AAV mediated gene therapy that restores otoferlin gene

Abstract

To provide pharmaceutical compositions for use in treatment of patients afflicted with DFNB9 deafness, or in preventing DFNB9 deafness in patients having DFNB9 mutations.SOLUTION: The pharmaceutical composition of the invention comprises a vector system that allows the expression of full-length otoferlin polypeptide in inner hair cells, where the vector system comprises at least two kinds of AAV particles, i) one contains a polynucleotide comprising a recombinant inducing region of a size of 100 to 500 nucleotides, and a polynucleotide comprising a partial coding sequence encoding the N terminal part of the otoferlin polypeptide, and ii) the other contains a polynucleotide comprising a recombinant inducing region of a size of 100 to 500 nucleotides, and a polynucleotide comprising a partial coding sequence encoding the C terminal part of the otoferlin polypeptide, and the patient is a human patient having a developed and mature auditory system.SELECTED DRAWING: None

Description

[Background technology]

[0001] More than half of cases of nonsyndromic profound congenital deafness have a genetic cause, with most (~80%) being autosomal recessive (DFNB) (Duman D. & Tekin M, Front Biosci (Landmark Ed) 17:2213-2236 (2012)). Genetic diagnosis of deafness provides essential information for cochlear gene therapy, and rapid advances have been made in both accuracy and accessibility of genetic testing in the past few years. Identification of mutations in syndromic deafness genes can occur years before symptoms appear in patients, allowing time to plan disease management.

[0002] Deafness genes code for proteins with a wide range of molecular functions essential for the functioning of the cochlea, such as sensory organ development, sound transduction in the hair cell stereocilia, maintenance of the endocochlear potential (EP) and high concentrations of extracellular potassium, and synaptic neurotransmission between hair cells and spiral ganglion neurons (SGNs). The main proteins made by deafness genes include ion channels and transporters, gap and tight junctions, protein subunits in the cytoskeleton and molecular motors, and transcription factors that are transiently expressed in the developing cochlea. Whether mutations affect early cochlear development and cause significant cellular degeneration is a major factor in determining the "treatment time window," a critical issue in this therapeutic field.

[0003] Although prosthetic cochlear implants are currently used in rehabilitation (Kral A & O'Donoghue GM N Engl J Med 363(15):1438-1450 (2010)), hearing restoration is far from complete, especially for speech perception in noisy environments or for music perception, due to the inherent limitations in frequency resolution imposed by electrical interference between channels.

[0004] The main motivation for developing biological therapies is to restore hearing without implanting any prosthetic device and to achieve a sound resolution quality and cost much better than what is currently achievable by cochlear implants. In particular, gene therapy by localized adeno-associated virus (AAV)-mediated gene therapy has already been proposed to treat human forms of hearing loss (Zhang et al, Frontiers in Molecular Neuroscience, vol.11, Art.221, 2018).

[0005] Using the Ush1c c.216G>A knock-in mouse model to study Usher type 1C disease, Pan et al. Nature biotechnology; 35(3):264-272 (2017) tested whether cochlear gene therapy could be used to target hair cells and correct the hearing loss phenotype. A novel synthetic AAV, Anc80L65, was able to transduce over 90% of hair cells. Treatment showed morphological protection of the cochlea, and hearing thresholds improved by 60-70 dB compared to untreated ears when the recombinant viral vector was injected at P0-P1 (i.e., the day the mice were born or the day after, referred to as "postnatal day 0 or 1"). The same injections performed at P10-P12 (i.e., 10 or 12 days after birth, just before the onset of hearing - in this species, onset of hearing occurs around P12) produced no therapeutic effect (Pan et al. Nature biotechnology; 35(3):264-272 (2017)).

[0006] Akil et al. Neuron 75:283-293 (2012) used AAV2 / 1 to deliver vesicular glutamate transporter 3 (Vglut3) cDNA to the cochleae of neonatal (i.e., 1-12 days after birth) KO mice to treat impaired synaptic transmission in inner hair cells. Based on data from auditory brainstem responses (ABRs) and acoustic startle reflexes, the authors showed that hearing function in the injected ear was restored within 2 weeks.

[0007] These two studies confirmed a significant reduction in cellular degeneration in the cochlea when recombinant viral vectors were injected at early postnatal stages (ie, prior to maturation of mouse hair cells).

[0008] To date, all gene therapy studies that have evaluated inner ear treatments in mice have concluded that these treatments are not effective in adult animals. Thus, there is consensus that a critical period exists for gene therapy to be effective in protecting or restoring hearing, and that the therapeutic window of opportunity exists only in mice during fetal or early postnatal stages, i.e., before the onset of hearing occurs (Ahmed et al, JARO 18:649-670 (2017)).

[0009] The mouse inner ear is structurally and functionally immature at birth, and it is well known that in this species, hearing expression occurs at postnatal day 12 (P12) and is complete around postnatal day 20 (P20) (Shnerson and Willott, J. Comp. Physiol. Psychol. 94, 36-40 (1980)). However, hearing expression and maturation occurs at a completely different time in humans. In fact, the human inner ear develops hearing function as early as 4.5 months in utero and is complete at birth (see Figure 6 and Hepper PG & Shahidullah BS Arch Dis Child71(2):F81-87 (1994)).

[0010] This means that prior art experiments aiming to restore hearing function before the onset of hearing or before the completion of cochlear maturation would have to be performed in utero when translated into human trials (Figure 6).To date, no humans have been treated by gene therapy of hair cells, as it was thought impossible to restore hearing after birth or during early childhood (i.e., when the auditory system is fully mature and functional).

[0011] Nevertheless, the ultimate goal of cochlear gene therapy is the treatment of common hereditary hearing loss in humans after potentially genetically induced hearing loss has been detected or diagnosed, i.e., in most cases after birth.

[0012] It is practically not possible to develop a gene therapy protocol that involves in utero delivery of the therapy to the cochlea, because this surgical procedure may induce several side effects, among which is definitive hearing loss (Zhang et al, Frontiers in Molecular Neuroscience, vol.11, Art.221, 2018). Moreover, it is well known that DFNB hearing loss is usually diagnosed in humans during the neonatal period, i.e., between 0 and 4 months after birth.

[0013] Therefore, to be transposable to humans, gene therapy approaches need to be tested and, for example, be efficient in reversing established deafness phenotypes affecting the mature auditory system when administered to mice from birth to P20 (equivalent to juveniles or adults).

[0014] This is the only way to identify a treatment whose time frame is compatible with human ethics and welfare, as it can be administered to postnatal humans, children and adults whose auditory systems are mature. [Brief description of the drawings]

[0015] [Figure 1A]FIG. 1A is a schematic diagram of the recombinant AAV vector pair used in this study and the processes of recombination, transcription, splicing, and translation that generate the full-length protein otoferlin in co-infected cells. [Figure 1B] FIG. 1B shows the expression of otoferlin in HEK293 cells after dual AAV vector delivery. [Figure 2a] FIG. 2a is a confocal image of immunostaining at P70. [Figure 2b] FIG. 2b shows ABR thresholds and hearing thresholds for click stimuli. [Figure 2c] FIG. 2c shows the ABR trace with ABR I wave latency and normalized ABR I wave amplitude. [Figure 3a] FIG. 3a is a confocal image of immunostaining at P80. [Figure 3b] FIG. 3b shows ABR thresholds and hearing thresholds for click stimuli. [Figure 3c] FIG. 3c shows the ABR trace with ABR I wave latency and normalized ABR I wave amplitude. [Figure 4a] FIG. 4a is a confocal image of immunostaining at P40. [Figure 4b] FIG. 4b shows the ABR thresholds. [Figure 4c] FIG. 4c shows the ABR trace with ABR I wave latency and normalized ABR I wave amplitude. [Diagram 5] FIG. 5 shows that dual AAV-mediated gene therapy in Otofts / ts mice restores normal expression of otoferlin and hearing. [Figure 6] FIG. 6 shows the difference in maturity of the auditory systems of humans and mice. [Figure 7] FIG. 7 shows some of the mutations in the DFNB9 gene that have been identified to date. [Figure 8]FIG. 8 shows (A) protein aggregation and misfolding of otoferlin in inner hair cells of Otofts / ts mice, and (B) auditory brainstem responses (ABR) in Otof+ / ts and Otofts / ts mice. [Figure 9] FIG. 9 shows the effects of unilateral injection of a pair of AAV-Otof NT recombinant vectors and AAV-Otof CT recombinant vectors into Otofts / ts mice. [Figure 10] FIG. 10 shows (A) voltage-activation curves of ICa and (B) corresponding ΔCm responses in wild-type, Otofts / ts and treated Otofts / ts IHCs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] The inventors have developed an alternative approach to identify treatments that have a realistic chance of effectively preventing or reversing hearing loss in subjects (particularly humans) whose auditory system (particularly the cochlea) is mature and that do not involve prenatal gene transfer. In this context, the inventors have been able to demonstrate that recombinant expression of otoferlin protein in inner hair cells can restore hearing in a mouse model treated from birth to after P20 (corresponding to a juvenile or adult).

[0017] Otoferlin is abundantly expressed in the sensory inner hair cells (IHCs) of the cochlea, as well as in other cells of the central nervous system. It plays a key role in the final step of synaptic vesicle fusion at the cochlear hair cell synapse with the afferent spiral ganglion neuron. More precisely, it is important for exocytosis at the auditory ribbon synapse (Roux et al, Cell 127(2):277-89, 2006).

[0018] In humans, mutations affecting the otoferlin gene ("OTOF gene") result in severe non-syndromic bilateral hearing loss that develops after birth and before language acquisition. Some of them also result in thermosensitive non-syndromic auditory neuropathy that is triggered by a large increase in body temperature (e.g., in the case of fever, see Marlin S. et al, Biochemical and Biophysical Research Communications, 394 (2010) 737-742 and Varga R. et al, J. Med. Genet 2006; 43:576-581). So far, at least 60 mutations have been identified (see Figure 7), five of which are known to be temperature sensitive (P.Q994VfsX6, P.I515T, p.G541S, PR1607W, p.E1804del, as described in Pangrsic T. et al, Trends in Neurosciences, 2012, col.35, No.11).

[0019] These two deafness phenotypes (constitutive and induced) are found worldwide and are known as "Deafness, Autosomal Recessive 9" or "DFNB9" deafness.

[0020] DFNB9 hearing loss accounts for up to 8% of autosomal recessive non-syndromic hearing loss in some Western populations, thereby still ranking within the top five inherited forms of hearing loss requiring therapeutic intervention.

[0021] Here we report the first proof of principle in the DFNB9 mouse model (OTOF knockout mice) that cochlear delivery of fragmented cDNA via a dual AAV vector approach, when administered sufficiently after the auditory system has matured (P30), can effectively and long-term correct the severe hearing loss phenotype in these mice. This result suggests that the therapeutic window of localized gene transfer in patients with DFNB9 congenital deafness is indeed longer than originally anticipated.

[0022] Indeed, administration of the vectors of the invention, each providing a portion of the OTOF gene, allows expression of the full-length OTOF protein in transfected inner hair cells of OTOF knockout mice at late postnatal stages (P30), resulting in better outcomes than treatment of younger mice.

[0023] This is quite surprising, given that many studies have taught that the therapeutic window for local gene transfer in mice affected by hereditary hearing loss is during the fetal or early postnatal period (Ahmed et al, JARO 18:649-670 (2017); Zhang et al, Frontiers in Molecular Neuroscience, vol.11, Art.221, 2018).

[0024] It is known that in mice, a full range of response frequencies can be observed by P14 (i.e., postnatal day 14). Response latencies and interpeak intervals mature rapidly during the second and third postnatal weeks, becoming adult-like characteristics by P18 (Song L. et al, J Acoust Soc Am 119(4):2242-2257 (2006)). Thus, at P30, the mouse auditory system is fully mature, which corresponds to that of a child or adult (see FIG. 6).

[0025] Thus, the results obtained by the inventors indicate that the gene therapy used in the present invention may be effective not only in humans in the prenatal time frame, but also in pediatric patients diagnosed with congenital DFNB9 hearing loss, or in adult patients diagnosed even later, for example due to a temperature-sensitive mutation in the OTOF gene.

[0026] In a first aspect, the present invention relates to a vector system enabling expression of a full-length otoferlin polypeptide or a functional fragment thereof in inner hair cells for use in treating a patient suffering from DFNB9 hearing loss, said patient being preferably an infant, child, teenager or adult.

[0027] As used herein, the term "otoferlin" refers to the otoferlin polypeptide, abbreviated herein as "OTOF." This polypeptide is also known as "AUNB1," "DFNB6," "DFNB9," "NSRD9," and "FER1L2."

[0028] The full length of wild-type human otoferlin polypeptide isoform 1 is shown in SEQ ID NO: 1 (corresponding to Genbank number AF183185.1). This polypeptide is a member of the Ferlin family of transmembrane proteins and has a C2 domain as synaptotagmin, PKC and PLC. This long form contains six C2 domains. As mentioned above, it is involved in synaptic vesicle fusion between cochlear hair cells and afferent spiral ganglion neurons (Roux et al, Cell 127(2):277-89, 2006; Michalski et al, Elife, 2017 Nov 7;6 e31013).

[0029] The term "otoferlin polypeptide" in the present context refers to the otoferlin polypeptide of SEQ ID NO: 1 and its homologous sequences that retain at least one biological function of the otoferlin polypeptide of interest. For example, this biological function is related to the regulation of vesicle fusion at ribbon synapses of cochlear inner hair cells that activate primary auditory neurons (Roux et al. 2006; Michalski et al., Elife, 2017 Nov 7;6 e31013). This regulation can be assessed by classical ex vivo electrophysiological measurements.

[0030] In a preferred embodiment, the vector system of the invention allows the expression of a homologous polypeptide whose amino acid sequence shares at least 70% identity and / or similarity with SEQ ID NO: 1. More preferably, said homologous sequence shares at least 75%, even more preferably at least 80% or at least 90% identity and / or similarity with SEQ ID NO: 1. If the homologous polypeptide is much shorter than SEQ ID NO: 1, local alignment may be taken into account.

[0031] The homologous polypeptide may, for example, have the amino acid sequence set forth in SEQ ID NO: 5 (corresponding to Genbank number NP_001274418). The sequence characterizes isoform e (variant 5) of the wild-type human otoferlin polypeptide. This isoform e is encoded by a cDNA variant having the sequence of SEQ ID NO: 22. This variant lacks an alternative in-frame exon in the 3' coding region and uses a downstream stop codon compared to SEQ ID NO: 1. It codes for a different C-terminus (but its N-terminal portion is the same) compared to SEQ ID NO: 1.

[0032] Said homologous polypeptides can also have the amino acid sequence shown in SEQ ID NO: 6 (corresponding to Genbank number NP_004793.2) or SEQ ID NO: 24 (corresponding to Genbank number NP_919303.1), which correspond to the short isoforms b and c (variants 2 and 3), respectively. More precisely, SEQ ID NO: 6 represents isoform b (variant 2, also called "short form 1"), which has a shorter N-terminus and is missing one segment compared to SEQ ID NO: 1. On the other hand, SEQ ID NO: 24 represents isoform c (variant 3, also called "short form 2"), which is shorter and has a different C-terminus compared to SEQ ID NO: 1, and therefore differs in the 5'UTR and coding sequence compared to variant 1 (SEQ ID NO: 1).

[0033] The homologous sequence may also be, for example, an otoferlin polypeptide of another animal species, such as SEQ ID NO: 7 (corresponding to Genbank number NP_001093865.1), which is the mouse full-length isoform 1 of the otoferlin polypeptide. This isoform is encoded by the cDNA of SEQ ID NO: 16 (NM_1100395).

[0034] In the context of the present invention, when the identity percentage between the two homologous sequences can be determined by global alignment of the entire sequences (e.g., when the sequences are approximately the same size), this alignment can be performed by algorithms well known to those skilled in the art, such as the algorithm disclosed in Needleman and Wunsch (1970). Thus, sequence comparison between two amino acid sequences or two nucleotide sequences can be performed by using any software known to those skilled in the art, such as the "needle" software using a "gap open" parameter of 10, a "gap extend" parameter of 0.5 and the "Blosum62" matrix.

[0035] If local alignment of sequences is to be taken into account (e.g. in the case of homologues having a smaller size than the sequence of the invention), said alignment can be carried out by conventional algorithms, for example the algorithm disclosed in Smith and Waterman (J. Mol. Evol. 1981; 18(1) 38-46).

[0036] The present invention provides a system that encodes a homologous amino acid sequence that is "similar" to SEQ ID NO:1 or SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:24. The "similarity" of two target amino acid sequences can be determined by calculating a similarity score for the two amino acid sequences. As used herein, "similarity score" refers to the score generated for two sequences when the two sequences are optimally aligned using the BLOSUM62 amino acid substitution matrix, a gap presence penalty of 11 and a gap extension penalty of 1. Two sequences are "optimally aligned" when they are aligned to generate the maximum score possible for the pair of sequences. To achieve that maximum score, it may be necessary to introduce gaps into one or both sequences. Two amino acid sequences are substantially similar if the similarity score exceeds a certain threshold. The threshold can be any integer ranging from at least 1190 to the maximum score possible for a particular reference sequence (e.g., SEQ ID NO:1). For example, the threshold similarity score may be 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, 1500 or more. In a particular embodiment of the invention, when the threshold score is set at, for example, 1300 and the reference sequence is SEQ ID NO:1, then any amino acid sequence is "similar" to SEQ ID NO:1 if it can be optimally aligned with SEQ ID NO:1 to generate a similarity score of more than 1300.Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well known in the art and are described, for example, in Dayhoff et al. (1978), "A model of evolutionary change in proteins", "Atlas of Protein Sequence and Structure," Vol. 5, Suppl. 3 (ed. MO Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, DC, and Henikoff et al. (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919. While optimal alignment and scoring can be performed manually, the process is facilitated by the use of computer-implemented alignment algorithms, such as gapped BLAST 2.0 (described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402 and publicly available on the National Center for Biotechnology Information website). To generate accurate similarity scores using NCBI BLAST, it is important to turn off any filtering (e.g., low complexity filtering) and disable the use of composition based statistics. Also, one must ensure that the correct substitution matrix and gap penalties are used. Optimal alignments (including multiple alignments) can be created, for example, using PSI-BLAST (available through the NCBI internet site and described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402).

[0037] In another embodiment, the vector system of the present invention can allow the expression of a functional fragment of an otoferlin polypeptide. The term "functional fragment" in this specification refers to any fragment of a human otoferlin polypeptide or any fragment of a polypeptide having a homologous sequence as defined above, said fragment retaining at least one biological function of the otoferlin polypeptide of interest in this context. For example, this biological function is involved in the regulation of vesicle fusion at ribbon synapses of cochlear inner hair cells that activate primary auditory neurons (Roux et al. 2006; Michalski et al., Elife, 2017 Nov 7;6 e31013). This regulation can be evaluated by classical ex vivo electrophysiological measurements.

[0038] For example, the functional fragment may have the amino acid sequence set forth in SEQ ID NO: 6 (corresponding to isoform b having Genbank No. NP_004793.2) or SEQ ID NO: 24 (corresponding to isoform c having Genbank No. NP_919303.1), which characterize a short isoform of the wild-type human otoferlin polypeptide, containing only the three C2 domains.

[0039] In this aspect of the invention, the vector system of the invention is administered to a patient suffering from DFNB9 deafness. By "patient suffering from DFNB9 deafness" is meant herein a patient, particularly a human patient, suspected of (or diagnosed as) having a mutation in the constitutive otoferlin gene, said mutation resulting in aberrant expression, function or both of the otoferlin protein. In certain embodiments, said mutation may be temperature sensitive.

[0040] To date, more than 60 pathogenic mutations have been reported in otoferlin (see Figure 7). Among these, there are at least five temperature-sensitive mutations (P.Q994VfsX6, P.I515T, p.G541S, PR1607W, p.E1804del) that were identified in patients affected by fever-conditioned paroxysmal hearing loss.

[0041] These patients can be identified by a skilled physician using, for example, a combination of electrophysiological testing of the auditory brainstem response (ABR) and / or genetic testing to identify mutations in the OTOF gene. In some embodiments, the patient has one or more of the following nonsense or missense mutations in the OTOF gene: TYR730TER, GLN829TER, PRO1825ALA, PRO50ARG, LEU1011PRO, ILE515THR, ARG1939GLN, or GLY541SER. In some embodiments, the patient has an A to G transition at the intron 8 / exon 9 junction (IVS8-2A-G), or a G to A transition at position +1, which is the first intronic nucleotide in the splice donor site of exon 5, or a G to C transversion at the donor splice site of intron 39. In some embodiments, patients have a one base pair deletion (1778G) resulting in a stop codon in exon 16 and a G to A change at 6141 resulting in an ARG to GLN substitution in exon 48.

[0042] The patients to whom the vector system of the present invention is administered are patients, particularly human patients, whose auditory system, particularly the cochlea, is already developed and mature. These patients, particularly human patients, are therefore not human embryos or fetuses, as the administration is not intended to take place in utero. According to FIG. 7, the patients of interest in the present invention are preferably human newborns, typically less than 6 months of age, or even less than 3 months of age, if DFNB9 hearing loss is diagnosed at that age. These human babies are more preferably between 3 months and 1 year of age.

[0043] Of note, the human cochlea as a whole reaches its adult size at 17-19 weeks of gestation and is fully morphologically mature at 30-36 weeks (corresponding to postnatal day 12 in mice). Functional maturation of the ribbon synapses of the inner hair cells can be assessed by monitoring the I wave of the ABR measurement, which can be measured around 28 weeks of gestation in humans. Recording and analysis of the I wave of the ABR (reflecting the function of the inner hair cell synapses with the primary auditory neurons) shows full functional maturation of human infants at birth (corresponding to postnatal day 20 in mice). This is well known in the art (see, for example, Pujol et Lavigne-Rebillard, Acta oto-laryngologica. Supplementum · February 1991).

[0044] Thus, the vector system of the present invention can also be administered to older human patients, such as infants (2-6 years old), children (6-12 years old), teenagers (12-18 years old) or adults (18 years old or older).

[0045] Overall, therefore, it is preferred to administer the vector system of the present invention to human patients aged between 3 months and 25 years.

[0046] The patients of the present invention are particularly human infants diagnosed with post-lingual DFNB9 hearing loss.

[0047] In another specific embodiment, a patient of the invention is a human aged 6 years or older, ie, administration of treatment occurs when the central nervous system is fully mature (see FIG. 7).

[0048] In a particular embodiment, the vector system of the present invention is administered to a human patient suffering from DFNB9 hearing loss induced by a temperature sensitive mutation, preferably a teenager or adult carrying at least one of the above-mentioned otoferlin temperature sensitive mutations.

[0049] As used herein, the term "treat" is intended to mean the administration of a therapeutically effective amount of one of the vector systems of the present invention to a patient suffering from DFNB9 hearing loss, to partially or completely restore the patient's hearing. Said restoration can be assessed by testing the auditory brainstem response (ABR) with an electrophysiological device. "Treatment of DFNB9 hearing loss" is intended to refer in particular to the complete restoration of hearing function, regardless of the cellular mechanism involved.

[0050] In the case of patients with temperature sensitive mutations, the vector system of the present invention can also be administered to prevent thermoregulation-induced hearing loss. In the context of the present invention, the term "prevent" refers to attenuating or slowing the hearing loss in the audible frequency range.

[0051] In these and other DFNB9 patients, the vector system of the present invention can be administered both to prevent hearing loss before it occurs and to restore hearing once hearing loss has already occurred.

[0052] Multiple delivery routes to the inner ear have been explored. These include injection into the perilymphatic space via the round window membrane (RWM) and oval window, and injection into the scala tympani or scala vestibuli via cochleotomy. Distribution throughout the perilymphatic space has been demonstrated for all of these delivery routes. In addition, it has been demonstrated that advective flow through the cochlea and vestibular organs can facilitate distribution of therapeutics from the injection site to more distant regions of the inner ear. Delivery to the endolymphatic space has also been explored via cochleotomy to the scala media, canalostomy, and injection into the endolymphatic sac. These approaches have also resulted in wide distribution, but face the additional challenge of breaching the barrier between the endolymph and perilymph of high potassium. Breakdown of the barrier creates two potential problems. First, leakage of high potassium into the perilymphatic space bathing the basal outer surface of hair cells and neurons can chronically depolarize these cells, potentially causing cell death. Second, the breaking of tight junctions between the endolymph and perilymph can lead to a decrease in the endocochlear potential, which is normally in the range of +80 to +120 mV. A decrease in the endocochlear potential reduces the driving force for sensory transduction in hair cells, thus leading to decreased cochlear sensitivity and increased hearing thresholds. Avoiding these complications is particularly difficult in the adult cochlea. However, by targeting the endolymphatic space of the vestibular system, which does not have an endocochlear DC potential but is continuous with the endolymphatic space of the cochlea, these confounding issues can be minimized while still providing sufficient distribution within the cochlea (Ahmed et al, JARO 18:649-670 (2017)).

[0053] The cochlea is highly compartmentalized and separated from the rest of the body by the blood-cochlear barrier (BCB). This minimizes therapeutic injection volume and leakage into the body's systemic circulation, protects the immune privilege of the cochlea, and reduces the likelihood of a systemic adverse immune response. Cochlear hair cells and supporting cells do not normally divide, so the cells of the cochlea remain stable, and therefore it is possible to use non-integrating viral vectors (e.g., AAV) for sustained transgene expression.

[0054] Because the posterior semicircular canal appears to be accessible in humans, the semicircular canal approach has been proposed as a promising injection route for future cochlear gene therapy in human trials (Suzuki et al., Sci. Rep. 7:45524 (2017); Yoshimura et al., Sci. Rep. 8:2980 (2018)).

[0055] In a preferred embodiment of the present invention, the vector system of the present invention is administered to the human ear via one of two common and well-established techniques routinely used in clinical otolaryngological surgery practice. More precisely, these approaches are adopted to target the perilymphatic space. For this purpose, injections using a microcatheter are performed either through the oval window using a laser stapedectomy (trans-stapes) or through the transmastoid / trans-round window (Dai C. et al, JARO, 18:601-617, 2017).

[0056] Systemic administration by intravenous injection or infusion is also possible.

[0057] The vector system of the present invention comprises at least one polynucleotide vector capable of inducing expression of a full-length otoferlin polypeptide or a functional fragment thereof in an inner hair cell. Preferably, said polynucleotide vector comprises a coding sequence encoding said polypeptide or a functional fragment thereof operably linked to a promoter specifically enabling expression of the gene in said cell.

[0058] The coding sequence is, for example, the human otoferlin gene of SEQ ID NO: 2, which corresponds to the cDNA sequence of isoform 1 of the human wild-type otoferlin gene (NM_19248.2 = isoform a or variant 1, which is the longest isoform).

[0059] The coding sequence may also be the shorter of SEQ ID NO: 22, the cDNA sequence NM_0011287489.1 (isoform e or variant 5), the cDNA sequence NM_004802.3 (isoform b or variant 2), the cDNA sequence NM_194322.2 (isoform c or variant 3) or the cDNA sequence NM_194323.2 (isoform d or variant 4).

[0060] Several viral and non-viral vectors have been developed for the delivery of genetic material in various tissues and organs. In most cases, these vectors are replication-incompetent and pose little threat of virus-induced disease. Rather, the viral genome is partially or completely deleted and expanded to allow inclusion of a therapeutic DNA cargo within the viral capsid. Some vectors contain single-stranded DNA, while others contain double-stranded DNA. Particularly preferred vectors in the context of the present invention are lentiviral vectors, adenoviral vectors, and adeno-associated viruses (AAV), as disclosed in Ahmed et al, JARO 18:649-670 (2017).

[0061] Specifically, AAVs are small, replication-deficient, adenovirus-dependent viruses of the Parvoviridae family. They have an icosaedrical capsid with a diameter of 20-25 nm and a genome of 4.8 kb that is flanked by two inverted terminal repeats (ITRs). After uncoating within the host cell, the AAV genome can persist in a stable episomal state by forming high molecular weight head-to-tail circular concatemers or can integrate into the host cell genome. Both scenarios provide long-term and high levels of transgene expression.

[0062] AAV appears to be a promising virus for cochlear gene therapy based on the results obtained in human clinical trials of ocular gene therapy. The reasons for the success of AAV in human ocular gene therapy include (1) a proven safety profile (numerous human trials have shown that AAV lacks pathogenicity and has very low immunogenicity), (2) long-term transgene expression in non-dividing cells, and (3) the small size of AAV (approximately 20 nm, which is one-fifth that of adenovirus) helps it to diffuse across cellular barriers and reach target cells (Zhang et al, Frontiers in Molecular Neuroscience, vol.11, Art.221, 2018).

[0063] In a preferred embodiment, the vector system of the present invention comprises at least one AAV particle comprising a polynucleotide encoding a full-length otoferlin polypeptide or a functional fragment thereof, as described above.

[0064] In another preferred embodiment, the vector system of the present invention comprises at least two types of AAV particles, of which i) one type comprises a polynucleotide comprising a partial coding sequence encoding the N-terminal portion of an otoferlin polypeptide or a functional fragment thereof, and ii) another type comprises a polynucleotide comprising a partial coding sequence encoding the C-terminal portion of an otoferlin polypeptide or a functional fragment thereof.

[0065] Twelve naturally occurring serotypes of human AAV have been characterized so far. These serotypes have different intrinsic tropism and transduction efficiency in muscle, lung, liver, brain, retina and vasculature. Multiple attempts at AAV pseudotyping and capsid engineering have led to considerable improvements in tropism and transduction efficiency. With regard to cells of the inner ear, AAV1-4, 7 and 8 have been shown to infect spiral lamina border, spiral ligament and spiral ganglion cells in vivo. Infection of IHC has also been shown for AAV1-3, 5, 6 and 8. AAV1 was the most efficient, occasionally infecting OHC and supporting cells. AAV5 has also been shown to be efficient in Clausius cells, spiral ganglion and inner spiral sulcus cells. Among the pseudotyped vectors, AAV2 / 1 was found to efficiently transduce progenitor cells to give rise to IHCs and OHCs in the mouse cochlea, and AAV2 / 2 was optimal for IHC in the guinea pig cochlea (Ahmed et al, JARO 18:649-670 (2017)).

[0066] Thus, in a preferred embodiment, the vector system of the present invention comprises an AAV vector selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV10.

[0067] In a more preferred embodiment, the serotype of the vector is AAV2, AAV8, AAV5 or AAV1. In an even more preferred embodiment, the serotype of the vector is AAV2 or AAV8. AAV8, which is the most preferred serotype in the context of the present invention, is currently being tested in vivo.

[0068] AAV can be genetically modified to enhance the efficiency of gene expression and prevent unintended spread of the virus. These genetic modifications include deletion of the E1 region, deletion of the E1 region with deletion of either the E2 or E4 region, or deletion of the entire adenoviral genome except for cis-acting inverted terminal repeats and packaging signals. Such vectors are advantageously included in the present invention.

[0069] Furthermore, genetically modified AAVs with mutant capsid proteins can be used to target gene expression to specific tissue types, such as auditory cells. For this purpose, modified serotype-2 and -8 AAV vectors can be used, in which tyrosine residues in the viral envelope are replaced with alanine residues. In the case of tyrosine mutant serotype-2, tyrosine 444 can be replaced with alanine (AAV2-Y444A). In the case of serotype 8, tyrosine 733 can be replaced with alanine residue (AAV8-Y733A). By using AAV2-Y444A or AAV8-Y733A, gene transfer can be increased up to 10,000-fold, and the amount of AAV required to infect sensory hair cells in the cochlea can be reduced.

[0070] In a preferred embodiment, the polynucleotide of the invention expressing an otoferlin polypeptide or gene or a functional fragment thereof is contained in a recombinant AAV2 particle in which all tyrosine residues have been replaced with phenylalanine residues (AAV2(Y->F) or Quad YF as described in Petrs-Silva H et al, Mol. Ther. 19, 293-301 (2011) and in the Examples). Mutated tyrosine residues on the outer surface of the capsid protein include, but are not limited to, mutations such as Tyr252 to Phe252 (Y252F), Tyr272 to Phe272 (Y272F), Tyr444 to Phe444 (Y444F), Tyr500 to Phe500 (Y500F), Tyr700 to Phe700 (Y700F), Tyr704 to Phe704 (Y704F), Tyr730 to Phe730 (Y730F) and Tyr733 to Phe733 (Y733F). These modified vectors facilitate the penetration of vectors across the round window membrane, which allows for non-invasive delivery of vectors to hair cells / spiral ganglion neurons of the cochlea. These mutant vectors avoid proteasomal degradation and their transduction efficiency is greatly improved.

[0071] Other recombinant AAV particles derived from the natural serotypes 1 to 10 include AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShH10, AAV8(Y733F), AAV2.15, AAV2.4, AAVM41 and AAVr3.45 (Asokan A. et al, Mol. Therapy, vol.20 n°4, 699-708, 2012).

[0072] It is also possible to use the synthetic vector Anc80L65, which has been shown to have the highest efficiency for transducing inner ear hair cells reported so far (Suzuki et al., Sci. Rep. 7:45524 (2017)). Exosome-associated AAV can also be used, as proposed by Gyorgy et al., Mol. Ther. 25(2):379-391, 2017.

[0073] An overloaded AAV / PHP.B vector in which the capsid has been modified to enhance packaging capacity may also be used.

[0074] Methods for preparing viruses and virions containing heterologous polynucleotides or constructs are known in the art.In the case of AAV, cells can be co-infected or transfected with adenovirus or polynucleotide constructs that contain suitable adenovirus genes for AAV helper functions.Examples of materials and methods are described, for example, in US8,137,962 and US6,967,018.

[0075] A person skilled in the art will easily determine whether or not it is necessary to enhance the permeability of the round window membrane as proposed in WO2011 / 075838 prior to administration of the vector of the invention, depending on the target cell.

[0076] Even when AAV is used, the system of the invention can be a single vector system, in which case modified capsids may be used (see AAV / PHP.B vectors).

[0077] If the selected AAV capsid has a limited packaging capacity of 5 kilobases, it is better to use a dual vector system, for example as disclosed in WO2013 / 075008, which is incorporated herein by reference.

[0078] The inventors used the dual AAV vector approach to deliver two halves of the otoferlin gene to inner hair cells, where homologous recombination occurs and full-length protein is expressed. The inventors' results show that two different AAV vectors can efficiently transduce target inner hair cells, produce otoferlin protein in inner hair cells, and long-term rescue the severe deafness phenotype of OTOF KO mice suffering from congenital deafness due to DFNB9 invalidation.

[0079] Thus, the vector system of the invention preferably comprises at least two types of AAV particles: Each of the AAV particles comprises: a) a first polynucleotide comprising an inverted terminal repeat at each end of said first polynucleotide and comprising, from 5' to 3' between said inverted terminal repeats, a suitable promoter followed by a partial coding sequence comprising the N-terminal portion of the otoferlin gene and a splice donor site; or b) a second polynucleotide comprising an inverted terminal repeat at each end of said second polynucleotide and comprising, from 5' to 3' between said inverted terminal repeats, a splice acceptor site and a partial coding sequence comprising the C-terminal portion of the otoferlin gene, optionally followed by a polyadenylation sequence. Including any of the following: the first and second polynucleotides each comprise a recombinogenic sequence located after the splice donor site in the first polynucleotide and a recombinogenic sequence located before the splice acceptor site in the second polynucleotide; and The coding sequences in the first and second polynucleotides, when combined, encode the full-length otoferlin polypeptide.

[0080] This preferred embodiment employs a "first" and a "second" polynucleotide. However, it should be understood that "first" and "second" do not imply a particular order or importance unless specifically stated.

[0081] As explained in FIG. 1 and WO2013 / 075008, the first and second polynucleotides used in this particular embodiment must contain certain genetic elements to induce proper recombination and expression of the otoferlin protein in the target cell.

[0082] These specific ingredients are as follows:

[0083] ·ITR In some embodiments of the present invention, a partial or full-length cDNA of the OTOF gene is inserted into two ITR-containing plasmids.

[0084] When using an AAV vector, the ITR sequences of the polynucleotides described herein may be derived from any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) or may be derived from multiple serotypes. In some embodiments of the polynucleotides provided herein, the ITR sequences are derived from AAV2. ITR sequences and plasmids containing ITR sequences are known in the art and commercially available.

[0085] An exemplary AAV2 ITR sequence adjacent to the 5' end of the expression construct comprises the sequence of SEQ ID NO: 10. An exemplary AAV2 ITR sequence adjacent to the 3' end of the expression construct comprises the sequence of SEQ ID NO:11.

[0086] Such ITRs can also be used advantageously when the polynucleotide of the invention is a single vector system.

[0087] · Appropriate promoter Promoters contemplated for use in the vector system of the present invention include, but are not limited to, the cytomegalovirus (CMV) promoter, the SV40 promoter, the Rous sarcoma virus (RSV) promoter, the chimeric CMV / chicken β-actin promoter (CBA) and the truncated form of CBA (smCBA) (U.S. Patent No. 8,298,818). In certain embodiments, the promoter is a chimeric promoter comprising the CMV and β-actin promoters.

[0088] In a preferred embodiment, the promoter used in the vector system of the invention is the truncated chimeric CMV beta actin (smCBA) promoter of SEQ ID NO:8, or a promoter that contains at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:8.

[0089] Such promoters can also be used advantageously when the polynucleotide of the present invention is a single vector system.

[0090] The promoter can be incorporated into the vector using standard techniques known in the art. Multiple copies of the promoter or multiple promoters can be used in the vector system of the present invention. In one embodiment, the promoter can be positioned at approximately the same distance from the transcription start site as it is from the transcription start site in its natural genetic environment. Some variation in this distance can be tolerated without substantially reducing promoter activity. The transcription start site is usually included in the vector.

[0091] A recombination-inducing sequence that promotes homologous recombination of the two halves of the cDNA in vivo to generate and result in the expression of the entire coding sequence of the OTOF polypeptide in transfected inner hair cells. In some embodiments, two polynucleotides of the invention (e.g., a first and a second polynucleotide) comprise a so-called "recombinogenic region" that can promote homologous recombination between the two polynucleotides delivered to a cell (see, e.g., Ghosh et al. Hum Gene Ther. 2011 Jan;22(l):77-83).

[0092] This recombinogenic region is typically a first region of a first polynucleotide that has a homologous region in a second polynucleotide, or vice versa. The two regions preferably have a threshold level of sequence identity as defined above, having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity with each other.

[0093] This recombination induction region preferably has a size consisting of 50 to 500, 50 to 400, 50 to 300, 100 to 500, 100 to 400, 100 to 300, 200 to 500, 200 to 400, or 200 to 300 nucleotides.

[0094] In a preferred embodiment, the two regions are identical and have a size of 200 to 300 nucleotides.

[0095] These recombinogenic sequences have sequences which are sufficiently homologous to permit hybridization to one another under standard stringent conditions and standard methods.

[0096] As used herein, "stringent" conditions of hybridization refer to conditions in which hybridization is typically performed overnight at a temperature 20-25°C below the melting temperature (Tm) of the DNA hybrid in 6xSSPE, 5x Denhardt's solution, 0.1% SDS, 0.1 mg / mL denatured DNA. The melting temperature is represented by the following formula: Tm=81.5C+16.6Log[Na+]+0.41(%G+C)-0.61(%formamide)-600 / length of the duplex in base pairs.

[0097] Washes are typically performed as follows: (1) 2 times for 15 minutes in 1xSSPE, 0.1% SDS at room temperature (low stringency wash), (2) 1 time for 15 minutes in 0.2xSSPE, 0.1% SDS at Tm-20°C (medium stringency wash).

[0098] In a more preferred embodiment, the two regions are identical and have the sequence of SEQ ID NO:9 or a homologous sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:9.

[0099] Splice donor and splice acceptor sites When recombined in vivo, the full-length cDNA contains a splice donor / splice acceptor pair that triggers splicing from the recombination-inducing region. The polynucleotide contained in the dual vector system of the present invention contains a splice donor site or a splice acceptor site. In a preferred embodiment, the splice donor site and / or the splice acceptor site contain a splice consensus sequence. In a more preferred embodiment, the splice donor site and / or the splice acceptor site carried by the polynucleotide contained in the vector system of the present invention contains a splice consensus sequence derived from the alkaline phosphatase enzyme.

[0100] In a preferred embodiment, the polynucleotide comprised in the dual vector system of the invention comprises SEQ ID NO:12 and / or SEQ ID NO:13 as splice donor and splice acceptor sites, respectively, or comprises splice sites that comprise at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:12 and / or SEQ ID NO:13.

[0101] The polynucleotide sequences of the present invention contained in either the single or dual vector system may contain other regulatory components that are functional in the inner hair cells in which the vector is expressed. Those skilled in the art will be able to select regulatory elements for use in human inner hair cells. Regulatory elements include, for example, internal ribosome entry sites (IRES), transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements.

[0102] Transcription termination regions can usually be obtained from the 3' untranslated region of eukaryotic or viral gene sequences. Transcription termination sequences can be placed downstream of coding sequences to provide efficient termination. Signal peptide sequences are amino-terminal sequences that code for information involved in relocating operably linked polypeptides to a wide range of post-translational cellular destinations, from specific organelle compartments to the protein's site of action and the extracellular environment. Enhancers are cis-acting elements that increase transcription of genes and can be included in vectors. Enhancer elements are known in the art and include, but are not limited to, CaMV 35S enhancer element, cytomegalovirus (CMV) early promoter enhancer element, and SV40 enhancer element.

[0103] DNA sequences that direct polyadenylation of the mRNA encoded by the structural gene can also be included in the vector.

[0104] The dual vector approach is advantageous in that the coding sequence of the OTOF gene is split into two parts for easier packaging in virions with limited packaging capacity. When using AAV capsids, it is preferred to use a polynucleotide comprising an OTOF coding sequence that contains 5 kilobases or less, 4 kilobases or less, and even more preferably 3 kilobases or less.

[0105] The coding sequence of the human OTOF gene is preferably cleaved at the natural splice sites.

[0106] For example, human OTOF gene isoform 1 of SEQ ID NO: 2 can be divided into an N-terminal portion having the nucleotide sequence shown in SEQ ID NO: 3 (nucleotides 1 to 2676 of SEQ ID NO: 2) and a C-terminal portion having the nucleotide sequence shown in SEQ ID NO: 4 (nucleotides 2677 to 5994 of SEQ ID NO: 2). And human OTOF gene isoform 5 of SEQ ID NO: 22 can be divided into an N-terminal portion of SEQ ID NO: 3 and a C-terminal portion of SEQ ID NO: 23.

[0107] Exemplary polynucleotides that can be used as the first and second polynucleotides in the vector system of the present invention are, for example, SEQ ID NO: 19 and SEQ ID NO: 20, respectively. These two polynucleotides encode the N-terminal and C-terminal portions, respectively, of isoform 1 of the otoferlin human protein.

[0108] SEQ ID NO: 19 is the 5'ITR sequence of AAV2 having the sequence of SEQ ID NO: 10 (nt 20 to 162), the CMV enhancer (nt 186-440), the chicken β-actin promoter (nt 441-835), exon 1 of the β-actin protein and the chimeric intron (nt 836-1130) (all three referred to as "smCBA" and corresponding to the sequence of SEQ ID NO: 8); the 5' portion (nt 1153 to 3558) of the human otoferlin isoform 1 coding sequence having the sequence of SEQ ID NO: 3, the splice donor site of alkaline phosphatase (nt 3559 to 3642) having the sequence of SEQ ID NO: 12, a recombination-inducing sequence having the sequence of SEQ ID NO: 9 (nt 3649 to 3935), and AAV2 3'ITR sequence having the sequence of SEQ ID NO: 11 Includes.

[0109] On the other hand, SEQ ID NO: 20 is the 5'ITR sequence of AAV2 having the sequence of SEQ ID NO: 10 (nt 20 to 162), a recombination-inducing sequence having the sequence of SEQ ID NO: 9 (nt 207 to 493), the splice acceptor site of alkaline phosphatase (nt 516 to 564) having the sequence of SEQ ID NO: 13, the 3' part (nt 565 to 4152) of the coding sequence of human otoferlin isoform 1 having the sequence of SEQ ID NO: 4, The bovine growth hormone polyadenylation signal (nt 4190-4411), and AAV2 3'ITR sequence having the sequence of SEQ ID NO: 11 Includes.

[0110] Exemplary polynucleotides that can be used as the first and second polynucleotides in the vector system of the present invention are, for example, SEQ ID NO: 19 and SEQ ID NO: 21, respectively. These two polynucleotides encode the N-terminal and C-terminal portions, respectively, of isoform 5 of the otoferlin human gene of SEQ ID NO: 22 (since the N-terminal portions of isoforms 1 and 5 are identical, SEQ ID NO: 19 can be used to induce expression of the two isoforms).

[0111] SEQ ID NO: 21 is the 5'ITR sequence of AAV2 having the sequence of SEQ ID NO: 10 (nt 20 to 162), a recombination-inducing sequence having the sequence of SEQ ID NO: 9 (nt 207 to 493), the splice acceptor site of alkaline phosphatase (nt 516 to 564) having the sequence of SEQ ID NO: 13, the 3' part (nt 565 to 4152) of the coding sequence of human otoferlin isoform 5 having SEQ ID NO: 23, The bovine growth hormone polyadenylation signal (nt 4190-4411), and AAV2 3'ITR sequence having the sequence of SEQ ID NO: 11 Includes.

[0112] Pharmaceutical Compositions of the Present Invention In another aspect, the present invention is directed to a pharmaceutical composition for treating a patient, particularly a human patient, having a mature auditory system and suffering from DFNB9 hearing loss, or for preventing DFNB9 hearing loss in patients carrying a DFNB9 mutation, comprising the vector system of the present invention (i.e. the polynucleotide or a virion comprising same) as described above.

[0113] More generally, the pharmaceutical composition can be administered to a human subject suffering from congenital hearing loss due to altered or defective expression of the DFNB59 gene, such as may be observed when otoferlin is expressed at normal levels but is non-functional.

[0114] In other words, the present invention relates to the use of the vector system of the present invention as described above for the manufacture of a pharmaceutical composition intended to prevent and / or treat patients, in particular humans, who have a mature auditory system and suffer from the above-mentioned disorders associated with altered or defective expression of the DFNB59 gene.

[0115] As used herein, "pharmaceutical acceptable carrier" includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Examples of pharmaceutical acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, and combinations thereof. In many cases, it may be preferable to include an isotonic agent, such as sugars, polyalcohols (e.g., mannitol, sorbitol), or sodium chloride in the composition. The pharmaceutical acceptable carrier may further include minor amounts of auxiliary substances, such as wetting or emulsifying agents, preservatives, or buffers, that enhance the shelf life or effectiveness of the antioxidant compound or pharmaceutical composition containing it.

[0116] The pharmaceutical composition of the present invention can be in various forms. These include liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. The form used depends on the intended mode of administration and therapeutic application. Typical compositions are in the form of injectable or infusible solutions.

[0117] Pharmaceutical compositions must be sterile and stable under the conditions of manufacture and storage. The pharmaceutical compositions of the present invention are preferably formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high drug concentration. Sterile injectable solutions can be prepared by incorporating the vectors of the present invention in the required amount in an appropriate solvent with one or a combination of ingredients as enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the vectors of the present invention into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile lyophilized powders for preparing sterile injectable solutions, the preferred preparation methods are vacuum drying and spray drying, which yield a powder of the active ingredient and any additional desired ingredients from its previously sterile-filtered solution. The proper fluidity of the solution can be maintained, for example, by the use of a coating, such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prolonged absorption of the injectable compositions can be achieved by including an agent that delays absorption, such as monostearate salts and gelatin, in the composition.

[0118] In the context of the present invention, typical modes of administration of the compositions of the present invention are intratympanic (middle ear), intracochlear or parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal). In one example, the pharmaceutical composition of the present invention is administered by intravenous infusion or injection. In another example, the pharmaceutical composition of the present invention is delivered to a specific location using stereostatic delivery, particularly via the tympanic membrane or mastoid in the middle ear.

[0119] More precisely, the compositions of the present invention can be administered using a microcatheter performed either through the oval window using a laser stapedectomy (across the stapes) or across the mastoid process / across the round window (Dai C. et al, JARO, 18:601-617, 2017).

[0120] In a preferred embodiment of the invention, the pharmaceutical composition of the invention is administered to the human ear via intracochlear administration, more precisely by targeting the endolymphatic space of the vestibular system, or by the semicircular canal approach described above.

[0121] The pharmaceutical compositions of the invention typically contain a "therapeutically effective amount" or a "prophylactically effective amount" of a vector of the invention. A "therapeutically effective amount" refers to an amount of a vector of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, in this case for both prevention and treatment of hearing loss, without unacceptable toxicity or undesirable side effects.

[0122] The therapeutically effective amount of the vector of the present invention may vary according to factors such as the condition, age, sex and weight of the subject, as well as the ability of the compound to induce a desired response. A therapeutically effective amount may also be an amount in which the toxic or detrimental effects of the claimed compound are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount of the vector of the present invention that is effective at the dosage and for the period of time necessary to achieve the desired prophylactic result. Typically, a prophylactic dose can be used in subjects before they become ill or at an early stage of the disease, so that the prophylactically effective amount is usually less than the therapeutically effective amount.

[0123] The dosage regimen can be adjusted to provide an optimal desired response (e.g., therapeutic or prophylactic response). For example, a single bolus can be administered, several divided doses can be administered over time, or the dose can be relatively reduced or increased as indicated by the exigencies of the treatment situation. As used herein, dosage unit form refers to a physically discrete unit suitable as a single administration for the mammalian subject to be treated. Each unit contains a predetermined amount of the vector compound of the present invention calculated to produce the desired therapeutic or prophylactic effect, together with the necessary pharmaceutical carrier. The specifications for the dosage unit form are determined by and may depend directly on (a) the intrinsic characteristics of the vector and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the technology of formulating such vectors to treat or prevent hearing loss in a subject.

[0124] In some embodiments in which a first and second AAV particle are used, the first and second AAV polynucleotides / particles may be contained within the same composition or different compositions and may be administered together or separately.

[0125] In some embodiments, the composition of the present invention comprises 10 6 ~10 14 particles / mL or 10 10 ~10 15 particles / mL, or any value between any ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 or 10 14 In one embodiment, the composition of the invention comprises 10 13 Contains > AAV particles / mL.

[0126] In some embodiments, when a first AAV particle comprising a first polynucleotide and a second AAV particle comprising a second polynucleotide are administered, the amount administered is the same for both particles.

[0127] The present invention also relates to a method of treatment comprising the administration of the vector system and pharmaceutical compositions comprising same to a patient, particularly a human patient, having a mature auditory system and suffering from DFNB9 deafness. All embodiments disclosed above are applicable to said method of treatment.

[0128] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the expression of otoferlin in HEK293 cells after dual AAV vector delivery. (A) Schematic diagram of the pair of recombinant AAV vectors used in this study and the process of recombination, transcription, splicing, and translation to generate the full-length protein otoferlin in co-infected cells. The recombinant AAV-Otof NT and AAV-Otof CT vectors contain the 5' and 3' parts of otoferlin cDNA, respectively. The recombination-inducing bridging sequences present in the two recombinant vectors are indicated by grey spheres. The red bars below the protein diagram indicate the two peptides used to generate antibodies against the N- and C-terminal parts of otoferlin. Abbreviations: ITR, inverted terminal repeat; smCBA, cytomegalovirus immediate early / chicken β-actin chimeric promoter; SA, splice acceptor site; SD, splice donor site; polyA, polyadenylation signal; C2, C2 domain; TM, transmembrane domain. (B) HEK293 cells were infected with AAV-Otof NT alone (upper panel), AAV-Otof CT alone (middle panel), or AAV-Otof NT and AAV-Otof CT together (lower panel). After 48 hours, HEK293 cells were stained for otoferlin (green) with a polyclonal antibody raised against the C-terminal part of the protein, and cell nuclei were labeled with DAPI (blue). Only co-infected cells produce otoferlin. Scale bar: 15 μm.

[0129] FIG. 2 shows that dual AAV-mediated gene therapy in P10 Otof− / − mice restores otoferlin expression and prevents hearing loss. (a) Left panel: Mosaic confocal images of the middle and apical turns of the injected cochlea immunostained for otoferlin (green) at P70. Nuclei are stained with DAPI (blue). The majority of IHCs express otoferlin, but none of the outer hair cells (OHCs) express otoferlin. Arrowheads indicate non-transduced IHCs. Inset: Higher magnification of the boxed area. Scale bars: 50 μm and 10 μm (inset). Right panel: Images of IHCs co-immunostained for otoferlin (green), the ribbon protein ribeye (blue), and the GluA2 subunit of the postsynaptic glutamate receptor (red). Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, but tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 μm. (b) Left panel: Four weeks after dual AAV injection, Otof− / − mice (green dots, n=8) showed ABR thresholds close to those of wild-type mice (black dots, n=8) in response to clicks or tone bursts at frequencies of 8 kHz, 16 kHz, and 32 kHz. In contrast, Otof− / − mice administered AAV-Otof NT (orange dots, n=3) or without injection (blue dots, n=6) showed no discernible ABR waves up to a sound intensity of 86 dB SPL. Right panel: In Otof− / − mice treated at P10 (arrows), hearing thresholds to click stimuli remained stable for at least 6 months after recovery. (c) Left panel: ABR traces recorded 3 weeks after therapeutic injection in wild-type, Otof- / -, and rescued Otof- / - mice (injected Otof- / -) show similar waveforms in wild-type and rescued mice. Right panel: Bar graphs showing ABR I wave latency and normalized ABR I wave amplitude in rescued Otof- / - mice (gray, n=8) and wild-type mice (black, n=5).

[0130] FIG. 3 shows that dual AAV-mediated gene therapy in P17 Otof− / − mice durably restores otoferlin expression and hearing. (a) Left panel: Mosaic confocal images of the middle and apical turns of injected cochleae immunostained for otoferlin (green) at P80. Cell nuclei are stained with DAPI (blue). Most IHCs express otoferlin, but outer hair cells (OHCs) do not. Arrowheads indicate non-transduced IHCs. Inset: Higher magnification of boxed area. Scale bars: 50 μm and 10 μm (inset). Right panel: Images of IHCs co-immunostained for otoferlin (green), the ribbon protein ribeye (blue), and the GluA2 subunit of postsynaptic glutamate receptors (red). Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, but tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 μm. (b) Left panel: ABR thresholds in response to clicks or tone burst stimuli at frequencies of 8 kHz, 16 kHz and 32 kHz in untreated Otof- / - mice (blue, n=5), treated Otof- / - mice (green, n=5) and wild-type mice (black, n=5) 4 weeks after paired intracochlear injections of recombinant vectors in treated mice. Right panel: Time course of hearing recovery in Otof- / - mice injected at P17 (arrow). Hearing recovery to near wild-type levels is maintained for at least 20 weeks after injection. (c) Left panel: ABR traces recorded 2 weeks after therapeutic injection in wild-type (black), Otof- / - (Otof- / -) and rescued Otof- / - (injected Otof- / -) mice show similar waveforms in wild-type and rescued mice. Right panel: Bar graph showing that the latency of ABR I wave in rescued Otof- / - mice (n=5) is similar to that in wild-type mice (n=5), whereas its normalized amplitude is approximately half that of wild-type mice.

[0131] FIG. 4 shows that dual AAV-mediated gene therapy in P30 Otof− / − mice durably restores otoferlin expression and hearing. (a) Left panel: Mosaic confocal images of the middle and apical turns of injected cochleae immunostained for otoferlin (green) at P40. Cell nuclei are stained with DAPI (blue). Most IHCs express otoferlin, but outer hair cells (OHCs) do not. Arrowheads indicate non-transduced IHCs. Inset: Higher magnification of boxed area. Scale bars: 50 μm and 10 μm (inset). Right panel: Images of IHCs co-immunostained for otoferlin (green), the ribbon protein ribeye (blue), and the GluA2 subunit of postsynaptic glutamate receptors (red). Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, but tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 μm. (b) ABR thresholds in response to clicks or tone burst stimuli at frequencies of 8 kHz, 16 kHz and 32 kHz in untreated Otof- / - mice (blue, n=3), treated Otof- / - mice (green, n=3) and wild-type mice (black, n=3) 3 weeks (left panel), 14 weeks and 20 weeks (right panel) after paired intracochlear injection of recombinant vectors in treated mice. In these mice, hearing recovery to near wild-type levels is maintained for at least 20 weeks after injection. (c) Left panel: ABR traces recorded 7 weeks after therapeutic injection in wild-type (black), Otof- / - (Otof- / -) and rescued Otof- / - (injected Otof- / -) mice show similar waveforms in wild-type and rescued mice. Right panel: Bar graph showing that the latency of ABR I wave in rescued Otof- / - mice (n=3) is similar to that in wild-type mice (n=3), whereas its normalized amplitude is approximately half that of wild-type mice.

[0132] Figure 5 shows the Otof ts / ts We show that dual AAV-mediated gene therapy in mice restores normal expression of otoferlin and hearing. (A) Wild type (Otof + / + ) Mouse (left panel), Otof ts / ts Mice (middle panel) and treated Otof ts / ts (Right panel) Confocal images of IHCs immunostained for otoferlin (green) located in the mid-turn cochlea from untreated Otof ts / ts Although it shows abnormal clumping at the IHC base in mice, its expression in IHC of treated mice is nearly normal. (B) Wild-type mouse (black), Otof ts / ts Mouse (blue) and rescued Otof ts / ts ABR waveforms recorded 4 weeks after therapeutic injection in mice (green) show similar waveforms in wild-type and rescued mice, whereas no ABR waves are detectable in untreated mutants.

[0133] The diagram in Figure 6 shows the differences in maturation of the human and mouse auditory systems (Shnerson and Willott, J. Comp. Physiol. Psychol. 1980 Feb; 94(1):36-40).

[0134] Figure 7 shows some of the mutations in the DFNB9 gene that have been identified to date. These mutations underlie the recessive form of prelingual deafness, DFNB9.

[0135] Figure 8 shows (A) Otof ts / ts Protein aggregation and misfolding of otoferin in mouse inner hair cells, and (B) Otof + / ts and Otof ts / ts Auditory brainstem response (ABR) in mice (see also FIG. 5).

[0136] Figure 9 shows the Otof ts / tsThe effect of unilateral injection of a pair of AAV-Otof NT and AAV-Otof CT recombinant vectors into mice is shown. Five weeks after injection, three Otof mice were ts / ts The sensory epithelium of treated mouse cochleae was microdissected and immunolabeled for otoferlin. Expression of otoferlin in IHCs of treated cochleae was measured, whereas expression of Otoferlin in untreated cochleae was significantly higher than that in untreated cochleae. ts / ts This was compared with its expression in mice (see also FIG. 5).

[0137] FIG. 10 shows wild type, Otof ts / ts and treated Otof ts / ts (A)I in IHC Ca (B) Voltage-activation curves of and (C) the corresponding ΔCm responses. Changes in plasma membrane capacitance (ΔCm) were used to monitor the fusion of synaptic vesicles during exocytosis. EXAMPLES

[0138] I. Materials and Methods animal Otoferlin knockout (Otof- / -) mice generated in the C57BL / 6 strain (Roux I. et al, Cell, 127, 277-289 (2006)) were backcrossed with FVB mice for more than 10 generations to obtain a uniform FVB genetic background, because unlike the C57BL / 6 background, this background is associated with stable hearing thresholds within 10 months of age (Kommareddi, P., et al. J Assoc Res Otolaryngol 16, 695-712 (2015)). Recombinant AAV2 vectors were delivered into Otof- / - mice in the FVB genetic background. All procedures and animal handling conformed to the welfare guidelines of the Institut National de la Santé et de la Recherche Medicale, the Pasteur Institute and the NIH, and conformed to the protocol requirements approved by the University of California, San Francisco. Before surgery, mice were anesthetized by intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset, 100 mg / kg), xylazine hydrochloride (Xyla-ject, 10 mg / kg), and acepromazine (2 mg / kg). Depth of anesthesia was checked by monitoring deep tissue response to toe pinch. Mice were injected subcutaneously with carprofen (2 mg / kg) before surgery and every 24 hours after surgery for one week to reduce inflammation and pain. Animals were monitored for signs of distress and abnormal weight loss after surgery.

[0139] A mouse model with a temperature-sensitive mutation (p.E1804del) in the C2F domain (Otof ts / ts ) was created. ts / ts Mice are severely deaf. The results shown in Figure 8 highlight that the distribution of otoferlin in IHCs of these mice is abnormal / highly impaired (the protein is aggregated and misfolded in the inner hair cells). Furthermore, auditory brainstem responses (ABRs) were correlated with Otof + / ts and Otof ts / tsRecordings in mice to monitor the electrical responses of primary auditory neurons and the continuous neuronal transmission in the central auditory pathway to click stimuli showed that at 1 month of age, Otof was significantly increased at the various intensities tested (40–86 dB). + / ts The characteristic waveform of mouse ABR is obtained, but Otof ts / ts It is observed that in mice no response is obtained even at 100 dB.

[0140] Construct and packaging of recombinant AAV2 vectors The full-length coding sequence of mouse otoferlin cDNA (Otof1 isoform 1; NM_001100395.1) was divided into a 5' fragment (nucleotides 1-2448) and a 3' fragment (nucleotides 2449-5979), and these fragments were synthesized (Genscript, Piscataway, NJ). The 5' construct contains the 5' portion of Otof1 cDNA (encoding amino acids 1-816, including the C2A, C2B, and C2C domains of the protein) and a splice donor (SD) site, and the 3' construct contains the 3' portion of Otof1 cDNA (encoding amino acids 817-1992, including the C2D, C2E, C2F, and transmembrane domains of the protein) and a splice acceptor (SA) site. In addition, both constructs contain an alkaline phosphatase recombinogenic bridge sequence [Lay Y et al, Hum Gene Ther 17, 1036-1042 (2006); Ghosh A. et al, Hum Gene Ther 22, 77-83 (2011); Dyka FM et al, Hum Gene Ther Methods 25, 166-177 (2014)]. Recognition sites for NotI / NheI and MfeI / KpnI restriction endonuclease were added to these constructs, and then these constructs were inserted into the AAVpTR22 vector plasmid as previously described [Lay Y et al, Hum Gene Ther 17, 1036-1042 (2006); Ghosh A. et al, Hum Gene Ther 22, 77-83 (2011); Dyka FM et al, Hum Gene Ther Methods 25, 166-177 (2014)] to generate a pair of recombinant vectors designated AAV-Otof NT and AAV-Otof CT. An additional recombinant vector containing the cDNA for green fluorescent protein (GFP) was designed to serve as a positive control for cell transduction.Recombinant vectors were packaged into AAV2 quadY-F capsids (Petrs-Silva H. et al, Molecular therapy : the journal of the American Society of Gene Therapy 19, 293-301 (2011)), and recombinant viruses were purified and titered by the Ocular Gene Therapy Core at the University of Florida as previously described [Zolotukhin S. et al, Methods 28, 158-167 (2002); Jacobson SG et al., Molecular therapy : the journal of the American Society of Gene Therapy 13, 1074-1084 (2006)].

[0141] Transgene expression in transfected HEK293 cells HEK293 cells were grown in 6-well plates on polylysine-coated coverslips in Dulbecco's modified Eagle's medium supplemented with 1x non-essential amino acids, 10% fetal bovine serum (Gibco) and penicillin-streptomycin (Pen / Strep, Invitrogen). The next day, cells were infected as previously described (Lopes VS et al, Gene Ther 20, 824-833 (2013)). Briefly, coverslips containing cells at 75% confluence were incubated at 37°C and 5% CO2 in 200 μL of serum-free medium containing either one or both of the AAV2-Otof recombinant viruses (10000 genome-containing particles / cell for each vector). After 2 hours, 1 mL of complete medium was added. The next day, the medium was replaced and the cells were incubated for an additional 48 hours. Cells were fixed with 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS), pH 7.4, for 2 h at 4°C, rinsed three times with PBS, and incubated with 0.25% TritonX-100 and 5% normal goat serum in PBS for 1 h at room temperature. Cells were then incubated overnight at 4°C with previously characterized rabbit polyclonal antibodies, 14cc and C19 (Roux I. et al, Cell, 127, 277-289 (2006)), directed against the N-terminal (amino acids 196-211) and C-terminal (amino acids 1848-1978) portions of otoferlin, respectively (dilution 1:200). Samples were rinsed twice with PBS and incubated with Cy3-conjugated goat anti-rabbit IgG secondary antibody (Life Technologies, dilution 1:2000) for 2 h at room temperature. The samples were then rinsed twice with PBS, stained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize cell nuclei, mounted on glass slides with a drop of Fluorsave solvent (Biochem Laboratories, France), and observed under an Olympus confocal immunofluorescence microscope.

[0142] Vector delivery to the cochlea Virus was delivered to the left cochlea as previously described (Akil O. et al, Neuron 75, 283-293 (2012)). Anesthetized Otof- / - mice were injected with AAV2-Otof vector pairs through the round window membrane into the scala tympani of the cochlea at P10, P17 or P30. The ear was approached through a dorsal incision (Duan M et al, Gene Ther 11 Suppl 1, S51-56 (2004)). A small hole was made in the bulla with an 18G needle and expanded with forceps. The round window membrane was gently punctured with a borosilicate capillary glass pipette, which was then removed. Once perilymph outflow had ceased, AAV2-Otof NT (6.3x10 12 vg / mL) and AAV2-Otof CT (4.5x10 12 A fixed volume (2 μL) containing the vector pair at 100 μg / mL (100 μg / mL) was injected into the scala tympani over 1 min with a fine glass micropipette (outer tip diameter 10 μm). The pipette was withdrawn and the gap was rapidly closed with fascia and adipose tissue. The wound was sutured in layers with 6-0 absorbable chromic sutures (Ethicon).

[0143] Hearing tests Hearing tests were performed on anesthetized Otof+ / +, Otof- / - and rescued Otof- / - mice at various time points in a soundproof chamber as previously described (Akil O. et al, Neuron 75, 283-293 (2012)). Mice were anesthetized by intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset, 100 mg / mL) and xylazine hydrochloride (Xyla-ject, 10 mg / mL) and then injected with one-fifth of the initial dose as needed. Body temperature was maintained by a heating pad and monitored by a rectal probe during recording. Auditory brainstem responses (ABRs) were recorded using a TDT BioSig III system (Tucker Davis Technologies) with three subdermal needle electrodes placed on the scalp of the mice, one on the vertex, one under the pinna of the left ear (reference electrode) and one under the contralateral ear (ground electrode). The sound stimuli were clicks (5 ms duration, 31 Hz) and tone pips (10 ms duration, cosine squared shaping, 21 Hz) at 8 kHz, 16 kHz and 32 kHz. They were delivered under anechoic conditions and monaural responses were recorded from the left ear (the right ear was blocked during recording). For each sound stimulus, electroencephalographic (EEG) activity was recorded for 20 ms at a sampling rate of 25 kHz using filtering (0.3-3 kHz). EEG waveforms of 512 and 1000 stimuli were averaged for clicks and tone bursts, respectively. Sound stimulus intensity was decreased in 5 dB sound pressure level (SPL) intervals from the maximum intensity tested (86 dB SPL). Hearing thresholds were defined as the lowest stimulus level at which ABR peaks of waves I-V were clearly and repeatedly present upon visual inspection. These threshold assessments were confirmed by offline analysis of stored waveforms. The latency of ABR wave I was measured as the time interval between the click stimulus and the peak amplitude of wave I. Furthermore, for comparison between rescued Otof− / − and wild-type mice, the values ​​of the wave I peak amplitude in the ABR traces were normalized to the mean value of control wild-type mice (considered as 100%).

[0144] Counting inner hair cells and synaptic ribbons Mouse cochleae were perfused with 4% paraformaldehyde in 0.1 M PBS (pH 7.4) and incubated in the same fixative for 2 h at 4°C. Cochleae were rinsed three times with PBS and decalcified by incubating with 5% ethylenediaminetetraacetic acid (EDTA) in 0.1 M PBS overnight at 4°C. Cochlear sensory epithelium (organ of Corti) was microdissected into surface preparations, preincubated with PBS containing 0.25% TritonX-100 and 5% normal goat serum (blocking buffer) for 1 h at room temperature, and incubated with primary antibodies overnight at 4°C. The following antibodies were used: rabbit anti-otoferlin C-terminal portion (C19, 1:250 dilution), mouse (lgG1) anti-CtBP2 / Ribeye, mouse (lgG2a) anti-glutamate receptor subunit A2 (Millipore, 1:200 dilution) and rabbit anti-GFP (Invitrogen, A11122; 1:250 dilution). Samples were rinsed three times with PBS and incubated with the appropriate secondary antibodies: Alexa Fluor488-labeled anti-mouse lgG1, Alexa Fluor568-labeled anti-mouse lgG2a (Life Technologies, 1:1000 dilution) or Atto Fluor647-labeled anti-rabbit IgG (Sigma, 1:200 dilution). Samples were washed three times with PBS and mounted on slides with one drop of Fluorsave using DAPI to stain cell nuclei. Fluorescent confocal z-stacks of the organ of Corti were acquired by an LSM 700 confocal microscope (Zeiss, Oberkochen, Germany) equipped with a high-resolution objective (numerical aperture 1.4, 60x oil immersion objective). Images were acquired in 512x512 or 1024x1024 rasters (pixel size = 0.036 μm in x and y) with a z-step of 0.2 μm. Inner hair cells (IHCs) producing otoferlin and synaptic ribbons were counted by 3D rendering of z-stacks of up to 20 confocal images. To calculate the percentage of IHCs expressing the otoferlin transgene, the total number of IHCs producing otoferlin was divided by the total number of IHCs identified by DAPI stained cell nuclei (minimum of 150 consecutive analyses).

[0145] Reverse transcriptase-polymerase chain reaction (RT-PCR) Total mRNA was extracted from the left cochlea of ​​six Otof+ / + mice and six Otof- / - mice rescued at P10 (Trizol, Invitrogen). Reverse transcription (RT) was performed using oligo dT primer and superscript II RNase H. - (Invitrogen) at 42°C for 50 min. Two microliters of the RT reaction product was used in a polymerase chain reaction (PCR; Taq DNA polymerase, Invitrogen) consisting of 35 cycles (94°C for 30 s, 60°C for 45 s, 72°C for 60 s) and a final extension at 72°C for 10 min. A pair of PCR primers (forward primer TGTCTCAGAGCTCCGAGGCA (SEQ ID NO: 14) and reverse primer ATCGTGGAGGAGGAACTGGGCA (SEQ ID NO: 15)) were designed to amplify a 2676 bp intermediate fragment (nucleotides 27-2702) of otoferlin cDNA (GenBank accession number NM_001100395.1) encompassing the junction between the AAV-Otof NT and AAV-Otof CT inserts. The PCR products were purified by electrophoresis on a 2% agarose gel containing 0.5 mg / mL ethidium bromide (Qiaquick gel extraction kit, QIAGEN) and sequenced (Elim Biopharmaceuticals) to confirm sequence identity with the otoferlin cDNA sequence.

[0146] statistical analysis Data are expressed as mean ± standard deviation (SD). All statistical analyses were performed by the nonparametric Mann-Whitney U test. Statistical significance is indicated in the figures as follows: ns, not significant; * , p < 0.05; ** , p < 0.01; *** , p<0.001.

[0147] II. Results An AAV2-based vector was designed to express the green fluorescent protein (GFP) gene under the control of a chimeric CMV-chicken β-actin promoter. This expression cassette was packaged into the AAV2 quadY-F capsid, in which four surface tyrosine (Y) residues of the AAV2 capsid are replaced by phenylalanine (F) residues, and has been shown to increase the efficiency of gene transfer in the retina (Petrs-Silva H. et al, Molecular therapy : the journal of the American Society of Gene Therapy 19(2):293-301 (2011)). The recombinant virus was injected through the round window membrane into the left cochlea of ​​five wild-type mice at P2. GFP immunostaining of the sensory epithelium 3 weeks after injection revealed transduction of various types of cells, including IHCs. The transduction rate of IHCs was 78 ± 6% (mean ± SD), demonstrating the suitability of this AAV serotype for delivering therapeutic genes to these cells (not shown). The coding sequence of mouse otoferlin cDNA was divided into a 5' fragment (Otof NT, nucleotides 1-2448) and a 3' fragment (Otof CT, nucleotides 2449-5979), and each of them was inserted into an AAV vector with a recombinogenic bridge sequence. (Ghosh A. et al, Hum Gene Ther 22(1):77-83 (2011); Dyka FM et al, Hum Gene Ther Methods 25(2):166-177 (2014)). The AAV-Otof NT recombinant vector has a splice donor site following the 5' portion of the cDNA, and the AAV-Otof CT recombinant vector has a splice acceptor site following the 3' portion of the cDNA (see Methods and Figure 1). Each of these recombinant vectors was packaged into an AAV2 quadY-F capsid. HEK293 cells were infected with AAV-Otof NT, AAV Otof CT, or both recombinant viruses, and immunostained for otoferlin 48 hours later.The same results were obtained using two different antibodies raised against the C-terminal or N-terminal parts of the protein (Roux I, et al, Cell 127:277-289 (2006)). Otoferlin was only detected in cells simultaneously infected with both viruses, indicating that the two vectors had recombined to produce concatemers via the inverted terminal repeats and that the resulting transcripts were able to correctly splice to produce the protein (Figure 1).

[0148] A single unilateral injection of a pair of AAV-Otof NT and AAV-Otof CT recombinant vectors was administered to Otof− / − mice through the round window membrane into the left cochlea either before the onset of hearing (P10) or after the onset of hearing. Because the maturation of IHC ribbon synapses is still underway at P17 (Kros CJ et al, Nature 394(6690):281-284 (1998); Wong AB et al, EMBO J 33(3):247-264 (2014)), but the cochlea is mature at P30 (Song L. et al, J Acoust Soc Am 119(4):2242-2257 (2006)), injections after the onset of hearing were performed at either of two different time points: P17 and P30. Eight weeks after injection of the recombinant vector pair at P10, three Otof mice were - / -Sensory epithelia from treated mouse cochleae were microdissected and otoferlin was immunolabeled (by an antibody raised against the C-terminal part of otoferlin protein) to assess IHC transduction rate. Otoferlin protein was detected in more than 60% of IHCs (64±6%, mean±SD, n=3 (cochleae)) but not in other cell types (Fig. 2a, left panel). This result provides evidence that localized delivery of recombinant AAV-vector pairs in vivo efficiently reconstitutes a large cDNA in cochlear sensory cells, with the majority of cells capable of sustained and widespread production of the protein. The accuracy of the pre-mRNA splicing process in transduced cells was checked by RT-PCR and sequence analysis of a large fragment of otoferlin transcript containing the junction between Otof NT and Otof CT cDNAs (not shown).

[0149] Measurement of auditory brainstem responses (ABRs) in mice 4 weeks after injection at P10 showed substantial recovery of hearing thresholds in response to click and tone burst stimuli (8 kHz, 16 kHz, and 32 kHz) in all treated mice (n=8), but not in mice that received either AAV-Otof NT or AAV-Otof CT alone (n=3 each) or no injection (n=6) (Figures 2b, 2c). ABR thresholds to both click and tone burst stimuli in treated mice were similar to those in control wild-type mice (n=8; Mann-Whitney U test, p>0.15 for all comparisons). Long-term efficacy of gene therapy was assessed by performing ABR measurements to clicks at several time points after injection between 1 and 30 weeks. From the fourth week onwards, the ABR thresholds of treated mice were not significantly different from those of wild-type mice (Mann-Whitney U test, p>0.05 for comparisons at all stages) (Fig. 2b). However, the amplitude of the ABR I wave, which reflects the electrical response of primary auditory neurons to sound stimuli, was 39 ± 7% (mean ± SD) of the mean value for wild-type mice (Mann-Whitney U test, p=0.002). Meanwhile, the latency of the I wave (1.15 ± 0.09 ms) was similar to that of wild-type mice (1.27 ± 0.05 ms) (Mann-Whitney U test, p=0.06) (Fig. 2c).

[0150] Thirty weeks after injection, six of eight mice injected at P10 had hearing thresholds within 10 dB of those of wild-type mice. Thus, gene therapy prior to the expression of hearing prevents hearing loss in Otof- / - mice. We previously showed that about half of the IHC ribbons were degenerated in Otof- / - mice (Roux I, et al, Cell 127:277-289 (2006)). The number of presynaptic ribbons (along with postsynaptic glutamate receptors) was analyzed by immunofluorescence and 3D confocal microscopy imaging in transduced and non-transduced IHCs of treated Otof- / - cochleae 8 weeks after injection at P10 (Figure 2a, right panel). The number of ribbons per IHC in transduced cells (12.5 ± 1.8, mean ± SD, n = 48 cells from 3 mice) was nearly twice as high as the number of ribbons per IHC in non-transduced cells (6.9 ± 1.3, n = 48 cells from 3 mice) (Mann-Whitney U test, p < 10 -4 ), remained lower than the number of ribbons per wild-type IHC (16 ± 1.3, n = 48 (cells from 3 mice)) (Mann-Whitney U test, p < 10 -4 ), which may explain the incomplete recovery of wave I amplitude in ABR measurements.

[0151] After injection of the recombinant vector pairs into the cochleae of Otof- / - mice at P17 or P30, otoferlin was detected in IHC of the whole treated cochleae but not in IHC of the contralateral cochleae (not shown). IHC transduction rates were similar in the two groups of mice (82±9% and 85±7% for n=5 and n=3 cochleae treated at P17 and P30, respectively) and higher than mice injected at P10 (Mann-Whitney U test, p<0.05 for both comparisons) (Figures 3a and 4a). ABR measurements 4 weeks after injection showed hearing recovery in all mice injected at P17 (n=5), with ABR thresholds in response to click or tone burst stimuli remarkably similar to wild-type mice (n=5) (Mann-Whitney U test, p>0.2 for all comparisons). Hearing thresholds in response to clicks remained unchanged for 20 weeks after injection, indicating sustained restoration of hearing in these mice, even though the average ABR I wave amplitude was approximately half that of wild-type mice (47 ± 10%) (Figure 3b, c).

[0152] Similarly, Otof- / - mice injected at P30 showed similar hearing recovery 3 weeks after injection, and ABR thresholds in response to click or tone burst stimuli persisted at wild-type levels 20 weeks after injection, despite the average ABR I wave amplitude being approximately half that of wild-type mice (55±10%) (n=3, Mann-Whitney U test, p>0.5 for all stepwise comparisons) (Fig. 4b, c). The number of presynaptic ribbons (along with postsynaptic glutamate receptors) was analyzed by immunofluorescence and 3D confocal microscopy imaging in transduced and non-transduced IHCs of Otof- / - cochleae treated at P17 and P30 (Figs. 3a and 4a). The number of ribbons per IHC in transduced cells (10.0±1.3, mean±SD, n=48 (cells from 3 mice treated at P17 and analyzed at P80) and 8.9±2.3, n=48 (cells from 3 mice treated at P30 and analyzed at P40)) was higher than the number of ribbons per IHC in non-transduced cells from the same cochleae (6.2±1.3, n=48 cells and 5.8±0.7, n=48 cells, respectively) (Mann-Whitney U test, p<10 for both comparisons). -4 ) than IHC from 10-week-old wild-type mice (16 ± 1.3, n = 48 (cells from 3 mice)) (Mann-Whitney U test, p < 10 for both comparisons). -4 Since the number of ribbons per IHC was already significantly reduced in untreated Otof− / − mice analyzed at P15 (8.2±1.0, n=48 (cells from 3 mice)) and unexpectedly remained stable in untransduced late stage IHCs of treated mice (see P40, P70 and P80 values ​​above), one might speculate that gene therapy in IHCs of Otof− / − mice increased the number of ribbons by promoting their generation rather than preventing their degeneration.

[0153] Using the dual AAV gene therapy described above, administered to animals with p30, we have demonstrated that a mouse model carrying a human temperature-sensitive mutation in the DFNB9 gene (Otof ts / tsIt was also possible to restore normal distribution of otoferlin and restore hearing function to nearly normal ABR thresholds in mice (Fig. 5).

[0154] More precisely, dual viral gene therapy was shown to override the human temperature-sensitive mutation of otoferlin aggregates in the DFNB9 mouse model described above (Figure 9). In this experiment, unilateral injections of a pair of AAV-Otof NT and AAV-Otof CT recombinant vectors were performed after the onset of hearing (P30) in the Otof mice. ts / ts Mice were injected with a single dose into the left cochlea through the round window membrane. Five weeks after injection, three Otof mice were ts / ts The sensory epithelium of treated mouse cochleae was microdissected and immunolabeled for otoferlin (see FIG. 9). Expression of otoferlin in IHCs (dashed line) of treated cochleae was significantly higher than that of Otof ts / ts Otoferlin aggregates (arrows) were found to be nearly normal when compared with untreated cochleae of mice.

[0155] As shown in FIG. 10, it was finally found that the above-mentioned dual viral gene therapy restored calcium currents and exocytosis in IHCs in this animal model.

[0156] The present invention includes the following inventions. [1] A vector system enabling expression of a full-length otoferlin polypeptide or a functional fragment thereof in inner hair cells for use in treating a patient suffering from DFNB9 hearing loss or for preventing DFNB9 hearing loss in a patient with a DFNB9 mutation, wherein the patient is a human having a developed and mature auditory system, such as a newborn, infant, child, teenager or adult. [2] A vector system for use according to [1], wherein the otoferlin polypeptide has the sequence of SEQ ID NO:1. [3] A vector system for use according to [1], comprising at least one AAV particle comprising a polynucleotide encoding the full-length otoferlin polypeptide or a functional fragment thereof. [4] A vector system for use as described in [1], wherein the vector system comprises at least two types of AAV particles, i) one of which comprises a polynucleotide comprising a partial coding sequence encoding an N-terminal portion of an otoferlin polypeptide or a functional fragment thereof, and ii) another of which comprises a polynucleotide comprising a partial coding sequence encoding a C-terminal portion of an otoferlin polypeptide or a functional fragment thereof. [5] The vector system comprises at least two types of AAV particles; Each of the AAV particles comprises: a) a first polynucleotide comprising an inverted terminal repeat at each end of said first polynucleotide and comprising, from 5' to 3' between said inverted terminal repeats, a suitable promoter followed by a partial coding sequence comprising the N-terminal portion of the otoferlin gene and a splice donor site; or b) a second polynucleotide comprising an inverted terminal repeat at each end of said second polynucleotide and comprising, from 5' to 3' between said inverted terminal repeats, a splice acceptor site and a partial coding sequence comprising the C-terminal portion of the otoferlin gene, optionally followed by a polyadenylation sequence. Including any of the following: the first and second polynucleotides each comprise a recombinogenic sequence located after the splice donor site in the first polynucleotide and a recombinogenic sequence located before the splice acceptor site in the second polynucleotide; and A vector system for use as described in [1], wherein the coding sequences in the first and second polynucleotides, when combined, encode the full-length otoferlin polypeptide or a functional fragment thereof. [6] A vector system for use according to [5], wherein the otoferin gene has the sequence of SEQ ID NO: 2. [7] A vector system for use according to [5], wherein the N-terminal portion of the otoferlin gene is the sequence of SEQ ID NO: 3 and the C-terminal portion of the otoferlin gene is the sequence of SEQ ID NO: 4. [8] A vector system for use according to [3], wherein the AAV particles are of the AAV2 serotype. [9] A vector system for use as described in [1], comprising AAV2 particles in which the capsid has been modified by replacing tyrosine amino acid residues with phenylalanine amino acid residues.

[10] The vector system for use according to [1], wherein the human patient has been diagnosed with DFNB9 deafness after language acquisition.

[11] The vector system for use according to [1], wherein the patient is a teenager or adult suffering from DFNB9 hearing loss induced by a temperature sensitive mutation, preferably a temperature sensitive mutation selected from P.Q994VfsX6, P.I515T, p.G541S, PR1607W, p.E1804del.

[12] A pharmaceutical composition for use in treating a patient suffering from DFNB9 hearing loss or for preventing DFNB9 hearing loss in a patient having a DFNB9 mutation, comprising the vector system according to any one of [1] to [9] and a pharma- ceutical acceptable vehicle, wherein the patient is a human having a developed and mature auditory system, such as a newborn, infant, child, teenager or adult.

Claims

1. 1. A pharmaceutical composition for use in treating a patient suffering from DFNB9 hearing loss or for preventing DFNB9 hearing loss in a patient with a DFNB9 mutation, comprising: the pharmaceutical composition comprises a vector system capable of expressing a full-length otoferlin polypeptide in an inner hair cell; The vector system comprises at least two types of AAV particles, and among the at least two types of AAV particles, i) one type comprises a polynucleotide comprising a recombinogenic region having a size of 100 to 500 nucleotides and a partial coding sequence encoding an N-terminal portion of an otoferlin polypeptide, and ii) another type comprises a polynucleotide comprising a recombinogenic region having a size of 100 to 500 nucleotides and a partial coding sequence encoding a C-terminal portion of an otoferlin polypeptide, The pharmaceutical composition, wherein the patient is a human patient having a developed and mature auditory system.

2. 2. The pharmaceutical composition of claim 1, wherein the human patient is a neonate, infant, child, teenager or adult.

3. 3. The pharmaceutical composition of claim 1 or 2, wherein the human patient is a neonate, infant or child.

4. The human patient has one or more of the following nonsense or missense mutations in the otoferlin gene: TYR730TER, GLN829TER, PRO1825ALA, PRO50ARG, LEU1011PRO, ILE515THR, ARG1939GLN, or GLY541SER; or an A to G transition at the intron 8 / exon 9 junction (IVS8-2A-G), or a splice of exon 5.

4. The pharmaceutical composition of claim 1, further comprising a G to A transition at position +1, the first intron nucleotide at the donor site, or a G to C transversion at the donor splice site of intron 39, or a one base pair deletion (1778G) resulting in a stop codon in exon 16 and a G to A change at 6141 resulting in an ARG to GLN substitution in exon 48.

5. The pharmaceutical composition according to any one of claims 1 to 3, wherein the human patient is affected by DFNB9 deafness induced by a temperature sensitive mutation.

6. 6. The vector system for use according to claim 5, wherein the human patient is a teenager or an adult carrying at least one temperature sensitive mutation selected from p. Q994VfsX6, p. I515T, p. G541S, PR1607W and p. E1804del.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the recombinogenic region has the sequence of SEQ ID NO:9 or a homologous sequence having at least 90% sequence identity with SEQ ID NO:

9.

8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the otoferlin polypeptide has the sequence of SEQ ID NO:1 or SEQ ID NO:

5.

9. Each of the at least two types of AAV particles is a) a first polynucleotide comprising an inverted terminal repeat at each end of said first polynucleotide and comprising, from 5' to 3' between said inverted terminal repeats, a suitable promoter followed by a partial coding sequence comprising the N-terminal portion of an otoferlin gene and a splice donor site; or b) a second polynucleotide comprising an inverted terminal repeat at each end of said second polynucleotide and comprising, from 5' to 3' between said inverted terminal repeats, a splice acceptor site, a partial coding sequence comprising the C-terminal portion of the otoferlin gene, and optionally followed by a polyadenylation sequence. Including any of the following: the first and second polynucleotides each comprise a recombinogenic sequence located after the splice donor site in the first polynucleotide and a recombinogenic sequence located before the splice acceptor site in the second polynucleotide; and The pharmaceutical composition of any one of claims 1 to 7, wherein the coding sequences in the first and second polynucleotides, when combined, encode the full-length otoferlin polypeptide.

10. The pharmaceutical composition of claim 9, wherein the otoferlin gene has the sequence of SEQ ID NO:

2.

11. The pharmaceutical composition according to claim 9 or 10, wherein the N-terminal portion of the otoferlin gene is the sequence of SEQ ID NO: 3 and the C-terminal portion of the otoferlin gene is the sequence of SEQ ID NO:

4.

12. The pharmaceutical composition of claim 9, wherein the otoferlin gene has the sequence of SEQ ID NO:

22.

13. 13. The pharmaceutical composition of claim 9 or 12, wherein the N-terminal portion of the otoferlin gene is the sequence of SEQ ID NO: 3 and the C-terminal portion of the otoferlin gene is the sequence of SEQ ID NO:

23.

14. The pharmaceutical composition according to any one of claims 9 to 13, wherein the suitable promoter is selected from the group consisting of a cytomegalovirus (CMV) promoter, an SV40 promoter, a Rous sarcoma virus (RSV) promoter, a chimeric CMV / chicken β-actin promoter (CBA) and a truncated form of CBA (smCBA).

15. The pharmaceutical composition according to any one of claims 9 to 14, wherein the splice donor site and / or the splice acceptor site comprise a splice consensus sequence derived from the alkaline phosphatase enzyme.

16. The pharmaceutical composition according to any one of claims 9 to 15, wherein the inverted terminal repeat is derived from AAV2.

17. The pharmaceutical composition of any one of claims 1 to 16, wherein the AAV particles are of AAV2 serotype or AAV8 serotype.

18. 18. The pharmaceutical composition of any one of claims 1 to 17, wherein the pharmaceutical composition comprises a pharma- ceutically acceptable carrier selected from water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and combinations thereof.

19. The pharmaceutical composition according to any one of claims 1 to 18, wherein the pharmaceutical composition is a sterile injectable solution.

20. The pharmaceutical composition according to any one of claims 1 to 19, wherein the pharmaceutical composition is administered via the round window membrane (RWM) by injection using a microcatheter.

21. The pharmaceutical composition comprises ６ ~10 １４ 21. The pharmaceutical composition of any one of claims 1 to 20, comprising AAV particles / mL.

22. The pharmaceutical composition of any one of claims 1 to 21, wherein the at least two types of AAV particles are administered in the same amount.

Images