Improved methods for DNA integration using RNA-induced endonucleases

Abstract

To provide improved, safer and commercially efficient methods for developing genetically engineered cells.SOLUTION: More specifically, disclosed is a process comprising providing a donor DNA construct, a guide RNA, and an RNA-guided nuclease with a host cell to be transfected; and introducing the three components into the host cell. There is further disclosed a donor DNA construct designed for inserting a CAR (chimeric antigen receptor) into a defined genomic site of a host cell. Further, the present disclosure provides a host cell transfected with a CAR that lacks viral vectors that may present a safety concern. The disclosure provides more efficient and more cost-effective process for engineering T cells to express CAR constructs.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on November 12, 2019, is named 087735_0103_ST25.TXT and is 52,000 bytes in size.

[0002] Related Applications This application claims priority to U.S. Patent Application No. 16 / 288,052, filed February 27, 2019, the entire contents of which are incorporated herein by reference.

[0003] Technical Field The present disclosure provides methods and compositions for using RNA-guided endonucleases, such as cas proteins, to efficiently integrate a DNA sequence of interest into a target DNA molecule, such as a host genome. [Background technology]

[0004] background Targeted integration of exogenous DNA sequences into genomic loci is highly desirable. CRISPR-Cas genome engineering is a fast and relatively simple method to knock out gene function or precisely knock in DNA sequences for gene correction or gene tagging. Targeted gene knockout is achieved by generating double-strand breaks (DSBs) in DNA using Cas9 nuclease and guide RNA (gRNA). The DSBs are then often imperfectly repaired by random insertions or deletions (indels) via the endogenous non-homologous end joining (NHEJ) repair pathway. For knock-in experiments, in addition to Cas9 nuclease and gRNA, a DNA donor template is required, and the DSBs are typically repaired with the donor template via the homology-directed repair (HDR) pathway.

[0005] Knock-ins using donor templates, either single-stranded DNA (ssDNA) donor oligos or donor plasmids (dsDNA), often have relatively low efficiencies ranging from 1–10%. Thus, the success of HDR-mediated knock-in experiments requires significant design considerations and experimental optimization. Using single-stranded oligodeoxynucleotides (ssODNs) with short homology arms, several groups have achieved precise DNA editing, such as SNP correction or epitope tagging. Donor plasmids (dsDNA) can incorporate much longer exogenous DNA, but with much lower efficiencies. Several groups have used AAV (viral) vectors to deliver HDR donor ssDNA and achieved gene knock-in efficiencies of 40–60% in combination with CRISPR / Cas9. However, these methods still require the production of high-titer AAV vectors, which is time-consuming and needs to be compatible with cGMP manufacturing for clinical use.

[0006] Genome engineering tools have been developed based on components of the type II prokaryotic CRISPR (Clustered Regularly Interspaced Short palindromic Repeats) adaptive immune system of some bacteria, such as S. pyogenes. This multi-component system, called the RNA-guided Cas nuclease system or more simply CRISPR, contains a Cas endonuclease that has the ability to bind a guide RNA molecule and create a double-stranded break in genomic DNA at the specific sequence targeted by the guide RNA. The RNA-guided Cas endonuclease has the ability to cleave DNA where the RNA guide hybridizes to the genomic sequence. Furthermore, the Cas9 nuclease cleaves DNA only if a specific sequence, known as a protospacer adjacent motif (PAM), is present immediately downstream of the target sequence in the genome. The canonical PAM sequence in S. pyogenes is 5'-NGG-3', where N refers to any nucleotide.

[0007] It has been demonstrated that expression of a single chimeric crRNA:tracrRNA transcript, which is typically expressed as two distinct RNAs in native type II CRISPR systems, is sufficient to instruct the Cas9 nuclease to cleave the target DNA sequence in a sequence-specific manner. In addition, several mutant forms of the Cas9 nuclease have been developed. For example, one mutant form of the Cas9 nuclease functions as a nickase, generating breaks in the complementary strands of DNA rather than in both strands as is the case with wild-type Cas9. This allows repair of the DNA template using a high-fidelity pathway rather than NHEJ, preventing the formation of indels at the target locus and possibly at other locations in the genome, reducing possible off-target / toxic effects while maintaining the ability to undergo homologous recombination. Paired nicking can reduce off-target activity by 50-1,500-fold in cell lines and can facilitate gene knockout in mouse zygotes without losing on-target cleavage efficiency.

[0008] In addition, cas proteins have been isolated from various bacteria and have been shown to use different PAM sequences than S. pyogenes cas9. Furthermore, some cas proteins, such as cas12a, naturally use a single RNA guide, i.e., they use a crRNA that hybridizes to the target sequence, but not a tracrRNA.

[0009] Adoptive immunotherapy involves the transfer of autoantigen-specific cells generated ex vivo and is a promising strategy for treating viral infections and cancer. The cells used for adoptive immunotherapy can be generated either by proliferation of antigen-specific cells or by redirecting cells via genetic engineering.

[0010] CARs are synthetic receptors consisting of a targeting moiety associated with one or more signaling domains in a single fusion molecule. In general, the binding moiety of a CAR consists of the antigen-binding domain of a single-chain antibody (scFv), which contains the light chain and variable fragment of a monoclonal antibody linked by a flexible linker. Binding moieties based on receptor or ligand domains have also been successfully used. The signaling domain of first-generation CARs is derived from the cytoplasmic region of CD3ζ or Fc receptor gamma chain. First-generation CARs have been shown to successfully redirect T cell cytotoxicity, but failed to confer long-term proliferation and antitumor activity in vivo. Signaling domains from costimulatory molecules, including CD28, OX-40 (CD134) and 4-1BB (CD137), have been added alone (second generation) or in combination (third generation) to enhance the survival of CAR-modified T cells and increase their proliferation. CARs have allowed successful redirection of T cells against antigens expressed on the surface of tumor cells from various malignancies, including lymphomas and solid tumors.

[0011] CAR (chimeric antigen receptor) cell immunotherapy, which involves removing T cells from the patient's blood, adding CARs by gene transfer, and injecting the genetically engineered cells back into the body, is one of the most promising methods for treating cancer. Currently, gene transfer techniques include virus-based gene transfer methods using gamma-retroviral vectors or lentiviral vectors. To create GMP (Good Manufacturing Practice required by the FDA) level viral vectors, the viral vectors must meet clinical safety standards such as replication incompetent, low genotoxicity and low immunogenicity. These conventional approaches have ease of use and reasonable expression, but may give rise to secondary transformation events, such as undesirable blood cancers and other events resulting from the integration of the viral genome into T cells.

[0012] A review article (Ren and Zhao, Protein Cell 8(9):634-643, 2017) indicates that any use of CRISPR / Cas9 still involves the use of viral vectors for the knock-in process to insert the CAR (chimeric antigen receptor) construct into the T cell genome. "Gene editing using CRISPR encoded by non-integrating viruses such as adenovirus and adenovirus-associated virus (AAV) has also been reported." Furthermore, Ren et al., Clin.Cancer Res.16:1300, published online on November 4, 2016, used a CD19 CAR construct and found that gene disruption in T cells was less efficient with lentiviral and adenoviral CRISPR.

[0013] Although RNA-guided endonucleases such as the Cas9 / CRISPR system appear to be an attractive approach for genetically engineering some mammalian cells, the use of Cas9 / CRISPR in primary cells, especially in T cells, is significantly more difficult because (1) T cells are adversely affected by the introduction of DNA into their cytoplasm, i.e., a high rate of apoptosis is observed when cells are transformed with a DNA vector; (2) the CRISPR system requires stable expression of Cas9 in cells, but long-term expression of Cas9 in living cells can result in chromosomal defects; (3) the specificity of current RNA-guided endonucleases is determined only by sequences containing 11 nucleotides (N12-20NGG, where NGG represents PAM), making it very difficult to identify a target sequence in a desired locus that is unique in the genome. In addition to CAS9, other nucleases are zinc finger nucleases (ZFNs) or TAL effector nucleases (TALENs).

[0014] The present disclosure aims to provide a solution to these limitations in order to efficiently carry out the manipulation of RNA-guided endonucleases in host cells such as T cells. There is a need in the art for a safer transduction technique for chimeric antigen receptor constructs that does not involve transduction with viral vectors and can instead use transfection techniques. This includes increasing the transfection efficiency of CAR constructs while avoiding the risk of having viral genes potentially expressed by transduced cells administered to patients. The present disclosure is made to address this need in the art. [Prior art documents] [Non-patent literature]

[0015] [Non-Patent Document 1] Ren and Zhao, Protein Cell 8(9):634-643, 2017 [Non-Patent Document 2] Ren et al., Clin. Cancer Res. 16:1300 Summary of the Invention [Problem to be solved by the invention]

[0016] Abstract According to the first aspect, a method for site-specific integration of donor DNA into target DNA molecule is described.The method comprises introducing into cell an RNA-guided endonuclease or a nucleic acid molecule encoding an RNA-guided endonuclease, at least one engineered guide RNA or at least one nucleic acid molecule encoding an engineered guide RNA, and a donor DNA molecule comprising at least two nucleic acid modifications.The guide RNA comprises a target sequence designed to hybridize with a target site in the target DNA, and the donor DNA is inserted into the target DNA molecule at the target site.

[0017] In any of the disclosed implementations, the method can further include any of the following details, which can be combined with each other in any combination unless clearly mutually exclusive. (i) the at least two nucleic acid modifications can be present on a single strand of the donor DNA molecule; (ii) the one or more nucleic acid modifications can be modifications of one or more nucleotides or nucleotide linkages within 10 nucleotides of the 5' end of the modified strand of the donor DNA molecule; (iii) the one or more nucleic acid modifications can be backbone modifications; (iv) the one or more nucleic acid modifications can be phosphorothioate or phosphoramidite modifications, or a combination thereof; (v) the one or more nucleic acid modifications can be a modification or substitution of a nucleobase; (vi) the one or more nucleic acid modifications can be a sugar modification or substitution; (vii) the one or more nucleic acid modifications can be 2'-O-methyl group modifications of deoxyribose; (viii) the donor DNA molecule can be a double-stranded DNA molecule; (ix) the donor DNA molecule can have a modified strand that includes at least two nucleic acid modifications and can have a 5' terminal phosphate on the strand opposite the modified strand; (x) the donor molecule may have one to three phosphorothiolate modifications in the backbone within 10 nucleotides of the 5' end of the modified strand of the donor DNA molecule and one to three 2'-O-methyl nucleotide modifications within 10 nucleotides of the 5' end of the modified strand of the donor DNA molecule; (xi) the donor molecule may have one to three phosphorothiolate modifications in the backbone within five nucleotides of the 5' end of the modified strand of the donor DNA molecule and one to three 2'-O-methyl nucleotide modifications within five nucleotides of the 5' end of the modified strand of the donor DNA molecule; (xii) the donor DNA molecule may contain homology arms flanking sequences for integration into the genome; (xiii) at least one of the homology arms can be between 50 and 2000 nucleotides in length; (xiv) at least one of the homology arms can be between 100 and 1000 nucleotides in length; (xv) at least one of the homology arms can be between 150 and 650 nucleotides in length; (xvi) at least one of the homology arms can be 150 to 350 nucleotides in length; (xvii) at least one of the homology arms may be 150-200 nucleotides in length; (xviii) the donor DNA molecule can comprise a modified strand and a counter strand, the modified strand can comprise two or more nucleic acid modifications, and the counter strand can comprise a terminal phosphate; (xix) The donor DNA may comprise a chimeric antigen receptor (CAR) construct. (xx) the guide RNA can be a crRNA; (xxi) The method may further comprise introducing tracrRNA into the cell; (xxii) the guide RNA can be a chimeric guide RNA; (xxiii) the RNA-guided endonuclease can be Cas9, Cas12a, Cas12b, Cas13, Cas14 or CasX; (xxiv) at least one guide RNA can be introduced into the cell; (xxv) an RNA-guided endonuclease can be introduced into the cell; (xxvi) The RNA-guided endonuclease and the guide RNA can be introduced into the cell as a ribonucleoprotein complex (RNP); (xxvii) the RNP may contain tracrRNA; (xxviii) RNPs can be introduced into cells by electroporation or liposome transfer; (xxix) The donor DNA and RNP can be introduced into the cell simultaneously or separately; (xxx) the RNA-guided endonuclease or the nucleic acid molecule encoding the RNA-guided endonuclease, the at least one engineered guide RNA or the at least one nucleic acid molecule encoding an engineered guide RNA, and the donor DNA molecule may be introduced into the cell simultaneously; (xxxi) the cell may be a eukaryotic cell; (xxxii) the cell can be a mammalian cell; (xxxiii) the cell can be a human cell; (xxxiv) the cell can be a hematopoietic cell; (xxxv) the cell can be a T cell; (xxxvi) The target site may be selected from a T cell receptor gene, a PD-1 gene, or a TIM3 gene.

[0018] According to a second aspect, a host cell is described. The host cell comprises a donor DNA as described herein integrated into a target DNA molecule as described herein, and the host cell may be produced by any of the methods described herein.

[0019] According to a third aspect, a population of primary T cells transfected with a chimeric antigen receptor (CAR) construct is described. The population of primary T cells comprises T cells having the CAR construct integrated into the genome at a cas9 nuclease target site, at least 20% of the T cells of the population express the CAR construct, and the T cells of the population do not comprise a recombinant viral vector or sequences derived from the recombinant viral vector.

[0020] In any of the disclosed embodiments, the population of primary T cells transfected with a chimeric antigen receptor (CAR) construct may further comprise any of the following items, which may be combined with each other in any combination unless clearly mutually exclusive. (i) the CAR construct can be at least 1.8 kb; (ii) the CAR construct can be an anti-CD38 CAR construct, an anti-CD19 CAR construct, or an anti-BCMA CAR construct; (iii) at least 40% of the cells in the population are capable of expressing the CAR construct; (iv) at least 50% of the cells in the population are capable of expressing the CAR construct; (v) the CAR construct can be inserted into the TRAC locus; (vi) at least 20% of the cells in the population may not express the T cell receptor; (vii) the CAR construct can be inserted into the PD-1 locus; (viii) at least 20% of the cells in the population do not express PD-1.

[0021] According to a fourth aspect, a system for targeted integration of donor DNA into target locus is described.The system comprises an RNA-guided endonuclease or a nucleic acid molecule encoding the RNA-guided endonuclease, a guide RNA or a nucleic acid molecule encoding the guide RNA, and a double-stranded donor DNA molecule.The donor DNA molecule comprises one modified strand with one or more phosphorothioate bonds within 10 nucleotides of the 5' end of the modified strand.

[0022] In any of the disclosed embodiments, the system can further include any of the following details, which can be combined with each other in any combination unless clearly mutually exclusive. (i) the system may include an RNA-guided endonuclease; (ii) the system may comprise a guide RNA; (iii) the donor DNA molecule may further comprise at least one modification of a sugar moiety or a nucleobase of the modified strand within 10 nucleotides of the 5′ end of the modified strand; (iv) the donor DNA may have homology arms flanking the sequence of interest for integration into the genome; (v) one or more phosphorothioate linkages on a single strand of the double-stranded DNA molecule may be present within 5 nucleotides of the 5' end of the modified strand; (vi) at least one modification of a sugar moiety or nucleobase of the modified strand can be present within 5 nucleotides of the 5′ end of the modified strand; (vii) at least one modification of the sugar moiety can include 2'-O-methylation; (viii) the sequence of interest may comprise an expression cassette; (ix) the expression cassette may include a construct containing one or more antibody or receptor domains; (x) at least one of the homology arms can be between 50 and 5,000 nucleotides in length; (xi) at least one of the homology arms can be between 100 and 1000 nucleotides in length; (xii) at least one of the homology arms can be between 150 and 800 nucleotides in length; (xiii) the nuclease may be selected from the group consisting of Cas9, Cas12a, Cas12b, CasX, and combinations thereof; (xiii) the guide RNA can be a chimeric guide having sequences of both crRNA and tracrRNA; (xiv) the guide RNA can be a crRNA; (xv) the guide RNA may contain one or more phosphorothioate (PS) oligonucleotides; (xvi) the guide RNA may be a crRNA and the system may further comprise a tracrRNA; (xvii) the guide RNA can be a single guide RNA; (xviii) The system may comprise a ribonucleoprotein complex comprising an RNA-guided endonuclease and a guide RNA.

[0023] According to a fifth aspect, a composition for generating a donor DNA molecule is described. The composition includes a first primer (single-stranded deoxyoligonucleotide) having one or more phosphorothioate linkages and one or more modified nucleotides within 5 nucleotides of the 5' end of the oligonucleotide, and a second primer (single-stranded deoxyoligonucleotide) having a 5' terminal phosphate.

[0024] In any of the disclosed embodiments, the composition for generating the donor DNA molecule may further include the following particulars. (i) The first and second primers may be homologous to sequences on opposite sides of a target site for an RNA-guided endonuclease in the target genome.

[0025] According to a sixth aspect, a double-stranded donor DNA molecule is described that is configured to integrate a sequence of interest into a target site in a host genome. The double-stranded donor DNA molecule comprises one or more modifications to the nucleotides of one donor DNA strand, homologous arms flanking the sequence of interest, the homologous arms comprising sequences homologous to sequences present on either side of the target site in the host genome, and 1-10 modified nucleotides present within 10 nucleotides of the 5' end of one strand of the donor DNA.

[0026] In any of the disclosed embodiments, the double-stranded donor DNA molecule can further comprise any of the following features, which can be combined with each other in any combination unless clearly mutually exclusive: (i) The double-stranded donor DNA molecule can contain 1 to 5 modified nucleotides located within 5 nucleotides of the 5' end of one strand of the donor DNA; (ii) the modified nucleotides may contain 1 to 4 phosphorothioate (PS) linkages or 1 to 4 2'-O-methylation modifications, or a combination thereof; (iii) One strand of the double-stranded donor DNA molecule can have two or more modifications in either the first 10 nucleotides or the first 5 nucleotides from the 5' end, and the other strand has a terminal 5' phosphate. (iv) the sequence of interest may comprise a chimeric antigen receptor (CAR) construct; (v) The target site may be selected from a T cell receptor gene, a PD-1 gene, or a TIM3 gene. [Brief description of the drawings]

[0027] [Figure 1A] Figure 1A provides a chemical diagram showing, in the structure on the right, phosphorothioate (PS) modifications of internucleotide linkages that may be present in a primer. The nucleotides shown in the oligonucleotide on the left are linked via (unmodified) phosphodiester bonds. Figure 1B provides a chemical diagram of an oligonucleotide that has two PS bonds linking the 5'-most nucleotide to the next nucleotide located "downstream" in the oligonucleotide, which is then attached by a PS bond to the next downstream nucleotide of the oligonucleotide. The 5'-most nucleotide of the oligonucleotide contains a 2'-O-methyl modification. [Figure 1B] Figure 1A provides a chemical diagram showing, in the structure on the right, phosphorothioate (PS) modifications of internucleotide linkages that may be present in a primer. The nucleotides shown in the oligonucleotide on the left are linked via (unmodified) phosphodiester bonds. Figure 1B provides a chemical diagram of an oligonucleotide that has two PS bonds linking the 5'-most nucleotide to the next nucleotide located "downstream" in the oligonucleotide, which is then attached by a PS bond to the next downstream nucleotide of the oligonucleotide. The 5'-most nucleotide of the oligonucleotide contains a 2'-O-methyl modification. [Diagram 2]Figure 2A shows the structure of a donor DNA construct, such as a CAR donor DNA construct that contains an open reading frame with a sequence encoding a single chain variable fragment (scFv), followed by a CD8a leader peptide, followed by a CD28 hinge-CD28 transmembrane intracellular region, followed by a CD3ζ intracellular domain. The coding sequence is preceded by a JeT promoter (SEQ ID NO:3), and the construct contains a homology arm (HA), in this case a matching sequence of the human TRAC locus adjacent to the promoter + coding sequence. This provides a diagram of the template DNA used to generate the donor DNA. Anti-CD38A2 contains a CD38 CAR transgene whose expression is driven by the JeT promoter and is flanked by homology arms on the 5' and 3' sides to allow for targeted integration. FIG. 2B shows the primer design to confirm knock-in, showing the same diagram as FIG. 2A, and also showing the location of the PCR primers used to confirm CAR integration by amplification with one primer located within the CAR and one primer in TRAC outside the homology arms at both the 5' and 3' ends, which generate products of 1371 bp and 1591 bp, respectively, upon integration at the targeted integration site. [Figure 3A]Figure 3A provides flow cytometry plots of PBMCs 8 days after transfection with donor DNA containing a construct for expressing an anti-CD38 CAR and RNP containing a guide RNA targeting the TRAC locus. The CAR cassette was flanked by homology arms with homology to TRAC locus sequences adjacent to the integration target site in exon 1 of the TRAC gene. The y-axis reports cell size. Expression of the anti-CD38 construct is along the x-axis. Negative control: no donor DNA was transformed into the target cells; No modification - the donor DNA had no chemical modification; PS modification: within the 5 most 5' nucleotide backbone positions, there were three phosphorothioate linkages; PS + 2'-OMe: in addition to phosphorothioate linkages, three nucleotides within the 5 most 5' nucleotides of the donor contained 2'-OMe in addition to PS modification; TCR KO / retroviral construct: cells were transfected with RNP in the absence of donor DNA to knock out the TCR gene, and transduced with retrovirus to express anti-CD38 CAR. Figure 3B provides the results of flow cytometry performed on the same cultures as in Figure 3A 10 days after transfection. Figure 3C provides the results of flow cytometry performed on cultures receiving dual modified donor DNA and controls (TRAC knockout only and TRAC knockout with retroviral transduction) 20 days after transfection. [Figure 3B]Figure 3A provides flow cytometry plots of PBMCs 8 days after transfection with donor DNA containing a construct for expressing an anti-CD38 CAR and RNP containing a guide RNA targeting the TRAC locus. The CAR cassette was flanked by homology arms with homology to TRAC locus sequences adjacent to the integration target site in exon 1 of the TRAC gene. The y-axis reports cell size. Expression of the anti-CD38 construct is along the x-axis. Negative control: no donor DNA was transformed into the target cells; No modification - the donor DNA had no chemical modification; PS modification: within the 5 most 5' nucleotide backbone positions, there were three phosphorothioate linkages; PS + 2'-OMe: in addition to phosphorothioate linkages, three nucleotides within the 5 most 5' nucleotides of the donor contained 2'-OMe in addition to PS modification; TCR KO / retroviral construct: cells were transfected with RNP in the absence of donor DNA to knock out the TCR gene, and transduced with retrovirus to express anti-CD38 CAR. Figure 3B provides the results of flow cytometry performed on the same cultures as in Figure 3A 10 days after transfection. Figure 3C provides the results of flow cytometry performed on cultures receiving dual modified donor DNA and controls (TRAC knockout only and TRAC knockout with retroviral transduction) 20 days after transfection. [Figure 3C]Figure 3A provides flow cytometry plots of PBMCs 8 days after transfection with donor DNA containing a construct for expressing an anti-CD38 CAR and RNP containing a guide RNA targeting the TRAC locus. The CAR cassette was flanked by homology arms with homology to TRAC locus sequences adjacent to the integration target site in exon 1 of the TRAC gene. The y-axis reports cell size. Expression of the anti-CD38 construct is along the x-axis. Negative control: no donor DNA was transformed into the target cells; No modification - the donor DNA had no chemical modification; PS modification: within the 5 most 5' nucleotide backbone positions, there were three phosphorothioate linkages; PS + 2'-OMe: in addition to phosphorothioate linkages, three nucleotides within the 5 most 5' nucleotides of the donor contained 2'-OMe in addition to PS modification; TCR KO / retroviral construct: cells were transfected with RNP in the absence of donor DNA to knock out the TCR gene, and transduced with retrovirus to express anti-CD38 CAR. Figure 3B provides the results of flow cytometry performed on the same cultures as in Figure 3A 10 days after transfection. Figure 3C provides the results of flow cytometry performed on cultures receiving dual modified donor DNA and controls (TRAC knockout only and TRAC knockout with retroviral transduction) 20 days after transfection. [Figure 4] Figure 4 shows a gel of PCR products showing integration of donor DNA at the targeted TRAC (exon 1) site. Primary human T cells were electroporated with TRAC RNP alone or together with ssDNA. PCR was used to confirm the presence of the anti-CD38A2 CAR transgene integrated into the TRAC locus two weeks after electroporation (lanes 3 and 6, showing products from the 5' and 3' integration regions). No bands were observed in untransformed ATC (lanes 1 and 4) or in T cells transformed with RNP targeting TRAC exon 1 but not given donor DNA (lanes 2 and 5). [Diagram 5]FIG. 5 is a graph showing the results of a cytotoxicity assay using activated T cells (ATC, stars) as a control, TCR knockout ATC, CART cells transduced with anti-CD38A2 retrovirus (RV CART, black line), CART cells transduced with TRAC knockout retrovirus (dots), TRAC knockout with phosphorothioate-modified ssdonor DNA knockin (dashed line), and TRAC knockout with phosphorothioate and 2'-O-methyl modified ssDNA knockin (dashed line and dots). [Figure 6] Figures 6A, 6B, and 6C provide graphs of the results of cytokine secretion assays using anti-CD38 CART cells and controls co-cultured with K52 or RPM18226 cells. T cell cultures tested were as provided in Figure 5. [Figure 7] Figure 7 provides the results of testing donor DNA with different lengths of homology arms (HA). Cultures were assessed by flow cytometry for loss of TCR expression (Y-axis) and anti-CD38 expression (X-axis). [Figure 8] Figure 8 provides the results of testing double-stranded donor DNA modified by three PS linkages and the addition of three 2'-O-methyl nucleotides proximal to the 5' end of one strand of the donor DNA molecule. Cultures were assessed by flow cytometry for loss of TCR expression (Y-axis) and anti-CD38 expression (X-axis). [Figure 9] Figure 9 provides flow cytometry results for cells transfected with ds PS and 2'-OMe modified donor DNA containing a cassette for expressing anti-CD19 CAR. The donor was co-transfected with RNP to induce TRAC exon 1 locus. TCR expression is determined on the Y axis and anti-CD19 CAR expression is determined on the Y axis. [Figure 10]Figure 10 provides flow cytometry results for cells transfected with ds PS and 2'-OMe modified donor DNA containing a cassette for expressing anti-BCMA CAR. The donor was co-transfected with RNP to induce TRAC exon 1 locus. TCR expression is determined on the Y axis and anti-BCMA CAR expression is determined on the Y axis. [Figure 11] Figure 11 provides flow cytometry results for cells transfected with ds PS and 2'-OMe modified donor DNA containing a cassette for expressing anti-CD38 CAR. The donor was co-transfected with RNP to induce TRAC exon 3 locus. TCR expression is determined on the Y axis and anti-CD38 CAR expression is determined on the Y axis. [Figure 12] Figure 12 provides flow cytometry results for cells transfected with ds PS and 2'-OMe modified donor DNA containing a cassette for expressing an anti-CD19 CAR. In one culture, the donor had a homology arm derived from TRAC exon 3 and was directed to the TRAC exon 3 locus by co-transfection with RNP with exon 3 guide RNA (second panel). In another culture, the donor had a homology arm derived from TRAC exon 1 and was directed to the TRAC exon 1 locus by co-transfection with RNP with exon 1 guide RNA (second panel). TCR expression is determined on the Y axis and anti-CD19 CAR expression is determined on the Y axis. [Figure 13]Figure 13 provides flow cytometry results for cells transfected with ds PS and 2'-OMe modified donor DNA containing a cassette for expressing anti-CD38 CAR and homology arms derived from the TRAC gene or the PD-1 gene. In one culture, the donor had a homology arm derived from TRAC exon 1 and was directed to the TRAC exon 1 locus by co-transfection with RNPs carrying exon 1 guide RNA (third panel). In another culture, the donor had a homology arm derived from the PD-1 locus and was directed to the PD-1 gene by co-transfection with RNPs carrying PD-1 gene guide RNA (fourth panel). TCR expression is determined on the Y axis, and anti-CD38 or anti-PD-1 CAR expression is determined on the Y axis. [Figure 14] Figure 14 provides the results of a cytotoxicity assay using T cell cultures transfected with a dual-modified (PS and 2'-OMe) donor fragment containing an anti-CD38 CAR construct and a homology arm from the PD-1 gene targeted to the PD-1 gene by an RNP containing a guide RNA with a target sequence from the PD-1 gene. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Detailed Description The present disclosure provides an improved, safer, commercially efficient method for developing genetically engineered and transduced cells for immunotherapy. More specifically, the disclosed method includes introducing an RNA-guided endonuclease, a guide RNA, and a donor DNA construct into a host cell, where the guide RNA is engineered to guide a cas protein complexed with the guide RNA to a target site in the host genome. Cleavage of genomic DNA at the target site by the RNA-guided endonuclease and subsequent repair of the double-stranded break with a donor fragment containing homologous arms by homology-directed repair (HDR) results in the integration of the sequence of the donor DNA molecule located between the homologous arms. This method can be used to knock out a gene at a target locus and simultaneously insert or "knock in" a transgene provided in the donor DNA molecule at the disrupted locus. This method can be used for any host cell, including prokaryotic and eukaryotic cells, and can be used with mammalian cells, such as human cells. This method has advantages in ease of use, efficiency, and the ability to generate genomic modifications without the use of selection markers or viral vectors, which are undesirable in many applications, including clinical applications. In some embodiments, the host cell is a hematopoietic cell, such as a T cell.

[0029] The present disclosure also provides a donor DNA composition, wherein the donor DNA molecule comprises one or more modifications to nucleotides of one donor DNA strand. The donor DNA can comprise homology arms flanking a sequence of interest whose integration into the host genome is desired, the homology arms having sequences homologous to sequences present on either side of the target sequence in the host genome. The donor DNA in some embodiments is double-stranded. In various embodiments, the donor DNA comprises 1-10 modified nucleotides that are proximal to the 5' end of one strand of the donor DNA, e.g., within 10 nucleotides or within 5 nucleotides of the 5' end of one strand of the donor DNA. In some embodiments, the donor DNA has at least two types of nucleic acid modifications of 1-10 nucleotides at the 5' end of one strand of the donor DNA. In some embodiments, the donor DNA has two types of nucleic acid modifications of 1-10 nucleotides at the 5' end of one strand of the donor DNA. The modification can be, for example, an internucleotide phosphorothioate (PS) bond or 2'-O-methylation of the deoxyribose of one or more nucleotides of the donor DNA molecule. For example, the donor DNA molecule can have one, two, three or four PS bonds within the first 5, first 6 or first 7 nucleotides from the 5' end of the modified strand, and can also have one, two, three or four 2'-O-methyl modified nucleotides within the first 5, first 6 or first 7 nucleotides from the 5' end of the modified strand. In some embodiments, the donor DNA molecule is double-stranded, with one strand containing a modification at the 5' end. In some embodiments, the donor DNA molecule is double-stranded, with one strand having two or more modifications in either the first 10 or first 5 nucleotides from the 5' end, and the opposite strand having a terminal 5' phosphate. In various embodiments, the donor DNA molecule is double-stranded and has at least two PS linkages and at least two 2'-O-methyl modified nucleotides on one strand of the donor DNA, with the PS and 2'-O-methyl modifications present within the first five nucleotides from the 5' end of the modified strand.In various embodiments, the donor DNA molecule is double-stranded and has three PS bonds and three 2'-O-methyl modified nucleotides on one strand of the donor DNA, and the PS and 2'-O-methyl modifications are present within the first five nucleotides from the 5' end of the modified strand. In some examples of these embodiments, the opposite strand contains a terminal 5' phosphate. The donor DNA is introduced into cells as a double-stranded molecule.

[0030] The present disclosure further provides a donor DNA construct designed for inserting a CAR (chimeric antigen receptor) into a host cell. Additionally, the present disclosure provides a host cell transduced with a CAR that lacks a viral vector. The present disclosure provides a more efficient and cost-effective method for engineering T cells to express a CAR construct. The CAR construct can include, as a non-limiting example, a homology arm that targets the construct to a T cell receptor gene, a PD-1 gene, or a TIM3 gene to simultaneously knock in the CAR construct and knock out the TCR, PD-1, or TIM3 gene.

[0031] In a further aspect, the present disclosure provides a system for genome modification, comprising an RNA-guided endonuclease or a nucleic acid molecule encoding the RNA-guided endonuclease, a guide RNA or a nucleic acid molecule encoding the guide RNA, and a donor DNA molecule, wherein the donor DNA molecule comprises at least one nucleotide modification within 10 nucleotides or within 5 nucleotides of the 5'-end. In some embodiments, the donor DNA is double-stranded and comprises at least one, at least two, or at least three modifications on at least one, at least two, or at least three nucleotides present within 10 nucleotides or within 5 nucleotides of one strand of the double-stranded donor DNA molecule. The modifications can be, for example, phosphorothioate bonds and / or 2'-O-methylation of nucleotides. The donor DNA can have homology arms adjacent to the sequence of interest to be integrated into the genome. The sequence of interest can be, for example, an expression cassette for the expression of a construct comprising one or more antibody or receptor domains. The homology arms can be about 50 to about 5000 nucleotides in length, or about 100 to 1000 nucleotides in length, for example, about 150 to about 800 nucleotides in length. In the donor DNA molecule, the homology arms can be the same length or different lengths.

[0032] In some embodiments, the nuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, CasX, and combinations thereof. The guide RNA can be a chimeric guide having both crRNA and tracrRNA sequences, or it can be a crRNA, and can optionally include one or more phosphorothioate (PS) oligonucleotides. In cases where the guide is a crRNA and the RNA-guided endonuclease uses tracrRNA, the system can also include tracrRNA. For example, Cas9 can be used with crRNA and tracrRNA, or with a chimeric guide RNA (sometimes called a single guide or "sgRNA") that combines structural features of crRNA and tracrRNA. On the other hand, Cas12a naturally uses only crRNA and does not have an associated tracrRNA. In various embodiments, the RNA-guided endonuclease, the guide RNA (which can be a crRNA or a chimeric guide RNA), and, if included, the tracrRNA, can be complexed as a ribonucleoprotein complex that is introduced into the cell. The donor DNA can be introduced into the target cell together with the RNP or separately, for example in a separate electroporation or transfection.

[0033] 1. A method for site-specific integration of a donor DNA into a target DNA molecule, comprising: an RNA-guided endonuclease or a nucleic acid molecule encoding the RNA-guided endonuclease; At least one engineered guide RNA or at least one nucleic acid molecule encoding an engineered guide RNA; a donor DNA molecule comprising at least one nucleic acid modification; introducing into a cell Also provided herein is a method, wherein the guide RNA comprises a target sequence designed to hybridize with a target site in the target DNA, and the donor DNA is inserted into the target DNA molecule at the target site. In various embodiments, the donor DNA comprises at least two modified nucleotides, which can have the same or different modifications, and are preferably present within 10 nucleotides or within 5 nucleotides of the 5' end of one strand of the donor DNA. In some embodiments, the donor DNA is double-stranded, and one or more nucleotide modifications are present on a single strand of the donor DNA molecule. In some embodiments, the donor DNA is double-stranded, and one or more nucleotide modifications are present on a single strand of the donor DNA molecule within 10 nucleotides or within 5 nucleotides of the 5' end of the modified strand. In some embodiments, the donor DNA comprises a backbone modification, such as a phosphoramidite or phosphorothioate modification. In some embodiments, the donor DNA comprises a modification of the sugar moiety of a nucleotide. In some embodiments, the donor DNA is double stranded and comprises at least one, at least two, or at least three phosphorothioate modifications within 5 nucleotides of the 5' end of a single strand of the donor DNA molecule, and further comprises at least one, at least two, or at least three 2'-O-methylated nucleotides within 5 nucleotides of the 5' end of a single strand of the donor DNA molecule. In various embodiments, the donor DNA comprises homology arms flanking a DNA sequence of interest, e.g., an expression cassette, the homology arms having homology to sites in the target genome on either side of the target site of the RNA-guided endonuclease. The homology arms can be about 50 to about 2000 nt in length, e.g., 100 to 1000 nt in length, or 150 to 650 nt in length, e.g., 150 to 350 nt in length, or 150 to 200 nt in length. In the donor DNA molecule, the homology arms can be the same length or different lengths.In various embodiments, the donor DNA molecule has two or more nucleotide modifications on the modified strand, and the opposite strand includes a terminal phosphate.

[0034] The RNA-guided endonuclease may be a cas protein, and may be, as non-limiting examples, cas9, cas 12a or casX protein. In various embodiments of the method, the RNA-guided endonuclease and the RNA guide are introduced into the cell as a ribonucleoprotein complex (RNP). The RNP may further comprise tracrRNA in some embodiments. The RNP may be introduced into the target cell by any feasible means, including, for example, electroporation or liposome transfer. The donor DNA may be delivered to the cell simultaneously with the RNP or separately.

[0035] Also included herein is a method for making a donor DNA molecule, comprising amplifying a template DNA comprising a homologous arm adjacent to a sequence of interest using a first primer comprising at least two nucleotide modifications within the first 5 nucleotides of the 5' end of the primer and a second primer comprising a 5' end phosphate.In various embodiments, the first primer can comprise at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten modifications, and can comprise more than one type of modification.For example, the primer for making a donor DNA molecule can comprise at least one phosphorothioate modification and at least one 2'-O-methyl modification of the nucleotide within the first 5 nucleotides of the 5' end of the primer.

[0036] The first and second primers can be homologous to sequences on opposite sides of a target site of an RNA-guided endonuclease in a target genome. The first primer can include one or more phosphorothioate linkages and one or more 2'-O-methylated nucleotides within 5 nucleotides of the 5' end of the modified strand of the oligonucleotide, e.g., the first primer can have three phosphorothioate linkages and three 2'-O-methylated nucleotides. The primers can be, for example, 17-100 nucleotides in length, e.g., 17-30 oligonucleotides in length. The primers are designed to hybridize to opposite strands of genomic sequence on either side of a cas target site in a genome, such as in a human gene, such that construct-based donor fragments with flanking sequences homologous to sequences surrounding the target site of interest can be generated with the desired nucleotide or backbone modifications.

[0037] Further included is a composition comprising primers for amplifying a donor DNA fragment for insertion into a mammalian genome. The composition can comprise a first DNA oligonucleotide primer and a second DNA oligonucleotide primer, each of the first and second oligonucleotide primers comprising at least one 2'-O-methyl modification of a nucleotide within 5 nucleotides of the 5' end of the primer and at least one phosphorothioate modification within 5 nucleotides of the 5' end of the primer. The first and second oligonucleotide primers are a primer pair, the first and second primers can amplify a sequence comprising a target site comprising a sequence of at least 18 nucleotides on one side of the target site of a cas nuclease, and the second primer comprises a sequence of at least 18 nucleotides on the opposite strand of the target site of the cas nuclease.

[0038] definition Unless specifically stated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Furthermore, any methods or materials similar or equivalent to those described herein can be used in the practice of the present disclosure.

[0039] As used herein, the terms "a," "an," or "the" include not only embodiments having one element, but also embodiments having more than one element. For example, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates to the contrary. Thus, for example, reference to "a cell" includes a plurality of such cells, reference to "the agent" includes reference to one or more agents known to those of skill in the art, and so forth.

[0040] The term "primary cells" refers to cells that are directly isolated from a multicellular organism. Primary cells have typically undergone very few population doublings and therefore represent more of the major functional components of the tissue from which they are derived compared to continuous (tumor or artificially immortalized) cell lines. In some cases, primary cells are cells that are used immediately after isolation. In other cases, primary cells cannot divide indefinitely and therefore cannot be cultured in vitro for long periods of time.

[0041] The term "genome editing" refers to a type of genetic engineering in which one or more nucleases are used to insert, replace, or remove DNA from a target DNA, e.g., the genome of a cell. The nuclease creates a specific double-strand break (DSB) at a desired location in the genome, and utilizes the cell's endogenous machinery to repair the induced break by homology-directed repair (HDR) (e.g., homologous recombination) or by non-homologous end joining (NHEJ). Any suitable nuclease can be introduced into a cell to induce genome editing of a target DNA sequence, including but not limited to CRISPR-associated protein (Cas) nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, other endonucleases or exonucleases, mutant forms thereof, fragments thereof, and combinations thereof. To improve the efficiency of precise genome editing by homology directed repair (HDR), nuclease-mediated genome editing of target DNA sequences can be "induced" or "regulated" (e.g., enhanced) using modified single guide RNAs (sgRNAs) described herein in combination with a Cas nuclease (e.g., a Cas9 polypeptide or Cas9 mRNA).

[0042] The term "homologous recombination repair" or "HDR" refers to a mechanism within cells that accurately and precisely repairs double-stranded DNA breaks using a homologous template to guide the repair. The most common form of HDR is homologous recombination (HR), a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA.

[0043] The term "non-homologous end joining" or "NHEJ" refers to a pathway for repairing double-stranded DNA breaks in which the broken ends are directly joined without the need for a homologous template.

[0044] The term "nucleic acid", "nucleotide" or "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and polymers thereof in either single-stranded, double-stranded or multi-stranded form. The term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers containing purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic or derivatized nucleotide bases. In some embodiments, nucleic acids can include mixtures of DNA, RNA and analogs thereof. The term also encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. A particular nucleic acid sequence also encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by creating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al., Biol. Chem. 260:2605-2608, 1985; and Rossolini et al., Mol. Cell. Probes 8:91-98, (1994)). The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.

[0045] The term "nucleotide analog" or "modified nucleotide" refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)), in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or linear sugar analog), or at the phosphate.

[0046] The term "gene" or "nucleotide sequence encoding a polypeptide" refers to a segment of DNA involved in producing a polypeptide chain. The DNA segment can include regions preceding and following the coding region (leader and trailer), as well as intervening sequences (introns) between individual coding segments (exons), which are involved in the transcription / translation and transcription / translation control of the gene product.

[0047] The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as to naturally occurring and non-naturally occurring amino acid polymers. The terms encompass amino acid chains of any length, including full-length proteins, in which the amino acid residues are linked by covalent peptide bonds.

[0048] The term "variant" refers to a form of an organism, strain, gene, polynucleotide, polypeptide or characteristic that deviates from that occurring in nature.

[0049] The term "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence, either by traditional Watson-Crick or other non-traditional types. Percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90% and 100% complementary). "Fully complementary" means that all contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[0050] The term "stringent conditions" for hybridization refers to conditions under which a nucleic acid having complementarity to a target sequence hybridizes primarily to the target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on many factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, NY.

[0051] The term "hybridization" refers to a reaction in which one or more polynucleotides react to form a stabilized complex through hydrogen bonds between the bases of nucleotide residues. Hydrogen bonds can occur by Watson-Crick base pairing, Hoogsteen binding, or in any other sequence-specific manner. The complex can include two strands forming a double-stranded structure, three or more strands forming a multistranded complex, a single self-hybridizing strand, or any combination of these.

[0052] A "recombinant expression vector" is a recombinantly or synthetically produced nucleic acid construct that has a series of specified nucleic acid elements that allow for the transcription of a particular polynucleotide sequence in a host cell. An expression vector can be part of a plasmid, a viral genome, or a nucleic acid fragment. Typically, an expression vector contains a polynucleotide to be transcribed operably linked to a promoter.

[0053] "Operably linked" means two or more genetic elements, such as a polynucleotide coding sequence and a promoter, positioned in a relative position that allows for proper biological function of the elements, such as a promoter directing transcription of the coding sequence.

[0054] The term "promoter" refers to an arrangement of nucleic acid control sequences that directs transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, for example, in the case of a polymerase II type promoter, a TATA element. A promoter also includes a distal enhancer or repressor element, which may be located several thousand base pairs from the start site of transcription, as necessary. Other elements that may be present in an expression vector include those that enhance transcription (e.g., enhancers) and those that terminate transcription (e.g., terminators), as well as those that confer a certain binding affinity or antigenicity to the recombinant protein produced from the expression vector.

[0055] "Recombinant" refers to a genetically modified polynucleotide, polypeptide, cell, tissue, or organism. For example, a recombinant polynucleotide (or a copy or complement of a recombinant polynucleotide) is one that has been engineered using well-known methods. A recombinant expression cassette that includes a promoter operably linked to a second polynucleotide (e.g., a coding sequence) can include a promoter that is heterologous to the second polynucleotide as a result of human engineering (e.g., by the methods described in Sambrook et al., Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). A recombinant expression cassette (or expression vector) typically includes polynucleotides in combinations not found in nature. For example, human-engineered restriction sites or plasmid vector sequences can flank the promoter or separate it from other sequences. Recombinant proteins are those expressed from recombinant polynucleotides, and recombinant cells, tissues and organisms are those that contain recombinant sequences (polynucleotides and / or polypeptides).

[0056] The term "single nucleotide polymorphism" or "SNP" refers to a change in a single nucleotide in a polynucleotide, including within an allele. This can include the substitution of one nucleotide for another, and the deletion or insertion of a single nucleotide. Most typically, SNPs are biallelic markers, although triallelic and tetraallelic markers can also exist. As a non-limiting example, a nucleic acid molecule containing SNP A\C can contain a C or an A at the polymorphic position.

[0057] The terms "cultivate", "culturing", "grow", "proliferate", "maintain", "maintaining", "expand", "expanding", and the like, when referring to cell culture itself or the process of culturing, can be used interchangeably to mean that cells (e.g., primary cells) are maintained outside their normal environment under controlled conditions, e.g., conditions suitable for survival. Cultured cells are allowed to survive, and culturing can result in cell proliferation, quiescence, differentiation, or division. The term does not mean that all cells in the culture survive, grow, or divide, as some cells may naturally die or senesce. Cells are typically cultured in a medium, which can be replaced during the course of culturing.

[0058] The terms "subject," "patient," and "individual" are used interchangeably herein to include a human or an animal. For example, an animal subject can be a mammal, a primate (e.g., monkey), a livestock animal (e.g., horse, cow, sheep, pig, or goat), a companion animal (e.g., dog, cat), a laboratory animal (e.g., mouse, rat, guinea pig, bird), an animal of veterinary importance, or an animal of economic importance.

[0059] The term "administering" includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarteriolar, intradermal, subcutaneous, intraperitoneal, intraventricular and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like.

[0060] The term "treat" refers to an approach to obtain beneficial or desired results, including but not limited to therapeutic benefit and / or preventive benefit. Therapeutic benefit refers to any therapeutically appropriate improvement or effect on one or more diseases, conditions or symptoms being treated. For preventive benefit, the composition can be administered to a subject who is at risk of developing a particular disease, condition or symptom, or a subject who reports one or more physiological symptoms of a disease, although the disease, condition or symptom may not yet be manifested.

[0061] The term "effective amount" or "sufficient amount" refers to an amount of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) sufficient to produce a beneficial or desired result. A therapeutically effective amount may vary depending on one or more of the subject and disease condition being treated, the subject's weight and age, the severity of the disease condition, the mode of administration, etc., and can be easily determined by one of ordinary skill in the art. The specific amount may vary depending on one or more of the particular agent selected, the type of target cell, the location of the target cell in the subject, the dosing regimen to be followed, whether it is administered in combination with other agents, the timing of administration, and the physical delivery system in which it is delivered.

[0062] The term "pharmaceutically acceptable carrier" refers to a substance that aids in the administration of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) to a cell, organism, or subject. "Pharmaceutically acceptable carrier" refers to a carrier or excipient that can be included in a composition or formulation and does not cause significant adverse toxic effects to the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, normal saline solution, lactated Ringer's solution, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, and colors. Those skilled in the art will recognize that other pharmaceutical carriers are useful in the present invention.

[0063] The term "increasing stability" with respect to a component of a CRISPR system refers to a modification that stabilizes the structure of any molecular component of a CRISPR system. This term includes modifications that decrease, inhibit, attenuate, or reduce the degradation of any molecular component of a CRISPR system.

[0064] The term "increasing specificity" with respect to components of a CRISPR system refers to modifications that increase the specific activity (e.g., on-target activity) of any molecular component of a CRISPR system. The term includes modifications that decrease, inhibit, attenuate, or reduce the non-specific activity (e.g., off-target activity) of any molecular component of a CRISPR system.

[0065] The term "reducing toxicity" with respect to a component of a CRISPR system refers to a modification that reduces, inhibits, attenuates, or reduces the toxic effect of any molecular component of a CRISPR system on a cell, organism, subject, etc.

[0066] The term "enhanced activity" with respect to components of the CRISPR system and in the context of gene regulation refers to an increase or improvement in the efficiency and / or frequency of inducing, regulating, controlling or regulating genome editing and / or gene expression.

[0067] The term "about" with respect to a referenced numerical value can include values ​​in a range of plus or minus 10% from that value. For example, the amount "about 10" includes amounts from 9 to 11, including the reference numerals 9, 10, and 11. The term "about" with respect to a referenced numerical value can also include values ​​in a range of plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% from that value.

[0068] IV. Non-viral transfection steps Disclosed herein is a method that provides a highly efficient targeted gene integration approach. The method can be used for genome engineering of any cell type, for example, in applications where engineered cells are introduced into a patient.

[0069] In some embodiments, the methods provided herein can be used to install CARs into T cells against any of the constructs that treat cancer, such as CD38, CD19, CD20, CD123, BCMA, etc. The efficiency of gene transfer can reach 40-80%. This approach using targeted gene integration can be used for both autologous and allogeneic approaches, and importantly, does not carry the risk of secondary and unwanted cell transformation when engineered cells are introduced into the patient, and is therefore safer than current conventional approaches. Additional advantages include modified guide strands, reliable gene integration, integration of large genes, gene integration of CARs, and gene integration of CARs with high expression.

[0070] The examples disclose the generation of CAR-T cells via RNA-guided endonuclease-mediated genome editing using phosphorothioate and 2'-O-methyl modified single-stranded or double-stranded donor DNA synthesized by PCR. Preferably, modified single-stranded (ss) or double-stranded (ds) DNA is generated by adding three PS bonds to nucleotides within 10 or 5 nucleotides of the 5' end of one primer. Without limiting the invention to any particular mechanism, it is believed that the PS modification inhibits exonuclease degradation of the modified strand of donor DNA. Nucleotides within 10 or 5 nucleotides of the 5' end of the primer are also modified with 2'-O-methyl to avoid non-specific binding caused by phosphorothioate bonds. Phosphorothioate and 2'-O-methyl modified ds donor DNA and ss donor DNA can be generated by PCR, asymmetric PCR or reverse transcription. Alternatively, the final ds DNA product of the synthesis can be modified with phosphorothioate and 2'-O-methyl, or dsDNA can be generated with modifications to only one strand.

[0071] Further disclosed are donor DNA constructs, such as donor DNA constructs with chemical modifications, such as phosphorothioate and 2'-O-methyl, that are designed to include CAR constructs, i.e., insert CAR (chimeric antigen receptor) into a predetermined genomic site of a host cell.Furthermore, the present disclosure provides host cells transfected with CAR that lack viral vectors that may present safety concerns.

[0072] This method using donor DNA with modifications on one strand can increase knock-in efficiency by at least 2-fold, which is comparable to viral vector methods, and has the advantage of being highly stable in terms of site specificity of integration and CAR expression in T cells compared to traditional retroviral or lentiviral approaches. At least double modification of one donor strand with phosphorothioate and / or 2'-O-methyl can increase knock-in efficiency. This one-step knock-out / knock-in method provides a faster and cheaper method of CAR-T production for multiple cancer treatments. The ability to use double-stranded DNA and avoid nuclease treatment of the donor construct and laborious, yield-reducing recovery of the single strand are other advantages of this method.

[0073] In this application, we present a simple and robust method for knocking in long dsDNA or ssDNA (e.g., about 3 kb anti-CD38 CAR and CD19 CAR) by modified dsDNA or ssDNA donor with phosphorothioate and 2'-O-methyl modification. We show that modified long dsDNA and ssDNA sequences are highly efficient HDR templates for CAR integration into primary T cells. Furthermore, we demonstrate that this method has the advantage of site specificity of integration and highly stable CAR expression in T cells compared to traditional retrovirus or lentivirus approaches.

[0074] The introduction of a CAR construct into T cells using the methods provided herein for targeted integration into the genome completely avoids the use of a viral vector, such as any recombinant viral vector, such as a retroviral vector or an adenoviral vector. Thus, the present disclosure provides a population of primary human T cells, in which at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% of the cells of the population express a CAR construct integrated into the genome, and none of the cells of the population contains a viral vector or any sequence derived from a viral vector. For example, the population of T cells provided herein that contains a CAR construct integrated into the genome does not have any retroviral or adenoviral sequences detectable in the population. The CAR construct integrated into the genome may not contain a viral vector sequence or a sequence derived from a viral vector. The population may be a population that has been transfected with donor DNA encoding a CAR construct using the methods and / or systems provided herein. The CAR construct is integrated into a site in the genome of the T cells that is targeted by the guide RNA. The CAR construct is integrated into the cas target site, i.e., the site adjacent to the PAM specific for cas nuclease. For example, the CAR construct is integrated into the target site in the genome adjacent to the cas9 PAM. As a non-limiting example, the CAR construct can be integrated into the T cell receptor gene (e.g., TRAC gene) or the PD-1 gene, such as, but not limited to, SEQ ID NO:1, SEQ ID NO:26 and SEQ ID NO:32. In various embodiments, the insertion of the CAR construct into the targeted site in the genome, such as the site in the TRAC gene or the site in the PD-1 gene, results in the knockout (disrupted expression) of the TRAC gene or the PD-1 gene.Thus, the present disclosure provides a population of primary T cells, in which at least 20%, at least 30% or at least 40% of the cells of the population express a CAR construct integrated into the genome and do not express the gene (e.g., TRAC or PD-1 gene) that is knocked out by targeted integration, and none of the cells contain a viral vector or any sequence derived from a viral vector. For example, the population of T cells provided herein that contains a CAR construct integrated into the genome does not have any retroviral or adenoviral sequences detectable in the population. The integrated CAR construct can be at least 1.5 kb, at least 1.7 kb, at least 1.9 kb, at least 2 kb or at least 2.1 kb in length. In a non-limiting example, the CAR construct can be a CAR construct that encodes a CAR that binds either CD38, CD19, CD20, CD123 or BCMA. In some exemplary embodiments, the CAR construct is anti-CD38. It can be a CAR, an anti-CD19 CAR or an anti-BCMA CAR.

[0075] The present disclosure provides a method for expressing a CAR gene in a primary cell, comprising: (a) a single guide RNA (sgRNA) comprising a first nucleotide sequence complementary to a selected knockout nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide, wherein one or more of the nucleotides of the sgRNA sequence are optionally modified nucleotides; (b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, and / or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or a Cas polypeptide, The method includes introducing into a primary cell a Cas polypeptide, an mRNA encoding a Cas polypeptide, and / or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or a Cas polypeptide, where the modified sgRNA directs the Cas polypeptide to the site of the knockout nucleic acid, and (c) a donor target DNA comprising a 5' HA sequence, a promoter sequence, a CAR construct, and a 3' HA sequence, the donor target DNA preferably being double-stranded, with both strands or preferably one strand modified with at least one phosphothioate bond within 5 nucleotides of the 5' end of the donor to reduce 5' exonuclease cleavage, and optionally one, two, three or four 2'-O-methyl modified nucleotides within 5 nucleotides of the 5' end. Preferably, the strand opposite the modified strand has a 5' terminal phosphate.

[0076] The present disclosure provides a method for inducing gene expression of a CAR gene in a primary cell, comprising: (a) a tracrRNA and a crRNA comprising a first nucleotide sequence complementary to a selected target knockout nucleic acid, wherein one or more of the nucleotides in the tracrRNA and the crRNA are optionally modified nucleotides; (b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, and / or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or a Cas polypeptide, wherein the crRNA directs the Cas polypeptide to the site of the knockout nucleic acid, and (c) a donor target DNA comprising a 5' HA sequence, a promoter sequence, a CAR construct, and a 3' HA sequence, wherein the donor target DNA is preferably double-stranded and has both or preferably one strand modified with at least one phosphothioate bond within 5 nucleotides of the 5' end of the donor to reduce 5' exonuclease cleavage, and optionally one, two, three or four 2'-O-methyl modified nucleotides within 5 nucleotides of the 5' end. Preferably, the strand opposite the modified strand has a 5' terminal phosphate. EXAMPLES

[0077] The examples demonstrate the advantage of the disclosed methods for knocking in donor DNA and knocking out target endogenous genes, such as T cell receptor (TCR) or PD-1 genes, which provide high transfection efficiency without the use of viral vectors.

[0078] Buffy coats from healthy volunteer donors were obtained from the San Diego Blood Bank. Portions of fresh whole blood or leukapheresis products were obtained from StemCell Techologies. Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation. PBMCs were incubated for 10 min with 100 ng / mL CD3 antibody (BioLegend, San Diego, CA) for 2 days in AIM-V medium (ThermoFisher Scientific, Waltham, MA) supplemented with 5% fetal bovine serum (Sigma, St. Louis, MO) with 300 U / mL IL-2 (Proleukin).6 PBMCs were activated at a density of 1000 cells / mL. The medium was changed every 2 to 3 days and the cells were incubated for 10 min at 4°C for 1 h. 6 Cells were replated at 10 cells / mL. This treatment selectively expands T cells in culture. In some experiments, cells were cultured at 10 in CTS™ OpTmizer™ T Cell Expansion SFM (ThermoFisher) supplemented with 5% CTS™ Immune Cell SR (Thermofisher scientific) with 300 U / mL IL-2 (Proleukin). 6 Cells were cultured at a density of 10000000000 cells / mL. In some experiments, T cells were isolated from PBMCs using magnetic negative selection using the EasySep™ Human T Cell Isolation Kit or CD3 Positive Selection Kit (Stemcell Technology Inc.) according to the manufacturer's instructions.

[0079] For use in cytotoxicity assays, RPMI-8226 multiple myeloma cell line (CD38-expressing) cells were transduced to express green fluorescent protein (GFP). K562 (human immortalized myeloid leukemia) cells (not CD38-expressing) were transduced to express R-phycoerythrin (RPE). Both cell lines were cultured in RPMI1640 medium (ATCC) supplemented with 10% fetal bovine serum (Sigma). CAR plasmids were generated using the In-Fusion® HD Cloning Kit (Takara Bio USA, Inc., Mountain View, CA). Backbone plasmid pAAV-MCS was purchased from Cell Biolabs (San Diego, CA).

[0080] In some experiments, retroviral transduced T cells were compared with Cas-mediated knock-in cells. Transduction of T cells with retroviral constructs was essentially performed as described in Ma et al., 2004 The Prostate 61:12-25; and Ma et al., The Prostate 74(3):286-296, 2014 (the disclosures of which are incorporated herein by reference in their entirety). Briefly, anti-CD38 CAR MFG retroviral vector plasmid DNA was transfected into Phoenix-Eco cell line (ATCC) using FuGene reagent (Promega, Madison, WI) to generate an narrow-skinned retrovirus, and then the harvested transient viral supernatant (wide-skinned virus) was used to transduce Gal-V envelope into PG13 packaging cells to generate a retrovirus for infecting human cells. The viral supernatant from PG13 cells was then used to transduce activated T cells (or PBMCs) 2–3 days after CD3 or CD3 / CD28 activation. Activated human T cells were prepared by activating normal healthy donor peripheral blood mononuclear cells (PBMCs) with 100 ng / mL mouse anti-human CD3 antibody OKT3 (Orth Biotech, Rartian, NJ) or anti-CD3, anti-CD28 TransAct (Miltenly Biotech, German) and 300–1000 U / mL IL2 as per the manufacturer's manual for 2 days in AIM-V growth medium (GIBCO-Thermo Fisher scientific, Waltham, MA) supplemented with 5% FBS. 10 μg / mL Retronectin (Takara Bio 5 × 10 cells were cultured in 3 mL of viral supernatant in a 6-well plate pre-coated with 100 mM NaCl (USA). 6 Activated human T cells were transduced and centrifuged at 1000 g for 1 hour at 32° C. After transduction, the transduced T cells were expanded in AIM-V growth medium supplemented with 5% FBS and 300-1000 U / mL IL2. [Table 1-1] [Table 1-2]

[0081] [Example 1] Simultaneous T cell receptor gene knockout and anti-CD38 CAR knock-in in human T cells. In this example, the T cell receptor alpha constant (TRAC) gene was targeted using an anti-CD38 CAR construct as donor DNA. The pAAV-TRAC-anti-CD38 construct was designed using approximately 1.3 kb of genomic DNA sequence of the T cell receptor alpha constant (TRAC) adjacent to the target sequence (CAGGGTTCTGGATATCTGT (SEQ ID NO: 1)) in the genome. The target sequence was identified as the upstream site of the Cas9 PAM in exon 1 of the TRAC gene for Cas9-mediated gene disruption and insertion of the donor construct. The anti-CD38 CAR gene construct (SEQ ID NO: 2) contained sequences encoding a single chain variable fragment (scFv) specific for human CD38, followed by CD8 and CD28 hinge-CD28 transmembrane-CD28 intracellular region and CD3 zeta intracellular domain. An exogenous JeT promoter (US Pat. No. 6,555,6674; SEQ ID NO: 3) was used to initiate transcription of the anti-CD38 CAR.

[0082] To construct the pAAV-anti-CD38A2 donor plasmid used as a PCR template to generate the donor fragment for genome editing, an anti-CD38A2 CAR construct (SEQ ID NO: 4) with 650-660 bp homology arms was synthesized by Integrated DNA Technologies (IDT, Coralville, IA). In-fusion cloning reactions were performed at room temperature containing MluI and BstEII double-digested pAAV-MCS vector (50 ng), anti-CD38A2 CAR fragment (SEQ ID NO: 4) with flanking homology arms (50 ng), 1 ul of 5X In-Fusion HD Enzyme Premix (Takara Bio) and nuclease-free water. The reactions were briefly vortexed and centrifuged, then incubated at 50°C for 30 min. Stellar™ Competent Cells (Takara Bio USA) were then transformed with the in-fusion product and plated onto ampicillin-treated agar plates. Multiple colonies were selected for Sanger sequencing (Genewiz, South Plainfield, NJ) and correct clones were identified using primers CTTAGGCTGGGCATTAGCAG (SEQ ID NO: 5), CATGGAATGGTCATGGGTCT (SEQ ID NO: 6) and GGCTACGTATTCGGTTCAGG (SEQ ID NO: 7). Correct clones were grown and DNA plasmids from these clones were purified.

[0083] For RNA-guided targeting of the TCR alpha (TRAC) gene, tracrRNA (ALT-R® CRISPR-Cas9 tracrRNA) and crispr RNA (ALT-R® CRISPR-Cas9 crRNA) were purchased from IDT (Coralville, IA), and the crRNA was designed to contain the target sequence CAGGGTTCTGGATATCTGT (SEQ ID NO: 1), which is located immediately upstream of the cas9 PAM sequence (NGG) in the first exon of the TRAC gene.

[0084] To generate donor fragment DNA, PrimeSTAR Max Premix (Takara Bio USA) was used in the PCR reaction. The AAV donor plasmid pAAV-anti-CD38A2 described above was used as a template. To generate donor fragments with 660nt and 650nt homology arms, the forward primer had the sequence: TGGAGCTAGGGCACCATATT (SEQ ID NO: 36) and the reverse primer had the sequence: CAACTTGGAGAAGGGGCTTA (SEQ ID NO: 9). In various experiments to test the effectiveness of different homology arm lengths, primers with sequences that hybridize to specific positions within the homology arms of the pAAV-anti-CD38A2 construct were used to generate donor fragments with homology arms of the desired length by PCR. Phosphorothioate bonds (Figure 2A) were introduced into the three terminal nucleotides at the 5' end of the forward primer (SEQ ID NO: 36) to inhibit exonuclease degradation (i.e., between the first and second, second and third, and third and fourth nucleotides from the 5' end). The nucleotides at the second, third and fourth positions from the 5' end of the forward oligonucleotide primer were also 2'-O-methyl modified to avoid non-specific binding that may be caused by the phosphorothioate (PS) backbone of the terminal three nucleotides (SEQ ID NO: 8, FIG. 2B). The reverse primer (SEQ ID NO: 9) was modified by 5'-terminal phosphorylation so that the strand could be digested by strandase provided by the Guide-it™ Long ssDNA Production System kit (Takara Bio USA). To generate donor DNA fragments, the thermocycler settings were: 1 cycle at 98°C for 30 s, 35 cycles at 98°C for 10 s, 66°C for 5 s, 72°C for 30 s and 1 cycle at 72°C for 10 min. Strandase digestion was performed according to the manufacturer's instructions (Takara Bio USA) and ssDNA was purified using NucleoSpin Gel and PCR Clean-Up kit (Takara Bio USA). The concentration of ssDNA was determined by NanoDrop (Denovix, Wilmington, DE).As controls, donor fragments were generated using unmodified primers such that the resulting donor fragments had no chemical modification (no PS or 2'-O-methyl groups) or only PS modifications (no 2'-O-methyl groups).

[0085] To generate TCR knockout / anti-CD38 CAR knock-in, T cells were activated by adding CD3 to the culture. Approximately 48-72 hours after initiating T cell activation with CD3, PBMC cultures containing activated T cells were electroporated with SpCas9 protein + crRNA (containing the guide sequence of SEQ ID NO:1) and tracrRNA using the Neon® Transfection System (ThermoFisher Scientific) and a 10 μl or 100 μl tip. Briefly, Alt-R CRISPR-Cas9 crRNA and Alt-R tracrRNA (IDT) were first mixed and heated at 95 °C for 5 min. The mixture was then removed from the heat and cooled to room temperature (15-25 °C) on the bench for approximately 20 min. For each transfection, 10 μg of SpCas9 protein (IDT) was mixed with 200 pmol of crRNA:tracrRNA duplex to form RNPs. 1 × 10 6 T cells were mixed with RNP and electroporated at 1700V, 20ms pulse width, 1 pulse. After 1-2 hours, 10ug of single-stranded donor DNA was electroporated into the cells at 1600V, 20ms pulse width, 1 pulse. In some cases, T cells were mixed with RNP and donor DNA, and RNP and donor were electroporated simultaneously. After electroporation, cells were diluted in culture medium and incubated at 37°C, 5% CO2.

[0086] As a control for the Cas-mediated knock-in approach, CAR-expressing PBMCs were generated by transduction of T cells with a retrovirus containing the same anti-CD38A2 expression cassette (SEQ ID NO:2) in the retroviral vector used to generate the donor fragment used in CRISPR targeting.

[0087] To determine knock-in efficiency by detecting CAR expression in transformed cells by FACS, transfected or transduced PBMCs were washed with DPBS / 5% human serum albumin and then stained with anti-CD3-BV421 antibody SK7 (BioLegend) and PE-conjugated anti-CD38-Fc protein (Chimerigen Laboratories, Allston, MA) for 30–60 min at 4 °C. CD3 and anti-CD38 CAR expression were analyzed using iQue Screener Plus (Intellicyte Co.). Negative controls were cells transfected with RNPs containing hybridized tracrRNA and cas9 protein complexed with crRNA targeting the first exon of the TRAC gene, but not with anti-CD38 CAR donor DNA. PBMCs transfected with RNPs containing guides targeting the TRAC locus were then transduced with retroviruses containing anti-CD38 CAR constructs as described above and were also analyzed for expression of the anti-CD38 CAR. Figure 3A shows that in cells transformed with RNPs in the absence of a donor fragment (to knock out the TRAC gene) to express the anti-CD38 CAR, 8 days after transfection, no expression of the anti-CD38 construct was detected (left-most panel). On the other hand, PBMCs with TRAC knockout and subsequently transduced with a retrovirus containing a construct to express the anti-CD38 CAR showed expression of the anti-CD38 CAR in approximately 70% of cells 8 days after transfection (right-most panel of Figure 3A). For cultures transformed with anti-CD38 CAR ss donor DNA in addition to RNPs targeting exon 1 of the TRAC gene, approximately 12% of the population that received ss donor DNA with no chemical modifications and approximately 13% of cultures transduced with ss donor DNA with only PS backbone modifications on nucleotides near the 5' end of the donor DNA (introduced by using PCR primers with PS bonds between nucleotides 1 and 2, 2 and 3, and 3 and 4, numbered from the 5' end) demonstrated expression of the anti-CD38 construct.Addition of methyl groups to the 2' oxygens of three nucleotides at the second, third and fourth nucleotides from the 5' end of the donor fragment strand that also contained a PS modification (by using primer SEQ ID NO:8 containing the following modifications to generate donor DNA by PCR) resulted in significantly higher expression of anti-CD38 CAR in the transfected population, with expression of anti-CD38 CAR seen in approximately 20% of cells that received the "doubly modified" (2'-O-methyl and PS) single-stranded donor fragment at day 8. Notably, chemical modification of donor DNA did not affect the viability of transfected cultures.

[0088] Increased expression of the anti-CD38 CAR was observed over time in cultures transfected with RNPs targeting the TRAC gene in addition to the anti-CD38 CAR donor fragment. Ten days after transfection, flow cytometry of PBMC cultures transfected with unmodified single-stranded donors or single-stranded donors modified to contain PS linkages on the three 5'-most nucleotides demonstrated that of all cultures transfected with RNPs targeting TRAC, at least 80% of cells did not express the TCR. Furthermore, in cultures transfected with anti-CD38 CAR donors in addition to RNPs targeting TRAC, at least 42% of cells that did not express a TCR expressed the anti-CD38 construct (Figure 3B, panels 2-4). For cultures transfected with anti-CD38 CAR donor fragments bearing both PS and 2'-O-methyl groups on the 5'-proximal nucleotides, 57% of cells were expressing the anti-CD38 construct by day 10. Concurrently, expression of the anti-CD38 CAR in retrovirally transduced cultures declined to approximately half of that seen on day 8 and to approximately 34% of cells 10 days after transfection or transduction. Analysis of doubly modified ss donor transfected and retrovirally transduced cultures at day 20 (Figure 3C) showed that expression of the anti-CD38 construct in the cultures was stabilized, with cas9 modified cultures transfected with ss donors bearing both PS and 2'-O-methyl modifications at the 5' end showing 54% of TCR negative cells expressing the construct and retrovirally transduced cultures showing 31% of TCR negative cells expressing the construct.

[0089] To confirm the occurrence of homology-directed repair (HDR) at the target locus in exon 1 of the TRAC gene, PCR was performed on DNA isolated from the culture to confirm that the donor fragment was inserted into the TRAC site targeted by the guide RNA. To detect targeted insertion of the anti-CD38 CAR transgene into the TRAC locus, genomic DNA was amplified from untransfected activated T cells (ATC), TRAC knockout cells transformed with RNPs containing TRAC exon 1 guide RNA, and T cells transfected with phosphorothioate and 2'-O-methyl modified donor DNA in addition to RNPs. To confirm the location of the donor DNA in the genome, oligonucleotide primers were targeted to sequences outside the TRAC homology arms but adjacent to the homology arm sequences in the genome. To extract genomic DNA, 30 μL of Quick A total of 1 × 10 in extraction solution (Epicentre) 5 The cells were resuspended. The cell lysates were incubated at 65°C for 5 min, then at 95°C for 2 min, and stored at -20°C. The concentration of genomic DNA was determined by NanoDrop (Denovix). The following primer sets were used to PCR amplify the genomic region containing the TRAC target site: 5' PCR forward primer on TRAC: CTGCTTTCTGAGGGTGAAG (SEQ ID NO: 10), 5' PCR reverse primer on CAR: CTTTCGACCAACTGGACCTG (SEQ ID NO: 11); 3' forward primer on CAR: CGTTCTGGGTACTCGTGGTT (SEQ ID NO: 12), 3' reverse primer on TRAC: GAGAGCCTTCCCTGACTTT (SEQ ID NO: 13) (see Figure 1B). Both primer sets were designed to avoid amplification of the HDR template by annealing outside the homology arms.

[0090] The concentration of genomic DNA was determined by NanoDrop (Denovix). Both primer sets were designed such that one primer of the pair anneals to a site in the genome outside the homology arms and the other primer of the pair anneals to a site within the coding region of the construct (i.e., not within the homology arms). The PCR contained 400 ng of genomic DNA and Q5 High Fidelity 2X mix (New England Biolabs). Thermocycler settings consisted of one cycle of 98°C for 2 min, 35 cycles of 98°C for 10 s, 65°C for 15 s, 72°C for 45 s, and one cycle of 72°C for 10 min. The PCR products were purified on a 1% agarose gel containing SYBR Safe (Life Technologies). The PCR products were then eluted from the agarose gel and isolated using NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL GmbH&Co.KG). The PCR products were subjected to Sanger sequencing (Genewiz). Figure 4 is a photograph of a gel separating the PCR products. Positive bands corresponding to the anti-CD38 construct adjacent to genomic sequences flanking the homology arms in the genome at the 5' and 3' ends of the construct were only seen in cells transfected with donor DNA (lanes 3 and 6) and not in non-transfected ATC (lanes 1 and 4) or TRAC knockout cells (lanes 2 and 5). Sequencing of these PCR products confirmed that they contained the anti-CD38 CAR sequence. SEQ ID NO:

[0091] To test the functionality of the transfected cells, 3 weeks after electroporation, activated T cells transfected with an anti-CD38 CAR targeted to the TRAC locus were starved overnight with IL-2 and tested in a specific killing assay (Figure 5). Activated T cells were co-cultured with a target cell mixture of CD38-positive RPMI-8226 / GFP cells and CD38-negative K562 / RPE cells. The effector-to-target cell ratios for incubation ranged from 10:1 to 0.08:1. After overnight incubation, cells were analyzed by flow cytometry to measure the GFP-positive and RPE-positive cell populations to determine specific target cell killing by anti-CD38A2 CART cells. Figure 5 shows that while non-transfected ATC cells showed some toxicity at the highest effector-to-target ratios, TRAC knockout cells showed virtually no killing regardless of effector-to-target cell ratio. However, anti-CD38A2 CART cells showed potent killing activity of CD38-positive cells-RPMI8226 but not CD38-negative cells-K562 (Figure 5). T cells incorporating chemically modified donor T cells containing anti-CD38 CAR cassettes showed cytotoxicity against target cells, similar to cells transduced with retroviruses containing anti-CD38 CAR constructs.

[0092] Transfected activated T cells (ATC) were also tested for cytokine secretion (Figure 6A, Figure 6B, Figure 6C). T cells were starved overnight in IL-2-free medium. Anti-CD38 CAR-T cells or ATC controls were then co-cultured with CD38-negative K562 cells or CD38-positive RPMI8226 cells. The effector-to-target cell ratio for incubation was 2:1. After overnight incubation, cells were centrifuged to collect supernatants for quantification of cytokines IL-2, IFN-γ and TNFα (Affymetrix eBioscience) according to the manufacturer's instructions. Gene-edited TCR knockout anti-CD38A2 CART cells also released similar amounts of IFN-γ and other pro-inflammatory cytokines when co-cultured with CD38-positive tumor cells (RPMI8226) but not when co-cultured with CD38-negative cells (K562).

[0093] In summary, in vitro cell function studies revealed no significant differences between the TRAC site-specific integrated anti-CD38A2 CAR achieved by this novel and efficient method and the virus-mediated randomly integrated anti-CD38A2 CAR in terms of both specific killing assays (Figure 5) and cytokine secretion assays (Figures 6A, 6B, 6C).

[0094] [Example 2] Shortening the length of homologous arms of donor DNA When synthesizing donor DNA by PCR, the nuclease reaction and the resulting purification of single-stranded donor fragments is time consuming and typically results in reduced yields of donor fragments for transfection, and it can be difficult to control the length of the homology arms (homology can be over-chewed). In further experiments testing the efficiency of directed gene knock-out and antibody construct knock-in, double-stranded donor DNA was tested to eliminate nuclease digestion of PCR-synthesized donors.

[0095] For knock-in of anti-CD38 CAR construct, donor fragments with different lengths of homologous arms (HA) were generated. The pAAV-TRAC-anti-CD38 construct described in Example 1, which contains 660 and 650nt TRAC exon 1 homologous arms (SEQ ID NO: 4) in addition to the anti-CD38 cassette, was used as a template. A first set of primers, SEQ ID NO: 8 and SEQ ID NO: 9, was used to generate donor fragments with 660nt and 650nt homologous arms from this template. A second set of primers, SEQ ID NO: 14 and SEQ ID NO: 15, was used to generate donor fragments with approximately 350nt (375 and 321 nucleotide) homologous arms, with the primer SEQ ID NO: 14 having PS bonds between the 1st and 2nd, 2nd and 3rd, and 3rd and 4th nucleotides from the 5' end, and 2'-O-methyl modified nucleotides at positions 2, 3, and 5. A third set of primers, SEQ ID NO:18 and SEQ ID NO:19, was used to generate donor fragments with homology arms of approximately 165 nt (171 and 161 nt), with the primer SEQ ID NO:18 having PS bonds between the first and second, third and fourth, and fourth and fifth nucleosides from the 5' end, and 2'-O-methyl modified nucleotides at positions 3, 4, and 5. In each case, the forward primers (SEQ ID NO:8, 14, and 18) were designed to have three PS bonds within the five most 5' nucleotides (e.g., between any of the first and second, second and third, third and fourth, and fourth and fifth nucleosides from the 5' end of the primer) and three 2'-O-methyl groups present in any of the five most 5' nucleotides. In each case, the reverse primers (SEQ ID NO:9, 15, and 17) had a 5' terminal phosphate (see Table 1).

[0096] Each primer set was used to generate a donor DNA molecule with multiple PS and 2'-O-methyl modifications near the 5' end of one strand of the donor and a 5' phosphate at the 5' end of the opposite strand of the donor. RNPs were constructed to contain tracr and crRNA as described in Example 1, and the crRNA contained the target sequence of SEQ ID NO: 1, a sequence found in exon 1 of the TRAC gene. Donor molecules with homologous arms of approximately 665, 350 and 165 base pairs in length were transfected independently into activated T cells as described in Example 1, except that the donor fragment and RNP were transfected in the same electroporation (using the Neon® Transfection System (ThermoFisher Scientific), 1700V, 20ms pulse width, 1 pulse) under conditions for electroporating RNP. As a control, activated T cells are transfected with RNP in the absence of donor fragment, which should result in targeted knockout of the TRAC locus but no donor DNA insertion. To test the expression of T cell receptor and anti-CD38 CAR construct, flow cytometry was performed as described in Example 1. Figure 7 shows that, as expected, T cell cultures transfected with only RNP have low expression levels of T cell receptor and do not show expression of anti-CD38 CAR. However, T cells transfected with donor DNA with different sizes of homologous arms in addition to RNP show low levels of T cell receptor expression and good expression of anti-CD38 CAR in culture, demonstrating that transfection of double-stranded DNA is highly effective for targeted knock-in. Furthermore, the shortest HA length tested, 161 / 171 nt, functioned at least as well as the longer lengths, with the percentage of knockout cells expressing the introduced construct being ∼24% for the ∼665 nt arm, ∼30% for the ∼350 nt arm, and ∼38% for the ∼165 nt arm.Thus, short homology arms have been found to be extremely effective in targeted knock-in genome modification using double-stranded DNA donors and have the advantage of allowing for smaller constructs and / or allowing for greater capacity in the construct to allow for the inclusion of additional or longer sequences in the donor DNA.

[0097] [Example 3] Modified double-stranded donor DNA vs. unmodified double-stranded donor DNA Primers with and without nucleotide modifications were used to synthesize donor DNA containing anti-CD38 CAR and carrying the approximately 165 nt TRAC exon 1 homology arm described in Example 2 above to test their relative effectiveness in promoting HDR. In the first case, primer SEQ ID NO:18 had three PS bonds present between the first and second, third and fourth, and fourth and fifth nucleosides and three 2'-O-methyl modified nucleotides within the first five nucleotides at the 5' end of the primer (at nucleotide positions 2, 3, and 5), and primer SEQ ID NO:19 had a 5' terminal phosphate (Table 1). These primers were used to generate donor DNA with the corresponding nucleotide modifications (i.e., three PS bonds and three 2'-O-methyl groups within five nucleotides of the 5' end of the first strand of the donor DNA product, and a phosphate on the 5' end of the second strand of the donor DNA product). In the second case, primer SEQ ID NO:37 was identical to primer SEQ ID NO:18, except that primer SEQ ID NO:37 lacked chemical modifications (see Table 1). Primer SEQ ID NO:37 and primer SEQ ID NO:19 lacking the 5' terminal phosphate were used to generate donor DNA without nucleotide modifications with an anti-CD38 CAR cassette. These donor DNAs were transfected into activated T cells as double-stranded DNA molecules (neither strand was denatured or nuclease digested) containing tracrRNA and crRNA containing the target sequence of SEQ ID NO:1 (within exon 1 of the TRAC gene) together with RNP. For electroporation with double-stranded DNA as the donor, 5ug of dsDNA was used to transfect 1 million activated T cells.

[0098] As in Example 2, control activated T cells were transfected with RNP in the absence of donor fragment, which should result in targeted knockout of the TRAC locus without inserting the construct. To test the expression of the T cell receptor and anti-CD3 CAR construct, flow cytometry was performed essentially as provided in Example 1. The results shown in Figure 8 show that transfection with RNP and modified duplex donor resulted in at least 2-fold expression of the anti-CD38 construct throughout the culture compared to transfection with RNP and unmodified duplex donor, with more than 50% of the cells in the culture expressing the anti-CD38 CAR transgene and not expressing the TCR (CD3 negative).

[0099] Sequencing of the PCR product generated using primers to diagnose the insertion locus (see FIG. 2B) provided a sequence demonstrating the anti-CD38 CAR donor fragment integrated into exon 1 of the TRAC gene. The PCR product sequence (SEQ ID NO:39 and SEQ ID NO:40) contained sequences flanking the homologous arms in the genome, the homologous arms present in the donor fragment, and a portion of the anti-CD38 CAR in a single PCR product, demonstrating the expected insertion.

[0100] Example 4: HDR-mediated knock-in of anti-CD19 and anti-BCMA CAR constructs with simultaneous TCR knock-out Additional donor DNA containing anti-CD19 CAR and anti-BCMA CAR expression constructs were also tested for insertion into the TRAC locus.

[0101] An anti-CD19 CAR construct was generated containing an anti-CD19 CAR cassette (SEQ ID NO:22) containing a Jet promoter (SEQ ID NO:3), an intron, an anti-CD19 CAR construct, and an SV40 polyA sequence, essentially as described for the anti-CD38 CAR pAAV construct described in Example 1, and cloned adjacent to the TRAC gene exon 1 homology arm (HA) of SEQ ID NO:20 and SEQ ID NO:21 into a vector. The anti-CD19 CAR with HA pAAV construct was used as a template in a PCR reaction provided in Example 1, using primers given as SEQ ID NO:18 and SEQ ID NO:19, which resulted in the production of modified donor DNA with HA of approximately 170 and 160 nucleotides (see Table 1). The forward primer (SEQ ID NO:18) had three PS bonds between the first and second, third and fourth, and fourth and fifth nucleosides, numbered from the 5' end of the primer, and three 2'-O-methyl modifications at nucleotides 3, 4, and 5. The reverse primer (SEQ ID NO: 19) had a 5'-terminal phosphate. The resulting double-stranded donor DNA was therefore synthesized with the corresponding modifications, i.e., the first strand with three PS and three 2'-O-methyl modifications within 5 nucleotides of the 5'-terminus, and the second strand with a 5'-terminal phosphate.

[0102] Cells were transfected with RNPs made according to the method provided in Example 1 using the above primers SEQ ID NO: 18 and a double-stranded chemically modified donor fragment having a sequence of SEQ ID NO: 38 incorporating nucleotide modifications of SEQ ID NO: 19, and the crRNA of the RNP contained the target sequence of SEQ ID NO: 1 targeting exon 1 of the TRAC gene. As a control, activated T cells were transfected with RNPs in the absence of donor fragments, which should result in targeted knockout of the TRAC locus without insertion of the construct. To evaluate the efficiency of introducing different constructs into the TRAC locus, flow cytometry was performed essentially as described in Example 1, except that anti-CD19 CAR expression was detected by CD19-Fc (Speed ​​Biosystem) followed by APC anti-human IgG Fcγ (Jackson Immunoresearch). The results are shown in Figure 9, where it can be seen that the anti-CD19 CAR was expressed in approximately 42% of the cells in the culture in the absence of T cell receptor expression.

[0103] An anti-BCMA CAR construct was generated by replacing the CD38 CAR with a BCMA CAR based on the anti-CD38 CAR pAAV construct described in Example 1. The BCMA CAR fragment was synthesized by IDT. The sequence of the insert is given as SEQ ID NO: 23. The anti-BCMA CAR construct was used as a template in a PCR reaction described in Example 1 using primers given as SEQ ID NO: 18 and SEQ ID NO: 19, which resulted in the production of a donor DNA with an HA of approximately 160-170 nucleotides (see Table 1). The forward primer (SEQ ID NO: 18) had three PS and three 2'-O-methyl modifications within 5 nucleotides of the 5' end of the primer. The reverse primer (SEQ ID NO: 19) had a 5' terminal phosphate. Thus, the resulting double-stranded donor DNA was synthesized with a first strand having three PS and three 2'-O-methyl modifications within 5 nucleotides of the 5' end, and a second strand having a 5' terminal phosphate.

[0104] The double-stranded donor fragment having the sequence of SEQ ID NO: 37, with nucleotides modified by incorporation of the above chemically modified primer, was used to transfect cells with RNPs made according to the method provided in Example 1, where the crRNA of the RNP contained the target sequence of SEQ ID NO: 1 targeting exon 1 of the TRAC gene. As a control, activated T cells were transfected with RNPs in the absence of donor fragment, which should result in targeted knockout of the TRAC locus without insertion of the construct. To evaluate the efficiency of introducing different constructs into the TRAC locus, flow cytometry was performed as described in Example 1, except that anti-BCMA CAR expression was detected by PE or APC conjugated BCMA-Fc (R&D). The results are shown in Figure 10, where it can be seen that the anti-BCMA CAR was expressed in approximately 66% of the cells in the culture, in the absence of T cell receptor expression.

[0105] [Example 5] HDR-mediated knock-in targeting TRAC exon 3 To test the efficiency of inserting donor DNA into a locus other than exon 1 of the TRAC gene using the methods for donor insertion provided herein, an anti-CD38 CAR construct was made to generate donor DNA with HA from exon 3 of the TRAC gene. In this case, the construct was made essentially as described in Example 1 for the TRAC exon 1 targeting construct, except that the HA (5' HA SEQ ID NO:24 (183 nt) and 3' HA SEQ ID NO:25 (140 nt)) was the sequence surrounding the exon 3 target site (SEQ ID NO:26). The sequence of the insert of the pAAV construct made as donor DNA with TRAC gene exon 3 homology arms is then given as SEQ ID NO:27. To generate the donor fragment, the forward primer (SEQ ID NO:28) contained PS linkages between the first and second, second and third, and third and fourth nucleosides and 2'-O-methyl modifications at the second, fourth, and fifth positions from the 5' end, and the reverse primer (SEQ ID NO:29) had a 5' terminal phosphate. The resulting double-stranded donor DNA incorporating the primers had a first strand with the corresponding PS and 2'-O-methyl modification on the 5'-most nucleotide, and a second strand with a 5' terminal phosphate.

[0106] The double-stranded donor fragment with modified nucleotides by incorporation of the above primer and with the sequence of SEQ ID NO: 27 was used to transfect cells with RNPs made according to the method provided in Example 1, where the crRNA contained the target sequence of SEQ ID NO: 26 targeting exon 3 of the TRAC gene. As a control, activated T cells were transfected with RNPs in the absence of donor fragments, which should result in targeted knockout of the TRAC locus without insertion of a construct. An additional control was non-transfected activated T cells (ATCs). Flow cytometry was performed essentially as described in Example 1. The results are shown in Figure 11, showing that transfection with RNPs or RNPs + donor DNA causes over 80% of cells to lose TCR expression throughout the culture. Furthermore, in approximately 42% of cells in cultures transfected with donor DNA carrying HA from TRAC gene exon 3 in addition to the target-directing RNP, anti-CD38 CAR was expressed in the absence of T cell receptor expression.

[0107] Sequencing of the PCR product generated using primers to diagnose the insertion locus (see FIG. 2B) provided a sequence demonstrating the anti-CD38 CAR donor fragment integrated into exon 3 of the TRAC gene. The PCR product sequence (SEQ ID NO: 41 and SEQ ID NO: 42) contained sequences flanking the homologous arms in the genome, the homologous arms present in the donor fragment, and a portion of the anti-CD38 CAR in a single PCR product, demonstrating the expected insertion.

[0108] Figure 12 compares the targeting of anti-CD19 CAR to exon 3 and exon 1 of the TRAC gene. Anti-CD19 CAR donor DNA directed to exon 3 was synthesized to contain the anti-CD19 CAR cassette (SEQ ID NO: 22) described in the above example, with the anti-CD19 expression cassette flanked by sequences from the exon 3 locus described above (SEQ ID NO: 24 and SEQ ID NO: 25). An anti-CD19 CAR donor directed to exon 1 (having the sequence of SEQ ID NO: 38) is provided in Example 4. Each of these constructs, one with the anti-CD19 CAR cassette (SEQ ID NO: 22) flanked by TRAC exon 1 HA (SEQ ID NO: 18 and SEQ ID NO: 19) and the other with the anti-CD19 CAR cassette (SEQ ID NO: 22) flanked by TRAC exon 3 HA (SEQ ID NO: 24 and SEQ ID NO: 25), was used to generate donor fragments using modified forward primers with PS and 2'-O-methyl modifications on the three 5'-most nucleotides. The reverse primer had a 5' terminal phosphate. Exon 1 The primers for generating the anti-CD19 CAR donor flanked by HA were SEQ ID NO: 18 and SEQ ID NO: 19, where the primer SEQ ID NO: 18 contained PS bonds between the first and second, third and fourth, and fourth and fifth nucleosides, and 2'-O-methyl groups at positions 3, 4, and 5 from the 5' end. The primers for generating the anti-CD19 CAR donor flanked by exon 3 HA were SEQ ID NO: 28 and SEQ ID NO: 29, where the primer SEQ ID NO: 28 had PS bonds between the first and second, second and third, and third and fourth nucleosides from the 5' end, and 2'-O-methyl groups at positions 2, 4, and 5 from the 5' end. Thus, the resulting double-stranded donor DNA had a first strand with the corresponding PS and 2'-O-methyl modification on the 5'-terminal nucleotide, and a second strand with a 5'-terminal phosphate.

[0109] Donor fragments were transfected independently into activated T cells with RNPs. RNPs were made as described in Example 1, except that the target sequence of crRNA for targeting TRAC gene exon 1 was SEQ ID NO: 1, and the target sequence of crRNA for targeting TRAC gene exon 3 was SEQ ID NO: 26. As can be seen from Figure 12, about 41% of the cultures transfected with RNPs targeting exon 3 of TRAC gene and donor fragments for expressing anti-CD19 CAR were both TCR negative and positive for anti-CD19 CAR, while about 20% of the cultures transfected with RNPs targeting exon 1 of TRAC gene and donor fragments for expressing anti-CD19 CAR were both TCR negative and positive for anti-CD19 CAR. T cell cultures transduced with retroviruses containing anti-CD19 CAR expression cassettes showed a higher percentage of anti-CD19 CAR expressing cells, but these cells did not have a TCR knockout.

[0110] Example 6: HDR-mediated knock-in targeting the PD-1 gene The PD-1 locus was also targeted with a CAR construct. In this case, an anti-CD38 CAR cassette (SEQ ID NO:2) was juxtaposed to homology arms (SEQ ID NO:30 and SEQ ID NO:31) with sequences of the PD-1 locus surrounding the target site (SEQ ID NO:32), using methods essentially as described in Example 1 to provide a template for making donor DNA.

[0111] Donor DNA was generated essentially as described in Example 1 using a forward primer (SEQ ID NO: 34) containing a 5' phosphate and a reverse primer (SEQ ID NO: 35) containing phosphorothioate linkages between the first and second, second and third, and third and fourth nucleosides from the 5' end, and 2'-O-methyl groups on the first, second, and fourth nucleosides from the 5' end, see Table 1.

[0112] The double-stranded chemically modified donor fragment (SEQ ID NO: 33) was used to transfect cells with RNPs made according to the method provided in Example 1, where the crRNA contained the target sequence of SEQ ID NO: 32 targeting the PD-1 gene. As a control, activated T cells were transfected with RNPs in the absence of donor fragments, resulting in targeted knockout of the PD-1 locus without insertion of a CAR construct. An additional control was non-transfected activated T cells (ATC). Flow cytometry was performed essentially as described in Example 1, including an additional control of non-transfected activated T cells (ATC). PD-1 expression was detected using a BV421-conjugated antibody against PD-1 (EH12.2H7, BioLegend).

[0113] The results are shown in Figure 13, and it is clear that the percentage of cells expressing PD-1 was reduced from about 19% in ATC to about 4% in the cells of the culture transfected with RNP targeting the PD-1 locus (PD-1 RNP). In addition to the RNP targeting PD-1, the anti-CD38 CAR was expressed in the absence of PD-1 expression in about 27% of the cells in the culture transfected with a donor having an HA with homology to the PD-1 locus. In comparison, about 32% of the cells in the culture transfected with an RNP targeting exon 1 of the TCR and an anti-CD38 CAR donor fragment with an HA with homology to the sequence of exon 1 of the TRAC gene.

[0114] Sequencing of the PCR product generated using primers to diagnose the insertion locus (see FIG. 2B) provided a sequence demonstrating the anti-CD38 CAR donor fragment integrated into the PD-1 gene. The PCR product sequence (e.g., SEQ ID NO: 43) contained sequences flanking the homologous arms in the genome, the homologous arms present in the donor fragment, and a portion of the anti-CD38 CAR in a single PCR product, demonstrating the expected insertion.

[0115] Figure 14 provides the results of a cytotoxicity assay performed using PBMCs and isolated T cells from cultures transfected with anti-CD38 CAR donor fragments and RNPs targeting the PD-1 locus ("PD-1 KOKI PBMCs" and "PD-1 KOKI T cells," respectively). These modified cells showed high levels of cytotoxicity against target cells in the assay, relative to control cells with a PD-1 gene knockout but not given a CAR construct ("PD-1 KO") and control cells with a TRAC gene knockout but not given a CAR construct ("TRAC-1 KO"), and were slightly less cytotoxic than cells transfected with anti-CD38 CAR donor fragments and RNPs targeting the TRAC locus ("TRAC KOKI"), possibly due to the less efficient integration of the donor CAR construct at the PD-1 site observed (Figure 13). In certain embodiments, for example, the following items are provided: (Item 1) 1. A method for site-specific integration of a donor DNA into a target DNA molecule, comprising: an RNA-guided endonuclease or a nucleic acid molecule encoding the RNA-guided endonuclease; At least one engineered guide RNA or at least one nucleic acid molecule encoding an engineered guide RNA; a donor DNA molecule comprising at least two nucleic acid modifications; introducing into a cell The method of claim 1, wherein the guide RNA comprises a target sequence designed to hybridize to a target site in the target DNA, and the donor DNA is inserted into the target DNA molecule at the target site. (Item 2) 2. The method of claim 1, wherein the at least two nucleic acid modifications are present on a single strand of the donor DNA molecule. (Item 3) 3. The method of claim 1 or 2, wherein the one or more nucleic acid modifications are modifications of one or more nucleotides or nucleotide linkages within 10 nucleotides of the 5' end of the modified strand of the donor DNA molecule. (Item 4) 2. The method of claim 1, wherein the one or more nucleic acid modifications are backbone modifications. (Item 5) 5. The method of claim 4, wherein the one or more nucleic acid modifications are phosphorothioate or phosphoramidite modifications or a combination thereof. (Item 6) 2. The method of claim 1, wherein the one or more nucleic acid modifications are nucleobase modifications or substitutions. (Item 7) 2. The method of claim 1, wherein the one or more nucleic acid modifications are sugar modifications or substitutions. (Item 8) 8. The method of claim 7, wherein the one or more nucleic acid modifications are 2'-O-methyl group modifications of deoxyribose. (Item 9) 3. The method of claim 1 or 2, wherein the donor DNA molecule is a double-stranded DNA molecule. (Item 10) 11. The method of claim 9, wherein the donor DNA molecule has a modified strand that includes the at least two nucleic acid modifications and has a 5'-terminal phosphate on the strand opposite the modified strand. 11. The method of claim 10, wherein the donor DNA molecule has 1 to 3 phosphorothiolate modifications on the backbone within 10 nucleotides of the 5' end of the modified strand of the donor DNA molecule and 1 to 3 2'-O-methyl nucleotide modifications within 10 nucleotides of the 5' end of the modified strand of the donor molecule. (Item 12) 12. The method of claim 11, wherein the donor molecule has 1-3 phosphorothiolate modifications on the backbone within 5 nucleotides of the 5' end of the modified strand of the donor molecule and 1-3 2'-O-methyl nucleotide modifications within 5 nucleotides of the 5' end of the modified strand of the donor molecule. (Item 13) 2. The method of claim 1, wherein the donor DNA molecule comprises homology arms flanking a sequence for integration into the genome. (Item 14) Item 14. The method of item 13, wherein at least one of the homology arms is 50 to 2000 nucleotides in length. (Item 15) Item 14. The method according to item 13, wherein at least one of the homology arms is 100 to 1000 nucleotides in length. (Item 16) Item 14. The method of item 13, wherein at least one of the homology arms is 150 to 650 nucleotides in length. (Item 17) Item 14. The method of item 13, wherein at least one of the homology arms is 150 to 350 nucleotides in length. (Item 18) Item 14. The method according to item 13, wherein at least one of the homology arms is 150 to 200 nucleotides in length. (Item 19) 14. The method of claim 13, wherein the donor DNA molecule comprises a modified strand and an opposing strand, the modified strand comprising two or more nucleic acid modifications and the opposing strand comprising a terminal phosphate. (Item 20) 2. The method of claim 1, wherein the donor DNA comprises a chimeric antigen receptor (CAR) construct. (Item 21) 2. The method of item 1, wherein the guide RNA is a crRNA. (Item 22) The method of claim 21, further comprising introducing tracrRNA into the cell. (Item 23) 2. The method of claim 1, wherein the guide RNA is a chimeric guide RNA. (Item 24) 2. The method of claim 1, wherein the RNA-guided endonuclease is Cas9, Cas12a, Cas12b, Cas13, Cas14 or CasX. (Item 25) 2. The method of claim 1, wherein at least one guide RNA is introduced into the cell. (Item 26) 2. The method of claim 1, wherein an RNA-guided endonuclease is introduced into the cell. (Item 27) 27. The method of claim 26, wherein the RNA-guided endonuclease and the guide RNA are introduced into the cell as a ribonucleoprotein complex (RNP). (Item 28) 28. The method of claim 27, wherein the RNP further comprises tracrRNA. (Item 29) 28. The method of claim 27, wherein the RNP is introduced into the cell by electroporation or liposome transfer. (Item 30) 28. The method of claim 27, wherein the donor DNA and the RNP are introduced into the cell simultaneously or separately. (Item 31) 2. The method of claim 1, wherein the RNA-guided endonuclease or the nucleic acid molecule encoding an RNA-guided endonuclease, the at least one engineered guide RNA or the at least one nucleic acid molecule encoding an engineered guide RNA, and the donor DNA molecule are introduced into the cell simultaneously. (Item 32) 2. The method of claim 1, wherein the cell is a eukaryotic cell. (Item 33) 33. The method of claim 32, wherein the cell is a mammalian cell. (Item 34) 33. The method of claim 32, wherein the cell is a human cell. (Item 35) 33. The method of item 32, wherein the cells are hematopoietic cells. (Item 36) 36. The method of claim 35, wherein the cell is a T cell. (Item 37) 2. The method of claim 1, wherein the target site is selected from a T cell receptor gene, a PD-1 gene, or a TIM3 gene. (Item 38) A host cell comprising: comprising a donor DNA integrated into a target DNA molecule, The host cell is produced by the method according to any one of items 1 to 37. (Item 39) A population of primary T cells transfected with a chimeric antigen receptor (CAR) construct, said population of primary T cells comprising T cells having the CAR construct integrated into the genome at a cas9 nuclease target site; at least 20% of the T cells in the population express the CAR construct; A population of primary T cells transfected with a chimeric antigen receptor (CAR) construct, wherein the T cells of the population do not comprise a recombinant viral vector or a sequence derived from a recombinant viral vector. (Item 40) 41. The population of primary T cells according to claim 39, wherein the CAR construct is at least 1.8 kb. 40. The population of primary T cells of item 39, wherein the CAR construct is an anti-CD38 CAR construct, an anti-CD19 CAR construct, or an anti-BCMA CAR construct. (Item 42) 40. The population of primary T cells of paragraph 39, wherein at least 40% of the cells of the population express the CAR construct. (Item 43) 40. The population of primary T cells of paragraph 39, wherein at least 50% of the cells of the population express the CAR construct. (Item 44) 40. The population of primary T cells of item 39, wherein the CAR construct is inserted into the TRAC locus. (Item 45) 45. The population of primary T cells of item 44, wherein at least 20% of the cells in the population do not express the T cell receptor. (Item 46) 40. The population of primary T cells of paragraph 39, wherein the CAR construct is inserted into the PD-1 locus. (Item 47) 47. The population of primary T cells of paragraph 46, wherein at least 20% of the cells in the population do not express PD-1. (Item 48) 1. A system for targeted integration of donor DNA into a target locus, comprising: an RNA-guided endonuclease or a nucleic acid molecule encoding the RNA-guided endonuclease; A guide RNA or a nucleic acid molecule encoding the guide RNA; a double-stranded donor DNA molecule, the donor DNA molecule comprising one modified strand having one or more phosphorothioate linkages within 10 nucleotides of the 5' end of the modified strand. (Item 49) 49. The system according to item 48, wherein the system comprises an RNA-guided endonuclease. (Item 50) 49. The system of item 48, wherein the system comprises a guide RNA. (Item 51) 49. The system of claim 48, wherein the donor DNA molecule further comprises at least one modification of a sugar moiety or a nucleobase of the modified strand within 10 nucleotides of the 5' end of the modified strand. (Item 52) 49. The system of item 48, wherein the donor DNA has homology arms flanking a sequence of interest for integration into the genome. (Item 53) 49. The system of item 48, wherein the one or more phosphorothioate linkages on the modified strand of the double-stranded DNA molecule are present within 5 nucleotides of the 5' end of the modified strand. (Item 54) 52. The system of claim 51, wherein the at least one modification of a sugar moiety or nucleobase of the modified strand is present within 5 nucleotides of the 5' end of the modified strand. (Item 55) Item 56. The system according to item 51, wherein the at least one modification of a sugar moiety comprises 2'-O-methylation. 53. The system of item 52, wherein the sequence of interest comprises an expression cassette. (Item 57) 53. The system of item 52, wherein the expression cassette comprises a construct comprising one or more antibody or receptor domains. (Item 58) 53. The system according to item 52, wherein at least one of the homology arms is 50 to 5000 nucleotides in length. (Item 59) 59. The system according to item 58, wherein at least one of the homology arms is 100 to 1000 nucleotides in length. (Item 60) 60. The system according to item 59, wherein at least one of the homology arms is 150 to 800 nucleotides in length. (Item 61) 49. The system of claim 48, wherein the nuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, CasX and combinations thereof. (Item 62) 51. The system of item 50, wherein the guide RNA is a chimeric guide having sequences of both crRNA and tracrRNA. (Item 63) 51. The system of item 50, wherein the guide RNA is a crRNA. (Item 64) 51. The system of item 50, wherein the guide RNA comprises one or more phosphorothioate (PS) oligonucleotides. (Item 65) 51. The system of item 50, further comprising tracrRNA. (Item 66) 51. The system of item 50, wherein the guide RNA is a single guide RNA. (Item 67) 49. The system according to item 48, comprising a ribonucleoprotein complex comprising said RNA-guided endonuclease and said guide RNA. (Item 68) 1. A composition for generating a donor DNA molecule, comprising: a first primer having, on a single strand of the double-stranded DNA molecule, one or more phosphorothioate linkages and one or more modified nucleotides within 5 nucleotides of the 5' end of the modified strand of the nucleic acid molecule; a second primer having a 5' terminal phosphate. (Item 69) 70. The composition of claim 68, wherein the first and second primers are homologous to sequences on opposite sides of a target site of an RNA-guided endonuclease in a target genome. (Item 70) A double-stranded donor DNA molecule configured to integrate a sequence of interest into a target site in a host genome. one or more modifications to nucleotides of one donor DNA strand; homology arms flanking the sequence of interest, the homology arms comprising sequences homologous to sequences present on either side of the target site in the host genome; and 1 to 10 modified nucleotides present within 10 nucleotides of the 5' end of one strand of the donor DNA. (Item 71) 71. The double-stranded donor DNA molecule of item 70, comprising 1 to 5 modified nucleotides present within 5 nucleotides of the 5' end of one strand of the donor DNA. (Item 72) 71. The double-stranded donor DNA molecule according to item 70, wherein the modified nucleotides comprise one to four phosphorothioate (PS) linkages or one to four 2'-O-methylation modifications or a combination thereof. (Item 73) 71. The double-stranded donor DNA molecule of item 70, wherein one strand has two or more modified nucleotides present within 5 nucleotides of the 5' end of one strand of the donor DNA and the other strand has a terminal 5' phosphate. (Item 74) 71. The double-stranded donor DNA molecule of claim 70, wherein the sequence of interest comprises a chimeric antigen receptor (CAR) construct. (Item 75) 71. The double-stranded donor DNA molecule of item 70, wherein the target site is selected from a T cell receptor gene, a PD-1 gene, or a TIM3 gene. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15]

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

Table 2-21

Table 2-22

Table 2-23

Table 2-24

Table 2-25

Table 2-26

Table 2-27

Table 2-28

Table 2-29

Table 2-30

Table 2-31

Table 2-32

Table 2-33

Table 2-34

Table 2-35

Table 2-36

Table 2-37

Table 2-38

Claims

[Claim 1] The invention described in this specification.

Images