Nucleic acid molecule encoding car and vector comprising the same, car, immune cell including car and pharmaceutical composition comprising the cell, method for improving cytotoxic activity, and method for producing immune cell including car

Abstract

To provide an improved chimeric antigen receptor (CAR), capable of improving cytotoxic activity of an immune cell comprising the CAR, and a nucleic acid molecule encoding the same.SOLUTION: There is provided a nucleic acid molecule encoding a CAR in which at least three amino acid residues in a framework region 3 of a light chain variable region of the antigen-binding region included in the CAR are acidic amino acid residues.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a nucleic acid molecule having a nucleotide sequence encoding a chimeric antigen receptor (hereinafter also referred to as "CAR"). The present invention relates to a vector comprising the nucleic acid molecule. The present invention relates to a CAR. The present invention relates to an immune cell comprising a CAR. The present invention relates to a pharmaceutical composition for treating a malignant tumor comprising an immune cell comprising a CAR. The present invention relates to a method for improving the cytotoxic activity of an immune cell comprising a CAR. The present invention relates to a method for producing an immune cell comprising a CAR. [Background technology]

[0002] CAR is a receptor protein produced by genetically fusing an extracellular domain containing an antigen-binding region, a transmembrane domain, and an intracellular domain that transmits an activation signal of an immune cell. For example, as described in Patent Document 1, a single-chain antibody that binds to an antigen expressed in a tumor cell is used in the antigen-binding region of CAR. In recent years, attention has been focused on cancer immunotherapy, in which a gene encoding a CAR is introduced into an immune cell, and the immune cell expressing the CAR on the cell surface is transplanted into a patient to treat cancer. When an immune cell expressing a CAR recognizes an antigen on a tumor cell in vivo, it becomes activated and expresses cytotoxic molecules such as Fas ligand, perforin, and granzyme, as well as cytokines, thereby exerting an antitumor effect. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] U.S. Patent No. 7,741,465 Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide an improved CAR that can improve the cytotoxic activity of immune cells expressing the CAR. The present invention also aims to provide a nucleic acid molecule encoding such a CAR and a vector containing the nucleic acid molecule. The present invention also aims to provide an immune cell containing such a CAR, a pharmaceutical composition containing the immune cell, a method for improving the cytotoxic activity of the immune cell, and a method for producing the immune cell. [Means for solving the problem]

[0005] The present inventors discovered that the cytotoxic activity of immune cells containing CAR can be improved by changing a specific amino acid residue in framework region 3 of the light chain variable region of the antigen-binding region of CAR to an acidic amino acid residue, and completed the present invention. Thus, the following inventions [1] to

[20] are provided. Hereinafter, framework region 3 is also referred to as "FR3".

[0006] [1] A nucleic acid molecule having a nucleotide sequence encoding a CAR, the nucleic acid molecule comprising a segment encoding an extracellular domain, a segment encoding a transmembrane domain, and a segment encoding an intracellular domain, the segment encoding the extracellular domain comprising a nucleotide sequence encoding an antigen-binding region comprising a light chain variable region and a heavy chain variable region, wherein at least three codons in the nucleotide sequence encoding FR3 of the light chain variable region defined by the Chothia method are codons encoding acidic amino acid residues, and the at least three codons include at least three selected from the group consisting of a codon encoding the amino acid residue at position 60 in the light chain variable region, a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, a codon encoding the amino acid residue at position 72, a codon encoding the amino acid residue at position 74, and a codon encoding the amino acid residue at position 76.

[0007] [2] The nucleic acid molecule according to [1] above, wherein 3 to 5 codons selected from the group consisting of a codon encoding the amino acid residue at position 60, a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, a codon encoding the amino acid residue at position 72, a codon encoding the amino acid residue at position 74, and a codon encoding the amino acid residue at position 76 in the light chain variable region are codons encoding acidic amino acid residues.

[0008] [3] A nucleic acid molecule according to [1] or [2] above, wherein the antigen-binding region comprises a single-chain antibody, and the single-chain antibody is a single-chain antibody that binds to a complex of a MAGE-A4-derived peptide and HLA-A2, CD19, BCMA or CEA.

[0009] [4] The nucleic acid molecule according to any one of the above [1] to [3], wherein the transmembrane domain comprises a transmembrane region of any one protein selected from the group consisting of the T cell receptor α chain, the T cell receptor β chain, CD3ε, CD3ζ, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD154, 4-1BB, ICOS, and GITR.

[0010] [5] The nucleic acid molecule according to any one of [1] to [4] above, wherein the intracellular domain comprises a signal transduction domain of at least one protein selected from the group consisting of CD3ζ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD66d, CD79a, CD79b, FcRγ, and FcRβ.

[0011] [6] The nucleic acid molecule according to [5] above, wherein the segment encoding the intracellular domain further comprises a nucleotide sequence encoding a costimulatory domain, and the costimulatory domain is a costimulatory domain of at least one protein selected from the group consisting of 4-1BB, CD28, GITR, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154 and ICOS.

[0012] [7] The nucleic acid molecule according to any one of [1] to [6] above, further comprising a segment encoding a hinge domain between the nucleotide sequence encoding the antigen-binding region and the segment encoding the transmembrane domain.

[0013] [8] The nucleic acid molecule according to any one of the above [1] to [7], wherein the nucleic acid molecule is DNA or RNA.

[0014] [9] A vector comprising the nucleic acid molecule according to any one of [1] to [8] above.

[0015]

[10] A CAR comprising an extracellular domain, a transmembrane domain, and an intracellular domain, wherein the extracellular domain comprises an antigen-binding region comprising a light chain variable region and a heavy chain variable region, and at least three amino acid residues in FR3 of the light chain variable region defined by the Chothia method are acidic amino acid residues, and the at least three amino acid residues include at least three selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region.

[0016]

[11] The CAR according to the above-mentioned

[10] , wherein 3 to 5 amino acid residues selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region are acidic amino acid residues.

[0017]

[12] A CAR described in

[10] or

[11] above, wherein the antigen-binding region comprises a single-chain antibody, and the single-chain antibody is a single-chain antibody that binds to a complex of a MAGE-A4-derived peptide and HLA-A2, CD19, BCMA or CEA.

[0018]

[13] The CAR according to any one of the above

[10] to

[12] , wherein the transmembrane domain comprises a transmembrane region of any one protein selected from the group consisting of the T cell receptor α chain, the T cell receptor β chain, CD3ε, CD3ζ, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD154, 4-1BB, ICOS, and GITR.

[0019]

[14] The CAR according to any one of

[10] to

[13] above, wherein the intracellular domain comprises a signaling domain of at least one protein selected from the group consisting of CD3ζ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD66d, CD79a, CD79b, FcRγ, and FcRβ.

[0020]

[15] The CAR described in

[14] above, wherein the intracellular domain further comprises a costimulatory domain, and the costimulatory domain is a costimulatory domain of at least one protein selected from the group consisting of 4-1BB, CD28, GITR, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, and ICOS.

[0021]

[16] The CAR according to any one of

[10] to

[15] above, further comprising a hinge domain between the antigen-binding region and the transmembrane domain.

[0022]

[17] An immune cell comprising the chimeric antigen receptor according to any one of

[10] to

[16] above.

[0023]

[18] A pharmaceutical composition for treating a malignant tumor, comprising the immune cell described in

[17] above.

[0024]

[19] A method for improving the cytotoxic activity of an immune cell comprising a CAR, the method comprising: a CAR comprising an extracellular domain, a transmembrane domain, and an intracellular domain; the extracellular domain comprising an antigen-binding region comprising a light chain variable region and a heavy chain variable region; and at least three amino acid residues in FR3 of the light chain variable region defined by the Chothia method being acidic amino acid residues, thereby improving the cytotoxic activity of the immune cell comprising the CAR compared to a CAR before the at least three amino acid residues are acidic amino acid residues.

[0025]

[20] A method for producing an immune cell containing a CAR, comprising introducing the nucleic acid molecule described in any one of [1] to [8] above or the vector described in [9] above into an immune cell and allowing the immune cell to express the CAR. Effect of the Invention

[0026] According to the present invention, immune cells containing a CAR with improved cytotoxic activity can be obtained. [Brief description of the drawings]

[0027] [Figure 1]FIG. 1 is a schematic diagram of an example of a nucleic acid molecule of this embodiment. A diagram of an enlarged light chain variable region-encoding segment (VL) in the nucleic acid molecule is also shown. In the diagram, A indicates a segment encoding an extracellular domain, B indicates a segment encoding a transmembrane domain, and C indicates a segment encoding an intracellular domain. D indicates a segment encoding an antigen-binding region contained in the extracellular domain. Among these segments, VH indicates a segment encoding a heavy chain variable region, L indicates a segment encoding a linker, HD indicates a segment encoding a hinge domain, TMD indicates a segment encoding a transmembrane domain, co-STD indicates a segment encoding a costimulatory domain, and SD indicates a segment encoding a signal transduction domain. In the enlarged view of VL, the dashed line with * indicates a codon encoding an acidic amino acid residue. In this diagram, there are three codons encoding acidic amino acid residues in the segment encoding FR3, but the present invention is not limited thereto. [Diagram 2] FIG. 1 is a schematic diagram of an example of a CAR according to the present embodiment. In the diagram, VH indicates a heavy chain variable region, VL indicates a light chain variable region, HD indicates a hinge domain, TMD indicates a transmembrane domain, co-STD indicates a costimulatory domain, and SD indicates a signal transduction domain. The curved line connecting VH and VL indicates a linker. In VL, the dashed line with * indicates an acidic amino acid residue. In this diagram, there are three acidic amino acid residues in FR3, but the present invention is not limited thereto. [Diagram 3] FIG. 1 is a schematic diagram showing the nucleic acid molecules encoding the CARs of Examples 1 to 4. [Figure 4] FIG. 1 is a schematic representation of a nucleic acid molecule encoding a CAR of Example 5. [Diagram 5] FIG. 1 is a schematic representation of the nucleic acid molecules encoding the CARs of Examples 6 and 7. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] 1. Nucleic acid molecules The nucleic acid molecule of this embodiment has a nucleotide sequence encoding a CAR. In this specification, the term "nucleotide sequence" is synonymous with "base sequence" and "nucleic acid sequence". A nucleotide sequence refers to a one-dimensional arrangement (order) of nucleotides in a nucleic acid molecule. A nucleic acid molecule encoding a polypeptide has a nucleotide sequence encoding the polypeptide. In this specification, the expression "having a nucleotide sequence" means both consisting of the nucleotide sequence and including the nucleotide sequence. In this specification, the term "polypeptide" includes a protein molecule, a partial region in a protein molecule, and a fragment of a protein molecule. In this specification, a partial region in a nucleic acid molecule may be referred to as a "segment", and a partial region in a protein molecule may be referred to as a "domain".

[0029] As illustrated in FIG. 1, the nucleic acid molecule of this embodiment includes, in order from the 5' side, a segment encoding an extracellular domain, a segment encoding a transmembrane domain, and a segment encoding an intracellular domain. The segment encoding the extracellular domain includes a nucleotide sequence encoding an antigen-binding region including a light chain variable region and a heavy chain variable region. In this specification, the term "antigen-binding region including a light chain variable region and a heavy chain variable region" refers to a domain that includes at least one light chain variable region and at least one heavy chain variable region and can bind to a specific antigen via these. In the antigen-binding region, one antigen-binding site is composed of one heavy chain variable region and one light chain variable region that is paired with it. When the antigen-binding region includes multiple heavy chain variable regions and multiple light chain variable regions, multiple antigen-binding sites can be composed in the antigen-binding region.

[0030] An example of the antigen-binding region is a single-chain antibody. Hereinafter, the single-chain antibody is also referred to as "scFv". An scFv is a molecule in which one light chain variable region and one heavy chain variable region are linked via a peptide linker. An scFv has one antigen-binding site. A segment encoding an scFv is a partial region of the nucleic acid molecule of this embodiment. In the nucleic acid molecule of FIG. 1, the segment encoding the antigen-binding region includes a nucleotide sequence encoding an scFv consisting of VH, L, and VL. In FIG. 1, the nucleotide sequence encoding the scFv includes, but is not limited to, segments encoding each of VH, L, and VL in order from the 5' side. The nucleotide sequence encoding the scFv may include, but is not limited to, segments encoding each of VL, L, and VH in order from the 5' side. Details of each segment of the nucleic acid molecule of this embodiment and the CAR encoded by this nucleic acid molecule will be described later.

[0031] Hereinafter, FR3 of the light chain variable region is also referred to as "light chain FR3". As illustrated in FIG. 1, the nucleic acid molecule of this embodiment is characterized in that at least three codons in the nucleotide sequence encoding the light chain FR3 defined by the Chothia method are codons encoding acidic amino acid residues. However, the at least three codons include at least three selected from the group consisting of a codon encoding the amino acid residue at position 60 of the light chain variable region, a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, a codon encoding the amino acid residue at position 72, a codon encoding the amino acid residue at position 74, and a codon encoding the amino acid residue at position 76. As long as at least three of the codons encoding the amino acid residues at these positions are codons encoding acidic amino acid residues, the codons encoding the amino acid residues at other positions of the light chain FR3 may be codons encoding any of acidic amino acid residues, basic amino acid residues, and neutral amino acid residues. In this specification, "codon" refers to three consecutive nucleotides of DNA or RNA. The Chothia method will be discussed later.

[0032] Thus, the CAR encoded by the nucleic acid molecule of this embodiment has an antigen-binding region in which at least three amino acid residues in the light chain FR3 defined by the Chothia method are acidic amino acid residues, and the at least three amino acid residues include at least three selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region. Such an antigen-binding region is also referred to as a "modified antigen-binding region" below. In addition, a CAR having a modified antigen-binding region is also referred to as a "modified CAR" below. The nucleic acid molecule of this embodiment can be said to be a nucleic acid molecule encoding a modified CAR.

[0033] A framework region (FR) is a region other than the complementarity determining region (CDR) present in each of the light chain variable region and the heavy chain variable region of an antibody. The FR plays the role of a scaffold connecting the three CDRs and contributes to the structural stability of the CDRs. Therefore, the amino acid sequence of the FR is highly conserved among antibodies of the same species. Each of the heavy chain and light chain variable regions has three CDRs, CDR1, CDR2, and CDR3, and four FRs, FR1, FR2, FR3, and FR4. These are arranged in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 from the N-terminus of the variable region. Hereinafter, the CDR of the heavy chain may be referred to as "HCDR" and the CDR of the light chain may be referred to as "LCDR".

[0034] In the art, methods for numbering the amino acid residues of CDRs (hereinafter also referred to as "numbering methods") are known to define the boundaries and lengths of CDRs. When the amino acid residues of CDRs are numbered by the numbering method, the amino acid residues of FRs are also numbered. The numbers assigned to the amino acid residues by the numbering method indicate the position of the amino acid residue in the amino acid sequence of the light chain or heavy chain. Examples of numbering methods include the Chothia method (Chothia C. and Lesk AM., Canonical Structures for the Hypervariable Regions of Immunoglobulins., J. Mol. Biol., vol. 196, p. 901-917, 1987), the Kabat method (Kabat EA. et al., Sequences of Proteins of Immunological Interest., NIH publication No. 91-3242), the IMGT method (Lefranc MP. et al., Developmental and Comparative Immunology 29 (2005) 185-203), the Honegger method (Honegger A. et al., Yet Another Numbering Scheme for Immunoglobulin Variable Domains: An Automatic Modeling and Analysis Tool., J. Mol. Biol., vol. 309, p. 657-670, 2001), the ABM method, and the Contact method. In the present specification, the numbering is based on the assumption that the first amino acid residue in the light chain variable region is "position 1."

[0035] Regarding the antigen-binding region, the boundaries and lengths of the CDRs and FRs in the light and heavy chain variable regions may be defined by any numbering system. In this specification, the boundaries and lengths of the CDRs and FRs are defined by the Chothia method. For example, when the antigen-binding region includes or consists of an scFv, the light chain FR1 of the scFv is defined as a region consisting of amino acid residues at positions 1 to 23 of the light chain variable region according to the Chothia method. The light chain FR2 of the scFv is defined as a region consisting of amino acid residues at positions 35 to 49 of the light chain variable region. The light chain FR3 of the scFv is defined as a region consisting of amino acid residues at positions 57 to 88 of the light chain variable region. The light chain FR4 of the scFv is defined as a region consisting of amino acid residues at positions 98 to 110 of the light chain variable region. In this specification, when the positions of amino acid residues in the light chain variable region of the antigen-binding region are described, the positions of the amino acid residues represent the positions defined by the Chothia method, unless otherwise specified.

[0036] A nucleic acid molecule encoding a modified antigen-binding region can be obtained by modifying the codons described below for a nucleic acid molecule encoding an original antigen-binding region. In this specification, the term "original antigen-binding region" refers to an antigen-binding region before modification, in which the number of acidic amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 of the light chain variable region is two or less. That is, in the nucleotide sequence encoding the light chain variable region of the original antigen-binding region, the codons encoding the amino acid residues at the above positions have two or less codons encoding acidic amino acid residues. In the nucleotide sequence encoding the light chain variable region of the original antigen-binding region, the codons encoding the amino acid residues at positions other than the above positions may be codons encoding any of acidic amino acid residues, basic amino acid residues, and neutral amino acid residues. Hereinafter, a CAR having an original antigen-binding region is also referred to as a "CAR before modification".

[0037] The nucleic acid molecule of this embodiment can be obtained by linking, in order from the 5' side, a nucleic acid molecule encoding an extracellular domain, a nucleic acid molecule encoding a transmembrane domain, and a nucleic acid molecule encoding an intracellular domain. Linking of these nucleic acid molecules can be performed by known gene recombination techniques and other molecular biology techniques. The nucleic acid molecule encoding the extracellular domain may consist of a nucleic acid molecule encoding a modified antigen-binding region. Preferably, the nucleic acid molecule encoding the extracellular domain is obtained by linking a nucleic acid molecule encoding a modified antigen-binding region and a nucleic acid molecule encoding a hinge domain by the above-mentioned techniques.

[0038] In the nucleotide sequence encoding the light chain FR3 of the original antigen-binding region, changing three or more codons encoding amino acid residues that are not acidic amino acid residues to codons encoding acidic amino acid residues is hereinafter also referred to as "modifying the codons" or "modifying the codons". A nucleic acid molecule encoding a modified antigen-binding region can be obtained by modifying the codons of a nucleic acid molecule encoding the original antigen-binding region. The amino acid residues that are not acidic amino acid residues are neutral amino acid residues and / or basic amino acid residues, preferably neutral amino acid residues. It is preferable that the nucleotide sequence encoding the modified antigen-binding region is the same as the nucleotide sequence encoding the original antigen-binding region except for the site where the codons have been modified.

[0039] By such codon modification, at least three codons in the nucleotide sequence encoding the light chain FR3 of the original antigen-binding region become codons encoding acidic amino acid residues, and a nucleic acid molecule encoding the modified antigen-binding region can be obtained. Codon modification can be performed by substituting or inserting codons in the nucleic acid molecule encoding the original antigen-binding region.

[0040] The acidic amino acid residues are aspartic acid residues and glutamic acid residues. The basic amino acid residues are lysine residues and arginine residues. The neutral amino acid residues are alanine residues, asparagine residues, cysteine ​​residues, glycine residues, glutamine residues, isoleucine residues, leucine residues, methionine residues, phenylalanine residues, proline residues, serine residues, threonine residues, tryptophan residues, tyrosine residues, valine residues, and histidine residues. Histidine residues may exhibit weak basicity or may exhibit neutrality under a neutral environment, and therefore, in this specification, histidine residues are treated as neutral amino acid residues. In particular, in the calculation of the electrical properties (X) of CDRs described below, histidine residues are treated as neutral amino acid residues.

[0041] In the nucleotide sequence encoding the light chain FR3, the at least three codons introduced by codon modification may all be codons encoding aspartic acid residues, or all may be codons encoding glutamic acid residues. Alternatively, in the nucleotide sequence encoding the light chain FR3, some of the at least three codons introduced by codon modification may be codons encoding aspartic acid residues, and the remaining may be codons encoding glutamic acid residues.

[0042] The nucleic acid molecule of this embodiment may be DNA or RNA. In the nucleotide sequence encoding the light chain FR3, the type of codon introduced by codon modification is not particularly limited as long as it encodes an acidic amino acid residue. When the nucleic acid molecule of this embodiment is DNA, examples of the codons encoding the acidic amino acid residue include GAC and GAT which encode aspartic acid residues, and GAA and GAG which encode glutamic acid residues. When the nucleic acid molecule of this embodiment is RNA, examples of the codons encoding the acidic amino acid residues include GAC and GAU which encode aspartic acid residues, and GAA and GAG which encode glutamic acid residues.

[0043] In the nucleic acid molecule of this embodiment, the number of codons encoding acidic amino acid residues in the nucleotide sequence encoding the light chain FR3 is, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14. The number of codons encoding acidic amino acid residues in the nucleotide sequence encoding the light chain FR3 is preferably 3 to 6, more preferably 3 to 5.

[0044] In the light chain FR3 of the modified antigen-binding region, at least three acidic amino acid residues derived from the modification of the codon are preferably located at the amino acid residue positions excluding the Vernier zone residues and non-exposed residues from the amino acid sequence of the light chain FR3. The "Vernier zone residue" is an amino acid residue in the amino acid sequence of the FR that contributes to the structural stability of the CDR. The "non-exposed residue" is an amino acid residue that is folded inside the molecule and is not exposed on the surface. Even if the non-exposed residue is modified, it is expected that the effect of the modification is small or non-existent. For example, the amino acid residues excluding the Vernier zone residues and non-exposed residues from the amino acid sequence of the light chain FR3 are the amino acid residues at positions 57, 58, 59, 60, 61, 62, 63, 65, 67, 70, 72, 74, 76, 77, 79, 80, and 81 of the light chain variable region. Therefore, when a codon encoding an amino acid residue other than positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region is modified in the nucleotide sequence encoding the modified antigen-binding region, the modified codon is preferably a codon encoding an amino acid residue at a position selected from the group consisting of positions 57, 58, 59, 61, 62, 77, 79, 80, and 81.

[0045] As described above, in the nucleotide sequence encoding the modified antigen-binding region, at least three codons selected from the group consisting of the codon encoding the amino acid residue at position 60, the codon encoding the amino acid residue at position 63, the codon encoding the amino acid residue at position 65, the codon encoding the amino acid residue at position 67, the codon encoding the amino acid residue at position 70, the codon encoding the amino acid residue at position 72, the codon encoding the amino acid residue at position 74, and the codon encoding the amino acid residue at position 76 in the light chain variable region are codons encoding acidic amino acid residues. Preferably, 3 to 6 codons selected from the above group are codons encoding acidic amino acid residues. More preferably, 3 to 5 codons selected from the above group are codons encoding acidic amino acid residues.

[0046] For example, in the nucleotide sequence encoding the modified antigen-binding region, the codons encoding at least three amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region may be codons encoding acidic amino acid residues. Alternatively, in the nucleotide sequence encoding the modified antigen-binding region, the codons encoding the amino acid residues at positions 60, 74, and 76 in the light chain variable region may be codons encoding acidic amino acid residues.

[0047] For example, in the nucleotide sequence encoding the modified antigen-binding region, the codons encoding at least two amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region and the codons encoding at least one amino acid residue selected from the group consisting of positions 60, 74, and 76 in the light chain variable region may be codons encoding acidic amino acid residues. Alternatively, in the nucleotide sequence encoding the modified antigen-binding region, the codons encoding at least one amino acid residue selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region and the codons encoding at least two amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region may be codons encoding acidic amino acid residues.

[0048] In the nucleotide sequence encoding the light chain FR3 of the modified antigen-binding region, when 3 to 6 codons are codons encoding acidic amino acid residues, the 3 to 6 codons may include, for example, codons encoding 3, 4, or 5 amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and codons encoding 1, 2, or 3 amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region. Alternatively, the 3 to 6 codons may include, for example, codons encoding 1, 2, or 3 amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and codons encoding 2 or 3 amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region.

[0049] When three to five codons in the nucleotide sequence encoding the light chain FR3 of the modified antigen-binding region are codons encoding acidic amino acid residues, the three to five codons may include, for example, a codon encoding two or three amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and a codon encoding one or two amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region. Alternatively, the three to five codons may include, for example, a codon encoding one or two amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and a codon encoding two or three amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region.

[0050] In the nucleotide sequence encoding the light chain FR3 of the modified antigen-binding region, for example, each codon described in any one of 1) to 11) below can be a codon encoding an acidic amino acid residue. 1) a codon encoding the amino acid residue at position 60, a codon encoding the amino acid residue at position 63, and a codon encoding the amino acid residue at position 65 in a light chain variable region; 2) a codon encoding the amino acid residue at position 60, a codon encoding the amino acid residue at position 74, and a codon encoding the amino acid residue at position 76 in the light chain variable region; 3) a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 70, and a codon encoding the amino acid residue at position 72 in the light chain variable region; 4) a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, and a codon encoding the amino acid residue at position 72 in the light chain variable region; 5) a codon encoding the amino acid residue at position 70, a codon encoding the amino acid residue at position 72, and a codon encoding the amino acid residue at position 74 in the light chain variable region; 6) a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, and a codon encoding the amino acid residue at position 70 in the light chain variable region; 7) a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, and a codon encoding the amino acid residue at position 72 in the light chain variable region; 8) a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 70, and a codon encoding the amino acid residue at position 72 in the light chain variable region; 9) a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, and a codon encoding the amino acid residue at position 72 in the light chain variable region; 10) a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, and a codon encoding the amino acid residue at position 72 in the light chain variable region; and 11) A codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, and a codon encoding the amino acid residue at position 72 in the light chain variable region.

[0051] Since the CDR is involved in the affinity of the antigen-binding region for the antigen, it is preferable that the nucleotide sequence encoding the CDR of the antigen-binding region is not altered in the nucleic acid molecule of this embodiment. That is, the amino acid sequence of the CDR of the modified antigen-binding region and the nucleotide sequence encoding it are preferably the same as the amino acid sequence of the CDR of the original antigen-binding region and the nucleotide sequence encoding it.

[0052] The electrical properties of the CDRs of the antigen-binding region encoded by the nucleic acid molecule of this embodiment are not particularly limited, and may be negatively, neutrally, or positively charged. This also applies to the original antigen-binding region. Here, the electrical properties of the CDRs are an index determined based on the number of acidic amino acid residues and basic amino acid residues of the CDRs contained in one antigen-binding site. The CDRs contained in one antigen-binding site are all CDRs present in one heavy chain variable region and one light chain variable region constituting one antigen-binding site. That is, the CDRs contained in one antigen-binding site are a total of six CDRs, including LCDR1, LCDR2, LCDR3, HCDR1, HCDR2, and HCDR3. The electrical properties of the CDRs are specifically determined by the following formula (I). When the antigen-binding region contains multiple antigen-binding sites, the electrical properties of the CDRs can be determined for each antigen-binding site.

[0053] X = [number of basic amino acid residues in CDRs in one antigen-binding region] - [number of acidic amino acid residues in CDRs in one antigen-binding region] (I) (In the formula, When X is less than or equal to -2, the electrical characteristic of the CDR is negative charge; When X is -1, 0 or 1, the electronic properties of the CDRs are neutral; When X is 2 or more, the electrical characteristic of the CDR is a positive charge.

[0054] As can be seen from the above formula (I), the electrical properties of the CDRs of the antigen-binding region are determined by the difference between the total number of basic amino acid residues contained in the six CDRs, LCDR1, LCDR2, LCDR3, HCDR1, HCDR2 and HCDR3 in the antigen-binding region and the total number of acidic amino acid residues. In the above formula, the acidic amino acid residues are aspartic acid residues and glutamic acid residues, and the basic amino acid residues are arginine residues and lysine residues. As described above, in calculating the electrical properties of the CDRs, histidine residues are treated as neutral amino acid residues. For example, in the scFv that binds to the MAGE-A4 / HLA-A2 complex in Example 1 described below, when the CDRs are defined by the Chothia method, the number of acidic amino acid residues in the CDRs contained in one antigen-binding site is 6, and the number of basic amino acid residues is 3 (see Table 1). Therefore, the electrical properties of the CDRs of the scFv are negatively charged.

[0055] Hereinafter, immune cells containing CAR before modification are also referred to as "immune cells before modification", and immune cells containing CAR after modification are also referred to as "immune cells after modification". When the amino acid sequence of CAR after modification is the same as that of CAR before modification, except that at least three amino acid residues in the light chain FR3 are acidic amino acid residues, the cytotoxic activity of the immune cells after modification can be compared with that of the immune cells before modification. The term "cytotoxic activity" is synonymous with "cytocidal effect". The immune cells after modification have improved cytotoxic activity against tumor cells compared to the immune cells before modification.

[0056] The cytotoxic activity of immune cells containing CAR can be evaluated in vitro. For example, the cytotoxic activity can be evaluated by indicators such as the number of surviving tumor cells and the survival rate when immune cells containing CAR are co-cultured with tumor cells. Specifically, the method of Example 1 described later is exemplified. The cytotoxic activity of immune cells containing CAR can also be evaluated in vivo using non-human animals. For example, in the case of solid cancer, the cytotoxic activity can be evaluated by transplanting tumor cells into a non-human animal such as a mouse, administering immune cells containing CAR, and measuring the size of the tumor. In the case of blood cancer, the cytotoxic activity can be evaluated by transplanting tumor cells into a non-human animal such as a mouse, administering immune cells containing CAR, and measuring the number of tumor cells in the collected blood using a microscope, flow cytometer, or the like.

[0057] As described above, the nucleic acid molecule encoding the modified antigen-binding region can be obtained from the original nucleic acid molecule encoding the antigen-binding region by known gene recombination techniques and other molecular biology techniques. First, a primer set for modifying codons is prepared based on the nucleotide sequence of the nucleic acid molecule encoding the original antigen-binding region. For example, when the codon modification is a codon substitution, a primer set designed to replace at least three codons in the nucleotide sequence encoding the light chain FR3 with codons encoding acidic amino acid residues is prepared. Then, by amplifying the original nucleic acid molecule encoding the antigen-binding region using the primer set as a template by PCR, a nucleic acid molecule encoding an antigen-binding region in which at least three amino acid residues in the light chain FR3 are replaced with acidic amino acid residues can be obtained. Alternatively, when the codon modification is a codon insertion, a primer set designed to insert codons encoding acidic amino acid residues into at least three positions in the nucleotide sequence encoding the light chain FR3 is prepared. Then, by performing a PCR method using this primer set, the original nucleic acid molecule encoding the antigen-binding region can be amplified as a template to obtain a nucleic acid molecule encoding an antigen-binding region in which acidic amino acid residues have been inserted into at least three positions in the light chain FR3.

[0058] When a nucleic acid molecule encoding a CAR before modification is available, a nucleic acid molecule encoding a CAR containing a modified antigen-binding region can be prepared by In-Fusion (registered trademark) cloning as described in Example 1 below. For example, a DNA fragment is first synthesized in which at least three codons in the nucleotide sequence encoding the light chain FR3 are codons encoding acidic amino acid residues. Next, a linearized vector is prepared by deleting a portion corresponding to the above fragment from a plasmid DNA vector containing a gene encoding a CAR before modification by inverse PCR. Then, the DNA fragment and the linearized vector are ligated with an In-Fusion reagent. This results in a nucleic acid molecule encoding a CAR containing a modified antigen-binding region.

[0059] As described above, since the nucleic acid molecule encoding the modified antigen-binding region is obtained based on the nucleic acid molecule encoding the original antigen-binding region, it is preferable that the original antigen-binding region is available as a nucleic acid molecule containing a nucleotide sequence encoding it. For example, when an E. coli clone having a plasmid DNA encoding the original antigen-binding region is available, the nucleic acid molecule containing a nucleotide sequence encoding the original antigen-binding region can be obtained by extracting the plasmid DNA from the E. coli clone. In addition, for the preparation of the above primer set, it is preferable that the nucleotide sequence encoding the original antigen-binding region is known or can be confirmed. When the antigen-binding region includes or consists of an scFv, the nucleotide sequence encoding the scFv can be found from known databases such as PDB, GeneBank, abYsis, and IMGT. When a nucleic acid molecule containing a nucleotide sequence encoding the original antigen-binding region is in possession of the nucleic acid molecule, the nucleotide sequence encoding the original antigen-binding region can be found by sequencing the nucleic acid molecule.

[0060] The modified antigen-binding region and the original antigen-binding region preferably bind to at least an antigen expressed in tumor cells. The antigen may be an antigen that is also expressed in normal cells, or an antigen that is specifically expressed in tumor cells. The antigen includes not only full-length antigens, but also fragments of the antigen and complexes of the antigen fragments and MHC (major histocompatibility complex) proteins. Examples of antigen fragments include a portion of the antigen presented by antigen-presenting cells or tumor cells themselves, and synthetic peptides consisting of a portion of the amino acid sequence of the antigen. MHC proteins are called HLA (human leukocyte antigens) in humans, and include HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DQ, and HAL-DP. For example, when the antigen is a protein expressed in tumor cells, the modified antigen-binding region and the original antigen-binding region can bind to a complex of the antigen fragment and MHC protein.

[0061] The types of antigens recognized by the antigen-binding region are preferably antigens present on the surface of tumor cells and antigens present inside tumor cells. Examples of such antigens include CD19, CD20, CD30, CD44, CD133, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, PRAME, NY-ESO-1, SSX2, GP100, MART-1, HER2, carcinoembryonic antigen (CEA), MUC-1, CA125, glypican 3 (GPC3), B cell maturation antigen (BCMA), prostate specific membrane antigen (PSMA), ganglioside GM2, and mesothelin. The antigen recognized by the antigen-binding region may be a complex of an antigen fragment and an MHC protein. This complex is formed when the antigen is fragmented in a tumor cell and the fragment binds to the MHC of the tumor cell. The formed complex is then presented on the surface of the tumor cell. Examples of such complexes include a complex between a MAGE-A4-derived peptide and HLA-A2 (hereinafter also referred to as a "MAGE-A4 / HLA-A2 complex") and a complex between a PRAME-derived peptide and HLA-A24 (hereinafter also referred to as a "PRAME / HLA-A24 complex"). Examples of HLA-A2 that form a complex with a MAGE-A4-derived peptide include HLA-A*02:01, HLA-A*02:02, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, and HLA-A*02:11. Of these, HLA-A*02:01 is preferred. Examples of HLA-A24 that form a complex with a PRAME-derived peptide include HLA-A*24:02 and HLA-A*24:03. Of these, HLA-A*24:02 is preferred. MAGE-A4-derived peptides and PRAME-derived peptides may form complexes with HLAs different from those mentioned above depending on the sequence of the fragmented peptide. MAGE-A4-derived peptides and PRAME-derived peptides are oligopeptides consisting of a part (e.g., 8 to 20 amino acids) of the amino acid sequence of MAGE-A4 and PRAME, respectively. An example of a MAGE-A4-derived peptide is an oligopeptide consisting of the amino acid sequence of GVYDGREHTV (SEQ ID NO: 1).An example of a PRAME-derived peptide is an oligopeptide consisting of the amino acid sequence LYVDSLFFL (SEQ ID NO: 2).

[0062] The original nucleic acid molecule encoding the antigen-binding region itself can be obtained by known gene recombination techniques and other molecular biology techniques. When the antigen-binding region includes or consists of scFv, a nucleic acid molecule encoding scFv that binds to an antigen of a tumor cell can be isolated, for example, by a phage display method using an antibody phage library. Alternatively, a hybridoma that produces an antibody that binds to an antigen of a tumor cell can be prepared, and a nucleic acid molecule encoding scFv can be prepared by reverse transcription and PCR using RNA extracted from the hybridoma. The hybridoma can be prepared by known methods, such as the method described in Kohler G. and Milstein C., Nature, vol.256, p.495-497, 1975.

[0063] In the segment encoding the extracellular domain (hereinafter also referred to as the "extracellular segment"), the nucleotide sequence encoding the antigen-binding region includes a nucleotide sequence encoding a light chain variable region and a nucleotide sequence encoding a heavy chain variable region. The nucleotide sequence encoding the antigen-binding region may include a nucleotide sequence encoding a part or all of the constant region of an antibody. The constant region of an antibody may be either a heavy chain or a light chain constant region, but is preferably a light chain constant region. In the nucleotide sequence encoding the antigen-binding region, the order of the nucleotide sequence encoding the light chain variable region and the nucleotide sequence encoding the heavy chain variable region is not particularly limited. For example, the nucleotide sequence encoding the antigen-binding region may include, in order from the 5' side, a nucleotide sequence encoding a light chain variable region and a nucleotide sequence encoding a heavy chain variable region. Alternatively, the nucleotide sequence encoding the antigen-binding region may include, in order from the 5' side, a nucleotide sequence encoding a heavy chain variable region and a nucleotide sequence encoding a light chain variable region. When the nucleotide sequence encoding a part or all of the constant region of the light chain is included, it is preferable that the nucleotide sequence follows the nucleotide sequence encoding the light chain variable region. When it includes a nucleotide sequence encoding part or all of a heavy chain constant region, it is preferred that this nucleotide sequence follows the nucleotide sequence encoding the heavy chain variable region.

[0064] The segment encoding the antigen-binding region comprises or consists of a nucleotide sequence encoding an scFv that binds to any one of the above-mentioned tumor cell antigens. Preferably, the segment encoding the antigen-binding region comprises or consists of a nucleotide sequence encoding an scFv that binds to a complex of a MAGE-A4-derived peptide and HLA-A2, CD19, BCMA or CEA.

[0065] Preferably, the nucleotide sequence encoding the scFv that binds to the complex of the MAGE-A4-derived peptide and HLA-A2 includes the nucleotide sequences shown in SEQ ID NOs: 3 to 7 and a nucleotide sequence consisting of GATGATAGC. SEQ ID NO: 3 represents a nucleotide sequence encoding HCDR1, SEQ ID NO: 4 represents a nucleotide sequence encoding HCDR2, SEQ ID NO: 5 represents a nucleotide sequence encoding HCDR3, SEQ ID NO: 6 represents a nucleotide sequence encoding LCDR1, and SEQ ID NO: 7 represents a nucleotide sequence encoding LCDR3. The nucleotide sequence consisting of GATGATAGC encodes LCDR2. A specific example of a nucleotide sequence encoding an scFv that includes SEQ ID NOs: 3 to 7 and a nucleotide sequence consisting of GATGATAGC is shown in SEQ ID NO: 8. A nucleotide sequence encoding an scFv in which the light chain FR3 is modified based on the nucleotide sequence shown in SEQ ID NO: 8 is shown, for example, in SEQ ID NOs: 9 to 13.

[0066] Preferably, the nucleotide sequence encoding the scFv that binds to CD19 includes the nucleotide sequences shown in SEQ ID NOs: 14 to 17, the nucleotide sequence consisting of CACACATCT, and the nucleotide sequence consisting of GGTAGCGAA. SEQ ID NO: 14 shows the nucleotide sequence encoding HCDR1, SEQ ID NO: 15 shows the nucleotide sequence encoding HCDR3, SEQ ID NO: 16 shows the nucleotide sequence encoding LCDR1, and SEQ ID NO: 17 shows the nucleotide sequence encoding LCDR3. The nucleotide sequence consisting of CACACATCT encodes HCDR2. The nucleotide sequence consisting of GGTAGCGAA encodes LCDR2. A specific example of the nucleotide sequence encoding the scFv including SEQ ID NOs: 14 to 17, the nucleotide sequence consisting of CACACATCT, and the nucleotide sequence consisting of GGTAGCGAA is shown in SEQ ID NO: 18. Based on the nucleotide sequence shown in SEQ ID NO: 18, the nucleotide sequence encoding the scFv with the light chain FR3 modified is shown in, for example, SEQ ID NOs: 19 to 26.

[0067] The nucleotide sequence encoding the scFv preferably contains a nucleotide sequence encoding a peptide linker between the nucleotide sequence encoding the light chain variable region and the nucleotide sequence encoding the heavy chain variable region. In the scFv, the peptide linker is a portion that links the light chain variable region and the heavy chain variable region. The amino acid sequence of the peptide linker is not particularly limited, but generally, a sequence having a length of 15 to 20 amino acids containing a repeat of an amino acid sequence consisting of glycine residues and serine residues (e.g., GGGGS: SEQ ID NO: 27) is used. For example, the nucleotide sequence encoding the scFv may contain, in order from the 5' side, a nucleotide sequence encoding a light chain variable region, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding a heavy chain variable region. Alternatively, the nucleotide sequence encoding the scFv may contain, in order from the 5' side, a nucleotide sequence encoding a heavy chain variable region, a nucleotide sequence encoding a peptide linker, and a nucleotide sequence encoding a light chain variable region.

[0068] In CAR, the transmembrane domain is a site for fixing the CAR to the cell membrane of an immune cell. The transmembrane domain of CAR may be derived from a transmembrane protein. For example, in the nucleic acid molecule of this embodiment, a segment having a nucleotide sequence encoding a transmembrane domain (hereinafter also referred to as a "transmembrane segment") may include a nucleotide sequence encoding the full length of a transmembrane protein. Alternatively, the transmembrane segment may include a nucleotide sequence encoding a part of a transmembrane protein, so long as the function as a transmembrane domain is maintained. The part of the transmembrane protein preferably includes all or a part of the transmembrane region of the protein. The transmembrane protein is not particularly limited, and examples thereof include the α chain of the T cell receptor, the β chain of the T cell receptor, CD3ε, CD3ζ, CD4, CD5, CD8α, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD154, 4-1BB (also called CD137), ICOS (Inducible T-cell co-stimulator), and GITR (Glucocorticoid-induced TNF receptor). Preferably, the transmembrane segment comprises a nucleotide sequence encoding the transmembrane region of any one protein selected from the group of these transmembrane proteins. Among them, a nucleotide sequence encoding the transmembrane region of CD8α or CD28 is particularly preferred. A specific example of a nucleotide sequence encoding the transmembrane region of CD8α is shown in SEQ ID NO:28. A specific example of a nucleotide sequence encoding the transmembrane region of CD28 is shown in SEQ ID NO:29.

[0069] The nucleic acid molecule of this embodiment preferably includes a segment encoding a hinge domain (hereinafter also referred to as "hinge segment") between the nucleotide sequence encoding the antigen-binding region and the transmembrane segment. In a CAR, the hinge domain can provide the extracellular domain with the length for the antigen-binding region to access the antigen and flexibility to avoid steric hindrance. The hinge domain is also called a spacer region. The hinge domain of a CAR can be derived from, for example, a transmembrane protein or IgG. Specifically, in the nucleic acid molecule of this embodiment, the hinge segment may include a nucleotide sequence encoding the entire extracellular region of a transmembrane protein or the entire constant region of an IgG. Alternatively, the hinge segment may include a nucleotide sequence encoding a part of the extracellular region of a transmembrane protein or a part of the constant region of an IgG, as long as the function as a hinge domain is maintained. The part of the extracellular region of a membrane protein that can be used as a hinge domain is hereinafter also referred to as a "hinge region". Preferably, the hinge segment comprises a nucleotide sequence encoding any one region selected from the group consisting of an IgG light chain constant region, a CD8α hinge region, and a CD28 hinge region. The IgG is preferably IgG4. A specific example of a nucleotide sequence encoding an IgG light chain constant region is shown in SEQ ID NO: 30. A specific example of a nucleotide sequence encoding a CD28 hinge region is shown in SEQ ID NO: 31. A specific example of a nucleotide sequence encoding a CD8α hinge region is shown in SEQ ID NO: 117.

[0070] In the CAR, the intracellular domain includes a signaling domain. The signaling domain of the CAR is a site for inducing signaling that activates an immune cell expressing the CAR when the antigen-binding region binds to an antigen. In the nucleic acid molecule of this embodiment, the segment encoding the intracellular domain (hereinafter also referred to as the "intracellular segment") may include a nucleotide sequence encoding the signaling domain. The signaling domain of the CAR may be derived from a membrane protein having an intracellular region, such as a cell membrane receptor or a transmembrane protein. The intracellular region of the membrane protein may have a signaling domain. That is, the intracellular domain of the CAR may include the signaling domain of the membrane protein. Thus, the intracellular segment may include a nucleotide sequence encoding the entire length of the membrane protein. Alternatively, the intracellular segment may include a nucleotide sequence encoding a part of the above membrane protein, as long as the function as the signaling domain is maintained. It is preferable that the part of the membrane protein includes all or a part of the signaling domain of the protein. The membrane protein is not particularly limited, and examples thereof include CD3ζ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD66d, CD79a, CD79b, FcRγ, and FcRβ. Preferably, the intracellular segment comprises a nucleotide sequence encoding a signaling domain of at least one protein selected from the group of membrane proteins. Among them, CD3ζ is preferred. Specific examples of nucleotide sequences encoding the signaling domain of CD3ζ are shown in SEQ ID NOs: 32 and 118.

[0071] The intracellular segment preferably has a nucleotide sequence encoding a costimulatory domain in addition to the nucleotide sequence encoding the signaling domain. It is known that a signal from the costimulatory domain is transmitted to an immune cell (especially a T cell) together with a signal from the signaling domain, thereby improving the proliferation ability, cytotoxic activity, survival rate, etc. of the immune cell. The costimulatory domain of the CAR may be derived from a membrane protein having an intracellular region, such as a cell membrane receptor or a transmembrane protein. The intracellular region of the membrane protein may have a costimulatory domain. That is, the intracellular domain of the CAR may include a costimulatory domain of a membrane protein. Thus, the intracellular segment may include a nucleotide sequence encoding the entire length of the membrane protein. Alternatively, the intracellular segment may include a nucleotide sequence encoding a part of the membrane protein as long as the function as a costimulatory domain is maintained. The part of the membrane protein preferably includes all or a part of the costimulatory domain of the protein. The membrane protein is not particularly limited, and examples thereof include 4-1BB (CD137), CD28, GITR, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, and ICOS. Preferably, the intracellular segment comprises a nucleotide sequence encoding a costimulatory domain of at least one protein selected from the group of these membrane proteins. Among them, at least one selected from the group consisting of 4-1BB, CD28, and GITR is preferred. A specific example of a nucleotide sequence encoding the costimulatory domain of 4-1BB is shown in SEQ ID NO: 33. A specific example of a nucleotide sequence encoding the costimulatory domain of CD28 is shown in SEQ ID NO: 34. A specific example of a nucleotide sequence encoding the costimulatory domain of GITR is shown in SEQ ID NO: 35.

[0072] In the intracellular domain segment, the order of the nucleotide sequence encoding the signal transduction domain and the nucleotide sequence encoding the costimulatory domain is not particularly limited. For example, the nucleotide sequence encoding the intracellular domain may include, from the 5' side, a nucleotide sequence encoding the signal transduction domain and a nucleotide sequence encoding the costimulatory domain. Alternatively, the nucleotide sequence encoding the intracellular domain may include, from the 5' side, a nucleotide sequence encoding the costimulatory domain and a nucleotide sequence encoding the signal transduction domain.

[0073] The nucleic acid molecule of this embodiment may contain various nucleotide sequences in addition to the nucleotide sequence encoding CAR, as necessary. Examples of such nucleotide sequences include leader sequences, restriction enzyme recognition sequences, nucleotide sequences encoding peptide tags, and stop codons. The peptide tag can be appropriately selected from known peptide tags, such as histidine tags, glutathione-S-transferase (GST) tags, and FLAG (registered trademark) tags.

[0074] A further embodiment of the present invention relates to a vector comprising the nucleic acid molecule of 1 above. Specifically, the vector of this embodiment may be in a form in which the nucleic acid molecule of this embodiment is incorporated into a known vector. The type of vector is not particularly limited, and examples thereof include a plasmid vector and a virus vector. The vector may be linear or circular. The type of plasmid vector is not particularly limited, and examples thereof include an expression vector, a vector for producing a virus vector, a transposon vector, and a cloning vector. An expression vector is a vector that allows a protein encoded by the nucleotide sequence of a nucleic acid molecule incorporated into the vector to be expressed in an appropriate host cell such as a mammalian cell, an insect cell, a yeast, or an E. coli. A transposon vector is a vector that allows a nucleic acid molecule incorporated into the transposon vector to be incorporated into the genome of a host cell by being introduced into an appropriate host together with an expression vector into which a gene encoding a transposase is incorporated.

[0075] The type of viral vector is not particularly limited, and examples thereof include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, vaccinia viral vectors, Epstein-Barr viral (EBV) vectors, etc. It is preferable that the viral vector is replication-deficient so that the virus does not replicate autonomously in infected cells.

[0076] The vector may contain an appropriate control sequence, if necessary, such as a promoter sequence, an operator sequence, an enhancer sequence, a nucleotide sequence encoding a drug resistance marker, a multicloning site, and the like.

[0077] As described above, the nucleic acid molecule of this embodiment may be either DNA or RNA. DNA is a more stable substance than RNA, and various DNA vectors are commercially available. Therefore, the nucleic acid molecule of this embodiment, which is DNA, is advantageous in that it is easy to store and handle. It is known that RNA encoding a protein can express the protein without being affected by the transcriptional regulatory process when introduced into a cell. Therefore, the nucleic acid molecule of this embodiment, which is RNA, is advantageous in that it allows rapid expression of CAR in immune cells.

[0078] 2. CAR A further embodiment of the present invention relates to a CAR. The CAR of this embodiment is a protein molecule encoded by the nucleotide sequence of the nucleic acid molecule described in 1 above. That is, the CAR of this embodiment is the above-mentioned "modified CAR". The CAR of this embodiment is a protein produced by a genetic engineering technique, which includes, in order from the N-terminus, an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain includes an antigen-binding region including a light chain variable region and a heavy chain variable region. The CAR of this embodiment is characterized in that at least three amino acid residues in the light chain FR3 of the antigen-binding region are acidic amino acid residues. However, the at least three amino acid residues include at least three selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region. As long as at least three of the amino acid residues at these positions are acidic amino acid residues, the amino acid residues at other positions in the light chain FR3 may be any of acidic, basic, and neutral amino acid residues.

[0079] As described above, the CAR of the present embodiment has an antigen-binding region in which at least three amino acid residues in the light chain FR3 defined by the Chothia method are acidic amino acid residues, and the at least three amino acid residues include at least three selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region. The antigen-binding region is the same as the modified antigen-binding region. That is, the CAR of the present embodiment has a modified antigen-binding region. The CAR of the present embodiment can also be said to be a mutant of a CAR having an original antigen-binding region. The CAR of the present embodiment is preferably expressed in an immune cell and fixed to the cell membrane of the immune cell. The immune cell expressing the CAR has improved cytotoxic activity against tumor cells compared to the immune cell expressing a CAR containing the original antigen-binding region.

[0080] In the CAR of this embodiment, at least three acidic amino acid residues in the light chain FR3 are derived from the above-mentioned codon modification. In the light chain FR3 of the modified antigen-binding region, the at least three acidic amino acid residues derived from the codon modification may all be aspartic acid residues or all be glutamic acid residues. Alternatively, some of the at least three acidic amino acid residues derived from the codon modification may be aspartic acid residues and the remaining may be glutamic acid residues.

[0081] The amino acid residues before the at least three amino acid residues in the light chain FR3 are changed to acidic amino acid residues are neutral amino acid residues and / or basic amino acid residues, preferably neutral amino acid residues, i.e., the at least three acidic amino acid residues in the light chain FR3 of the modified antigen-binding region are changed from at least three residues selected from neutral amino acid residues and / or basic amino acid residues in the light chain FR3 of the original antigen-binding region.

[0082] In the light chain FR3 of the modified antigen-binding region, the number of the at least three acidic amino acid residues derived from the codon modification is, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14. In the light chain FR3 of the modified antigen-binding region, the number of the at least three acidic amino acid residues derived from the codon modification is preferably 3 to 6, more preferably 3 to 5. As described above, the at least three acidic amino acid residues in the light chain FR3 of the modified antigen-binding region are preferably located at amino acid residue positions excluding Vernier zone residues and non-exposed residues from the amino acid sequence of the light chain FR3. Therefore, in the modified antigen-binding region, when an amino acid residue at a position other than positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region has been altered to be an acidic amino acid residue by codon modification, the position is preferably any of positions 57, 58, 59, 61, 62, 77, 79, 80, and 81.

[0083] As described above, in the modified antigen-binding region, at least three amino acid residues selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region are acidic amino acid residues derived from codon modification. Preferably, 3 to 6 amino acid residues selected from the above group are acidic amino acid residues. More preferably, 3 to 5 amino acid residues selected from the above group are acidic amino acid residues.

[0084] For example, in the modified antigen-binding region, at least three amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region may be acidic amino acid residues. Alternatively, in the modified antigen-binding region, the amino acid residues at positions 60, 74, and 76 in the light chain variable region may be acidic amino acid residues.

[0085] For example, in the modified antigen-binding region, at least two amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region and at least one amino acid residue selected from the group consisting of positions 60, 74, and 76 in the light chain variable region may be acidic amino acid residues. Alternatively, in the modified antigen-binding region, at least one amino acid residue selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region and at least two amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region may be acidic amino acid residues.

[0086] When three to six amino acid residues in the light chain FR3 of the altered antigen-binding region are acidic amino acid residues, the three to six amino acid residues may include, for example, three, four, or five amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and one, two, or three amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region. Alternatively, the three to six amino acid residues may include, for example, one, two, or three amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and two or three amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region.

[0087] When three to five amino acid residues in the light chain FR3 of the modified antigen-binding region are acidic amino acid residues, the three to five amino acid residues may include, for example, two or three amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and one or two amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region. Alternatively, the three to five amino acid residues may include, for example, one or two amino acid residues selected from the group consisting of positions 63, 65, 67, 70, and 72 in the light chain variable region, and two or three amino acid residues selected from the group consisting of positions 60, 74, and 76 in the light chain variable region.

[0088] In the light chain FR3 of the altered antigen-binding region, for example, each amino acid residue described in any one of the following 1) to 11) can be an acidic amino acid residue. 1) the amino acid residues at positions 60, 63, and 65 of the light chain variable region; 2) the amino acid residues at positions 60, 74, and 76 in the light chain variable region; 3) codons encoding the amino acid residues at positions 63, 70, and 72 in the light chain variable region; 4) the amino acid residues at positions 67, 70, and 72 of the light chain variable region; 5) the amino acid residues at positions 70, 72, and 74 in the light chain variable region; 6) the amino acid residues at positions 63, 65, 67, and 70 in the light chain variable region; 7) the amino acid residues at positions 63, 65, 67, and 72 in the light chain variable region; 8) the amino acid residues at positions 63, 65, 70, and 72 in the light chain variable region; 9) the amino acid residues at positions 63, 67, 70, and 72 in the light chain variable region; 10) the amino acid residues at positions 65, 67, 70, and 72 in the light chain variable region; and 11) The amino acid residues at positions 63, 65, 67, 70, and 72 in the light chain variable region.

[0089] As described above, the amino acid sequence of the CDR of the antigen-binding region in the CAR of this embodiment is preferably the same as the amino acid sequence of the CDR of the original antigen-binding region. The electrical properties of the CDR of the antigen-binding region of the CAR of this embodiment are not particularly limited, and may be negatively charged, neutral, or positively charged. The electrical properties of the CDR are determined by the above formula (I).

[0090] In the CAR of this embodiment, the extracellular domain includes an antigen-binding region including a light chain variable region and a heavy chain variable region. An example of the antigen-binding region is scFv. The antigen-binding region may include a part or all of the constant region of an antibody. The constant region of an antibody may be either a heavy chain or a light chain constant region, but is preferably a light chain constant region. In the antigen-binding region, the order of the light chain variable region and the heavy chain variable region is not particularly limited. For example, the antigen-binding region may include a light chain variable region and a heavy chain variable region in order from the N-terminus. Alternatively, the antigen-binding region may include a heavy chain variable region and a light chain variable region in order from the N-terminus. In the antigen-binding region, a part or all of the light chain constant region is preferably included after the light chain variable region. In the antigen-binding region, a part or all of the heavy chain constant region is preferably included after the heavy chain variable region.

[0091] In the CAR of this embodiment, the antigen-binding region may comprise or consist of an scFv that binds to any one of the above-mentioned antigens present on the surface of tumor cells and antigens present inside tumor cells. Preferably, the antigen-binding region comprises or consists of an scFv that binds to a complex of a MAGE-A4-derived peptide and HLA-A2, CD19, or CEA.

[0092] Preferably, the amino acid sequence of scFv that binds to the complex of MAGE-A4-derived peptide and HLA-A2 includes the amino acid sequence shown in SEQ ID NO: 36 to 40 and the amino acid sequence consisting of DDS (Asp-Asp-Ser). SEQ ID NO: 36 shows the amino acid sequence of HCDR1, SEQ ID NO: 37 shows the amino acid sequence of HCDR2, SEQ ID NO: 38 shows the amino acid sequence of HCDR3, SEQ ID NO: 39 shows the amino acid sequence of LCDR1, and SEQ ID NO: 40 shows the amino acid sequence of LCDR3. The amino acid sequence consisting of DDS is the amino acid sequence of LCDR2. A specific example of the amino acid sequence of scFv that includes the amino acid sequence shown in SEQ ID NO: 36 to 40 and DDS is shown in SEQ ID NO: 41. The amino acid sequence of scFv in which the light chain FR3 is modified based on this SEQ ID NO: 40 is shown in, for example, SEQ ID NO: 42 to 46.

[0093] Preferably, the amino acid sequence of scFv that binds to CD19 includes the amino acid sequences shown in SEQ ID NOs: 47 to 50, an amino acid sequence consisting of GSE (Gly-Ser-Glu), and an amino acid sequence consisting of HTS (His-Thr-Ser). SEQ ID NO: 47 shows the amino acid sequence of HCDR1, SEQ ID NO: 48 shows the amino acid sequence of HCDR3, SEQ ID NO: 49 shows the amino acid sequence of LCDR1, and SEQ ID NO: 50 shows the amino acid sequence of LCDR3. The amino acid sequence consisting of GSE is the amino acid sequence of HCDR2, and the amino acid sequence consisting of HTS is the amino acid sequence of LCDR2. A specific example of the amino acid sequence of scFv including SEQ ID NOs: 47 to 50 is shown in SEQ ID NO: 51. The amino acid sequences of scFv in which the light chain FR3 is modified based on this SEQ ID NO: 51 are shown in, for example, SEQ ID NOs: 52 to 59.

[0094] The scFv preferably contains a peptide linker between the light chain variable region and the heavy chain variable region. The peptide linker is as described above. For example, the scFv may contain, in order from the N-terminus, a light chain variable region, a peptide linker, and a heavy chain variable region. Alternatively, the scFv may contain, in order from the N-terminus, a heavy chain variable region, a peptide linker, and a light chain variable region.

[0095] In the CAR of this embodiment, the transmembrane domain may include the entire length of a transmembrane protein. Alternatively, the transmembrane domain may include a part of a transmembrane protein, as long as its function is maintained. The part of the transmembrane protein preferably includes all or a part of the transmembrane region of the protein. Examples of transmembrane proteins that can be used for the transmembrane domain include the proteins exemplified in 1 above. Preferably, the transmembrane domain is a transmembrane region of any one protein selected from the group consisting of, for example, the α chain of the T cell receptor, the β chain of the T cell receptor, CD3ε, CD3ζ, CD4, CD5, CD8α, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD154, 4-1BB (CD137), ICOS, and GITR. Among them, the transmembrane region of CD8α or CD28 is preferred. A specific example of the amino acid sequence of the transmembrane region of CD8α is shown in SEQ ID NO:60. An example of the amino acid sequence of the transmembrane region of CD28 is shown in SEQ ID NO:61.

[0096] The CAR of this embodiment preferably includes a hinge domain between the antigen-binding region and the transmembrane domain. The hinge domain may include the entire extracellular region of a transmembrane protein or the entire constant region of IgG. Alternatively, the hinge domain may include a part of the extracellular region of a transmembrane protein or a part of the constant region of IgG, so long as the function is maintained. Proteins that can be used for the hinge domain include the proteins exemplified in 1 above. Preferably, the hinge domain is any one region selected from the group consisting of, for example, the constant region of the light chain of IgG, the hinge region of CD8α, and the hinge region of CD28. The IgG is preferably IgG4. A specific example of the amino acid sequence of the constant region of the light chain of IgG is shown in SEQ ID NO: 62. A specific example of the amino acid sequence of the hinge region of CD28 is shown in SEQ ID NO: 63. A specific example of the amino acid sequence of the hinge region of CD8α is shown in SEQ ID NO: 119.

[0097] In the CAR of this embodiment, the intracellular domain may include the entire length of a membrane protein having an intracellular region. Alternatively, the intracellular domain may include a part of the above membrane protein as long as the function as a signaling domain is maintained. The signaling domain may be present in the intracellular region of the membrane protein. The part of the membrane protein having an intracellular region preferably includes all or a part of the signaling domain of the protein. Examples of membrane proteins that can be used for the intracellular domain include the proteins exemplified in 1 above. Preferably, the intracellular domain includes a signaling domain of at least one protein selected from the group consisting of, for example, CD3ζ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD66d, CD79a, CD79b, FcRγ, and FcRβ. Among them, the signaling domain of CD3ζ is preferred. Specific examples of the amino acid sequence of the signaling domain of CD3ζ are shown in SEQ ID NOs: 64 and 120.

[0098] In the CAR of this embodiment, the intracellular domain preferably has a costimulatory domain in addition to the signal transduction domain. The intracellular domain may include the entire length of a membrane protein having an intracellular region. Alternatively, the intracellular domain may include a part of the membrane protein as long as the function as a costimulatory domain is maintained. The costimulatory domain may be present in the intracellular region of each of the above proteins. The part of the membrane protein having an intracellular region preferably includes all or a part of the costimulatory domain of the protein. Examples of membrane proteins that can be used as costimulatory domains include the proteins exemplified in 1 above. Preferably, the costimulatory domain includes a costimulatory domain of at least one protein selected from the group consisting of, for example, 4-1BB (CD137), CD28, GITR, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, and ICOS. Among them, the costimulatory domains of 4-1BB, CD28, and GITR are preferred. An exemplary amino acid sequence of the costimulatory domain of 4-1BB is shown in SEQ ID NO: 65. An exemplary amino acid sequence of the costimulatory domain of CD28 is shown in SEQ ID NO: 66. An exemplary amino acid sequence of the costimulatory domain of GITR is shown in SEQ ID NO: 67.

[0099] In the intracellular domain, the order of the signal transduction domain and the costimulatory domain is not particularly limited.For example, the intracellular domain may include the signal transduction domain and the costimulatory domain in order from the N-terminus.Alternatively, the intracellular domain may include the costimulatory domain and the signal transduction domain in order from the N-terminus.

[0100] The CAR of this embodiment may contain additional oligopeptides or polypeptides as necessary. Such oligopeptides and polypeptides include signal peptides and peptide tags. The peptide tag can be appropriately selected from known peptide tags such as histidine tags, GST tags, and FLAG (registered trademark) tags.

[0101] The CAR of this embodiment can be produced by a protein expression system using the nucleic acid molecule of this embodiment. The protein expression system may be an expression system using a host cell, or may be a cell-free protein synthesis system. In the production by an expression system using a host cell, for example, the nucleic acid molecule of this embodiment incorporated in an expression vector suitable for the host cell to be used can be introduced into the host cell to express the CAR of this embodiment. Examples of cell-free protein synthesis systems include a wheat germ-derived synthesis system, an E. coli-derived synthesis system, and a reconstituted cell-free protein synthesis system. When the CAR is produced in a host cell, the host cell may be dissolved in a solution containing an appropriate solubilizing agent to release the CAR in the solution. In a cell-free protein synthesis system, the synthesized CAR is contained in the reaction solution. The CAR released in the liquid can be collected by a known method such as column chromatography. For example, when the produced CAR has a histidine tag or a GST tag as a peptide tag, it can be collected by affinity chromatography using a carrier containing Ni-NTA (nitrilotriacetic acid chelated with nickel ions) or glutathione. If necessary, the recovered CAR may be purified by known methods such as gel filtration or dialysis.

[0102] 3. CAR-containing immune cells A further embodiment of the present invention relates to immune cells containing a CAR. The immune cells containing a CAR of this embodiment are immune cells that express the CAR described in 2. above by introducing the nucleic acid molecule described in 1. above into the immune cells. Details of the CAR and the nucleic acid molecule are as described above. Examples of immune cells before the introduction of the nucleic acid molecule described in 1. above include immune cells collected from mammals including humans, immune cells prepared from stem cells, and immune cells established as cell lines. Specifically, examples include immune cells obtained by leukocyte apheresis and immune cells isolated from blood.

[0103] Examples of immune cells separated or isolated from a biological sample include peripheral blood mononuclear cells (PBMC), T cells, and natural killer (NK) cells. Among them, T cells and NK cells are preferred. T cells include CD8-positive T cells, CD4-positive T cells, cytotoxic T cells, helper T cells, regulatory T cells, and tumor-infiltrating lymphocytes. Preferred T cells are CD8-positive T cells and cytotoxic T cells. Preferred immune cell cell lines are lymphocyte-derived cell lines, such as Jurkat cells, MOLT-4 cells, and U-937 cells. Hereinafter, T cells expressing CAR may be referred to as "CAR-T cells".

[0104] The method for introducing the nucleic acid molecule of 1. above into immune cells is not particularly limited and can be appropriately selected from known gene introduction methods. Examples of gene introduction methods include lipofection, electroporation, calcium phosphate method, gene introduction using cationic polymers, gene introduction using viral vectors, and gene introduction using transposons. In the lipofection and gene introduction using cationic polymers, commercially available transfection reagents such as FuGENE (registered trademark) and JetPEI (registered trademark) may be used.

[0105] The immune cells containing the CAR of this embodiment can be cultured in the same manner as the immune cells before the nucleic acid molecule of this embodiment is introduced. The medium, serum, additives, etc. can be appropriately determined depending on the type of immune cells used. Examples of the medium include MEM, DMEM, RPMI-1640, etc. When the immune cells are lymphocytes, commercially available lymphocyte media such as GT-T502, GT-T503, and GT-T551 (Takara Bio Inc.) may be used. Examples of the serum include fetal bovine serum (FBS) and human AB serum. Examples of the additives include L-glutamine, insulin, and IL-2. Examples of the culture conditions for the immune cells include conditions at 37°C under a 5% CO2 atmosphere.

[0106] In the immune cells containing the CAR of this embodiment, the CAR is expressed as a transmembrane protein. When the extracellular domain of the CAR binds to an antigen of a tumor cell, the immune cells are activated by a signal from the intracellular domain of the CAR. The activated immune cells containing the CAR of this embodiment exert cytotoxic activity by releasing cytotoxic proteins (e.g., perforin, granzyme, etc.) and antitumor cytokines (e.g., tumor necrosis factor (TNF)-α, lymphokines, etc.), and expressing cell surface molecules that induce cell death, such as Fas ligand. The immune cells containing the CAR of this embodiment have improved cytotoxic activity compared to immune cells containing a CAR having the original antigen-binding region. The cell-killing effect of the immune cells containing the CAR can be examined by known methods such as a cytotoxicity assay. Specifically, the method of Example 1 described later is exemplified. The cytotoxic activity can also be evaluated by administering the immune cells containing the CAR to a non-human animal transplanted with tumor cells and measuring the size of the tumor.

[0107] 4. Methods for producing immune cells including CAR A further embodiment of the present invention relates to a method for producing immune cells containing a CAR (hereinafter also referred to as the "production method of this embodiment"). In the production method of this embodiment, the nucleic acid molecule of 1 above is introduced into immune cells, and the immune cells are caused to express the CAR of 2 above, thereby producing immune cells containing a CAR of 3 above. Details of the CAR and the nucleic acid molecule are as described above. Details of the immune cells before the introduction of the nucleic acid molecule of 1 above are as described above. Preferred are PBMCs, T cells and NK cells. When the immune cells containing a CAR obtained by the production method of this embodiment are transplanted into a living organism, it is preferable to use immune cells separated or isolated from a biological sample collected from the living organism itself or another living organism of the same species as the living organism.

[0108] The method of introducing the nucleic acid molecule of 1. above into immune cells is as described above. After introducing the nucleic acid molecule into the immune cells, it is preferable to culture the immune cells for a predetermined period of time. The method of culturing immune cells is as described above. The predetermined period can be at least the period until CAR is expressed in the immune cells. The period until CAR is expressed is determined depending on the method of introducing the nucleic acid molecule, and is, for example, 3 hours to 72 hours, preferably 6 hours to 48 hours. When the method of introducing the nucleic acid molecule is a method that allows stable expression of CAR in immune cells, the predetermined period may be a period sufficient for the proliferation of immune cells expressing CAR. Such a period is not particularly limited, but is, for example, 48 hours to 20 days, preferably 72 hours to 14 days.

[0109] By introducing the nucleic acid molecule of 1. above into immune cells, the CAR of 2. above is expressed in the immune cells. If necessary, the expression of CAR in immune cells may be confirmed. The expression of CAR in immune cells may be confirmed by known protein detection methods such as enzyme-linked immunosorbent assay (ELISA), flow cytometry, immunoprecipitation, polyacrylamide gel electrophoresis, and Western blotting.

[0110] 5. Pharmaceutical Compositions A further embodiment of the present invention relates to a pharmaceutical composition for treating malignant tumors, comprising immune cells containing CAR (hereinafter also referred to as "pharmaceutical composition of this embodiment"). The pharmaceutical composition of this embodiment comprises immune cells containing CAR as the active ingredient, as described above in 3. Details of CAR and immune cells containing the same are as described above. The pharmaceutical composition of this embodiment may further comprise a pharmaceutical acceptable additive. Examples of such additives include an aqueous medium for stably preserving immune cells, D-glucose, dextran, serum albumin, dimethyl sulfoxide (DMSO), and the like. Examples of the aqueous medium include physiological saline, phosphate buffered saline (PBS), and complex electrolyte solutions. The pharmaceutical composition of this embodiment is preferably administered parenterally to a patient. That is, the pharmaceutical composition is preferably in a form suitable for parenteral administration, such as an injection or infusion.

[0111] The malignant tumor to be treated by the pharmaceutical composition of the present embodiment is a tumor containing tumor cells having an antigen recognized by CAR. The malignant tumor may be a blood cancer or a solid cancer. For example, acute leukemia (acute myeloid leukemia, B-cell acute lymphoblastic leukemia, acute monocytic leukemia, acute erythroleukemia, acute megakaryoblastic leukemia, etc.), chronic leukemia (chronic myeloid leukemia, chronic lymphocytic leukemia, chronic monocytic leukemia, etc.), lymphoma (diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, Burkitt lymphoma, Hodgkin lymphoma, lymphoplasmacytic lymphoma, marginal zone lymphoma, etc.), multiple myeloma, melanoma, breast cancer, prostate cancer, bladder cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, spleen cancer, lung cancer, stomach cancer, esophageal cancer, ovarian cancer, osteosarcoma, neuroblastoma, etc.

[0112] 6.Treatment method A further embodiment of the present invention relates to a method for treating malignant tumors using immune cells containing the CAR described above in 3. (hereinafter, also referred to as the "treatment method of this embodiment"). The method includes a step of administering the above-mentioned pharmaceutical composition to a patient with malignant tumor. The malignant tumor to be treated is as described above.

[0113] In the administration step, the immune cells are preferably administered to the patient parenterally. Parenteral administration includes, for example, intravenous, intraarterial, intramuscular, intraperitoneal, and subcutaneous administration. Among these, intravenous administration is preferred.

[0114] The administration of the pharmaceutical composition of this embodiment can be appropriately determined depending on the type of cancer, the patient's condition, age, body weight, etc. The dosage is, for example, 1 × 10 immune cells containing CAR per administration for an adult weighing 50 kg or more. 4 Cells or more 1×10 10 cells or less, preferably 1×10 5 Cells or more 1×10 9 cells or less, preferably 1×10 6 Cells or more 5×10 8 The number of administrations is 1 to 4 times a day, or less. The number of administrations may be one or more. After administration, immune cells containing CAR are engrafted and proliferate in the patient's body, so the number of administrations is usually one. However, if it is determined that the engraftment and proliferation of immune cells is insufficient, the agent may be administered multiple times. The administration interval may be, for example, 1 to 4 times a day, once a week, once every 10 to 30 days, once a month, once every 3 to 6 months, once a year, etc.

[0115] The pharmaceutical composition of this embodiment can be used in combination with other anticancer drugs. The administration of the other anticancer drugs and the administration of the pharmaceutical composition of 5. above may be on the same day or on different days. Examples of other anticancer drugs include alkylating agents such as cyclophosphamide, metabolic antagonists such as pentostatin, molecular targeted drugs such as rituximab, kinase inhibitors such as imatinib, proteasome inhibitors such as bortezomib, calcineurin inhibitors such as cyclosporine, anticancer antibiotics such as idarubicin, plant alkaloids such as irinotecan, platinum preparations such as cisplatin, hormone therapy drugs such as tamoxifen, immunosuppressants such as nivolumab and pembrolizumab, but are not limited thereto.

[0116] Prior to administration of the pharmaceutical composition of the present embodiment, the patient may be subjected to lymphocyte-depleting chemotherapy to reduce the number of white blood cells, using, for example, fludarabine, cyclophosphamide, or bendamustine.

[0117] 7. Method for improving the cytotoxic activity of immune cells A further embodiment of the present invention relates to a method for improving the cytotoxic activity of immune cells containing a CAR (hereinafter, also referred to as the "improvement method of this embodiment"). The improvement method of this embodiment includes the step of introducing the nucleic acid molecule of 1. above into immune cells and expressing the CAR of 2. above in the immune cells. The obtained immune cells containing a CAR express a CAR having a modified antigen-binding region. The immune cells expressing the CAR have improved cytotoxic activity compared to immune cells expressing a CAR having the original antigen-binding region. The improvement method of this embodiment can contribute to killing more tumor cells in a treatment method using immune cells expressing a CAR. Details of the nucleic acid molecule and the CAR are as described above. The method for introducing a nucleic acid molecule into immune cells and the method for measuring the cytotoxic activity of immune cells containing a CAR are as described above.

[0118] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. EXAMPLES

[0119] Example 1: Preparation of CAR-T cells that bind to the MAGE-A4 / HLA-A2 complex and confirmation of their cytotoxic activity (1) Obtaining a nucleic acid molecule encoding a CAR template In the same manner as in the examples of US2020 / 0276237 (which is incorporated herein by reference), a plasmid DNA for preparing a viral vector containing a gene encoding a CAR having an scFv that binds to the MAGE-A4 / HLA-A2 complex was obtained. The complex to which the scFv binds was a complex of MAGE-A4 and HLA-A*02:01. Hereinafter, the CAR encoded by the gene in the above plasmid DNA is referred to as "MAGE-A4-zG". The amino acid sequence of the MAGE-A4-derived peptide in the MAGE-A4 / HLA-A2 complex was GVYDGREHTV (SEQ ID NO: 1). The above plasmid DNA was used as a template for preparing a nucleic acid molecule encoding a MAGE-A4-zG mutant by PCR.

[0120] Referring to FIG. 3, the gene encoding MAGE-A4-zG was linked in this order from the 5' side: a leader sequence (Leader), a nucleotide sequence encoding a heavy chain variable region (VH), a nucleotide sequence encoding a linker (L), a nucleotide sequence encoding a light chain variable region (VL), a nucleotide sequence encoding a light chain constant region (CL), a nucleotide sequence encoding a transmembrane domain of CD28 (CD28TM), a nucleotide sequence encoding CD3ζ, and a nucleotide sequence encoding an intracellular domain of GITR (GITRICD). VH, L, VL, and CL constituted a segment having a nucleotide sequence encoding the extracellular domain of CAR. VH, L, and VL constituted a segment having a nucleotide sequence encoding a scFv that specifically binds to the MAGE-A4 / HLA-A2 complex. CD3ζ and GITRICD constituted a segment having a nucleotide sequence encoding the intracellular domain of CAR. CL was a segment having a nucleotide sequence encoding the hinge domain of CAR. That is, MAGE-A4-zG was a CAR that contained an scFv consisting of VH, VL and a linker connecting them, and CL as extracellular domains, CD28TM as a transmembrane domain, and CD3ζ and GITRICD as intracellular domains.

[0121] The amino acid sequences of the CDRs of the scFv of MAGE-A4-zG are shown in Table 1. These CDRs were defined by the Chothia method using Discovery Studio. As can be seen from Table 1, in the amino acid sequences of all CDRs, the number of acidic amino acid residues was 6 and the number of basic amino acid residues was 3. From the above formula (I), the electrical properties of the CDRs of the scFv of MAGE-A4-zG were negative charge (X=-3).

[0122] [Table 1]

[0123] (2) Obtaining a nucleic acid molecule encoding the MAGE-A4-zG mutant [reagent] Ligation reagent: In-Fusion(R) HD Cloning Kit (Takara Bio Inc.) PCR Reagent: PrimeSTAR(R) Max Premix (Takara Bio Inc.) Competent cells: ECOS (trademark) Competent E. coli DH5α (Nippon Gene Co., Ltd.)

[0124] [Primer set] Forward primer: GATGAGGCTGACTATTACTGTCTG (SEQ ID NO: 68) Reverse primer: CCGGTCGCTATCATCATAGACGACC (SEQ ID NO: 69)

[0125] In Example 1, nucleic acid molecules encoding three MAGE-A4-zG mutants shown in 1) to 3) below were obtained. These mutants had scFvs in which four amino acid residues in the light chain FR3 of MAGE-A4-zG were replaced with glutamic acid residues. Specific production procedures will be described later. Hereinafter, these mutants are referred to as "MAGE-A4-zG-Em1", "MAGE-A4-zG-Em2" and "MAGE-A4-zG-Em3", respectively. In the following 1) to 3), the numbers of amino acid residues indicate the positions in VL defined by the Chothia method.

[0126] 1) MAGE-A4-zG-Em1: The amino acid residues at positions 63, 65, 67, and 70 of VL were replaced with Glu (E) residues. 2) MAGE-A4-zG-Em2: The amino acid residues at positions 63, 65, 67, and 72 of the VL were replaced with Glu (E) residues. 3) MAGE-A4-zG-Em3: The amino acid residues at positions 65, 67, 70, and 72 of the VL were replaced with Glu (E) residues.

[0127] The synthesis of 114-nucleotide DNA fragments (SEQ ID NOs: 70 to 72) containing codons encoding the amino acid residues shown in 1) to 3) above was entrusted to Eurofins Genomics. A linearized vector was prepared by performing PCR using the plasmid DNA obtained in (1) above as a template and a PCR reagent and primer set. This linearized vector had a sequence in which a part of the nucleotide sequence encoding the scFv of MAGE-A4-zG was deleted. The obtained linearized vector and each of the synthesized DNA fragments were ligated with a ligation reagent. Competent cells were transformed with the ligation solution. The obtained E. coli was cultured and plasmid DNA was extracted. As a result, a plasmid DNA for producing a viral vector containing a gene encoding the MAGE-A4-zG mutant was obtained.

[0128] (3) Preparation of immune cells Human peripheral blood mononuclear cells (PBMC) (product number: CC2703) were purchased from Lonza Co., Ltd. A PBMC culture plate was prepared as follows. Anti-CD3 antibodies OKT-3 (eBioscience) and RetroNectin (registered trademark) (Takara Bio Inc.) were added to ACD-A solution (Terumo Corporation) to final concentrations of 5 μg / mL and 25 μg / mL, respectively. 400 μL of the resulting solution was placed in each well of a 12-well plate (Nunc Co., Ltd.) and left to stand overnight at 4° C. Each well was washed three times with PBS to obtain a PBMC culture plate. A PBMC culture medium was prepared as follows. AB serum (300 μL, Veritas Co., Ltd.) was added to lymphocyte medium GT-T503 (50 mL, Takara Bio Inc.), and human IL-2 (NIPRO Co., Ltd.) was further added to a final concentration of 300 IU / mL to prepare a PBMC culture medium. PBMCs were cultured at 2.5 x 10 in PBMC culture medium. 5 ~3.0×10 5 The cells were suspended at 1000 cells / mL. 2 mL of the cell suspension was placed in each well of a PBMC culture plate and cultured for 3 days at 37°C in a CO2 incubator. On the third day, 1 mL of medium was replaced and cultured for an additional day.

[0129] (4) Generation of immune cells expressing MAGE-A4-zG and its mutants (4.1) Production of retroviruses using packaging cells plat-A Plasmid DNA for constructing each viral vector, containing genes encoding MAGE-A4-zG and its mutants, was introduced into packaging cells plat-A using FuGENE (registered trademark) (Promega) and cultured for 2 days. The culture supernatant was then collected to obtain a solution containing the viral vector (hereinafter also referred to as "viral solution").

[0130] (4.2) Preparation of retrovirus dilutions and washing solutions A retrovirus dilution solution was prepared by adding Albuminar (registered trademark) 25% (CSL Behring, Inc.) to a mixture of PBS (40 mL) and ACD-A solution (2.4 mL) to a final concentration of 2.5%. A retrovirus washing solution was prepared by adding Albuminar (registered trademark) 25% to PBS (39 mL) to a final concentration of 1.5%.

[0131] (4.3) Preparation of plates for retroviral infection RetroNectin (registered trademark) (Takara Bio Inc.) was diluted with retrovirus diluent to a final concentration of 20 μg / mL. 250 μL of the RetroNectin (registered trademark) diluent was placed in each well of a 24-well plate and allowed to stand overnight at 4° C. The liquid in each well was removed, and the wells were washed twice with retrovirus washing solution. 1 mL of the virus liquid prepared in (4.1) above was placed in each well, and the wells were centrifuged at 2000×g for 2 hours at 32° C. to coat the inside of each well with the retrovirus. The virus liquid in each well was removed, and the wells were washed twice with retrovirus washing solution to prepare a plate for retrovirus infection.

[0132] (4.4) Retroviral delivery of CAR genes into T cells The PBMCs cultured in (3) above were collected and diluted to 1.3 × 10 5 The cells were suspended in PBMC culture medium at 1.5 mL per well of the retrovirus infection plate and centrifuged at 1000×g for 10 minutes at 32°C. The plate was then placed in a CO2 incubator and the cells were cultured at 37°C. In this way, T cells expressing various CARs including MAGE-A4-zG and its mutants (CAR-T cells) were obtained. The CAR-T cells were used for various assays 11 to 14 days after the isolation of PBMC.

[0133] (5) Confirmation of cytotoxic activity of CAR-T cells The various CAR-T cells prepared in (4.4) above were used as effector cells, and their cytotoxic activity was measured using the N-SPC (registered trademark) Non-RI Cytotoxicity Assay Kit (Techno Suzuta Co., Ltd.). The human melanoma cell line SK-MEL-37 was used as the target cell. SK-MEL-37 was an A2-positive MAGE-A4-positive tumor cell.

[0134] The measurement principle of the above assay kit is as follows. When the BM-HT Reagent provided with the above assay kit is added to target cells, the BM-HT Reagent is hydrolyzed by intracellular esterase to produce HT chelate within the target cells. When target cells are killed by effector cells, the HT chelate leaks into the culture supernatant. When the Eu Solution provided with the above assay kit is added to the culture supernatant containing the HT chelate, an Eu / HT complex is formed. When this complex is excited with laser light, time-resolved fluorescence is generated. Since the leakage of HT chelate depends on the cytotoxic activity of effector cells, the cytotoxic activity can be quantitatively measured by measuring time-resolved fluorescence.

[0135] 1 x 10 target cells 4 The cells were suspended in medium at 10:1 cells / mL, and BM-HT Reagent was added. Effector cells (CAR-T cells) and target cells were mixed at a cell number ratio of 10:1, placed in each well of a 96-well plate, and co-cultured at 37°C for 2 hours. For comparison, two wells (control wells) were prepared to which target cells were added without effector cells, and cultured in the same manner. At 1.5 hours after the start of culture, Detergent included in the above kit was added to one of the control wells, and the fluorescence detected from the control well was taken as the maximum fluorescence. The other control well was left untreated, and the fluorescence detected from the control well was taken as the minimum fluorescence. Eu Solution (120 μL) was added to the culture supernatant of the co-culture (12 μL), and the mixture was left to stand at room temperature for 15 minutes, after which time-resolved fluorescence was measured. Measurements were performed in triplicate for each CAR-T cell.

[0136] (6) Results Table 2 shows the results of measuring the cytotoxic activity of each CAR-T cell. In the table, "NA" in the "Sequence Number" column indicates the sequence number of the nucleotide sequence encoding the CAR, and "AA" indicates the sequence number of the amino acid sequence of the CAR. The "Mutation Site" column indicates the position where the amino acid residue of the light chain defined by the Chothia method was replaced with an acidic amino acid residue. "Effector:Target" indicates the mixing ratio of effector cells to target cells. "Cell lysis (%)" indicates the proportion of target cells killed by each CAR-T cell. "SD" indicates the standard deviation of cell lysis (%) of each CAR-T cell. "Ratio" indicates the ratio of cell lysis of T cells containing the MAGE-A4-zG mutant when the cell lysis value of T cells containing MAGE-A4-zG is set to 1.00.

[0137] [Table 2]

[0138] As shown in Table 2, when the mixture ratio of effector cells to target cells was 10:1, the cytotoxic activity of each mutant was as follows, assuming that the cytotoxic activity of T cells containing MAGE-A4-zG was 1.00. The cytotoxic activity of T cells containing MAGE-A4-zG-Em1 was 1.35, the cytotoxic activity of T cells containing MAGE-A4-zG-Em2 was 1.56, and the cytotoxic activity of T cells containing MAGE-A4-zG-Em3 was 1.54. The cytotoxic activity of T cells containing MAGE-A4-zG mutants was higher than that of T cells containing MAGE-A4-zG. Thus, by substituting at least three amino acid residues of the light chain FR3 defined by the Chothia method with acidic amino acid residues in MAGE-A4-zG, the cytotoxic activity of the immune cells containing the obtained MAGE-A4-zG mutants could be improved.

[0139] Example 2: Confirmation of cytotoxic activity of CAR-T cells that bind to the MAGE-A4 / HLA-A2 complex The mixture ratio of effector cells to target cells was changed to 3:1, and the cytotoxic activity of each CAR-T cell prepared in Example 1 was measured. The target cells were SK-MEL-37. The specific measurement procedure was the same as in Example 1. The results are shown in Table 3.

[0140] [Table 3]

[0141] As shown in Table 3, when the mixing ratio of effector cells to target cells was 3:1, the cytotoxic activity of each mutant was as follows, assuming that the cytotoxic activity of T cells containing MAGE-A4-zG was 1.00. The cytotoxic activity of T cells containing MAGE-A4-zG-Em1 was 2.54, the cytotoxic activity of T cells containing MAGE-A4-zG-Em2 was 2.31, and the cytotoxic activity of T cells containing MAGE-A4-zG-Em3 was 1.85. The cytotoxic activity of T cells containing MAGE-A4-zG mutants was higher than that of T cells containing MAGE-A4-zG, even when the mixing ratio of effector cells to target cells was changed to 3:1.

[0142] Example 3: Preparation of CAR-T cells that bind to the MAGE-A4 / HLA-A2 complex and confirmation of their cytotoxic activity (1) Obtaining a nucleic acid molecule encoding the MAGE-A4-zG mutant In Example 3, nucleic acid molecules encoding two MAGE-A4-zG mutants shown in 4) and 5) below were obtained. These mutants had scFvs in which three amino acid residues in the light chain FR3 of MAGE-A4-zG were replaced with glutamic acid residues or aspartic acid residues. Specific production procedures will be described later. Hereinafter, these mutants are referred to as "MAGE-A4-zG-Em4" and "MAGE-A4-zG-Dm5", respectively. In 4) and 5) below, the numbers of amino acid residues indicate the positions in VL defined by the Chothia method.

[0143] 4) MAGE-A4-zG-Em4: The amino acid residues at positions 63, 70, and 72 of the VL were replaced with Glu (E) residues. 5) MAGE-A4-zG-Dm5: The amino acid residues at positions 60, 74, and 76 of the VL were substituted with Asp (D) residues.

[0144] Synthesis of a 114-nucleotide DNA fragment (SEQ ID NO: 81 and 82) containing codons encoding the amino acid residues shown in 4) and 5) above was outsourced to Eurofins Genomics. Except for using this DNA fragment, a plasmid DNA for producing a viral vector containing a gene encoding the MAGE-A4-zG mutant was obtained in the same manner as in Example 1. A viral liquid containing genes encoding MAGE-A4-zG and its mutants was prepared in the same manner as in Example 1.

[0145] (2) Generation of immune cells expressing MAGE-A4-zG and its mutants and confirmation of their activity In the same manner as in Example 1, the above virus solution was used to introduce genes encoding MAGE-A4-zG and its mutants into PBMCs (Lonza, Inc.) to obtain each CAR-T cell. In the same manner as in Example 1, the cytotoxic activity of each CAR-T cell was measured. The target cells were SK-MEL-37. The mixture ratio of effector cells to target cells was 3:1. The results are shown in Table 4.

[0146] [Table 4]

[0147] As shown in Table 4, when the mixture ratio of effector cells to target cells was 3:1, the cytotoxic activity of each mutant was as follows, assuming that the cytotoxic activity of T cells containing MAGE-A4-zG was 1.00. The cytotoxic activity of T cells containing MAGE-A4-zG-Em4 was 2.28, and the cytotoxic activity of T cells containing MAGE-A4-zG-Dm5 was 1.95. The cytotoxic activity of T cells containing MAGE-A4-zG-Em4 or MAGE-A4-zG-Dm5 was higher than that of T cells containing MAGE-A4-zG. Thus, it was shown that immune cells containing MAGE-A4-zG mutants different from those in Example 1 also had improved cytotoxic activity.

[0148] Example 4: Confirmation of cytotoxic activity of CAR-T cells binding to MAGE-A4 / HLA-A2 complex The mixture ratio of effector cells and target cells was changed to 1:1, and the cytotoxic activity of each CAR-T cell prepared in Example 3 was measured. The target cells were SK-MEL-37. The specific measurement procedure was the same as in Example 1. The results are shown in Table 5.

[0149] [Table 5]

[0150] As shown in Table 5, when the mixing ratio of effector cells to target cells was 1:1, the cytotoxic activity of each mutant was as follows, assuming that the cytotoxic activity of T cells containing MAGE-A4-zG was 1.00. The cytotoxic activity of T cells containing MAGE-A4-zG-Em4 was 2.00, and the cytotoxic activity of T cells containing MAGE-A4-zG-Dm5 was 1.89. Even when the mixing ratio of effector cells to target cells was changed to 1:1, the cytotoxic activity of T cells containing MAGE-A4-zG-Em4 or MAGE-A4-zG-Dm5 was higher than that of T cells containing MAGE-A4-zG.

[0151] Example 5: Preparation of CAR-T cells that bind to CD19 and confirmation of their cytotoxic activity (1) Obtaining a nucleic acid molecule encoding a CAR template A plasmid DNA for constructing a viral vector containing a gene encoding a CAR having an scFv that binds to CD19 was obtained by gene synthesis. Hereinafter, the CAR encoded by the gene in this plasmid DNA is referred to as "CD19-BBz." The above plasmid DNA was used as a template to generate a nucleic acid molecule encoding a CD19-BBz mutant by PCR.

[0152] 4, the gene encoding CD19-BBz had, from the 5' end, a leader sequence, a nucleotide sequence encoding VL, a nucleotide sequence encoding L, a nucleotide sequence encoding VH, a nucleotide sequence encoding CD8α, a nucleotide sequence encoding 4-1BB, and a nucleotide sequence encoding CD3ζ linked in this order. CD19-BBz was a CAR that contained an scFv consisting of VH, VL, and a linker connecting them as an extracellular domain, CD8α as a transmembrane domain, and 4-1BB and CD3ζ as intracellular domains.

[0153] The amino acid sequences of the CDRs of the scFv of CD19-BBz are shown in Table 6. These CDRs were defined by the Chothia method using Discovery Studio. As can be seen from Table 6, in the amino acid sequences of all CDRs, the number of acidic amino acid residues was 4 and the number of basic amino acid residues was 1. From the above formula (I), the electrical characteristics of the CDRs of the scFv of CD19-BBz were negative charge (X=-3).

[0154] [Table 6]

[0155] (2) Obtaining a nucleic acid molecule encoding the CD19-BBz mutant [Primer set] Forward primer: GATATAGCCACCTATTTCTGCCAG (SEQ ID NO: 87) Reverse primer: TCCACTATGCAGCCGAGATGTGTG (SEQ ID NO: 88)

[0156] In Example 5, nucleic acid molecules encoding two CD19-BBz mutants shown in 6) and 7) below were obtained. These mutants had scFvs in which three or four amino acid residues in the light chain FR3 of CD19-BBz were replaced with glutamic acid residues or aspartic acid residues. Specific production procedures will be described later. Hereinafter, these mutants are referred to as "CD19-BBz-Em6" and "CD19-BBz-Dm7", respectively. In 6) and 7) below, the numbers of amino acid residues indicate the positions in VL defined by the Chothia method.

[0157] 6) CD19-BBz-Em6: The amino acid residues at positions 67, 70, and 72 of the VL sequence were replaced with Glu (E) residues. 7) CD19-BBz-Dm7: The amino acid residues at positions 63, 65, 67, and 70 of the VL sequence are substituted with Asp (D) residues.

[0158] Synthesis of 102-nucleotide DNA fragments (SEQ ID NOs: 89 and 90) containing codons encoding the amino acid residues shown in 6) and 7) above was entrusted to Eurofins Genomics. PCR was performed using the plasmid DNA obtained in (1) above as a template and a PCR reagent and primer set to prepare a linearized vector. This linearized vector had a sequence in which a part of the nucleotide sequence encoding the scFv of CD19-BBz was deleted. The obtained linearized vector and each of the synthesized DNA fragments were ligated with a ligation reagent. Competent cells were transformed with the ligation solution. The obtained E. coli was cultured to extract plasmid DNA. Thus, plasmid DNA for producing a viral vector containing a gene encoding a CD19-BBz mutant was obtained. The various reagents and competent cells used in Example 5 were the same as those in Example 1.

[0159] (3) Generation of immune cells expressing CD19-BBz and its mutants and confirmation of their activity In the same manner as in Example 1, virus liquids containing genes encoding CD19-BBz and its mutants were prepared. Then, using these virus liquids, genes encoding CD19-BBz and its mutants were introduced into PBMCs (Lonza, Inc.) to obtain each CAR-T cell. In the same manner as in Example 1, the cytotoxic activity of each CAR-T cell was measured. As the target cell, human B cell precursor leukemia cell line Nalm-6 was used. Nalm-6 was a CD19-positive tumor cell. The mixture ratio of effector cells to target cells was 1:1. The results are shown in Table 7.

[0160] [Table 7]

[0161] As shown in Table 7, when the mixture ratio of effector cells to target cells was 1:1, the cytotoxic activity of each mutant was as follows, assuming that the cytotoxic activity of T cells containing CD19-BBz was 1.00. The cytotoxic activity of T cells containing CD19-BBz-Em6 was 3.09, and the cytotoxic activity of T cells containing CD19-BBz-Dm7 was 2.00. Thus, by substituting at least three amino acid residues of the light chain FR3 defined by the Chothia method with acidic amino acid residues in CD19-BBz, the cytotoxic activity of the immune cells containing the obtained CD19-BBz mutant could be improved.

[0162] Example 6: Preparation of CAR-T cells that bind to CD19 and confirmation of their cytotoxic activity (1) Obtaining a nucleic acid molecule encoding a CAR template A plasmid DNA for constructing a viral vector containing a gene encoding a CAR having an scFv that binds to CD19 was obtained by gene synthesis. Hereinafter, the CAR encoded by the gene in this plasmid DNA is referred to as "CD19-28z". The above plasmid DNA was used as a template for constructing a nucleic acid molecule encoding a CD19-28z mutant by PCR.

[0163] Referring to FIG. 5, the gene encoding CD19-28z had a leader sequence, a nucleotide sequence encoding VL, a nucleotide sequence encoding L, a nucleotide sequence encoding VH, a nucleotide sequence encoding the hinge domain of CD28, a nucleotide sequence encoding CD28TM, a nucleotide sequence encoding the intracellular domain of CD28 (CD28ICD), and a nucleotide sequence encoding CD3ζ linked in this order from the 5' side. CD19-28z was a CAR that contained an scFv consisting of VH, VL, and a linker connecting them as an extracellular domain, a hinge domain of CD28, CD28TM as a transmembrane domain, and CD28ICD and CD3ζ as an intracellular domain. The scFv contained in CD19-28z was the same as the scFv contained in CD19-BBz in Example 5. The amino acid sequence of the CDR of the scFv contained in CD19-28z was as shown in Table 6.

[0164] (2) Obtaining a nucleic acid molecule encoding the CD19-28z mutant In Example 6, nucleic acid molecules encoding six CD19-28z mutants shown in 8) to 13) below were obtained. These mutants had scFvs in which three, four, or five amino acid residues in the light chain FR3 of CD19-28z were replaced with aspartic acid residues or glutamic acid residues. Specific production procedures will be described later. Hereinafter, these mutants are referred to as "CD19-28z-Dm8", "CD19-28z-Em9", "CD19-28z-Dm10", "CD19-28z-Dm11", "CD19-28z-Dm12", and "CD19-28z-Em13", respectively. In 8) to 13) below, the numbers of amino acid residues indicate the positions in VL defined by the Chothia method.

[0165] 8) CD19-28z-Dm8: The amino acid residues at positions 60, 63, and 65 of the VL sequence are substituted with Asp (D) residues. 9) CD19-28z-Em9: The amino acid residues at positions 70, 72, and 74 of the VL sequence were replaced with Glu (E) residues. 10) CD19-28z-Dm10: The amino acid residues at positions 63, 65, 70, and 72 of the VL sequence are substituted with Asp (D) residues. 11) CD19-28z-Dm11: The amino acid residues at positions 63, 67, 70, and 72 of the VL sequence are substituted with Asp (D) residues. 12) CD19-28z-Dm12: The amino acid residues at positions 63, 65, 67, 70, and 72 of the VL sequence are substituted with Asp (D) residues. 13) CD19-28z-Em13: The amino acid residues at positions 63, 65, 67, 70, and 72 of the VL sequence are substituted with Glu (E) residues.

[0166] Synthesis of 102-nucleotide DNA fragments (SEQ ID NOs: 97 to 102) containing codons encoding the amino acid residues shown in 8) to 13) above was entrusted to Eurofins Genomics. PCR was performed using the plasmid DNA obtained in (1) above as a template and a PCR reagent and primer set to prepare a linearized vector. This linearized vector had a sequence in which a part of the nucleotide sequence encoding the scFv of CD19-28z was deleted. The obtained linearized vector and each of the synthesized DNA fragments were ligated with a ligation reagent. Competent cells were transformed with the ligation solution. The obtained E. coli was cultured to extract plasmid DNA. Thus, plasmid DNA for producing a viral vector containing a gene encoding the CD19-28z mutant was obtained. The various reagents and competent cells used in Example 6 were the same as those in Example 1. The primer set used in Example 6 was the same as that in Example 5.

[0167] (3) Generation of immune cells expressing CD19-28z and its mutants and confirmation of their activity Viral fluids containing genes encoding CD19-28z and its mutants were prepared in the same manner as in Example 1. Then, the genes encoding CD19-28z and its mutants were introduced into PBMCs (Lonza, Inc.) using the viral fluids to obtain each CAR-T cell. The cytotoxic activity of each CAR-T cell was measured in the same manner as in Example 1. The target cells were Nalm-6. The mixture ratio of effector cells to target cells was 3:1. The results are shown in Table 8.

[0168] [Table 8]

[0169] As shown in Table 8, when the mixture ratio of effector cells to target cells was 3:1, the cytotoxic activity of each mutant was as follows, assuming that the cytotoxic activity of T cells containing CD19-28z was 1.00. The cytotoxic activity of T cells containing CD19-28z-Dm8 was 1.20, the cytotoxic activity of T cells containing CD19-28z-Em9 was 1.88, the cytotoxic activity of T cells containing CD19-28z-Dm10 was 1.96, the cytotoxic activity of T cells containing CD19-28z-Dm11 was 1.62, the cytotoxic activity of T cells containing CD19-28z-Dm12 was 1.50, and the cytotoxic activity of T cells containing CD19-28z-Em13 was 1.36. Thus, by substituting at least three amino acid residues in the light chain FR3 of CD19-28z, as defined by the Chothia method, with acidic amino acid residues, the cytotoxic activity of immune cells containing the resulting CD19-28z mutant could be improved.

[0170] Example 7: Confirmation of cytotoxic activity of CAR-T cells binding to CD19 The mixture ratio of effector cells and target cells was changed to 1:1, and the cytotoxic activity of each CAR-T cell prepared in Example 6 was measured. The target cells were Nalm-6. The specific measurement procedure was the same as in Example 1. The results are shown in Table 9.

[0171] [Table 9]

[0172] As shown in Table 9, when the mixture ratio of effector cells to target cells was 1:1, the cytotoxic activity of each mutant was as follows, when the cytotoxic activity of T cells containing CD19-28z was set to 1.00. The cytotoxic activity of T cells containing CD19-28z-Dm8 was 1.24, the cytotoxic activity of T cells containing CD19-28z-Em9 was 1.86, the cytotoxic activity of T cells containing CD19-28z-Dm10 was 2.38, the cytotoxic activity of T cells containing CD19-28z-Dm11 was 2.33, the cytotoxic activity of T cells containing CD19-28z-Dm12 was 2.24, and the cytotoxic activity of T cells containing CD19-28z-Em13 was 1.52. With regard to cytotoxic activity, T cells containing the CD19-28z mutant had higher activity than T cells containing CD19-28z, even when the mixture ratio of effector cells to target cells was changed to 1:1.

Claims

1. A nucleic acid molecule having a nucleotide sequence encoding a chimeric antigen receptor, the nucleic acid molecule comprises a segment encoding an extracellular domain, a segment encoding a transmembrane domain, and a segment encoding an intracellular domain; the segment encoding the extracellular domain comprises a nucleotide sequence encoding an antigen-binding region comprising a light chain variable region and a heavy chain variable region; at least three codons in the nucleotide sequence encoding framework region 3 of the light chain variable region defined by the Chothia method are codons encoding acidic amino acid residues; a nucleic acid molecule, wherein the at least three codons include at least three selected from the group consisting of a codon encoding the amino acid residue at position 60, a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, a codon encoding the amino acid residue at position 72, a codon encoding the amino acid residue at position 74, and a codon encoding the amino acid residue at position 76 in the light chain variable region.

2. The nucleic acid molecule according to claim 1, wherein three to five codons selected from the group consisting of a codon encoding the amino acid residue at position 60, a codon encoding the amino acid residue at position 63, a codon encoding the amino acid residue at position 65, a codon encoding the amino acid residue at position 67, a codon encoding the amino acid residue at position 70, a codon encoding the amino acid residue at position 72, a codon encoding the amino acid residue at position 74, and a codon encoding the amino acid residue at position 76 in the light chain variable region are codons encoding acidic amino acid residues.

3. The nucleic acid molecule of claim 1, wherein the antigen-binding region comprises a single-chain antibody, and the single-chain antibody is a single-chain antibody that binds to a complex of a MAGE-A4-derived peptide and HLA-A2, CD19, BCMA or CEA.

4. The nucleic acid molecule of claim 1, wherein the transmembrane domain comprises a transmembrane region of any one of proteins selected from the group consisting of the alpha chain of the T cell receptor, the beta chain of the T cell receptor, CD3ε, CD3ζ, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD154, 4-1BB, ICOS, and GITR.

5. The nucleic acid molecule of claim 1, wherein the intracellular domain comprises a signal transduction domain of at least one protein selected from the group consisting of CD3ζ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD66d, CD79a, CD79b, FcRγ and FcRβ.

6. the segment encoding the intracellular domain further comprises a nucleotide sequence encoding a costimulatory domain; The nucleic acid molecule of claim 5, wherein the costimulatory domain is a costimulatory domain of at least one protein selected from the group consisting of 4-1BB, CD28, GITR, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154 and ICOS.

7. The nucleic acid molecule of claim 1 , further comprising a segment encoding a hinge domain between the nucleotide sequence encoding the antigen-binding region and the segment encoding the transmembrane domain.

8. The nucleic acid molecule of claim 1 , wherein the nucleic acid molecule is DNA or RNA.

9. A vector comprising the nucleic acid molecule according to any one of claims 1 to 8.

10. A chimeric antigen receptor comprising an extracellular domain, a transmembrane domain, and an intracellular domain, the extracellular domain comprises an antigen-binding region comprising a light chain variable region and a heavy chain variable region; at least three amino acid residues in framework region 3 of the light chain variable region as defined by the Chothia method are acidic amino acid residues; a chimeric antigen receptor, wherein the at least three amino acid residues include at least three selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 of the light chain variable region.

11. The chimeric antigen receptor according to claim 10, wherein three to five amino acid residues selected from the group consisting of the amino acid residues at positions 60, 63, 65, 67, 70, 72, 74, and 76 in the light chain variable region are acidic amino acid residues.

12. The chimeric antigen receptor of claim 10, wherein the antigen-binding region comprises a single-chain antibody, and the single-chain antibody is a single-chain antibody that binds to a complex of a MAGE-A4-derived peptide and HLA-A2, CD19, BCMA or CEA.

13. The chimeric antigen receptor of claim 10, wherein the transmembrane domain comprises a transmembrane region of any one protein selected from the group consisting of a T cell receptor α chain, a T cell receptor β chain, CD3ε, CD3ζ, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD154, 4-1BB, ICOS, and GITR.

14. The chimeric antigen receptor of claim 10, wherein the intracellular domain comprises a signal transduction domain of at least one protein selected from the group consisting of CD3ζ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD66d, CD79a, CD79b, FcRγ, and FcRβ.

15. the intracellular domain further comprises a costimulatory domain; The chimeric antigen receptor of claim 14, wherein the costimulatory domain is a costimulatory domain of at least one protein selected from the group consisting of 4-1BB, CD28, GITR, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, and ICOS.

16. The chimeric antigen receptor of claim 10, further comprising a hinge domain between the antigen binding region and the transmembrane domain.

17. An immune cell comprising the chimeric antigen receptor according to any one of claims 10 to 16.

18. A pharmaceutical composition for treating a malignant tumor, comprising the immune cell of claim 17.

19. A method for improving the cytotoxic activity of an immune cell comprising a chimeric antigen receptor, comprising: The chimeric antigen receptor comprises an extracellular domain, a transmembrane domain, and an intracellular domain, the extracellular domain comprising an antigen-binding region comprising a light chain variable region and a heavy chain variable region, The method comprises converting at least three amino acid residues in framework region 3 of the light chain variable region defined by the Chothia method to acidic amino acid residues, thereby improving the cytotoxic activity of an immune cell comprising the chimeric antigen receptor, as compared to the chimeric antigen receptor before the at least three amino acid residues are converted to acidic amino acid residues.

20. A method for producing an immune cell containing a chimeric antigen receptor, comprising introducing the nucleic acid molecule according to any one of claims 1 to 8 into an immune cell and causing the immune cell to express the chimeric antigen receptor.

21. A method for producing an immune cell containing a chimeric antigen receptor, comprising introducing the vector according to claim 9 into an immune cell and causing the immune cell to express the chimeric antigen receptor.

Images