Oral bacterial growth inhibitor

Abstract

To provide a technique for inhibiting the number of bacteria involved in mucin decomposition in an oral cavity, which can inhibit the growth of oral bacteria that may be involved in mucin decomposition, such as Ruminococcus gnavus, thereby inhibiting the decomposition of mucin in the oral cavity, thereby contributing to the prevention and improvement of unhealthy conditions and diseases in the oral cavity in which mucin deficiency is involved in onset or worsening.SOLUTION: Provided is an agent for inhibiting the growth of oral bacteria containing agaro-oligosaccharides as an active ingredient and having in the genomic DNA a NanA gene consisting of a DNA sequence that has 49.9% or more sequence identity with sequence number 1 (the NanA gene of Ruminococcus gnavus).SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to an oral bacterial proliferation inhibitor containing agarooligosaccharide as an active ingredient, more specifically, to an oral bacterial proliferation inhibitor containing agarooligosaccharide as an active ingredient and having an N-acetylneuraminic acid lyase gene in its genomic DNA, the N-acetylneuraminic acid lyase gene having a DNA sequence with 49.9% or more sequence identity with SEQ ID NO:1. [Background technology]

[0002] Mucins are high molecular weight glycoproteins derived from animals, and are the main components of mucus produced in the mucosal epithelium of the digestive and respiratory tracts, as well as in the salivary glands. They have a structure in which glycans are frequently bound to the core protein, and generally have strong viscosity and high water retention. Mucins are classified into secretory and membrane-bound types, and in addition to protecting the mucosa as a physical barrier and acting as a lubricant, membrane-bound mucins are also involved in transmitting information into the cytoplasm. The genes encoding the core proteins of mucins are written as "MUC" and numbered in the order in which they were discovered, and to date, more than 20 types have been reported in humans.

[0003] In the oral cavity, secretory MUC5B and MUC7 are contained as major proteins in saliva (Non-Patent Document 1). In addition, membrane-bound MUC1 is expressed in the oral mucosal epithelium (Non-Patent Document 2). In the oral cavity, mucins aid in chewing, swallowing and speaking with their lubricating action, protect the oral mucosa from damage, prevent the oral cavity from drying out, capture harmful substances and foreign bodies in food, and infectious microorganisms such as bacteria and viruses, preventing them from coming into contact with mucosal epithelial cells, and are thought to exert a cleansing effect by treating them with gastric juice when swallowed. For example, it is speculated that a person may complain of dry mouth when there is little salivary mucin, and it has been reported that MUC7 is involved in the inhibition of Candida proliferation and antibacterial properties (Non-Patent Document 3).

[0004] It is said that sialic acid (N-acetylneuraminic acid (Neu5Ac), N-glycolylneuraminic acid (Neu5Gc), deaminoneuraminic acid (3-deoxy-D-glycero-D-galacto-2-nonulopyranosonic acid; KDN, etc.) bound to the glycan terminus is important for the functional expression of these mucins. It is thought that when the sialic acid at the glycan terminus is degraded by oral microorganisms, mucin aggregates and becomes non-functional (Non-Patent Document 3). In addition, it has been reported that MUC7 has an antibacterial site, and when the sialic acid at the glycan terminus is degraded, the decomposition of the antibacterial site proceeds more rapidly (Non-Patent Document 1).

[0005] On the other hand, Ruminococcus gnavus has been reported as a mucin-decomposing bacterium. Ruminococcus gnavus is a bacterium that is normally present in the intestine and grows using sialic acid from mucin as a nutrient source. It has been reported that the Ruminococcus gnavus ATCC 29149 strain has a unique sialic acid metabolic pathway in which it excises 2,7-anhydro-N-acetylneuraminic acid (not N-acetylneuraminic acid) from mucin sugar chains, transports it into the cell, converts it to N-acetylneuraminic acid, and metabolizes it by decomposing it into N-acetylmannosamine and pyruvic acid using N-acetylneuraminic acid lyase (NanA) (Non-Patent Document 4). [Prior art documents] [Patent documents]

[0006] [Non-Patent Document 1] Shoko Takehara, Application of antibacterial salivary mucin (MUC7) to oral care products, Niigata University Social Collaboration Promotion Organization>Research Seeds Collection>H Medical, Health and Welfare>School of Dentistry, Department of Preventive Dentistry, [online], [Retrieved June 8, 2023], Internet<https: / / www.ircp.niigata-u.ac.jp / seeds / 12288.html> [Non-Patent Document 2] HS Kho, Review Oral epithelial MUC1 and oral health, ORAL DISEASES, First published: 26 February 2018, 2018 Mar;24(1-2):19-21. doi: 10.1111 / odi.12713. [Non-Patent Document 3] Yoichi Nakagawa, Report on Research Results of Non-sterilization Research Grants, as of May 11, 2011, Institution Number: 32710, Research Category: Fundamental Research (C), Research Period: 2008-2010, Project Number: 20592348, Research Title (Japanese) Approach to Dry Mouth Treatment: The Effect of Mucin on Oral Symptoms [Non-Patent Document 4] Andrew Bell et.al., Elucidation of a unique sialic acid metabolism pathway in mucus-foraging Ruminococcus gnavus unravels mechanisms of bacterial adaptation to the gut, Nat Microbiol. 2019 December; 4(12): 2393?2404. doi:10.1038 / s41564-019-0590-7 Summary of the Invention [Problem to be solved by the invention]

[0007] Therefore, the present inventors thought that if the number of bacteria involved in mucin decomposition in the oral cavity could be suppressed, the decomposition of mucin in the oral cavity could be suppressed, and unhealthy conditions and diseases in the oral cavity whose onset or exacerbation is related to mucin deficiency could be prevented or improved.That is, an object of the present invention is to provide a technology for suppressing the number of bacteria involved in mucin decomposition in the oral cavity.

[0008] As a result of intensive research, the present inventors have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end can suppress the bacterial count of Ruminococcus gnavus, a mucin-degrading bacterium, in the oral cavity, and furthermore can suppress the bacterial count of oral bacteria having in their genomic DNA a homologue of the gene for NanA (SEQ ID NO: 1), a sialic acid metabolic enzyme of Ruminococcus gnavus. Based on these findings, the present inventors have completed the following inventions.

[0009] (1) A first aspect of the agent of the present invention (sometimes referred to as "the agent") is an agent that inhibits the proliferation of oral bacteria that have in their genomic DNA a NanA gene having a DNA sequence that has 49.9% or more sequence identity with SEQ ID NO: 1 (the NanA gene of Ruminococcus gnavus), and contains agarooligosaccharides as an active ingredient.

[0010] (2) The agent may be used to suppress the expression of NanA in the oral cavity. That is, the agent may be an agent for suppressing the expression of NanA in the oral cavity.

[0011] (3) The present agent may be used to inhibit the decomposition of oral mucin. That is, the present agent may be an agent for inhibiting the decomposition of oral mucin.

[0012] (4) In the present invention, the oral bacteria may be of the genus Ruminococcus, Fusobacterium, or Blautia.

[0013] (5) In the present invention, the oral bacterium may be Ruminococcus gnavus.

[0014] (6) In the present invention, when the oral bacterium is of the genus Fusobacterium, the agent may be used for preventing or improving a disease selected from gingivitis, periodontal disease, colon cancer, and oral cancer. That is, the agent may be an agent for preventing or improving a disease selected from gingivitis, periodontal disease, colon cancer, and oral cancer.

[0015] (7) In the present invention, the agarooligosaccharide may contain agarobiose.

[0016] (8) A second embodiment of the agent is an agent for suppressing the growth of oral bacteria that have in their genomic DNA a NanA gene consisting of a DNA sequence that has 49.9% or more sequence identity with SEQ ID NO:1, and comprises 3,6-anhydro-L-galactose or an oligosaccharide having this at its reducing end as an active ingredient. Effect of the Invention

[0017] According to the present invention, it is possible to inhibit the proliferation of oral bacteria that may be involved in mucin degradation, such as Ruminococcus gnavus and Fusobacterium spp., thereby suppressing the expression of NanA in the oral cavity or inhibiting the degradation of mucin in the oral cavity, thereby contributing to the prevention and improvement of unhealthy conditions and diseases in the oral cavity whose onset or worsening is related to mucin deficiency.

[0018] In addition, the agarooligosaccharides used as active ingredients in the present invention are oligosaccharides made from agar, which has been consumed as a food since ancient times, and are extremely safe. Therefore, according to the present invention, the proliferation of oral bacteria that may be involved in mucin decomposition can be inhibited without concerns about safety or side effects. [Brief description of the drawings]

[0019] [Figure 1] 1 is a bar graph showing the absorbance (OD660) of the culture medium in which Ruminococcus gnavus was cultured with varying concentrations of agarooligosaccharides. [Diagram 2] 1 is a bar graph showing the absorbance (OD660) of the culture medium in which Ruminococcus gnavus was cultured in the presence of agarooligosaccharides and disaccharides to octasaccharides. [Diagram 3] 1 is a bar graph showing the absorbance (OD660) of the culture medium in which Fusobacterium nucleatum was cultured with varying concentrations of agaro-oligosaccharides. [Figure 4]1 is a bar graph showing the absorbance (OD660) of the culture medium in which Fusobacterium nucleatum was cultured in the presence of agarooligosaccharides, disaccharides or tetrasaccharides. [Diagram 5] 1 is a bar graph showing the absorbance (OD660) of the culture medium in which oral bacteria were cultured at an agarooligosaccharide concentration of 0% by mass or 0.1% by mass. [Figure 6] 1 is a bar graph showing the proportion of bacteria carrying the NanA gene when oral bacteria were cultured in a medium containing agarooligosaccharides at a concentration of 0 mass%, 0.01 mass%, or 0.02 mass%. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The present invention will be further explained below. The present agent contains agarooligosaccharide as an active ingredient.

[0021] Agarooligosaccharides are even-numbered oligosaccharides consisting of repeating units of agarobiose, a disaccharide consisting of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include the smallest unit, agarobiose, a disaccharide, agarotetraose, a hexasaccharide, agarohexaose, an octasaccharide, and agarooctaose, a decasaccharide. In the present invention, agarooligosaccharides contain at least one of these oligosaccharides, and may consist of one type or two or more types.

[0022] As shown in the examples below, among agarooligosaccharides, agarobiose exhibits a particularly high growth inhibitory effect on oral bacteria having a NanA gene homologue of Ruminococcus gnavus. Therefore, it is preferable that the agarooligosaccharide contains agarobiose. In this case, the agarooligosaccharide may be composed of only agarobiose, or may contain agarooligosaccharides other than agarobiose. In this case, the content of agarobiose in the agarooligosaccharide may be, for example, 1 to 100% by mass, 10 to 100% by mass, 20 to 100% by mass, 30 to 100% by mass, 40 to 100% by mass, 50 to 100% by mass, etc.

[0023] Agaroligosaccharide is an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end.Therefore, the active ingredient of the present agent may be 3,6-anhydro-L-galactose or an oligosaccharide having it at the reducing end.In this case, the number of sugars of the oligosaccharide may be, for example, 2-8 sugars, 2-10 sugars, 2-12 sugars, etc.

[0024] Agaroligosaccharides can be commercially available agarooligosaccharides (agar oligosaccharides), or can be produced according to a conventional method. A typical method for producing agarooligosaccharides is, for example, a method of hydrolyzing agar. Hydrolysis can be carried out using an acid or an enzyme.

[0025] Examples of the acid decomposition method include a method using a solid acid as described in Japanese Patent No. 4796697, a method using a mineral acid such as sulfuric acid or hydrochloric acid, or a method using an organic acid such as acetic acid or citric acid, and any method may be used. By acid decomposition, an even-numbered sugar having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained.

[0026] Examples of enzymatic decomposition methods include decomposition with α-agarase and decomposition with β-agarase. With α-agarase, an even-numbered sugar having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained, as in the case of acid decomposition. Decomposition with α-agarase can be carried out, for example, by the method described in Japanese Patent Application Publication No. H2-65789.

[0027] The agar hydrolysate may be used as agarooligosaccharides as it is, or may be purified or pH adjusted before use. Examples of purification methods include filtration using filter paper or activated carbon. The agarooligosaccharide solution obtained by hydrolysis may be used in liquid form, or may be powdered by vacuum freeze drying or the like, as necessary.

[0028] Agar is a dehydrated and dried mucilage extracted from red seaweed such as Agarica and Gracilaria, and contains the polysaccharides agarose and agaropectin as main components. In addition to agar, substances containing agarose and agaropectin can be used as raw materials for producing agarooligosaccharides. Specific examples of such substances include solutions obtained by hot water extraction of red algae such as Agaraceae, Gracilaria, and Gracilaria, which are raw materials for agar. Examples of red algae in the Agaraceae family include Acanthus maximus, Acanthus nigricans, Acanthus obacilliformis, Acanthus gracilis, Acanthus sieboldii, and Acanthus yuikari, examples of red algae in the Gracilaria family include Gracilaria gracilaria and Acanthus sieboldii, and examples of red algae in the Gracilaria family include Acanthus gis and Acanthus sieboldii. These red algae can be used alone or in combination of two or more types.

[0029] The sugar composition of agarooligosaccharides can be confirmed by liquid chromatography, including high performance liquid chromatography, as shown in the Examples below. In addition, agarooligosaccharides having a desired number of sugars, such as only agarobiose, only agarotetraose, or only agarohexaose, can be fractionated and used after adjusting the sugar composition of the agarooligosaccharides.

[0030] 3,6-anhydro-L-galactose can be produced by a conventional method, or a commercially available product such as a reagent. An example of such a production method is the method described in Japanese Patent No. 4007760. That is, 50 μl of 10x phosphate buffered saline and 50 μl of 10 units / μl β-galactosidase phosphate buffered saline solution are added to 450 μl of a 100 mM aqueous solution of agarobiose, mixed, and reacted at 37° C. for 1 hour. 5 ml of a 1-butanol:ethanol=1:1 mixture is added to this reaction solution, and insoluble matter is precipitated by centrifugation. The resulting supernatant is subjected to column chromatography using a silica gel column, and the mixture is compressed at 0.3 kg / cm using a compressor with 1-butanol:ethanol:water=5:5:1 as the eluent. 2 The mixture is pressurized to 500° C. and separated. By collecting fractions so that each fraction is 7 ml, for example, fractions 14 to 17 can be obtained that contain high-purity 3,6-anhydro-L-galactose. These fractions can be collected and dried under reduced pressure to obtain 3,6-anhydro-L-galactose.

[0031] This agent is an agent for suppressing the proliferation of oral bacteria that have in their genomic DNA a NanA gene consisting of a DNA sequence that has 49.9% or more sequence identity with SEQ ID NO: 1. In the present invention, with regard to oral bacteria, suppressing proliferation and suppressing the number of bacteria are synonymous.

[0032] In the present invention, oral bacteria refers to bacteria that inhabit the oral cavity or bacteria that are detected from a specimen collected from the oral cavity.

[0033] Whether the proliferation of a specific oral bacterium can be inhibited can be confirmed by a conventional method. For example, as shown in the examples below, if a specific oral bacterium is isolated, the active ingredient of the present agent is added to the culture medium for the bacterium, and the degree of proliferation is confirmed by a turbidity method or the like, in comparison with the case where the active ingredient is not added. In addition, if a specific oral bacterium is not isolated, the number of bacteria can be confirmed by quantitative PCR using a primer specific to the bacterium. That is, the number of bacteria can be compared by quantitative PCR between the case where the active ingredient of the present agent is contacted and the case where it is not contacted, and the degree of proliferation inhibition can be confirmed.

[0034] SEQ ID NO:1 (948 residues) is the DNA sequence of the gene encoding NanA from Ruminococcus gnavus. [SEQ ID NO:1] ATGGCTTTTATGAAGCAAAGGAGCAAAACTATGAGAAATCTTGAGAAGTATAAAGGTGTGATTCCGGCATTTTATGCTTGCTATGACAAAGAAGGAAACATTAGTCCAGAAGGTGTACAGGGACTGACAAAATATTTTGTAAAAAAAGGGGTAAAAGGTGTCTATGTAAACGGTTCTTCCGGAGAATGTATTTATCAGAGTGTGGAGGACCGTAAGATTGTACTTGAGAATGTTATGAAAGTAGCGGAAGGTAAACTTACAGTTATTGCCCATGTGGCCTGCAATAACACGAAGGACAGTCAGGAGCTTGCCAGACATGCAGAAGGGCTGGGGGTAGATGCAATCGCTGCAATTCCTCCCATCTATTTTCACTTACCGGAATATGCTATTGCGCAGTATTGGAATGCCATTAGTGCAGCGGCACCGAACACAGACTTTGTAATTTATAACATACCTCAGCTTGCTGGTGTTGCA CTTACACAGAATTTATTTGTAGAGATGAGGAAAAATCCCAACGTCATTGGTGTCAAGAATTCCTCTATGCCGGTACAGGATATCCAAATGTTTAAGCAGGCTGCAGGAGCTGAGTACATTATCTTTAATGGTCCTGATGAGCAGTTTATGAGCGGACGTGTTATCGGGGCAGAGGGTGCAATTGGGGGAACCTATGGTGCTATGCCTGAATTATACTTAAAGTTGGATGAGTGTATAAATGCAGGAAAGATGACAGAGGCAAGAAAAATCCAGTATGCTTGTAATGAGATAATTTACAAAATGTGTTCAGCGCATGGAAATATGTATGCAGTTATTAAAGCAATTCTAAAGATTAATGAAGGACTGGAACTTGGTGCAGTAAGAGAGCCTCTTCCAGCATTGGTAGATGAGGACATGGAGATTGTAAAAGAAGCTGCACAGATGATCTGTGATGCGAAGAAGAAATTTCTATAA

[0035] N-acetylneuraminic acid lyase (NanA) is an enzyme that decomposes N-acetylneuraminic acid into N-acetylmannosamine and pyruvate. The activity of NanA can be measured, for example, by the following method. <Jay Prakash Kumar et.al., Crystal structures and kinetics of N-acetylneuraminate lyase from Fusobacterium nucleatum, Acta Cryst. (2018). F74, 725?732> That is, pyruvate produced by NanA can be confirmed by the method described in the standard binding assay.<Zhu, A., Romero, R. & Petty, H. R. (2010). Anal. Biochem. 396, 146?151.> Specifically, pyruvate produced by the decomposition of N-acetylneuraminic acid is oxidized by pyruvate oxidase in the presence of phosphate and oxygen to produce acetyl phosphate, carbon dioxide, and hydrogen peroxide. The oxidation of a fluorescent probe by hydrogen peroxide is catalyzed by horseradish peroxidase, and the hydrogen peroxide produced is detected using a fluorogenic substrate.<Sugahara, K., Sugimoto, K., Nomura, O. & Usui, T. (1980). Clin. Chim. Acta, 108, 493?498.> .

[0036] As described above, Ruminococcus gnavus is known to be present in the human intestine, but as shown in the examples below, it is also an oral bacterium detected in samples collected from the oral cavity. It has NanA, a sialic acid metabolic enzyme, and grows using sialic acid in mucin as a nutrient source. Therefore, oral bacteria that have a homologue of the NanA gene of Ruminococcus gnavus in their genomic DNA may express NanA and be involved in the decomposition of mucin in the oral cavity, and if the number of such bacteria can be suppressed, it may be possible to suppress the expression of NanA in the oral cavity and suppress the decomposition of mucin in the oral cavity.

[0037] A homologue of the NanA gene of Ruminococcus gnavus refers to a NanA gene consisting of a DNA sequence having a high sequence identity with SEQ ID NO: 1. Here, examples of the sequence identity include 49.9% or more, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, 59% or more, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, 90% or more, 95% or more, and the like, including 100%. It should be noted that "sequence identity" refers to sequence consistency and is used interchangeably with "identity."

[0038] A "DNA sequence having a high sequence identity to SEQ ID NO: 1" can also be referred to as a "DNA sequence in which one or more nucleotides are deleted, substituted, inserted or added in SEQ ID NO: 1." In this case, the number of nucleotides deleted, substituted, inserted or added can be, for example, 1 to 474, 1 to 464, 1 to 455, 1 to 445, 1 to 436, 1 to 427, 1 to 417, 1 to 408, 1 to 398, 1 to 389, 1 to 379, 1 to 341, 1 to 331, 1 to 312, 1 to 284, 1 to 189, 1 to 94, 1 to 90, 1 to 80, 1 to 70, 1 to 60, or 1 to 50.

[0039] The sequence identity between a certain DNA sequence and SEQ ID NO:1 can be confirmed in accordance with standard methods, for example, using programs such as FASTA (http: / / www.genome.JP / tools / fasta / ), Basic local alignment search tool (BLAST; http: / / www.ncbi.nlm.nih.gov.), Position-Specific Iterated BLAST (PSI-BLAST; http: / / www.ncbi.nlm.nih.gov.), CLUSTALW (http: / / www.genome.jp / ja / ), and MAFFT (http: / / www.genome.jp / ja / ).

[0040] Specific examples of oral bacteria having a NanA gene (homolog of the NanA gene of Ruminococcus gnavus) in their genomic DNA that has a high sequence identity to SEQ ID NO: 1 include bacteria of the genus Ruminococcus such as Ruminococcus gnavus (ATCC 29149 = JCM6515 genome; CP027002.1) (sequence identity; approximately 100%), bacteria of the genus Fusobacterium such as Fusobacterium mortiferum (ATCC 9817 genome; CP028102.1) (sequence identity; approximately 65%), Fusobacterium nucleatum (JCM8532 genome; AE009951.2) (sequence identity; approximately 50%), and Fusobacterium nucleatum (ATCC 23726 genome; CP028109.1) (sequence identity; approximately 53%), and bacteria of the genus Blautia Wexlerae (genome of MCC298; CP102267.1) (sequence identity; approximately 96%), Blautia luti (genome of JCM17040; AP028156.1) (sequence identity; approximately 71%), Blautia producta (genome of ATCC 27340 = DSM 2950 = JCM 1471; CP048626.1) (sequence identity; approximately 71%), Blautia coccoides (genome of strain YL58; CP022713.1) (sequence identity; approximately 73%), Enterocloster bolteae (genome of ATCC BAA-613; CP022464.2) (sequence identity; approximately 72%), Anaerotruncus colihominis (genome of DSM 17241 = JCM 15631 genome; CP102255.1) (sequence identity; ~72%), Lactobacillus oligofermentans (DSM 15707 = LMG 22743 = JCM 16175 genome; LN898144.1) (sequence identity; ~71%), Treponema brennaborense (DSM 12168 genome; CP002696.1) (sequence identity; ~69%), Marvinbryantia formatexigens (DSM 14469 genome; CP102268.1) (sequence identity: about 68%), Streptococcus parasanguinis (ATCC 15912 genome; CP002843.1) (sequence identity: about 64%), etc. can be mentioned.

[0041] Among these, the genus Fusobacterium is a gram-negative, non-motile, anaerobic, non-spore-forming bacillus belonging to the family Fusobacteriaceae, and is known to be a normal bacterium in the oral cavity that is involved in the onset and aggravation of various diseases and ill health conditions. For example, Fusobacterium nucleatum is a causative bacterium of gingivitis, periodontal disease, and colorectal cancer, and has also been reported to have the potential to promote oral cancer through multiple mechanisms of action, such as activating cell proliferation, promoting cell invasion, inducing chronic inflammation, and immune evasion (Jay Prakash Kumar et al., Crystal structures and kinetics of N-acetylneuraminate lyase from Fusobacterium nucleatum, Acta Cryst. (2018). F74, 725-732) (McIlvanna et al. Fusobacterium nucleatum and oral cancer: a critical review, BMC Cancer (2021) 21:1212). Therefore, by suppressing the proliferation of Fusobacterium in the oral cavity, the present agent can be used to prevent or improve diseases selected from gingivitis, periodontal disease, colon cancer and oral cancer.

[0042] Whether or not a certain oral bacterium possesses a homologue of the NanA gene of Ruminococcus gnavus can be confirmed by a conventional method. For example, if the genomic DNA of the bacterium is sequenced and genome sequence information can be obtained, the presence or absence of the homologue can be confirmed. In addition, as shown in the examples described below, PCR may be performed using the genomic DNA of the bacterium as a template and primers capable of amplifying the homologue to confirm the presence or absence of amplification. If a significant amount of PCR product is observed, it can be said that the bacterium possesses the homologue.

[0043] In the present invention, oral mucin refers to mucin present in the oral cavity. Examples of oral mucin include the above-mentioned mucins contained in saliva (MUC5B, MUC7, etc.) and mucins in oral mucosa epithelial cells (MUC1, etc.).

[0044] Whether or not the decomposition of mucin in the oral cavity is inhibited can be confirmed by a conventional method. For example, as described in Non-Patent Document 3, the amount of MUC5B and MUC7 present in saliva can be measured by ELISA (Enzyme-Linked Immunosorbent Assay) using a commercially available ELISA kit. Therefore, the degree of inhibition of mucin decomposition can be confirmed by comparing the amount of mucin present when contacted with agarooligosaccharides and when not contacted with agarooligosaccharides.

[0045] The agent according to the present invention may be used as it is as food and beverages, supplements, medicines, quasi-drugs, cosmetics, etc., or may be used by mixing with other ingredients as a raw material for food and beverages, supplements, medicines, quasi-drugs, cosmetics, etc. These products can be produced by methods known to those skilled in the art using agaro-oligosaccharides as a raw material.

[0046] The dosage (ingestion amount) of agaro-oligosaccharides can be appropriately set depending on the subject of administration, the form of the product, and the purpose.Specific examples of dosage amounts include, for example, 0.0125 mg / kg body weight or more, 0.025 mg / kg body weight or more, 0.05 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, and 200 mg / kg body weight or less per day for adults.

[0047] The content of agarooligosaccharides in the product can also be appropriately set depending on the form and use of the product. Specific examples of the content include 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, and 5% by mass or less.

[0048] The present invention will be described below based on examples. It should be noted that the technical scope of the present invention is not limited to the characteristics shown by these examples. EXAMPLES

[0049] <Test Method> (1) Preparation of agarooligosaccharides 50 g of agar ("Ultra Agar AX-30" Ina Food Industry Co., Ltd.) was added to 1000 g of purified water and dissolved by heating, after which 2 g of concentrated sulfuric acid was added and stirred at 90°C for 3 hours. The pH was adjusted to 3.5 with sodium hydroxide, and then the mixture was treated with activated charcoal and filtered through filter paper to recover the filtrate. This was further filtered through a filter with a pore size of 0.1 μm to recover the filtrate, which was then powdered by vacuum freeze-drying to obtain agaro-oligosaccharide powder.

[0050] The composition of the prepared agaro-oligosaccharides was measured using high performance liquid chromatography (Prominence (registered trademark) HPLC system (Shimadzu Corporation)). The measurement conditions were as follows: two columns (TSKgel (registered trademark) α-2500, Tosoh Corporation) were connected in series, elution was performed using H2O as the solvent, a flow rate of 0.3 ml / min, and a temperature of 60°C, and detection was performed using RI (differential refraction). The results were as follows (values ​​are mass %, the same applies below). In this example, a composition containing the following disaccharides to decasaccharides is referred to as "agaro-oligosaccharides". Disaccharide (agarobiose): 31.5 Tetrasaccharide (agarotetraose): 30.1 Hexasaccharide (agarohexaose): 21.2 8 sugars (agarooctaose): 11.6 10 sugars (agarodecaose): 5.6

[0051] (2) Preparation of disaccharides to octasaccharides The agarooligosaccharides prepared by the test method (1) were subjected to recycle size exclusion chromatography to separate fractions containing disaccharides, tetrasaccharides, hexsaccharides, and octasaccharides. The recycle size exclusion chromatography was performed under the following conditions. <Conditions for Recycle Size Exclusion Chromatography> System: LaboACE LC-7080 Plus (Japan Analytical Industry) Column: JAIGEL-W252 / W253 (Japan Analytical Industry) Mobile phase: Aqueous solution containing 0.005% (v / v) acetic acid and 10% (v / v) ethanol Flow rate: 3.5mL / min The composition of each fraction was confirmed by high performance liquid chromatography under the conditions described in Test Method 1(1). Each fraction was dried to obtain agarobiose, agarotetraose, agarohexaose, and agarooctaose. In this Example, agarobiose, agarotetraose, agarohexaose, and agarooctaose are sometimes referred to as "disaccharide," "tetrasaccharide," "hexasaccharide," and "octasaccharide," respectively.

[0052] (3) Culture medium The culture medium was <G. Le Blay et. al., In vitro inhibition activity of nisin A, nisin Z, pediocin PA-1, Letters in Applied Microbiology, Volume45, Issue3, September 2007, Pages 252-257> We used a medium that was appropriately modified based on the Brain-Heart Infusion medium (※1) described in. *1Composition of Brain-Heart Infusion medium: Brain-Heart Infusion, 5g / L yeast extract, 5g K2HPO4, 8g glucose, 0.5g L-cysteine ​​hydrochloride, 1g Tween 80, 0.005g hemin, 0.002g vitamin K1, 1mg resazurin, 50mL salt solution (*2). *2 Composition of salt solution (per 1L): 5g sodium acetate, 2g ammonium citrate, 0.2g MgSO2·7H2O, 0.05g MnSO4·H2O, pH 6.8.

[0053] Example 1: Growth inhibition effect of Ruminococcus gnavus (1) Cultivation in the presence of agarooligosaccharides Ruminococcus gnavus JCM6515 (RIKEN BioResource Research Center, Microbial Materials Development Laboratory (JCM)) was cultured on sheep blood agar medium (M) (composition per 1L of purified water: 14.5g casein-sugar digested peptone, 5.0g soybean-papain digested peptone, 5.0g sodium chloride, 1.5g growth factor, 50mL defibered sheep blood, 14.0g agar, pH 7.3) (BD Japan) to obtain colonies. The single colony was inoculated into 3.0mL of culture medium and then cultured anaerobically at 37℃ for 3 days using the anaerobic culture kit "Anelopac" (Mitsubishi Gas Chemical), and this was used as the seed liquid.

[0054] Agar-oligosaccharides were added to the culture medium to final concentrations of 0 mass%, 0.01 mass%, 0.10 mass%, and 0.20 mass% to prepare the main culture medium. After dispensing 0.5 mL of the main culture medium into Deep Well Plates (AxyGen Scientific, CA, USA) at each well, 0.25 μL of the seed liquid was inoculated and cultured anaerobically at 37°C using the anaerobic culture kit "Anelopac" (Mitsubishi Gas Chemical).

[0055] (2) Measurement of bacteria count by turbidity method 20 μL of the culture solution was collected 24 hours and 48 hours after the start of static culture, and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture solution was measured using a microplate reader (Wako SUNRISE Rainbow). The culture medium was also diluted 10-fold and measured in the same way, and the measurement value of the culture medium was subtracted from the measurement value of the culture solution, and then multiplied by 10 to obtain the absorbance (OD660) of the culture solution. The results are shown in Figure 1.

[0056] As shown in Figure 1, the higher the final concentration of agarooligosaccharides in the main culture medium, the smaller the absorbance (OD660) value was, both after 24 and 48 hours. In other words, agarooligosaccharides suppressed the number of Ruminococcus gnavus in the main culture medium in a concentration-dependent manner. This result demonstrated that agarooligosaccharides can suppress the growth of Ruminococcus.

[0057] (3) Culture in the presence of disaccharides to octasaccharides Ruminococcus gnavus was cultured by the method described in Example 1(1) except that agarooligosaccharides were replaced with disaccharides, tetrasaccharides, hexasaccharides or octasaccharides, and the number of bacteria was measured by the turbidity method described in Example 1(2). The final concentration of disaccharides to octasaccharides in the medium was 0.2% by mass (2000 μg / mL), and the culture time was 23 hours, 31 hours and 47 hours. As comparative controls, a sample to which agarooligosaccharides were added at the same concentration and a sample to which neither agarooligosaccharides nor disaccharides to octasaccharides were added (no addition) were also cultured in the same manner, and the number of bacteria was measured. The results are shown in FIG. 2.

[0058] As shown in Figure 2, the absorbance (OD660) values ​​of the samples to which agarooligosaccharides, disaccharides, and tetrasaccharides were added were significantly lower than those of the sample without addition, regardless of the length of the incubation time. The absorbance of the sample to which hexasaccharides were added was also significantly lower than that of the sample without addition at 23 and 31 hours of incubation, and was considerably lower at 47 hours. The absorbance of the sample to which octasaccharides were added was also significantly lower than that of the sample without addition at 23 hours of incubation, and was considerably lower at 31 hours. These results demonstrated that agarooligosaccharides, agarobiose, agarotetraose, agarohexaose, and agarooctaose can inhibit the growth of Ruminococcus. Since all of these oligosaccharides have 3,6-anhydro-L-galactose at the reducing end, it was revealed that 3,6-anhydro-L-galactose or oligosaccharides having it at the reducing end can inhibit the growth of Ruminococcus.

[0059] In addition, the absorbance of disaccharides and tetrasaccharides did not increase with the incubation time, and was significantly low regardless of the incubation time. These results indicate that agarobiose and agarotetraose have a significantly greater inhibitory effect on the proliferation of Ruminococcus than other agarooligosaccharides.

[0060] Example 2: Growth inhibition effect of Fusobacterium nucleatum (1) Cultivation in the presence of agarooligosaccharides Ruminococcus gnavus JCM6515 was substituted for Fusobacterium nucleatum JCM8532 (RIKEN BioResource Research Center, Microbial Materials Development Laboratory (JCM)) and cultured according to the method described in Example 1(1), and the absorbance of the culture solution was measured by the turbidity method described in Example 1(2). However, the culture time was 48 hours. The results are shown in FIG. 3.

[0061] As shown in Figure 3, the higher the final concentration of agarooligosaccharides in the main culture medium, the smaller the absorbance (OD660). In other words, agarooligosaccharides suppressed the number of Fusobacterium nucleatum bacteria in the main culture medium in a concentration-dependent manner. This result demonstrated that agarooligosaccharides can suppress the growth of Fusobacterium.

[0062] (2) Culture in the presence of disaccharides and tetrasaccharides Fusobacterium nucleatum was cultured by the method described in Example 2(1) except that agarooligosaccharides were replaced with disaccharides and tetrasaccharides, and the number of bacteria was measured by the turbidity method. The final concentration of disaccharides and tetrasaccharides in the medium was 0.2% by mass (2000 μg / mL), and the culture time was 23 hours, 31 hours, and 47 hours. As comparative controls, samples to which agarooligosaccharides were added at the same concentration and samples to which neither agarooligosaccharides, disaccharides, nor tetrasaccharides were added (no addition) were also cultured in the same manner, and the number of bacteria was measured. The results are shown in FIG. 4.

[0063] As shown in Figure 4, the absorbance (OD660) values ​​of the samples to which disaccharides and tetrasaccharides were added were significantly lower than those of the unadded samples, regardless of the length of the incubation time. In particular, the absorbance of disaccharides did not increase with the incubation time, and the absorbance values ​​were significantly lower at all incubation times. The absorbance of the samples to which agarooligosaccharides were added was also significantly lower at 23 hours of incubation, and was considerably lower even at 31 hours, compared to the unadded samples. These results demonstrated that agarooligosaccharides, agarobiose, and agarotetraose can inhibit the growth of Fusobacterium. In particular, agarobiose was found to have a significantly greater effect of inhibiting the growth of Fusobacterium.

[0064] Furthermore, since agarooligosaccharides, agarobiose, and agarotetraose all have 3,6-anhydro-L-galactose at the reducing end, it was revealed that 3,6-anhydro-L-galactose or oligosaccharides having it at the reducing end can inhibit the growth of Fusobacterium.

[0065] Example 3: Growth inhibition effect of oral bacteria carrying the NanA gene homologue of Ruminococcus gnavus (1) Design of specific primers As homologues of the NanA gene of Ruminococcus gnavus (Table 1 (a) below), (b) to (k) in Table 1 below were extracted using EMBOSS Matcher (European Bioinformatics Institute (EMBL-EBI) https: / / www.ebi.ac.uk / Tools / psa / emboss_matcher / ). [Table 1]

[0066] Next, based on (A) to (D) in Table 1 (SEQ ID NOs: 1 to 4), the following specific primers capable of amplifying the NanA genes of Ruminococcus gnavus and Blautia were prepared. <For amplifying the NanA gene of Ruminococcus gnavus and Forward primer: 5'- TTKTTGGARACACAGACGGA -3' (SEQ ID NO: 10) Reverse primer: 5'-ACCAGGTYTCTCCCTCATCATC-3' (SEQ ID NO: 11)

[0067] In addition, based on (f) to (h) in Table 1 (SEQ ID NOs: 6 to 8), the following specific primers were prepared as capable of amplifying the NanA gene of Streptococcus parasanguinis. <For amplifying nanA of Streptococcus parasanguinis> Forward primer: 5'- GCTTTTTACGCCTGCTATGA -3' (SEQ ID NO: 12) Reverse primer: 5'-TACATTCGCCRGARGATCCGTT-3' (SEQ ID NO: 13)

[0068] In addition, the following universal primers were prepared that can amplify the V3-V4 region of the 16S ribosomal RNA gene of all bacteria. <For amplifying 16S ribosomal RNA (V3-V4 region) genes of all bacteria> Forward primer: 5'- CGGTGAATACGTTCCCGG -3' (SEQ ID NO: 14) Reverse primer: 5'-TACGGCTACCTTGTTACGACTTC-3' (SEQ ID NO: 15)

[0069] (2) Cultivation of oral bacteria in the presence of agarooligosaccharides The entire tooth was rubbed with a cotton swab. The cotton swab was placed in a 1.5 mL Eppendorf tube containing 700 μL of culture medium, and the cotton swab was pressed against the wall of the tube to transfer the material attached to the swab to the medium, which was used as the seed mother liquid. Agarooligosaccharides were added to the culture medium to a final concentration of 0 mass%, 0.01 mass%, 0.02 mass%, or 0.10 mass% to prepare the main culture medium. After dispensing 0.5 mL of the main culture medium into Deep Well Plates (AxyGen Scientific, CA, USA) per well, 0.25 μL of the seed mother liquid was inoculated and cultured anaerobically at 37 ° C. using the anaerobic culture kit "Anelopac" (Mitsubishi Gas Chemical).

[0070] (3) Measurement of the total number of oral bacteria using the turbidity method After 30 hours, 20 μL of culture medium with a final concentration of agarooligosaccharides of 0% and 0.1% by mass was collected and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture medium was measured using a microplate reader (Wako SUNRISE Rainbow). The culture medium was also diluted 10-fold and measured, and the measured value of the culture medium was subtracted from the measured value of the culture medium, and the result was multiplied by 10 to obtain the absorbance (OD660) of the culture medium. This absorbance (OD660) is generally used as an index that correlates with the total number of oral bacteria. The results are shown in Figure 5.

[0071] As shown in Figure 5, when the final concentration of agarooligosaccharides in the main culture medium was 0% by mass, the absorbance (OD660) was 0.34, whereas when the final concentration was 0.1% by mass, the absorbance (OD660) was 0.35, showing almost no difference. This result demonstrated that agarooligosaccharides had almost no effect on the total number of all bacteria when added to the medium at a concentration of 0.1% by mass or less.

[0072] (4) Measurement of the number of bacteria carrying the NanA gene by quantitative PCR After 30 hours, the culture medium was centrifuged to obtain 0, 0.01, and 0.02% agarooligosaccharides. Genomic DNA was extracted from the collected precipitate using a stool mini kit (QIAGEN) according to the manufacturer's instructions. The collected genomic DNA was used as a template to perform quantitative PCR using the real-time PCR reagent "PowerTrack? SYBR Green Master Mix" (ThermoFisher) and the primers of SEQ ID NOs: 10 to 15 to determine the DNA copy number of each gene. The annealing temperature was 50°C (for the nanA gene) or 60°C (for the 16S rRNA gene). Generally, it is said that bacteria have about four copies of the 16S rRNA gene on average, so the value obtained by dividing the DNA copy number of the 16S rRNA gene by 4 reflects the total number of bacteria, and the DNA copy number of each NanA gene reflects the number of bacteria carrying each NanA gene. From this, we calculated the value obtained by dividing the "DNA copy number of each NanA gene" by the "value obtained by dividing the DNA copy number of the 16S rRNA gene by 4," and used this value as the "proportion of bacteria carrying the NanA gene." The results are shown in Figure 6.

[0073] 6, the percentage of bacteria carrying the NanA gene of Ruminococcus gnavus and Blautia genus was 1.1% when the final concentration of agaro-oligosaccharides in the main culture medium was 0% by mass, whereas it was 0.44% at 0.01% by mass and 0.0035% at 0.02% by mass. In other words, agaro-oligosaccharides suppressed the percentage of bacteria carrying the NanA gene of Ruminococcus gnavus and Blautia genus in the main culture medium in a concentration-dependent manner.

[0074] The percentage of bacteria carrying the NanA gene of Streptococcus parasanguinis was 0.10% when the final concentration of agaro-oligosaccharides in the main culture medium was 0% by mass, whereas it was 0.023% when the final concentration was 0.01% by mass and 0.013% when the final concentration was 0.02% by mass. In other words, agaro-oligosaccharides suppressed the percentage of bacteria carrying the NanA gene of Streptococcus parasanguinis in the main culture medium in a concentration-dependent manner.

[0075] These results demonstrated that agarooligosaccharides or 3,6-anhydro-L-galactose or oligosaccharides having it at the reducing end can inhibit the growth of oral bacteria that possess in their genomic DNA the NanA gene, which has high sequence identity with the NanA gene (sequence number 1) of Ruminococcus gnavus.

Claims

1. 1. An agent for inhibiting the proliferation of oral bacteria which have in their genomic DNA an N-acetylneuraminic acid lyase gene having a DNA sequence with a sequence identity of 49.9% or more with SEQ ID NO:1, said agent comprising agarooligosaccharide as an active ingredient.

2. The agent according to claim 1, which is used for suppressing the expression of N-acetylneuraminic acid lyase in the oral cavity.

3. The agent according to claim 1, which is used to inhibit the decomposition of oral mucin.

4. The agent according to claim 1 , wherein the oral bacteria is of the genus Ruminococcus, Fusobacterium or Blautia.

5. The agent according to claim 1 , wherein the oral bacterium is Ruminococcus gnavus.

6. The agent according to claim 1, wherein the oral bacterium is of the genus Fusobacterium and is used for preventing or ameliorating a disease selected from gingivitis, periodontal disease, colon cancer and oral cancer.

7. The agent according to claim 1 , wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.

8. A proliferation inhibitor for oral bacteria having in its genomic DNA an N-acetylneuraminic acid lyase gene having a DNA sequence with a sequence identity of 49.9% or more with SEQ ID NO:1, the agent comprising 3,6-anhydro-L-galactose or an oligosaccharide having said galactose at its reducing end as an active ingredient.

Images