Bundgaard, Advanced Drug Delivery Reviews, 8:1-38 (1992); g) Bundgaard, et al., Journal of Pharmaceutical Sciences, 77:285 (1988); and h)Kakeya, et al., Chem. Pharm. Bull., 32:692 (1984) reference.

[0184] As with other compounds described herein, the prodrugs may be provided in any of a variety of forms, e.g., crystalline forms, salt forms, etc. In some embodiments, the prodrugs are provided as a pharma- ceutically acceptable salt thereof.

[0185] Protecting group: As used herein, the term "protecting group" includes those well known in the art and described in detail in Protecting Groups in Organic Synthesis, TW Greene and PGM Wuts, 3rd edition, John Wiley & Sons, 1999 (the entirety of which is incorporated herein by reference). It also includes protecting groups specifically adapted to nucleotides and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012 (the entirety of Chapter 2 is incorporated herein by reference). Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthy]methyl carbamate (DBD-Tmoc), 4-methoxyphenanthyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-methylethyl carbamate (Met ... Phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-Dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropyl allyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyl dithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitro Trobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthio Phenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acryloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl (o-nitrophenyl) methyl carbamate, phenothiazinyl-(10)-carbonyl derivatives, N'-p-toluenesulfonylaminocarbonyl derivatives, N'-phenylaminothiocarbonyl derivatives, t-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropyl methyl carbamate, p-decyloxybenzyl carbamate, 2,2-Dimethoxycarbonylvinylcarbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methyl 1-methyl-1-cyclopropylmethylcarbamate, 1-methyl-1-cyclopropylmethylcarbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethylcarbamate, 1-methyl-1-(p-phenylazophenyl)ethylcarbamate, 1-methyl-1-phenylethylcarbamate, 1-methyl-1-(4-pyridyl)ethylcarbamate, phenylcarbamate, p-(phenylazo)benzylcarbamate, 2,4,6-tri-t-butylphenylcarbamate, 4-(trimethylammonium)benzylcarbamate, 2,4,6-trimethylbenzyl carbamates, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)acetamide, o-phenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-Tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrololine-3-yl)amine, tert-butyl ... Quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, Np- Methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylideneamine, Np-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenyl N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridine sulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4- Methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0186] Suitable protected carboxylic acids include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0187] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (ME), and the like. M), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl] -4-Methoxypiperazin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trimethyl-1-phenylpropanediol, 1- ... ethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl, 3-(imidazolyloxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethyltexilyl silyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate Acid esters, 3-phenylpropionates, 4-oxopentanoates (levulinates), 4,4-(ethylenedithio)pentanoates (levulinoyldithioacetals), pivalates, adamantates, crotonates, 4-methoxycrotonates, benzoates, p-phenylbenzoates, 2,4,6-trimethylbenzoates (mesitoates), alkyl methyl carbonates, 9-fluorenylmethyl carbonates (Fmoc), alkyl ethyl carbonates, alkyl 2,2,2-Trichloroethyl (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoic acid ester, 4-azidobutyric acid ester, 4-nitro-4-methylpentanoic acid ester, o-(dibromomethyl)benzoic acid ester, 2-formylbenzenesulfonic acid ester, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyric acid Acid esters, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothionyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidene orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N'-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronic acid esters, ethyl borate, and phenyl borate.

[0188] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl(trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, ( DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting groups are selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl groups.

[0189] In some embodiments, the phosphorus protecting group is a group that is attached to an internucleotide phosphorus bridge during oligonucleotide synthesis. In some embodiments, the phosphorus protecting group is attached to a sulfur atom of an internucleotide phosphorothioate bridge. In some embodiments, the phosphorus protecting group is attached to an oxygen atom of an internucleotide phosphorothioate bridge. In some embodiments, the phosphorus protecting group is attached to an oxygen atom of an internucleotide phosphate bridge. In some embodiments, the phosphorus protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0190] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids linked to one another by peptide bonds). In some embodiments, a protein contains only naturally occurring amino acids. In some embodiments, a protein contains one or more non-naturally occurring amino acids (e.g., a moiety that forms one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues of a protein chain contain a non-amino acid moiety (e.g., a glycan, etc.). In some embodiments, a protein contains more than one polypeptide chain, e.g., linked by one or more disulfide bonds or associated by other means. In some embodiments, a protein contains L-amino acids, D-amino acids, or both; in some embodiments, a protein contains one or more amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than about 20 amino acids, or less than about 10 amino acids. In some embodiments, the protein is an antibody, an antibody fragment, a biologically active portion thereof, and / or a characteristic portion thereof.

[0191] Sample: As used herein, a "sample" is a specific organism or material obtained from. In some embodiments, the sample is a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, the source of interest includes an organism, such as an animal or a human. In some embodiments, the biological sample includes biological tissue or biological fluid. In some embodiments, the biological sample is or includes any one or more of bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy sample; cell-containing body fluid; suspended nucleic acid; sputum; saliva; urine; cerebrospinal fluid, ascites; pleural fluid; feces; lymphatic fluid; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; washings or lavages, such as ductal lavage or bronchoalveolar lavage; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and / or cells therefrom, etc. In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any suitable means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of bodily fluids (e.g., blood, lymph, feces, etc.), etc. In some embodiments, as will be clear from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components thereof and / or adding one or more agents thereto), for example, filtration using a semi-permeable membrane. Such a "processed sample" may include, for example, nucleic acids or proteins obtained by extraction from a sample or processing a primary sample by techniques such as amplification or reverse transcription of mRNA, isolation and / or purification of specific components, etc. In some embodiments, the sample is an organism. In some embodiments, the sample is a plant. In some embodiments, the sample is an animal. In some embodiments, the sample is a human. In some embodiments, the sample is a non-human organism.

[0192] Stereochemical isomers: As used herein, the phrase "stereochemical isomers" refers to different compounds assembled with the same atoms connected by the same series of bonds, but with different three-dimensional structures that are not interchangeable. In some embodiments of the present invention, the chemical compositions provided may be or may contain a pure composition of an individual stereochemical isomer of a compound; in some embodiments, the chemical compositions provided may be or may contain a mixture of two or more stereochemical isomers of the compound. In certain embodiments, such mixtures contain equal amounts of different stereochemical isomers; in certain embodiments, such mixtures contain different amounts of at least two different stereochemical isomers. In some embodiments, the chemical compositions may contain all diastereomers and / or enantiomers of the compound. In some embodiments, the chemical compositions may contain less than all diastereomers and / or enantiomers of the compound. In some embodiments, if a particular enantiomer of a compound of the present invention is desired, it may be synthesized, for example, by asymmetric synthesis or derivatization with a chiral auxiliary, and the resulting diastereomeric mixture is separated and the auxiliary is cleaved to obtain the pure desired enantiomer. Alternatively, if the molecule contains a basic functional group, such as amino, diastereomeric salts can be formed with an appropriate optically active acid and resolved, for example, by fractional crystallization.

[0193] Subject: As used herein, the term "subject" or "subject" refers to any organism to which a provided compound or composition is administered in accordance with the present invention, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, the subject is suffering from and / or susceptible to a disease, disorder, and / or condition.

[0194] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting the full or nearly full extent or degree of a feature or characteristic of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely evade completion and / or completion or accomplishment or absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0195] Suffering from: An individual "suffering from" a disease, disorder, and / or condition has been diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0196] Susceptible (to a disease): An individual who is "susceptible" to a disease, disorder, and / or condition is one who is at a higher risk of developing the disease, disorder, and / or condition than members of the general community. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not be diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0197] Systemic: As used herein, the phrases "systemic administration," "systemically administered," "peripheral administration," and "peripherally administered" have their art-recognized meaning of administering a compound or composition so that it enters the entire body of the recipient.

[0198] Tautomers: As used herein, the phrase "tautomers" is used to describe organic compounds of different isomers that are readily convertible. Tautomers may be characterized by the formal migration of a hydrogen atom or a proton, accompanied by the shifting of a single bond and an adjacent double bond. In some embodiments, tautomers may result from proton tautomerism (i.e., rearrangement of a proton). In some embodiments, tautomers may result from valence tautomerism (i.e., rapid rearrangement of bond electrons). All such tautomers are intended to be included within the scope of the present invention. In some embodiments, tautomers of a compound exist in mobile equilibrium with one another, such that attempts to synthesize the separate substances would result in mixtures. In some embodiments, tautomers of a compound are separable and isolatable compounds. In some embodiments of the present invention, a chemical composition may be provided that is or includes a pure composition of a single tautomer of a compound. In some embodiments of the present invention, a chemical composition may be provided as a mixture of two or more tautomers of a compound. In certain embodiments, such mixtures contain the same amount of different tautomers; in certain embodiments, such mixtures contain different amounts of at least two tautomers of a compound. In some embodiments of the invention, the chemical composition may contain all tautomers of a compound. In some embodiments of the invention, the chemical composition may contain fewer than all tautomers of a compound. In some embodiments of the invention, the chemical composition may contain one or more tautomers of a compound in amounts that vary over time as a result of interconversion. In some embodiments of the invention, the tautomer is keto-enol tautomerism. One skilled in the chemical arts can "capture" (i.e., chemically modify to retain the "enol" form) the keto-enol tautomer with any suitable reagent known in the chemical arts to obtain an enol derivative that can be subsequently isolated using one or more suitable techniques known in the art. Unless otherwise indicated, the invention encompasses all tautomers of the relevant compounds, whether in pure form or in mixtures with each other.

[0199] Therapeutic Agent: As used herein, the term "therapeutic agent" refers to any agent that induces a therapeutic effect and / or a desired biological and / or pharmacological effect when administered to a subject. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.

[0200] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that induces a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. As will be recognized by those skilled in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance delivered, the target cell or tissue, and others. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, ameliorates, relieves, inhibits, prevents, delays the onset, reduces the severity, and / or reduces the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0201] Treatment: As used herein, the terms "treat", "treatment" or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, suppress, prevent, delay onset, reduce severity, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not show signs of the disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who shows only early signs of the disease, disorder, and / or condition, for example, to reduce the risk of developing pathology associated with the disease, disorder, and / or condition.

[0202] Unsaturated: As used herein, the term "unsaturated" means that a moiety has one or more units of unsaturation.

[0203] Unit dose: As used herein, the term "unit dose" refers to an amount administered as a single dose of a pharmaceutical composition and / or in a physically separate unit. In many embodiments, a unit dose comprises a predetermined amount of an active agent. In some embodiments, a unit dose comprises the entire single dose of the agent. In some embodiments, one or more unit doses are administered to achieve the entire single dose. In some embodiments, administration of multiple unit doses is required or expected to be required to achieve the intended effect. A unit dose can be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic agents, a predetermined amount of a solid form, sustained release formulation, or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose can be in a formulation that includes any of a variety of components in addition to the therapeutic agent. For example, an acceptable carrier (e.g., a pharma- ceutically acceptable carrier), a diluent, a stabilizer, a buffer, a preservative, etc., as described below, can be included. It will be understood by those skilled in the art that in many embodiments, the appropriate total daily dose of a particular therapeutic agent may include a portion or a multiple of a unit dose, and may be determined, for example, by the attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dose level for any particular subject or organism may depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific active compound used; the specific composition used; the age, weight, health, sex and diet of the subject; the number of administrations and the excretion rate of the specific compound used; the duration of treatment; drugs and / or additional therapies used in combination or simultaneously with the specific compound used, and similar factors well known in the medical field.

[0204] Wild-type: As used herein, the term "wild-type" has its art-recognized meaning of referring to an entity having a structure and / or activity actually found in a "normal" (as opposed to mutant, diseased, altered, etc.) state or context. Those of skill in the art will recognize that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0205] Nucleic acid: The term "nucleic acid" includes any nucleotide, its modified variants, its analogs, and its polymers. As used herein, the term "polynucleotide" refers to any length of polymeric form of nucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA), or their modified variants or analogs. These terms refer to the primary structure of the molecule, and thus include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include, as equivalents, nucleotide analogs, such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides, and analogs of either RNA or DNA made from modified polynucleotides. These terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N- or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus atom bridges (also referred to herein as "internucleotide linkages"). The terms encompass nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified phosphorus atom bridges. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. The prefix poly- refers to a nucleic acid containing from 2 to about 10,000 nucleotide monomer units, where the prefix oligo- refers to a nucleic acid containing from 2 to about 200 nucleotide monomer units.

[0206] Nucleotide: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide consisting of a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing internucleotide linkages. The naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T) and uracil (U)) are derivatives of purines or pyrimidines, but should be understood to include natural and unnatural base analogs. Natural sugars are pentose (five-carbon sugars), deoxyribose (forming DNA) or ribose (forming RNA), but should be understood to include natural and unnatural sugar analogs. Nucleotides are linked via internucleotide linkages to form nucleic acids or polynucleotides. Many internucleotide linkages are known in the art (e.g., but not limited to, phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothioates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate backbone of natural nucleic acids, such as those described herein. Other analogs (e.g., artificial nucleic acids, or moieties that can be incorporated into nucleic acids or artificial nucleic acids) include: boranophosphate RNA, FANA, locked nucleic acid (LNA), morpholino, peptide nucleic acid (PNA), threose nucleic acid (TNA), and glycol nucleic acid (GNA). Those of skill in the art will recognize a variety of modified nucleotides or nucleotide analogs, including, for example, those described in any of the following: Gryaznov, S; Chen, J.-KJ Am. Chem. Soc. 1994, 116, 3143; Hendrix et al., 1997 Chem. Eur. J. 3:110; Hyrup et al., 1996 Bioorg. Med. Chem. 4:5; Jepsen et al., 2004 Oligo. 14:130-146; Jones et al., J. Org. Chem. 1993, 58, 2983; Koizumi et al., 2003 Nuc. Acids Res.12:3267-3273;Koshkin et al., 1998 Tetrahedron54:3607-3630;Kumar et al., 1998 Bioo.Med.Chem.Let.8:2219-2222;Lauritsen et al., 2002 Chem.Comm.5:530-531;Lauritsen et al., 2003 Bioo.Med.Chem.Lett.13:253-256;Mesmaeker et al., Angew.Chem.,Int.Ed.Engl.1994,33,226;Morita et al., 2001 Nucl.Acids Res.Supp.1:241-242;Morita et al., 2002 Bioo.Med.Chem.Lett.12:73-76;Morita et al., 2003 Bioo.Med.Chem.Lett.2211-2226;Nielsen et al., 1997 Chem.Soc.Rev.73;Nielsen et al., 1997 J.Chem.Soc.PerkinsTransl.1:3423-3433;Obika et al., 1997 Tetrahedron Lett.38(50):8735-8;Obika et al., 1998 Tetrahedron Lett.39:5401-5404;Pallan et al., 2012 Chem.Comm.48:8195-8197;Petersen et al., 2003 TRENDS Biotech.21:74-81;Rajwanshi et al., 1999 Chem.Commun.1395-1396;Schultz et al., 1996 Nucleic Acids Res. 24:2966;Seth et al., 2009 J. Med. Chem. 52:10-13;Seth et al., 2010 J. Med. Chem. 53:8309-8318;Seth et al., 2010 J. Org. Chem. 75:1569-1581;Seth et al., 2012 Bioo. Med. Chem. Lett. 22:296-299;Seth et al., 2012 Mol. Ther-Nuc. Acids.1,e47;Seth,Punit P;Siwkowski,Andrew;Allerson,Charles R;Vasquez,Guillermo;Lee,Sam;Prakash,Thazha P;Kinberger,Garth;Migawa,Michael T;Gaus,Hans;Bhat,Balkrishen;et al. From Nucleic Acids Symposium Series(2008),52(1),553-554;Singh et al., 1998 Chem.Comm.1247-1248;Singh et al., 1998 J.Org.Chem.63:10035-39;Singh et al., 1998 J.Org.Chem.63:6078-6079;Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et al., Ann. NY Acad. Sci. 1988, 507, 220; Van Aerschot et al., 1995 Angew. Chem. Int. Ed. Engl. 34:1338; Vasseur et al., J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO 2016 / 079181.

[0207] Nucleoside: The term "nucleoside" refers to a moiety in which a nucleobase or modified nucleobase is covalently linked to a sugar or modified sugar.

[0208] Sugar: The term "sugar" refers to a monosaccharide in closed and / or open form. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term also encompasses structural analogs that are used in place of normal sugar molecules, such as glycols, whose polymers form the backbone of the nucleic acid analog, glycol nucleic acid ("GNA").

[0209] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar, such that the modified sugar mimics the spatial arrangement, electronic state, or some other physicochemical property of a sugar.

[0210] Nucleic acid base: The term "nucleic acid base" refers to a nucleic acid moiety that is involved in hydrogen bonds that bind one nucleic acid strand to another complementary strand in a sequence-specific manner. Most natural nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the natural nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the natural nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase is a "modified nucleobase", e.g., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobases mimic the spatial arrangement, electronic state, or some other physicochemical property of the nucleobases and retain the hydrogen bonding properties that allow one nucleic acid strand to bind to another complementary strand in a sequence-specific manner. In some embodiments, the modified nucleobases can pair with all five natural bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of the oligonucleotide duplex.

[0211] Chiral Ligand: The term "chiral ligand" or "chiral auxiliary" refers to a moiety that is chiral and can be incorporated into a reactant such that a reaction can be carried out with a particular stereoselectivity.

[0212] Condensation Reagent: In a condensation reaction, the term "condensation reagent" refers to a reagent that activates a less reactive site, making it more susceptible to action with another reagent. In some embodiments, such another reagent is a nucleophile.

[0213] Blocking Group: The term "blocking group" refers to a group that masks the reactivity of a functional group that can be subsequently unmasked by removal of the blocking group. In some embodiments, a blocking group is a protecting group.

[0214] Moiety: The term "moiety" refers to a specific segment or functional group of a molecule. A chemical moiety is often recognized as a chemical entity that is incorporated into or added to a molecule.

[0215] Solid support: The term "solid support" refers to any support that allows the synthesis of nucleic acids. In some embodiments, the term refers to glass or polymer that is insoluble in the medium used in the reaction step to carry out nucleic acid synthesis and derivatize to introduce reactive groups. In some embodiments, the solid support is highly crosslinked polystyrene (HCP) or controlled pore glass (CPG). In some embodiments, the solid support is controlled pore glass (CPG). In some embodiments, the solid support is a composite support of controlled pore glass (CPG) and highly crosslinked polystyrene (HCP).

[0216] Linking moiety: The term "linking moiety" refers to any moiety that may be located between a terminal nucleotide and the solid support or between a terminal nucleoside and another nucleoside, nucleotide, or nucleic acid.

[0217] DNA molecule: The term "DNA molecule" refers to its single-stranded form or the polymeric form of double-stranded deoxyribonucleotides (adenine, guanine, thymine, or cytosine). The term refers only to the primary and secondary structure of the molecule and does not limit it to any particular tertiary form. Thus, the term includes double-stranded DNA found in linear DNA molecules (e.g., restriction enzyme fragments), viruses, plasmids, and chromosomes, among others. In discussing specific double-stranded DNA molecular structures, the sequence may be described herein according to the convention of giving only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).

[0218] Coding sequence: A DNA "coding sequence" or "coding region" is a double-stranded DNA that is transcribed and translated into an in vivo polypeptide when placed under the control of appropriate expression control sequences. The boundaries of the coding sequence ("open reading frame" or "ORF") are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxylic) terminus. Coding sequences include, but are not limited to, prokaryotic sequences, cDNA from prokaryotic mRNA, genomic DNA sequences from prokaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. Polyadenylation signals and transcription termination sequences are usually located 3' to the coding sequence. The term "non-coding sequence" or "non-coding region" refers to regions of a polynucleotide sequence that are not translated into amino acids (e.g., 5' and 3' untranslated regions).

[0219] Reading Frame: The term "reading frame" refers to one of six possible reading frames, three in each direction of a double-stranded DNA molecule. The reading frame used determines which codons are used to code for amino acids within the coding sequence of the DNA molecule.

[0220] Antisense: As used herein, an "antisense" nucleic acid molecule comprises a nucleotide sequence that is complementary to a "sense" nucleic acid that codes for a protein, for example, complementary to the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence, or complementary to the coding strand of a gene. Thus, an antisense nucleic acid molecule can associate with a sense nucleic acid molecule through hydrogen bonds. In some embodiments, an antisense oligonucleotide is an oligonucleotide that participates in RNaseH-mediated cleavage; for example, an antisense oligonucleotide sequence-specifically hybridizes to a portion of a target mRNA, thus targeting the mRNA for cleavage by RNaseH. In some embodiments, an antisense oligonucleotide can distinguish between wild-type and mutant alleles of a target. In some embodiments, an antisense oligonucleotide participates largely in RNaseH-mediated cleavage of mutant alleles, but participates to a much lesser extent in RNaseH-mediated cleavage of wild-type alleles (e.g., does not participate largely in RNaseH-mediated cleavage of a target wild-type allele).

[0221] Wobble position: As used herein, "wobble position" refers to the third position of a codon. In some embodiments, the mutation in the DNA molecule in the wobble position of a codon results in silent or conservative mutation at the amino acid level. For example, there are four codons that code for glycine, namely, GGU, GGC, GGA and GGG, and therefore, the mutation of any nucleotide in the wobble position to another nucleotide selected from A, U, C and G will not result in any change at the amino acid level of the encoded protein, and therefore is a silent substitution.

[0222] Silent Substitution: A "silent substitution" or "silent mutation" is one in which the nucleotide in a codon is changed but does not result in a change in the amino acid residue encoded by the codon. Examples include mutations in the first position of a particular codon, such as the codon "CGG," which still codes for Arg when mutated to AGG, as well as in the third position of the codon.

[0223] Gene: As used herein, the terms "gene", "recombinant gene" and "gene construct" refer to a DNA molecule, or a portion of a DNA molecule, that codes for a protein or a portion thereof. The DNA molecule may contain an open reading frame that codes for the protein (as an exon sequence) and may further contain an intron sequence. As used herein, the term "intron" refers to a DNA sequence present in a given gene that is not translated into a protein, and in some, but not all, cases, found between exons. As is well known in the art, it may be desirable for a gene to be operably associated with (or may contain) one or more promoters, enhancers, repressors and / or other control sequences that regulate the activity or expression of the gene.

[0224] Complementary DNA: As used herein, "complementary DNA" or "cDNA" includes a recombinant polynucleotide synthesized by reverse transcription of mRNA from which intervening sequences (introns) have been removed.

[0225] Homology: "homology" or "identity" or "similarity" refers to the sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position of each sequence that can be located for purposes of comparison. When the same position of the compared sequences is occupied by the same base, then the molecules are identical at that position; when the same site is occupied by the same or similar nucleic acid residue (e.g., similar in steric and / or electronic state), then the molecules can be called homologous (similar) at that position. Expression of percentage of homology / similarity or identity represents a function of the number of identical or similar nucleic acids at a position shared by the compared sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces the identity and homology / similarity.

[0226] In some embodiments, the term "homology" describes a mathematically based comparison of sequence similarity used for identical genes with similar functions or motifs. The nucleic acid sequences described herein can be used as "query sequences" to perform searches against public databases, for example, to identify other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. In some embodiments, gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402 to obtain gapped alignments for comparison purposes. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and BLAST) can be used (see www.ncbi.nlm.nih.gov).

[0227] Identity: As used herein, "identity" means the percentage of identical nucleotide residues at corresponding positions in two or more sequences when the sequences are aligned for maximum sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods to determine identity are designed to maximize the match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs.Computer program methods for determining identity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)). The well known Smith Waterman algorithm can also be used to determine identity.

[0228] Heterologous: A "heterologous" region of a DNA sequence is an identifiable segment of DNA within a larger DNA sequence that is not found in relation to the larger sequence at all. Thus, when a heterologous region codes for a mammalian gene, the gene may be on a side of DNA that is not normally adjacent to the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a sequence where the coding sequence itself is not found at all (e.g., a cDNA containing introns or synthetic sequences where the genomic coding sequence has different codons or motifs from the unmodified gene). Allelic variation or natural mutation events do not give rise to a non-homologous region of DNA as defined herein.

[0229] Transition Mutation: The term "transition mutation" refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by another pyrimidine, or a purine (adenosine (A) or guanosine (G)) is replaced by another purine.

[0230] Transversion Mutation: The term "transversion mutation" refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by a purine, or a purine (adenosine (A) or guanosine (G)) is replaced by a pyrimidine.

[0231] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotide monomers containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges (also referred to herein as "internucleotide linkages" as further defined herein).

[0232] Oligonucleotides can be single-stranded or double-stranded. In this specification, the term "oligonucleotide strand" encompasses single-stranded oligonucleotides. Single-stranded oligonucleotides can have double-stranded regions, and double-stranded oligonucleotides can have single-stranded regions. Illustrative oligonucleotides include, but are not limited to, structural genes, genes including control and termination regions, viral or plasmid DNA, self-replicating systems such as single-stranded and double-stranded siRNAs and other RNA interference agents (RNAi agents or iRNA agents), shRNAs, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0233] The double-stranded and single-stranded oligonucleotides that are effective in inducing RNA interference are also referred to herein as siRNA, RNAi agent, or iRNA agent.In some embodiments, these RNA interference-inducing oligonucleotides are associated with a cytoplasmic multiprotein complex known as RNAi-induced silencing complex (RISC).In many embodiments, single-stranded and double-stranded RNAi agents are long enough that they can be cut by endogenous molecules, such as Dicer, to produce smaller oligonucleotides that can enter RISC machinery and participate in the RISC-mediated cleavage of target sequence, such as target mRNA.

[0234] The oligonucleotides of the invention can be of various lengths. In certain embodiments, the oligonucleotides can range from about 2 to about 200 nucleotides in length. In various related embodiments, the single-stranded, double-stranded, and triple-stranded oligonucleotides can range in length from about 4 to about 10 nucleotides, about 10 to about 50 nucleotides, about 20 to about 50 nucleotides, about 15 to about 30 nucleotides, about 20 to about 30 nucleotides. In some embodiments, the oligonucleotides are about 9 to about 39 nucleotides in length. In some embodiments, the oligonucleotides are at least 4 nucleotides in length. In some embodiments, the oligonucleotides are at least 5 nucleotides in length. In some embodiments, the oligonucleotides are at least 6 nucleotides in length. In some embodiments, the oligonucleotides are at least 7 nucleotides in length. In some embodiments, the oligonucleotides are at least 8 nucleotides in length. In some embodiments, the oligonucleotides are at least 9 nucleotides in length. In some embodiments, the oligonucleotides are at least 10 nucleotides in length. In some embodiments, the oligonucleotides are at least 11 nucleotides in length. In some embodiments, the oligonucleotides are at least 12 nucleotides in length. In some embodiments, the oligonucleotide is at least 15 nucleotides in length. In some embodiments, the oligonucleotide is at least 20 nucleotides in length. In some embodiments, the oligonucleotide is at least 25 nucleotides in length. In some embodiments, the oligonucleotide is at least 30 nucleotides in length. In some embodiments, the oligonucleotide is a double-stranded complementary strand at least 18 nucleotides in length. In some embodiments, the oligonucleotide is a double-stranded complementary strand at least 21 nucleotides in length.

[0235] Internucleotide linkage: As used herein, the phrase "internucleotide linkage" generally refers to a phosphorus-containing bond between nucleotide units of an oligonucleotide, and is synonymous above and herein with "intersugar linkage" and "phosphorus atom bridge." In some embodiments, the internucleotide linkage is a phosphodiester linkage found in natural DNA and RNA molecules. In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" in which each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are =S, =Se, =NR', -SR', -SeR', -N(R'). 2 , B(R') 3 In some embodiments, the internucleotide linkage is selected from, but is not limited to, a phosphotriester linkage, a phosphorothioate diester linkage, a phosphodi ... [ka] or a modified phosphorothioate triester linkage. Those skilled in the art will appreciate that the internucleotide linkages may exist as anions or cations at a given pH depending on the presence of acid or base moieties in the linkage.

[0236] Unless otherwise specified, when used in conjunction with an oligonucleotide sequence, s, s1, s2, s3, s4, s5, s6 and s7 each independently represent the following modified internucleotide bridges as shown below: [Table 1] TIFF2025029016000004.tif184166TIFF2025029016000005.tif66166

[0237] For example, (Rp,Sp)-ATsCs1GA has 1) a phosphorothioate internucleotide bond between T and C; ( [ka] ) ; and 2) between C and G [ka] Unless otherwise specified, the Rp / Sp designation preceding an oligonucleotide sequence refers to the configuration of the chiral bond phosphorus atom of the internucleotide bond from 5' to 3' in the oligonucleotide sequence. For example, in (Rp,Sp)-ATsCs1GA, the phosphorus of the "s" bond between T and C has the Rp configuration, and the phosphorus of the "s1" bond between C and G has the Sp configuration. In some embodiments, "all(Rp)" or "all(Sp)" are used to indicate that all chiral bond phosphorus atoms of the oligonucleotide have the same Rp or Sp configuration, respectively. For example, all (Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all of the chiral linking phosphorus atoms of the oligonucleotide have the Rp configuration; all (Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all of the chiral linking phosphorus atoms of the oligonucleotide have the Sp configuration.

[0238] Oligonucleotide Type: As used herein, the phrase "oligonucleotide type" refers to an oligonucleotide that is an oligonucleotide having a particular base sequence, backbone linkage pattern (i.e., internucleotide linkage pattern, e.g., phosphate, phosphorothioate, etc.), backbone chiral center pattern (i.e., linked phosphorus stereochemical pattern (Rp / Sp)), and backbone phosphorus modification pattern (e.g., "-XLR" in Formula I). 1 "Type" refers to an oligonucleotide that has a specific pattern of repeating units (such as a "type" of oligonucleotide). Oligonucleotides of a commonly designated "type" are structurally identical to each other.

[0239] Those skilled in the art will recognize that the synthesis method of the present invention provides a degree of control during the synthesis of an oligonucleotide chain, such that each nucleotide unit of the oligonucleotide chain can be designed and / or preselected to have a specific stereochemistry at the linking phosphorus and / or a specific modification at the linking phosphorus and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is designed and / or determined to have a specific combination of modifications at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of one or more of the above structural features. The present invention provides compositions (e.g., chiral controlled oligonucleotide compositions) that include or consist of a plurality of oligonucleotide molecules. In some embodiments, all such molecules are of the same type (i.e., structurally identical to each other). However, in many embodiments, the compositions provided include a plurality of oligonucleotides of different types, usually in a predetermined relative amount.

[0240] Chiral control: As used herein, "chiral control" refers to the ability to control the stereochemical representation of any chiral linkage phosphorus within an oligonucleotide chain. The phrase "chiral controlled oligonucleotide" refers to an oligonucleotide that exists in a single diastereomeric form with respect to the chiral linkage phosphorus. Chiral controlled oligonucleotides are prepared from chiral controlled oligonucleotide synthesis.

[0241] Chiral control oligonucleotide composition: As used herein, the phrase "chiral control oligonucleotide composition" refers to an oligonucleotide composition that contains a certain level of an individual oligonucleotide type. For example, in some embodiments, the chiral control oligonucleotide composition contains one oligonucleotide type. In some embodiments, the chiral control oligonucleotide composition contains a mixture of multiple oligonucleotide types. Illustrative chiral control oligonucleotide compositions are further described herein.

[0242] Chiral pure: The phrase "chiral pure" is used herein to describe chiral controlled oligonucleotide compositions in which the entire oligonucleotide exists in a single diastereoisomer with respect to the phosphorus linkage.

[0243] Chiral homogeneity: As used herein, the phrase "chiral homogeneity" is used to describe an oligonucleotide molecule or type in which all nucleotide units have the same stereochemistry at the junction phosphorus.For example, an oligonucleotide whose nucleotide units all have Rp stereochemistry at the junction phosphorus is chiral homogeneous.Similarly, an oligonucleotide whose nucleotide units all have Sp stereochemistry at the junction phosphorus is chiral homogeneous.

[0244] Predetermined: Predetermined means deliberately selected, e.g., as opposed to randomly occurring or achieved. Those skilled in the art will understand upon reading this specification that the present invention provides new and surprising technology that allows for the selection of specific oligonucleotide types for formulation and / or inclusion in the provided compositions, and further allows for controlled formulation of the selected specific types, optionally in selected specific relative amounts, precisely, so that the provided compositions are formulated. Such provided compositions are "predetermined" as described herein. Compositions that may include specific individual oligonucleotide types are not "predetermined" compositions, because they were created through a process that, by chance, does not control the intentional creation of specific oligonucleotide types. In some embodiments, a predetermined composition is one that can be intentionally replicated (e.g., through repetition of a controlled process).

[0245] Linked phosphorus: As defined herein, the phrase "linked phosphorus" is used to indicate that the particular phosphorus atom depicted is present in an internucleotide linkage, which corresponds to the phosphorus atom of a phosphodiester internucleotide linkage occurring in natural DNA and RNA. In some embodiments, the linked phosphorus atom is in a modified internucleotide linkage, in which each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the linked phosphorus atom is represented by the P * In some embodiments, the linking phosphorus atom is chiral. In some embodiments, the chiral linking phosphorus atom is P * It is.

[0246] P modification: As used herein, the term "P modification" refers to any modification at the bound phosphorus other than a stereochemical modification. In some embodiments, a P modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the bound phosphorus. In some embodiments, the "P modification" includes the addition, substitution, or removal of a pendant moiety covalently attached to the bound phosphorus. 1 (Wherein, X, L and R 1 are independently as defined and described herein and below).

[0247] Blockmir: As used herein, the term "blockmir" refers to an oligonucleotide chain in which the pattern of structural features that characterize each individual nucleotide unit is characterized by the presence of at least two consecutive nucleotide units that share a common structural feature at the internucleotide phosphorus bond. A common structural feature refers to a common stereochemistry at the bond phosphorus or a common modification at the bond phosphorus. In some embodiments, the at least two consecutive nucleotide units that share a common structural feature at the internucleotide phosphorus bond are referred to as "blocks."

[0248] In some embodiments, the blockmir is a "stereoblockmir", e.g., at least two consecutive nucleotide units have the same stereochemistry at the bond phosphorus. Such at least two consecutive nucleotide units form a "stereoblockmir". For example, (Rp,Sp)-ATsCs1GA is a stereoblockmir, since at least two consecutive nucleotide units, Ts and Cs1, have the same stereochemistry at the bond phosphorus (both Sp). In the same oligonucleotide, (Rp,Sp)-ATsCs1 forms a block, which is a stereoblock.

[0249] In some embodiments, the blockmir is a "P-modified blockmir", e.g., at least two consecutive nucleotide units have the same modification at the linked phosphorus. Such at least two consecutive nucleotide units form a "P-modified block". For example, (Rp,Sp)-ATsCsGA is a P-modified blockmir because at least two consecutive nucleotide units, Ts and Cs, have the same P modification (i.e., both are phosphorothioate diester). In the same oligonucleotide of (Rp,Sp)-ATsCsGA, TsCs forms a block, which is a P-modified block.

[0250] In some embodiments, the blockmir is a "linked blockmir", e.g., at least two consecutive nucleotide units have the same stereochemistry and the same modification at the linking phosphorus. At least two consecutive nucleotide units form a "linked block". For example, (Rp,Rp)-ATsCsGA is a linked blockmir, since at least two consecutive nucleotide units, Ts and Cs, have the same stereochemistry (both Rp) and P modification (both phosphorothioate). In the same oligonucleotide of (Rp,Rp)-ATsCsGA, TsCs forms a block and is a linked block.

[0251] In some embodiments, the blockmir comprises one or more blocks independently selected from a stereoblock, a P-modified block, and a conjugated block, in some embodiments the blockmir is a stereoblockmir to one block, and / or a P-modified blockmir to another block, and / or a conjugated blockmir to yet another block. For example, (Rp,Rp,Rp,Rp,Rp,Sp,Sp,Sp)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG is a stereoblockmir with respect to the stereoblocks AsTsCsGsAs1 (all Rp at the bound phosphorus) or Ts1Cs1Gs1 (all Sp at the bound phosphorus), a P-modified blockmir with respect to the P-modified blocks AsTsCsGs (all s bonds) or As1Ts1Cs1Gs1 (all s1 bonds), or a bonded blockmir with respect to the bonded blocks AsTsCsGs (all Rp and all s bonds at the bound phosphorus) or Ts1Cs1Gs1 (all Sp and all s1 bonds at the bound phosphorus).

[0252] Altmer: As used herein, the term "altmer" refers to an oligonucleotide chain whose structural feature pattern characterizing each individual nucleotide unit is characterized by the absence of two consecutive nucleotide units in the oligonucleotide chain that share a particular structural feature in the internucleotide phosphorus bond. In some embodiments, the altmer is designed such that it contains a repeating pattern. In some embodiments, the altmer is designed such that it does not contain a repeating pattern.

[0253] In some embodiments, the altomer is a "stereoaltomer", e.g., no two consecutive nucleotide units have the same stereochemistry at the linking phosphorus, e.g., (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsCsGsCsAsCsC.

[0254] In some embodiments, the altmer is a "P-modified altmer", e.g., no two consecutive nucleotide units have the same modification at the bound phosphorus. For example, all (Sp)CAs1GsT, where each bound phosphorus has a different P modification than the others.

[0255] In some embodiments, the altmer is a "linked altmer", e.g., no two consecutive nucleotide units have the same stereochemistry or the same modification at the linked phosphorus, e.g., (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC.

[0256] Unimer: As used herein, the term "unimer" refers to an oligonucleotide chain whose structural feature pattern characterizes each individual nucleotide unit, in which all nucleotide units in the chain share at least one common structural feature at the internucleotide phosphorus bond. A common structural feature refers to a common stereochemistry at the bond phosphorus or a common modification at the bond phosphorus.

[0257] In some embodiments, the unimer is a "stereounimer", e.g., all nucleotide units have the same stereochemistry at the linkage phosphorus, e.g., all (Sp)-CsAs1GsT, where all of the linkages have Sp phosphorus.

[0258] In some embodiments, the unimer is a "P-modified unimer", e.g., all nucleotide units have the same modification at the linked phosphorus, e.g., (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC.

[0259] In some embodiments, the unimer is a "linked unimer", e.g., all nucleotide units have the same stereochemistry and the same modification at the linked phosphorus, e.g., all (Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsCsGsCsAsCsC, where all of the internucleotide linkages are phosphorothioate diesters with an Sp linked phosphorus.

[0260] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide chain characterized in that at least one internucleotide phosphorus bond of the oligonucleotide chain is a phosphodiester bond, such as that found in natural DNA or RNA. In some embodiments, one or more internucleotide phosphorus bonds of the oligonucleotide chain are phosphodiester bonds, such as those found in natural DNA or RNA. For example, all (Sp)-CAs1GsT, in which the internucleotide bond between C and A is a phosphodiester bond.

[0261] Skipmer: As used herein, the term "skipmer" refers to a type of gapmer in which every other internucleotide phosphorus bond of the oligonucleotide strand is a phosphodiester bond, such as that found in natural DNA or RNA, and every other internucleotide phosphorus bond of the oligonucleotide strand is a modified internucleotide bond, e.g., all (Sp)-AsTCs1GAs2TCs3G.

[0262] For purposes of this invention, the chemical elements are identified according to the Periodic Table of the Elements, compiled by CAS, Handbook of Chemistry and Physics, 67th Edition, 1986-87, inside cover.

[0263] The methods and structures described herein relating to the compounds and compositions of the invention also apply to pharma- ceutically acceptable acids or base addition acids and all stereoisomers of these compounds and compositions. [Brief description of the drawings]

[0264] [Figure 1] Figure 1 shows the relative activity of oligonucleotides inducing exon 51 skipping in human DMD patient-derived fibroblasts carrying the Δ48-50 deletion (DMD cells carrying del48-50). Results were normalized to the label WV-942. The Taqman assay used specifically detects DMD transcripts that have skipped exon 51.

[0265] [Diagram 2] Figure 2 shows the relative activity of oligonucleotides inducing exon 51 skipping in human DMD patient-derived fibroblasts carrying the Δ48-50 deletion. Results were normalized to untreated controls. The Taqman assay used specifically detects DMD transcripts that have skipped exon 51.

[0266] [Figure 3A] Figure 3A shows the expression of muscle differentiation markers in differentiated human DMD fibroblasts with or without oligonucleotide treatment compared to untreated controls. Taqman assays specific for DMD, DES, MYOD1, MYOG, MYH1 and RYR1 were used. [Figure 3B] Figure 3B shows the expression of muscle differentiation markers in differentiated human DMD fibroblasts with or without oligonucleotide treatment compared to untreated controls. Taqman assays specific for DMD, DES, MYOD1, MYOG, MYH1 and RYR1 were used. [Figure 3C] Figure 3C shows the expression of muscle differentiation markers in differentiated human DMD fibroblasts with or without oligonucleotide treatment compared to untreated controls. Taqman assays specific for DMD, DES, MYOD1, MYOG, MYH1 and RYR1 were used. [Figure 3D] Figure 3D shows the expression of muscle differentiation markers in differentiated human DMD fibroblasts with or without oligonucleotide treatment compared to untreated controls. Taqman assays specific for DMD, DES, MYOD1, MYOG, MYH1 and RYR1 were used. [Figure 3E] Figure 3E shows the expression of muscle differentiation markers in differentiated human DMD fibroblasts with or without oligonucleotide treatment compared to untreated controls. Taqman assays specific for DMD, DES, MYOD1, MYOG, MYH1 and RYR1 were used. [Figure 3F]Figure 3F shows the expression of muscle differentiation markers in differentiated human DMD fibroblasts with or without oligonucleotide treatment compared to untreated controls. Taqman assays specific for DMD, DES, MYOD1, MYOG, MYH1 and RYR1 were used.

[0267] [Figure 4] Example of a time course of C3a complement activation. Oligonucleotide concentration: 330 μg / mL; 37° C.

[0268] [Diagram 5] Example of a time course of Bb complement activation. Oligonucleotide concentration: 330 μg / mL; 37° C.

[0269] [Figure 6] Example of albumin binding.

[0270] [Figure 7A] Various oligonucleotide sequences and chemistries: WV395 and WV884-WV897. The subscripts .01 and .02 indicate batch numbers. These include stereochemically pure (chirally pure) oligonucleotides or oligonucleotide compositions containing 2'-OMe modifications. [Figure 7B] Various oligonucleotide sequences and chemistries: WV395 and WV884-WV897. The subscripts .01 and .02 indicate batch numbers. These include stereochemically pure (chirally pure) oligonucleotides or oligonucleotide compositions containing 2'-OMe modifications.

[0271] [Figure 8]Figures 8A and 8B. Ability of different oligonucleotides to induce exon 51 skipping of human dystrophin. Figure 8B is a compilation of data including more than three replicates. Controls: WV-942, WV-1714 and untreated. Concentration: 10 μM; Duration: 4 days in differentiation medium; Treatment was gymnotic (no transfection reagent). Cells: Del 48-50 [primary human myoblasts from patients with (dystrophin deletion exon 48-50), DL589.2 (dystrophin deletion exon 51-55)].

[0272] [Figure 9A] Composition of PS (phosphorothioate) and 2'-F on the wings of various oligonucleotides, including WV-2095 to WV-2109. WV-2106 to WV-2109 are hemimers. [Figure 9B] Composition of PS (phosphorothioate) and 2'-F on the wings of various oligonucleotides, including WV-2095 to WV-2109. WV-2106 to WV-2109 are hemimers.

[0273] [Figure 10] Figures 10A and 10B. Ability of various oligonucleotides to induce skipping of dystrophin exon 51. Figure 10B shows additional data for WV-1714. WV-1683, the negative control for this experiment, targets mouse exon 23.

[0274] [Figure 11A] The sequences and chemistry of the various oligonucleotides, WV-1108 and WV-2381 to WV-2395, which have PS (phosphorothioate) in the wings and PO (phosphodiester) in the core. [Figure 11B] The sequences and chemistry of the various oligonucleotides, WV-1108 and WV-2381 to WV-2395, which have PS (phosphorothioate) in the wings and PO (phosphodiester) in the core.

[0275] [Figure 12] Ability of different oligonucleotides to induce skipping of exon 51 of dystrophin. Controls: WV-942 (Drisapersen, sterically randomized) and untreated. Concentration: 10 μM; Duration: 4 days in differentiation medium; Cells: Del 48-50; Treatment was gymnotic (without transfection reagent).

[0276] [Figure 13A] The sequences and chemistry of various oligonucleotides, WV-2366 to WV-2370, which have phosphorothioates in the Sp configuration in the wings and PO (phosphodiester) in the core. [Figure 13B] Figures 13A and 13B. Sequences and chemistries of various oligonucleotides, WV-2366 to WV-2370. These have phosphorothioates in the Sp configuration in the wings and PO (phosphodiester) in the core.

[0277] [Figure 14] Ability of different oligonucleotides to induce skipping of exon 51 of dystrophin. Controls: WV-942 and untreated. Concentration: 10 μM; Duration: 4 days in differentiation medium; Cells: Del 48-50; Treatment was gymnotic (without transfection reagent).

[0278] [Figure 15] The sequences and chemistry of various oligonucleotides that are 20-mers or 25-mers, including WV-2313 to WV-2320, WV-2223 to WV-2230.

[0279] [Figure 16] Position of various oligonucleotide sequences, 20-mers or 25-mers, including WV-2313 to WV-2320, WV-2223 to WV-2230, relative to human (H) and mouse (M) dystrophin sequences.

[0280] [Figure 17] Ability of different oligonucleotides to induce skipping of exon 51 of dystrophin. Controls: WV-942 and untreated. Concentration: 10 μM; Duration: 4 days in differentiation medium; Cells: Del 48-50; Treatment was gymnotic (without transfection reagent).

[0281] [Figure 18] Exon skipping with the active compound, oligonucleotide WV-942, delivered by gymnotic delivery (not conjugated to lipids) or delivered by conjugation to lipids (listed in Table 5).

[0282] [Figure 19] In vivo pharmacokinetic (PK) data relating to delivery of oligonucleotide WV-942 delivered by gymnotic delivery (not conjugated to lipid) or by conjugation to lipid to gastrocnemius, cardiac and quadriceps muscle tissues. The articles tested are listed in Table 4. From left to right: WV-942, WV-2588, WV-2581, WV-2582, WV-2584, WV-2585, WV-2586 and WV-2587.

[0283] [Figure 20] In vivo pharmacokinetic (PK) data associated with delivery of WV-942 delivered by gymnotic delivery (not conjugated to lipid) or by conjugation to lipid to gastrocnemius, cardiac, quadriceps and diaphragm muscle tissues. From left to right: WV-942, WV-2588, WV-2581, WV-2582, WV-2584, WV-2585, WV-2586 and WV-2587.

[0284] [Figure 21] Standard curves of lipid conjugates in different tissues (quadriceps and diaphragm).

[0285] [Figure 22] Standard curves of lipid conjugates in different tissues (heart and gastrocnemius muscle).

[0286] [Figure 23] Examples of lipid and linker structures for conjugation to active compounds. Abbreviations: Oligo: an example of an oligonucleotide.

[0287] [Figure 24] Figure 24 shows the efficacy of stereochemically pure oligonucleotides with 2'-F wings and PO or Rp cores in skipping exon 51 of human dystrophin compared to WV-942 (Drisapersen). Treatment was 10 μM gymnotic treatment.

[0288] [Diagram 25] Figure 25 shows the effectiveness of stereo-pure oligonucleotides in skipping exon 51 of human dystrophin compared to WV-942. Data for two different doses (3 μM and 10 μM) are presented. Bottom left is stereo-random material with different patterns of 2'-F and 2'-OMe modifications. Bottom right is stereo-pure oligonucleotide.

[0289] [Figure 26] Figure 26 shows the efficacy of various oligonucleotides, shown as fold change compared to WV-942. Data for two different doses (3 μM and 10 μM) are presented.

[0290] [Figure 27A] Figure 27A shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27B]Figure 27B shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27C] Figure 27C shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27D] Figure 27D shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27E] Figure 27E shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27F] Figure 27F shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27G] Figure 27G shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Fig. 27H] Figure 27H shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27I] Figure 27I shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27J] Figure 27J shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27K] Figure 27K shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27L] Figure 27L shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27M] Figure 27M shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27N] Figure 27N shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers. [Figure 27O] Figure 27O shows liquid chromatographic and mass spectral data for oligonucleotides WV887, WV892, WV896, WV1714, WV2444, WV2445, WV2526, WV2527, WV2528 and WV2530. The subscripts (01), (02), .01, .02 indicate batch numbers.

[0291] [Figure 28] Figure 28 shows an example of skipping efficiency of certain provided chirality-controlled oligonucleotide compositions in skipping exon 51 of human dystrophin compared to WV-942. Data for three different doses (1 μM, 3 μM and 10 μM) are presented. In general, skipping efficiency increases with increasing concentration. Treatment was gymnotic (without transfection reagent).

[0292] [Figure 29] Figure 29 shows an example of skipping efficiency of certain provided chirality-controlled oligonucleotide compositions in skipping exon 51 of human dystrophin compared to WV-942. Data for different doses from 0.3 μM to 30 μM are presented. In general, skipping efficiency increases with increasing concentration. WV-3545 (WV-3473 conjugated with stearic acid by PO and C6 amino linker) and WV-3546 (WV-3473 conjugated with terbinaric acid by PO and C6 amino linker), both of which contain oligonucleotide-lipid conjugates, showed higher efficiency. Treatment was gymnotic (without transfection reagent). Experiments were repeated three times and average data shown.

[0293] [Diagram 30] Figure 30 shows that some examples of provided oligonucleotides have no hTLR9 agonist activity under the conditions tested. Experiments were repeated three times and average data is shown.

[0294] [Diagram 31] Figure 31 shows that various provided oligonucleotides can block the hTLR9 agonist activity of oligonucleotide ODN2006 (and antagonize hTLR9). As shown, conjugates of oligonucleotides with lipids (e.g., stearic acid (WV-3545) or terbinaric acid (WV-3546)) (e.g., WV-3473 (WV-3545 and WV-3546)) have a significant increase in hTLR9 antagonist activity. The concentration of agonist oligonucleotide ODN2006 was kept constant at 0.3 μM. Each oligonucleotide was tested at decreasing concentrations of 5, 2.5, 1.25, 0.6, 0.3, 0.15 and 0.075 μM (from left to right). The treatment was gymnotic (without transfection reagent). The experiment was repeated three times and the average data is shown.

[0295] [Diagram 32]Figure 32 shows that various oligonucleotides can block the hTLR9 agonist activity of oligonucleotide ODN2006 (and antagonize hTLR9). As shown, conjugates of oligonucleotides with lipids (e.g., stearic acid (WV-3545) or terbinaric acid (WV-3546)) (e.g., WV-3473 (WV-3545 and WV-3546)) have a significant increase in hTLR9 antagonist activity. neg: negative control (buffer only). ODN2006c: agonist control with CpG sequence replaced by GpC. PMO: eteplirsen The concentration of agonist oligonucleotide ODN2006 was kept constant at 0.3 μM. Each oligonucleotide was tested at decreasing concentrations of 5, 2.5, 1.25, 0.6, 0.3, 0.15 and 0.075 μM (from left to right). Treatment was gymnotic (no transfection reagent). Experiments were repeated three times and average data are shown.

[0296] [Diagram 33] Figure 33 shows an example of skipping efficiency of certain provided chirality-controlled oligonucleotide compositions in skipping exon 51 of human dystrophin compared to WV-942 and PMO (eteplirsen). In general, skipping efficiency increases with increasing concentration. Data for different doses from 0.1 μM to 10 μM are presented. DMD del48-50 cells were used. Treatment was gymnotic (without transfection reagent).

[0297] [Diagram 34]Figure 34 shows an example of skipping efficiency of certain provided chirality-controlled oligonucleotide compositions in skipping exon 51 of human dystrophin compared to WV-942 and PMO (eteplirsen). In general, skipping efficiency increases with increasing concentration. Data for three different doses (1 μM, 3 μM and 10 μM) are presented. DMD del48-50 cells were used. Treatment was gymnotic (without transfection reagent). neg: negative control.

[0298] [Diagram 35] Figure 35 shows an example of skipping efficiency of certain provided chirality-controlled oligonucleotide compositions in skipping exon 51 of human dystrophin. In general, skipping efficiency increases with increasing concentration. Data for four different doses (1 μM, 3 μM, 10 μM and 10 μM) are presented. DMD del48-50 cells were used. Treatment was gymnotic (without transfection reagent).

[0299] [Diagram 36] Figure 36 shows an example of the skipping efficiency of certain provided oligonucleotide compositions in skipping exon 51 of human dystrophin compared to WV-942. Data is presented for a dose of 10 μM. Treatment was gymnotic (without transfection reagent). DMD del48-50 cells were used.

[0300] [Figure 37] Figure 37 shows an example of the skipping efficiency of certain provided oligonucleotide compositions in skipping exon 51 of human dystrophin compared to WV-942. Data is shown for two doses of 3 μM (right bar) and 10 μM (left bar). Treatment was gymnotic (without transfection reagent). Under the conditions tested, lipid conjugation efficiently increased skipping.

[0301] [Figure 38A] FIG. 38A shows an example of the distribution of oligonucleotides in various muscle tissues: gastrocnemius (FIG. 38A). [Figure 38B] FIG. 38B shows examples of oligonucleotide distribution in various muscle tissues: triceps (FIG. 38B). [Figure 38C] FIG. 38C shows examples of oligonucleotide distribution in different muscle tissues: heart (FIG. 38C). [Figure 38D] FIG. 38D shows an example of the distribution of oligonucleotides in various muscle tissues: diaphragm (FIG. 38D). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0302] Synthetic oligonucleotides provide useful molecular tools in a variety of applications. For example, oligonucleotides are useful for therapeutic, diagnostic, research, and new nanomaterial applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their susceptibility to endonucleases and exonucleases. Thus, to circumvent these drawbacks, various synthetic counterparts have been developed. These synthetic counterparts include synthetic oligonucleotides that contain chemical modifications, such as base modifications, sugar modifications, backbone modifications, etc., that render these molecules less susceptible to denaturation and improve other properties of the oligonucleotides. Chemical modifications may also result in certain undesirable effects, such as increased toxicity. From a structural point of view, modifications to the phosphate bridges between nucleotides introduce chirality, and certain properties of the oligonucleotides can be influenced by the arrangement of the phosphorus atoms that form the backbone of the oligonucleotide. For example, in vitro studies have shown that the properties of antisense nucleotides, such as binding affinity, sequences that specifically bind to complementary RNA, and stability against nucleases, are particularly influenced by the chirality of the backbone (e.g., the arrangement of the phosphorus atoms).

[0303] In particular, the present disclosure encompasses the recognition that structural elements of an oligonucleotide, e.g., base sequence, chemical modifications (e.g., modifications of sugars, bases and / or internucleotide bridges, and their pattern), and / or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotide bridges), and / or their pattern), can have significant effects on properties, e.g., activity, toxicity, as may be mediated, for example, by protein binding characteristics, stability, ability to alter splicing, etc. In some embodiments, oligonucleotide properties can be modulated by optimizing chemical modifications (modifications of bases, sugars and / or internucleotide bridges) and / or stereochemistry (pattern of backbone chiral centers).

[0304] In some embodiments, the present disclosure shows that oligonucleotide compositions comprising oligonucleotides with controlled structural elements (e.g., controlled chemical modifications and / or controlled backbone stereochemical patterns) confer unexpected properties, including, but not limited to, those described herein. In some embodiments, the provided compositions comprising oligonucleotides with chemical modifications (e.g., base modifications, sugar modifications, internucleotide bridge modifications, etc.) have improved properties, such as improved ability to alter splicing, low toxicity or improved protein binding profile and / or improved delivery. In particular, in some embodiments, the present disclosure provides compositions and methods for altering splicing of transcripts. In some embodiments, the altered transcript splicing by the provided compositions and methods includes the production of products with desired and / or improved biological functions and / or knockdown of undesired products, such as by modifying splicing products such that undesired biological functions can be suppressed or eliminated.

[0305] In some embodiments, the transcript is a pre-mRNA. In some embodiments, the splicing product is a mature RNA. In some embodiments, the splicing product is an mRNA. In some embodiments, the modification comprises skipping one or more exons. In some embodiments, the splicing of the transcript is improved in that the skipping of the exon increases the amount of mRNA and protein with improved beneficial activity compared to the absence of exon skipping. In some embodiments, an exon that causes a frameshift is skipped. In some embodiments, an exon that contains an undesired mutation is skipped. In some embodiments, an exon that contains a premature termination codon is skipped. The undesired mutation may be a mutation that causes a change in the protein sequence or may be a silent mutation. In some embodiments, an exon that contains an undesired SNP is skipped.

[0306] In some embodiments, the splicing of the transcript is improved in that exon skipping reduces the amount of mRNA and protein with undesired activity compared to the absence of exon skipping. In some embodiments, the target is knocked down by exon skipping, such that the skipping of one or more exons causes premature stop codons and / or frameshift mutations.

[0307] Reading frame correction is achieved by skipping one or two exons flanking the deletion, by skipping an in-frame exon containing a nonsense mutation, or by skipping a duplicated exon.

[0308] In some embodiments, the disclosure provides compositions and methods for reducing certain undesirable repeats (e.g., CAG repeats) by altering splicing (e.g., skipping exons) (see, e.g., Evers et al., Targeting several CAG expansion diseases by a single antisense oligonucleotide, PLoS One. 2011;6(9):e24308.doi:10.1371 / journal.pone.0024308; Mulders et al., Triplet-repeat oligonucleotide-mediated reversal of RNA toxicity in myotonic dystrophy, Proc Natl Acad Sci US A. 2009 Aug. 18;106(33):13915-20, etc.). Examples of targets include, but are not limited to, HTT, ATXN3, DMPK, CNBP, AR, C9ORF72 (a target in familial frontotemporal dementia and amyotrophic lateral sclerosis), and those listed below. [Table 2] TIFF2025029016000009.tif83166

[0309] In some embodiments, a provided oligonucleotide (e.g., a first plurality of oligonucleotides) in a provided composition comprises a base modification, a sugar modification, and / or an internucleotide bridge modification. In some embodiments, a provided oligonucleotide comprises a base modification and a sugar modification. In some embodiments, a provided oligonucleotide comprises a base modification and an internucleotide bridge modification. In some embodiments, a provided oligonucleotide comprises a sugar modification and an internucleotide modification. In some embodiments, a provided composition comprises a base modification, a sugar modification, and an internucleotide bridge modification. Examples of chemical modifications (e.g., base modifications, sugar modifications, internucleotide bridge modifications, etc.) are widely known in the art, including, but not limited to, those described in this disclosure. In some embodiments, the modified base is a substituted A, T, C, G, or U. In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is a 2-F modification. In some embodiments, the 2'-modification is a 2'-OR 1 In some embodiments, the 2'-modification is 2'-OR 1 where R 1is an optionally substituted alkyl. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar moiety is a bridged bicyclic or polycyclic ring. In some embodiments, the modified sugar moiety is a bridged bicyclic or polycyclic ring containing 5-20 ring atoms, where one or more ring atoms are optionally and independently a heteroatom. Examples of ring structures are widely known in the art, e.g., those found in BNAs, LNAs, etc. In some embodiments, the oligonucleotides provided contain both one or more modified internucleotide bridges and one or more natural phosphate bridges. In some embodiments, oligonucleotides and compositions thereof containing both modified internucleotide bridges and natural phosphate bridges provide improved properties, e.g., activity and toxicity. In some embodiments, the modified internucleotide bridge is a chiral internucleotide bridge. In some embodiments, the modified internucleotide bridge is a phosphorothioate bridge. In some embodiments, the modified internucleotide bridge is a substituted phosphorothioate bridge. In particular, the present disclosure embraces the recognition that a stereo-randomized oligonucleotide preparation comprises multiple distinct chemical moieties that differ from each other, for example, from each other in the stereochemical configuration of the individual backbone chiral centers in the oligonucleotide chain. Without controlling the stereochemistry of the backbone chiral centers, a stereo-randomized oligonucleotide preparation results in an uncontrolled composition that comprises an undetermined amount of oligonucleotide stereoisomers. These stereoisomers may have the same base sequence, but these stereoisomers are different chemical moieties due to at least their different backbone stereochemistry, and may have different properties (e.g., activity, toxicity, etc.), as shown herein. In particular, the present disclosure provides new compositions that are or comprise a particular stereoisomer of an oligonucleotide of interest. In some embodiments, a particular stereoisomer may be defined, for example, by its base sequence, its length, its backbone crosslinking pattern, and its backbone chiral center pattern. As understood in the art, in some embodiments, base sequence may refer to the identity and / or modification state of the nucleoside residues in an oligonucleotide (e.g., the identity and / or modification state of the sugar and / or base elements relative to standard naturally occurring nucleotides, e.g., adenine, cytosine, guanosine, thymine, and uracil) and / or the hybridization characteristics of such residues (i.e., the ability to hybridize with a specific complementary residue). In some embodiments, the oligonucleotides in the provided compositions include sugar modifications, e.g., 2'-modifications, in the wing regions. In some embodi...

Claims

[Claim 1] 1. An oligonucleotide composition comprising: (1) nucleotide sequence; (2) backbone crosslinking pattern; (3) the pattern of chiral centers in the backbone; and (4) Backbone phosphorus modification pattern a first plurality of oligonucleotides of a particular oligonucleotide type defined by the composition has controlled chirality in that it is enriched for said particular oligonucleotide type relative to a substantially racemic preparation of said oligonucleotide having the same base sequence; wherein, when the oligonucleotide composition is contacted with a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof. Oligonucleotide Compositions.

Images