Class ii, type v crispr systems

Abstract

SOLUTION: Described herein are methods, compositions, and systems derived from uncultivated microorganisms useful for gene editing.SELECTED DRAWING: Figure 4B

Description

[Technical field]

[0001] cross reference This application is a continuation of U.S. Provisional Application No. 62 / 986,477, filed March 6, 2020, entitled "Class II Type V CRISPR Systems," U.S. Provisional Application No. 63 / 022,276, filed May 8, 2020, entitled "Class II Type V CRISPR Systems," U.S. Provisional Application No. 63 / 045,815, filed June 29, 2020, entitled "Class II Type V CRISPR Systems," U.S. Provisional Application No. 63 / 045,815, filed August 20, 2020, entitled "Class II Type V CRISPR Systems," This application claims the benefit of U.S. Provisional Application No. 63 / 068,316, entitled "Class II Type V CRISPR Systems," filed on August 24, 2020, U.S. Provisional Application No. 63 / 069,699, entitled "Class II Type V CRISPR Systems," filed on November 19, 2020, and U.S. Provisional Application No. 63 / 116,157, entitled "Class II Type V CRISPR Systems," filed on November 19, 2020, each of which is incorporated by reference in its entirety. [Background technology]

[0002] Clustered regularly interspaced related short palindromic repeats (CRISPR)-guided ribonucleic acid (RNA) plus Cas enzymes are widely distributed components of prokaryotic immune systems (~45% in bacteria and ~84% in archaea) that function to protect such microorganisms from non-self nucleic acids, e.g., infectious viruses and plasmids, by CRISPR-RNA-guided nucleic acid cleavage. Although deoxyribonucleic acid (DNA) elements encoding CRISPR RNA elements are relatively conserved in terms of structure and length, their CRISPR-associated (Cas) proteins are highly diverse and contain a wide range of nucleic acid-interacting domains. Although CRISPR DNA elements were observed as early as 1987, the programmable endonuclease cleavage capabilities of CRISPR / Cas complexes were only recognized relatively recently. This has led to the use of recombinant CRISPR / Cas systems in a variety of DNA engineering and gene editing applications.

[0003] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy, created on Mar. 5, 2021, is named 55921-710_601_SL.txt and is 2,617KB in size. Summary of the Invention [Means for solving the problem]

[0004] In some aspects, the disclosure provides an engineered nuclease system, comprising: (a) an endonuclease comprising a RuvC domain, the endonuclease being derived from an uncultured microorganism and being a Cas12a endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and hybridize to a target nucleic acid sequence. In some embodiments, the Cas12a endonuclease comprises the sequence GWxxxK. In some embodiments, the engineered guide RNA comprises the sequence UCUAC[N 3-5 ]GUAGAU(N4). In some embodiments, the engineered guide RNA comprises CCUGC[N4]GCAGG(N 3-4In some aspects, the disclosure provides an engineered nuclease system, comprising: (a) an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and hybridize to a target nucleic acid sequence. In some embodiments, the endonuclease comprises a RuvCI, II, or III domain. In some embodiments, the endonuclease has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of the RuvCI, II or III domains of SEQ ID NOs: 1-3470 or variants thereof. In some embodiments, the RuvCI domain comprises a D catalytic residue. In some embodiments, the RuvCII domain comprises an E catalytic residue. In some embodiments, the RuvCIII domain comprises a D catalytic residue. In some embodiments, the RuvC domain does not have nuclease activity.In some embodiments, the endonuclease further comprises a WEDII domain having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of the WEDII domains of SEQ ID NOs: 1-3470 or variants thereof. In some aspects, the disclosure provides an engineered nuclease system, the nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 3862-3913, the endonuclease being a Class 2 Type V Cas endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to hybridize to a target nucleic acid sequence, the spacer sequence being configured to form a complex with the endonuclease. In some embodiments, the endonuclease further comprises a zinc finger-like domain. In some embodiments, the guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3471, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, -3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857.In some embodiments, the disclosure provides an engineered nuclease system, the nuclease system comprising: (a) a nuclease selected from the group consisting of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3678, 3679-3680, 3681-3682, 3683-3684, 3685-3686, 3687-3688, 3689-3690, 3691-3692, 3693-3694, 3695-3696, 3697-3698, 3699-4000, 3700-3700, 3701-3702, 3703-3704, 3705-3706, 3707-3708, 3709-3710, 3711-3712, 3713-3714, 3715-3716, 3717-3718, 3719-3720, 3721-3722, 3722-3724, 3723-3725, 3724-3726, 3725-3728, 3726-3729, 3730-3730, 3731-373 (b) an engineered guide RNA comprising a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857; and (b) a class 2 V-type Cas endonuclease configured to bind to the engineered guide RNA. In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 3863-3913. In some embodiments, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a eukaryotic, fungal, plant, mammalian, or human genome. In some embodiments, the guide RNA is 30-250 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence that is at least 80% identical to a sequence from the group consisting of SEQ ID NOs: 3938-3953. In some embodiments, when the sequence of the endonuclease is optimally aligned to SEQ ID NO: 215, the endonuclease comprises at least one of the following mutations: S168R, E172R, N577R, or Y170R. In some embodiments, when the sequence of the endonuclease is optimally aligned to SEQ ID NO: 215, the endonuclease comprises the mutations S168R and E172R. In some embodiments, when the sequence of the endonuclease is optimally aligned to SEQ ID NO: 215, the endonuclease comprises the mutations N577R or Y170R.In some embodiments, the endonuclease comprises the mutation S168R when the sequence of the endonuclease is optimally aligned to SEQ ID NO: 215. In some embodiments, the endonuclease does not comprise the mutations E172, N577 or Y170. In some embodiments, the engineered nuclease system comprises:

[0005] The single-stranded or double-stranded DNA repair template comprises a first homology arm comprising a sequence of at least 20 nucleotides 5' to 3', i.e., 5' to a target deoxyribonucleic acid sequence, a synthetic DNA sequence of at least 10 nucleotides, and a second homology arm comprising a sequence of at least 20 nucleotides 3' to the target sequence. In some embodiments, the first homology arm or the second homology arm comprises a sequence of at least 40, 80, 120, 150, 200, 300, 500, or 1,000 nucleotides. In some embodiments, the first homology arm or the second homology arm is homologous to a genomic sequence of a prokaryotic, bacterial, fungal, or eukaryotic organism. In some embodiments, the single-stranded or double-stranded DNA repair template comprises a donor transgene. In some embodiments, the engineered nuclease system further comprises a DNA repair template comprising a double-stranded DNA segment flanked by one or two single-stranded DNA segments. In some embodiments, the single stranded DNA segment is conjugated to the 5' end of the double stranded DNA segment. In some embodiments, the single stranded DNA segment is conjugated to the 3' end of the double stranded DNA segment. In some embodiments, the single stranded DNA segment has a length of 4-10 nucleotide bases. In some embodiments, the single stranded DNA segment has a nucleotide sequence complementary to a sequence within a spacer sequence. In some embodiments, the double stranded DNA sequence comprises a barcode, an open reading frame, an enhancer, a promoter, a protein coding sequence, an miRNA coding sequence, an RNA coding sequence, or a transgene. In some embodiments, the double stranded DNA sequence is flanked by nuclease cleavage sites. In some embodiments, the nuclease cleavage sites comprise a spacer and a PAM sequence. In some embodiments, the system comprises a Mg 2+In some embodiments, the guide RNA comprises a hairpin comprising at least 8, at least 10, or at least 12 base pairs of ribonucleotides. In some embodiments, the hairpin comprises 10 base pairs of ribonucleotides. In some embodiments, (a) the endonuclease comprises a sequence at least 75%, 80%, or 90% identical to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof, and (b) the guide RNA structure comprises a sequence at least 80% or 90% identical to a non-degenerate nucleotide of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857. In some embodiments, the endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 3863-3913. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 3871. In some embodiments, sequence identity is determined by the BLASTP, CLUSTALW, MUSCLE, MAFFT, or CLUSTALW algorithms using Smith-Waterman homology search algorithm parameters. In some embodiments, sequence identity is determined by the BLASTP homology search algorithm using parameters of word length (W) of 3, expectation (E) of 10, and a BLOSUM62 scoring matrix setting occurrences of 11, gap costs at extensions of 1, and using an adjustment of the conditional combination scoring matrix.

[0006] In some aspects, the disclosure provides an engineered guide RNA, comprising: (a) a DNA targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule; and (b) a protein binding segment comprising two complementary sequences of nucleotides that hybridize to form a double-stranded RNA (dsRNA) duplex, wherein the two complementary sequences of nucleotides are covalently linked to each other with an intervening nucleotide, and the engineered guide ribonucleic acid polynucleotide is capable of forming a complex with an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, and targeting the complex to a target sequence of the target DNA molecule. In some embodiments, the DNA targeting segment is located 3' to both of the two complementary sequences of nucleotides. In some embodiments, the protein binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to the non-degenerate nucleotides of SEQ ID NOs: 3608-3609. In some embodiments, the double-stranded RNA (dsRNA) duplex comprises at least 5, at least 8, at least 10, or at least 12 ribonucleotides.

[0007] In some aspects, the present disclosure provides a deoxyribonucleic acid polynucleotide that encodes an engineered guide ribonucleic acid polynucleotide described herein.

[0008] In some aspects, the disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism. The nucleic acid encodes a class 2 V-type Cas endonuclease and is derived from an uncultured microorganism, and the organism is not an uncultured organism. In some embodiments, the endonuclease comprises a variant having at least 70%, or at least 80% sequence identity to any one of SEQ ID NOs: 1-3470. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 3938-3953. In some embodiments, the NLS comprises SEQ ID NO: 3939. In some embodiments, the NLS is present proximal to the N-terminus of the endonuclease. In some embodiments, the NLS comprises SEQ ID NO: 3938. In some embodiments, the NLS is present proximal to the C-terminus of the endonuclease. In some embodiments, the organism is a prokaryote, a bacterium, a eukaryote, a fungus, a plant, a mammal, a rodent, or a human.

[0009] In some embodiments, the present disclosure provides engineered vectors comprising a nucleic acid sequence encoding a class 2 V-type Cas endonuclease or a Cas12a endonuclease, the endonuclease being derived from an uncultured microorganism.

[0010] In some aspects, the disclosure provides engineered vectors comprising a nucleic acid described herein.

[0011] In some aspects, the present disclosure provides a genetically engineered vector comprising a deoxyribonucleic acid polynucleotide as described herein. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, a viral particle derived from an adeno-associated virus (AAV), a lentivirus, or an adenovirus.

[0012] In some aspects, the disclosure provides a cell comprising the vector described herein.

[0013] In some aspects, the disclosure provides a method of producing an endonuclease comprising culturing any of the host cells described herein.

[0014] In some aspects, the disclosure provides a method for binding, cleaving, marking or modifying a double-stranded deoxyribonucleic acid polynucleotide, comprising: (a) contacting a double-stranded deoxyribonucleic acid polynucleotide with a class 2 type V Cas endonuclease in a complex comprising the endonuclease and an engineered guide RNA configured to bind to the double-stranded deoxyribonucleic acid polynucleotide; (b) the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and (c) the PAM comprises a sequence comprising any one of SEQ ID NOs: 3863-3913. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide RNA and a second strand comprising a PAM. In some embodiments, the PAM is immediately adjacent to the 5' end of the sequence complementary to a sequence of the engineered guide RNA. In some embodiments, the PAM comprises SEQ ID NO: 3871. In some embodiments, the class 2 V-type Cas endonuclease is from an uncultured microorganism. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. In some embodiments, the method comprises delivering an engineered nuclease system of any one of claims 1 to 0 to a target nucleic acid locus, wherein the endonuclease is configured to form a complex with an engineered guide ribonucleic acid structure, and wherein the complex is configured such that upon binding the complex to the target nucleic acid locus, the complex modifies the target nucleic acid locus. In some embodiments, modifying the target nucleic acid locus comprises binding the target nucleic acid locus, nicking the target nucleic acid locus, cleaving the target nucleic acid locus, or marking the target nucleic acid locus. In some embodiments, the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is within a cell.In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, a human cell, or a primary cell. In some embodiments, the cell is a primary cell. In some embodiments, the primary cell is a T cell. In some embodiments, the primary cell is a hematopoietic stem cell (HSC). In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid according to any one of claims

[0007] to

[0008] or a vector according to any one of claims

[0008] to

[0011] . In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding an endonuclease. In some embodiments, the nucleic acid comprises a promoter to which an open reading frame encoding an endonuclease is operably linked. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing an open reading frame encoding the endonuclease. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding an engineered guide RNA operably linked to a ribonucleic acid (RNA) pol III promoter. In some embodiments, the endonuclease induces a single-stranded or double-stranded break at or near the target locus. In some embodiments, the endonuclease induces a staggered single-stranded break within or 3' to the target locus.

[0015] In some aspects, the disclosure provides a method of editing the TRAC locus of a cell. The method includes contacting a cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA configured to form a complex with the endonuclease, the engineered guide RNA comprising a spacer sequence configured to hybridize to a region of the TRAC locus, the engineered guide RNA comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 4316-4369. In some embodiments, the RNA-guided nuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2 type V Cas endonuclease. In some embodiments, the class 2 type V Cas endonuclease comprises a RuvC domain comprising a RuvCI subdomain, a RuvCII subdomain, and a RuvCIII subdomain. In some embodiments, the Class 2 V-type Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof. In some embodiments, the engineered guide RNA further comprises a sequence having at least 80% sequence identity to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857. In some embodiments, the endonuclease comprises a sequence that is at least 75%, 80% or 90% identical to any one of SEQ ID NOs: 141, 215, 229, 261 or 1711-1721, or a variant thereof.In some embodiments, the guide RNA structure comprises a sequence that is at least 80%, or at least 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857. In some embodiments, the method further comprises contacting or introducing into the cell a donor nucleic acid that comprises a cargo sequence flanked on the 3' or 5' end by a sequence that has at least 80% identity to any one of SEQ ID NOs: 4424 or 4425. In some embodiments, the cell is a peripheral blood mononuclear cell (PBMC). In some embodiments, the cell is a T cell, or a precursor thereof, or a hematopoietic stem cell (HSC). In some embodiments, the cargo sequence comprises a sequence that encodes a T cell receptor polypeptide, a CAR-T polypeptide, or a fragment or derivative thereof. In some embodiments, the engineered guide RNA comprises a sequence that has at least 80% identity to any one of SEQ ID NOs: 4370-4423. In some embodiments, the engineered guide RNA comprises the nucleotide sequence of sgRNA1-54 from Table 5A with the corresponding chemical modifications listed in Table 5A. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 80% sequence identity to any one of SEQ ID NOs: 4334, 4350, or 4324. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 4388, 4404, or 4378. In some embodiments, the engineered guide RNA comprises the nucleotide sequence of sgRNA9, 35, or 19 from Table 5A.

[0016] In some aspects, the disclosure provides an engineered nuclease system, the system comprising: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA configured to form a complex with the endonuclease and comprising a spacer sequence configured to hybridize to a target nucleic acid sequence, the engineered guide RNA comprising: (i) a 2'-O methyl or 2'-fluoro base modification of at least one nucleotide within the first four bases at the 5' end of the engineered guide RNA or the last four bases at the 3' end of the engineered guide RNA; (ii) an engineered nucleotide sequence comprising a 2'-O methyl or 2'-fluoro base modification of at least one nucleotide within the first four bases at the 5' end of the engineered guide RNA or the last four bases at the 3' end of the engineered guide RNA; In some embodiments, the engineered guide RNA comprises at least one of the following: (i) a phosphorothioate (PS) linkage between at least two of the first five bases at the 5' end of the engineered guide RNA or at least two of the last five bases at the 3' end of the engineered guide RNA, (ii) a phosphorothioate linkage within the 3' or 5' stem of the engineered guide RNA, (iii) a 2'-O methyl or 2'-fluoro base modification within the 3' or 5' stem of the engineered guide RNA, (iv) a 2'-O methyl or 2'-fluoro base modification of at least seven bases in the spacer region of the engineered guide RNA, and (vi) a phosphorothioate linkage within the loop region of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a 2'-O methyl or 2'-fluoro base modification of at least one nucleotide within the first five bases at the 5' end of the engineered guide RNA or the last five bases at the 3' end of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a 2'-O methyl or 2'-fluoro base modification at the 5' end of the engineered guide RNA or at the 3' end of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a phosphorothioate (PS) linkage between at least two of the first five bases at the 5' end of the engineered guide RNA or a phosphorothioate linkage between at least two of the last five bases at the 3' end of the engineered guide RNA.In some embodiments, the engineered guide RNA comprises a phosphorothioate linkage in the 3' or 5' stem of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a 2'-O methyl base modification in the 3' or 5' stem of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a 2'-fluoro base modification of at least 7 bases of the spacer region of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises a phosphorothioate linkage in the loop region of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises at least three 2'-O methyl or 2'-fluoro bases at the 5' end of the engineered guide RNA, two phosphorothioate linkages between the first three bases at the 5' end of the engineered guide RNA, at least four 2'-O methyl or 2'-fluoro bases at the 4' end of the engineered guide RNA, and three phosphorothioate linkages between the last three bases at the 3' end of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises at least two 2'-O-methyl bases and at least two thiophosphate bonds at the 5' end of the engineered guide RNA, and at least one 2'-O-methyl base and at least one thiophosphate bond at the 3' end of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises at least one 2'-O-methyl base in both the 3' stem or 5' stem region of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises at least one to at least fourteen 2'-fluoro bases in the spacer region, excluding the seed region, of the engineered guide RNA. In some embodiments, the engineered guide RNA comprises at least one 2'-O-methyl base in the 5' stem region of the engineered guide RNA, and at least one to at least fourteen 2'-fluoro bases in the spacer region, excluding the seed region, of the guide RNA. In some embodiments, the guide RNA comprises a spacer sequence that targets the VEGF-A gene.In some embodiments, the guide RNA comprises a spacer sequence having at least 80% identity to SEQ ID NO: 3985. In some embodiments, the guide RNA comprises nucleotides of guide RNA 1-7 from Table 7, including chemical modifications listed in Table 7. In some embodiments, the RNA-guided nuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2 type V Cas endonuclease. In some embodiments, the class 2 type V Cas endonuclease comprises a RuvC domain, including a RuvCI subdomain, a RuvCII subdomain, and a RuvCIII subdomain. In some embodiments, the class 2 type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof. In some embodiments, the Class 2 V-type Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261 or 1711-1721, or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.

[0017] In some aspects, the disclosure provides a host cell comprising an open reading frame encoding a heterologous endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof. In some embodiments, the endonuclease has at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof. In some embodiments, the host cell is an E. coli cell or a mammalian cell. In some embodiments, the host cell is an E. coli cell, the E. coli cell is a λDE3 lysogen, or the E. coli cell is a BL21(DE3) strain. In some embodiments, the E. coli cell has an ompT lon genotype. In some embodiments, the open reading frame is a T7 promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an araP promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an araP promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an araP promoter sequence, a PrhaBAD promoter sequence, a T7 ... BADThe open reading frame is operably linked to a promoter, a strong leftward promoter (pL promoter) from lambda phage, or any combination thereof. In some embodiments, the open reading frame comprises a sequence encoding an affinity tag linked in-frame to the sequence encoding the endonuclease. In some embodiments, the affinity tag is an immobilized metal affinity chromatography (IMAC) tag. In some embodiments, the IMAC tag is a polyhistidine tag. In some embodiments, the affinity tag is a myc tag, a human influenza hemagglutinin (HA) tag, a maltose binding protein (MBP) tag, a glutathione S-transferase (GST) tag, a streptavidin tag, a FLAG tag, or any combination thereof. In some embodiments, the affinity tag is linked in-frame to the sequence encoding the endonuclease via a linker sequence encoding a protease cleavage site. In some embodiments, the protease cleavage site is a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a blood clotting factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof. In some embodiments, the open reading frame is codon-optimized for expression in a host cell. In some embodiments, the open reading frame is provided on a vector. In some embodiments, the open reading frame is integrated into the genome of a host cell.

[0018] In some aspects, the disclosure provides a culture comprising any of the host cells described herein in a compatible liquid medium.

[0019] In some aspects, the disclosure provides a method of producing an endonuclease, comprising culturing any of the host cells described herein in a compatible growth medium. In some embodiments, the method further comprises inducing expression of the endonuclease. In some embodiments, the induction of expression of the nuclease is by adding additional chemical agents or increased nutrients, or by increasing or decreasing temperature. In some embodiments, the additional chemical agents or increased nutrients include isopropyl β-D-1-thiogalactopyranoside (IPTG) or additional amounts of lactose. In some embodiments, the method further comprises isolating the host cells after culturing and lysing the host cells to produce a protein extract. In some embodiments, the method further comprises isolating the endonuclease. In some embodiments, the isolation comprises subjecting the protein extract to IMAC, ion exchange chromatography, anion exchange chromatography, or cation exchange chromatography. In some embodiments, the open reading frame comprises a sequence encoding an affinity tag linked in frame to the sequence encoding the endonuclease. In some embodiments, the affinity tag is linked in frame to the sequence encoding the endonuclease via a linker sequence encoding a protease cleavage site. In some embodiments, the protease cleavage site comprises a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a blood clotting factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof. In some embodiments, the method further comprises cleaving the affinity tag by contacting the endonuclease with a protease corresponding to the protease cleavage site. In some embodiments, the affinity tag is an IMAC affinity tag. In some embodiments, the method further comprises performing subtractive IMAC affinity chromatography to remove the affinity tag from the composition comprising the endonuclease.

[0020] In some aspects, the disclosure provides a system comprising: (a) a class 2 type VA Cas endonuclease configured to bind a 3-nucleotide PAM sequence or a 4-nucleotide PAM sequence, the endonuclease having increased cleavage activity for sMbCas12a; and (b) an engineered guide RNA configured to form a complex with the class 2 type VA Cas endonuclease, the engineered guide RNA comprising a spacer sequence configured to hybridize to a target nucleic acid comprising a target nucleic acid sequence. In some embodiments, the cleavage activity is measured in vitro by introducing the endonuclease plus a compatible guide RNA into a cell comprising the target nucleic acid and detecting cleavage of the target nucleic acid sequence in the cell. In some embodiments, the class 2 type VA Cas endonuclease comprises a sequence having at least 75% sequence identity to any one of 215-225, or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to the non-degenerate nucleotides of SEQ ID NO: 3609. In some embodiments, the target nucleic acid further comprises a YYN PAM sequence proximal to the target nucleic acid sequence. In some embodiments, the Class 2 VA-type Cas endonuclease has at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 200% or more increased activity relative to sMbCas12a.

[0021] In some aspects, the disclosure provides a system comprising: (a) a class 2 type V-A' Cas endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a sequence having at least 80% identity to about 19 to about 25, or about 19 to about 31 contiguous nucleotides of a naturally occurring effector repeat sequence of the class 2 type V Cas endonuclease. In some embodiments, the naturally occurring effector repeat sequence is any one of SEQ ID NOs: 3560-3572. In some embodiments, the class 2 type V-A' Cas endonuclease has at least 75% identity to SEQ ID NO: 126.

[0022] In some aspects, the disclosure provides a system comprising: (a) a class 2 VL-type endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a sequence having at least 80% identity to about 19 to about 25, or about 19 to about 31 contiguous nucleotides of a naturally occurring effector repeat sequence of the class 2 V-type Cas endonuclease. In some embodiments, the class 2 VL-type endonuclease has at least 75% sequence identity to any one of SEQ ID NOs: 793-1163.

[0023] In some aspects, the disclosure provides a method of disrupting a VEGF-A locus in a cell, the method comprising introducing into the cell (a) a class 2 type V Cas endonuclease and (b) an engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the VEGF-A locus, wherein the engineered guide RNA comprises a targeting sequence having at least 80% identity to SEQ ID NO: 3985, or wherein the engineered guide RNA comprises a nucleotide sequence of any one of guide RNAs 1-7 from Table 7. In some embodiments, the class 2 type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof. In some embodiments, the Class 2 V-type Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261 or 1711-1721, or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.

[0024] In some aspects, the disclosure provides a method of disrupting a locus in a cell, the method comprising contacting a cell with a composition comprising: (a) a class 2 type V Cas endonuclease having at least 75% identity to any one of SEQ ID NOs: 215-225, or a variant thereof; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and hybridize to a region of the locus, wherein the class 2 type V Cas endonuclease has at least equivalent cleavage activity to spCas9 in the cell. In some embodiments, the cleavage activity is measured in vitro by introducing the endonuclease plus a compatible guide RNA into a cell containing a target nucleic acid and detecting cleavage of a target nucleic acid sequence in the cell. In some embodiments, the composition comprises 20 pmol or less of the class 2 type V Cas endonuclease. In some embodiments, the composition comprises 1 pmol or less of the class 2 type V Cas endonuclease.

[0025] Further aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description, in which only illustrative embodiments of the present disclosure are shown and described. As will be understood, the present disclosure is capable of other and different embodiments, and its several details are capable of modification in various obvious respects, all without departing from the present disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.

[0026] References All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference herein. [Brief description of the drawings]

[0027] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0028] [Figure 1] 1 shows exemplary configurations of different classes and types of CRISPR / Cas loci previously described prior to the present disclosure. [Diagram 2] FIG. 1 shows the environmental distribution of MG nucleases described herein. Protein lengths are shown for representatives of the MG29 protein family. Shaded circles indicate the environment or environment type that identifies each protein (dark grey circles indicate hot environmental sources, light grey circles indicate non-hot environmental sources). N / A indicates that the type of environment in which the sample was collected is unknown. [Diagram 3] The number of predicted catalytic residues present in MG nucleases detected from the sample types described herein (e.g., FIG. 2) is presented. Protein lengths are shown for representatives of the MG29 protein family. The number of predicted catalytic residues for each protein is indicated in the diagram legend (3.0 residues). The first, second and third catalytic residues are located in the RuvCI, RuvCII and RuvCIII domains, respectively. [Figure 4A] Figure 4A shows the diversity of CRISPR VA-type effectors. Figure 4A shows the distribution of taxonomic classifications of contigs encoding novel VA-type effectors per family. [Figure 4B] Figure 4B shows the diversity of CRISPR type VA effectors. Figure 4B represents the phylogenetic gene tree inferred from the alignment of 119 novel and 89 reference type V effector sequences. MG families are represented in brackets. PAM requirements for active nucleases are highlighted in the family-associated boxes. Non-type VA reference sequences were used to root the tree (*MG61 family requires crRNA with alternative stem-loop sequences). [Figure 5A] Figure 5A provides various property information for the nucleases described herein, which depicts the distribution per family of effector protein length and sample type. [Figure 5B] Figure 5B provides various property information regarding the nucleases described herein, showing the presence of RuvC catalytic residues. [Figure 5C] Figure 5C provides various property information for the nucleases described herein. Figure 5C shows the number of CRISPR arrays with various repeat motifs. [Figure 5D] Figure 5D provides various property information for the nucleases described herein. Figure 5D depicts the distribution of repeat motifs per family. [Figure 6A] Figure 6A represents a multiple sequence alignment of the catalytic and PAM interacting regions in VA-type sequences. Francisella novicida Cas12a (FnCas12) is the reference sequence. Other reference sequences are Acidaminococcus species (AsCas12a), Moraxella bovocri (MbCas12a), and Lachnospira bacterium ND2006 (LbCas12a). Figure 6A shows blocks of conservation around the DED catalytic residues in the RuvC-I (left), RuvC-II (middle) and RuvC-III (right) regions. [Figure 6B]Figure 6B represents a multiple sequence alignment of the catalytic and PAM interacting regions in VA-type sequences. Francisella novicida Cas12a (FnCas12) is the reference sequence. Other reference sequences are Acidaminococcus sp. (AsCas12a), Moraxella bovocri (MbCas12a), and Lachnospira bacterium ND2006 (LbCas12a). Figure 6B shows the WED-II and PAM interacting regions that contain residues involved in PAM recognition and interaction. The grey boxes immediately below the FnCas12a sequence identify the domains. Darker boxes in the alignment indicate increasing sequence identity. The black boxes on the FnCas12a sequence indicate the catalytic residues (and positions) in the reference sequence. The grey boxes indicate the domains in the reference sequence at the top of the alignment (FnCas12a). The black boxes indicate the catalytic residues (and positions) in the reference sequence. [Figure 7A] Figure 7A shows the VA type and its associated V-A' effector. Figure 7A shows the VA type (MG26-1) and V-A' (MG26-2) indicated by arrows pointing to the direction of transcription. The CRISPR array is shown as a grey line. The predicted domains of each protein in the contig are indicated by boxes. [Figure 7B] Figure 7B depicts type VA and its associated V-A' effectors. Figure 7B shows a sequence alignment of type V-A' MG26-2 and AsCas12a reference sequences. Top: RuvC-I domain. Middle: Region containing RuvC-I and RuvC-II catalytic residues. Bottom: Region containing RuvC-III catalytic residues. Catalytic residues are indicated by boxes. [Figure 8]Schematic diagram of the structure of sgRNA and target DNA in a ternary complex with AacC2C1 (see Yang, Hui, Pu Gao, Kanagalaghatta R. Rajashankar, and Dinshaw J. Patel. 2016. "PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease." Cell 167(7):1814-28.e12, which is incorporated herein by reference in its entirety). [Figure 9] Effect of mutation or truncation of the R-AR domain of sgRNA on AacC2c1-mediated cleavage of linear plasmid DNA, WT, and wild-type sgRNA. Mutant nucleotides within the sgRNA (lanes 1-5) are highlighted in the left panel. Δ15: 15 nt deleted from the R-AR 1 region of the sgRNA. Δ12: 12 nt removed from the sgRNA J2 / 4 R-AR 1 region (see Liu, Liang, Peng Chen, Min Wang, Xueyan Li, Jiuyu Wang, Maolu Yin, and Yanli Wang. 2017. "C2c1-sgRNA Complex Structure Reveals RNA-Guided DNA Cleavage Mechanism." Molecular Cell 65(2):310-22, which is incorporated herein by reference in its entirety). [Figure 10A] Figure 10A shows that the CRISPR RNA (crRNA) structure is conserved among VA-type systems. Figure 10A shows the folding structure of the reference crRNA sequence in the LbCpf1 system. [Figure 10B] Figure 10B shows that the CRISPR RNA (crRNA) structure is conserved among VA-type systems. Figure 10B shows multiple sequence alignment of CRISPR repeats associated with novel VA-type systems. LbCpf1 processing sites are indicated by black lines. [Figure 10C]Figure 10C shows that CRISPR RNA (crRNA) structure is conserved among VA-type systems. Figure 10C shows the folded structure of the MG61-2 putative crRNA with an alternative stem-loop motif CCUGC[N3-4]GCAGG. [Figure 10D] Figure 10D shows that the CRISPR RNA (crRNA) structure is conserved among VA-type systems. Figure 10D shows multiple sequence alignment of CRISPR repeats with alternative repeat motif sequences. Processing sites and loops are indicated. [Figure 11] 1 depicts the predicted structure of the guide RNA (SEQ ID NO: 3608) used herein. [Figure 12-1] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise: SEQ ID NOs: 3636, 3637, 3641, 3640) of the MG enzymes described herein. [Figure 12-2] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise: SEQ ID NOs: 3636, 3637, 3641, 3640) of the MG enzymes described herein. [Figure 13-1] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise: SEQ ID NOs: 3644, 3645, 3649, 3648) of the MG enzyme described herein. [Figure 13-2] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise: SEQ ID NOs: 3644, 3645, 3649, 3648) of the MG enzyme described herein. [Figure 14-1] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise, SEQ ID NOs: 3652, 3653, 3657, 3656) of the MG enzyme described herein. [Figure 14-2] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise, SEQ ID NOs: 3652, 3653, 3657, 3656) of the MG enzyme described herein. [Figure 15-1] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise: SEQ ID NOs: 3660, 3661, 3665, 3664) of the MG enzyme described herein. [Figure 15-2]1 depicts the predicted structures of the corresponding sgRNAs (clockwise: SEQ ID NOs: 3660, 3661, 3665, 3664) of the MG enzyme described herein. [Figure 16-1] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise, SEQ ID NOs: 3666, 3667, 3672, 3671) of the MG enzyme described herein. [Figure 16-2] 1 depicts the predicted structures of the corresponding sgRNAs (clockwise, SEQ ID NOs: 3666, 3667, 3672, 3671) of the MG enzyme described herein. [Figure 17A] Figure 17A depicts an agarose gel showing the results of PAM vector library cleavage in the presence of TXTL extracts containing various MG family nucleases and their corresponding tracrRNAs or sgRNAs (described in Example 12). Figure 17A depicts lane 1: ladder. The bands from top to bottom are 766, 500, 350, 300, 350, 200, 150, 100, 75, 50; lane 2: 28-1 + MGcrRNA spacer 1 (SEQ ID NO: 141 + 3860); lane 3: 29-1 + MGcrRNA spacer 1 (SEQ ID NO: 215 + 3860); lane 4: 30-1 + MGcrRNA spacer 1 (SEQ ID NO: 226 + 3860); lane 5: 31-1 + MGcrRNA spacer 1 (SEQ ID NO: 229 + 3860); lane 6: 32-1 + MGcrRNA spacer 1 (SEQ ID NO: 261 + 3860); lane 7: ladder. [Figure 17B]FIG. 17B depicts an agarose gel showing the results of PAM vector library cleavage in the presence of TXTL extracts containing various MG family nucleases and their corresponding tracrRNAs or sgRNAs (described in Example 12). Figure 17B shows lane 1: ladder, lane 2: LbaCas12a + LbaCas12a crRNA spacer 2, lane 3: LbaCas12a + MGcrRNA spacer 2, lane 4: Apo 13-1, lane 5: 28-1 + MGcrRNA spacer 2 (SEQ ID NO: 141 + 3861), lane 6: 29-1 + MGcrRNA spacer 2 (SEQ ID NO: 215 + 3861), lane 7: 30-1 + MGcrRNA spacer 2 (SEQ ID NO: 226 + 3861), lane 8: 31-1 + MGcrRNA spacer 2 (SEQ ID NO: 229 + 3861), lane 9: 32-1 + MGcrRNA spacer 2 (SEQ ID NO: 261 + 3861). [Figure 18A1] Figure 18A1 shows that the VA-type effectors described herein are active nucleases. Figure 18A1 displays the seqLogo of the determined PAM sequences for the six nucleases described herein. [Figure 18A2] Figure 18A2 shows that the VA-type effectors described herein are active nucleases. Figure 18A2 displays the seqLogo of the determined PAM sequences for the six nucleases described herein. [Figure 18B] Figure 18B shows that the VA-type effectors described herein are active nucleases. Figure 18B shows the box plots of plasmid transfection activity assays inferred from the frequency of insertion / deletion editing for active nucleases. The boundaries of the box plots indicate the first and third quartiles. The mean is indicated by "x" and the median is represented by the midline within each box. [Figure 18C]Figure 18C shows that the VA-type effectors described herein are active nucleases. Figure 18C shows the plasmid transfection editing frequency at four target sites for MG29-1 and AsCas12a. One comparative experiment was performed with AsCas12a. [Figure 18D] Figure 18D shows that the VA-type effectors described herein are active nucleases. Figure 18D shows the plasmid and RNP editing activity for nuclease MG29-1 at 14 target loci using either TTN or CCN PAMs. [Figure 18E] Figure 18E shows that the VA-type effector described herein is an active nuclease. Figure 18E shows the editing profile of nuclease MG29-1 from RNP transfection assay. One comparative experiment was performed with AsCas12a. Editing frequency and profile experiments for MG29-1 were performed in duplicate. Line plots (Figure 18C and Figure 18D) show the average editing frequency with one standard deviation error bar. [Figure 19] 13 depicts indel formation in cells resulting from transfection of HEK cells with MG29-1 constructs as described in Example 12 together with corresponding sgRNAs containing a variety of different targeting sequences targeting different locations in the human genome. [Figure 20] 1 shows the seqLogo of specific MG family enzyme PAM sequences derived by NGS as described herein (as described in Example 13). [Figure 21] Shown is the seqLogo of the PAM sequences of specific MG family enzymes derived by NGS described herein (top to bottom, SEQ ID NOs: 3865, 3867, 3872). [Figure 22] Shown is the seqLogo of the PAM sequences derived by NGS described herein (top to bottom, SEQ ID NOs: 3878, 3879, 3880, 3881). [Figure 23]The seqLogo of the NGS-derived PAM sequences described herein is displayed (top to bottom, SEQ ID NOs: 3883, 3884, 3885). [Figure 24] 3 shows the seqLogo of the NGS-derived PAM sequence described herein (SEQ ID NO: 3882). [Diagram 25] 1 depicts indel formation in cells resulting from transfection of HEK cells with the MG31-1 constructs described in Example 14 along with corresponding sgRNAs containing a variety of different targeting sequences targeting various locations in the human genome. [Figure 26A] Figure 26A shows the biochemical characteristics of VA-type nucleases. Figure 26A shows that PCR of cleavage products with adapters attached to the cleavage product ends demonstrates the activity of the nucleases described herein and Cpf1 (positive control) when bound to universal crRNA. The predicted cleavage product bands are labeled with arrows. [Figure 26B] Figure 26B shows the biochemical characteristics of VA-type nucleases. Figure 26B shows PCR of cleavage products with adapters attached to their ends, showing the activity of the nucleases described herein when bound to native crRNA. Cleavage product bands are indicated by arrows. [Figure 26C] Figure 26C shows the biochemical characteristics of VA-type nucleases. Figure 26C shows an analysis of NGS cleavage sites showing cleavage in the target strand at position 22, with less frequent cleavage after 21 or 23 nt. [Figure 27A]Figure 27A represents a multiple sequence alignment of the VL-type nucleases described herein, and Figure 27A shows an exemplary positional configuration for the VL-type nucleases. The region containing the putative RuvC-III domain is shown as a light gray rectangle. The putative RuvC catalytic residues are shown as small dark gray rectangles on each sequence. The putative single guide RNA binding sequence is a small white rectangle, the putative cleavable phosphate binding site is shown as a black rectangle on the sequence, and the residues predicted to disrupt base stacking near the cleavable phosphate in the target sequence are shown as small medium gray rectangles on the sequence. [Figure 27B] Figure 27B represents a multiple sequence alignment of the VL-type nucleases described herein. Figure 27B shows a multiple sequence alignment. The region containing the putative RuvC-III domain is shown as a light gray rectangle. The putative RuvC catalytic residues are shown as small dark gray rectangles on each sequence. The putative single guide RNA binding sequence is a small white rectangle, the putative cleavable phosphate binding site is shown as a black rectangle on the sequence, and the residues predicted to disrupt base stacking near the cleavable phosphate in the target sequence are shown as small medium gray rectangles on the sequence. [Figure 28] Shown are VL-type candidates labelled with MG60 as an exemplary positional organisation with effector repeat structures and a phylogenetic tree showing the position of the enzyme within the V-type family. [Figure 29] An example of a smaller V-type effector, which can be labeled MG70, is shown. [Figure 30-1] 1 shows the characterization information for MG70 as described herein. An exemplary positional organization is presented along with a phylogenetic tree showing the position of the enzymes in the V-type family. [Figure 30-2] 1 shows the characterization information for MG70 as described herein. An exemplary positional organization is presented along with a phylogenetic tree showing the position of the enzymes in the V-type family. [Figure 31-1]1 shows another example of a small type V effector MG81 described herein. An exemplary positional organization is presented along with a phylogenetic tree showing the position of enzymes in the type V family. [Figure 31-2] 1 shows another example of a small type V effector MG81 described herein. An exemplary positional organization is presented along with a phylogenetic tree showing the position of enzymes in the type V family. [Diagram 32] The activity of individual enzymes in the V-type effector families identified herein (e.g., MG20, MG60, MG70, and others) is maintained across a range of different enzyme lengths (e.g., 400-1200 AA). Light-colored dots (typical) indicate active enzymes, whereas dark-colored dots (unknown) indicate untested enzymes. [Diagram 33] FIG. 1 shows the sequence conservation of MG nucleases described herein. Black lines indicate putative RuvC catalytic residues. [Diagram 34] FIG. 33 depicts an expanded version of the multiple sequence alignment in FIG. 33 of a region of the MG nuclease described herein that contains the putative RuvC catalytic residues (dark grey rectangle), the scissile phosphate binding residues (black rectangle), and residues predicted to disrupt base stacking adjacent to the scissile phosphate (light grey rectangle). [Diagram 35] 33 depicts a zoomed-in version of the multiple sequence alignment in FIG. 33 of a region of the MG nuclease described herein that contains the putative RuvC catalytic residues (dark grey rectangle), the scissile phosphate binding residues (black rectangle), and residues predicted to disrupt base stacking adjacent to the scissile phosphate (light grey rectangle). [Diagram 36] 1 depicts the region of the MG nuclease described herein that contains the putative RuvC-III domain and catalytic residues. [Figure 37] The region of the MG nuclease containing the putative single-guide RNA binding residues (white rectangle above the sequence) is depicted. [Figure 38]Figure 1 shows a multiple protein sequence alignment of representatives from several MGV type families. The conserved regions containing portions of the RuvC domain predicted to be involved in nuclease activity are shown. Predicted catalytic residues are highlighted. [Figure 39] MG29-1 gene editing tests the TRAC locus. The bar graph shows the creation of insertions and deletions obtained by transfecting MG29-1 with 54 distinct guide RNAs targeting the TRAC locus in primary human T cells. The corresponding guide RNAs depicted in the figure are identified by SEQ ID NOs: 4316-4423. [Diagram 40] Figure 39 represents the optimization of MG29-1 editing in TRAC. The bar graph shows the creation of indels obtained by transfecting MG29-1 (at the concentrations shown) with the four best 22 nt guide RNAs (9, 19, 25 and 35) from Figure 39. Legend: MG29-1 9 is MG29-1 effector (SEQ ID NO:215) and guide 9 (SEQ ID NO:4378), MG29-1 19 is MG29-1 effector (SEQ ID NO:215) and guide 19 (SEQ ID NO:4388), MG29-1 25 is MG29-1 effector (SEQ ID NO:215) and guide 25 (SEQ ID NO:4394), and MG29-1 35 is MG29-1 effector (SEQ ID NO:215) and guide 35 (SEQ ID NO:4404). [Diagram 41] Figure 39 depicts optimization of dose and guide length for MG29-1 editing with TRAC. The line graph shows the creation of indels resulting from transfection of MG29-1 and either guide RNA #19 (SEQ ID NO: 4388) or guide RNA #35 (SEQ ID NO: 4404). Three different doses of nuclease / guide RNA were used. For each dose, six different guide lengths were tested, consecutive 1-nucleotide 3' truncations of SEQ ID NO: 4388 and 4404. The guide used in Figure 39 and Figure 40 is the guide containing a 22 nt long spacer in this case. [Diagram 42] 2 shows the correlation between the generation of indels in TRAC and the loss of T cell receptor expression in the experiments of Example 22. [Diagram 43] Figure 1 shows targeted transgene integration in TRAC stimulated by MG29-1 cleavage. Cells that received only the transgene donor by AAV infection maintained TCR expression but lost CAR expression. Cells transfected with MG29-1 RNP and infected with 100,000vg (vector genome) of the CAR transgene donor lost TCR expression but gained CAR expression. 1 shows FACS plots of CAR antigen binding versus TCR expression for cells transfected with AAV alone containing a CAR-T-containing donor sequence ("AAV"), an AAV containing a CAR-T-containing donor sequence with MG29-1 enzyme and sgRNA19 (SEQ ID NO: 4388) ("AAV+MG29-1-19-22" with a 22 nucleotide spacer), or an AAV containing a CAR-T-containing donor sequence with MG29-1 enzyme and sgRNA35 (SEQ ID NO: 4404) ("AAV+MG29-1-35-22" with a 22 nucleotide spacer). [Diagram 44] MG29-1 gene editing in TRAC in hematopoietic stem cells. Bar graphs show the extent of indel creation in TRAC after transfection with MG29-1-9-22 ("MG29-1 9", MG29-1 + guide RNA #19) and MG29-1-35-22 ("MG29-1 35", MG29-1 + guide RNA #35) compared to mock-transfected cells. [Diagram 45] Figure 1 shows the refinement of the MG29-1 PAM based on the analysis of gene editing results in cells. Guide RNAs were designed using the 5'-NTTN-3' PAM sequence and then classified according to the resulting gene editing activity. The identity of the underlined base (5'-proximal N) is shown for each interval. All guides with activity above 10% had a T at this position in the genomic DNA. This indicates that the MG29-1 PAM can be best described as 5'-TTTN-3'. For each interval, the statistical significance of the excess surface of T at this position is shown. [Figure 46-1]Analysis of gene editing activity against base composition of MG29-1 spacer sequences. Bar graphs show experimental data showing the relationship between GC content (%) and indel frequency ("high" means >50% indels (N=4), "intermediate" means 10-50% indels (N=15), ">1%" means 1-5% indels (N=12), and "<1%" means <1% indels (N=82)). [Figure 46-2] Analysis of gene editing activity against base composition of MG29-1 spacer sequences. Bar graphs show experimental data showing the relationship between GC content (%) and indel frequency ("high" means >50% indels (N=4), "intermediate" means 10-50% indels (N=15), ">1%" means 1-5% indels (N=12), and "<1%" means <1% indels (N=82)). [Figure 47] Represents chemical modifications of MG29-1 guide RNA. The bar graph shows the results of modifications from Table 7 on VEGF-A editing activity relative to unmodified guide RNA (sample #1). [Figure 48-1] Dose titration of variously chemically modified MG29-1 RNA. Bar graphs show the generation of indels after transfection of RNPs with guides using modification patterns 1, 4, 5, 7 and 8. RNP doses were 126 pmol MG29-1 and 160 pmol guide RNA or as indicated. Total dose (A), 1 / 4 (B), 1 / 8 (C), 1 / 16 (D) and 1 / 32 (E). [Figure 48-2] Dose titration of variously chemically modified MG29-1 RNA. Bar graphs show the generation of indels after transfection of RNPs with guides using modification patterns 1, 4, 5, 7 and 8. RNP doses were 126 pmol MG29-1 and 160 pmol guide RNA or as indicated. Total dose (A), 1 / 4 (B), 1 / 8 (C), 1 / 16 (D) and 1 / 32 (E). [Figure 49] 1 shows the plasmid map of pMG450 (MG29-1 nuclease protein in lac inducible tac promoter E. coli BL21 expression vector). [Figure 50] 13 depicts the indel profile of MG29-1 with spacer mAlb29-1-8 (sequence number 3999) compared to spCas9 with a guide targeting mouse albumin intron 1. [Figure 51-1] Representative indel profile of MG29-1 with guides targeting mouse albumin intron 1 as determined by next generation sequencing (approximately 15,000 total reads analyzed) as in Example 29. [Figure 51-2] Representative indel profile of MG29-1 with guides targeting mouse albumin intron 1 as determined by next generation sequencing (approximately 15,000 total reads analyzed) as in Example 29. [Figure 52] As in Example 29, the editing efficiency of MG29-1 is shown when compared with spCas9 in mouse hepatocyte cell lines Hepa1-6 transfected with RNP. [Figure 53A] Figure 53A shows the editing efficiency in mammalian cells of MG29-1 variants with single and double amino acid substitutions when compared to wild type MG29-1. Figure 53A depicts the editing efficiency in Hepa1-6 cells transfected with plasmids sorting for MG29-1 WT or mutant versions. [Figure 53B] Figure 53B shows the editing efficiency in mammalian cells of MG29-1 variants with single and double amino acid substitutions when compared to wild-type MG29-1. Figure 53B represents the editing efficiency in Hepa1-6 cells transfected with mRNA encoding WT or S168R at various concentrations. [Figure 53C] Figure 53C shows the editing efficiency in mammalian cells of MG29-1 variants with single and double amino acid substitutions when compared to wild type MG29-1. Figure 53C represents the editing efficiency in Hepa1-6 cells transfected with mRNA sorted versions of MG29-1 with single or double amino acid substitutions. [Fig. 53D] Figure 53D shows the editing efficiency in mammalian cells of MG29-1 variants with single and double amino acid substitutions when compared to wild type MG29-1. Figure 53D represents the editing efficiency in Hepa1-6 and HEK293T cells transfected with MG29-1 WT for S168R combined with 13 guides. The 12 guides correspond to the guides in Table 7. Guide "35(TRAC)" is a guide targeting the human TRAC locus. [Figure 54] The predicted secondary structure of MG29-1 guide mAlb29-1-8 is shown. [Figure 55] 1 shows the effect of chemical modification of the MG29-1 sgRNA sequence on the stability of the sgRNA in whole cell extracts of mammalian cells. [Figure 56A] Figure 56A shows the use of sequencing to identify cleavage sites on the target strand in an in vitro reaction carried out with MG29-1 protein, guide RNA and appropriate template. Figure 56A shows the distance of the cleavage position from the PAM in nucleotides as determined by next generation sequencing. [Figure 56B] Figure 56B shows the use of sequencing to identify cleavage sites on the target strand in an in vitro reaction performed with MG29-1 protein, guide RNA and appropriate template. Figure 56B shows the use of Sanger sequencing to define MG29-1 cleavage sites on the target strand. [Figure 56C]Figure 56C shows the use of sequencing to identify the cleavage site on the targeted strand in an in vitro reaction performed with MG29-1 protein, guide RNA and appropriate template. Figure 56C shows the use of Sanger sequencing to define the MG29-1 cleavage site on the non-targeted strand. To assess cleavage of both strands, transcript Sanger sequencing was performed on an in vitro reaction containing MG29-1, guide and appropriate template. The cleavage site on the targeted strand is position 23, consistent with the NGS data in Figure 56A showing cleavage at bases 21-23. The "A" peak at the end of the sequence is due to the polymerase transcript and is expected. The cleavage site on the non-targeted strand can be seen in the reversed read where the expected terminating base is a "T". The marked spot (line) indicates cleavage at position 17 from the PAM followed by the terminal T. However, there are mixed T signals at positions 18, 19 and 20 from the PAM, suggesting various breaks on this strand at positions 17, 18 and 19.

[0029] Brief Description of the Sequence Listing The Sequence Listing submitted herewith provides exemplary polynucleotide and polypeptide sequences for use in the methods, compositions and systems according to the present disclosure. Below are exemplary descriptions of the sequences herein.

[0030] MG11 SEQ ID NOs: 1 to 37 show the full-length peptide sequences of MG11 nuclease.

[0031] SEQ ID NO: 3471 shows the 5' direct repeat of a crRNA designed to function with MG11 nuclease.

[0032] SEQ ID NOs: 3472 to 3538 show the effector repeat motifs of MG11 nuclease.

[0033] SEQ ID NOs: 38 to 118 show the full-length peptide sequences of MG13 nuclease.

[0034] SEQ ID NOs: 3540 to 3550 show the effector repeat motif of MG13 nuclease.

[0035] MG19 SEQ ID NOs: 119 to 124 show the full-length peptide sequences of MG19 nuclease.

[0036] SEQ ID NOs: 3551-3558 show the nucleotide sequences of sgRNAs engineered to function with MG19 nuclease.

[0037] SEQ ID NOs: 3863 to 3866 show PAM sequences compatible with MG19 nuclease.

[0038] MG20 SEQ ID NO: 125 shows the full-length peptide sequence of MG20 nuclease.

[0039] SEQ ID NO: 3559 shows the nucleotide sequence of an sgRNA engineered to function with MG20 nuclease.

[0040] SEQ ID NO: 3867 shows a PAM sequence compatible with MG20 nuclease.

[0041] MG26 SEQ ID NOs: 126 to 140 show the full-length peptide sequences of MG26 nuclease.

[0042] SEQ ID NOs: 3560 to 3572 show the effector repeat motif of MG26 nuclease.

[0043] MG28 SEQ ID NOs: 141 to 214 show the full-length peptide sequences of MG28 nuclease.

[0044] SEQ ID NOs: 3573 to 3607 show the effector repeat motif of MG28 nuclease.

[0045] SEQ ID NOs: 3608-3609 show the 5' direct repeats of crRNA designed to function with MG28 nuclease.

[0046] SEQ ID NOs: 3868-3869 show PAM sequences compatible with MG28 nuclease.

[0047] MG29 SEQ ID NOs: 215 to 225 show the full-length peptide sequences of MG29 nuclease.

[0048] SEQ ID NOs: 3610 to 3611 show the effector repeat motif of MG29 nuclease.

[0049] SEQ ID NO: 3612 shows the nucleotide sequence of an sgRNA engineered to function with MG29 nuclease.

[0050] SEQ ID NOs: 3870 to 3872 show PAM sequences compatible with MG29 nuclease.

[0051] MG30 SEQ ID NOs: 226 to 228 show the full-length peptide sequences of MG30 nuclease.

[0052] SEQ ID NOs: 3613 to 3615 show the effector repeat motifs of MG30 nuclease.

[0053] SEQ ID NO: 3873 shows a PAM sequence compatible with MG30 nuclease.

[0054] MG31 SEQ ID NOs: 229 to 260 show the full-length peptide sequences of MG31 nuclease.

[0055] SEQ ID NOs: 3616 to 3632 show the effector repeat motifs of MG31 nuclease.

[0056] SEQ ID NOs: 3874 to 3876 show PAM sequences compatible with MG31 nuclease.

[0057] MG32 SEQ ID NO: 261 shows the full-length peptide sequence of MG32 nuclease.

[0058] SEQ ID NOs: 3633 to 3634 show the effector repeat motif of MG32 nuclease.

[0059] SEQ ID NO: 3876 shows a PAM sequence compatible with MG32 nuclease.

[0060] MG37 SEQ ID NOs: 262 to 426 show the full-length peptide sequences of MG37 nuclease.

[0061] SEQ ID NO: 3635 shows the effector repeat motif of MG37 nuclease.

[0062] SEQ ID NOs: 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, and 3660-3661 set forth the nucleotide sequences of sgRNAs engineered to function through MG37 nuclease.

[0063] SEQ ID NOs: 3638, 3642, 3646, 3650, 3654, 3658 and 3662 show the nucleotide sequence of MG37tracrRNA derived from the same locus as the MG37 nuclease described above.

[0064] SEQ ID NOs: 3639, 3643, 3647, 3651, 3655 and 3659 show 5' direct repeat sequences derived from the native MG37 locus that function as crRNAs when placed 5' to a 3' targeting sequence or spacer sequence.

[0065] MG53 SEQ ID NOs: 427-428 show the full-length peptide sequences of MG53 nuclease.

[0066] SEQ ID NO: 3663 shows a 5' direct repeat sequence derived from the native MG53 locus that functions as a crRNA when placed 5' to a 3' targeting or spacer sequence.

[0067] SEQ ID NOs: 3664-3667 show the nucleotide sequences of sgRNAs engineered to function with MG53 nuclease.

[0068] SEQ ID NOs: 3668-3669 show the nucleotide sequence of tracrRNA of MG53 derived from the same locus as the MG53 nuclease described above.

[0069] MG54 SEQ ID NOs: 429 to 430 show the full-length peptide sequences of MG54 nuclease.

[0070] SEQ ID NO: 3670 shows a 5' direct repeat sequence derived from the native MG54 locus that functions as a crRNA when placed 5' to a 3' targeting sequence or spacer sequence.

[0071] SEQ ID NOs: 3671-3672 show the nucleotide sequences of sgRNAs engineered to function with MG54 nuclease.

[0072] SEQ ID NOs: 3673 to 3676 show the nucleotide sequence of tracrRNA of MG54, which is derived from the same locus as the MG54 nuclease described above.

[0073] MG55 SEQ ID NOs: 431 to 688 show the full-length peptide sequences of MG55 nuclease.

[0074] MG56 SEQ ID NOs: 689 to 690 show the full-length peptide sequences of MG56 nuclease.

[0075] SEQ ID NO: 3678 shows the 5' direct repeat of a crRNA designed to function with MG56 nuclease.

[0076] SEQ ID NOs: 3679 to 3680 show the effector repeat motif of MG56 nuclease.

[0077] MG57 SEQ ID NOs: 691 to 721 show the full-length peptide sequences of MG57 nuclease.

[0078] SEQ ID NOs: 3681 to 3694 show the effector repeat motifs of MG57 nuclease.

[0079] SEQ ID NOs: 3695-3696 show the nucleotide sequences of sgRNAs engineered to function with MG57 nuclease.

[0080] SEQ ID NOs: 3879 to 3880 show PAM sequences compatible with MG57 nuclease.

[0081] MG58 SEQ ID NOs: 722 to 779 show the full-length peptide sequences of MG58 nuclease.

[0082] SEQ ID NOs: 3697 to 3711 show the effector repeat motif of MG58 nuclease.

[0083] MG59 SEQ ID NOs: 780 to 792 show the full-length peptide sequences of MG59 nuclease.

[0084] SEQ ID NOs: 3712 to 3728 show the effector repeat motifs of MG59 nuclease.

[0085] SEQ ID NOs: 3729-3730 show the nucleotide sequences of sgRNAs engineered to function with MG59 nuclease.

[0086] SEQ ID NOs: 3881-3882 show PAM sequences compatible with MG59 nuclease.

[0087] MG60 SEQ ID NOs: 793 to 1163 show the full-length peptide sequences of MG60 nuclease.

[0088] SEQ ID NOs: 3731 to 3733 show the effector repeat motif of MG60 nuclease.

[0089] MG61 SEQ ID NOs: 1164 to 1469 show the full-length peptide sequences of MG61 nuclease.

[0090] SEQ ID NOs: 3734-3735 show the 5' direct repeats of crRNA designed to function with MG61 nuclease.

[0091] SEQ ID NOs: 3736 to 3847 show the effector repeat motifs of MG61 nuclease.

[0092] MG62 SEQ ID NOs: 1470 to 1472 show the full-length peptide sequences of MG62 nuclease.

[0093] SEQ ID NOs: 3848 to 3850 show the effector repeat motif of MG62 nuclease.

[0094] MG70 SEQ ID NOs: 1473 to 1514 show the full-length peptide sequences of MG70 nuclease.

[0095] MG75 SEQ ID NOs: 1515 to 1710 show the full-length peptide sequences of MG75 nuclease.

[0096] MG77 SEQ ID NOs: 1711 to 1712 show the full-length peptide sequences of MG77 nuclease.

[0097] SEQ ID NOs: 3851-3852 show the nucleotide sequences of sgRNAs engineered to function with MG77 nuclease.

[0098] SEQ ID NOs: 3883 to 3884 show PAM sequences compatible with MG77 nuclease.

[0099] MG78 SEQ ID NOs: 1713 to 1717 show the full-length peptide sequences of MG78 nuclease.

[0100] SEQ ID NO: 3853 shows the nucleotide sequence of an sgRNA engineered to function with MG78 nuclease.

[0101] SEQ ID NO: 3885 shows a PAM sequence compatible with MG78 nuclease.

[0102] MG79 SEQ ID NOs: 1718 to 1722 show the full-length peptide sequences of MG79 nuclease.

[0103] SEQ ID NOs: 3854-3857 show the nucleotide sequences of sgRNAs engineered to function with MG79 nuclease.

[0104] SEQ ID NOs: 3886 to 3889 show PAM sequences compatible with MG79 nuclease.

[0105] MG80 SEQ ID NO: 1723 shows the full-length peptide sequence of MG80 nuclease.

[0106] MG81 SEQ ID NOs: 1724 to 2654 show the full-length peptide sequences of MG81 nuclease.

[0107] MG82 SEQ ID NOs: 2655 to 2657 show the full-length peptide sequences of MG82 nuclease.

[0108] MG83 SEQ ID NOs: 2658-2659 show the full-length peptide sequences of MG83 nuclease.

[0109] MG84 SEQ ID NOs: 2660 to 2677 show the full-length peptide sequences of MG84 nuclease.

[0110] MG85 SEQ ID NOs: 2678 to 2680 show the full-length peptide sequences of MG85 nuclease.

[0111] MG90 SEQ ID NOs: 2681 to 2809 show the full-length peptide sequences of MG90 nuclease.

[0112] MG91 SEQ ID NOs: 2810 to 3470 show the full-length peptide sequences of MG91 nuclease.

[0113] Spacer Segment SEQ ID NOs: 3858 to 3861 show the nucleotide sequences of spacer segments.

[0114] NLS SEQ ID NOs:3938-3953 show exemplary nuclear localization sequences (NLS) that can be added to nucleases according to the present disclosure. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0115] While various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes and substitutions will occur to those skilled in the art without departing from the present invention. It will be understood that various alternatives to the embodiments of the present invention described herein may be utilized.

[0116] The practice of some methods disclosed herein uses immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA techniques, unless otherwise indicated.See, for example, Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012); the series Current Protocols in Molecular Biology (FM Ausubel, et al. eds.), the series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (MJ MacPherson, BD Hames and GR Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th Edition (RI Freshney, ed. (2010)), which are incorporated herein by reference in their entirety.

[0117] As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms unless the context clearly dictates otherwise. Furthermore, to the extent the terms "including," "includes," "having," "has," "with," or variations thereof are used in any of the detailed description and / or claims, such terms are intended to be inclusive in a manner similar to the term "comprising."

[0118] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., on the limitations of the measurement system. For example, according to the context of the art, "about" can mean within one or more standard deviations. Alternatively, "about" can mean within a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value.

[0119] As used herein, "cell" generally refers to a biological cell. A cell may be the basic structural, functional, and / or biological unit of an organism. A cell may be derived from any organism having one or more cells. Some non-limiting examples include prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, cells of unicellular eukaryotes, protist cells, cells from plants (e.g., crops, fruits, vegetables, grains, soybean, corn, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkin, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, ferns, club mosses, hornworts, liverworts, mosses), algae cells (e.g., Botryococcus braunii, Cladophora cerevisiae ... Examples of cells that can be used to generate cells include: Mydomonas reinhardtii, Nannochloropsis gadgetana, Chlorella pyrenoidosa, Sargassum patens C. agarde, etc.), seaweed (e.g., kelp), fungal cells (e.g., yeast cells, cells from mushrooms), animal cells, cells from invertebrates (e.g., fruit flies, cnidarians, echinoderms, nematodes, etc.), cells from vertebrates (e.g., fish, amphibians, reptiles, birds, mammals), cells from mammals (e.g., pigs, cows, goats, sheep, rodents, rats, mice, non-human primates, humans, etc.). Cells may not be derived from a naturally occurring organism (e.g., cells may be synthetically produced, which may be referred to as artificial cells).

[0120] As used herein, the term "nucleotide" generally refers to a base-sugar-phosphate combination. A nucleotide may include synthetic nucleotides. A nucleotide may include synthetic nucleotide analogs. A nucleotide may be a monomeric unit of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The term nucleotide may include ribonucleoside triphosphates, adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives may include, for example, [αS]dATP, 7-deaza-dGTP and 7-deaza-dATP, as well as nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing such derivatives. As used herein, the term nucleotide includes dideoxyribonucleoside triphosphates, such as cytosine triphosphate (CTP), guanosine triphosphate (GTP), dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives may include, for example, [αS]dATP, 7-deaza-dGTP and 7-deaza-dATP, as well as nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing such derivatives. Deoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. Nucleotides can be unlabeled or detectably labeled, such as with a moiety that includes an optically detectable moiety (e.g., a fluorophore). Labeling can also be performed with quantum dots. Detectable labels can include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzyme labels.Fluorescent labels for nucleotides may include, but are not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer (Foster City, Calif.); FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP available from Amersham (Arlington Heights, Ill.); Fluorescein-15-dATP, Fluorescein-12-dUTP, Tetramethyl-rhodamine-6-dUTP, IR770-9-dATP, Fluorescein-12-ddUTP, Fluorescein-12-UTP, and Fluorescein-15-2'-dATP available from Mannheim (Indianapolis, Ind.); and Molecular Examples of chromosomal labeling nucleotides available from Probes (Eugene, Oreg.) include BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, Fluorescein-12-UTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Tetramethylrhodamine-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP.Nucleotide can also be labeled or marked by chemical modification.Chemically modified single nucleotide can be biotin-dNTP.Some non-limiting examples of biotin-labeled dNTP can include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP) and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).

[0121] The terms "polynucleotide", "oligonucleotide", and "nucleic acid" are used interchangeably to generally refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, in either single-stranded, double-stranded, or multiple-stranded form. A polynucleotide may be exogenous or endogenous to a cell. A polynucleotide may be present in a cell-free environment. A polynucleotide may be a gene or a fragment thereof. A polynucleotide may be DNA. A polynucleotide may be RNA. A polynucleotide may have any three-dimensional structure and may perform any function. A polynucleotide may contain one or more analogs (e.g., modified backbones, sugars, or nucleobases). If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. Some non-limiting examples of analogs include 5-bromouracil, peptide nucleic acid, xenonucleic acid, morpholino, locked nucleic acid, glycol nucleic acid, threose nucleic acid, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein attached to the sugar), thiol-containing nucleotides, biotin-linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queousine, and wyosine. Non-limiting examples of polynucleotides include coding or non-coding regions of a gene or gene fragment, loci (locuses) defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, cell-free polynucleotides, including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes, and primers.The sequence of nucleotides may be interrupted by non-nucleotide components.

[0122] The term "transfection" or "transfected" generally refers to the introduction of a nucleic acid into a cell by non-viral or viral-based methods. The nucleic acid molecule may be a genetic sequence that encodes a complete protein or a functional portion thereof. See, e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88, which is incorporated herein by reference in its entirety.

[0123] The terms "peptide", "polypeptide", and "protein" are used interchangeably herein and generally refer to a polymer of at least two amino acid residues linked by one or more peptide bonds. The term does not imply a particular length of the polymer, nor is it intended to imply or distinguish whether the peptide is produced using recombinant techniques, chemical synthesis, or enzymatic synthesis, or whether it is naturally occurring. The term applies to naturally occurring amino acid polymers and to amino acid polymers that include at least one modified amino acid. In some cases, the polymer may be interrupted by non-amino acids. The term includes amino acid chains of any length, including full-length proteins, proteins with or without secondary and / or tertiary structure (e.g., domains). The term also encompasses amino acid polymers that have been modified by any other manipulation, such as, for example, disulfide bond formation, glycosylation, lipid modification, acetylation, phosphorylation, oxidation, and conjugation with a labeling component. As used herein, the term "amino acid" generally refers to natural and non-natural amino acids, including, but not limited to, modified amino acids and amino acid analogs. Modified amino acids may include natural and unnatural amino acids that have been chemically modified to include groups or chemical moieties that do not naturally occur in amino acids. Amino acid analogs may refer to amino acid derivatives. The term "amino acid" includes both D- and L-amino acids.

[0124] As used herein, "non-natural" may generally refer to a nucleic acid or polypeptide sequence that is not found in a natural nucleic acid or protein. Non-natural may refer to an affinity tag. Non-natural may refer to a fusion. Non-natural may refer to a naturally occurring nucleic acid or polypeptide sequence that includes mutations, insertions, and / or deletions. A non-natural sequence may exhibit and / or encode an activity (e.g., an enzyme activity, a methyltransferase activity, an acetyltransferase activity, a kinase activity, an ubiquitination activity, etc.) that may also be exhibited by the nucleic acid and / or polypeptide sequence to which the non-natural sequence is fused. A non-natural nucleic acid sequence or polypeptide sequence may be linked to a naturally occurring nucleic acid sequence or polypeptide sequence (or a variant thereof) by genetic engineering to generate a chimeric nucleic acid sequence and / or a polypeptide sequence that encodes a chimeric nucleic acid and / or polypeptide.

[0125] As used herein, the term "promoter" generally refers to a regulatory DNA region that controls the transcription or expression of a gene and may be adjacent to or overlap the nucleotide or region of nucleotides where RNA transcription begins. A promoter may contain specific DNA sequences that bind protein factors (often called transcription factors) that drive the binding of RNA polymerase to DNA leading to gene transcription. A "basal promoter" (also called a "core promoter") may generally refer to a promoter that contains all the elements that are essentially required to promote the transcriptional expression of an operably linked polynucleotide. Eukaryotic basal promoters typically, but not necessarily, contain a TATA box and / or a CAAT box.

[0126] As used herein, the term "expression" generally refers to the process by which a nucleic acid sequence or polynucleotide is transcribed from a DNA template (such as, for example, an mRNA or other mRNA transcript) and / or the process by which the transcribed RNA is subsequently translated into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide may be collectively referred to as a "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0127] As used herein, "operably linked," "operably coupled," "operably linked," or grammatical equivalents thereof generally refer to the juxtaposition of genetic elements, such as promoters, enhancers, polyadenylation sequences, etc., which are in a relationship that allows them to operate in an expected manner. For example, a regulatory element, which may include a promoter and / or enhancer sequence, is operably linked to a coding region if it helps initiate transcription of the coding sequence. There may be intervening residues between the regulatory element and the coding region, so long as this functional relationship is maintained.

[0128] As used herein, "vector" generally refers to a polymer or an association of polymers that contains or associates with a polynucleotide and can be used to mediate the delivery of the polynucleotide to a cell. Examples of vectors include plasmids, viral vectors, liposomes, and gene delivery vehicles. A vector generally includes a genetic element, such as a regulatory element, that is operatively linked to a gene to drive gene expression in a target.

[0129] As used herein, "expression cassette" and "nucleic acid cassette" are generally used interchangeably to refer to a combination of nucleic acid sequences or elements that are expressed together or that are operably linked for expression. In some cases, an expression cassette refers to a combination of regulatory elements and one or more genes that are operably linked for expression.

[0130] A "functional fragment" of a DNA or protein sequence generally refers to a fragment that retains substantially similar biological activity (either functional or structural) as the biological activity of the full-length DNA or protein sequence. The biological activity of a DNA sequence can be the ability to affect expression in a manner known to be attributed to the full-length sequence.

[0131] As used herein, a "genetically engineered" subject generally indicates that the subject has been modified by human intervention. By way of non-limiting examples, a nucleic acid may be modified by changing its sequence to a non-naturally occurring sequence, a nucleic acid may be modified by linking it to a nucleic acid with which it is not naturally associated such that the linked product retains a function not present in the nucleic acid from which it originates, a genetically engineered nucleic acid may be synthesized in vitro with a non-naturally occurring sequence, a protein may be modified by changing its amino acid sequence to a non-naturally occurring sequence, and a genetically engineered protein may acquire a new function or property. A "genetically engineered" system includes at least one genetically engineered component.

[0132] As used herein, "synthetic" and "artificial" may generally be used interchangeably to refer to proteins or domains thereof that have low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) to naturally occurring human proteins. For example, the VPR and VP64 domains are synthetic transactivation domains.

[0133] As used herein, the term "Cas12a" generally refers to a family of Cas endonucleases that are class 2, VA-type Cas endonucleases that (a) use relatively small guide RNAs (about 42-44 nucleotides) that are processed by the nuclease itself post-transcriptionally from the CRISPR array, and (b) cleave DNA, leaving a staggered cut site. Further characterization of this family of enzymes can be found, for example, in Zetsche B, Heidenreich M, Mohanraju P, et al. Nat Biotechnol 2017;35:31-34, and Zetsche B, Gootenberg JS, Abudayyeh OO, et al. Cell 2015;163:759-771, which are incorporated herein by reference.

[0134] As used herein, a "guide nucleic acid" may generally refer to a nucleic acid that can hybridize to another nucleic acid. A guide nucleic acid may be RNA. A guide nucleic acid may be DNA. A guide nucleic acid may be programmed to bind to a sequence of a nucleic acid in a site-specific manner. A targeted or target nucleic acid may comprise nucleotides. A guide nucleic acid may comprise nucleotides. A portion of a target nucleic acid may be complementary to a portion of a guide nucleic acid. A double-stranded target polynucleotide strand that is complementary to and hybridizes with a guide nucleic acid may be referred to as a complementary strand. A double-stranded target polynucleotide strand that is complementary to a complementary strand and thus may not be complementary to a guide nucleic acid may be referred to as a non-complementary strand. A guide nucleic acid may comprise a polynucleotide strand and may be referred to as a "single guide nucleic acid". A guide nucleic acid may comprise two polynucleotide strands and may be referred to as a "dual guide nucleic acid". Unless otherwise specified, the term "guide nucleic acid" may be an inclusive term and refers to both single and dual guide nucleic acids. A guide nucleic acid may include a segment that may be referred to as a "nucleic acid targeting segment" or a "nucleic acid targeting sequence" or a "spacer sequence." A nucleic acid targeting segment may include a sub-segment that may be referred to as a "protein binding segment" or a "protein binding sequence" or a "Cas protein binding segment."

[0135] The terms "sequence identity" or "percent identity" with respect to two or more nucleic acid or polypeptide sequences generally refer to two (e.g., in a pairwise alignment) or multiple (e.g., a multiple alignment) sequences that have identical or a certain percentage of identical amino acid residues or nucleotides when compared and aligned for maximum matching over a partial or overall comparison window as measured using a sequence comparison algorithm. Suitable sequence comparison algorithms for polypeptide sequences include, for example, BLASTP using parameters of a word length (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting a gap cost of 11, an extension of 1, with an adjustment of the conditional combination scoring matrix for polypeptide sequences longer than 30 residues; BLASTP using parameters of a word length (W) of 2, an expectation (E) of 1,000,000, and a PAM30 scoring matrix setting gap costs of 9 for opening a gap and 1 for extending a gap for sequences of less than 30 residues (these are the default parameters for BLASTP in the BLAST suite available at https: / / blast.ncbi.nlm.nih.gov); CLUSTALW with a Smith-Waterman homology search algorithm with a match of 2, a mismatch of -1, and a gap of -1; MUSCLE with default parameters; MAFFT with parameters of a retree of 2 and a maximum iteration of 1000; Novafold with default parameters; HMMER hmmalign with default parameters.

[0136] The term "optimally aligned" with respect to two or more nucleic acid or polypeptide sequences generally refers to two (e.g., in a pairwise alignment) or multiple (e.g., multiple alignment) sequences aligned for maximum amino acid residue or nucleotide matching, e.g., as determined by an alignment that produces a maximum or "optimized" percent identity score.

[0137] The present disclosure includes variants of any of the enzymes described herein that have one or more conservative amino acid substitutions. Such conservative substitutions can be made in the amino acid sequence of a polypeptide without disrupting the three-dimensional structure or function of the polypeptide. Conservative substitutions can be achieved by substituting amino acids with similar hydrophobicity, polarity and R chain length for each other. Additionally or alternatively, by comparing aligned sequences of homologous proteins from different species, conservative substitutions can be identified by placing amino acid residues that are mutated between species (e.g., non-conserved residues) without denaturing the basic function of the encoded protein. Such conservatively substituted variants include those that are at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least about 115%, at least about 116%, at least about 117%, at least about 118%, at least about 119%, at least about 120%, at least about 121%, at least about 122%, at least about 123%, at least about 124%, at least about 125%, at least about 126%, at least about 127%, at least about 128%, at least about 129%, at least about 130%, at least about 131%, at least about 132%, at least about 133%, at least about 134%, at least about 135%, at least about 136%, at least about 137%, at least about 138%, at least about 139%, at least about 140%, at least about Conservatively substituted variants may include variants having about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity with the endonuclease (e.g., MG11, MG13, MG26, MG28, MG29, MG30, MG31, MG32, MG37, MG53, MG54, MG55, MG56, MG57, MG58, MG59, MG60, MG61, MG62, MG70, MG82, MG83, MG84, or MG85 family endonucleases described herein, or any other family nuclease described herein). In some embodiments, such conservatively substituted variants are functional variants. Such functional variants may include sequences having substitutions of one or more critical active site residues or guide RNA binding residues such that the activity of the endonuclease is not destroyed.In some embodiments, a functional variant of any of the proteins described herein lacks at least one conserved or functional residue called out in Figure 17, Figure 18, Figure 10, Figure 20, or Figure 25, or a substitution of a residue set out in Table IB. In some embodiments, a functional variant of any of the proteins described herein lacks all of the conserved or functional residues called out in Figure 17, Figure 18, Figure 10, Figure 20, or Figure 25, or a substitution of a residue set out in Table IB.

[0138] The disclosure also includes variants of any of the enzymes described herein (e.g., reduced activity variants) having substitutions of one or more catalytic residues that reduce or eliminate activity of the enzyme. In some embodiments, reduced activity variants such as the proteins described herein include disruptive substitutions of at least one, at least two, or all three catalytic residues identified in Table 1B.

[0139] Conservative substitution tables providing functionally similar amino acids are available in a variety of references (see, for example, Creighton, Proteins: Structures and Molecular Properties (WH Freeman & Co.; 2nd edition (December 1993)). Each of the following eight groups contains amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) Cysteine ​​(C), Methionine (M)

[0140] overview The discovery of novel Cas enzymes with unique functionality and structure could offer the potential to further disrupt deoxyribonucleic acid (DNA) editing technology, improving speed, specificity, functionality, and ease of use. Given the expected prevalence of microbial clustered regularly interspaced short palindromic repeats (CRISPR) systems, and the wide variety of microbial species, relatively functionally characterized CRISPR / Cas enzymes are largely absent from the literature. This is in part because the vast number of microbial species may not be easily cultured in laboratory conditions. Metagenomic sequencing from natural environmental niches containing a large number of microbial species could dramatically increase the number of known novel CRISPR / Cas systems, offering the potential to accelerate the discovery of novel oligonucleotide editing functionality. A recent example of the utility of such an approach is demonstrated by the discovery of a CasX / CasY CRISPR system from a metagenomic analysis of a natural microbial community in 2016.

[0141] CRISPR / Cas systems are RNA-dependent nuclease complexes that have been described to function as adaptive immune systems in microorganisms. Typically, CRISPR / Cas systems occur in CRISPR (clustered regularly interspaced short palindromic repeats) operons or loci. It generally contains two parts: (i) an array of short repeat sequences (30-40 bp) separated by equally short spacer sequences that encode the RNA-based targeting element, and (ii) an ORF that encodes the Cas, which encodes the nuclease polypeptide directed by the RNA-based targeting element in addition to accessory proteins / enzymes. An effective nuclease targeting a specific target nucleic acid sequence generally requires both (i) complementary hybridization between the first 6-8 nucleic acids of the target (targeting seed) and the crRNA guide, and (ii) the presence of a protospacer adjacent motif (PAM) sequence within the vicinity of the defined targeting seed (PAMs are generally not represented in the host genome). Depending on the exact function and composition of the system, CRISPR-Cas systems are commonly organized into two classes, five types, and 16 subtypes based on shared functional properties and evolutionary similarities (see Figure 1).

[0142] Class I CRISPR-Cas systems have large multi-subunit effector complexes and include Types I, III, and IV. Class II CRISPR-Cas systems generally have single polypeptide multi-domain nuclease effectors and include Types II, V, and VI.

[0143] Type II CRISPR-Cas systems are considered the simplest in terms of components. In type II CRISPR-Cas systems, processing of the mature crRNA of the CRISPR array does not require the presence of a special endonuclease subunit, but rather a small transcoding crRNA (tracrRNA) that has a region complementary to the array repeat sequence. This tracrRNA interacts with both the corresponding effector nuclease (e.g., Cas9) and the repeat sequence to form a precursor dsRNA structure. This structure is cleaved with endogenous ribonuclease III to generate the mature effector enzyme with both tracrRNA and crRNA added. CasII nucleases are known as DNA nucleases. Type II effectors generally display a structure consisting of a RuvC-like endonuclease domain incorporating a ribonuclease H-fold with an unrelated HNH nuclease domain inserted within the fold of the RuvC-like nuclease domain. The RuvC-like domain is responsible for cleavage of the target (e.g., complementary to the crRNA) DNA strand, whereas the HNH domain is responsible for cleavage of the displaced DNA strand.

[0144] Type V CRISPR-Cas systems are characterized by a nuclease effector (e.g., Cas12) structure similar to type II effectors, including a RuvC-like domain. Like type II, most (but not all) type V CRISPR systems use tracrRNA to process pre-crRNA into mature crRNA. However, unlike type II systems that require RNase III to cleave this pre-crRNA into multiple crRNAs, type V systems are capable of using the effector nuclease itself to cleave the pre-crRNA. Like type II CRISPR-Cas systems, type V CRISPR-Cas systems are also known as DNA nucleases. Unlike type II CRISPR-Cas systems, some type V enzymes (e.g., Cas12a) have been shown to have potent single-stranded non-specific deoxyribonuclease activity that is activated by the first crRNA-specific cleavage of the double-stranded target sequence.

[0145] CRISPR-Cas systems have emerged in recent years as the gene editing technology of choice for their targeting capabilities and ease of use. The most commonly used systems are class 2 type II SpCas9 and class 2 type VA Cas12a (previously Cpf1). VA systems in particular are becoming more widely used due to their reported higher specificity in cells than other nucleases and fewer or no off-target effects. VA systems also have smaller guide RNAs (42-44 nucleotides compared to approximately 100 nt for SpCas9) that are processed by the nuclease itself after transcription by the CRISPR array, simplifying multiplex applications involving multiple gene editing. Furthermore, VA systems have a staggered cut site, which drives dependent repair pathways such as microhomology-dependent targeted integration (MITI).

[0146] The most commonly used type VA enzymes require a 5' protospacer adjacent motif (PAM) adjacent to the selected target site, 5'-TTTV-3' (for Lachnospira bacterium ND2006 (LbCas12a) and Acidaminococcus species (AsCas12a)) and 5'-TTV-3' (for Francisella novicida (FnCas12a)). Recent surveys of orthologs have revealed proteins with less restrictive PAM sequences that are also active in mammalian cell cultures (e.g., YTV, YYN or TTN). However, these enzymes do not fully encompass VA biodiversity and targeting capabilities and may not represent all possible capabilities and requirements for PAM sequences. Here, we retrieved thousands of genomic fragments from a large metagenome of type VA nucleases. The known diversity of VA enzymes may be expanded and novel systems may be developed into highly targetable, compact and precise gene editing drugs.

[0147] MG enzyme VA-type CRISPR systems are rapidly being adopted for use in a variety of genome editing applications. These programmable nucleases are part of the microbial adaptive immune system, and their natural diversity remains largely unexplored. A novel family of VA-type CRISPR enzymes was identified through large-scale analysis of metagenomics collected from various complex environments, and representatives of these systems have been developed into gene editing platforms. The nucleases are phylogenetically diverse (see Figure 4A) and recognize single guide RNAs with specific motifs. The majority of these systems are derived from uncultured organisms, some of which encode different V-type effectors within the same CRISPR operon. Biochemical analysis revealed unexpected PAM diversity (see Figure 4B), indicating that these systems will advance a variety of genome editing applications. The simplicity of the guide sequences and activity in human cell lines suggest utility in gene and cell therapy.

[0148] In some embodiments, the present disclosure provides novel VL type candidates (see FIG. 27). The VL type may be a novel subtype, and several subtypes may be identified. These nucleases are about 1000-1100 amino acids long. The VL type may be found in the same CRISPR locus as the VA type effectors. For the VL candidates, RuvC catalytic residues may be identified, and these VL type candidates may not require tracrRNA. An example of a VL type is the MG60 nuclease described herein (see FIG. 28 and FIG. 32).

[0149] In some embodiments, the present disclosure provides smaller V-shaped effectors (see FIG. 30). Such effectors may be small putative effectors. These effectors may simplify delivery and expand therapeutic applications.

[0150] In some embodiments, the present disclosure provides a novel V-type effector. Such an effector can be MG70 as described herein (see FIG. 29). MG70 can be an ultra-small enzyme about 373 amino acids long. MG70 can have a single transposase domain at the N-terminus and a predicted tracrRNA (see FIG. 30 and FIG. 32).

[0151] In some embodiments, the present disclosure provides smaller V-type effectors (see FIG. 31). Such effectors can be MG81, as described herein. MG81 can be about 500-700 amino acids long and can contain RuvC and HTH DNA binding domains.

[0152] In one aspect, the present disclosure provides engineered nuclease systems discovered by metagenomic sequencing. In some cases, metagenomic sequencing is performed on a sample. In some cases, the sample can be collected from a variety of environments. Such environments can be human microbiomes, animal microbiomes, hot environments, cold environments. Such environments can include sediments. Examples of the types of environments for the engineered nuclease systems described herein can be found in FIG. 2.

[0153] In one aspect, the disclosure provides an engineered nuclease system comprising (a) an endonuclease. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a class 2 type V Cas endonuclease. In some cases, the endonuclease is a class 2 type VA Cas endonuclease. In some cases, the endonuclease is derived from an uncultured microorganism. The endonuclease may comprise a RuvC domain. In some cases, the engineered nuclease system comprises (b) an engineered guide RNA. In some cases, the engineered guide RNA is configured to form a complex with the endonuclease. In some cases, the engineered guide RNA comprises a spacer sequence. In some cases, the spacer sequence is configured to hybridize to a target nucleic acid sequence.

[0154] In one aspect, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease. In some cases, the endonuclease has at least about 70% sequence identity to any one of SEQ ID NOs: 1-3470. In some cases, the endonuclease has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 1-3470.

[0155] In some cases, the endonuclease comprises a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of SEQ ID NOs: 1-3470. In some cases, the endonuclease can be substantially identical to any one of SEQ ID NOs: 1-3470.

[0156] In some cases, the engineered nuclease system comprises an engineered guide RNA. In some cases, the engineered guide RNA is configured to form a complex with an endonuclease. In some cases, the engineered guide RNA comprises a spacer sequence. In some cases, the spacer sequence is configured to hybridize to a target nucleic acid sequence.

[0157] In one aspect, the disclosure provides an engineered nuclease system comprising (a) an endonuclease. In some cases, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence. In some cases, the PAM sequence is substantially identical to any one of SEQ ID NOs: 3863-3913. In some cases, the PAM sequence is any one of SEQ ID NOs: 3863-3913. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a class 2 Cas endonuclease. In some cases, the endonuclease is a class 2 type V Cas endonuclease. In some cases, the endonuclease is a class 2 type VA Cas endonuclease. In some cases, the engineered nuclease system comprises (b) an engineered guide RNA. In some cases, the engineered guide RNA is configured to form a complex with the endonuclease. In some cases, the engineered guide RNA comprises a spacer sequence. In some cases, the spacer sequence is configured to hybridize to a target nucleic acid sequence.

[0158] In some cases, the endonuclease is not a Cpf1 or Cms1 endonuclease. In some cases, the endonuclease further comprises a zinc finger-like domain.

[0159] In some cases, the guide RNA comprises a sequence having at least 80% sequence identity to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857. In some cases, the guide RNA is at least about 20% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857. Also includes sequences having about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity.In some cases, the guide RNA has at least about 20% to at least about the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857. This includes variants having 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity. In some cases, the guide RNA comprises a sequence that is substantially identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857.

[0160] In some cases, the guide RNA is at least about 20% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, or 3851-3857. or at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity. In some cases, the endonuclease is configured to bind to the engineered guide RNA. In some cases, the Cas endonuclease is configured to bind to the engineered guide RNA. In some cases, the class 2 Cas endonuclease is configured to bind to the engineered guide RNA. In some cases, the class 2 V-type Cas endonuclease is configured to bind to the engineered guide RNA. In some cases, class 2 VA-type Cas endonucleases are configured to bind to engineered guide RNAs.

[0161] In some cases, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 3863-3913.

[0162] In some cases, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a eukaryotic, fungal, plant, mammalian or human genome. In some cases, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a eukaryotic genome. In some cases, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a fungal genome. In some cases, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a plant genome. In some cases, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a mammalian genome. In some cases, the guide RNA comprises a sequence complementary to a polynucleotide sequence of a human genome.

[0163] In some cases, the guide RNA is between 30 and 250 nucleotides in length. In some cases, the guide RNA is between 42 and 44 nucleotides in length. In some cases, the guide RNA is 42 nucleotides in length. In some cases, the guide RNA is 43 nucleotides in length. In some cases, the guide RNA is 44 nucleotides in length. In some cases, the guide RNA is between 85 and 245 nucleotides in length. In some cases, the guide RNA is more than 90 nucleotides in length. In some cases, the guide RNA is less than 245 nucleotides in length.

[0164] In some cases, the endonuclease may include a variant having one or more nuclear localization sequences (NLS). The NLS may be near the N-terminus or C-terminus of the endonuclease. The NLS may be added to the N-terminus or C-terminus of any one of SEQ ID NOs: 3938-3953, or a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 3938-3953. In some cases, the NLS can comprise a sequence substantially identical to any one of SEQ ID NOs: 3938-3953.

[0165] [Table 1]

[0166] In some cases, the engineered nuclease system further comprises a single-stranded or double-stranded DNA repair template. In some cases, the engineered nuclease system further comprises a single-stranded DNA repair template. In some cases, the engineered nuclease system further comprises a double-stranded DNA repair template. In some cases, the single-stranded or double-stranded DNA repair template may further comprise a first homology arm comprising a sequence of at least 20 nucleotides 5' to 3', i.e., 5' to the target deoxyribonucleic acid sequence, a synthetic DNA sequence of at least 10 nucleotides, and a second homology arm comprising a sequence of at least 20 nucleotides 3' to the target sequence.

[0167] In some cases, the first homology arm comprises a sequence of at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 175, at least 200, at least 250, at least 300, at least 400, at least 500, at least 750, or at least 1000 nucleotides. In some cases, the second homology arm comprises a sequence of at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 175, at least 200, at least 250, at least 300, at least 400, at least 500, at least 750, or at least 1000 nucleotides.

[0168] In some cases, the first homology arm or the second homology arm is homologous to a prokaryotic genomic sequence. In some cases, the first homology arm or the second homology arm is homologous to a bacterial genomic sequence. In some cases, the first homology arm or the second homology arm is homologous to a fungal genomic sequence. In some cases, the first homology arm or the second homology arm is homologous to a eukaryotic genomic sequence.

[0169] In some cases, the engineered nuclease system further comprises a DNA repair template. The DNA repair template may comprise a double-stranded DNA segment. The double-stranded DNA segment may be adjacent to one single-stranded DNA segment. The double-stranded DNA segment may be adjacent to two single-stranded DNA segments. In some cases, the single-stranded DNA segment is conjugated to the 5' end of the double-stranded DNA segment. In some cases, the single-stranded DNA segment is conjugated to the 3' end of the double-stranded DNA segment.

[0170] In some cases, the single stranded DNA segment has a length of 1-15 nucleotide bases. In some cases, the single stranded DNA segment has a length of 4-10 nucleotide bases. In some cases, the single stranded DNA segment has a length of 4 nucleotide bases. In some cases, the single stranded DNA segment has a length of 5 nucleotide bases. In some cases, the single stranded DNA segment has a length of 6 nucleotide bases. In some cases, the single stranded DNA segment has a length of 7 nucleotide bases. In some cases, the single stranded DNA segment has a length of 8 nucleotide bases. In some cases, the single stranded DNA segment has a length of 9 nucleotide bases. In some cases, the single stranded DNA segment has a length of 10 nucleotide bases.

[0171] In some cases, the single-stranded DNA segment has a nucleotide sequence complementary to a sequence within the spacer sequence. In some cases, the double-stranded DNA sequence comprises a barcode, an open reading frame, an enhancer, a promoter, a protein coding sequence, an miRNA coding sequence, an RNA coding sequence, or a transgene.

[0172] In some cases, engineered nuclease systems have been 2+ The present invention further includes a source of.

[0173] In some cases, the guide RNA comprises a hairpin that comprises at least 8 base pairs of ribonucleotides. In some cases, the guide RNA comprises a hairpin that comprises at least 9 base pairs of ribonucleotides. In some cases, the guide RNA comprises a hairpin that comprises at least 10 base pairs of ribonucleotides. In some cases, the guide RNA comprises a hairpin that comprises at least 11 base pairs of ribonucleotides. In some cases, the guide RNA comprises a hairpin that comprises at least 12 base pairs of ribonucleotides.

[0174] In some cases, the endonuclease comprises a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, a sequence at least 70% identical to a variant of 141, 215, 229, 261, or 1711-1721, or a variant thereof. In some cases, the endonuclease comprises a sequence at least 75% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof. In some cases, the endonuclease comprises a sequence at least 80% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof. In some cases, the endonuclease comprises a sequence at least 85% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof. In some cases, the endonuclease comprises a sequence at least 90% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof. In some cases, the endonuclease comprises a sequence at least 95% identical to a variant of any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof.

[0175] In some cases, the guide RNA structure comprises a sequence that is at least 70% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence that is at least 75% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence that is at least 80% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence that is at least 85% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence that is at least 90% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the guide RNA structure comprises a sequence that is at least 95% identical to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO: 3608. In some cases, the endonuclease is configured to bind to a PAM that comprises any one of SEQ ID NOs: 3863-3913.

[0176] In some cases, sequences may be determined by the BLASTP, CLUSTALW, MUSCLE, or MAFFT algorithms using Smith-Waterman homology search algorithm parameters, or the CLUSTALW algorithm. Sequence identity may be determined by the BLASTP homology search algorithm using parameters of word length (W) of 3, expectation (E) of 10, and a BLOSUM62 scoring matrix setting the occurrence of 11, gap cost at extension of 1, and using an adjustment of the conditional combination scoring matrix.

[0177] In one aspect, the disclosure provides an engineered guide RNA comprising (a) a DNA targeting segment. In some cases, the DNA targeting segment comprises a nucleotide sequence that is complementary to a target sequence. In some cases, the target sequence is in a target DNA molecule. In some cases, the engineered guide RNA comprises (b) a protein-binding segment. In some cases, the protein-binding segment comprises two complementary sequences of nucleotides. In some cases, the two complementary sequences of nucleotides hybridize to form a double-stranded RNA (dsRNA) duplex. In some cases, the two complementary sequences of nucleotides are covalently linked to each other with an intervening nucleotide. In some cases, the engineered guide ribonucleic acid polynucleotide can form a complex with an endonuclease. In some cases, the endonuclease has at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 1-3470. In some cases, the complex targets a target sequence of a target DNA molecule.

[0178] In some cases, the DNA targeting segment is located 3' of both of the two complementary sequences of nucleotides. In some cases, the protein binding segment comprises a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the first 19 nucleotides or non-degenerate nucleotides of SEQ ID NO:3608.

[0179] In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 8 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 9 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 10 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 11 ribonucleotides. In some cases, the double-stranded RNA (dsRNA) duplex comprises at least 12 ribonucleotides.

[0180] In some cases, the deoxyribonucleic acid polynucleotide encodes an engineered guide ribonucleic acid polynucleotide.

[0181] In one aspect, the disclosure provides a nucleic acid comprising an engineered nucleic acid sequence. In some cases, the engineered nucleic acid sequence is optimized for expression in an organism. In some cases, the nucleic acid encodes an endonuclease. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a class 2 endonuclease. In some cases, the endonuclease is a class 2 type V Cas endonuclease. In some cases, the endonuclease is a class 2 type VA Cas endonuclease. In some cases, the endonuclease is from an uncultured microorganism. In some cases, the organism is not an uncultured organism.

[0182] In some cases, the endonuclease comprises a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to any one of SEQ ID NOs: 1-3470.

[0183] In some cases, the endonuclease may include a variant having one or more nuclear localization sequences (NLS). The NLS may be near the N-terminus or C-terminus of the endonuclease. The NLS may be added to the N-terminus or C-terminus of any one of SEQ ID NOs: 3938-3953 or a variant having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 3938-3953.

[0184] In some cases, the organism is a prokaryote. In some cases, the organism is a bacterium. In some cases, the organism is a eukaryote. In some cases, the organism is a fungus. In some cases, the organism is a plant. In some cases, the organism is a mammal. In some cases, the organism is a rodent. In some cases, the organism is a human.

[0185] In one aspect, the disclosure provides a genetically engineered vector. In some cases, the genetically engineered vector comprises a nucleic acid sequence encoding an endonuclease. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a class 2 Cas endonuclease. In some cases, the endonuclease is a class 2 type V Cas endonuclease. In some cases, the endonuclease is a class 2 type VA Cas endonuclease. In some cases, the endonuclease is derived from an uncultured microorganism.

[0186] In some cases, the engineered vector comprises a nucleic acid described herein. In some cases, the nucleic acid described herein is a deoxyribonucleic acid polynucleotide described herein. In some cases, the vector is a plasmid, a minicircle, a CELiD, a viral particle derived from an adeno-associated virus (AAV), or a lentivirus.

[0187] In one aspect, the disclosure provides a cell comprising the vector described herein.

[0188] In one aspect, the disclosure provides a method of producing an endonuclease. In some cases, the method includes culturing a cell.

[0189] In one aspect, the disclosure provides a method for binding, cleaving, marking or modifying a double-stranded deoxyribonucleic acid polynucleotide. The method may include contacting the double-stranded deoxyribonucleic acid polynucleotide with an endonuclease. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a class 2 Cas endonuclease. In some cases, the endonuclease is a class 2 type V Cas endonuclease. In some cases, the endonuclease is a class 2 type VA Cas endonuclease. In some cases, the endonuclease is in a complex that includes an engineered guide RNA. In some cases, the engineered guide RNA is configured to bind to the endonuclease. In some cases, the engineered guide RNA is configured to bind to the double-stranded deoxyribonucleic acid polynucleotide. In some cases, the engineered guide RNA is configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide. In some cases, the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM). In some cases, the PAM comprises a sequence comprising any one of SEQ ID NOs: 3863-3913.

[0190] In some cases, the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide RNA and a second strand comprising a PAM. In some cases, the PAM is immediately adjacent to the 5' end of the sequence complementary to a sequence of the engineered guide RNA. In some cases, the endonuclease is not Cpf1 endonuclease or Cms1 endonuclease. In some cases, the endonuclease is from an uncultured microorganism. In some cases, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. In some cases, the PAM sequence comprises any one of SEQ ID NOs: 3863-3913.

[0191] In one aspect, the present disclosure provides a method of modifying a target nucleic acid locus. The method may include delivering an engineered nuclease system as described herein to a target nucleic acid locus. In some cases, the endonuclease is configured to form a complex with an engineered guide ribonucleic acid structure. In some cases, the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies the target nucleic acid locus.

[0192] In some cases, modifying the target nucleic acid locus includes binding the target nucleic acid locus, nicking the target nucleic acid locus, cleaving the target nucleic acid locus, or marking the target nucleic acid locus. In some cases, the target nucleic acid locus includes deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some cases, the target nucleic acid includes genomic DNA, viral DNA, viral RNA, or bacterial DNA. In some cases, the target nucleic acid locus is in vitro. In some cases, the target nucleic acid locus is within a cell. In some cases, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell.

[0193] In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid as described herein or a vector as described herein. In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding an endonuclease. In some cases, the nucleic acid comprises a promoter. In some cases, the open reading frame encoding the endonuclease is operably linked to a promoter.

[0194] In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing an open reading frame encoding an endonuclease. In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some cases, delivery of the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding an engineered guide RNA operably linked to a ribonucleic acid (RNA) pol III promoter.

[0195] In some cases, the endonuclease induces a single-stranded or double-stranded break at or near the target locus, in some cases, the endonuclease induces a staggered single-stranded break within or 3' to the target locus.

[0196] In some cases, effector repeat motifs are used to inform the guide design of the MG nuclease. For example, the processed gRNA of a type VA system consists of the final 20-22 nucleotides of the CRISPR repeat. This sequence may be synthesized into a crRNA (along with a spacer) and tested in vitro with the synthesized nuclease to cleave on a library of possible targets. Using this method, the PAM may be determined. In some cases, type VA enzymes may use a "universal" gRNA. In some cases, type V enzymes may require a unique gRNA.

[0197] The disclosed system can be used for various applications, such as editing nucleic acids (e.g., gene editing), binding to nucleic acid molecules (e.g., sequence-specific binding), etc. Such systems can be used, for example, to address (e.g., remove or replace) genetically inherited mutations that may cause disease in subjects, and to inactivate genes to confirm their function in cells. They can also be used as diagnostic tools to detect genetic elements caused by disease (e.g., by cleavage of reverse transcribed viral RNA or amplified DNA sequences that code for disease-causing mutations), as inactivating enzymes combined with probes to target and detect specific nucleotide sequences (e.g., sequences that code for microbial resistance to bacteria). They can also be used to inactivate viruses by targeting viral genomes or to render them unable to infect host cells, to add genes or modify metabolic pathways, to engineer organisms to produce useful small molecules, macromolecules, or secondary metabolites, to establish gene drive elements for evolutionary selection, and as biosensors to detect cellular perturbations by exogenous small molecules and nucleotides. EXAMPLES

[0198] Example 1 Methods of metagenomic analysis for novel proteins Metagenomic samples were collected from sediments, soils, and animals. Deoxyribonucleic acid (DNA) was extracted using Zymobiomics DNA Miniprep Kit and sequenced on an Illumina HiSeq® 2500. Samples were collected with the consent of the landowners. A hidden Markov model generated based on known Cas protein sequences, including class II type V Cas effector proteins, was used to search the metagenomic sequence data and identify novel Cas effectors (see Figure 2, which shows the distribution of proteins detected in MG29, one family identified from sample types such as hyperthermia samples). The novel effector proteins identified by this search were aligned to known proteins to identify possible active sites (see Figure 3, which shows that all MG29 family effectors identified from various samples have three catalytic residues derived from the RuvCI, RuvCII, and RuvCIII catalytic domains and are predicted to be active). This metagenomic workflow resulted in diagrams of the MG11, MG13, MG19, MG20, MG26, MG28, MG29, MG30, MG31, MG32, MG37, MG53, MG54, MG55, MG56, MG57, MG58, MG59, MG60, MG61, MG62, MG70, MG75, MG77, MG78, MG79, MG80, MG81, MG82, MG83, MG84, MG85, MG90, and MG91 families described herein. Putative spacer sequences were identified by their location adjacent to genomic loci encoding effector proteins.

[0199] Example 2 Methods of metagenomic analysis for novel proteins Thirteen animal microbiome, hot biofilm and sediment samples were collected and stored on ice or in Zymo DNA / RNA Shield after collection. DNA was extracted from samples using either Qiagen DNeasy PowerSoil kit or ZymoBIOMICS DNA miniprep kit. DNA sequencing libraries were constructed and sequenced on Illumina HiSeq 4000 or Novaseq instruments at the Vincent J. Coates Genomics Sequencing Laboratory at UC Berkeley using paired 150 bp reads with target insert sizes of 400-800 bp (targeting 10 GB of sequencing per sample). Publicly available metagenomic sequencing data was downloaded from NCBI SRA. Sequencing reads were trimmed using BBMap (Bushnell B., sourceforge.net / projects / bbmap / ) and assembled using Megahit 11. Open reading frames and protein sequences were predicted using Prodigal. We generated HMM profiles of known VA-type CRISPR nucleases and searched this against all predicted proteins using HMMER3 (hmmer.org) to identify possible effectors. CRISPR arrays on assembled contigs were predicted using Minced (https: / / github.com / ctSkennerton / minced). We used Kaiju to assign proteins to classes and determined contig classes by finding matches for all encoded proteins.

[0200] MAFFT was used to align predicted type V effector proteins and reference (e.g., LbCas12a, AsCas12a, FnCas12a) effector proteins, and FasTree2 was used to infer phylogenetic lineages. Phylogenetic clusters composed of sequences recovered from this study were identified to represent novel families. In a manner that samples as much phylogenetic diversity as possible from within the family, candidates were selected if they contained components necessary for laboratory analysis (i.e., we found them in contigs that were well assembled and annotated using CRISPR arrays). Small effectors from diverse families were prioritized (i.e., families with representatives that share extensive protein sequence). To identify catalytic and PAM-interacting residues, MUSCLE and Clustal W were used to align selected representatives and reference sequences. CRISPR array repeats were searched for motifs related to the type V-A system, TCTAC-N-GTAGA (containing 1-8 N residues). From this analysis, if a representative CRISPR array contained one of these motif sequences, the family was putatively classified as VA. This dataset was used to identify HMM profiles associated with VA families that were then used to further classify the family (see Figures 33-37). Although it is customary to name novel Cas12 nucleases based on the organism they encode, this is not possible for the nucleases described herein. Therefore, in order to best follow convention, the system described herein is named with the prefix MG to indicate that the system is derived from assembled metagenomic fragments.

[0201] We retrieved 140,867 Mbp of assembled metagenomic sequencing data from diverse environments (soil microbiome, thermophilic microbiome, sediment microbiome, human microbiome, and non-human microbiome). In total, 119 genomic fragments encoded CRISPR effectors distantly related to VA-type nucleases flanking the CRISPR array (see Figure 4B). We classified the VA-type effectors into 14 novel families with average pairwise amino acid identity of less than 30% with each other and with reference sequences (e.g., LbCas12a, AsCas12a, FnCas12a). Several effectors contained the RuvC and α-helical recognition domains, as well as conserved DED nuclease catalytic residues from the RuvCI / CII / CIII domains (identified in multiple sequence alignments, see, e.g., Table 1A below), suggesting that such effectors are active nucleases (Figures 5-7). The novel VA-type nucleases ranged in size from less than 800 to 1,400 amino acids long (Figure 5A), and their classification spanned a diverse array of phyla (Figure 4A), suggesting possible horizontal transfer.

[0202] Some genomic fragments carrying VA-type CRISPR systems also encoded a second effector, also referred to here as VA-type prime (V-A', Figure 7A). For example, V-A'-type MG26-2 shares only 16.6% amino acid identity with VA-type MG26-1, but encodes it in the same CRISPR Cas operon and may share the same crRNA as MG26-1 (Figure 7B). Although no nuclease domain was predicted, MG26-2 contained three RuvC catalytic residues identified by multiple sequence alignment (Figure 7B).

[0203] [Table 2-1]

[0204] [Table 2-2]

[0205] Example 3 (General Protocol) Identification / Confirmation of PAM Sequence PAM sequences that can be cleaved in vitro by CRISPR effectors were identified by incubating a plasmid library with crRNA and eight randomized nucleotides located adjacent to the 5' end of a sequence complementary to the spacer of the crRNA. If the eight randomized nucleotides form a functional PAM sequence, the plasmid is cleaved. Functional PAM sequences were then identified by attaching adapters to the ends of the cleaved plasmids, followed by sequencing of DNA fragments containing the adapters. Putative endonucleases were expressed in an E. coli lysate-based expression system (myTXTL, Arbor Biosciences). E. coli codon-optimized nucleotide sequences encoding putative nucleases were transcribed under the control of a T7 promoter and translated in vitro from the PCR fragments. A second PCR fragment carrying a T7 promoter followed by a minimal CRISPR array composed of a repeat-spacer-repeat sequence was transcribed in the same reaction. Successful expression of the endonuclease and repeat-spacer-repeat sequences, followed by CRISPR array processing, provided a CRISPR nuclease complex that was active in vitro.

[0206] A library of target plasmids containing spacer sequences matching the plasmids in the minimal array preceded by 8N (degenerate) bases (possible PAM sequences) was incubated with the TXTL reaction results. After 1-3 hours, the reaction was stopped and the DNA was recovered by a DNA clean-up kit (e.g., Zymo DCC, AMPure XP beads, QiaQuick, etc.). The active PAM sequence cleaved with an endonuclease was used to ligate the adapter sequence to the DNA fragments with blunt ends, while the uncleaved DNA was inaccessible for ligation. DNA segments containing the active PAM sequence were then amplified by PCR using primers specific for the library and the adapter sequence. The PCR amplification products were resolved on a gel and amplicons corresponding to the cleavage event were identified. Amplified segments of the cleavage reaction were also used as templates for the preparation of NGS libraries or as substrates for Sanger sequencing. The resulting libraries, a subset of the starting 8N library, were sequenced to reveal sequences with PAM activity compatible with the CRISPR complex. For PAM testing with processed RNA constructs, the same procedure was repeated except that in vitro transcribed RNA was added along with the plasmid library and the minimal CRISPR array template was omitted. The following sequences were used as targets in these assays: CGTGAGCCACCACGTCGCAAGCCT (SEQ ID NO: 3860); GTCGAGGCTTGCGACGTGGTGGCT (SEQ ID NO: 3861); GTCGAGGCTTGCGACGTGGTGGCT (SEQ ID NO: 3858); and TGGAGATATCTTGAACCTTGCATC (sequence number 3859).

[0207] Example 4 Identification / confirmation of PAM sequences for endonucleases described herein PAM requirements were determined using a modified E. coli lysate-based expression system (myTXTL, Arbor Biosciences). Briefly, E. coli codon-optimized effector protein sequences were expressed under the control of a T7 promoter for 16 hours at 29°C. The crude protein pool was then used in an in vitro digestion reaction at a concentration of 20% of the final reaction volume. The reaction was incubated for 3 hours at 37°C with 5 nM of a plasmid library consisting of a constant target sequence preceded by 8N mixed bases, and 50 nM of in vitro transcribed crRNA derived from the same CRISPR locus as the effector linked to a sequence complementary to the target sequence in NEB buffer 2.1 (New England Biolab; NEB buffer 2.1 was chosen to compare candidates with commercially available proteins). Protein concentrations were not normalized in the PAM discovery assay (PCR amplification signals provide high sensitivity to low expression or activity). Cleavage products from the TXTL reaction were recovered by cleanup with AMPure SPRI beads (Beckman Coulter). DNA was blunt-ended by adding Klenow fragment and dNTPs (New England Biolab). Blunt-ended products were ligated using 100-fold excess of double-stranded adapter sequences and used as templates for preparation of NGS libraries, from which PAM requirements were determined.

[0208] Raw NGS reads were filtered for Phred quality scores >20. To find the PAM-proximal region, 28 bp representing known DNA sequence from the backbone adjacent to the PAM was used as a reference, and 8 bp adjacent portions were identified as putative PAMs. For each read, the distance between the PAM and the bound adapter was also measured. Reads that did not have a perfect match to the reference or adapter sequence were excluded. PAM sequences were filtered by cleavage site frequency so that only PAMs with the most frequent cleavage site ±2 bp were included in the analysis. This correction removed low levels of background cleavage that could occur at random positions due to the use of crude E. coli lysates. This filtering step can remove 2%-40% of the reads depending on the signal-to-noise ratio of the candidate protein. In this case, less active proteins have more background signal. For the reference MG29-1, 2% of the reads were filtered in this step. The filtered list of PAMs was used to generate sequence profiles using Logomaker. Sequence logo tables of these PAMs are shown in Figures 20-24.

[0209] Example 5 tracrRNA prediction and guide design The crystal structure of the ternary complex of AacC2c1 (Cas12b) bound to sgRNA and target DNA reveals two distinct repeat-anti-repeat (R-AR) duplexes of the bound sgRNA, denoted R-AR duplex 1 and R-AR duplex 2 (see Figures 8 and 9 herein and Yang, Hui, Pu Gao, Kanagalaghatta R. Rajashankar, and Dinshaw J. Patel. 2016. "PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease." Cell 167(7):1814-28.e12 and Liu, Liang, Peng Chen, Min Wang, Xueyan Li, Jiuyu Wang, Maolu Yin, and Yanli Wang. 2017. "C2c1-sgRNA Complex Structure Reveals RNA-Guided DNA Cleavage Mechanism.'' Molecular Cell 65(2):310-22, each of which is incorporated herein by reference in its entirety. Putative tracrRNA sequences for the CRISPR effectors disclosed herein were identified by searching for anti-repeat sequences in the genomic context surrounding the native CRISPR array. In this case, the R-AR duplex 2 anti-repeat sequence is located approximately 20-90 nucleotides upstream of (closer to the 5' end of) the R-AR duplex 1 anti-repeat sequence. After identification of the tracrRNA sequences, two guide sequences were designed for each enzyme. The first guide sequence included both R-AR duplex 1 and 2 (see, e.g., SEQ ID NOs: 3636, 3640, 3644, 3648, 3652, 3656, 3660, 3671, and 3672), and the second guide sequence was a shorter guide sequence that deleted the R-AR duplex 1 region (e.g., SEQ ID NOs: 3637, 3641, 3645, 3649, 3653, 3657, and 3661) as this region may not be essential for cleavage.

[0210] Example 6 Protocol for predicted RNA folding The method of Andronescu 2007, which is incorporated herein by reference in its entirety, was used to calculate predicted RNA folding of the RNA sequences at 37°C.

[0211] Example 7 Identification of RNA guides For contigs encoding VA-type effectors and CRISPR arrays, secondary structure folding of the repeats indicated that the novel VA-type system requires a single-guide crRNA (sgRNA, Figure 10). The tracrRNA sequence could not be predicted with certainty. The sgRNA contained approximately 19-22 nt from the 3' end of the CRISPR repeat. Multiple sequence alignment of the CRISPR repeats from six VA-type candidates tested for in vitro activity shows a highly conserved motif at the 3' end of the repeat that forms a stem-loop structure of the sgRNA (Figure 10C). This motif (UCUAC[N3-5]GUAGAU) consists of short palindromic repeats (stem) separated by 3-5 nucleotides (loop).

[0212] Conservation of sgRNA motifs was used to reveal novel effectors that may not show similarity to classified VA-type nucleases. Repeats from 69,117 CRISPR arrays were searched for motifs. The most common motifs contained a 4-nucleotide loop, while 3- and 5-nucleotide loops were less common (see Figure 12, Figure 13, Figure 14, Figure 15, and Figure 16). Examination of the genomic context surrounding CRISPR arrays containing repeat motifs revealed a large number of effectors of various lengths. For example, effectors from family MG57 were the largest of the identified VA-type nucleases (~1400 aa on average) and encoded repeats with 4 bp loops. Another family identified from HMM analysis contained a different repeat motif (CCUGC[N 3-4]GCAGG (see Figures 5C, 5D). Although the sequences differ, the structures were predicted to fold into highly similar stem-loop structures.

[0213] Example 8 In vitro cleavage efficiency of MG CRISPR complex The endonuclease is expressed as a His-tagged fusion protein from an inducible T7 promoter in a protease-deficient E. coli B strain. Cells expressing the His-tagged protein are lysed by sonication, and the His-tagged protein is purified by Ni-NTA affinity chromatography on a His-trap FF column (GE Lifescience) on an AKTA Avant FPLC (GE Lifescience). The eluate is resolved by SDS-PAGE on an acrylamide gel (Bio-Rad) and stained with InstantBlue Ultrafast Coomassie (Sigma-Aldrich). Purity is determined using densitometry of the protein bands using ImageLab software (Bio-Rad). The purified endonuclease is dialyzed into a storage buffer (pH 7.5) composed of 50 mM Tris-HCl, 300 mM NaCl, 1 mM TCEP, 5% glycerol, and stored at -80°C. Target DNA containing a spacer sequence and a PAM sequence (e.g., as determined in either Example 3 or Example 4) is constructed by DNA synthesis. If the PAM has degenerate bases, a single representative PAM is selected for testing. The target DNA consists of 2200 bp linear DNA derived from a plasmid by PCR amplification with the PAM and a spacer located 700 bp from one end. Successful cleavage results in 700 bp and 1500 bp fragments. Target DNA, in vitro transcribed single RNA, and purified recombinant protein are combined with an excess of protein and RNA in cleavage buffer (10 mM Tris, 100 mM NaCl, 10 mM MgCl2) and incubated for 5 min to 3 h (usually 1 h). The reaction is stopped by adding RNase A and incubating for 60 min. The reaction is then resolved on a 1.2% TAE agarose gel and the fraction of cleaved target DNA is quantified with ImageLab software.

[0214] Example 9 Genome cleavage activity test of MG CRISPR complex in E. coli E. coli lacks the ability to effectively repair double-stranded DNA breaks. This can result in genomic DNA breaks being a lethal event. Exploiting this phenomenon, endonuclease activity in E. coli is tested by recombinantly expressing an endonuclease and a guide RNA (e.g., as determined in Example 6) in a target strain with a spacer / target PAM sequence integrated into the genomic DNA (e.g., as determined in Example 4) and transforming with DNA encoding the endonuclease. The transformants are then rendered chemically competent and transformed with 50 ng of guide RNA (e.g., crRNA) that is either specific for the target sequence ("on-target") or non-specific for the target ("non-target"). After heat shock, the transformants were allowed to recover in SOC for 2 hours at 37°C. Nuclease efficiency is then determined by a 5-fold dilution series grown on induction media. Colonies were quantified from the dilution series in triplicate. A decrease in the number of colonies transformed with the on-target guide RNA compared to the number of colonies transformed with the off-target guide RNA indicates specific genomic cleavage by the endonuclease.

[0215] Example 10 General Procedure: Testing genome cleavage activity of MG CRISPR complexes in mammalian cells Two mammalian expression vectors are used to detect targeting and cleavage activity in mammalian cells. First, the MG Cas effector is fused to a viral 2A matched cleavable peptide sequence linked to a C-terminal SV40 NLS and a GFP tag (2A-GFP tag for monitoring protein expression). Next, the MG Cas effector is fused to two SV40 NLS sequences, one at the N-terminus and the other at the C-terminus. The NLS sequences include any of the NLS sequences described herein (e.g., SEQ ID NOs: 3938-3953). In some examples, the nucleotide sequence encoding the endonuclease is codon-optimized for expression in mammalian cells.

[0216] The single guide RNA with the crRNA sequence fused to a sequence complementary to the mammalian target DNA is cloned into a second mammalian expression vector. The two plasmids are co-transfected into HEK293T cells. 72 hours after co-transfection, DNA is extracted from the transformed HEK293T cells and used for preparation of NGS libraries. To demonstrate the targeting efficiency of the enzyme in mammalian cells, the NHEJ percentage is measured by quantifying the insertion and deletion at the target site. At least 10 different target sites are selected and the activity of each protein is tested.

[0217] Example 11 Testing genome cleavage activity of MG CRISPR complexes in mammalian cells To demonstrate targeting and cleavage activity in mammalian cells, the MG Cas effector protein sequence was cloned into a mammalian expression vector with flanking N- and C-terminal SV40 NLS sequences, a C-terminal His tag, and a 2A-GFP (e.g., viral 2A matched cleavable peptide sequence linked to GFP) tag at the C-terminus after the His tag (backbone 1). In some instances, the nucleotide sequence encoding the endonuclease was codon-optimized for expression in E. coli cells or was a native sequence codon-optimized for expression in mammalian cells.

[0218] Single guide RNA sequences (sgRNAs) with gene targets of interest were also cloned into a mammalian expression vector. The two plasmids are co-transfected into HEK293T cells. 72 hours after co-transfection of HEK293T cells with the expression plasmid and sgRNA targeting plasmid, DNA was extracted and used for preparation of NGS libraries. To demonstrate the targeting efficiency of the enzyme in mammalian cells, NHEJ percent was measured by indels in sequencing the target sites. 7-12 different target sites were selected to test the activity of each protein. An arbitrary threshold of 5% indels was used to identify active candidates. Genome editing efficiency in human cells was evaluated from NGS reads using CRISPResso with parameters: cleavage offset = -4 and window = 10. All post-cleavage events from CRISPResso results were summed for ±1bp indels / mutations, and ≥2bp deletions, insertions, and mutations. All results were normalized to all sequences aligned to the expected amplicon (see FIG. 18).

[0219] Example 12. Characterization of the MG29 family PAM specificity, tracrRNA / sgRNA validation The myTXTL system described in Example 3 and Example 8 was used to confirm the targeted endonuclease activity of the MG29 family of endonuclease systems. In this assay, PCR amplification of the cleaved target plasmid yields a product migrating at approximately 170 bp in the gel, as shown in Figure 17. An amplification product was observed for MG29-1 with crRNA corresponding to SEQ ID NO: 3609 (see Figure 17A, lane 7). Sequencing of the PCR products revealed the active PAM sequences for these enzymes, as shown in Table 2 below.

[0220] [Table 3-1]

[0221] [Table 3-2]

[0222] Targeted endonuclease activity in mammalian cells The MG29-1 target locus was selected to test the location in the genome with the PAM YYn (SEQ ID NO: 3871). A spacer corresponding to the selected target site was cloned into the sgRNA scaffold in backbone 1 of the mammalian vector system described in Example 9.

[0223] The sites are listed below in Table 3. The activity of MG29-1 at various target sites is shown in Table 2 and FIG.

[0224] [Table 4]

[0225] Example 13 High Replica PAM Determination by NGS Using E. coli lysate-based expression in myTXTL kit as described in Example 3 and Example 8, type V endonucleases (e.g., MG28, MG29, MG30, MG31 endonucleases) were tested for cleavage activity. When incubated with crRNA and a plasmid library containing spacer sequencing matching the crRNA preceded by 8 degenerate ("N") bases (5'PAM library), a subset of the plasmid library with a functional PAM was cleaved. Binding to this cleavage site and PCR amplification provided evidence of activity demonstrated by a band observed in the gel at 170 bp (Figure 17B). Gel 1 (top panel, A) lanes are as follows: 1 (ladder, the most intense band corresponds to 200 bp); 2: positive control (pre-validated library); 3 (n / a); 4 (n / a); 5 (MG28-1); 6 (MG29-1); 7 (MG30-1); 8 (MG31-1); 9 (MG32-1); and 10 (ladder). Gel 2 (bottom panel, B) lanes are as follows: 1 (ladder, the most intense band corresponds to 200 bp); 2: (LbCpf1 positive control); 3 (LbCpf1 positive control); 4 (negative control); 5 (n / a); 6 (n / a); 7 (MG28-1); 8 (MG29-1); 9 (MG30-1); and 10 (MG31-1); 11 (MG32-1).

[0226] The PCR products were further subjected to NGS sequencing and the PAM was matched to the seqLogo (e.g., Huber et al. Nat Methods. 2015 Feb;12(2):115-21) representation (Figure 20). The seqLogo representation shows 8 bp upstream (5') of the spacer labeled as positions 0-7. As shown in Figure 20, the PAM is pyrimidine rich (C and T) with the majority of the sequence requirement being 2-4 bp upstream of the spacer (positions 4-6 in SeqLogo).

[0227] The PAMs of the MG candidates are shown in Table 4 below.

[0228] [Table 5]

[0229] In some cases, the preference for the position immediately adjacent to the spacer may be weaker (eg, "m" or "v" instead of "n").

[0230] Example 14 Targeted endonuclease activity in mammalian cells using MG31 nuclease Targeted endonuclease activity in mammalian cells The MG31-1 target locus was selected to test the location in the genome with the PAM TTTR (SEQ ID NO: 3875). A spacer corresponding to the selected target site was cloned into the sgRNA scaffold in backbone 1 of the mammalian vector system described in Example 11.

[0231] The sites are listed below in Table 5. The activity of MG31-1 at various target sites is shown in Table 5 and FIG.

[0232] [Table 6]

[0233] Example 15 In vitro activity Promising candidates were selected from bioinformatics analysis and preliminary screening for further biochemical analysis as described in this example. Using the conserved 3'sgRNA structure, a "universal" sgRNA was designed containing a 3' 20nt CRISPR repeat and a 24nt spacer (Figure 10). Of the seven tested candidates, six showed activity in vitro against the 8N PAM library (Figure 26A). The remaining inactive candidate (30-1) showed activity when tested with the predicted endogenous trimmed CRISPR repeat (SEQ ID NO: 3608, see Figure 26B), but this candidate was not included in the NGS library assay (Figure 26C).

[0234] The majority of the identified PAMs are thymine-rich sequences of 2-3 bases (Figure 18A). However, two enzymes, MG26-1 (PAM YYn) and MG29-1 (PAM YYn), have PAM specificity for either pyrimidine bases, thymine or cytosine, which allows for broader sequence targeting. Analysis of putative PAM-interacting residues shows that active VA-type nucleases contain conserved lysines and a GWxxxK motif, indicating that they are important for the recognition and interaction of different PAMs in FnCas12a.

[0235] Our PAM detection assay required ligation to generate blunt-ended fragments prior to PAM enrichment, suggesting that these enzymes generate staggered double-stranded DNA breaks similar to previously reported VA-type nucleases. Analysis of the NGS reads used to detect indels allowed us to identify the cleavage site on the target strand (Figure 18B), showing cleavage after the 22nd PAM-distal base.

[0236] In vitro cleavage by MG29-1 was further investigated by sequencing the cleavage products. The cleavage position on the target strand was 22 nucleotides away from the PAM for the majority of sequences, with 21 or 23 nucleotides being less frequent (Figure 56). The cleavage position on the non-target strand is 17-19 nucleotides away from the PAM. Combined, these results indicate a 3-5 bp overhang.

[0237] Example 16 Genome editing After PAM validation, the novel proteins described herein were tested in HEK293T cells for gene targeting activity. All candidates showed greater than 5% NHEJ activity (background corrected) at at least one of the ten tested target loci. MG29-1 showed the highest overall activity in NHEJ modification results and was active for the greatest number of targets (Figure 18B). From this, this nuclease was selected for purified ribonucleoprotein (RNP) testing in HEK293 cells. RNP transfection of MG29-1 holoenzyme showed higher editing levels than plasmid-based transfection for four out of nine targets, and in some cases the editing efficiency exceeded 80% (Figure 18C). Analysis of the editing profile of MG29-1 shows that this nuclease generates more than 3 bp deletions at the target site than other types of edits (Figure 18D). In several targets (five to eight), the indel frequency of MG29-1 is twice that of AsCpf1 (Figure 18E).

[0238] Example 17 Observations We identified VA-type CRISPRs from metagenomes collected from various complex environments and organized into families. These novel VA-type nucleases had diverse sequences and phylogenetic origins within and across families, and cleaved targets with diverse PAM sites. Similar to other VA-type nucleases (e.g., LbCas12a, AsCas12a, FnCas12a), the effectors described herein utilize single-guide CRISPR RNAs (sgRNAs) to target double-stranded breaks in staggered DNA, simplifying guide design and synthesis to drive multiplex editing. Analysis of CRISPR repeat motifs that form stem-loop structures in crRNAs suggested that the VA-type effectors described herein have 4-nt loop guides, which are more prevalent than shorter or longer loops. Although we also previously observed 4-nt loops for orthologues of 16Cpf1, the sgRNA motif of LbCpf1 has the less common 5-nt. The MG61 family of VA-type effectors contains an unusual stem-loop CRISPR repeat motif sequence, CCUGC[N 3-4 ]GCAGG. The high degree of conservation of sgRNAs with various loop lengths in the VA type may provide a flexible level of activity, as shown for the proteins described herein. Taken together, these effectors are not close homologs of previously studied enzymes and greatly expand the diversity of VA type-like sgRNA nucleases.

[0239] Additional V-type effectors described herein can be created from duplications of VA-like nucleases, referred to herein as VA-type prime effectors (V-A'), which can be encoded adjacent to a Cas12a nuclease. Both VA-type and these V-A'-type systems may share the CRISPR sgRNA, but the V-A'-type systems are distinct from Cas12a (Figure 4). The CRISPR repeats associated with these prime effectors also contain UCUAC[N 3-5] folded into a single-guide crRNA with a GUAGAU motif. One report identified a V-type cms1 effector encoded adjacent to a VA-type nuclease, which required a single-guide crRNA for cleavage activity in plant cells. Although we reported different CRISPR arrays for each effector, the V-A' type system described herein suggested that both VA and V-A' types may require the same crRNA for DNA targeting and cleavage. As recently described in Roizman's bacterial genomes (e.g., Chen et al. Front Microbiol. 2019 May 3;10:928), both VA and V-A' type effectors are distantly related based on sequence homology and phylogenetic analyses. Thus, prime effectors do not belong within the VA-type classification, but are recognized as a separate V-type subclassification.

[0240] The PAMs determined for active VA-type nucleases are generally thymine-rich and similar to previously described PAMs otherwise described for VA-type nucleases. In contrast, MG29-1 requires a shorter YYN PAM sequence, increasing target flexibility compared to the four nucleotide TTTV PAM of LbCpf1. In addition, RNPs containing MG29-1 had higher activity in HEK293 cells compared to sMbCas12a, which has a three nucleotide PAM.

[0241] When testing novel nucleases for in vitro editing activity, MG29-1 showed activity comparable to or even better than other reported enzymes of this class. Reports of plasmid transfection editing efficiency in mammalian cells using Cas12a orthologues showed insertion / deletion frequencies of 21%-26% for guides with T-rich PAMs, with one of 18 guides with CCN PAMs showing approximately 10% activity with Mb3Cas12a (Moraxella bovocri AAX11_00205 Cas12a, see e.g. Wang et al. Journal of Cell Science 2020 133:jcs240705). Notably, it is clear that MG29-1 activity in plasmid transfection is greater than that reported for Mb3Cas12a for targets with TTN and CCN PAMs (see e.g. Figure 18). The difference in editing efficiency may be due to differences in genome availability at different target genes, since the target sites for plasmid transfection have identical TTG PAM in all experiments. MG29-1 editing as RNP is much more efficient than that by plasmid and more efficient than AsCas12a at two of the seven target loci. Therefore, MG29-1 may be a highly active and efficient gene editing nuclease. These findings increase the known diversity of single-guide VA-type CRISPR nucleases and demonstrate the potential of novel enzymes from uncultured microorganisms in genome editing. The seven novel nucleases showed in vitro activity with diverse PAM requirements, and RNP data showed editing efficiency of over 80% for therapeutically relevant targets in human cell lines. These novel nucleases expand the toolkit of CRISPR-associated enzymes for diverse genome editing applications.

[0242] Example 18 MG29-1-induced editing of the TRAC locus in T cells Three exons of the T cell receptor alpha chain constant region (TRACA) were scanned for sequences matching the initially predicted 5'-TTN-3'PAM preference of MG29-1, and single guide RNAs with unique Alt-R modifications were ordered from IDT. All guide spacer sequences were 22 nt in length. Guides (80 pmol) were mixed with purified MG29-1 protein (63 pmol) and incubated at room temperature for 15 min. T cells were purified from PBMCs using negative selection (Stemcell Technologies Human T Cell Isolation Kit #17951) and activated with CD2 / 3 / 28 beads (Miltenyi T Cell Activation / Proliferation Kit #130-091-441). After 4 days of cell expansion, each of the MG29-1 / guide RNA mixtures was electroporated into 200,000 T cells using a Lonza 4-D Nucleofector with program EO-115 and P3 buffer. 72 hours after transfection, cells were harvested and genomic DNA was isolated. Primers targeting the TRACA locus were used to PCR amplify for analysis using high-throughput DNA sequencing. The generation of insertions and deletions typical of NHEJ-based gene editing was quantified using a unique Python script (see Figure 39).

[0243] [Table 7-1]

[0244] [Table 7-2]

[0245] [Table 7-3]

[0246] [Table 7-4]

[0247] [Table 7-5]

[0248] [Table 7-6]

[0249] [Table 7-7]

[0250] [Table 7-8]

[0251] [Table 7-9]

[0252] [Table 7-10]

[0253] Example 19 Retest of lead guide of MG29-1 Experiments were performed to retest the lead guide for MG29-1. Single guide RNAs were ordered from IDT, scanning three exons of the T cell receptor alpha chain constant region for sequences matching 5'-TTN-3' and using the Alt-R modification. All guide spacer sequences were 22 nt in length. Guides were mixed with purified MG29-1 protein (80 pmol gRNA + 63 pmol MG29-1; or 160 pmol gRNA + 126 pmol MG29-1) and incubated for 15 min at room temperature. T cells were purified from PBMCs using negative selection (Stemcell Technologies Human T Cell Isolation Kit #17951) and activated with CD2 / 3 / 28 beads (Miltenyi T Cell Activation / Proliferation Kit #130-091-441). After 4 days of cell expansion, each of the MG29-1 / guide RNA mixtures was electroporated into 200,000 T cells using a Lonza 4-D Nucleofector using the program EO-115 and P3 buffer. Genomic DNA was harvested 72 hours after transfection and PCR amplified for analysis using high-throughput DNA sequencing. The generation of insertions and deletions typical of NHEJ-based gene editing was quantified using a proprietary Python script (see Figure 40).

[0254] Example 20: Test of guide spacer length for MG29-1 Experiments were performed to determine the optimal guide spacer length. Three exons of the T cell receptor alpha chain constant region were scanned for sequences matching 5'-TTN-3', and single guide RNAs using the Alt-R modification were ordered from IDT. Guides were mixed with purified MG29-1 protein (80 pmol gRNA + 60 pmol effector; 160 pmol gRNA + 120 pmol effector; or 320 pmol gRNA + 240 pmol effector) and incubated at room temperature for 15 minutes. T cells were purified from PBMCs using negative selection (Stemcell Technologies Human T Cell Isolation Kit #17951) and activated with CD2 / 3 / 28 beads (Miltenyi T Cell Activation / Proliferation Kit #130-091-441). After 4 days of cell expansion, each of the MG29-1 / guide RNA mixtures was electroporated into 200,000 T cells using a Lonza 4-D Nucleofector using program EO-115 and P3 buffer. Genomic DNA was harvested 72 hours after transfection and PCR amplified for analysis using high-throughput DNA sequencing. The generation of insertions and deletions typical of NHEJ-based gene editing was quantified using a unique Python script. The results are shown in Figure 41, which demonstrates that guide spacer lengths of 20-24 nt work well, with a drop-off at 19 nt.

[0255] Example 21 Determining the effect of MG29-1 indel generation on TCR expression Cells in Figure 41 were analyzed for TCR expression by flow cytometry using APC-labeled anti-human TCR α / β Ab (Biolegend #306718, clone IP26) and an Attune NxT flow cytometer (Thermo Fisher). Indel data are taken from Figure 41.

[0256] Example 22 Targeted CAR integration using MG29-1 Single guide RNAs were ordered from IDT, scanning the three exons of the T cell receptor alpha chain constant region for sequences matching 5'-TTN-3' and using the IDT-specific Alt-R modification. Guides (80 pmol) were mixed with purified MG29-1 protein (63 pmol) and incubated at room temperature for 15 minutes. T cells were purified from PBMCs using negative selection (Stemcell Technologies Human T Cell Isolation Kit #17951) and activated with CD2 / 3 / 28 beads (Miltenyi T Cell Activation / Proliferation Kit #130-091-441). After 4 days of cell expansion, each of the MG29-1 / guide RNA mixtures was electroporated into 200,000 T cells using a Lonza 4-D Nucleofector using the program EO-115 and P3 buffer. 100,000 vector genomes of serotype 6 adeno-associated virus (AAV-6) containing the coding sequence of a customized chimeric antigen receptor flanked by 5' and 3' homology arms targeting the TRAC gene (the 5' arm of SEQ ID NO: 4424 is approximately 500 nt long, and the 3' arm of SEQ ID NO: 4425 is approximately 500 nt long) were added immediately to the cells after transfection. The transcripts were analyzed for expression of the TCR for the TRAC indel (Figure 42), showing that the indel of the TRAC gene correlates with the loss of expression of the TCR. The cells were also simultaneously analyzed by flow cytometry for expression of the TCR (Figure 42) as in Example 21, and for binding of the target antigen to the CAR (Figure 43, plots gated for single live cells). The flow analysis results in Figure 43 show that guide RNA alone was effective at ablation of TCR expression ("RNP only"), but the addition of AAV to guide RNA generated a new population of cells that bound to the CAR antigen ("AAV+MG29-1-19-22" and "AAV+MG29-1-35-22" at the top left of the plot). sgRNA35 (SEQ ID NO: 4404) was less effective, but less effective, than sgRNA19 (SEQ ID NO: 4388) in inducing CAR integration.One possible explanation for this difference is that the predicted nuclease cleavage site for guide 19 is approximately 160 bp away from the end of the right homology arm.

[0257] [Table 8]

[0258] Example 23 MG29-1 TRAC editing in HSCs Hematopoietic stem cells were purchased from Allcell, thawed according to the supplier's instructions, and washed with DMEM + 10% FBS. Resuspended in Stemspan II medium supplemented with CC110 cytokines. One million cells were cultured in 4 mL medium in a 6-well dish for 72 hours. MG29-1 RNP was made and transfected, and gene editing was analyzed as in Example 18, except for using the EO-100 nucleofection program. The results are shown in Figure 56, which shows gene editing at TRAC of hematopoietic stem cells using #19 (SEQ ID NO: 4388) and #35 (SEQ ID NO: 4404) sgRNAs in Table 5B below. The results also show that #35 sgRNA is highly effective in targeting the TRAC locus.

[0259] [Table 9]

[0260] Example 24 Further analysis of PAM specificity associated with MG29-1 Further analysis was performed to more precisely determine the PAM specificity of MG29-1. Guide RNAs were designed using the 5'-NTTN-3' PAM sequence and then selected according to observed gene editing activity (Figure 45, identity of the underlined base (5'-proximal N) is shown for each interval). All guides with activity above 10% and with a T at this position in genomic DNA indicate that MG29-1 PAM can be better described as 5'-TTTN-3'. For each interval, the statistical significance of the excess surface of T at this position is shown. In Figure 45, the various intervals (high, medium, low, >1%, <1%) are ■ High: More than 50% indels (N=4) ■ Medium: 10-50% indels (N=15) ■ Low: 5-10% indels (N=5) ■ Over 1%: 1-5% indels (N=12) ■ Less than 1% (N=82)

[0261] [Table 10]

[0262] Example 25 Determination of MG29-1 indel induction versus spacer base composition Further analysis of gene editing activity versus base composition of MG29-1 spacer sequences was performed, and the correlation was moderate (R^2=0.23), but trended toward better activity at higher GC content (see Figure 46, where the correlation between indels induced in cultured cells versus GC content of spacer sequences is shown as a dot plot).

[0263] Example 26 Chemical modification of MG29-1 guide Using the procedure of Example 18, but with the indicated guide RNAs targeting VEGF-A, experiments were performed to optimize chemical modifications for targeting the VEGF-A locus using MG29-1 (see Table 7 below). The experiment used 126 pmol of MG29-1 and 160 pmol of guide RNA. The results are shown in Figure 47. Guides #4, #5, #6, #7 and #8 showed improved activity relative to unmodified guide #1, indicating that the corresponding modifications of these sequences improved the activity of these guide RNAs against the unmodified RNA sequence.

[0264] [Table 11]

[0265] Example 27 Titration of the modified MG29-1 guide from Example 26 Further experiments were performed to determine the dose-dependence of activity of the modified guides used in Example 26 and to identify possible dose-dependent toxic effects. Experiments were performed as in Example 26, except at 1 / 4 (B), 1 / 8 (C), 1 / 16 (D) and 1 / 32 (E) of the starting doses (A, 126 pmol MG29-1 and 160 pmol guide RNA). The results are shown in Figure 48.

[0266] Example 28 Large-Scale Synthesis of Nucleases Described Herein Project Overview Scale up production of Metagenomi's type VA CRISPR nuclease, MG29-1, to an initial culture volume of 10 L. Perform expression screening, scale-up expression, downstream development, formulation studies, and delivery of >90% of protein purified by SDS-PAGE.

[0267] Expression and purification screening Expression of MG29-1 from the pMG450 vector shown in Figure 49 was tested by varying conditions such as host strain, expression medium, inducer, induction time and temperature. Total soluble protein extracted from E. coli cell paste is analyzed by SDS-PAGE for all conditions. Immobilized metal affinity chromatography (IMAC) pulldown followed by SDS-PAGE is performed on the top three expression conditions to estimate yield and purity and identify optimal expression conditions. A scale-up method for lysis is developed. Critical parameters are identified for purification (Tobacco Etch Virus Protease (TEV) cleavage) by IMAC and subtractive IMAC. Column fractions are tested using SDS-PAGE. Elution pools are tested using SDS-PAGE and photometric absorbance at 280 nm (A280). A method is developed for buffer exchange and concentration by tangential flow filtration (TFF).

[0268] If necessary, develop further chromatography steps to achieve purity of 90% or greater. Test one chromatography mode (e.g., ceramic hydroxyapatite chromatography). Test up to eight unique conditions (e.g., 2-6 resins with 2-3 buffer systems each). Use SDS-PAGE and test column fractions. Use SDS-PAGE and A280 and test elution pools. Select one condition and perform a loading test of three conditions. Analyze column fractions and elution pools as above. Methods for buffer exchange and concentration by TFF may be developed.

[0269] Transform E. coli, prepare cultures in shake flasks, and induce using materials and methods with optimal expression conditions identified during expression screening. Harvest cell paste and verify expression by SDS-PAGE. Report results and use cell paste as starting material for purification. Limit cell culture volume to 20 L. Purify up to 1 gram of protein using methods developed during downstream method development. Formulate into final storage buffer and QC test for yield and concentration by A280 and purity by SDS-PAGE.

[0270] Formulation Testing Formulation testing is performed using purified protein to determine optimal storage conditions for the purified protein. Studies may investigate concentration, storage buffer, storage temperature, maximum freeze / thaw cycles, storage time, or other conditions.

[0271] Example 29 Demonstration of the ability of nucleases described herein to edit intronic regions in cultured mouse hepatocytes. Intronic regions of expressed genes are attractive genomic targets for integrating coding sequences of therapeutic proteins of interest for the purpose of expressing therapeutic proteins to treat or cure disease. Integration of protein coding sequences can be achieved by using sequence-specific nucleases in the presence of an exogenously supplied donor template to generate double-stranded breaks within the intron. The donor template can be integrated into the double-stranded break by one of two major cellular repair pathways, called homology directed repair (HDR) and non-homologous end joining (NHEJ), which result in targeted integration of the donor template. The NHEJ pathway is predominant in non-dividing cells, whereas the HDR pathway is mainly active only in dividing cells. The liver is a particularly attractive tissue for targeted integration of protein coding sequences. This is due to the effectiveness of in vivo delivery systems and the liver's ability to express and secrete proteins with high efficiency.

[0272] To evaluate the potential of MG29-1 to generate double-stranded breaks in intronic regions, serum albumin intron 1 was selected as the target locus. Single guide RNAs (sgRNAs) with a spacer length of 22 nt targeted to mouse albumin intron 1 were identified using the guide discovery algorithm of Geneious Prime nucleic acid analysis software (https: / / www.geneious.com / prime / ). A total of 112 possible sgRNAs within mouse albumin intron 1 were identified using a PAM of KTTG (sequence number 3870) located 5' to the spacer. Guides spanning intron / exon boundaries were excluded. The spacer sequences of these 112 guides were searched against the mouse genome using Geneious Prime, and specificity scores were assigned by the software based on alignment to additional sites in the genome. Spacer sequences with identical bases with 4 or more adjacent bases were excluded due to concerns about specificity. A total of 12 spacers with the highest specificity scores were selected for testing. To generate sgRNAs, the backbone sequence "TAATTTCTACTGTTGTAGAT" was added to the 3' end of the spacer sequence. sgRNAs were chemically synthesized by incorporating chemically modified bases known to improve the performance of sgRNAs with the cpf1 guide (AltR1 / AltR2 chemistry available from Integrated DNA Technologies). The spacer sequences for these guides are listed below in Table 8.

[0273] [Table 12-1]

[0274] [Table 12-2]

[0275] Hepa1-6 cells, a transformed mouse hepatocyte cell line, were cultured under standard conditions (DMEM medium containing 10% FBS in a 5% CO2 incubator) and transfected intranuclearly with a ribonucleoprotein formed by mixing sgRNA with purified MG29-1 protein in PBS buffer. Hepa1-6 cells (1 × 10) suspended in complete SF nucleofection reagent (Lonza) were transfected with an RNP formed by mixing 50 pmol of MG29-1 protein with 100 pmol of sgRNA using a 4D nucleofection device (Lonza). 5 ) was intranuclearly gene-edited. After nucleofection, cells were seeded in DMEM supplemented with 10% FBS in 24-well plates and incubated in a 5% CO2 incubator for 48–72 h. Genomic DNA was then extracted from the cells using a column-based purification kit (Purelink Genomic DNA Mini Kit, ThermoFisher Scientific) and quantified by absorbance at 260 nm. The albumin intron 1 region was PCR amplified from 50 ng of genomic DNA in a reaction containing 0.5 micromolar each of primers mAlb90F (CTCCTCTTCGTCTCCGGC) (sequence number 4031) and mAlb1073R (CTGCCACATTGCTCAGCAC) (sequence number 4032), and 1x Pfusion Flash PCR Master Mix.

[0276] The resulting 984bp PCR product spanning the entire intron 1 of mouse albumin was purified using a column-based purification kit (DNA Purification and Extraction Kit, Zymo Research) and sequenced using primers located within 150-350bp of the predicted target site for each sgRNA. PCR products generated using primers mAlb90F (sequence number 4031) and mAlb1073R (sequence number 4032) from untransfected Hepa1-6 cells were sequenced in parallel as a control. Sanger sequencing chromatograms were analyzed using Inference of CRISPR Edits (ICE) to determine indel frequency and indel profile (Hsiau et.al, Inference of CRISPR Edits from Sanger Trace Data. BioArxiv. 2018 https: / / www.biorxiv.org / content / early / 2018 / 01 / 20 / 251082).

[0277] When nucleases create double-strand breaks (DSBs) in DNA inside living cells, the DSBs are repaired by cellular DNA repair machinery. In actively dividing cells, such as transformed mammalian cells in culture, and in the absence of a repair template, this repair occurs via the NHEJ pathway, an error-prone process that introduces base insertions or deletions at the double-strand break site (Lieber, MR, Annu Rev Biochem. 2010; 79: 181-211). These insertions and deletions that occur and are subsequently repaired are therefore characteristic of the double-strand break and are widely used as information on the editing or cleavage efficiency of the nuclease. The insertion and deletion profiles depend on the properties of the nuclease that created the double-strand break, but also on the sequence context of the cleavage site. Based on in vitro assays, MG29-1 nuclease generates staggered breaks located 3' of the PAM. Staggered cuts often result in larger deletions due to single-strand trimming prior to end-joining. Table 8 lists the overall indel frequencies generated by each of the 19 sgRNAs targeting mouse albumin intron 1 tested in Hepa1-6 cells. Eleven of the 18 sgRNAs produced detectable indels at the target site, five sgRNAs produced indel frequencies greater than 50%, and four sgRNAs produced indel frequencies greater than 75%. These data demonstrate that MG29-1 nuclease is capable of editing the genome of live cultured mouse cells at the predicted target site for sgRNAs with greater than 75% efficiency.

[0278] The editing efficiency of the same set of sgRNAs was evaluated by co-transfecting sgRNAs and mRNA encoding MG29-1 nuclease using a commercially available lipid-based transfection reagent (Lipofectamine MessengerMAX, Invitrogen). mRNA encoding MG29-1 was generated by in vitro transcription using T7 polymerase from a plasmid in which the coding sequence of MG29-1 was cloned. The MG29-1 coding sequence was codon-optimized using a human codon usage table and flanked by nuclear localization signals derived from SV40 at the N-terminus and nucleoplasmin at the C-terminus. Additionally, a UTR was incubated at the 3' end of the coding sequence to improve translation. To improve mRNA stability in vivo, a 3' UTR was incubated at the 3' end of the coding sequence followed by a polyA tract of approximately 90-110 nucleotides (e.g., SEQ ID NO: 4426 for wild-type MG29-1 and SEQ ID NO: 3327 for the S168R variant). The in vitro transcription reaction contained Clean Cap® capping reagent (Trilink BioTechnologies), and the resulting RNA was purified using the MEGAClear™ Transcription Clean-Up Kit (Invitrogen), and purity was assessed using TapeStation (Agilent) and found to be composed of >90% full-length RNA.

[0279] As confirmed in Table 1, editing efficiency following mRNA / sgRNA lipid transfection of Hepa1-6 cells was similar but not identical to that seen with nucleofection of RNPs. However, we confirmed that MG29-1 nuclease is active in cultured hepatocytes when delivered in the form of mRNA.

[0280] [Table 13-1]

[0281] [Table 13-2]

[0282] [Table 13-3]

[0283] [Table 13-4]

[0284] [Table 13-5]

[0285] [Table 13-6]

[0286] Figure 50 is a representative example of an insertion / deletion profile of MG29-1 as determined by ICE analysis using mAlb29-1-8 (sequence number 3999) as a guide, demonstrating that 4-base deletions were the most frequent event (25% of all sequences), with 1-, 5-, 6- or 7-base deletions accounting for approximately 10-15% of sequences, respectively. Longer deletions of up to 13 bases were also detected, but insertions were undetectable. In contrast, spCas9 with a guide targeting mouse albumin intron 1 generated mostly 1-base insertions or deletions.

[0287] Figure 51 shows a representative example of the indel profile of MG29-1 and sgRNA mAlb29-1-8 as determined by next generation sequencing (NGS) of PCR products of the mouse albumin intron 1 region. In total, approximately 15,000 sequence reads were obtained. By NGS, 4-base deletions were the most frequent indels (20% of the total), while 1-, 5-, 6-, and 7-base deletions accounted for approximately 10% of indels, respectively. Larger deletions of up to 19 bp were also detected. The profile observed by NGS analysis is in close agreement with that measured by ICE. These results demonstrate that MG29-1 generates large deletions at the target site that are consistent with the staggered cleavage observed in vitro.

[0288] Example 30 Demonstration of the ability of nucleases described herein to target intronic regions in cultured human hepatocytes (HepG2) To evaluate the potential of MG29-1 to generate double-stranded breaks in intronic regions in human cells, intron 1 of human serum albumin was selected as the target locus. Single guide RNAs (sgRNAs) with a spacer length of 22 nt targeted to human albumin intron 1 were identified using the guide discovery algorithm of Geneious Prime nucleic acid analysis software (https: / / www.geneious.com / prime / ). A total of 90 possible sgRNAs within human albumin intron 1 were identified using a PAM of KTTG (sequence number 3870) located 5' to the spacer. Guides spanning intron / exon boundaries were excluded. The spacer sequences of these guides were searched against the mouse genome using Geneious Prime, and specificity scores were assigned by the software based on alignment to additional sites in the genome. Spacer sequences with identical bases with 4 or more adjacent bases were excluded due to concerns about specificity. A total of 23 spacers with the highest specificity scores were selected for testing. To generate sgRNAs, the backbone sequence "TAATTTCTACTGTTGTAGAT" was added to the 3' end of the spacer sequence. sgRNAs were chemically synthesized by incorporating chemically modified bases known to improve the performance of sgRNAs with the cpf1 guide (AltR1 / AltR2 chemistry available from Integrated DNA Technologies). The spacer sequences for these guides are listed below in Table 9.

[0289] [Table 14-1]

[0290] [Table 14-2]

[0291] HepG2 cells, a transformed human hepatocyte cell line, were cultured under standard conditions (MEM medium with 10% FBS in a 5% CO2 incubator) and transfected intranuclearly with a ribonucleoprotein formed by mixing sgRNA with purified MG29-1 protein in PBS buffer. A total of 1e5 HepG2 cells suspended in complete SF nucleofection reagent (Lonza) were transfected intranuclearly with an RNP formed by mixing 80 pmol of MG29-1 protein with 160 pmol of sgRNA using a 4D nucleofection device (Lonza). After nucleofection, cells were seeded in DMEM supplemented with 10% FBS in a 24-well plate and incubated in a 5% CO2 incubator for 48–72 h. Genomic DNA was then extracted from the cells using a column-based purification kit (Purelink Genomic DNA Mini Kit, ThermoFisher Scientific) and quantified by absorbance at 260 nm. The albumin intron 1 region was PCR amplified from 50 ng of genomic DNA in a reaction containing 0.5 micromolar each of primers hAlb11F (TCTTCTGTCAACCCCACACGCC) (sequence number 4079) and hAlb834R (CTTGTCTGGGCAAGGGAAGA) (sequence number 4080) and 1x Pfusion Flash PCR Master Mix. The resulting 826 bp PCR product spanning the entire intron 1 of mouse albumin was purified using a column-based purification kit (DNA Purification and Extraction Kit, Zymo Research) and sequenced using primers located within 150-350 bp of the predicted target site for the sgRNA.

[0292] PCR products generated using primers hAlb11F (TCTTCTGTCAACCCCACACGCC) (SEQ ID NO: 4079) and hAlb834R (CTTGTCTGGGCAAGGGAAGA) (SEQ ID NO: 4080) from untransfected HepG2 cells were sequenced in parallel as a control. Sanger sequencing chromatograms were analyzed using Inference of CRISPR Edits (ICE) to determine the frequency of indels and indel profiles. When nucleases create double-stranded breaks (DSBs) in DNA inside living cells, the DSBs are repaired by cellular DNA repair mechanisms. In actively dividing cells, such as transformed mammalian cells in culture, and under conditions in which no repair template is present, this repair occurs via the NHEJ pathway, an error-prone process that introduces base insertions or deletions at the site of the double-stranded break (Lieber, MR, Annu Rev Biochem. 2010; 79: 181-211).

[0293] These insertions and deletions that occur and are subsequently repaired are therefore characteristic of double-strand breaks and are widely used as information on the editing or cleavage efficiency of nucleases. The profile of insertions and deletions depends on the properties of the nuclease that created the double-strand break, but also on the sequence context of the cleavage site. Based on in vitro assays, MG29-1 nuclease cleaved the target strand 22 nucleotides from the PAM (less frequently 21 nucleotides from the PAM) and cleaved the non-target strand 18 nucleotides from the PAM, creating a staggered end of 4 nucleotides located 3' to the PAM. The staggered cleavage often results in larger deletions due to single-strand trimming before end joining.

[0294] Table 9 lists the overall indel frequencies generated by each of the 23 sgRNAs targeting human albumin intron 1 tested in HepG2 cells. Sixteen of the 23 sgRNAs produced detectable indels at the target site, eight sgRNAs produced indels greater than 50%, and five sgRNAs produced indel frequencies greater than 90%. These data demonstrate that MG29-1 nuclease is capable of editing the genome of live cultured human cell lines at the predicted target site for sgRNAs with greater than 90% efficiency.

[0295] Example 31 Demonstration of the ability of nucleases described herein to edit exon regions in cultured mouse hepatocytes Sequence-specific nucleases can be used to disrupt the coding sequence of a gene, thereby creating a functional knockout of a protein of interest. This can be of therapeutic use when knocking down a specific protein has a beneficial effect on a particular disease. One method of disrupting the coding sequence of a gene is to use sequence-specific nucleases to create double-strand breaks in the exon region of the gene. These double-strand breaks are repaired by error-prone repair pathways, generating insertions or deletions that can result in either frameshift mutations or changes to the amino acid sequence that disrupt the function of the protein.

[0296] To evaluate the potential of MG29-1 to generate double-stranded breaks in exon regions of genes expressed in hepatocytes, the gene encoding glycolate oxidase (hao-1) was selected as the target locus. Using the guide discovery algorithm of Geneious Prime nucleic acid analysis software, we identified single guide RNAs (sgRNAs) with a spacer length of 22 nt targeted to exons 1-4 of mouse hao-1 (https: / / www.geneious.com / prime / ). The first four exons of the hao-1 gene comprise approximately 50% of the N-terminus of the hao-1 coding sequence. The first four exons were selected because insertion deletions made toward the N-terminus of the gene's coding sequence are likely to create frameshift or missense mutations that disrupt protein activity. A total of 45 possible sgRNAs within mouse hao-1 exons 1-4 were identified using a PAM of KTTG (sequence number 3870) located 5' to the spacer. Guides spanning intron / exon boundaries were included because they can create indels that interfere with splicing. Geneious Prime was used to search the spacer sequences of these 45 guides against the mouse genome, and the software assigned a specificity score based on alignment to additional sites in the mouse genome. Spacer sequences with identical bases with 4 or more adjacent bases were excluded due to concerns about specificity. A total of 45 spacers with the highest specificity scores were selected for testing.

[0297] To generate sgRNAs, the backbone sequence "TAATTTCTACTGTTGTAGAT" was added to the 3' end of the spacer sequence. sgRNAs were chemically synthesized by incorporating chemically modified bases known to improve the performance of sgRNAs with the cpf1 guide (AltR1 / AltR2 chemistry available from Integrated DNA Technologies). The spacer sequences for these guides are listed in Table 10. Table 10: Spacer sequences of MG29-1 sgRNA targeting mouse hao-1 exons 1-4 and activity in Hepa1-6 cells transfected with MG29-1 / sgRNA RNP.

[0298] [Table 15-1]

[0299] [Table 15-2]

[0300] [Table 15-3]

[0301] Hepa1-6 cells, a transformed mouse hepatocyte cell line, were cultured under standard conditions (DMEM medium containing 10% FBS in a 5% CO2 incubator) and transfected intranuclearly with a ribonucleoprotein formed by mixing sgRNA with purified MG29-1 protein in PBS buffer. A total of 1 e of ribonucleoprotein was transfected into the nucleus using a 4D nucleofection device (Lonza) with an RNP formed by mixing 50 pmol of MG29-1 protein with 100 pmol of sgRNA suspended in complete SF nucleofection reagent (Lonza). 5Hepa1-6 cells were intranuclearly gene-edited. After nucleofection, cells were seeded in DMEM supplemented with 10% FBS in 24-well plates and incubated in a 5% CO2 incubator for 48-72 hours. Genomic DNA was then extracted from the cells using a column-based purification kit (Purelink Genomic DNA Mini Kit, ThermoFisher Scientific) and quantified by absorbance at 260 nm. Exons 1-4 of the mouse hao-1 gene 1 were PCR amplified from 40 ng of genomic DNA in reactions containing 0.5 micromolar paired primers, specific for each exon. The PCR primers used for exon 1 were PCR_mHE1_F_+233 (GTGACCAACCCTACCCGTTT) (sequence number 4171), PCR_mHE1_R_-553 (GCAAGCACCTACTGTCTCGT) (sequence number 4172). The PCR primers used for exon 2 were HAO1_E2_F5721 (CAACGAAGGTTCCCTCCAGG) (SEQ ID NO: 4173), HAO1_E2_R6271 (GGAAGGGTGTTCGAGAAGGA) (SEQ ID NO: 4174). The PCR primers used for exon 3 were HAO1_E3_F23198 (TGCCCTAGACAAGCTGACAC) (SEQ ID NO: 4175), HAO1_E3_R23879 (CAGATTCTGGAAGTGGCCCA) (SEQ ID NO: 4176). The PCR primers used for exon 4 were HAO1_E4_F31087 (CCTGTAGGTGGCTGAGTACG) (SEQ ID NO: 4177), HAO1_E4_R31650 (AGGTTTGGTTCCCCTCACCT) (SEQ ID NO: 4178).

[0302] In addition to primers and genomic DNA, the PCR reaction contained 1x Pfusion Flash PCR Master Mix (Thermo Fisher). The resulting PCR product contained a single band when analyzed on an agarose gel, demonstrating that the PCR reaction was specific, and was purified using a column-based purification kit (DNA Purification and Extraction Kit, Zymo Research). For sequencing, primers complementary to sequences at least 100 nt from each cleavage site were used. The primer for sequence exon 1 was Seq_mHE1_F_+139 (GTCTAGGCATACAATGTTTGCTCA) (sequence number 4179). The primer for sequence exon 2 was 5938F Seq_HAO1_E2 (CTATGCAAGGAAAAGATTTGGCC) (sequence number 4180). The primer for sequence exon 3 was HAO1_E3_F23476 (TCTTCCCCCTTGAATGAAACACT) (SEQ ID NO: 4181) and the inverse PCR primer was HAO1_E3_R23879 (CAGATTCTGGAAGTGGCCCA) (SEQ ID NO: 4182). The primer for sequence exon 4 was the inverse PCR primer HAO1_E4_R31650 (AGGTTTGGTTCCCCTCACCT) (SEQ ID NO: 4183).

[0303] Sequencing of the PCR products showed that these products contained the predicted sequences of hao-1 exons. Primers placed within the predicted 100-350 bp target site for each sgRNA were used to sequence PCR products derived from Hepa16 cells transfected with the different RNPs, or untreated controls. Sanger sequencing chromatograms were analyzed using Inference of CRISPR Edits (ICE), which determines the frequency of indels and indel profiles (Hsiau et.al, Inference of CRISPR Edits from Sanger Trace Data. BioArxiv. 2018 https: / / www.biorxiv.org / content / early / 2018 / 01 / 20 / 251082). When nucleases create double-strand breaks (DSBs) in DNA inside living cells, the DSBs are repaired by cellular DNA repair mechanisms. In actively dividing cells, such as transformed mammalian cells in culture, and under conditions in which no repair template is present, this repair occurs via the NHEJ pathway, which is an error-prone process that introduces base insertions or deletions at the double-stranded break site (Lieber, MR, Annu Rev Biochem. 2010; 79: 181-211). These insertions and deletions that occur and are subsequently repaired are therefore characteristic of double-stranded breaks and are widely used in the art as information on the editing or cutting efficiency of nucleases. As shown in Table 10, 14 guides demonstrated detectable editing at their predicted target sites. Four guides showed editing activity of over 90%. All 14 active guides have a PAM sequence of TTTN, which demonstrates that this PAM is preferred in vivo. However, not all guides utilizing TTTN PAM were active. These data demonstrate that MG29-1 nuclease can generate RNA-guided, sequence-specific double-stranded breaks in exonic regions in cultured hepatocytes with high efficiency.

[0304] Example 32: Design of additional sgRNAs to disrupt the Hao-1 gene Additional sgRNAs were designed to target exon portions of the hao-1 gene. These are set to target the first 4 exons, as they contain approximately 50% of the coding sequence, and insertion deletions made toward the N-terminus of the gene's coding sequence are likely to create frameshift or missense mutations that disrupt protein activity. Using the more restrictive KTTG PAM (SEQ ID NO: 3870), shown in Example 31 to be more active in mammalian cells, a total of 42 potential sgRNAs were identified within human hao-1 exons 1-4 (Table 11).

[0305] [Table 16-1]

[0306] [Table 16-2]

[0307] [Table 16-3]

[0308] We included guides that span intron / exon boundaries because such guides can create indels that interfere with splicing. We used Geneious Prime to search the spacer sequences of these 42 guides against the human genome, and the software assigned a specificity score based on the alignment to the human genome. A higher specificity score indicates a lower likelihood of such guides recognizing one or more sequences in the human genome other than the site for which the spacer was designed. Specificity scores ranged from 10% to 100%, with 25 guides having specificity scores above 90% and 33 guides having specificity scores above 80%. This analysis demonstrates that guides targeting exon regions of human genes with high specificity scores can be readily identified, and it is expected that a large number of highly active guides will be identified.

[0309] Example 33 Comparison of the editing capabilities of the nucleases described herein with those of spCas9 in mouse hepatocytes CRISPR Cas9 nuclease (spCas9), derived from the bacterial species Streptococcus pyogenes, has been widely used for genome editing and is one of the most active RNA-guided nucleases identified. The relative potency of MG29-1 compared to spCas9 was evaluated by nucleofection of different doses of RNP in mouse hepatocyte cell lines, Hepa1-6. The sgRNA targeting intron 1 of mouse albumin was used for both nucleases. For MG29-1, the sgRNA mAlb29-1-8 identified in Example 29 was selected. The guide mAlb29-1-8 (see Example 29) was chemically synthesized by incorporating chemical modifications called AltR1 / AltR2 (Integrated DNA Technologies), which were designed to improve the guiding ability of the V-type nuclease cpf1, which has a similar sgRNA structure as MG29-1. For spCas9, three guides selected from in silico screening were tested to identify sgRNAs that efficiently edited mouse albumin intron 1. The spCas9 protein used in these studies was obtained from a commercial supplier (AltR-sPCas9 from Integrated DNA Technologies).

[0310] The sgRNA mAlbR1 (spacer sequence, TTAGTATAGCATGGTCGAGC) was chemically synthesized and incorporated chemical modifications consisting of 2' O-methyl bases and phosphorothioate (PS) linkages on the three bases at both ends of the guide to improve cellular competence. The sgRNA mAlbR1 generated indels at a frequency of 90% when RNPs composed of 20 pmol spCas9 protein / 50 pmol guide were transfected into Hepa1-6 cells, indicating that it is a highly active guide. RNPs formed with nuclease protein ranging from 20 pmol to 1 pmol and a fixed ratio of protein:sgRNA of 1:2.5 were transfected into Hepa1-6 cells. Sanger sequencing and ICE analysis of PCR-amplified genomic DNA were used to quantitate indels at the target site in mouse albumin intron 1. The results shown in Figure 52 demonstrate that MG29-1 generated a higher percentage of indels than low doses of spCas9 when editing was not saturated. These data indicate that MG29-1 is at least as active, and potentially more active, than spCas9 in liver-derived mammalian cells.

[0311] Example 34 Compilation of sequence variants of nucleases described herein and evaluation in mouse hepatocytes To improve the editing efficiency of MG29-1, a set of mutations substituting one or two amino acids in the MG29-1 coding region was introduced. The set of amino acid substitutions was determined by alignment to Acidaminococcus species (AsCas12a). Different amino acids in AsCas12a were substituted with the goal of either denaturing or improving PAM binding by structure-guided editing (Kleinstiver, et al, Nat Biotechnol. 2019, 37 276-282). Four amino acid substitutions in AsCas12a: S170R, E174R, N577R and K583R, showed high editing efficiency with canonical and non-canonical PAMs. Sites in MG29-1 matching these substitutions were identified by multiple alignments. These sites correspond to S168R, E172R, N577R and K583R in MG29-1.

[0312] To test single amino acid substitutions, a two-plasmid delivery system was used. Standard molecular cloning techniques were used to construct expression plasmids encoding MG29-1 with single amino acid substitutions. One of the plasmids encodes MG29-1 under the CMV promoter, and the second plasmid contains an sgRNA that is mAlb29-1-8 (see Table 8), which has high editing efficiency in Hepa1-6 cells. Transcription of the guide was driven by the human U6 promoter. Confirmation of the initial results with single amino acid substitutions using the two-plasmid system and testing of double amino acid substitutions was performed using in vitro transcribed (IVT) mRNA encoding MG29-1 (see Example 33 for details on how the IVT mRNA was generated) and a chemically synthesized guide incorporating AltR1 / AltR2 chemical modifications optimized for Cpf1 by Integrated DNA Technologies (synthesized at Integrated DNA Technologies). To deliver the two-plasmid system, 100 ng of plasmid encoding MG29-1 and 400 ng of plasmid encoding the guide were mixed with Lipofectamine 3000 and added to Hepa1-6 cells and incubated for 3 days, followed by genomic DNA isolation.

[0313] To deliver IVT mRNA and synthetic guide, 300ng of mRNA and 120ng of synthetic guide were mixed with Lipofectamine Messenger MAX, which was added to the cells and incubated for 2 days, followed by genomic DNA isolation. The synthetic guides screened using IVT mRNA correspond to the guides detailed in Table 8, but for brevity, the guide names in Figure 53 have been shortened to represent guide "mAlb29-1-1" as g1-1 and "mAlb29-1-8" as g1-8. One guide targeting the human T-cell receptor locus (TRAC) was also tested (35TRAC in Figure 53D). Guide 35 TRAC spacer is GAGTCTCTCAGCTGGTACACGG (SEQ ID NO: 4268) with TTTG PAM. Guide 35 TRAC was ordered with the same modifications as already mentioned. Genomic DNA and PCR amplification was performed as described in the previous example for MG29-1 editing of the mouse albumin intron 1. For guide35 TRAC, the human TRAC locus was amplified using primer F: TGCTTTGCTGGGCCTTTTTC (SEQ ID NO: 4269), primer R: ACAGTCTGAGCAAAGGCAGG (SEQ ID NO: 4270). The resulting 957 bp PCR product was purified as previously described. Editing was assessed by Sanger sequencing using primer ATCACGAGCAGCTGGTTTCT (SEQ ID NO: 4271).

[0314] Sanger sequencing of PCR products followed by Inference of CRISPR Edits (ICE) was used to quantify editing efficiency for mouse albumin intron 1 and human TRAC locus. Data representing up to four biological replicates are plotted in Figure 53. The single amino acid substitution S168R demonstrated improved editing efficiency when using the two-plasmid system guide mAlb29-1-8 (Figure 53A). The mutation E172R did not provide a significant improvement with the guide mAlb29-1-8, while the mutation K583R completely prevented editing with the mAlb29-1-8 guide. Transfection with MG29-1 mRNA and the synthetic guide mAlb29-1-8 confirmed the results from plasmid transfection (Figure 53B). The single amino acid substitution S168R conferred even higher editing efficiency across the different concentrations of mRNA tested with the guide mAlb29-1-8 (Figure 53B). Double amino acid substitutions of S168R with E172R (a substitution that alone did not impair activity as seen in Figure 53A), or N577R (a substitution that conferred high editing efficiency of cpf1, although not tested in MG29-1 plasmid transfections) and Y170R (hypothesized to have the potential to improve editing efficiency based on the predicted MG29-1 protein) were tested and compared to the single S168R mutant.

[0315] None of the double mutations improved editing efficiency under the conditions tested (Figure 53C). The editing efficiency of MG29-1 WT and the S168R variant of MG29-1 were compared in parallel with 12 guides targeting the mouse albumin intron 1 and one guide targeting the human T-cell receptor locus (TRAC). The S168R variant of MG29-1 showed improved editing efficiency for all 13 guides, with some of the guides being more beneficial than others (Figure 4D). Importantly, S168R did not impair mammalian editing efficiency for any of the guides tested. These results demonstrate that the S168R (serine at amino acid position 168 changed to arginine) variant of MG29-1 improves editing activity, which is advantageous in identifying highly active guides for therapeutic applications.

[0316] Example 35 Identification of chemical modifications of sgRNAs of nucleases described herein that improve guide stability and improve editing efficiency in mammalian cells RNA molecules are inherently unstable in biological systems due to their susceptibility to cleavage by nucleases. Modification of the natural chemical structure of RNA has been widely used to improve the stability of RNA molecules used in RNA interference (RNAi) for therapeutic drug development (Corey, J Clin Invest. 2007 Dec 3; 117(12): 3615-3622, J.B. Bramsen, J. Kjems Frontiers in Genetics, 3 (2012), p. 154). The introduction of chemical modifications to the nucleobase or phosphodiester backbone of RNA has been important in terms of improving the stability and thus the performance of short RNA molecules in vivo. A wide range of chemical modifications have been developed with different properties in terms of stability against nucleases and affinity to complementary DNA or RNA.

[0317] Similar chemical modifications have been applied to guide RNAs for CRISPR Cas9 nucleases (Hendel et al, Nat Biotechnol. 2015 Sep;33(9):985-989, Ryan et al Nucleic Acids Res 2018 Jan 25;46(2):792-803., Mir et al Nature Communications volume 9, Article number:2641(2018), O'Reilly et al Nucleic Acids Res 2019 47,546-558, Yin et al Nature Biotechnology volume 35,pages 1179-1187(2017), each of which is incorporated by reference in its entirety.

[0318] MG29-1 nuclease is a novel nuclease with a defined amino acid sequence similar to known type V CRISPR enzymes such as cpf1. Although the sequence of the structural (backbone) components of the guide RNA identified for MG29-1 is similar to that of cpf1, it was not known which chemical modifications to the MG29-1 guide could improve stability while retaining activity. A series of chemical modifications of the MG29-1 sgRNA were designed to assess their effect on sgRNA activity in mammalian cells and stability in the presence of mammalian cell protein extracts.

[0319] We selected sgRNA mAlb29-1-8, which is highly active in the mouse hepatocyte cell line, Hepa1-6, when the guide contains a set of unique chemical modifications developed by IDT known as AltR1 / AltR2 that are designed to improve the activity of the guide RNA in cpf1, and is commercially available (IDT). We chose to test two chemical modifications of the nucleobase: 2'-O-methyl, which replaces the 2' hydroxyl group with a methyl group, and 2'-fluoro, which replaces the 2' hydroxyl group with a fluorine. Both 2'-O-methyl and 2'-fluoro modifications improve resistance to nucleases. The 2'-O-methyl modification is naturally present after transcriptional modification of RNA and improves the binding affinity of the RNA:RNA duplex, but has little effect on RNA:DNA stability. 2'-Fluoro modified bases reduce immune activating effects and increase the binding affinity of both RNA:RNA and RNA:DNA hybrids (Pallan et al Nucleic Acids Res 2011 Apr;39(8):3482-95, Chen et al Scientific Reports volume 9,Article number:6078(2019), Kawasaki,AMet al J Med Chem 36,831-841(1993)).

[0320] The inclusion of phosphorothioate (PS) linkages instead of phosphodiester bonds between the bases was also evaluated, as PS linkages improve resistance to nucleases (Monia et al Nucleic Acids, Protein Synthesis, and Molecular Genetics | Volume 271, ISSUE 24, P14533-14540, June 14, 1996).

[0321] The predicted secondary structure of MG29-1 sgRNA with a spacer (mAlb29-1-8) targeting mouse albumin intron 1 is shown in Figure 54. Based on what is known about other CRISPR-Cas systems, we presumed that the stem loop in the backbone portion of the guide is important for interaction with the MG29-1 protein. Based on the secondary structure, we designed a series of chemical modifications in different structural and functional regions of the guide. We adopted a modular approach that allows for the initial testing of guides with fewer chemical modifications, which will inform us which structural and functional regions of the guide can tolerate different chemical modifications without significantly compromising activity. The structural and functional regions were defined as follows: The 3' and 5' ends of the guide are targets for exonucleases and can be protected by various chemical modifications, including 2'-O-methyl and PS linkages, an approach used to improve the stability of spCas9 guides (Hendel et al, Nat Biotechnol. 2015 Sep;33(9):985-989).

[0322] For modification, sequences were selected that included both the stem and half of the loop of the backbone region of the guide. The spacer was divided into the seed region (the first 6 nucleotides closest to the PAM) and the remaining 16 nucleotides of the spacer (referred to as the non-seed region). In total, 43 guides were designed and 39 were synthesized. All 43 guides contain identical nucleotide sequences but differ in chemical modifications. The editing activity of the 39 guides was evaluated in Hepa1-6 cells by nucleofection of RNPs, or by co-transfection of mRNA encoding MG29-1 and the guides, or by both of these methods. These two transfection methods may affect the observed activity of the guides due to differences in their delivery to the cells.

[0323] When using RNP nucleofection, the guide and MG29-1 protein are precombined in vitro and then delivered to cells using nucleofection. In this nucleofection, an electric current is applied to a cell suspension in the presence of RNPs. The electric current creates transient pores in the cell membrane (and possibly also the nuclear membrane), allowing RNPs to enter the cell driven by the charge in the RNPs. It is not clear whether RNPs enter the nucleus via the pores generated by the electric current, or via engineered nuclear localization signals in the protein components of the RNPs, or a combination of the two.

[0324] When co-transfection of mRNA and guide is used with lipid transfection reagents such as Messenger MAX, the mixture of the two RNAs forms a complex with positively charged lipids. This complex enters the cell by endocytosis and eventually reaches the cytoplasm, where the mRNA is translated into protein. In the case of RNA-guided nucleases such as MG29-1, the resulting MG29-1 protein is presumed to form a complex with the guide RNA in the cytoplasm before entering the nucleus in a process mediated by a nuclear localization signal engineered into the MG29-1 protein.

[0325] Because it takes a certain amount of time for the mRNA to be translated into sufficient amounts of MG29-1 protein and for the MG29-1 protein to subsequently bind to the guide RNA, the guide RNA may need to remain intact in the cytoplasm for longer than when preformed RNPs are delivered by nucleofection. Thus, lipid-based mRNA / sgRNA co-transfection requires a more stable guide than RNP nucleofection, which results in some guide chemistry that is active like an RNP, but may be inactive when co-transfected with the mRNA using cationic lipid reagents.

[0326] Guides mAlb298-1 to mAlb298-5 contain chemical modifications only at the 5' and 3' ends of the sequence, using a mixture of 2'-O-methyl and 2' fluoro bases + PS linkages. Compared to sgRNAs without chemical modifications, these guides were 7- to 11-fold more active when delivered via RNP, demonstrating that terminal modifications to guides improve guide activity, presumably due to improved resistance to exonucleases. sgRNAs mAlb298-1 to mAlb298-5 showed 64-114% editing activity of guides containing commercially available chemical modifications (AltR1 / AltR2). Guide 4, although containing the greatest number of chemical modifications, had the least activity of the terminally modified guide; however, it still had 7-fold more activity than the unmodified guide. The guide mAlb298-30, which contains three 2'-O methyl bases and two PS bonds at the 5' end and four 2'-O methyl bases and three PS bonds at the 5' end, also showed approximately 10-fold higher activity than the unmodified guide, and showed similar or slightly improved activity when co-transfected with RNA compared to mAlb298-1. These data demonstrate that 2'O-methyl combined with PS bonds at both ends of the MG29-1 guide significantly enhanced guide activity compared to the unmodified guide.

[0327] Combinations of 2'-fluoro bases and PS bonds were also tolerated at the 3' end of the guide. Guide mAlb298-28 contains three 2'-fluoro bases and two PS bonds at the 5' end and four 2'-fluoro bases and three PS bonds at the 3' end. This end-modified guide retained good editing activity similar to guides with 2'-O methyl and PS modifications at both ends, demonstrating that 2'-fluoro can be used in place of 2'-O methyl to improve guide stability and retain editing activity.

[0328] The sgRNAs mAlb298-6, mAlb298-7, and mAlb298-8 contain identical minimal chemical modifications at both the 5' and 3' ends, with mAlb298-1 + PS linkages in different regions of the stem. PS linkages in the 3' stem (mAlb298-6) and 5' stem (mAlb298-7) reduced activity by approximately 30% compared to mAlb298-1 in RNP nucleofection assays, indicating that these modifications can be tolerated. A significant reduction in activity was observed with lipid-based transfection.

[0329] Introducing PS linkages in both the 3' and 5' stems (mAlb298-8) reduced activity by approximately 80% compared to mAlb298-1 in RNP nucleofection assays and by more than 95% in lipid transfection assays, indicating that the combination of the two PS linkage modifications severely impaired the function of the guide.

[0330] The sgRNA mAlb298-9 contains the same minimal chemical modifications at both the 5' and 3' ends that are present in the PS binding of the mAlb298-1+ loop and showed similar activity to mAlb298-1, indicating that the PS binding of the loop is well tolerated.

[0331] The sgRNAs mAlb298-10, mAlb298-11, and mAlb298-12 contain the same minimal chemical modifications at both the 5' and 3' ends, with mAlb298-1 + 2'-O methyl bases in different regions of the stem. The inclusion of 2'-O methyl bases in either the 3' stem (mAlb298-11) or 5' stem (mAlb298-12), or both halves of the stem (mAlb298-10), was generally well tolerated with slightly reduced activity when comparing the most active guide, mAlb298-12 (5' stem modification), to mAlb298-1.

[0332] The guide mAlb298-14 contains the same minimal chemical modifications at both the 5' and 3' ends that are present in mAlb298-1+ in combination with both 2'-O-methyl bases and PS linkages in the stem halves. It had no editing activity in RNP nucleofection or lipid-based RNA co-transfection. This confirms and validates the results that mAlb298-8, which contains only PS linkages in both stems, retained low levels of activity, indicating that extensive chemical modifications in both stem halves render the guide inactive.

[0333] The sgRNA mAlb298-13 contains identical minimal chemical modifications at both the 5' and 3' ends present in PS bonds spaced every other base throughout the remainder of the mAlb298-1+ backbone and the entire spacer except for the seed region of the spacer. These modifications resulted in a dramatic loss of editing activity close to background levels. Although this guide was only about 50% pure, compared to >75% purity for most guides, they were unable to cause a complete loss of editing activity. This demonstrates that distributing PS bonds in an essentially random manner throughout the guide is not an effective approach to improve guide stability while retaining editing activity.

[0334] Guides mAlb298-15 and mAlb298-16 contain identical minimal chemical modifications at both the 5' and 3' ends, with mAlb298-1 plus extensive PS linkages in the backbone. Both guides retained approximately 35% of mAlb298-1 activity by RNP nucleofection, while only 3% of mAlb298-1 activity by lipid-based RNA co-transfection. This indicates that extensive PS modification of the backbone significantly reduced editing activity. Combining PS linkages in the backbone with PS linkages in the spacer region, as in mAlb298-17 and mAlb298-18, resulted in further loss of activity, consistent with the observation that random inclusion of PS linkages hampers the ability of guides for direct editing by MG29-1.

[0335] The guide, mAlb298-19, contains the same chemical modifications in the spacer as mAlb298-1, but in the backbone region, the 5' end has four more 2'O-methyl bases and 14 more PS bonds. The activity of mAlb298-19 was about 40% of that of mAlb298-1 by RNP nucleofection, but only 22% by RNA cotransfection. This further demonstrates that extensive chemical modifications in the backbone region of the guide are not well tolerated.

[0336] Guides mAlb298-20, mAlb298-21, mAlb298-22, and mAlb298-23 have identical chemical modifications in the backbone region, consisting of a single 2'-O-methyl at the 5' end and two PS bonds, the same 5' end modification as mAlb298-1. The spacer region of guides mAlb298-20, mAlb298-21, mAlb298-22, and mAlb298-23 contains a combination of 2'-O-methyl and 2'-fluoro bases, as well as PS bonds. The most active of these four guides is mAlb298-2, in which 2'-fluoro modifications were made to all bases of the spacer, except for the seven bases closest to the PAM (seed region) and the final base at the 3' end, which was modified with a 2'-O-methyl and two PS bonds. This demonstrates that including 2'-fluoro modifications in most of the spacer, except for the seed region, does not significantly reduce activity, thereby representing a good strategy to enhance guide stability.

[0337] Guides mAlb298-24, mAlb298-25, mAlb298-26, and mAlb298-8 have identical chemical modifications in the backbone. mAlb298-8, which has PS bonds in both halves of the stem, significantly reduced the editing activity to only 24% (2% of guide mAlb298-1), demonstrating that these PS bonds impaired the activity. Interestingly, the editing activity of mAlb298-24 and mAlb298-25 was also low, but the activity of mAlb298-26 was improved compared to mAlb298-8. This indicates that further modification of mAlb298-26, including 2'-fluoro bases at 14 bases in the spacer (excluding the seed region), can rescue the reduced editing activity caused by the PS bonds in the stem. This provides further evidence that 2'-fluoro bases in the spacer have a beneficial effect on editing activity.

[0338] The guides mAlb298-27 and mAlb298-29 contain extensive base and PS modifications throughout the backbone and inactive spacer regions, further indicating that not all chemical modifications of the guides retain editing activity.

[0339] Based on the structure-activity relationships derived from the analysis of the mAlb298-1 to mAlb298-30 guides, a further set of seven guides were designed and engineered by RNP nucleofection and lipid-based RNA co-transfection of Hepa1-6 cells. These guides combine chemical modifications that have been observed to retain good editing activity in the mAlb298-1 to mAlb298-30 guides. Guides mAlb298-31 to mAlb298-37 all contain terminal modifications consisting of at least one 2'-O methyl and two PS linkages at the 5' end and one 2'-O methyl and one PS linkage at the 5' end. In addition to the terminal modifications, combining both 2'-O methyl bases in half of the stem and 2'-fluoro bases in 14 bases of the spacer (excluding the seed region), as in mAlb298-31, resulted in slightly improved editing activity compared to the unmodified guides, or a 10-fold improvement similar to the terminal modifications alone. Combining 2'-O methyl bases in the appropriate 5' stem with 2'-fluoro bases 14 bases into the spacer (excluding the seed region), as in mAlb298-32, resulted in the most active guide tested.

[0340] Similarly, combining PS linkages in the appropriate loops with 2'-fluoro bases in 14 bases of the spacer (excluding the seed region), as in mAlb298-33, resulted in potent activity up to 15-fold higher than the unmodified guide. Guide mAlb298-37 combines an even greater amount of 3'-end modifications with 2'-O methyl bases in the 5' stem, PS linkages and 14 2' fluoro bases in the loop, and 3 PS linkages in the spacer (excluding the seed region). This guide still retained editing activity similar to that of the AltR1 / R2 modification, and was significantly improved compared to the unmodified guide. Thus, mAlb298-37 represents a heavily modified MG29-1 guide that retains potent editing activity in mammalian cells. Guide mAlb298-38 showed potent editing activity when delivered as RNP, but was completely inactive when delivered to cells by lipid-based RNA co-transfection. This suggests that such guides may have some unexpected sensitivity to nucleases. mAlb298-39, an identical guide to mAlb298-37 except that it has 11 fewer 2'-fluoro bases and one less PS linkage in the spacer, had the highest editing activity considering both RNP and mRNA transfection methods, but it has fewer chemical modifications than some other guide designs that may be detrimental in terms of in vivo performance.

[0341] Further combinations of chemical modifications were designed to create mAlb298-40 to mAlb298-43, which have a greater amount of chemical modifications but can also retain good editing activity. For example, in mAlb298-41, which also incorporates some DNA bases, only six bases are unmodified ribonucleotides. Similarly, mAlb298-42 contains 2'-fluoro groups throughout the entire spacer and has five unmodified ribonucleotides. We expect that these and other guide chemical modifications will result in one or more optimized designs. Nevertheless, within the set of guides mAlb298-1 to mAlb298-39, and especially within the set of mAlb298-31 to mAlb298-39, we identify guides with a greater amount of chemical modifications that retain editing activity similar to or better than that of unmodified guides or guides with appropriate terminal modifications.

[0342] To test the stability of chemically modified guides compared to guides without chemical modifications (natural RNA), a stability assay using crude cell extracts was used. Crude cell extracts derived from mammalian cells were chosen because they must contain a mixture of nucleases to which guide RNAs are exposed when delivered to mammalian cells in vitro or in vivo. Hepa1-6 cells were harvested by adding 3 ml of cold PBS per 15 cm dish of confluent cells and using a cell scraper to release the cells from the dish surface. Cells were pelleted at 200 g for 10 min and frozen at -80 °C for future use. For stability assays, cells were resuspended in 4 volumes of cold PBS (e.g., for a 100 mg pellet, cells were resuspended in 400 μL of cold PBS). Triton X-100 was added to a final concentration of 0.2% (v / v) and cells were vortexed for 10 s, placed on ice for 10 min, and vortexed again for 10 s. Triton X-100 is a mild non-ionic detergent that disrupts cell membranes but does not inactivate or denature proteins at the concentrations used.

[0343] Stability reactions were set up on ice. This consisted of 20 μL of crude cell extract containing 100 fmol of each guide (1 μL of 100 nM stock). Six reactions were set up for each guide, consisting of loading, 15 min, 30 min, 60 min, 240 min and 540 min (times in minutes refer to the length of time each sample was incubated). Samples were incubated at 37°C for 15 min up to 540 min, with loading controls placed on ice for 5 min. After each incubation period, reactions were stopped by adding 300 μL of a mixture of phenol and guanidine thiocyanate (Tri reagent, Zymo Research), which immediately denatured all proteins and efficiently inhibited ribonucleases, facilitating the subsequent recovery of RNA. After adding Tri reagent, samples were vortexed for 15 s and stored at -20°C. RNA was extracted from samples using a Direct-zol RNA miniprep kit (Zymo Research) and eluted in 100 μL of nuclease-free water. Detection of modified guides was performed using Taqman RT-qPCR using Taqman miRNA assay technology (Thermo Fisher) and primers and probes designed to specifically detect the sequence of the mAlb298 sgRNA, which is identical for all of the guides. Data was plotted as a function of the percentage of sgRNA remaining compared to the input sample. Guides without chemical modifications were removed most rapidly when incubated with cell extract (Figure 55), with over 90% of guides degraded within 30 minutes. Guides with AltR1 / AltR2 (AltR in Figure 55) chemical modifications were slightly more stable than unmodified guides in the presence of cell extract, with approximately 80% of guides degraded in 30 minutes. A guide, mAlb298-31, containing chemical modifications at both ends as well as 2'O-methyl bases in both stems and 2'-fluoro bases at all positions in the spacer except the seed region, was significantly more stable than either the unmodified guide or the AltR guide.

[0344] Guide mAlb298-34 showed improved stability compared to guide mAlb298-31. Guide mAlb298-34 differs from guide mAlb298-31 only in the chemical modifications within the spacer. mAlb298-34 has nine fewer 2'-fluoro bases in the spacer than mAlb298-31, but contains four PS bonds in the spacer compared to two PS bonds in mAlb298-31. Since 2'-fluoro bases improve RNA stability, this suggests that the additional PS bonds in the spacer are responsible for the improved stability of mAlb298-34 compared to mAlb298-31.

[0345] Guide mAlb298-37 was the most stable of all guides tested, with 80% remaining after 240 min (4 h), significantly more stable than guide mAlb298-34, where 30% remained. The chemical modifications of mAlb298-37 differ from guide mAlb298-34 in both the spacer and backbone regions. mAlb298-37 has two additional 2'-O-methyl groups and two additional PS bonds at the 5' end. In addition, the loop region of mAlb298-37 contains PS bonds and does not contain the 2'-O-methyl groups present in the second half of the stem of mAlb298-34. Additionally, the spacer of mAlb298-37 contains nine more 2'-fluoro bases, but contains the same number of PS bonds as mAlb298-34, albeit in a different arrangement.

[0346] Overall, these data suggest that additional PS binding at the 5' end of the spacer and at the loop in the backbone region significantly improves the stability of the guide RNA. Among the guides tested, mAlb298-37, the guide with the greatest stability in cell extracts, also showed strong editing activity in Hepa1-6 cells, which was similar or improved compared to AltR1 / Altr2 modifications and improved compared to chemical modifications at only the 5' and 3' ends.

[0347] [Table 17-1]

[0348] [Table 17-2]

[0349] [Table 17-3]

[0350] [Table 17-4]

[0351] [Table 17-5]

[0352] [Table 17-6]

[0353] [Table 17-7]

[0354] [Table 17-8]

[0355] Example 36 Therapeutic gene editing in mice using nucleases described herein The gene editing platform described herein may affect repair degeneration in vivo. Liver tissue is an example of a tissue that can be advantageously targeted using the gene editing compositions and systems described herein for in vivo gene editing, for example, by introducing an indel that acts to knock down the expression of harmful genes and / or is used to replace defective genes. For example, some genetic diseases arise from defects in proteins that are primarily expressed in the liver, and in vivo delivery to the liver has been shown to be safe and effective in clinical trials with adeno-associated virus (AAV) vectors. Lipid nanoparticles for delivery of approved drugs for nucleic acid and RNAi strategies have also been shown. Liver tissue also contains the appropriate cellular machinery to effectively secrete proteins into the systemic circulation.

[0356] A subject having a condition in Table 13 or Table 14 is selected for gene editing therapy. For example, a human or mouse model subject suffering from hemophilia A is identified for treatment with gene replacement therapy using the gene editing platform.

[0357] [Table 18]

[0358] [Table 19]

[0359] A gene editing platform comprising lipid nanoparticles (LNPs) encapsulating sgRNA and mRNA encoding MG nuclease as described herein, and AAV (e.g., AAV serotype 8) comprising donor template nucleic acid encoding therapeutic gene is intravenously introduced into the liver of a subject. Surface functionalization of LNPs targets LNPs to hepatocytes.

[0360] For example, a subject suffering from hemophilia A is treated with a gene replacement platform comprising an LNP containing an mRNA (SEQ ID NO: 214) encoding the MG29-1 nuclease described herein. The LNP also contains an sgRNA specific to albumin I, which is highly expressed in the liver (e.g., albumin can be expressed in the liver at about 5 g / dL, while factor VIII can be expressed in the liver at about 10 μg / dL, i.e., one million times less than albumin). In addition to the LNP, an AAV8 (AAV serotype 8) viral particle containing a plasmid encoding a replacement template DNA encoding a factor VIII replacement nucleotide sequence is also delivered to the subject. Once inside the cell, the mRNA, sgRNA, and template DNA are transiently expressed. The MG29-1 nuclease uses the sgRNA to target a target locus in the host hepatocyte DNA and cleaves the host DNA. The donor template DNA transcribed from the plasmid delivered to the host hepatocyte within AAV8 is spliced ​​into the cell and stably integrated into the host DNA at the target site of the albumin I gene. The inserted factor VIII DNA is expressed under the albumin promoter.

[0361] A gene editing platform is also used in subjects selected for gene knockdown therapy. For example, a subject exhibiting hereditary ATTR amyloidosis is treated with LNPs containing mRNA (SEQ ID NO: 214) encoding MG29-1 nuclease as described herein and sgRNA specific to a target site in the transthyretin gene. MG29-1 nuclease and sgRNA are delivered and expressed in the liver cells of the subject. In some embodiments, sgRNA is targeted to the stop codon of the transthyretin gene, removing the activity of MG29-1 nuclease from the endogenous stop codon, effectively knocking down the expression of the gene. In some embodiments, the gene knockdown platform includes AAV8 containing a plasmid encoding a polynucleotide that includes a stop codon. When AAV8 is delivered to the same cell expressing nuclease and sgRNA, the exogenous stop codon is spliced ​​into the transthyretin gene. This results in knockdown of gene expression as a result of premature truncation of the protein being translated from the RNA produced from the edited DNA.

[0362] Although preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. The present invention is not intended to be limited by the specific examples provided within the specification. Although the present invention has been described with reference to the above specification, the description and illustration of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes and substitutions will occur to those skilled in the art without departing from the present specification. Furthermore, it should be understood that all aspects of the present invention are not limited to the specific depictions, configurations or relative proportions described herein, which depend upon various conditions and variables. It should be understood that various alternatives to the embodiments of the present invention described herein may be utilized in the practice of the present invention. It is therefore intended that the present invention also encompass any such alternatives, modifications, variations or equivalents. The following claims are intended to define the scope of the invention, and it is intended to encompass methods and structures within the scope of these claims and their equivalents.

Claims

1. 1. An engineered nuclease system comprising: (a) an endonuclease comprising a RuvC domain, the endonuclease being derived from an uncultured microorganism and being a Cas12a endonuclease; (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease and comprising a spacer sequence configured to hybridize to a target nucleic acid sequence.

2. 1. An engineered nuclease system comprising: (a) an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1 to 3470, or a variant thereof; (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease and comprising a spacer sequence configured to hybridize to a target nucleic acid sequence.

3. 1. An engineered nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 3862-3913, wherein the endonuclease is a class 2 type V Cas endonuclease; (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease and comprising a spacer sequence configured to hybridize to a target nucleic acid sequence.

4. The engineered nuclease system of any one of claims 1 to 3, wherein the endonuclease further comprises a zinc finger-like domain.

5. 5. The engineered nuclease system of any one of claims 1-4, wherein the guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3471, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, -3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857.

6. 1. An engineered nuclease system comprising: (a) an engineered guide RNA comprising a sequence having at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857; (b) a class 2 type V Cas endonuclease configured to bind to the engineered guide RNA.

7. 7. The engineered nuclease system of any one of claims 1 to 6, wherein the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 3863-3913.

8. 8. The engineered nuclease system of any one of claims 1 to 7, wherein the guide RNA comprises a sequence complementary to a polynucleotide sequence of a eukaryotic, fungal, plant, mammalian, or human genome.

9. 9. The engineered nuclease system of any one of claims 1 to 8, wherein the guide RNA is 30 to 250 nucleotides in length.

10. 10. The engineered nuclease system of any one of claims 1 to 9, wherein the endonuclease comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease.

11. 11. The engineered nuclease system of any one of claims 1 to 10, wherein the NLS comprises a sequence that is at least 80% identical to a sequence in the group consisting of SEQ ID NOs: 3938 to 3953.

12. 11. The engineered nuclease system of any one of claims 1 to 10, wherein the endonuclease comprises at least one of the following mutations: S168R, E172R, N577R, or Y170R, when the sequence of the endonuclease is optimally aligned to SEQ ID NO:

215.

13. 11. The engineered nuclease system of any one of claims 1 to 10, wherein the endonuclease comprises the mutations S168R and E172R when the sequence of the endonuclease is optimally aligned against SEQ ID NO:

215.

14. 11. The engineered nuclease system of any one of claims 1 to 10, wherein the endonuclease comprises the mutations N577R or Y170R when the sequence of the endonuclease is optimally aligned to SEQ ID NO:

215.

15. 11. The engineered nuclease system of any one of claims 1 to 10, wherein the endonuclease comprises the mutation S168R when the sequence of the endonuclease is optimally aligned against SEQ ID NO:

215.

16. 16. The engineered nuclease system of claim 15, wherein the endonuclease does not contain a mutation at E172, N577, or Y170.

17. A single-stranded or double-stranded DNA repair template, comprising: a first homology arm comprising a sequence of at least 20 nucleotides 5' to 3', i.e. 5' to said target deoxyribonucleic acid sequence; and a second homology arm comprising a synthetic DNA sequence of at least 10 nucleotides and a sequence of at least 20 nucleotides 3' to said target sequence.

17. The engineered nuclease system of any one of claims 1 to 16, further comprising:

18. 18. The engineered nuclease system of claim 17, wherein the first homology arm or the second homology arm comprises a sequence of at least 40, 80, 120, 150, 200, 300, 500, or 1,000 nucleotides.

19. 19. The engineered nuclease system of any one of claims 12 to 18, wherein the first homology arm and the second homology arm are homologous to a prokaryotic, bacterial, fungal, or eukaryotic genomic sequence.

20. The engineered nuclease system of any one of claims 12 to 19, wherein the single-stranded or double-stranded DNA repair template comprises a transgene donor.

21. 21. The engineered nuclease system of any one of claims 1 to 20, further comprising a DNA repair template comprising a double-stranded DNA segment flanked by one or two single-stranded DNA segments.

22. 22. The engineered nuclease system of claim 21 , wherein a single-stranded DNA segment is conjugated to the 5' end of the double-stranded DNA segment.

23. 22. The engineered nuclease system of claim 21 , wherein the single-stranded DNA segment is conjugated to the 3' end of the double-stranded DNA segment.

24. 24. The engineered nuclease system of any one of claims 21 to 23, wherein the single-stranded DNA segment has a length of 4 to 10 nucleotide bases.

25. 25. The engineered nuclease system of any one of claims 21 to 24, wherein the single-stranded DNA segment has a nucleotide sequence complementary to a sequence within the spacer sequence.

26. 26. The engineered nuclease system of any one of claims 21 to 25, wherein the double-stranded DNA sequence comprises a barcode, an open reading frame, an enhancer, a promoter, a protein coding sequence, an miRNA coding sequence, an RNA coding sequence, or a transgene.

27. 26. The engineered nuclease system of any one of claims 21 to 25, wherein the double-stranded DNA sequence is flanked by nuclease cleavage sites.

28. 28. The engineered nuclease system of claim 27, wherein the nuclease cleavage site comprises a spacer sequence and a PAM sequence.

29. The nuclease system is ２＋ 29. The engineered nuclease system of any one of claims 1 to 28, further comprising a source.

30. 30. The engineered nuclease system of any one of claims 1 to 29, wherein the guide RNA comprises a hairpin comprising at least 8, at least 10, or at least 12 base pairs of ribonucleotides.

31. 31. The engineered nuclease system of claim 30, wherein the hairpin comprises 10 base pairs of ribonucleotides.

32. a) the endonuclease comprises a sequence at least 75%, 80%, or 90% identical to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof; b) the guide RNA structure comprises a sequence that is at least 80% or 90% identical to the non-degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857; 32. An engineered nuclease system according to any one of claims 1 to 31.

33. 33. The engineered nuclease system of any one of claims 1 to 32, wherein the endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 3863-3913.

34. 33. The engineered nuclease system of any one of claims 1 to 32, wherein the endonuclease is configured to bind to a PAM comprising SEQ ID NO:3871.

35. 35. The engineered nuclease system of any one of claims 5 to 34, wherein the sequence identity is determined by BLASTP, CLUSTALW, MUSCLE, MAFFT algorithms, or CLUSTALW algorithms with Smith-Waterman homology search algorithm parameters.

36. The engineered nuclease system of claim 35, wherein the sequence identity is determined by the BLASTP homology search algorithm using a BLOSUM62 scoring matrix setting parameters of word length (W) of 3, expectation (E) of 10, and gap costs at occurrence and extension of 11, and using an adjustment of the conditional combination scoring matrix.

37. An engineered guide RNA, a) a DNA target segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule; b) a protein-binding segment comprising two complementary sequences of nucleotides that hybridize to form a double-stranded RNA (dsRNA) duplex; said two complementary sequences of nucleotides are covalently linked to one another with intervening nucleotides; An engineered guide RNA, wherein the engineered guide ribonucleic acid polynucleotide is capable of forming a complex with an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, and targeting the complex to the target sequence of the target DNA molecule.

38. 38. The engineered guide ribonucleic acid polynucleotide of Claim 37, wherein the DNA target segment is located 3' to both of the two complementary stretches of nucleotides.

39. The engineered guide ribonucleic acid polynucleotide of claims 37-38, wherein the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to non-degenerate nucleotides of SEQ ID NOs: 3608-3609.

40. 40. The engineered guide ribonucleic acid polynucleotide of any one of claims 37-39, wherein the double-stranded RNA (dsRNA) duplex comprises at least 5, at least 8, at least 10, or at least 12 ribonucleotides.

41. A deoxyribonucleic acid polynucleotide encoding the engineered guide ribonucleic acid polynucleotide of any one of claims 1 to 40.

42. 1. A nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, said nucleic acid encoding a class 2 type V Cas endonuclease, said endonuclease being derived from an uncultured microorganism, and said organism being other than said uncultured organism.

43. 43. The nucleic acid of claim 42, wherein the endonuclease comprises a variant having at least 70%, or at least 80% sequence identity to any one of SEQ ID NOs: 1-3470.

44. 44. The nucleic acid of claim 42 or 43, wherein the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease.

45. The nucleic acid of claim 44, wherein the NLS comprises a sequence selected from SEQ ID NOs: 3938-3953.

46. 46. ​​The nucleic acid of claim 44 or 45, wherein the NLS comprises SEQ ID NO: 3939.

47. 47. The nucleic acid of claim 46, wherein the NLS is proximal to the N-terminus of the endonuclease.

48. 46. ​​The nucleic acid of claim 44 or 45, wherein the NLS comprises SEQ ID NO: 3938.

49. 49. The nucleic acid of claim 48, wherein the NLS is proximal to the C-terminus of the endonuclease.

50. 50. The nucleic acid of any one of claims 42 to 49, wherein the organism is a prokaryote, a bacterium, a eukaryote, a fungus, a plant, a mammal, a rodent, or a human.

51. A genetically engineered vector comprising a nucleic acid sequence encoding a class 2 type V Cas endonuclease, wherein the endonuclease is derived from an uncultured microorganism.

52. A genetically engineered vector comprising a nucleic acid according to any one of claims 42 to 46.

53. 42. A genetically engineered vector comprising the deoxyribonucleic acid polynucleotide of claim 41.

54. 54. The genetically engineered vector of any one of claims 51 to 53, wherein the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV)-derived viral particle, a lentivirus, or an adenovirus.

55. A cell comprising the vector according to any one of claims 51 to 54.

56. 56. A method for producing an endonuclease, comprising culturing the cell of claim 55.

57. 1. A method for binding, cleaving, marking or modifying a double-stranded deoxyribonucleic acid polynucleotide, comprising: (a) contacting the double stranded deoxyribonucleic acid polynucleotide with a class 2 type V Cas endonuclease in a complex comprising the endonuclease and an engineered guide RNA configured to bind to the double stranded deoxyribonucleic acid polynucleotide; the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); The method, wherein the PAM comprises a sequence comprising any one of SEQ ID NOs: 3863-3913.

58. 58. The method of Claim 57, wherein the double stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide RNA and a second strand comprising the PAM.

59. 59. The method of Claim 58, wherein the PAM is immediately adjacent to the 5' end of the sequence complementary to the sequence of the engineered guide RNA.

60. 60. The method of any one of claims 57-59, wherein the PAM comprises SEQ ID NO:3871.

61. The method of any one of claims 57 to 60, wherein the class 2 type V Cas endonuclease is derived from an uncultured microorganism.

62. 62. The method of any one of claims 57 to 61, wherein the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.

63. 11. A method of modifying a target nucleic acid locus, the method comprising delivering to the target nucleic acid locus an engineered nuclease system according to any one of claims 1 to 36, wherein the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure, the complex being configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies the target nucleic acid locus.

64. 64. The method of claim 63, wherein modifying the target nucleic acid locus comprises binding the target nucleic acid locus, nicking the target nucleic acid locus, truncating the target nucleic acid locus, or marking the target nucleic acid locus.

65. 65. The method of claim 63 or 64, wherein the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).

66. 64. The method of claim 63, wherein the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA.

67. 67. The method of any one of claims 63 to 66, wherein the target nucleic acid locus is in vitro.

68. 67. The method of any one of claims 63 to 66, wherein the target nucleic acid locus is intracellular.

69. 69. The method of claim 68, wherein the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, a human cell, or a primary cell.

70. 70. The method of claim 68 or 69, wherein the cell is a primary cell.

71. 71. The method of claim 70, wherein the primary cell is a T cell.

72. 71. The method of claim 70, wherein the primary cell is a hematopoietic stem cell (HSC).

73. 73. The method of any one of claims 63 to 72, wherein delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid according to any one of claims 42 to 46, or a vector according to any one of claims 51 to 54.

74. 74. The method of any one of claims 63 to 73, wherein delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease.

75. 75. The method of Claim 74, wherein the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked.

76. 76. The method of any one of claims 63-75, wherein delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease.

77. 77. The method of any one of claims 63-76, wherein delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide.

78. 77. The method of any one of claims 63-76, wherein delivering the engineered nuclease system to the target nucleic acid locus comprises delivering deoxyribonucleic acid (DNA) encoding the engineered guide RNA operably linked to a ribonucleic acid (RNA) pol III promoter.

79. 79. The method of any one of claims 63 to 78, wherein the endonuclease induces a single-stranded or double-stranded break at or near the target locus.

80. 80. The method of claim 79, wherein the endonuclease induces a staggered single-stranded break within or 3' to the target locus.

81. 1. A method for editing a TRAC locus in a cell, comprising: (a) an RNA-guided endonuclease, and (b) contacting the cell with an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease, and wherein the engineered guide RNA comprises a spacer sequence configured to hybridize to a region of the TRAC locus; The method of claim 1, wherein the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 4316-4369.

82. 82. The method of Claim 81, wherein the RNA-guided nuclease is a Cas endonuclease.

83. 83. The method of claim 82, wherein the Cas endonuclease is a class 2 type V Cas endonuclease.

84. 84. The method of claim 83, wherein the class 2 type V Cas endonuclease comprises a RuvC domain comprising a RuvCI subdomain, a RuvCII subdomain, and a RuvCIII subdomain.

85. The method of claim 83 or 84, wherein the class 2 type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof.

86. 86. The method of any one of claims 81-85, wherein the engineered guide RNA further comprises a sequence having at least 80% sequence identity to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857.

87. 86. The method of any one of claims 81-85, wherein the endonuclease comprises a sequence that is at least 75%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof.

88. 88. The method of Claim 87, wherein the guide RNA structure comprises a sequence that is at least 80%, or at least 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.

89. 89. The method of any one of claims 81-88, wherein the method further comprises contacting or introducing into the cell a donor nucleic acid comprising a cargo sequence flanked on the 3' or 5' end by a sequence having at least 80% identity to any one of SEQ ID NOs: 4424 or 4425.

90. 90. The method of any one of claims 81 to 89, wherein the cells are peripheral blood mononuclear cells (PBMCs).

91. 90. The method of any one of claims 81 to 89, wherein the cell is a T cell, or a precursor thereof, or a hematopoietic stem cell (HSC).

92. 92. The method of any one of claims 89 to 91, wherein the cargo sequence comprises a sequence encoding a T cell receptor polypeptide, a CAR-T polypeptide, or a fragment or derivative thereof.

93. 93. The method of any one of claims 81-92, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 4370-4423.

94. 94. The method of Claim 93, wherein the engineered guide RNA comprises a nucleotide sequence of sgRNA 1-54 from Table 5A with the corresponding chemical modifications listed in Table 5A.

95. 94. The method of any one of claims 81-93, wherein the engineered guide RNA comprises a targeting sequence having at least 80% sequence identity to any one of SEQ ID NOs: 4334, 4350, or 4324.

96. 94. The method of any one of claims 81-93, wherein the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 4388, 4404, or 4378.

97. 97. The method of Claim 96, wherein the engineered guide RNA comprises the nucleotide sequence of sgRNA 9, 35, or 19 from Table 5A.

98. 1. An engineered nuclease system comprising: (a) an RNA-guided endonuclease; (b) an engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the endonuclease and the engineered guide RNA comprises a spacer sequence configured to hybridize the engineered guide RNA to a target nucleic acid sequence; The engineered guide RNA comprises the following modifications: (i) a 2'-O methyl or 2'-fluoro base modification of at least one nucleotide within the first four bases at the 5' end of the engineered guide RNA or the last four bases at the 3' end of the engineered guide RNA; (ii) a phosphorothioate (PS) linkage between at least two of the first five bases at the 5' end of the engineered guide RNA, or a phosphorothioate linkage between at least two of the last five bases at the 3' end of the engineered guide RNA; (iii) a phosphorothioate linkage within the 3' or 5' stem of the engineered guide RNA; (iv) a 2'-O methyl or 2'-base modification within the 3' or 5' stem of the engineered guide RNA; (v) 2'-fluoro base modifications of at least 7 bases in the spacer region of the engineered guide RNA; and (vi) a phosphorothioate bond in the loop region of the engineered guide RNA; A genetically engineered nuclease system comprising at least one of the following:

99. 99. The engineered nuclease system of Claim 98, wherein the engineered guide RNA comprises a 2'-O methyl, or a 2'-fluoro base modification of at least one nucleotide within the first 5 bases at the 5' end of the engineered guide RNA or the last 5 bases at the 3' end of the engineered guide RNA.

100. 99. The engineered nuclease system of Claim 98, wherein said engineered guide RNA comprises a 2'-O methyl, or a 2'-fluoro base modification at the 5' end of the engineered guide RNA or the 3' end of the engineered guide RNA.

101. 101. The engineered nuclease system of any one of claims 98-100, wherein the engineered guide RNA comprises a phosphorothioate (PS) linkage between at least two of the first five bases at the 5' end of the engineered guide RNA or a phosphorothioate linkage between at least two of the last five bases at the 3' end of the engineered guide RNA.

102. 102. The engineered nuclease system of any one of Claims 98-101, wherein the engineered guide RNA comprises a phosphorothioate linkage within the 3' or 5' stem of the engineered guide RNA.

103. 103. The engineered nuclease system of any one of Claims 98-102, wherein the engineered guide RNA comprises a 2'-O methyl base modification within the 3' or 5' stem of the engineered guide RNA.

104. 104. The engineered nuclease system of any one of claims 98-103, wherein the engineered guide RNA comprises 2'-fluoro base modifications of at least 7 bases in the spacer region of the engineered guide RNA.

105. 105. The engineered nuclease system of any one of Claims 98-104, wherein the engineered guide RNA comprises a phosphorothioate bond in the loop region of the engineered guide RNA.

106. 106. The engineered nuclease system of any one of Claims 98-105, wherein the engineered guide RNA comprises at least three 2'-O methyl or 2'-fluoro bases at the 5' end of the engineered guide RNA, two phosphorothioate bonds between the first three bases at the 5' end of the engineered guide RNA, at least four 2'-O methyl or 2'-fluoro bases at the 4' end of the engineered guide RNA, and three phosphorothioate bonds between the last three bases at the 3' end of the engineered guide RNA.

107. 99. The engineered nuclease system of Claim 98, wherein said engineered guide RNA comprises at least two 2'-O-methyl bases and at least two phosphorothioate linkages at the 5' end of the engineered guide RNA and at least one 2'-O-methyl base and at least one phosphorothioate linkage at the 3' end of the engineered guide RNA.

108. 108. The engineered nuclease system of Claim 107, wherein said engineered guide RNA comprises at least one 2'-O-methyl base in both the 3' stem or the 5' stem region of the engineered guide RNA.

109. 109. The engineered nuclease system of Claim 107 or 108, wherein the engineered guide RNA comprises at least 1 to at least 14 2'-fluoro bases in the spacer region excluding the seed region of the engineered guide RNA.

110. 108. The engineered nuclease system of Claim 107, wherein said engineered guide RNA comprises at least one 2'-O-methyl base in the 5' stem region of said engineered guide RNA and from at least 1 to at least 14 2'-fluoro bases in the spacer region excluding the seed region of said guide RNA.

111. 111. The engineered nuclease system of any one of claims 98 to 110, wherein the guide RNA comprises a spacer sequence that targets the VEGF-A gene.

112. 112. The engineered nuclease system of claim 111, wherein the guide RNA comprises a spacer sequence having at least 80% identity to SEQ ID NO: 3985.

113. 112. The engineered nuclease system of Claim 111, wherein said guide RNA comprises a nucleotide of guide RNA 1-7 from Table 7 comprising a chemical modification listed in Table 7.

114. The method of any one of claims 98 to 113, wherein the RNA-guided nuclease is a Cas endonuclease.

115. 115. The method of claim 114, wherein the Cas endonuclease is a class 2 type V Cas endonuclease.

116. The method of claim 115, wherein the class 2 type V Cas endonuclease comprises a RuvC domain comprising a RuvCI subdomain, a RuvCII subdomain, and a RuvCIII subdomain.

117. 117. The engineered nuclease system of any one of claims 115-116, wherein the class 2 Type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof.

118. 117. The engineered nuclease system of any one of claims 115-116, wherein the class 2 Type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof.

119. 119. The engineered nuclease system of any one of claims 114-118, wherein the engineered guide RNA comprises a sequence having at least 80% sequence identity to any one of the non-degenerate nucleotides of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857.

120. 119. The engineered nuclease system of any one of Claims 111-118, wherein the engineered guide RNA comprises a sequence having at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.

121. A host cell comprising an open reading frame encoding a heterologous endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof.

122. 122. The host cell of claim 121, wherein the endonuclease has at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof.

123. The host cell according to any one of claims 121 to 122, wherein the host cell is an E. coli cell.

124. 124. The host cell of claim 123, wherein the E. coli cell is a lambda DE3 lysogen or the E. coli cell is a BL21(DE3) strain.

125. The host cell of any one of claims 109 to 110, wherein the E. coli cell has an ompT lon genotype.

126. The open reading frame is selected from the group consisting of a T7 promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an araP promoter sequence, ＢＡＤ 126. The host cell of any one of claims 121 to 125, operably linked to a promoter, a strong leftward promoter from lambda phage (pL promoter), or any combination thereof.

127. 127. The host cell of any one of claims 121 to 126, wherein the open reading frame comprises a sequence encoding an affinity tag linked in-frame to a sequence encoding the endonuclease.

128. 128. The method of claim 127, wherein the affinity tag is an immobilized metal affinity chromatography (IMAC) tag.

129. 129. The method of claim 128, wherein the IMAC tag is a polyhistidine tag.

130. 128. The method of claim 127, wherein the affinity tag is a myc tag, a human influenza hemagglutinin (HA) tag, a maltose binding protein (MBP) tag, a glutathione S-transferase (GST) tag, a streptavidin tag, a FLAG tag, or any combination thereof.

131. 131. The host cell of any one of claims 127 to 130, wherein the affinity tag is linked in-frame to the sequence encoding the endonuclease via a linker sequence encoding a protease cleavage site.

132. 132. The host cell of claim 131, wherein the protease cleavage site is a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a blood clotting factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof.

133. 133. The host cell of any one of claims 121 to 132, wherein the open reading frame is codon-optimized for expression in the host cell.

134. The host cell according to any one of claims 121 to 133, wherein the open reading frame is provided on a vector.

135. 134. The host cell of any one of claims 121 to 133, wherein the open reading frame is integrated into the genome of the host cell.

136. A culture comprising a host cell according to any one of claims 121 to 135 in a compatible liquid medium.

137. A method for producing an endonuclease comprising culturing a host cell according to any one of claims 121 to 135 in a compatible growth medium.

138. 138. The method of claim 137, further comprising inducing expression of the endonuclease by adding an additional chemical agent or increased amounts of nutrients.

139. 139. The method of claim 138, wherein the additional chemical agents or increased nutrients include isopropyl β-D-1-thiogalactopyranoside (IPTG) or additional amounts of lactose.

140. 140. The method of any one of claims 137 to 139, further comprising isolating the host cells after said culturing and lysing the host cells to produce a protein extract.

141. 141. The method of claim 140, further comprising subjecting the protein extract to IMAC, or ion affinity chromatography.

142. 142. The method of claim 141, wherein the open reading frame comprises a sequence encoding an IMAC affinity tag linked in-frame to a sequence encoding the endonuclease.

143. 143. The method of claim 142, wherein the IMAC affinity tag is linked in frame to the sequence encoding the endonuclease via a linker sequence encoding a protease cleavage site.

144. 144. The method of claim 143, wherein the protease cleavage site comprises a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a blood clotting factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof.

145. 145. The method of any one of claims 143-144, further comprising contacting the endonuclease with a protease corresponding to the protease cleavage site, thereby cleaving the IMAC affinity tag.

146. 146. The method of claim 145, further comprising performing subtractive IMAC affinity chromatography to remove the affinity tag from the composition comprising the endonuclease.

147. A system, (a) a class 2 type VA Cas endonuclease configured to bind a 3- or 4-nucleotide PAM sequence, wherein the endonuclease has increased cleavage activity for sMbCasl2a; (b) the engineered guide RNA, wherein the engineered guide RNA is configured to form a complex with the Class 2 VA Cas endonuclease, and wherein the engineered guide RNA comprises a spacer sequence configured to hybridize to a target nucleic acid that comprises a target nucleic acid sequence.

148. The system of Claim 147, wherein the cleavage activity is measured in vitro by introducing the endonuclease along with a compatible guide RNA into a cell containing the target nucleic acid and detecting cleavage of the target nucleic acid sequence in the cell.

149. 149. The system of any one of claims 147-148, wherein the class 2 VA type Cas endonuclease comprises a sequence having at least 75% identity to any one of 215-225, or a variant thereof.

150. 150. The system of claim 149, wherein the engineered guide RNA comprises a sequence having at least 80% identity to the non-degenerate nucleotides of SEQ ID NO: 3609.

151. 151. The system of any one of claims 149-150, wherein the target nucleic acid further comprises a YYN PAM sequence proximal to the target nucleic acid sequence.

152. 152. The system of any one of claims 147-151, wherein the class 2 type VA Cas endonuclease has at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 200% or more increased activity relative to sMbCas12a.

153. A system, (a) a class 2 VA' type Cas endonuclease; (b) an engineered guide RNA, wherein the engineered guide RNA comprises a sequence having at least 80% identity to about 19 to about 25, or about 19 to about 31 contiguous nucleotides of a naturally occurring effector repeat sequence of a class 2 type V Cas endonuclease.

154. 154. The system of claim 153, wherein the natural effector repeat sequence is any one of SEQ ID NOs: 3560-3572.

155. 155. The system of any one of claims 153 to 154, wherein the class 2 type VA' Cas endonuclease has at least 75% identity to SEQ ID NO:

126.

156. 1. A method for disrupting a VEGF-A locus in a cell, comprising: (b) a class 2 V-type Cas endonuclease; and (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease, the engineered guide RNA comprising a spacer sequence configured such that the engineered guide RNA hybridizes to a region of the VEGF-A locus; and into said cell, the engineered guide RNA comprises a targeting sequence having at least 80% identity to SEQ ID NO: 3985; or The method, wherein said engineered guide RNA comprises the nucleotide sequence of any one of guide RNAs 1-7 from Table 7.

157. 157. The system of claim 156, wherein the class 2 type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 1-3470, or a variant thereof.

158. 158. The system of any one of claims 156-157, wherein the class 2 Type V Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 141, 215, 229, 261, or 1711-1721, or a variant thereof.

159. 159. The system of any one of claims 156-158, wherein the engineered guide RNA comprises a sequence having at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3471, 3539, 3551-3559, 3608-3609, 3612, 3636-3637, 3640-3641, 3644-3645, 3648-3649, 3652-3653, 3656-3657, 3660-3661, 3664-3667, 3671-3672, 3677-3678, 3695-3696, 3729-3730, 3734-3735, and 3851-3857.

160. The system of any one of Claims 156-158, wherein the engineered guide RNA comprises a sequence having at least 80% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 3608-3609, 3853, or 3851-3857.

161. 1. A method for disrupting a genetic locus in a cell, comprising: (a) a class 2 V-type Cas endonuclease having at least 75% identity to any one of SEQ ID NOs: 215-225, or a variant thereof; (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease, the engineered guide RNA comprising a spacer sequence configured to hybridize the engineered guide RNA to a region of the locus; and contacting the cell with a composition comprising The method, wherein the class 2 type V Cas endonuclease has at least equivalent cleavage activity to spCas9 in the cell.

162. 162. The method of Claim 161, wherein the cleavage activity is measured in vitro by introducing the endonuclease along with a compatible guide RNA into a cell containing the target nucleic acid and detecting cleavage of the target nucleic acid sequence in the cell.

163. The method of any one of claims 161 to 162, wherein the composition comprises 20 pmol or less of the class 2 type V Cas endonuclease.

164. The method of claim 163, wherein the composition comprises 1 pmol or less of the class 2 type V Cas endonuclease.

Images