Nrf2 ACTIVATOR

Abstract

To provide an Nrf2 activator for preventing or treating diseases whose onset and symptom progression are associated with oxidative stress.SOLUTION: An Nrf2 activator contains, as an active ingredient, a bisindole-type alkaloid, exemplified by the compound of the following structural formula, or a pharmaceutically acceptable salt thereof.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to an Nrf2 activator. [Background technology]

[0002] It is known that, as one of the defense mechanisms against oxidative stress in the body, the transcription factor Nrf2 (NF-E2 related factor 2) plays a role in protecting cells by increasing the expression of genes that reduce oxidative stress. For this reason, in recent years, active efforts have been made to search for ingredients that can activate Nrf2 to prevent or treat diseases in which oxidative stress is involved in the onset or progression of symptoms. For example, Patent Document 1 describes that an extract from wolfberry fruit (Lycium barbarum) has an Nrf2 activating effect. However, the search for ingredients that have an Nrf2 activating effect is still in a significant state. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] JP 2012-211107 A Summary of the Invention [Problem to be solved by the invention]

[0004] Therefore, an object of the present invention is to provide an Nrf2 activator for preventing or treating diseases in which oxidative stress is involved in the onset or progression of symptoms. [Means for solving the problem]

[0005] In view of the above, the present inventors have conducted intensive research and have found that conophylline, which is known as a bisindole alkaloid and has the following chemical structural formula, has Nrf2 activation effect.

[0006] [ka]

[0007] The Nrf2 activator of the present invention, which has been made based on the above findings, contains as an active ingredient a bisindole alkaloid represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof, as described in claim 1:

[0008] [ka]

[0009] [In the formula, R 1 is a hydroxyl group or R 2 Together with R it represents -O-. 2 is R 1 Together with -O- or R 3 Together with R it represents -O-. 3 is R 2 Together with R it represents -O- or a hydrogen atom. 4 and R 5 are either hydroxyl groups or together represent -O- or a bond.] Effect of the Invention

[0010] According to the present invention, it is possible to provide an Nrf2 activator for preventing or treating diseases in which oxidative stress is involved in the onset or progression of symptoms. [Brief description of the drawings]

[0011] [Figure 1] 1 is a graph showing the Nrf2 activating effect of conophylline in an example. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The Nrf2 activator of the present invention contains as an active ingredient a bisindole alkaloid represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof.

[0013] [ka]

[0014] [In the formula, R 1 is a hydroxyl group or R 2 Together with R it represents -O-. 2 is R 1 Together with -O- or R 3 Together with R it represents -O-. 3 is R 2 Together with R it represents -O- or a hydrogen atom. 4 and R 5 are either hydroxyl groups or together represent -O- or a bond.]

[0015] Pharmaceutically acceptable salts of the bisindole alkaloid represented by the above general formula (1) include inorganic acid salts (hydrochloride, sulfate, nitrate, phosphate, etc.), organic acid salts (acetate, lactate, citrate, tartrate, maleate, fumarate, oxalate, etc.), etc.

[0016] A specific example of the bisindole alkaloid represented by the above general formula (1) is conophylline (R 1 is a hydroxyl group, R 2 and R 3 Together, O, R 4 and R 5 together form -O-), conophyllidine (R 1 is a hydroxyl group, R 2 and R 3 Together, O, R 4 and R 5 are bonded together), conophorin (R 1 and R 2 Together, O, R 3 is a hydrogen atom, R 4 and R 5 together -O-), conophyllinine (R 1 is a hydroxyl group, R 2 and R 3 Together, O, R 4 and R 5are hydroxyl groups). These compounds are known as plant-derived bisindole alkaloids having antitumor activity and the like, and can be isolated and purified from plants of the Apocynaceae family, such as Ervatamia microphylla and Tabernaemontana divaricata (see, for example, Japanese Patent No. 4696303, if necessary). However, these compounds used as active ingredients of the Nrf2 activator of the present invention are not limited to those isolated and purified, and may be in the form of a solvent extract containing these compounds. In addition, these compounds may be synthesized by organic chemical techniques, and may be stereoisomers (enantiomers or diastereoisomers) or racemates based on the presence of asymmetric carbon. In addition, these compounds may be a mixture of two or more types of compounds, or may be in the form of a solvent extract containing two or more types of compounds. As used herein, the term "solvent extract" refers to an extract extracted from, for example, the above-mentioned plants using water or an organic solvent (such as monoalcohols exemplified by methanol, ethanol, and isopropanol, and polyhydric alcohols exemplified by 1,3-butylene glycol, ether, hexane, ethyl acetate, acetonitrile, etc., which may contain water) as an extraction solvent.

[0017] The Nrf2 activator of the present invention can be formulated into various preparation forms and taken or ingested as a medicine or health food by itself, and can also be incorporated into various foods and beverages and ingested. The Nrf2 activator of the present invention can also be applied to the skin in the form of an external preparation such as an ointment, cream, or lotion. The dosage, intake, or application amount can be appropriately determined based on the age, sex, weight, and severity of symptoms of the subject. By taking, ingesting, or applying an appropriate amount, it is possible to expect preventive and therapeutic effects (including skin-beautifying and whitening effects) of diseases in which oxidative stress is involved in the onset or progression of symptoms, such as Alzheimer's disease, chronic obstructive pulmonary disease, asthma, atherosclerosis, multiple sclerosis, rheumatoid arthritis, and skin damage and aging caused by light, based on its Nrf2 activating action. EXAMPLES

[0018] The present invention will be described in detail below with reference to examples, but the present invention should not be construed as being limited to the following description.

[0019] Experimental Example 1: Nrf2 Activation Effect of Conophylline (Experimental Method) The Nrf2 activation effect of conophylline (crystals), isolated and purified from Ervatamia microphylla, a plant of the Apocynaceae family, by the method described in Patent No. 4696303, was evaluated by the ARE (Antioxidant Response Element)-luciferase reporter assay, which is known as a monitoring system for the Nrf2 antioxidant pathway. Specifically, a plasmid containing a polynucleotide consisting of two repeated ARE sequences (TAGCTTGGAAATGACATTGCTAATGGTGACAAAGCAACTTTTAGCTTGGAAATGACATTGCTAATGGTGACAAAGCAACTTT: sequence number 1) was incorporated into the multicloning site of pNL2.2[NlucP / Hygro]Vector (Promega), a vector for luciferase reporter assays, and introduced into HaCaT cells (DKFZ) by electroporation using Cell Line Nucleofector Kit V (Lonza). After 24 hours, hygromycin was added at a final concentration of 600 μg / mL to select drug-resistant cells, thereby establishing a HaCaT cell line that stably expresses the ARE-luciferase reporter and has hygromycin resistance. Approximately 10,000 cells of ARE-luciferase reporter stably expressing HaCaT cell line per well were seeded in 100μL of medium (high glucose DMEM (Sigma) supplemented with 10% FBS (Gibco) and 200mmol / L L-glutamine solution (x100) (Fujifilm Wako Pure Chemical), the same below) in a 96-well plate and cultured for 16 to 24 hours in a 37℃, 5% CO2 incubator. After that, the medium was replaced with one containing conophylline dissolved in DMSO at various final concentrations (DMSO final concentration 0.1%) and cultured for another 24 hours. After 24 hours, the Nrf2 activation effect of conophylline was evaluated by measuring luciferase activity using the Nano-Glo Luciferase Assay System (Promega) according to the protocol.

[0020] (Experimental Results) The luciferase activity when only DMSO was added at a final concentration of 0.1% as a control was set to 1, and the relative values ​​are shown in Figure 1 (CNP stands for conophylline). As is clear from Figure 1, conophylline increased luciferase activity in a concentration-dependent manner. When conophylline was dissolved in DMSO to a final concentration of 1 μg / mL and added, and ML-385 (Cayman Chemical Co.), an Nrf2 inhibitor, was also dissolved in DMSO to a final concentration of 20 μM and added (DMSO final concentration 0.1%), luciferase activity was significantly reduced. From the above results, the Nrf2 activation effect of conophylline was confirmed.

[0021] Formulation Example 1: Tablets Tablets having Nrf2 activation activity and consisting of the following component composition were produced by a method known per se (unit: weight %). Conophylline 1 Lactose 80 Magnesium stearate 19

[0022] Formulation example 2: Biscuits A biscuit having an Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %). Conophylline 1 32g plain flour Whole eggs 16 Butter 16 Sugar 24 water 10 1 teaspoon baking powder

[0023] Formulation example 3: Jelly A jelly having an Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %). Conophylline 0.01 Gelling agent 1.3 Sugar 20 pH adjuster 2.5 Wednesday 76.19

[0024] Formulation Example 4: Ointment An ointment having an Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %). Conophylline 5 White Vaseline 95

[0025] Formulation Example 5: Cream A cream having an Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %). Conophylline 5 White Vaseline 30 Cetanol 15 Sodium Lauryl Sulfate 1 Ethyl parahydroxybenzoate 0.1 Butyl paraoxybenzoate 0.1 Water 48.8

[0026] Formulation Example 6: Lotion A lotion having an Nrf2 activating effect and consisting of the following component composition was produced by a method known per se (unit: weight %). Conophylline 10 Polyoxyethylene (40) hydrogenated castor oil 0.5 Ethanol 5 Paraben: 0.2 Water 84.3 [Industrial Applicability]

[0027] INDUSTRIAL APPLICABILITY The present invention has industrial applicability in that it can provide an Nrf2 activator for preventing or treating diseases in which oxidative stress is involved in the onset or progression of symptoms.

Claims

[Claim 1] An Nrf2 activator comprising as an active ingredient a bisindole alkaloid represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof: 【Chemistry 1】 [In the formula, R １ is a hydroxyl group or R ２ Together with represents -O-. ２ is R １ Together with -O- or R ３ Together with represents -O-. ３ is R ２ Together with R, they represent --O-- or a hydrogen atom. ４ and R ５ each represents a hydroxyl group or together represents --O-- or a bond.]

Images