Gene therapy vectors for infantile malignant osteopetrosis

Abstract

To provide improved gene therapy vectors comprising a polynucleotide sequence encoding a TCIRG1 polypeptide or a functional variant thereof, methods of use thereof, pharmaceutical compositions, and more, and in particular, to provide lentiviral vectors for treatment of infantile malignant osteopetrosis (IMO).SOLUTION: Provided is a transfer plasmid, comprising an expression cassette comprising a coding polynucleotide encoding a T cell immune regulator 1 (TCIRG1) polypeptide and a promoter, wherein the polynucleotide is operatively linked to the promoter, and wherein the transfer plasmid comprises an RNA-OUT repressor and a CMV IE promoter, and also comprises a polynucleotide sharing at least 95% identity to a specific sequence.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority benefit of U.S. Provisional Patent Application No. 62 / 852,216, filed May 23, 2019, the contents of which are incorporated herein by reference in their entirety.

[0002] Description of sequence listing The sequence listing associated with this application is provided in text format in lieu of a paper copy and is incorporated herein by reference. The name of the text file containing the sequence listing is ROPA_003_01WO_ST25.txt. The text file is approximately 62KB and was created on May 22, 2020, and has been submitted electronically via EFS-Web.

[0003] Field The present disclosure relates generally to gene therapy for diseases associated with mutations in the T cell immune regulator 1, ATPase H+ transporting V0 subunit a3 gene (TCIRG1). In particular, the present disclosure provides gene therapy vectors and plasmids comprising an expression cassette encoding the TCIRG1 protein (TCIRG1). [Background technology]

[0004] Infantile malignant osteopetrosis (IMO) is a rare recessive disorder characterized by increased bone mass caused by dysfunctional osteoclasts. The disease is most often caused by mutations in T-cell immunoregulatory factor 1, ATPase H+ transporting V0 subunit a3 (TCIRG1). TCIRG1 is involved in the ability of osteoclasts to resorb bone.

[0005] Osteoclast function can be restored by lentiviral vector-mediated expression of TCIRG1. Moscatelli et al. Bone 57:1-9 (2013) (Non-Patent Document 1). Further studies show that lentiviral-mediated expression of TCIRG1 is regulated in the same manner as the endogenous gene product, even though it is expressed by a lentiviral vector with a constitutive physiological promoter. Thudium et al. Calcif Tissue Int. 99:638-648 (2016) (Non-Patent Document 2). Furthermore, they demonstrated that the native TCIRG1 gene sequence leads to higher levels of protein expression and functional rescue in osteoclasts than the codon-optimized cDNA of the gene, even though the mRNA level from the codon-optimized cDNA of the gene is considerably higher. Furthermore, the data show that only a small proportion of human pre-osteoclasts with functional TCIRG1 are required to significantly increase resorption function in vitro, consistent with previous results from an oc / oc mouse model of osteopetrosis where resorbing and non-resorbing osteoclasts are likely fused. From both an efficacy and safety standpoint, this finding supports the further development of gene therapy for osteopetrosis.

[0006] There is still a need in the art for gene therapy vectors of TCIRG1 and therapeutic methods using such vectors.In addition, there is a need for reliable methods for producing such gene therapy vectors.The present disclosure provides such gene therapy vectors, their production methods, their use methods, pharmaceutical compositions, etc. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Moscatelli et al.Bone 57:1-9(2013) [Non-Patent Document 2] Thudium et al.Calcif Tissue Int.99:638-648(2016) Summary of the Invention

[0008] The present disclosure provides improved gene therapy vectors comprising polynucleotide sequences encoding a TCIRG1 polypeptide or a functional variant thereof, methods of use thereof, pharmaceutical compositions, and the like.

[0009] In one aspect, the disclosure provides a transfer plasmid comprising an expression cassette comprising a coding polynucleotide encoding an isoform of T cell immunoregulator 1 (TCIRG1) or a functional variant thereof and a promoter, wherein the polynucleotide is operably linked to the promoter, and the transfer plasmid comprises an RNA-OUT repressor and a CMV IE promoter.

[0010] In some embodiments, the RNA-OUT repressor shares at least 95% identity or at least 99% identity with SEQ ID NO:32.

[0011] In some embodiments, the CMV IE promoter shares at least 95% identity or at least 99% identity with SEQ ID NO:33.

[0012] In some embodiments, the transfer plasmid comprises a pCCL backbone.

[0013] In some embodiments, the pCCL backbone comprises an RNA-OUT repressor.

[0014] In some embodiments, the transfer plasmid shares at least 95% identity with SEQ ID NO:39.

[0015] In some embodiments, the transfer plasmid comprises SEQ ID NO:39.

[0016] In some embodiments, the promoter is an EFS promoter.

[0017] In some embodiments, the EFS promoter shares at least 95% identity with SEQ ID NO:2.

[0018] In some embodiments, the EFS promoter is SEQ ID NO:2.

[0019] In some embodiments, the encoding polynucleotide shares at least 95% identity with SEQ ID NO:3.

[0020] In some embodiments, the encoding polynucleotide shares at least 99% identity with SEQ ID NO:3.

[0021] In some embodiments, the coding polynucleotide is SEQ ID NO:3.

[0022] In some embodiments, the expression cassette comprises a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE).

[0023] In some embodiments, the WPRE is SEQ ID NO:4.

[0024] In some embodiments, the expression cassette shares at least 95% identity with SEQ ID NO:1.

[0025] In some embodiments, the expression cassette is flanked by a 5' long terminal repeat (LTR) and a 3' LTR.

[0026] In some embodiments, the 5'LTR is SEQ ID NO:34 and / or the 3'LTR is SEQ ID NO:28.

[0027] In some embodiments, the expression cassette shares at least 95% identity with SEQ ID NO:1.

[0028] In some embodiments, the expression cassette is SEQ ID NO:1.

[0029] In another aspect, the disclosure provides an expression cassette comprising a polynucleotide encoding an isoform of T cell immunoregulatory factor 1 (TCIRG1) or a functional variant thereof and an EFS promoter, optionally wherein the polynucleotide is operably linked to the EFS promoter.

[0030] In some embodiments, the coding polynucleotide shares at least 95% identity with SEQ ID NO: 3. In some embodiments, the coding polynucleotide shares at least 99% identity with SEQ ID NO: 3. In some embodiments, the coding polynucleotide is SEQ ID NO: 3. In some embodiments, the EFS promoter shares at least 95% identity with SEQ ID NO: 2. In some embodiments, the EFS promoter is SEQ ID NO: 2.

[0031] In some embodiments, the expression cassette comprises a Woodchuck Hepatitis Virus (WHP) Post-transcriptional Regulatory Element (WPRE). In some embodiments, the WPRE is SEQ ID NO:4.

[0032] In some embodiments, the expression cassette shares at least 95% identity with SEQ ID NO: 1. In some embodiments, the expression cassette is SEQ ID NO:1.

[0033] In another aspect, the present disclosure provides a recombinant lentiviral genome, comprising, in 5' to 3' order, a lentiviral 5' long terminal repeat (LTR), an expression cassette disclosed herein, and a lentiviral 3' LTR, wherein said recombinant lentiviral genome is replication-incompetent.

[0034] In another aspect, the present disclosure provides lentiviral particles comprising such recombinant lentiviral genomes.

[0035] In another aspect, the present disclosure provides a transfer plasmid comprising such a recombinant lentivirus genome.In certain embodiments, the transfer plasmid comprises an RNA-OUT sequence.In some embodiments, the RNA-OUT sequence is SEQ ID NO: 22.In some embodiments, the RNA-OUT sequence is configured to allow the transfer plasmid to stably propagate in a packaging cell line.

[0036] In certain embodiments, the transfer plasmid does not contain an antibiotic resistance gene or does not contain an ampicillin resistance gene, such as AmpR.

[0037] In a particular embodiment, the transfer plasmid comprises the sequence set forth in SEQ ID NO:23.

[0038] In another aspect, the disclosure provides a method of producing lentiviral particles, comprising transfecting any of the transfer plasmids of the disclosure and optionally one or more additional plasmids into a packaging cell line and culturing the packaging cell line. In some embodiments, the transfer plasmid is stably propagated at 30-37° C. in a bacterial host using shake flasks or fermentation for at least 1, 2, 3, 4, 5, 6, or 7 days.

[0039] In a related aspect, the present disclosure provides lentiviral particles produced using the transfer plasmids disclosed herein.

[0040] In another aspect, the present disclosure provides a pharmaceutical composition comprising any of the lentiviral particles of the present disclosure.

[0041] In another aspect, the disclosure provides modified cells comprising any of the expression cassettes of the disclosure.

[0042] In another aspect, the present disclosure provides modified cells comprising any of the recombinant lentiviral genomes of the present disclosure.

[0043] In some embodiments, the modified cell lacks an endogenous functional TCIRG1 gene.

[0044] In some embodiments, the modified cells are derived from a subject having or suspected of having infantile malignant osteopetrosis (IMO).

[0045] In some embodiments, the modified cells express TCIRG1 or a functional variant thereof at a level similar to the expression level of TCIRG1 observed in osteoclasts that have a functional TCIRG1 gene.

[0046] In some embodiments, the modified cells express TCIRG1 or a functional variant thereof at a level similar to the expression level of TCIRG1 observed in osteoclasts derived from subjects who do not have or are not suspected of having IMO.

[0047] In some embodiments, the modified cells are hematopoietic stem cells (HSCs).

[0048] In some embodiments, the modified cells are CD34+ progenitor cells.

[0049] In some embodiments, the modified cells are derived from HSCs isolated by apheresis from a subject having or suspected of having IMOs.

[0050] In some embodiments, the modified cells are derived from HSCs isolated by apheresis from subjects with or suspected of having IMOs following mobilization of HSCs by administration of G-CSF, plerifaxor, or a combination of G-CSF and plerifaxor.

[0051] In some embodiments, the modified cells are derived from a population of cells enriched for CD34+ cells by magnetic capture.

[0052] In another aspect, the disclosure provides a pharmaceutical composition comprising any of the modified cells of the disclosure.

[0053] In another aspect, the disclosure provides an in vitro method of modifying one or more cells of a subject having or suspected of having an IMO, the method comprising: providing peripheral blood mononuclear cells (PBMCs) mobilized from a subject by administering to the subject a composition comprising G-CSF, plerixafor, or a combination of G-CSF and plerixafor; enriching CD34+ cells from said PBMCs by magnetic separation to generate a population of CD34-enriched cells; and contacting said CD34-enriched cells with a lentiviral particle comprising a recombinant lentiviral genome, the recombinant lentiviral genome comprising, in 5' to 3' order, a lentiviral 5' long terminal repeat (LTR), any expression cassette of the disclosure, and a lentiviral 3' LTR, wherein the recombinant lentiviral genome is replication incompetent.

[0054] In another aspect, the present disclosure provides a method of treating infantile malignant osteopetrosis (IMO) in a subject having or suspected of having IMO, comprising administering to the subject any modified cell of the present disclosure or any pharmaceutical composition of the present disclosure.

[0055] In some embodiments, the method repopulates the HSC niche with modified cells expressing TCIRG1 or a functional variant thereof.

[0056] In some embodiments, the method relocates modified cells expressing TCIRG1 or a functional variant thereof to the osteoclast niche.

[0057] In some embodiments, the methods treat, ameliorate, prevent, reduce, inhibit, or alleviate IMO.

[0058] In some embodiments, the methods extend the mean overall survival of treated subjects by at least 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more.

[0059] In some embodiments, the methods prevent death of a subject from IMO.

[0060] In some embodiments, the subject is a human.

[0061] In some embodiments, the subject exhibited symptoms of IMO prior to treatment.

[0062] In some embodiments, the subject was identified as having reduced or undetectable expression of TCIRG1 prior to treatment.

[0063] In one embodiment, the subject has been identified as having a mutated TCIRG1 gene.

[0064] In some embodiments, the subject is an infant.

[0065] In some embodiments, the methods include autologous treatment.

[0066] In some embodiments, administration is via intravenous infusion.

[0067] In another aspect, the present disclosure provides a recombinant lentiviral genome for use in preparing a medicament for treating or preventing infantile malignant osteopetrosis (IMO), wherein the lentiviral genome comprises, in 5' to 3' order, a lentiviral 5' long terminal repeat (LTR), any expression cassette of the present disclosure, and a lentiviral 3' LTR, wherein the recombinant lentiviral genome is replication-incompetent.

[0068] In another aspect, the present disclosure provides a lentiviral particle for use in the preparation of a medicament for treating or preventing infantile osteopetrosis (IMO), comprising a recombinant lentiviral genome, the lentiviral genome comprising, in 5' to 3' order, a lentiviral 5' long terminal repeat (LTR), any expression cassette of the present disclosure, and a lentiviral 3' LTR, wherein the recombinant lentiviral genome is replication-incompetent.

[0069] [The present invention 1001] A transfer plasmid comprising an expression cassette comprising a coding polynucleotide encoding an isoform or functional variant of T cell immune regulator 1 (TCIRG1) or a promoter, wherein the polynucleotide is operably linked to the promoter, and the transfer plasmid comprises an RNA-OUT repressor and a CMV IE promoter. [The present invention 1002] 1001. The transfer plasmid of the present invention, wherein said RNA-OUT repressor shares at least 95% identity or at least 99% identity with SEQ ID NO:32. [The present invention 1003] 1001 or 1002, wherein said CMV IE promoter shares at least 95% identity or at least 99% identity with SEQ ID NO:33. [The present invention 1004] A transfer plasmid according to any one of claims 1001 to 1003, comprising a pCCL backbone. [The present invention 1005] 1004. The transfer plasmid of the present invention, wherein said pCCL backbone comprises said RNA-OUT repressor. [The present invention 1006] 1005. A transfer plasmid of the present invention, which shares at least 95% or 100% identity with SEQ ID NO:39. [The present invention 1007] The transfer plasmid of any one of claims 1001 to 1007, wherein the promoter is an EFS promoter. [The present invention 1008] 1007. The transfer plasmid of the present invention, wherein said EFS promoter shares at least 95% identity with SEQ ID NO:2. [The present invention 1009] The transfer plasmid of the present invention, wherein said EFS promoter is SEQ ID NO:2. [The present invention 1010] The transfer plasmid of any one of claims 1001 to 1009, wherein the coding polynucleotide shares at least 95% identity with SEQ ID NO:3. [The present invention 1011] The transfer plasmid of the present invention, wherein said coding polynucleotide shares at least 99% identity with SEQ ID NO:3. [The present invention 1012] The transfer plasmid of the present invention, wherein said coding polynucleotide is SEQ ID NO:3. [The present invention 1013] The transfer plasmid of any one of claims 1001 to 1012, wherein the expression cassette comprises a Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE). [The present invention 1014] The transfer plasmid of the present invention, wherein said WPRE is SEQ ID NO:4. [The present invention 1015] The transfer plasmid of any one of claims 1001 to 1014, wherein the expression cassette shares at least 95% identity with SEQ ID NO:1. [The present invention 1016] The transfer plasmid of any of claims 1001 to 1015, wherein the expression cassette is flanked by a 5' long terminal repeat (LTR) and a 3' LTR. [The present invention 1017] 1016. A transfer plasmid according to the invention, wherein said 5'LTR is SEQ ID NO: 34 and / or said 3'LTR is SEQ ID NO: 28. [The present invention 1018] The transfer plasmid of any one of claims 1001 to 1017, wherein the expression cassette shares at least 95% identity with SEQ ID NO:1. [The present invention 1019] The transfer plasmid of any one of claims 1001 to 1017, wherein the expression cassette is SEQ ID NO:1. [The present invention 1020] A lentiviral particle produced by transfecting a host cell with any one of the transfer plasmids of the present inventions 1001 to 1020. [The present invention 1021] An expression cassette comprising a coding polynucleotide encoding an isoform of T cell immunoregulatory factor 1 (TCIRG1) or a functional variant thereof, and an EFS promoter, wherein the polynucleotide is operably linked to the EFS promoter. [The present invention 1022] 1001. An expression cassette of the present invention, wherein said coding polynucleotide shares at least 95% identity with SEQ ID NO:3. [The present invention 1023] 1002. An expression cassette of the present invention, wherein said coding polynucleotide shares at least 99% identity with SEQ ID NO:3. [The present invention 1024] The expression cassette of the present invention 1003, wherein said coding polynucleotide is SEQ ID NO:3. [The present invention 1025] The expression cassette of any one of claims 1001 to 1004, wherein the EFS promoter shares at least 95% identity with SEQ ID NO:2. [The present invention 1026] The expression cassette of the present invention 1025, wherein the EFS promoter is SEQ ID NO:2. [The present invention 1027] An expression cassette according to any one of claims 1021 to 1026, comprising a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE). [The present invention 1028] The expression cassette of the present invention 1027, wherein said WPRE is SEQ ID NO:4. [The present invention 1029] An expression cassette of any of claims 1021 to 1028 of the present invention, which shares at least 95% identity with SEQ ID NO:1. [The present invention 1030] 1. An expression cassette for 1029 of the present invention, which is SEQ ID NO:1. [The present invention 1031] A recombinant lentivirus genome comprising, in 5' to 3' order: (a) a lentiviral 5' long terminal repeat (LTR); (b) any one of expression cassettes 1021 to 1030 of the present invention; (c) Lentiviral 3'LTR and and a replication-incompetent recombinant lentivirus genome. [The present invention 1032] A transfer plasmid comprising the recombinant lentiviral genome of the present invention. [The present invention 1033] A lentiviral particle comprising the recombinant lentiviral genome of the present invention. [The present invention 1034] A pharmaceutical composition comprising the lentiviral particles of the present invention. [The present invention 1035] A modified cell comprising any one of the expression cassettes of the present inventions 1021 to 1030. [The present invention 1036] A modified cell comprising a recombinant lentiviral genome of the present invention. [The present invention 1037] The modified cell of the present invention 1036, which lacks an endogenous functional TCIRG1 gene. [The present invention 1038] The modified cells of the invention 1036 or 1037 derived from a subject having or suspected of having infantile malignant osteopetrosis (IMO). [The present invention 1039] The modified cell of any of claims 1036 to 1038, which expresses TCIRG1 or a functional variant thereof at a level similar to the expression level of TCIRG1 observed in osteoclasts having a functional TCIRG1 gene. [The present invention 1040] The modified cell of any of claims 1036 to 1039, which expresses TCIRG1 or a functional variant thereof at a level similar to the expression level of TCIRG1 observed in osteoclasts derived from a subject not having or not suspected of having IMO. [The present invention 1041] The modified cell of any one of 1036 to 1040, which is a hematopoietic stem cell (HSC). [The present invention 1042] The modified cell of any one of claims 1036 to 1041, which is a CD34+ progenitor cell. [The present invention 1043] The modified cells of any of 1041 or 1042 of the present invention, derived from HSCs isolated by apheresis from a subject having or suspected of having IMO, optionally after mobilization of the HSCs by administration of G-CSF, plerifaxor, or a combination of G-CSF and plerifaxor. [The present invention 1044] The modified cell of any of claims 1035 to 1043, which is derived from a population of cells enriched for CD34+ cells by magnetic capture. [The present invention 1045] A pharmaceutical composition comprising the modified cell of any one of the present inventions Nos. 1035 to 1044. [The present invention 1046] 1. An in vitro method of modifying one or more cells of a subject having or suspected of having an IMO, comprising: (a) providing peripheral blood mononuclear cells (PBMCs) mobilized from a subject by administering to the subject a composition comprising G-CSF, plerixafor, or a combination of G-CSF and plerixafor; (b) enriching CD34+ cells from the PBMCs by magnetic separation to generate a population of CD34-enriched cells; (c) isolating the CD34-enriched cells in a 5' to 3' order; (i) lentiviral 5' long terminal repeat (LTR), (ii) any one of expression cassettes 1021 to 1030 of the present invention, and (iii) Lentivirus 3'LTR and contacting the lentiviral particle comprising a recombinant lentiviral genome comprising the wherein the recombinant lentiviral genome is replication-incompetent. [The present invention 1047] A method for treating infantile malignant osteopetrosis (IMO) in a subject having or suspected of having IMO, comprising administering to the subject a modified cell of any of claims 1035 to 1044 or a pharmaceutical composition of claim 1045. [The present invention 1048] The method of claim 1047, wherein modified cells expressing TCIRG1 or a functional variant thereof are repopulated into the HSC niche. [The present invention 1049] The method of any one of claims 1047 to 1048, wherein the modified cells expressing TCIRG1 or a functional variant thereof are repopulated to the osteoclast niche. [The present invention 1050] A method according to any one of claims 1047 to 1049 for treating, ameliorating, preventing, reducing, inhibiting, or alleviating IMO. [The present invention 1051] Any of the methods of claims 1047-1050, which extend the mean overall survival of treated subjects by at least 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more. [The present invention 1052] Any of the methods of claims 1047 to 1051, which prevent death of the subject due to IMO. [The present invention 1053] The method of any one of claims 1047 to 1052, wherein the subject is a human. [The present invention 1054] The method of any one of claims 1047 to 1053, wherein the subject exhibited symptoms of IMO prior to treatment. [The present invention 1055] The method of any of claims 1047 to 1054, wherein the subject is identified as having reduced or undetectable expression of TCIRG1 prior to treatment. [The present invention 1056] The method according to any one of claims 1047 to 1055, wherein the subject is identified as having a mutated TCIRG1 gene. [The present invention 1057] Any of the methods of claims 1047 to 1056, wherein the subject is an infant. [The present invention 1058] Any of the methods of claims 1047 to 1057, including autologous therapy. [The present invention 1059] The method of any of claims 1047 to 1058, wherein the administration is carried out via intravenous infusion. [The present invention 1060] 1. A recombinant lentiviral genome for use in the preparation of a medicament for treating or preventing infantile malignant osteopetrosis (IMO), said lentiviral genome comprising, in 5' to 3' order: (i) a lentiviral 5' long terminal repeat (LTR); (ii) any one of expression cassettes 1021 to 1030 of the present invention; (iii) Lentiviral 3'LTR and wherein the recombinant lentiviral genome is replication-incompetent. [The present invention 1061] A lentiviral particle for use in the preparation of a medicament for treating or preventing infantile malignant osteopetrosis (IMO), comprising a recombinant lentiviral genome, The lentiviral genome is, in 5' to 3' order: (i) a lentiviral 5' long terminal repeat (LTR); (ii) any one of the expression cassettes of the present invention 1021 to 1050; (iii) Lentiviral 3'LTR and wherein the recombinant lentiviral genome is replication-incompetent. [The present invention 1062] A transfer plasmid comprising any one of the expression cassettes of the present invention 1024 to 1030. [The present invention 1063] The transfer plasmid of the present invention 1062, further comprising an RNA-OUT sequence. [The present invention 1064] The transfer plasmid of the present invention 1063, wherein said RNA-OUT sequence is SEQ ID NO: 22. [The present invention 1065] The transfer plasmid of claim 1062 or 1063, wherein said RNA-OUT sequence is configured to enable said transfer plasmid to be stably propagated in a packaging cell line. [The present invention 1066] A method for producing lentiviral particles, comprising: transforming a bacterial cell with a transfer plasmid of any one of claims 1001 to 1019 or 1062 to 1065 of the present invention, such that the transfer plasmid replicates; isolating the replicated transfer plasmid; and transducing the replicated transfer plasmid and optionally one or more additional plasmids into a packaging cell line, whereby the lentiviral particles are produced. [The present invention 1067] A method for producing lentiviral particles, comprising transfecting a transfer plasmid of any one of claims 1001 to 1019 or 1062 to 1065 of the present invention and optionally one or more additional plasmids into a packaging cell line, and culturing the packaging cell line. [The present invention 1068] 1067. The method of claim 1067, wherein said transfer plasmid is stably propagated. [The present invention 1069] 1068. The method of claim 1068, wherein the transfer plasmid is stably propagated in a bacterial host at 30-37° C. using shake flasks or fermentation for at least 1, 2, 3, 4, 5, 6, or 7 days. [The present invention 1070] A lentiviral particle produced according to any one of the methods of the present invention 1066 to 1069. Other features and advantages of the invention will be apparent from and are encompassed by the following detailed description and claims. [Brief description of the drawings]

[0070] [Figure 1] FIG. 1 provides a diagram of the transfer plasmid for producing a lentiviral gene therapy vector encoding TCIRG1 (pCCL.PPT.EFS.tcirg1h.wpre). [Diagram 2] FIG. 2 shows the genetic sequence of the expression cassette (SEQ ID NO:1), which includes, in 5' to 3' order, the elongation factor 1-alpha short (EFS) promoter (underlined, SEQ ID NO:2), a polynucleotide encoding TCIRG1 (white text on black background, SEQ ID NO:3), and the woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) (underlined and bold, SEQ ID NO:4). [Diagram 3] Figures 3A-3B provide a comparison of the stability of two different lentiviral plasmids. Figure 3A shows a photograph of an ethidium bromide stained agarose gel showing the plasmid pRRL.PPT.EFS.tcirg1h.wpre either undigested with restriction enzymes ("Uncut") or digested with AflIII ("AflIII") or AflIII and NarI ("AflIII / NarI"). Figure 3B shows a photograph of an ethidium bromide stained agarose gel showing the plasmid pCCL.PPT.EFS.tcirg1h.wpre either undigested with restriction enzymes ("Uncut") or digested with AflIII ("AflIII") or AflIII and NarI (AflIII / NarI"). Figure 3C shows a schematic diagram of the pRRL.PPT.EFS.tcirg1h.wpre and pCCL.PPT.EFS.tcirg1h.wpre plasmids. [Figure 4] FIG. 4 shows an exemplary process for lentiviral particle production. [Diagram 5] Figures 5A-5B show vector copy numbers (VCN) in bulk CD34+ cell liquid cultures 6 days (Figure 5A) and 12 days (Figure 5B) after transduction. VCN was assessed by qPCR of gDNA extracted after culturing transduced CD34+ cells in SCGM complete medium. VCN for each donor and the average are represented for each transduction condition. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0071] Detailed Description The present inventors have shown that the transplantation of autologous cells transduced with lentiviral vectors encoding TCIRG1 is effective in treating infantile osteopetrosis (IMO). Furthermore, the inclusion of specific sequence elements in the expression cassette sequence of gene therapy vectors encoding TCIRG1 provides a safe and effective gene therapy for IMO. The present disclosure provides lentiviral vectors and plasmids encoding TCIRG1, including stable transfer plasmids that are advantageous for producing lentiviral vectors.

[0072] Vectors and plasmids The inventors have surprisingly discovered that large-scale production of lentiviral vectors for TCIRG1 gene therapy can be improved by modifying the pRRL plasmid containing the desired expression cassette in two ways: (i) replacing the pRRL vector backbone with the pCCL vector backbone, and (ii) replacing the conventional antibiotic resistance cassette of the pCCL backbone with the RNA-OUT selection marker. The improved plasmid is then transfected into a lentiviral particle production system together with a helper plasmid to produce the desired lentiviral vector.

[0073] The resulting pCCL / RNA-OUT vector for TCIRG1 gene therapy (e.g., the vector illustrated in FIG. 1) has improved stability, reflected in improved plasmid yields from E. coli-based plasmid production, and reduced levels of undesired recombinant products in the purified plasmid (shown in Example 1 and FIGS. 3A-3C). This improvement to the transfer plasmid allows for the production of lentiviral particles containing a TCIRG1 expression cassette in yields sufficient for clinical trials and use. Further data provided herein demonstrate that lentiviral particles produced using the methods and compositions disclosed herein can express CD34 with sufficient efficiency to reach clinically relevant vector copy number (VCN) levels. + It is shown that the cells are transduced.

[0074] In some embodiments, the present disclosure provides a transfer plasmid that is a lentiviral vector based on the pCCL transfer plasmid used in third generation lentiviral vector systems. The pCCL transfer plasmid contains a chimeric cytomegalovirus (CMV)-HIV 5' LTR and vector backbone in which simian virus 40 polyadenylation and (enhancer-less) origin of replication sequences are included downstream of the HIV 3' LTR, replacing most of the human sequences remaining from the HIV integration site. The CCL 5' hybrid long terminal repeat (LTR) is a cytomegalovirus (CMV) enhancer and promoter (nucleotides -673 to -1 relative to the transcription start site, GenBank accession number K03104) bound to the R region of the HIV-1 LTR. In some embodiments, the transfer plasmid contains the EFS promoter linked to the TCIRG1 gene with an upstream RRE and cPPT / CTS element and a downstream WPRE element (Figure 1). In some embodiments, the transfer plasmid comprises a PGK promoter (SEQ ID NO: 24) linked to the TCIRG1 gene with an upstream RRE and cPPT / CTS element and a downstream WPRE element. In some embodiments, the transfer plasmid comprises an RNA-OUT element. Advantageously, the RNA-OUT sequence contributes to the stable propagation of the transfer plasmid in the packing cell line. In some embodiments, the transfer plasmid does not comprise an antibiotic resistance gene, such as AmpR.

[0075] In some embodiments, the PGK promoter comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 24. In some embodiments, the PGK promoter comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity to SEQ ID NO: 24. In some embodiments, the PGK promoter has the sequence of SEQ ID NO:24. GGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAG CGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACT AGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGGCCGACCGCGATGGGCTGTGGCCATAGCGGCTGCTCAGCAGGGCGCGCGAGAGCAGGCGGCCGGGAAGGGGCGGTGCGGGAGGCGG GGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCAG (SEQ ID NO: 24)

[0076] In certain embodiments, the transfer plasmid is more stable when cultured or grown in E. coli than another plasmid containing the same expression cassette, thus resulting in a higher yield of plasmid, which is advantageous for use in vector production. In some embodiments, the transfer plasmid is more stable than the pRRL.PPT.EFS.tcirg1h.wpre transfer plasmid. In certain embodiments, at least 2-fold, at least 5-fold, or at least 10-fold more transfer plasmid is produced compared to the amount of pRRL.PPT.EFS.tcirg1h.wpre transfer plasmid produced under the same culture conditions.

[0077] In certain embodiments, the transfer plasmid is pCCL.PPT.EFS.tcirg1h.wpre or a functional variant thereof, such as those disclosed herein. The disclosure provides, in certain embodiments, a transfer plasmid pCCL.PPT.EFS.tcirg1h.wrpe or a functional variant thereof. The transfer plasmid pCCL.PPT.EFS.tcirg1h.wrpe may have the sequence of SEQ ID NO:23.

[0078] Alternatively, the transfer plasmid pCCL.PPT.EFS.tcirg1h.wrpe may have the sequence of SEQ ID NO:25, with the sequence GATCACGAGACTAGCCTCGAGAAGCTTGATCGATTGGCTCCGGTGCC (SEQ ID NO:26) deleted.

[0079] The sequence of SEQ ID NO:25 represents a circular plasmid. The same sequence substituted to start with the EFS promoter at base pair 1 is provided as SEQ ID NO:27.

[0080] In some embodiments, the transfer plasmid comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23. In some embodiments, the transfer plasmid comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 23. In some embodiments, the transfer plasmid has the sequence of SEQ ID NO: 23.

[0081] In some embodiments, the transfer plasmid comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 25. In some embodiments, the transfer plasmid comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 25. In some embodiments, the transfer plasmid has the sequence of SEQ ID NO: 25.

[0082] In some embodiments, the transfer plasmid comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 27. In some embodiments, the transfer plasmid comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 27. In some embodiments, the transfer plasmid has the sequence of SEQ ID NO: 27.

[0083] In some embodiments, the transfer plasmid comprises one or more of the vector elements listed in Table 1.

[0084] Table 1. pCCL.PPT.EFS.tcirg1h.wpre Vector Elements TIFF2025063200000002.tif113164

[0085] In some embodiments, lentiviral particles are generated by transient transfection of a third generation lentiviral vector system comprising pCCL.PPT.EFS.tcirg1h.wpre.

[0086] In some embodiments, the expression cassette comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1. In some embodiments, the expression cassette comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 1. In some embodiments, the expression cassette has the sequence of SEQ ID NO: 1.

[0087] In some embodiments, the expression cassette comprises, in 5' to 3' order, an EFS promoter, a polynucleotide encoding T cell immunoregulatory factor 1, ATPase H+ transport V0 subunit a3 (TCIRG1) or a functional variant thereof, and a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE). In some embodiments, the EFS promoter is operably linked to a polynucleotide encoding an isoform of TCIRG1 or a functional variant thereof. Related embodiments include transfer plasmids comprising the expression cassette, and vectors produced using the transfer plasmids.

[0088] In some embodiments, the EFS promoter comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2. In some embodiments, the EFS promoter comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 2. In some embodiments, the EFS promoter has the sequence of SEQ ID NO: 2. GGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGT CGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGACGC (SEQ ID NO: 2)

[0089] In some embodiments, the polynucleotides encoding an isoform of TCIRG1 or a functional variant thereof comprise a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 3. In some embodiments, the polynucleotides encoding an isoform of TCIRG1 or a functional variant thereof comprise a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 3. In some embodiments, the polynucleotides encoding an isoform of TCIRG1 or a functional variant thereof have the sequence of SEQ ID NO: 3.

[0090] In some embodiments, the WPRE comprises a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 4. In some embodiments, the WPRE comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 4. In some embodiments, the WPRE has the sequence of SEQ ID NO: 4. (SEQ ID NO:4)

[0091] In some embodiments, the polynucleotides encoding the isoforms of TCIRG1 or functional variants thereof comprise a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 5. In some embodiments, the polynucleotides encoding the isoforms of TCIRG1 or functional variants thereof comprise a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 5. In some embodiments, the isoforms of TCIRG1 or functional variants thereof have the sequence of SEQ ID NO: 5. (SEQ ID NO:5)

[0092] In one embodiment, the polynucleotide encoding the isoform of TCIRG1 or its functional variant is codon-optimized for expression in a human host cell. In one embodiment, the polynucleotide encoding the isoform of TCIRG1 or its functional variant is modified or "codon-optimized" to enhance expression by replacing rarely represented codons with more frequently represented codons. In one embodiment, the polynucleotide encoding the isoform of TCIRG1 or its functional variant is not codon-optimized. In one embodiment, the polynucleotide encoding the isoform of TCIRG1 or its functional variant is not modified. In one embodiment, the polynucleotide encoding the isoform of TCIRG1 or its functional variant is not codon-optimized. In one embodiment, the polynucleotide encoding the isoform of TCIRG1 or its functional variant is a naturally occurring polynucleotide sequence.

[0093] As used herein, the term "transgene" refers to a polynucleotide encoding an isoform of TCIRG1 or a functional variant thereof.

[0094] A coding sequence is a portion of an mRNA sequence that codes for an amino acid for translation. During translation, each of the 61 trinucleotide codons is translated into one of the 20 amino acids, resulting in degeneracy or redundancy in the genetic code. However, different cell types and different animal species utilize tRNAs (each with an anticodon) that code for the same amino acid at different frequencies. If a gene sequence contains a codon that is rarely represented by the corresponding tRNA, the ribosomal translation machinery may slow down, preventing efficient translation. Expression can be improved through "codon optimization" for a particular species, where the coding sequence is modified to code for the same protein sequence, but utilizes codons that are highly represented and / or utilized by highly expressed human proteins (Cid-Arregui et al., 2003; J. Virol. 77:4928).

[0095] In some embodiments, the coding sequence of the transgene is modified to replace the codons that are rarely expressed in mammals or primates with the codons that are frequently expressed in primates.For example, in some embodiments, the transgene encodes a polypeptide that has at least 85% sequence identity, for example, at least 90% sequence identity, at least 95% sequence identity, at least 98% identity, or at least 99% identity with a reference polypeptide (e.g., wild-type TCIRG1, SEQ ID NO: 3), and at least one codon of the coding sequence has a higher tRNA frequency in humans than the corresponding codon in the sequence disclosed above or herein.

[0096] In one embodiment, the transgene contains fewer alternative open reading frames than SEQ ID NO:3. In one embodiment, the transgene is modified to enhance expression by terminating or removing open reading frames (ORFs) that do not code for the desired transgene. An open reading frame (ORF) is a nucleic acid sequence following a start codon and does not contain a stop codon. An ORF may be in forward or reverse orientation and may be "in frame" or "out of frame" relative to the gene of interest. Such open reading frames have the potential to be expressed in the expression cassette along with the gene of interest, potentially resulting in undesirable adverse effects. In some embodiments, the transgene is modified to remove open reading frames by further altering the codon usage. This is done by removing one or more start codons (ATG) and / or introducing one or more stop codons (TAG, TAA, or TGA) in a reverse orientation or out of frame relative to the desired ORF, while retaining the amino acid sequence encoded in the gene of interest and, optionally, maintaining highly utilized codons (i.e., avoiding codons with a frequency of <20%).

[0097] In variations of the present disclosure, the transgene coding sequence may be optimized by either codon optimization and removal of non-transgene ORFs, or using both techniques. In some cases, non-transgene ORFs are removed or minimized after codon optimization to remove ORFs introduced during codon optimization.

[0098] In one embodiment, the transgene contains fewer CpG sites than SEQ ID NO:3. Without being bound by theory, it is believed that the presence of CpG sites in the polynucleotide sequence is associated with undesirable host immune response to the viral vector containing the polynucleotide sequence. In some embodiments, the transgene is designed to reduce the number of CpG sites. Exemplary methods are provided in US Patent Application Publication No. US2002 / 0065236A1.

[0099] In one embodiment, the transgene contains fewer cryptic splice sites than SEQ ID NO: 3. For optimization, GeneArt® software can be used to increase GC content and / or remove cryptic splice sites, for example, to avoid transcriptional silencing, thus increasing the expression of the transgene. Alternatively, any optimization method known in the art can be used. Removal of cryptic splice sites is described, for example, in International Patent Application Publication No. WO2004 / 015106A1.

[0100] Also disclosed herein are expression cassettes and gene therapy vectors encoding TCIRG1, e.g., the TCIRG1 sequences disclosed herein, which contain a consensus optimal Kozak sequence, a full-length polyadenylation (polyA) sequence (or replacement of the truncated polyA with a full-length polyA), and minimal or no upstream (i.e., 5') start codon (i.e., an ATG site).

[0101] In some embodiments, the expression cassette contains two or more of a 5' long terminal repeat (LTR), an enhancer / promoter region, a consensus optimal Kozak sequence, a transgene (e.g., a transgene encoding TCIRG1 as disclosed herein), a 3' untranslated region comprising a full-length polyA sequence, and a 3' LTR.

[0102] In one embodiment, the expression cassette comprises a Kozak sequence operably linked to the transgene. In one embodiment, the Kozak sequence is a consensus optimal Kozak sequence comprising or consisting of SEQ ID NO:6. GCCGCCACCATGG (SEQ ID NO:6)

[0103] In various embodiments, the expression cassette comprises an alternative Kozak sequence operably linked to the transgene. In one embodiment, the Kozak sequence is an alternative Kozak sequence comprising or consisting of any one of SEQ ID NOs: 14-18. (gcc) gccRccAUGG (SEQ ID NO: 14) AGNNAUGN (SEQ ID NO: 15) ANNAUGG (SEQ ID NO: 16) ACCAUGG (SEQ ID NO: 17) GACACCAUGG (SEQ ID NO: 18)

[0104] In SEQ ID NO: 14, lower case letters indicate the most common base at positions where the base can also be varied, and upper case letters indicate highly conserved bases, adenine or guanine. In SEQ ID NO: 14, the sequence in brackets (gcc) is optional. In SEQ ID NOs: 15-17, "N" indicates any base.

[0105] A variety of sequences can be used as translation initiation sites in place of this consensus optimal Kozak sequence, and it is within the skill of the art to identify and test other sequences. See Kozak M. An analysis of vertebrate mRNA sequences: intimations of translational control. J. Cell Biol. 115(4):887-903 (1991).

[0106] In one embodiment, the expression cassette comprises a full length polyA sequence operably linked to the transgene. In one embodiment, the full length polyA sequence comprises SEQ ID NO:7. TGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCCATATGCTGGCTGCCATGAACAAAGGTTGGCTATAAAGAGGTCATCAGTATATGAAAC AGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGGAGATC (SEQ ID NO: 7)

[0107] A variety of alternative polyA sequences may be used in the expression cassettes of the present disclosure, including, but not limited to, the bovine growth hormone polyadenylation signal (bGHpA) (SEQ ID NO: 19), the SV40 early / late polyadenylation signal (SEQ ID NO: 20), and the human growth hormone (HGH) polyadenylation signal (SEQ ID NO: 21). TCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATT GTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAGGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTG (SEQ ID NO: 19) CAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTA (SEQ ID NO: 20) CTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCCCAAGTTGGGAAGAAACCTGTAGGGCCTGC (SEQ ID NO: 21)

[0108] In some embodiments, the expression cassette comprises an active fragment of a polyA sequence. In certain embodiments, the active fragment of a polyA sequence comprises or consists of, for example, less than 20 base pairs (bp), less than 50 bp, less than 100 bp, or less than 150 bp of any of the polyA sequences disclosed herein.

[0109] In some cases, expression of the transgene is increased by ensuring that the expression cassette does not contain competing ORFs. In one embodiment, the expression cassette does not contain a start codon within 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 base pairs 5' of the start codon of the transgene. In one embodiment, the expression cassette does not contain a start codon 5' of the start codon of the transgene.

[0110] In one embodiment, the expression cassette comprises, operably linked in a 5' to 3' direction, a first inverse terminal repeat, an enhancer / promoter region, an intron, a consensus optimal Kozak sequence, a transgene, a 3' untranslated region comprising a full-length polyA sequence, and a second inverse terminal repeat, wherein the expression cassette does not comprise a start codon 5' of the start codon of the transgene.

[0111] In one embodiment, the enhancer / promoter region comprises, in the 5' to 3' direction, the CMV IE enhancer and the chicken beta-actin promoter.In one embodiment, the enhancer / promoter region comprises the CAG promoter.As used herein, "CAG promoter" refers to a polynucleotide sequence that comprises the CMV early enhancer element, the chicken beta-actin promoter, the first exon and the first intron of the chicken beta-actin gene, and the splice acceptor of the rabbit beta-globin gene.

[0112] In one embodiment, the enhancer / promoter region comprises the elongation factor 1 alpha short promoter (EFS promoter), which is a shorter intronless version of the elongation factor 1 alpha promoter. As used herein, "EFS promoter" refers to a polynucleotide sequence that contains a short intronless form of EF1alpha. The EFS promoter has been used in many clinical trials recently. It is a cell-derived enhancer / promoter with reduced cross-activation of nearby promoters, thus hypothetically reducing the risk of genotoxicity.

[0113] In one embodiment, the expression cassette shares at least 95% identity with a sequence selected from SEQ ID NO:1. In one embodiment, the expression cassette shares complete identity with a sequence selected from SEQ ID NO:1 or shares at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to a sequence selected from SEQ ID NO:1. In certain embodiments, the expression cassette comprises one or more modifications compared to a sequence selected from SEQ ID NO:1. In certain embodiments, the one or more modifications comprise one or more of the following: removal of one or more (e.g., all) upstream ATG sequences, replacement of the Kozak sequence with an optimized consensus Kozak sequence or another Kozak sequence, including but not limited to any of those disclosed herein, and / or replacement of the polyadenylation sequence with a full-length polyadenylation sequence or another polyadenylation sequence, including but not limited to any of those disclosed herein. Exemplary configurations of genetic elements within these exemplary expression cassettes are set forth in FIG. 1.

[0114] In a related embodiment, the present disclosure provides a gene therapy vector comprising an expression cassette disclosed herein. Generally, the gene therapy vector described herein comprises an expression cassette comprising a polynucleotide encoding one or more isoforms of TCIRG1, which allows expression of TCIRG1 to partially or completely restore defective TCIRG1 protein expression levels and / or defective osteoclast formation in a subject in need thereof (e.g., a subject with infantile malignant osteopetrosis or another disorder characterized by defective osteoclast formation at least in part due to defective TCIRG1 expression). In certain embodiments, the expression cassette comprises a polynucleotide sequence encoding TCIRG1 as disclosed herein, e.g., a sequence having at least 90%, at least 95%, at least 98%, or at least 99% identity to any of SEQ ID NO:3 or SEQ ID NO:3. The gene therapy vector may be a viral vector or a non-viral vector. Exemplary non-viral vectors include, for example, naked DNA, cationic liposome complexes, cationic polymer complexes, cationic liposome-polymer complexes, and exosomes. Examples of viral vectors include, but are not limited to, adenoviral, retroviral, lentiviral, herpesviral, and adeno-associated viral (AAV) vectors.

[0115] Gene delivery viral vectors useful for carrying out the present invention can be constructed using methodologies well known in the art of molecular biology. Typically, viral vectors carrying transgenes are constructed from polynucleotides that code for the transgene, appropriate regulatory factors, and elements required for the production of viral proteins, which mediate cell transduction. Such recombinant viruses can be produced by techniques well known in the art, for example, by transfecting packaging cells, or by transient transfection with helper plasmids or viruses. Typical examples of viral packaging cells include, but are not limited to, HeLa cells, SF9 cells (optionally with baculovirus helper vectors), 293 cells, and the like. AAV vectors can be produced using herpes virus-based systems, as described in US2017 / 0218395A1. Detailed protocols for producing such replication-defective recombinant viruses can be found, for example, in WO95 / 14785, WO96 / 22378, U.S. Pat. No. 5,882,877, U.S. Pat. No. 6,013,516, U.S. Pat. No. 4,861,719, U.S. Pat. No. 5,278,056 and WO94 / 19478, the complete contents of each of which are incorporated herein by reference.

[0116] In some embodiments, the vector is a retroviral vector, or more specifically, a lentiviral vector. As used herein, the term "retrovirus" or "retroviral" refers to an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded DNA copy and then covalently integrates its genomic DNA into the host genome. Retroviral vectors are a common tool for gene delivery (Miller, 2000, Nature.357:455-460). Once a virus is integrated into the host genome, it is called a "provirus". The provirus serves as a template for RNA polymerase II to direct the expression of the RNA molecule encoded by the virus.

[0117] Exemplary retroviruses (family Retroviridae) include, but are not limited to, (1) the Gammaretrovirus genus, such as Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), and feline leukemia virus (FLV); (2) the Spumavirus genus, such as simian foamy virus; and (3) lentiviruses, such as human immunodeficiency virus type 1 and simian immunodeficiency virus.

[0118] As used herein, the term "lentiviral" or "lentivirus" refers to a group (or genus) of complex retroviruses. Exemplary lentiviruses include, but are not limited to, HIV (including human immunodeficiency virus, HIV type 1 and HIV type 2), Visna-Maedi virus (VMV), Caprine Arthritis Encephalitis Virus (CAEV), Equine Infectious Anemia Virus (EIAV), Feline Immunodeficiency Virus (FIV), Bovine Immunodeficiency Virus (BIV), and Simian Immunodeficiency Virus (SIV). In one embodiment, an HIV-based vector backbone (i.e., HIV cis-acting sequence elements) is preferred.

[0119] Retroviral vectors, more specifically lentiviral vectors, can be used to implement the present invention. Thus, as used herein, the term "retroviral vector" is meant to include "lentiviral vector", and as used herein, the term "retrovirus" is meant to include lentivirus.

[0120] The term viral vector can refer to either a vector or viral particle capable of introducing a nucleic acid into a cell, or the introduced nucleic acid itself. A viral vector contains structural and / or functional genetic elements that are primarily derived from a virus. The term "retroviral vector" refers to a viral vector that contains structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus. The term "lentiviral vector" refers to a viral vector that contains structural and functional genetic elements, or portions thereof, that are primarily derived from a lentivirus, including LTRs. The term "hybrid" refers to a vector, LTR, or other nucleic acid that contains both retroviral sequences, e.g., lentiviral sequences, and non-lentiviral sequences. In one embodiment, a hybrid vector refers to a vector or transfer plasmid that contains retroviral sequences, e.g., lentiviral sequences, for reverse transcription, replication, integration, and / or packaging.

[0121] In certain embodiments, the terms "lentiviral vector" and "lentiviral expression vector" can be used to refer to lentiviral transfer plasmid and / or infectious lentiviral particle.When referring to elements such as cloning site, promoter, regulatory element, heterologous nucleic acid, etc. herein, it should be understood that the sequences of these elements are present in the lentiviral particle of the present invention in RNA form and in the DNA plasmid of the present invention in DNA form.

[0122] According to certain embodiments, most or all of the viral vector backbone sequence is derived from lentivirus, for example, HIV-1.However, it should be understood that many different sources of lentivirus sequence can be used, and many substitutions and modifications in a particular lentivirus sequence can be accommodated without impairing the ability of the transfer vector to perform the functions described herein.In addition, various lentivirus vectors are known in the art, see Naldini et al., (1996a, 1996b, and 1998), Zufferey et al., (1997), Dull et al., 1998, U.S. Patent No. 6,013,516, and U.S. Patent No. 5,994,136, many of which can be adapted to produce the viral vector or transfer plasmid of the present invention.

[0123] In preparing lentiviral vector, any host cell for producing lentiviral vector can be used, including, for example, mammalian cell (e.g., HEK293T cell).Host cell can also be a packaging cell in which lentiviral gag / pol gene and rev gene are stably maintained in host cell or producer cell in which lentiviral vector genome is stably maintained and packaged.Lentiviral vector is purified and formulated using standard techniques known in the art.

[0124] In certain embodiments, the present invention includes a cell comprising a gene expression cassette, gene transfer cassette, or recombinant lentiviral vector disclosed herein. In related embodiments, the cell is transduced with a recombinant lentiviral vector comprising an expression cassette disclosed herein, or an expression cassette disclosed herein is integrated into the genome of the cell. In certain embodiments, the cell is a cell used to produce a recombinant retroviral vector, e.g., a packaging cell.

[0125] In some embodiments, the lentiviral vector is pseudotyped.For example, the plasmid containing heterologous env gene can be used for pseudotype.Suitable env gene includes, but is not limited to, VSV-G.

[0126] In some embodiments, the backbone of the transfer plasmid comprises an RNA-OUT sequence. RNA-OUT is a selection marker system that facilitates the selection of cells carrying the transfer plasmid within the scope of antibiotic use, as described, for example, in U.S. Patent Nos. 9,109,012 and 9,737,620, which are incorporated herein by reference. In some embodiments, the RNA-OUT sequence is: GTAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTGTCTGATTATTGATTTTTGGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATGATTTTGATAAAAATCATTAGG (SEQ ID NO: 22)

[0127] Advantageously, the RNA-OUT sequence contributes to the stable propagation of the transfer plasmid in the packaging cell line.

[0128] In some embodiments, the disclosure provides a transfer expression cassette comprising a polynucleotide that shares at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1. In some embodiments, the expression cassette comprises a polynucleotide that shares at least 80%, 85%, 90%, 95%, 99%, or 100% identity with SEQ ID NO: 1. In some embodiments, the expression cassette has the sequence of SEQ ID NO: 1.

[0129] AAV is a 4.7 kb single-stranded DNA virus. Because wild-type AAV is non-pathogenic and has no known disease etiological association, recombinant vectors based on AAV are associated with excellent clinical safety. Furthermore, AAV offers the capacity for highly efficient gene delivery and sustained transgene expression in multiple tissues. By "AAV vector" is meant vectors derived from adeno-associated virus serotypes, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, AAVrh.74, and the like. AAV vectors can have one or more AAV wild-type genes deleted in whole or in part, e.g., the rep gene and / or the cap gene, but retain functionally adjacent inverted terminal repeat (ITR) sequences. Functional ITR sequences are necessary for rescue, replication, and packaging of AAV virions. Thus, AAV vectors are defined herein to include at least those sequences required in cis for viral replication and packaging (e.g., functional ITRs). The ITRs do not need to be wild-type nucleotide sequences and can be modified, for example, by nucleotide insertion, deletion, or substitution, so long as the sequence provides functional rescue, replication, and packaging. AAV vectors can include other modifications, including, but not limited to, one or more modified capsid proteins (e.g., VP1, VP2, and / or VP3). For example, capsid proteins may be modified to change tropism and / or reduce immunogenicity. AAV expression vectors are constructed using well-known techniques to provide at least the following control elements as operably linked components in the direction of transcription: a transcription initiation region, a DNA of interest (i.e., the TCIRG1 gene), and a transcription termination region.

[0130] Pharmaceutical Compositions and Methods of Use The present disclosure also provides a pharmaceutical composition comprising an expression cassette or vector (e.g., gene therapy vector) disclosed herein and one or more pharma- ceutically acceptable carriers, diluents, or excipients. In certain embodiments, the pharmaceutical composition comprises a lentiviral particle comprising an expression cassette disclosed herein, for example, the expression cassette comprises a codon transgene encoding TCIRG1, for example, SEQ ID NO: 3. For example, a pharmaceutical composition is provided comprising a therapeutically effective amount of a lentiviral particle comprising a nucleic acid sequence of a polynucleotide encoding one or more isoforms of TCIRG1 for use in the prevention or treatment of disorders characterized by a deficiency in osteoclast formation (e.g., infantile malignant osteopetrosis).

[0131] In certain embodiments, the lentiviral particles disclosed herein are used to transduce autologous CD34+ hematopoietic stem cells (HSCs) derived from a subject, thus complementing the genetic deficiency. Transduction can occur in vivo or ex vivo. The CD34+ enriched cell population is, in some embodiments, cultured in CellGenix Stem Cell Growth Medium (SCGM) containing recombinant human cytokines and incubated at 37° C. in 5% CO2 and 5% O2. The CD34+ enriched cell population is, in some embodiments, incubated with the same additives used for pre-stimulation, optionally with the addition of a transduction enhancer, and lentiviral particles (e.g., at MOI 50) containing the expression cassette EFS-TCIRG1-WPRE. After transduction, the cell suspension is, in some embodiments, washed with a portion of the cells, the supernatant is removed for release testing, and the formulation is frozen to prepare for injection. In some embodiments, HSCs are mobilized by treating the patient with G-CSF, plerixafor, or a combination of G-CSF and plerixafor. HSCs are then collected from the patient's peripheral blood by apheresis. CD34+ cells are enriched, for example, using magnetic capture (e.g., with Miltenyi Biotec CliniMAC system), and CD34+-enriched cells are transduced ex vivo with lentiviral particles. In some embodiments, the transduction process incorporates the use of transduction enhancers, such as, but not limited to, polyaxamers and prostaglandin E2 (PGE2).

[0132] In some embodiments, the transduced HSCs are then cultured at least 2.0×10 6 CD34+ cells / kg are injected into a subject, e.g., a human subject. In some embodiments, they repopulate the HSC niche with TCIRG1 expressing cells. In some embodiments, they repopulate the osteoclast niche with TCIRG1 expressing cells.

[0133] Also provided is a pharmaceutical composition comprising a therapeutically effective amount of modified cells comprising a nucleic acid sequence of a polynucleotide encoding one or more isoforms of TCIRG1, for use in the prevention or treatment of disorders characterized by a deficiency in osteoclast formation (e.g., infantile malignant osteopetrosis). In some embodiments, the modified cells express TCIRG1 or a functional variant thereof at a level similar to the expression level of TCIRG1 observed in osteoclasts having a functional TCIRG1 gene. In some embodiments, the modified cells express TCIRG1 or a functional variant thereof at a level similar to the expression level of TCIRG1 observed in osteoclasts derived from a subject not having or not suspected of having IMO. In some embodiments, the modified cells are hematopoietic stem cells (HSCs). In some embodiments, the modified cells are CD34+ progenitor cells. In some embodiments, the modified cells are derived from HSCs isolated by apheresis from a subject having or suspected of having IMO. In some embodiments, the modified cells are autologous to the subject. In some embodiments, the modified cells are derived from HSCs isolated by apheresis from subjects with or suspected of having IMOs after mobilization of HSCs by administration of G-CSF, plerixafor, or a combination of G-CSF and plerixafor. In some embodiments, the modified cells are derived from a population of cells enriched for CD34+ cells by magnetic capture. In some embodiments, the modified cells have been transduced using a vector disclosed herein, e.g., a lentiviral vector produced using a transfer plasmid disclosed herein.

[0134] The pharmaceutical composition containing the expression cassette or lentiviral particle or modified cell may be in any form suitable for the selected mode of administration, for example, intraventricular, intramyocardial, intracoronary, intravenous, intraarterial, intrarenal, intraurethral, ​​epidural, or intramuscular administration. The genetically modified cells containing polynucleotides encoding one or more TCIRG1 isoforms can be administered to animals and humans as the sole active agent or in combination with other active agents, in unit dosage form, as a mixture with conventional pharmaceutical supports. In some embodiments, the pharmaceutical composition comprises cells transduced ex vivo with any of the gene therapy vectors disclosed herein.

[0135] In various embodiments, the pharmaceutical composition contains pharma- ceutically acceptable vehicles (e.g., carriers, diluents, and excipients) for injection preparations. These may be, in particular, isotonic sterile saline solutions (sodium or disodium phosphate, sodium, potassium, calcium, or magnesium chloride, etc., or mixtures of such salts), or may be dry, in particular lyophilized compositions, which, when added with sterile water or saline, allow the composition of an injectable solution. Exemplary pharmaceutical forms suitable for injection include, for example, sterile aqueous solutions or dispersions, formulations containing sesame oil, peanut oil, or aqueous propylene glycol, and sterile powders for extemporaneous preparation of sterile injectable solutions or dispersions.

[0136] In another aspect, the present disclosure provides a method for preventing, alleviating, ameliorating, reducing, inhibiting, eliminating, and / or reversing one or more symptoms of infantile malignant osteopetrosis or another disorder in a subject in need thereof, comprising administering to the subject a gene therapy vector of the present disclosure. The term "infantile malignant osteopetrosis" or "malignant infantile osteopetrosis" or "infantile autosomal recessive osteopetrosis" or "infantile osteopetrosis" or "IMO" refers to a rare osteosclerotic skeletal dysplasia that typically appears in infancy and is characterized by the unique radiographic appearance of generalized hyperostosis-bone hyperproliferation. The generalized increase in bone density has a special bias for the medullary portion with relative sparing of the cortex. Obstruction of the bone marrow cavity and subsequent decline in cellular function can lead to severe hematological complications. Optic atrophy and cranial nerve damage secondary to bone proliferation can result in significant morbidity. In untreated cases, the prognosis is very poor. Plain radiographs provide important information for diagnosis, and clinical and radiological correlations are essential in the diagnostic process, with additional genetic testing being confirmatory.

[0137] In one embodiment, the modified cells, e.g., autologous cells transduced with lentiviral particles of the present disclosure, are administered via a route selected from the group consisting of parenteral, intravenous, intra-arterial, intracardiac, intracoronary, intramyocardial, intrarenal, intraurethral, ​​epidural, and intramuscular. In some embodiments, the modified cells are administered by injection, e.g., intravenous injection. In one embodiment, the modified cells are administered multiple times. In one embodiment, the modified cells are administered by injection.

[0138] In one embodiment, the present disclosure provides a method for treating a disease or disorder, optionally an IMO, in a subject in need thereof, comprising contacting a cell with a gene therapy vector according to the present disclosure and administering the cell to the subject. In one embodiment, the cell is a stem cell, optionally a pluripotent stem cell. In one embodiment, the stem cell is capable of differentiating into a bone cell. In one embodiment, the stem cell is capable of differentiating into an osteoclast. In one embodiment, the stem cell is autologous. In one embodiment, the stem cell is a CD34+ stem cell.

[0139] In one embodiment, the subject is presenting with symptoms of IMO or another disorder.In one embodiment, the subject is identified as having reduced or undetectable TCIRG1 expression.In one embodiment, the subject is identified as having a mutant TCIRG1 gene.

[0140] Subjects / patients suitable for treatment using the methods described herein include individuals at risk for a disease or disorder characterized by insufficient osteoclasts (e.g., IMO, as well as other known disorders of osteoclast formation. In some embodiments, the subject does not exhibit symptoms. In some embodiments, the subject is currently exhibiting symptoms. Such subjects may have been identified as having a mutated TCIRG1 gene or as having reduced or undetectable levels of TCIRG1 expression. Symptoms may be actively manifesting, or may be suppressed or controlled (e.g., with medication), or may be in remission. The subject may or may not have been diagnosed with the disorder, for example, by a licensed physician.

[0141] definition The term "T cell immunoregulatory factor 1, ATPase H+ transporting V0 subunit a3 gene" refers interchangeably to nucleic acid and polypeptide polymorphic variants, alleles, mutants, and interspecies homologs, and includes (1) the amino acid sequence encoded by a TCIRG1 nucleic acid (see, e.g., GenBank Accession Nos. NM_006019.4 (variant 1), NM_006053.3 (variant 2), NM_001351059.1 (variant 3)) and / or the amino acid sequence of a TCIRG1 polypeptide (see, e.g., GenBank Accession Nos. NP_00604 NP_006044.1 (isoform A), NP_006044.1 (isoform B), NP_001337988.1 (isoform C), preferably over a region of at least about 25, 50, 100, 200, 300, 400 or more amino acids, or over the entire length, having an amino acid sequence identity of greater than about 90%, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more, to a TCIRG1 polypeptide; (2) an amino acid sequence identity of at least about 25, 50, 100, 200, 300, 400 or more amino acids, or over the entire length, to a TCIRG1 polypeptide; (3) specifically hybridizes under stringent hybridization conditions to an antisense strand corresponding to a nucleic acid sequence encoding a TCIRG1 protein, and conservatively modified variants thereof; and (4) specifically hybridizes under stringent hybridization conditions to an antisense strand corresponding to a nucleic acid sequence encoding a TCIRG1 protein, and conservatively modified variants thereof. The G1 nucleic acid has a nucleic acid sequence that has greater than about 90%, preferably greater than about 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99% or more nucleotide sequence identity with a G1 nucleic acid (e.g., a TCIRG1 polynucleotide described herein, and a TCIRG1 polynucleotide encoding a TCIRG1 polypeptide described herein), preferably over a region of at least about 25, 50, 100, 200, 500, 1000, 2000 or more nucleotides, or over the entire length.

[0142] The TCIRG1 gene encodes several protein isoforms, including two major isoforms: the full-length isoform a (OC116) encodes the A3 subunit of the vacuolar-type H(+)-ATPase, which is involved in regulating the pH of intracellular compartments and organelles of eukaryotic cells, including the pH of intracellular compartments and organelles of osteoclasts; the short isoform b (TIRC7) encodes a T-cell-specific membrane protein that plays an important role in T-lymphocyte activation and immune responses.

[0143] The terms "identical" or "percent identity" in the context of two or more nucleic acid or polypeptide sequences refer to the maximum correlation over a comparison window or designated region, as measured using the following sequence comparison algorithms, or using manual alignment and visual inspection. When comparing and aligning sequences for correspondence, it refers to two or more sequences or subsequences that are the same or have a certain percentage of the same amino acid residues or nucleotides (i.e., share at least about 80% identity, e.g., at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity, over a specified region with a reference sequence, e.g., a TCIRG1 polynucleotide or polypeptide sequence described herein. In that case, such sequences are said to be "substantially identical." This definition also refers to the complement of the test sequence. Preferably, the identity exists over a region of at least about 25 amino acids or nucleotides in length, e.g., a region of 50, 100, 200, 300, 400 amino acids or nucleotides in length, or over the entire length of the reference sequence.

[0144] For sequence comparison, typically, one sequence acts as a reference sequence, and test sequence is compared to it.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, coordinates of subsequence are designated as necessary, and parameters of sequence algorithm program are designated.Default program parameters can be used, or alternative parameters can be designated.The sequence comparison algorithm then calculates the sequence identity percentage of test sequence to reference sequence based on program parameters.For sequence comparison of nucleic acid and protein to TCIRG1 nucleic acid and protein, BLAST and BLAST 2.0 algorithms and default parameters are used.

[0145] As used herein, a "comparison window" includes reference to any one segment of a number of contiguous positions selected from the group consisting of 20 to 600, usually about 50 to about 200, more usually about 100 to about 150, and a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods for aligning sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by manual alignment and visual inspection (see, for example, Ausubel et al., eds., Current Protocols in Molecular Biology (1995 supplement)). Examples of suitable algorithms for determining percentage of sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nucleic Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (World Wide Web, ncbi.nlm.nih.gov).

[0146] An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the antibody produced against the polypeptide encoded by the second nucleic acid, as described below.Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, when the two peptides differ only by conservative substitutions.Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions.Furthermore, another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequences.

[0147] As used herein, "administration" refers to local and systemic administration, including, for example, enteral administration, parenteral administration, pulmonary administration, and topical / transdermal administration. Routes of administration of compounds (e.g., polynucleotides encoding one or more TCIRG1 isoforms) that find use in the methods described herein include, for example, oral (per os (PO)), nasal or inhalation administration, administration as a suppository, topical contact, transdermal delivery (e.g., via a transdermal patch), intrathecal (IT), intravenous ("iv"), intraperitoneal ("ip"), intramuscular ("im"), intralesional, or subcutaneous ("sc") administration, or implantation of a sustained release device, e.g., a mini-osmotic pump, administration of a depot formulation, and the like, to a subject. Administration may be by any route, including parenteral and transmucosal (e.g., oral, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intrarenal, intraurethral, ​​intracardiac, intracoronary, intramyocardial, intradermal, epidural, subcutaneous, intraperitoneal, intraventricular, ionophoretic, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like.

[0148] The terms "systemic administration" and "administered systemically" refer to a method of administering a compound or composition to a mammal such that the compound or composition is delivered via the circulatory system to a site within the body, including the target site of pharmaceutical action. Systemic administration includes, but is not limited to, oral, intranasal, rectal and parenteral (e.g., outside the digestive tract, such as intramuscular, intravenous, intraarterial, transdermal, and subcutaneous) administration.

[0149] The term "co-administration" or "simultaneous administration", for example, when used in reference to a compound (e.g., TCIRG1 polynucleotide) and / or an analog thereof and another active agent, refers to administering the compound and / or analog and the active agent so that both can achieve a physiological effect simultaneously. However, the two agents do not have to be administered together. In certain embodiments, administration of one agent can precede administration of the other. A simultaneous physiological effect does not necessarily require the presence of both agents in the circulation at the same time. However, in certain embodiments, co-administration typically results in both agents being present in the body (e.g., in the plasma) at a significant percentage (e.g., 20% or more, e.g., 30% or 40% or more, e.g., 50% or 60% or more, e.g., 70% or 80% or more, e.g., 90% or more) of their maximum serum concentration for any given dose.

[0150] The term "effective amount" or "pharmaceutical effective amount" refers to the amount and / or dosage, and / or administration regimen of one or more compositions (e.g., gene therapy vectors, modified cells) required to bring about a desired result, e.g., increased expression of one or more TCIRG1 isoforms in an amount sufficient to reduce the ultimate severity of a disease characterized by impaired or deficient autophagy (e.g., IMO).

[0151] The phrase "administering" refers to the act of a medical professional (e.g., a physician) or other person managing the medical care of a subject, managing and / or authorizing the administration of the drug / compound in question to a subject. Administering can involve diagnosing and / or determining the appropriate therapeutic or prophylactic regimen and / or prescribing a particular drug / compound to a subject. Such prescribing can include, for example, drafting a prescription, annotating medical records, etc.

[0152] As used herein, the terms "treat" and "treatment" refer to slowing the onset, slowing or reversing the progression, reducing the severity, or alleviating or preventing either the disease or condition to which the term applies, or one or more symptoms of the disease or condition. The terms "treat" and "treatment" also include preventing, mitigating, ameliorating, reducing, inhibiting, eliminating, and / or reversing one or more symptoms of a disease or condition.

[0153] The term "alleviate" refers to the reduction or elimination of one or more symptoms of the pathology or disease, and / or the reduction in incidence or delay in onset or severity of one or more symptoms of the pathology or disease, and / or the prevention of the pathology or disease. In certain embodiments, the reduction or elimination of one or more symptoms of the pathology or disease may include, for example, a measurable and sustained increase in the expression level of one or more isoforms of TCIRG1.

[0154] As used herein, the phrase "consisting essentially of" refers to the genus or species of active pharmaceutical agents recited in the method or composition, and may further include other agents that do not themselves have substantial activity for the recited indication or purpose.

[0155] The terms "subject," "individual," and "patient" refer interchangeably to a mammal, preferably a human or non-human primate, but also to domesticated mammals (e.g., dogs or cats), laboratory mammals (e.g., mice, rats, rabbits, hamsters, guinea pigs), and agricultural mammals (e.g., horses, cows, pigs, sheep). In various embodiments, the subject may be a human (e.g., adult male, adult female, adolescent male, adolescent female, male child, female child).

[0156] The term "gene transfer" or "gene delivery" refers to a method or system for reliably inserting foreign DNA into a host cell. Such methods may result in transient expression of the unintegrated introduced DNA, extrachromosomal replication and expression of the introduced replicon (e.g., episome), or integration of the introduced genetic material into the genomic DNA of the host cell.

[0157] The term "vector" is used herein to refer to a nucleic acid molecule capable of introducing or transporting another nucleic acid molecule. The introduced nucleic acid is generally linked, e.g., inserted, into the vector nucleic acid molecule. The vector may contain sequences directing autonomous replication or reverse transcription in a cell, or may contain sequences sufficient to allow integration into the host cell DNA. "Vector" includes gene therapy vectors. As used herein, the term "gene therapy vector" refers to a vector that can be used to perform gene therapy, for example, to deliver a polynucleotide sequence encoding a therapeutic polypeptide to a subject. A gene therapy vector may contain a nucleic acid molecule ("transgene") encoding a therapeutically active polypeptide, e.g., TCIRG1, or other gene useful for replacement gene therapy when introduced into a subject. Useful vectors include, but are not limited to, viral vectors.

[0158] As used herein, the term "expression cassette" refers to a DNA segment capable in an appropriate setting of driving the expression of a polynucleotide (e.g., a transgene) that encodes a therapeutically active polypeptide (e.g., TCIRG1) that is incorporated into the expression cassette. When introduced into a host cell, the expression cassette can specifically instruct the cellular machinery to transcribe the transgene into RNA, which is then typically further processed and ultimately translated into a therapeutically active polypeptide. The expression cassette may be included in a gene therapy vector. In general, the term expression cassette excludes the polynucleotide sequences 5' to 5' LTR and 3' to 3' LTR.

[0159] All patents, patent publications, and other publications referenced and identified in this specification are individually and expressly incorporated by reference herein in their entirety for all purposes. EXAMPLES

[0160] Example 1: Stable propagation of transfer plasmids The stability of different plasmids containing the minimal TCIRG1 expression cassette, EFS-TCIRG1-WPRE (SEQ ID NO: 1), was tested. The plasmid construct pRRL.PPT.EFS.tcirg1h.wpre (Figure 3C) with ampicillin resistance (AmpR) showed unexpectedly poor growth and instability during culture in E. coli cells used to propagate the plasmid before transfection into the packaging cell line, as shown by the general smear of degraded DNA (Figure 3A), indicating low yield and instability of the plasmid. Various other plasmid backbones also showed instability (data not shown). However, when the minimal expression cassette EFS-TCIRG1-WPRE (SEQ ID NO: 1) was cloned from the pRRL vector into the pCCL vector with the RNA-OUT sequence (Figure 3C), the resulting plasmid construct, pCCL.PPT.EFS.tcirg1h.wpre (SEQ ID NO: 27), showed unexpectedly good growth and stability when grown in E. coli. This was demonstrated by the high yield of plasmid and the restriction digestion patterns observed (Figure 3B). The complete vector sequence is provided as SEQ ID NO: 27, and the location of each vector element is provided in Table 2.

[0161] Table 2. pCCL.PPT.EFS.tcirg1h.wpre Vector Elements TIFF2025063200000003.tif108128

[0162] Lentiviral vectors were produced by transient transfection of the pCCL / RNA-OUT vector, together with a packaging plasmid (pCMV ΔR8.91), and an envelope plasmid (VSV-G pMDG), into 293T cells by the protocol shown in Figure 4.

[0163] Example 2: Restoration of bone resorption function of osteoclasts from IMO patients using pCCL.PPT.EFS.tcirg1h.wpre This example shows the use of pCCL.PPT.EFS.tcirg1h.wpre for lentiviral-mediated TCIRG1 gene transfer in patient-derived HSCs. HSCs are obtained, expanded, and transduced with lentiviral particles carrying pCCL.PPT.EFS.tcirg1h.wpre as described in Example 1 to obtain genetically modified HSCs. After injection, genetically modified HSCs differentiate into osteoclasts. The method used is essentially as described in Moscatelli et al. Hum. Gene Therap. 29:938-949 (2017).

[0164] Samples of peripheral blood from IMO patients or umbilical cord blood (CB) from normal deliveries are obtained. Mononuclear cells from these sources are isolated using density gradient centrifugation with Ficoll, and CD34+ cells are separated from the mononuclear cell fraction using magnetic activated cell sorting (MACS) columns (Miltenyi Biotec, Bergisch Gladbach, Germany). For expansion, cells are cultured in SFEM StemSpan medium (StemCell Technologies, Vancouver, BC) containing human recombinant cytokines M-CSF (50 ng / ml), GM-CSF (30 ng / ml), SCF (200 ng / ml), IL-6 (10 ng / ml), and Flt3L (50 ng / ml) (R&D Systems, Minneapolis MN). CD34+ cells are cultured at 5 × 10 in 1 ml of medium using 24-well bacteriological plates. 4 Cells were seeded at a density of 1 x 10 and incubated for 1 week at 37 °C and then harvested. 5 The cells are replated at a density of 100 / well. Starting on day 7, medium is changed by demi-depletion every 2-3 days. For transplantation, CD34+ cells are cultured for 30 h in SFEM StemSpan medium (StemCell Technologies, Vancouver, BC) containing human recombinant cytokines SCF (100 ng / ml), Flt3L (100 ng / ml), and TPO (100 ng / ml) (R&D Systems, Minneapolis MN).

[0165] Transduction is performed in 24-well plates coated with RetroNectin (Takara Bio, Otsu, Japan). For in vitro experiments, CD34+ cells are transduced on day 3 with a first hit at a multiplicity of infection (MOI) of 30 for 6 h, and on day 7 with a second hit at MOI 30 for 6 h, followed by a week of culture with myeloid cytokine cocktail before differentiation into osteoclasts. For in vivo experiments, a short transduction protocol is used to allow efficient transduction while maintaining the stem / progenitor nature of the CD34+ population. Mononuclear cells are isolated and transduced with the first hit (MOI 30 or 100) overnight, then transduced with the second hit (MOI 30 or 100) for 6 h the next day, after which the cells are ready to be transplanted into subjects (mice or human patients).

[0166] Osteoclast formation can be assessed by differentiation in the presence of 50ng / ml M-CSF and 50ng / ml RANKL for approximately 10 days, followed by fixation of the cells with 4% formaldehyde for further analysis or lysis of the cells for Western blot analysis. Resorption is assessed by assays for the release of c-terminal type I collagen fragments (CTX-I) and Ca2+ release into the medium, and visualization of the formation of resorption pits using hematoxylin staining of fixed cells.

[0167] In animal studies, transduced osteoclasts are transplanted into NSG mice. NSG mice aged 8–15 weeks are sublethally irradiated with 300 cGy and 6 hours later, 1 × 10 transduced osteoclasts with lentiviral particles derived from pCCL.PPT.EFS.tcirg1h.wpre are injected via tail vein. 5 Non-transduced CB CD34+ cells or IMO CD34+ cells are transplanted. Mice are administered ciprofloxacin via drinking water for 2 weeks to avoid post-transplant infection. Peripheral blood is collected at different time points and bone marrow cells are harvested after termination of the mice by crushing the femur in a mortar.

[0168] Vector copy number analysis is performed on total bone marrow genomic DNA from samples taken from mice 9-19 weeks after transplantation. Peripheral blood and bone marrow of transplanted NSG mice are analyzed for human reconstitution by determining the percentage of huCD45-APC positive cells. For lineage analysis, cells were stained with antibodies against CD33-PeCy7, CD15-PeCy7, CD19-BV605, and CD3-PE.

[0169] The methods described above will be used to confirm the restoration of resorbing function of osteoclasts from IMO patients following lentivirus-mediated TCIRG1 gene transfer and long-term engraftment of transduced CD34+ cells.

[0170] Example 3: In vitro gene transfer of human CD34+ enriched cells using a clinically established gene transfer protocol In this example, (1) viable CD34 + Transduced CD34 cells and multilineage differentiation potential + FIG. 1 shows the suitability of pre-GMP batches of EFS-TCIRG1-WPRE (SEQ ID NO: 25 or 27) using the plasmids described in Example 1 by (1) phenotypic characterization of cells and (2) vector copy number (VCN determination in both liquid cultures and colonies).

[0171] Conserved phenotype and multilineage potential of mPB CD34+ cells following transduction with EFS-TCIRG1-WPRE The performance of the pre-GMP EFS-TCIRG1-WPRE batch was compared to LV (four batches) produced for the treatment of other disorders. Mobilized PB CD34 + CD34 cells were also used as target cells in the proposed IMO clinical trial. Various MOIs were tested. High cell viability (>95%) was obtained 20 hours after transduction across all vectors and MOIs tested, indicating the absence of short-term toxicity. +The percentage of cells was very high in all conditions tested immediately after transduction (>97%) and after 2 days of liquid culture was gradually lost over time at comparable levels in all conditions, as expected for this type of culture.

[0172] Transduced CD34 + The multilineage potential of the cells was assessed by quantification of differentiated CFUs in semi-solid methylcellulose medium cultures. Total CFUs as well as BFU-E, CFU-GM, and CFU-GEMM, describing erythroid and myeloid lineages, were evaluated. The presence of EFS-TCIRG1-WPRE did not affect CFU proliferation, as no significant differences in their total numbers were observed between experimental conditions compared to mock controls. No differences were observed in any of the colony types compared to mock, confirming the maintenance of multilineage potential in vitro after transduction with EFS-TCIRG1-WPRE, even at high MOI values.

[0173] EFS-TCIRG1-WPRE expresses mPB CD34 + High cell transduction efficiency To determine the vector dose of EFS-TCIRG1-WPRE required to provide a transduction efficiency suitable for therapeutic use, the lentiviral vector was tested using an established clinical transduction protocol. + Cells were maintained in liquid culture for up to 12 days to allow cellular clearance of episomal LV genome copies prior to VCN assessment. High VCN / cell values ​​were obtained with IMO vectors in a dose-dependent manner. The effect of increasing dose was consistent across all vectors tested, with higher VCN / cell values ​​for IMO vectors than LAD-I and FA vectors when transduced at the same MOI (Figures 5A-5B). High transduction efficacy of EFS-TCIRG1-WPRE is shown.

[0174] VCN / cell was also assessed in CFUs isolated according to phenotype (BFU-E, CFU-GM, or CFU-GEMM) to confirm transduction in different progenitor cells. EFS-TCIRG1-WPRE showed higher colony VCN values ​​in cells from both donors. Similar to the results of transduction with IMO vectors, liquid culture resulted in high transduction efficiency, and VCN / cell in colonies cultured in methylcellulose medium.

[0175] The VCN patterns in the different CFU types (BFU-E, CFU-GM, and CFU-GEMM) were found to be similar to other vectors and to be the highest values ​​typically seen in erythroid colonies, as previously described by Charrier et al. Gene Therapy 18:479-487 (2011).

[0176] The IMO vector EFS-TCIRG1-WPRE expresses human CD34 at levels comparable to those of clinical lots of lentivirus. + The cells are transduced with CD34 while a high transduction efficiency is achieved. + The phenotype and multilineage potential of the cells was preserved. The IMO vector was successfully implemented at a lower MOI than the control vector, demonstrating its suitability for use in gene therapy of IMO patients.

[0177] These studies demonstrated that VCN and transduction efficiency achieved efficiencies comparable to the correction levels of in vivo genetically modified hematopoietic cells, enabling the use of this gene therapy in the treatment of infantile malignant osteopetrosis due to mutations in TCIRG1.

[0178] Sequence information SEQUENCE LISTING <110> SPACECRAFT SEVEN, LLC <120> GENE THERAPY VECTORS FOR INFANTILE MALIGNANT OSTEOPETROSIS <150> US 62 / 852,216 <151> 2019-05-23 <160> 39 <170> PatentIn version 3.5 <210> 1 <211> 3384 <212> DNA <213> Artificial Sequence <220> <223> Made in Lab - Expression cassette <400> 1 ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60 ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120 gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180 gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtgtcgtga 240 cgcgggatcc gccaccatgg gctccatgtt tcggagcgag gaggtggccc tggtccagct 300 ctttctgccc acagcggctg cctacacctg cgtgagtcgg ctgggcgagc tgggcctcgt 360 ggagttcaga gacctcaacg cctcggtgag cgccttccag agacgctttg tggttgatgt 420 tcggcgctgt gaggagctgg agaagacctt caccttcctg caggaggagg tgcggcgggc 480 tgggctggtc ctgcccccgc caaaggggag gctgccggca cccccacccc gggacctgct 540 gcgcatccag gaggagacgg agcgcctggc ccaggagctg cgggatgtgc ggggcaacca 600 gcaggccctg cgggcccagc tgcaccagct gcagctccac gccgccgtgc tacgccaggg 660 ccatgaacct cagctggcag ccgcccacac agatggggcc tcagagagga cgcccctgct 720 ccaggccccc ggggggccgc accaggacct gagggtcaac tttgtggcag gtgccgtgga 780 gccccacaag gcccctgccc tagagcgcct gctctggagg gcctgcagag gcttcctcat 840 tgccagcttc agggagctgg agcagccgct ggagcacccc gtgacgggcg agccagccac 900 gtggatgacc ttcctcatct cctactgggg tgagcagatc ggacagaaga tccgcaagat 960 cacggactgc ttccactgcc acgtcttccc gtttctgcag caggaggagg cccgcctcgg 1020 ggccctgcag cagctgcaac agcagagcca ggagctgcag gaggtcctcg gggagacaga 1080 gcggttcctg agccaggtgc taggccgggt gctgcagctg ctgccgccag ggcaggtgca 1140 ggtccacaag atgaaggccg tgtacctggc cctgaaccag tgcagcgtga gcaccacgca 1200 caagtgcctc attgccgagg cctggtgctc tgtgcgagac ctgcccgccc tgcaggaggc 1260 cctgcgggac agctcgatgg aggagggagt gagtgccgtg gctcaccgca tcccctgccg 1320. ggacatgccc cccacactca tccgcaccaa ccgcttcacg gccagcttcc agggcatcgt ggatgcctac ggcgtgggcc gctaccagga ggtcaacccc gctccctaca ccatcatcac cttccccttc ctgtttgctg tgatgttcgg ggatgtgggc cacgggctgc tcatgttcct cttcgccctg gccatggtcc ttgcggagaa ccgaccggct gtgaaggccg cgcagaacga gatctggcag actttcttca ggggccgcta cctgctcctg cttatgggcc tgttctccat 1620 ctacaccggc ttcatctaca acgagtgctt cagtcgcgcc accagcatct tcccctcggg 1680 ctggagtgtg gccgccatgg ccaaccagtc tggctggagt gatgcattcc tggcccagca 1740. 1800. 1800. 1800. 1800. 1800. 1800. 1800. 1800. catcgatcct atttggagcc tggctgccaa cccttgagc ttcctcaact ccttcaagat gaagatgtcc gtcatcctgg gcgtcgtgca catggccttt ggggtggtcc tcggagtctt 1920 caaccacgtg cactttggcc agaggcaccg gctgctgctg gagacgctgc cggagctcac 1980 cttcctgctg ggactcttcg gttacctcgt gttcctagtc atctacaagt ggctgtgtgt 2040 ctgggctgcc agggccgcct cggcccccag catcctcatc cacttcatca acatgttcct 2100 cttctcccac agccccagca acaggctgct ctacccccgg caggaggtgg tccaggccac 2160 gctggtggtc ctggccttgg ccatggtgcc catcctgctg cttggcacac ccctgcacct 2220 gctgcaccgc caccgccgcc gcctgcggag gaggcccgct gaccgacagg aggaaaacaa 2280 ggccgggttg ctggacctgc ctgacgcatc tgtgaatggc tggagctccg atgaggaaaa 2340 ggcagggggc ctggatgatg aaggaggc cgagctcgtc ccctccgagg tgctcatgca 2400 ccaggccatc cacaccatcg agttctgcct gggctgcgtc tccaacaccg cctctacct 2460 gcgcctgtgg gccctgagcc tggcccacgc ccagctgtcc gaggttctgt gggccatggt 2520 gatgcgcata ggcctgggcc tgggccggga ggtgggcgtg gcggctgtgg tgctggtccc 2580 catctttgcc gcctttgccg tgatgaccgt ggctatcctg ctggtgatgg agggactctc 2640 agccttcctg cacgccctgc ggctgcactg ggtggaattc cagaacaagt tctactcagg 2700 cacgggctac aagctgagtc ccttcacctt cgctgccaca gatgactagt aagtcgacgg 2760 atcccccggg ctgcaggaat tcgagcatct taccgccatt tatacccata tttgttctgt 2820 ttttcttgat ttgggtatac atttaaatgt tataaaaca aaatggtggg gcaatcattt 2880 acatttttag ggatatgtaa ttactagttc aggtgtattg ccacaagaca aacatgttaa 2940 gaaactttcc cgttatttac gctctgttcc tgttaatcaa cctctggatt acaaaatttg 3000 tgaaagattg actgatattc ttaactatgt tgctcctttt acgctgtgtg gatatgctgc 3060 tttaatgcct ctgtatcatg ctattgcttc cgtacggct ttcgttttct cctccttgta 3120 taaatcctgg ttgctgtctc tttatgagga gttgtggccc gttgtccgtc aacgtggcgt 3180 ggtgtgctct gtgtttgctg acgcaacccc cactggctgg ggcattgcca ccacctgtca 3240 actcctttct gggactttcg ctttccccct cccgatcgcc acggcagaac tcatcgccgc 3300 ctgccttgcc cgctgctgga caggggctag gttgctgggc actgaaatt ccgtggtgtt 3360 gtcggggaag ctgacgtcct ttcg 3384 <210> 2 <211> 243 <212> DNA <213> Homo sapiens <400> 2 ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60 ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120 gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180 gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtgtcgtga 240 cgc 243 <210> 3 <211> 2493 <212> DNA <213> Homo sapiens <400> 3 atgggctcca tgtttcggag cgaggaggtg gccctggtcc agctctttct gcccacagcg 60 gctgcctaca cctgcgtgag tcggctgggc gagctgggcc tcgtggagtt cagagacctc 120 aacgcctcgg tgagcgcctt ccagagacgc tttgtggttg atgttcggcg ctgtgaggag 180 ctggagaaga ccttcacctt cctgcaggag gaggtgcggc gggctgggct ggtcctgccc 240 ccgccaaagg ggaggctgcc ggcaccccca ccccgggacc tgctgcgcat ccaggaggag 300 acggagcgcc tggcccagga gctgcgggat gtgcggggca accagcaggc cctgcgggcc 360 cagctgcacc agctgcagct ccacgccgcc gtgctacgcc agggccatga acctcagctg 420 gcagccgccc acacagatgg ggcctcagag aggacgcccc tgctccaggc ccccgggggg 480 ccgcaccagg acctgagggt caactttgtg gcaggtgccg tggagcccca caaggcccct 540 gccctagagc gcctgctctg gagggcctgc agaggcttcc tcattgccag cttcagggag 600 ctggagcagc cgctggagca ccccgtgacg ggcgagccag ccacgtggat gaccttcctc 660 atctcctact ggggtgagca gatcggacag aagatccgca agatcacgga ctgcttccac 720 tgccacgtct tcccgtttct gcagcaggag gaggcccgcc tcggggccct gcagcagctg 780 caacagcaga gccaggagct gcaggaggtc ctcggggaga cagagcggtt cctgagccag 840 gtgctaggcc gggtgctgca gctgctgccg ccagggcagg tgcaggtcca caagatgaag 900 gccgtgtacc tggccctgaa ccagtgcagc gtgagcacca cgcacaagtg cctcattgcc 960 gaggcctggt gctctgtgcg agacctgccc gccctgcagg aggccctgcg ggacagctcg 1020 atggaggagg gagtgagtgc cgtggctcac cgcatcccct gccgggacat gccccccaca 1080 ctcatccgca ccaaccgctt cacggccagc ttccagggca tcgtggatgc ctacggcgtg 1140 ggccgctacc aggaggtcaa ccccgctccc tacaccatca tcaccttccc cttcctgttt 1200 gctgtgatgt tcggggatgt gggccacggg ctgctcatgt tcctcttcgc cctggccatg 1260 gtccttgcgg agaaccgacc ggctgtgaag gccgcgcaga acgagatctg gcagactttc 1320 ttcaggggcc gctacctgct cctgcttatg ggcctgttct ccatctacac cggcttcatc 1380 tacaacgagt gcttcagtcg cgccaccagc atcttcccct cgggctggag tgtggccgcc 1440 atggccaacc agtctggctg gagtgatgca ttcctggccc agcacacgat gcttaccctg 1500 gaccccaacg tcaccggtgt cttcctggga ccctacccct ttggcatcga tcctatttgg 1560 agcctggctg ccaaccactt gagcttcctc aactccttca agatgaagat gtccgtcatc 1620 ctgggcgtcg tgcacatggc ctttggggtg gtcctcggag tcttcaacca cgtgcacttt 1680 ggccagaggc accggctgct gctggagacg ctgccggagc tcaccttcct gctgggactc 1740 ttcggttacc tcgtgttcct agtcatctac aagtggctgt gtgtctgggc tgccagggcc 1800 gcctcggccc ccagcatcct catccacttc atcaacatgt tcctcttctc ccacagcccc 1860 agcaacaggc tgctctaccc ccggcaggag gtggtccagg ccacgctggt ggtcctggcc 1920 ttggccatgg tgcccatcct gctgcttggc acacccctgc acctgctgca ccgccaccgc 1980 cgccgcctgc ggaggaggcc cgctgaccga caggaggaaa acaaggccgg gttgctggac 2040 ctgcctgacg catctgtgaa tggctggagc tccgatgagg aaaaggcagg gggcctggat 2100 gatgaagagg aggccgagct cgtcccctcc gaggtgctca tgcaccaggc catccacacc 2160 atcgagttct gcctgggctg cgtctccaac accgcctcct acctgcgcct gtgggccctg 2220 agcctggccc acgcccagct gtccgaggtt ctgtgggcca tggtgatgcg cataggcctg 2280 ggcctgggcc gggaggtggg cgtggcggct gtggtgctgg tccccatctt tgccgccttt 2340 gccgtgatga ccgtggctat cctgctggtg atggagggac tctcagcctt cctgcacgcc 2400 ctgcggctgc actgggtgga attccagaac aagttctact caggcacggg ctacaagctg 2460 agtcccttca ccttcgctgc cacagatgac tag 2493 <210> 4 <211> 606 <212> DNA <213> Woodchuck hepatitis virus <400> 4 attcgagcat cttaccgcca tttataccca tatttgttct gtttttcttg atttgggtat 60 acatttaaat gttaataaaa caaaatggtg gggcaatcat ttacattttt agggatatgt 120 aattactagt tcaggtgtat tgccacaaga caaacatgtt aagaaacttt cccgttattt 180 acgctctgtt cctgttaatc aacctctgga ttacaaaatt tgtgaaagat tgactgatat 240 tcttaactat gttgctcctt ttacgctgtg tggatatgct gctttaatgc ctctgtatca 300 tgctattgct tcccgtacgg ctttcgtttt ctcctccttg tataaatcct ggttgctgtc 360 tctttatgag gagttgtggc ccgttgtccg tcaacgtggc gtggtgtgct ctgtgtttgc 420 tgacgcaacc cccactggct ggggcattgc caccacctgt caactccttt ctgggacttt 480 cgctttcccc ctcccgatcg ccacggcaga actcatcgcc gcctgccttg cccgctgctg 540 gacaggggct aggttgctgg gcactgataa ttccgtggtg ttgtcgggga agctgacgtc 600 ctttcg 606 <210> 5 <211> 830 <212> PRT <213> Homo sapiens <400> 5 Met Gly Ser Met Phe Arg Ser Glu Glu Val Ala Leu Val Gln Leu Phe 1 5 10 15 Leu Pro Thr Ala Ala Ala Tyr Thr Cys Val Ser Arg Leu Gly Glu Leu 20 25 30 Gly Leu Val Glu Phe Arg Asp Leu Asn Ala Ser Val Ser Ala Phe Gln 35 40 45 Arg Arg Phe Val Val Asp Val Arg Arg Cys Glu Glu Leu Glu Lys Thr 50 55 60 Phe Thr Phe Leu Gln Glu Glu Val Arg Arg Ala Gly Leu Val Leu Pro 65 70 75 80 Pro Pro Lys Gly Arg Leu Pro Ala Pro Pro Pro Arg Asp Leu Leu Arg 85 90 95 Ile Gln Glu Glu Thr Glu Arg Leu Ala Gln Glu Leu Arg Asp Val Arg 100 105 110 Gly Asn Gln Gln Ala Leu Arg Ala Gln Leu His Gln Leu Gln Leu His 115 120 125 Ala Ala Val Leu Arg Gln Gly His Glu Pro Gln Leu Ala Ala Ala His 130 135 140 Thr Asp Gly Ala Ser Glu Arg Thr Pro Leu Leu Gln Ala Pro Gly Gly 145 150 155 160 Pro His Gln Asp Leu Arg Val Asn Phe Val Ala Gly Ala Val Glu Pro 165 170 175 His Lys Ala Pro Ala Leu Glu Arg Leu Leu Trp Arg Ala Cys Arg Gly 180 185 190 Phe Leu Ile Ala Ser Phe Arg Glu Leu Glu Gln Pro Leu Glu His Pro 195 200 205 Val Thr Gly Glu Pro Ala Thr Trp Met Thr Phe Leu Ile Ser Tyr Trp 210 215 220 Gly Glu Gln Ile Gly Gln Lys Ile Arg Lys Ile Thr Asp Cys Phe His 225 230 235 240 Cys His Val Phe Pro Phe Leu Gln Gln Glu Glu Ala Arg Leu Gly Ala 245 250 255 Leu Gln Gln Leu Gln Gln Gln Ser Gln Glu Leu Gln Glu Val Leu Gly 260 265 270 Glu Thr Glu Arg Phe Leu Ser Gln Val Leu Gly Arg Val Leu Gln Leu 275 280 285 Leu Pro Pro Gly Gln Val Gln Val His Lys Met Lys Ala Val Tyr Leu 290 295 300 Ala Leu Asn Gln Cys Ser Val Ser Thr Thr His Lys Cys Leu Ile Ala 305 310 315 320 Glu Ala Trp Cys Ser Val Arg Asp Leu Pro Ala Leu Gln Glu Ala Leu 325 330 335 Arg Asp Ser Ser Met Glu Glu Gly Val Ser Ala Val Ala His Arg Ile 340 345 350 Pro Cys Arg Asp Met Pro Pro Thr Leu Ile Arg Thr Asn Arg Phe Thr 355 360 365 Ala Ser Phe Gln Gly Ile Val Asp Ala Tyr Gly Val Gly Arg Tyr Gln 370 375 380 Glu Val Asn Pro Ala Pro Tyr Thr Ile Ile Thr Phe Pro Phe Leu Phe 385 390 395 400 Ala Val Met Phe Gly Asp Val Gly His Gly Leu Leu Met Phe Leu Phe 405 410 415 Ala Leu Ala Met Val Leu Ala Glu Asn Arg Pro Ala Val Lys Ala Ala 420 425 430 Gln Asn Glu Ile Trp Gln Thr Phe Phe Arg Gly Arg Tyr Leu Leu Leu 435 440 445 Leu Met Gly Leu Phe Ser Ile Tyr Thr Gly Phe Ile Tyr Asn Glu Cys 450 455 460 Phe Ser Arg Ala Thr Ser Ile Phe Pro Ser Gly Trp Ser Val Ala Ala 465 470 475 480 Met Ala Asn Gln Ser Gly Trp Ser Asp Ala Phe Leu Ala Gln His Thr 485 490 495 Met Leu Thr Leu Asp Pro Asn Val Thr Gly Val Phe Leu Gly Pro Tyr 500 505 510 Pro Phe Gly Ile Asp Pro Ile Trp Ser Leu Ala Ala Asn His Leu Ser 515 520 525 Phe Leu Asn Ser Phe Lys Met Lys Met Ser Val Ile Leu Gly Val Val 530 535 540 His Met Ala Phe Gly Val Val Leu Gly Val Phe Asn His Val His Phe 545 550 555 560 Gly Gln Arg His Arg Leu Leu Leu Glu Thr Leu Pro Glu Leu Thr Phe 565 570 575 Leu Leu Gly Leu Phe Gly Tyr Leu Val Phe Leu Val Ile Tyr Lys Trp 580 585 590 Leu Cys Val Trp Ala Ala Arg Ala Ala Ser Ala Pro Ser Ile Leu Ile 595 600 605 His Phe Ile Asn Met Phe Leu Phe Ser His Ser Pro Ser Asn Arg Leu 610 615 620 Leu Tyr Pro Arg Gln Glu Val Val Gln Ala Thr Leu Val Val Leu Ala 625 630 635 640 Leu Ala Met Val Pro Ile Leu Leu Leu Gly Thr Pro Leu His Leu Leu 645 650 655 His Arg His Arg Arg Arg Leu Arg Arg Arg Pro Ala Asp Arg Gln Glu 660 665 670 Glu Asn Lys Ala Gly Leu Leu Asp Leu Pro Asp Ala Ser Val Asn Gly 675 680 685 Trp Ser Ser Asp Glu Glu Lys Ala Gly Gly Leu Asp Asp Glu Glu Glu 690 695 700 Ala Glu Leu Val Pro Ser Glu Val Leu Met His Gln Ala Ile His Thr 705 710 715 720 Ile Glu Phe Cys Leu Gly Cys Val Ser Asn Thr Ala Ser Tyr Leu Arg 725 730 735 Leu Trp Path Leu Ser Leu Path His Path Gln Leu Ser Glu Val Leu Trp 740 745 750 Ala Met Val Met Arg Ile Gly Leu Gly Leu Gly Arg Glu Val Gly Val 755 760 765 Path Path Val Val Leu Val Pro Ile Phe Path Path Phe Path Val Met Thr 770 775 780 Val Ala Ile Leu Leu Val Met Glu Gly Leu Ser Ala Phe Leu His Ala 785 790 795 800 Leu Arg Leu His Trp Val Glu Phe Gln Asn Lys Phe Tyr Ser Gly Thr 805 810 815 Gly Tyr Lys Leu Ser Pro Phe Thr Phe Ala Ala Thr Asp Asp 820 825 830 <210> 6 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Consensus Kozak sequence <400> 6 gccgccacca tgg 13 <210> 7 <211> 387 <212> DNA <213> Mus musculus <400> 7 tggctaataa aggaaattta ttttcattgc aatagtgtgt tggaattttt tgtgtctctc 60 actcggaagg acatatggga gggcaaatca tttaaaacat cagaatgagt atttggttta 120 gagtttggca acatatgccc atatgctggc tgccatgaac aaaggttggc tataaagagg 180 tcatcagtat atgaaacagc cccctgctgt ccattcctta ttccatagaa aagccttgac 240 ttgaggttag atttttttta tattttgttt tgtgttattt ttttctttaa catccctaaa 300 attttcctta catgttttac tagccagatt tttcctcctc tcctgactac tcccagtcat 360 agctgtccct cttctcttat ggagatc 387 <210> 8 <400> 8 000 <210> 9 <400> 9 000 <210> 10 <400> 10 000 <210> 11 <400> 11 000 <210> 12 <400> 12 000 <210> 13 <400> 13 000 <210> 14 <211> 13 <212> RNA <213> Artificial Sequence <220> <223> Consensus Kozak sequence <400> 14 gccgccrcca ugg 13 <210> 15 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> Kozak sequence <220> <221> misc_feature <222> (2)..(3) <223> n is A, C, T, G or U <220> <221> misc_feature <222> (4)..(4) <223> n is a, c, g, or u <220> <221> misc_feature <222> (8)..(8) <223> n is A, C, T, G or U <400> 15 agnnaugn 8 <210> 16 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> Kozak sequence <220> <221> misc_feature <222> (2)..(3) <223> n is A, C, T, G or U <400> 16 annaugg 7 <210> 17 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> Kozak sequence <400> 17 accaugg 7 <210> 18 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> n is A, C, T, G or U <400> 18 gacaccaugg 10 <210> 19 <211> 235 <212> DNA <213> Bos taurus <400> 19 tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg 60 accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat 120 tgtctgagta ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag 180 gattgggagg acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctg 235 <210> 20 <211> 222 <212> DNA <213> simian virus 40 <400> 20 cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg cagtgaaaaa 60 aatgcttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt ataagctgca 120 ataaacaagt taacaacaac aattgcattc attttatgtt tcaggttcag ggggagatgt 180 gggaggtttt ttaaagcaag taaaacctct acaaatgtgg ta 222 <210> 21 <211> 202 <212> DNA <213> Homo sapiens <400> 21 ctgcccgggt ggcatccctg tgacccctcc ccagtgcctc tcctggccct ggaagttgcc 60 actccagtgc ccaccagcct tgtcctaata aaattaagtt gcatcattttt gtctgactag 120 gtgtccttct ataatattat ggggtggagg ggggtggtat ggagcaaggg gcccaagttg 180 ggaagaaacc tgtagggcct gc 202 <210> 22 <211> 141 <212> DNA <213> Escherichia coli <400> 22 gtagaattgg taaagagagt cgtgtaaaat atcgagttcg cacatcttgt tgtctgatta 60 ttgatttttg gcgaaaccat ttgatcatat gacaagatgt gtatctacct taacttaatg 120 atttgataa aaatcattag g 141 <210> 23 <211> 7660 <212> DNA <213> Artificial Sequence <220> <223> Made in Lab - plasmid construct <400> 23 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagcccc 60 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 120 cgaccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 180 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 240 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 300 gcattatgcc cagtacatga ccttatggga cttcctact tggcagtaca tctacgtatt 360 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg 420 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg 480 gcaccaaaat caacgggact ttccaaatg tcgtaacaac tccgccccat tgacgcaat 540 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctcgtttag tgaaccgggg 600 tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg 660 cttaagccctc ataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt 720 gactctgta actagagatc cctcagaccc tttagtcag tgtggaaaat cttagcagt 780 ggcgcccgaa cagggacttg aaagcgaaag ggaaccaga ggagctct cgacgcagga 840 ctcggcttgc tgaagcgcgc acggcaagg gcgaggggcg gcgactggtg agtacgccaa 900 aaattttgac tagcggaggc taggaggaga gagatggggtg cgagagcgtc agtattaagc 960 gggggagaat tagatcgcga tgggaaaaa ttcggttaag gccaggggga aagaaaaaat 1020 aaaattaa acatagta tgggcaagca gggagctaga acgattcgca gttaatcctg 1080 gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa ccatccctc 1140 agacaggatc agagaactt agacattat atatacagt agcaccctc tattgtgtgc 1200 acaagg agaaaaaaaaaagg aagctttaga ahagaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa hasaa 1260 aaaagtaa gaccaccgca cagcaagcgg ccgctgatct tcagacctgg agggagat 1320 atgagggaca attggagag tgaattatat aaataag tgtaaaat tgaaccatta 1380 ggagtagcac ccaccaggc aagagaga gtggtgcaga gagaaaaag agcagtgga 1440 ataggagctt tgttccttgg gttctggg gcagcaggaa gcactgggg cgcagcgtca 1500 atgacgctga cggtacaggc cagacaatta ttgtctggta tagtgcagca gcagaacaat 1560 ttgctgagggg ctattgaggc gcacagcat ctgttgcaac tcacagctg gggcatcag 1620 cagctccagg caagaatcct ggctgtggaa agataccta aggatcaca gctcctgggg 1680 atttggggtt gctctggaaa accatttgc accactgctg tgccttgtgtgttgg 1740 agtataaat ctctggaaca gatttggaat cacacgacct ggatggagtg ggacagagaa 1800 attackacatt acacaagctt atacactcc ttaattgaag atcgcaaaa ccacagaaa 1860 Aagaatgaac Aagaattatt Ggaattagat Aatgggcaa Gtttgtga Tggtttac 1920s atacaatt ggctgtgta tataaaatta ttcataatga tagtaggagg cttggtaggt 1980 ttaagaatag ttttgctgt actttctata gtgaatagag ttaggcagg atattcacca 2040 ttatcgtttc agacccacct cccaccccg agggaccg acaggcccga aggaatagaa 2100 gagaaggtg gagagaga cagagacaga tccattcgat tagtgaacgg atctcgacgg 2160 tatcggttaa cttttaaaag aaaagggggg attggggggt acagtgcagg ggaaagaata 2220 gtagacataa tagcacaga catacaaact aaagaattac aaaaaaaatt tacaaaaatt 2280 caaaattta tcgatcacga gactagccctc gagaagcttg atcgattgc tccggtgccc 2340 gtcagtgggc agagcgcaca tccccacag tccccgagaa gttgggggga ggggtcggca 2400 attgaaccgg tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact 2460 ggctccgcct tttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga 2520 acgttcttt tcgcaacgggg tttgccgcca gaacacaggt gtcgtgacgc gggatccgcc 2580 accatgggct ccatgtttcg gagcgaggag gtggccctgg tccagctctt tctgcccaca 2640 gcggctgcct acacctgcgt gagtcggctg ggcgagctgg gcctcgtgga gttcagagac 2700 ctcaacgcct cggtgagcgc cttccagaga cgctttgtgg ttgatgttcg gcgctgtgag 2760 gagctggaga agaccttcac cttcctgcag gaggaggtgc ggcgggctgg gctggtcctg 2820 cccccgccaa aggggaggct gccggcaccc ccaccccggg acctgctgcg catccaggag 2880 gagacggagc gcctggccca ggagctgcgg gatgtgcggg gcaaccagca ggccctgcgg 2940 gcccagctgc accagctgca gctccacgcc gccgtgctac gccagggcca tgaacctcag 3000 ctggcagccg cccacacaga tggggcctca gagaggacgc ccctgctcca ggcccccggg 3060 gggccgcacc aggacctgag ggtcaacttt gtggcaggtg ccgtggagcc ccacaaggcc 3120 cctgccctag agcgcctgct ctggagggcc tgcagaggct tcctcattgc cagcttcagg 3180 gagctggagc agccgctgga gcaccccgtg acgggcgagc cagccacgtg gatgaccttc 3240 ctcatctcct actggggtga gcagatcgga cagaagatcc gcaagatcac ggactgcttc 3300 3360. cctgccacg tcttcccgtt tctgcagcag gaggaggccc gcctcggggc cctgcagcag ctgcaacagc agagccagga gctgcaggag gtcctcgggg agacagagcg gttcctgagc 3420 caggtgctag gccgggtgct gcagctgctg ccgccagggc aggtgcaggt ccacaagatg 3480 aaggccgtgt acctggccct gaaccagtgc agcgtgagca ccacgcacaa gtgcctcatt gccgaggcct ggtgctctgt gcgagacctg cccgccctgc aggaggccct gcgggacagc 3600 tcgatggagg agggagtgag tgccgtggct caccgcatcc cctgccggga catgcccccc 3660 acactcatcc gcaccaaccg cttcacggcc agcttccagg gcatcgtgga tgcctacggc 3720 gtgggccgct accaggaggt caaccccgct ccctacacca tcatcacctt ccccttcctg 3780 tttgctgtga tgttcgggga tgtgggccac gggctgctca tgttcctctt cgccctggcc 3840 atggtccttg cggagaaccg accggctgtg aaggccgcgc agaacgagat ctggcagact 3900. ttcttcaggg gccgctacct gctcctgctt atgggcctgt tctccatcta caccggcttc 3960 atctacaacg agtgcttcag tcgcgccacc agcatcttcc cctcgggctg gagtgtggcc 4020. gccatggcca accagtctgg ctggagtgat gcattcctgg cccagcacac gatgcttacc 4080 ctggacccca acgtcaccgg tgtcttcctg ggaccctacc cctttggcat cgatcctatt 4140 tggagcctgg ctgccaacca cttgagcttc ctcaactcct tcaagatgaa gatgtccgtc atcctgggcg tcgtgcacat ggccttttggg gtggtcctcg gagtcttcaa ccacgtgcac 4260 tttggccaga ggcaccggct gctgctggag acgctgccgg agctcacctt cctgctggga ctcttcggtt acctcgtgtt cctagtcatc tacaagtggc tgtgtgtctg ggctgccagg 4380 gccgcctcgg cccccagcat cctcatccac ttcatcaaca tgttcctctt ctcccacagc 4440 cccagcaaca ggctgctcta cccccggcag gaggtggtcc aggccacgct ggtggtcctg gccttggcca tggtgcccat cctgctgctt ggcacacccc tgcacctgct gcaccgccac 4560 cgccgccgcc tgcggaggag gcccgctgac cgacaggagg aaaacaaggc cggggttgctg 4620. cgccgccgcc gacctgcctg acgcatctgt gaatggctgg agctccgatg aggaaaaggc agggggcctg 4680 gatgatgaag aggaggccga gctcgtcccc tccgaggtgc tcatgcacca ggccatccac 4740 accatcgagt tctgcctggg ctgcgtctcc aacaccgcct cctacctgcg cctgtgggcc 4800 ctgagcctgg cccacgccca gctgtccgag gttctgtggg ccatggtgat gcgcataggc 4860 ctgggcctgg gccgggaggt gggcgtggcg gctgtggtgc tggtccccat ctttgccgcc 4920 tttgccgtga tgaccgtggc tatcctgctg gtgatggagg gactctcagc cttcctgcac 4980 gccctgcggc tgcactgggt ggaattccag aacaagttct actcaggcac gggctacaag 5040 ctgagtccct tcaccttcgc tgccacagat gactagtaag tcgacggatc ccccgggctg 5100 caggaattcg agcatcttac cgccatttat acccatattt gttctgtttt tcttgatttg 5160 ggtatacatt taaatgttaa taaaacaaaa tggtggggca atcatttaca tttttaggga 5220 tatgtaatta ctagttcagg tgtattgcca caagacaaac atgttaagaa actttcccgt 5280 tatttacgct ctgttcctgt taatcaacct ctggattaca aaatttgtga aagattgact 5340 gatattctta actatgttgc tccttttacg ctgtgtggat atgctgcttt aatgcctctg 5400 tatcatgcta ttgcttcccg tacggctttc gttttctcct ccttgtataa atcctggttg 5460 ctgtctcttt atgaggagtt gtggcccgtt gtccgtcaac gtggcgtggt gtgctctgtg 5520 tttgctgacg caacccccac tggctggggc attgccacca cctgtcaact cctttctggg 5580 actttcgctt tccccctccc gatcgccacg gcagaactca tcgccgcctg ccttgcccgc 5640 tgctggacag gggctaggtt gctgggcact gataattccg tggtgttgtc ggggaagctg 5700 acgtcctttc gaattcgata tcaagctgta cctttaagac caatgactta caaggcagct 5760 gtagatctta gccacttttt aaaagaaaag gggggactgg aagggctaat tcactcccaa 5820 cgaagacaag atctgctttt tgcttgtact gggtctctct ggttagacca gatctgagcc 5880 tgggagctct ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga 5940 gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga 6000 cccttttagt cagtgtggaa aatctctagc agtagtagtt catgtcatct tattattcag 6060 tatttataac ttgcaaagaa atgaatatca gagagtgaga ggaacttgtt tattgcagct 6120 tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 6180 ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctggctctag 6240 ctatcccgcc cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc 6300 cgccccatgg ctgactaatt ttttttattt atgcagaggc cgaggccgcc tcggcctctg 6360 agctattcca gaagtagtga ggaggctttt ttggaggcct aggtagcccg cctaatgagc 6420 gggctttttt ttcttaggcc ttcttccgct tcctcgctca ctgactcgct gcgctcggtc 6480 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 6540 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 6600 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 6660 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 6720 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 6780 tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc 6840 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 6900 gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta 6960 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct 7020 acagagttct tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc 7080 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa 7140 caaaccaccg ctggtagcgg tggtttttt gtttgcaagc agcagattac gcgcagaaaa 7200 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 7260 aactcacgtt aagggatttt ggtcatgaga tttcaaaaa ggatcttcac ctagatcctt 7320 ttaaattaaa aatgaagtttt taaatcaatc taaagtatat atgagtaaac ttggtctgac 7380 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc 7440 atagttgcct gactcctgca aaccacgttg tggtagaatt ggtaaagaga gtcgtgtaaa 7500 atatcgagtt cgcacatctt gttgtctgat tattgatttt tggcgaaacc atttgatcat 7560 atgacaagat gtgtatctac cttaacttaa tgattttgat aaaaatcatt aggtacctgt 7620 acatttatat tggctcatgt ccaacattac cgccatgttg 7660 <210> 24 <211> 511 <212> DNA <213> Homo sapiens <400> 24 ggggttgggg ttgcgccttt tccaaggcag ccctgggttt gcgcagggac gcggctgctc 60 tgggcgtggt tccgggaaac gcagcggcgc cgaccctggg tctcgcacat tcttcacgtc 120 cgttcgcagc gtcacccgga tcttcgccgc tacccttgtg ggccccccgg cgacgcttcc 180 tgctccgccc ctaagtcggg aaggttcctt gcggttcgcg gcgtgccgga cgtgacaaac 240 ggaagccgca cgtctcacta gtaccctcgc agacggacag cgccagggag caatggcagc 300 gcgccgaccg cgatgggctg tggccaatag cggctgctca gcagggcgcg ccgagagcag 360 cggccgggaa ggggcggtgc gggaggcggg gtgtggggcg gtagtgtggg ccctgttcct 420 gcccgcgcgg tgttccgcat tctgcaagcc tccggagcgc acgtcggcag tcggctccct 480 cgttgaccga atcaccgacc tctctcccca g 511 <210> 25 <211> 7613 <212> DNA <213> Artificial Sequence <220> <223> Made in Lab - plasmid construct <400> 25 acattgatta ttgactagtt attaatagta atcaattacg gggtcattag ttcatagccc 60 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 120 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 180 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 240 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 300 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt 360 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg 420 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg 480 gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat 540 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctcgtttag tgaaccgggg 600 tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg 660 cttaagccctc ataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt 720 gactctgta actagagatc cctcagaccc tttagtcag tgtggaaaat cttagcagt 780 ggcgcccgaa cagggacttg aaagcgaaag ggaaccaga ggagctct cgacgcagga 840 ctcggcttgc tgaagcgcgc acggcaagg gcgaggggcg gcgactggtg agtacgccaa 900 aaattttgac tagcggaggc taggaggaga gagatggggtg cgagagcgtc agtattaagc 960 gggggagaat tagatcgcga tgggaaaaa ttcggttaag gccaggggga aagaaaaaat 1020 aaaattaa acatagta tgggcaagca gggagctaga acgattcgca gttaatcctg 1080 gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa ccatccctc 1140 agacaggatc agagaactt agacattat atatacagt agcaccctc tattgtgtgc 1200 acaagg agaaaaaaaaaagg aagctttaga ahagaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa hasaa 1260 aaaagtaa gaccaccgca cagcaagcgg ccgctgatct tcagacctgg agggagat 1320 atgagggaca attggagag tgaattatat aaataag tgtaaaat tgaaccatta 1380 ggagtagcac ccaccaaggc aaagagaaga gtggtgcaga gagaaaaaag agcagtggga 1440 ataggagctt tgttccttgg gttcttggga gcagcaggaa gcactatggg cgcagcgtca 1500 atgacgctga cggtacaggc cagacaatta ttgtctggta tagtgcagca gcagaacaat 1560 ttgctgaggg ctattgaggc gcaacagcat ctgttgcaac tcacagtctg gggcatcaag 1620 cagctccagg caagaatcct ggctgtggaa agatacctaa aggatcaaca gctcctgggg 1680 atttggggtt gctctggaaa actcatttgc accactgctg tgccttggaa tgctagttgg 1740 agtaataaat ctctggaaca gatttggaat cacacgacct ggatggagtg ggacagagaa 1800 attaacaatt acacaagctt aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa 1860 aagaatgaac aagaattatt ggaattagat aaatgggcaa gtttgtggaa ttggtttaac 1920 ataacaaatt ggctgtggta tataaatta ttcataatga tagtaggagg cttggtaggt 1980 ttaagaatag tttttgctgt actttctata gtgaatagag ttaggcaggg atattcacca 2040 ttatcgtttc agacccacct cccaaccccg aggggacccg acaggcccga aggaatagaa 2100 gaagaaggtg gagagagaga cagagacaga tccattcgat tagtgaacgg atctcgacgg 2160 tatcggttaa cttttaaaag aaaagggggg attggggggt acagtgcagg ggaaagaata 2220 gtagacataa tagcaacaga catacaaact aaagaattac aaaaacaaat tacaaaaatt 2280 caaaatttta tccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 2340 ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 2400 gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 2460 gtagtcgccg tgaacgttct tttcgcaac gggtttgccg ccagaacaca ggtgtcgtga 2520 cgcgggatcc gccaccatgg gctccatgtt tcggagcgag gaggtggccc tggtccagct 2580 cttctgccc acagcggctg cctacacctg cgtgagtcgg ctgggcgagc tgggcctcgt 2640 ggagttcaga gacctcaacg cctcggtgag cgccttccag agacgctttg tggttgatgt 2700 tcggcgctgt gaggagctgg agaagacctt caccttcctg caggaggagg tgcggcgggc 2760 tgggctggtc ctgccccgc caaaggggag gctgccggca cccccacccc gggacctgct 2820 gcgcatccag gaggagacgg agcgcctggc ccaggagctg cgggatgtgc ggggcaacca 2880 gcaggccctg cgggcccagc tgcaccagct gcagctccac gccgccgtgc tacgccaggg 2940 ccatgaacct cagctggcag ccgcccacac agatggggcc tcagagagga cgcccctgct 3000 ccaggccccc ggggggccgc accaggacct gagggtcaac tttgtggcag gtgccgtgga 3060 gccccacaag gcccctgccc tagagcgcct gctctggagg gcctgcagag gcttcctcat 3120 tgccagcttc agggagctgg agcagccgct ggagcacccc gtgacgggcg agccagccac 3180 gtggatgacc ttcctcatct cctactgggg tgagcagatc ggacagaaga tccgcaagat 3240 cacggactgc ttccactgcc acgtcttccc gtttctgcag caggaggagg cccgcctcgg 3300 ggccctgcag cagctgcaac agcagagcca ggagctgcag gaggtcctcg gggagacaga 3360 gcggttcctg agccaggtgc taggccgggt gctgcagctg ctgccgccag ggcaggtgca 3420 ggtccacaag atgaaggccg tgtacctggc cctgaaccag tgcagcgtga gcaccacgca 3480 caagtgcctc attgccgagg cctggtgctc tgtgcgagac ctgcccgccc tgcaggaggc 3540 cctgcgggac agctcgatgg aggagggagt gagtgccgtg gctcaccgca tcccctgccg 3600. ggacatgccc cccacactca tccgcaccaa ccgcttcacg gccagcttcc agggcatcgt ggatgcctac ggcgtgggcc gctaccagga ggtcaacccc gctccctaca ccatcatcac cttccccttc ctgtttgctg tgatgttcgg ggatgtgggc cacgggctgc tcatgttcct 3780 cttcgccctg gccatggtcc ttgcggagaa ccgaccggct gtgaaggccg cgcagaacga 3840 gatctggcag actttcttca ggggccgcta cctgctcctg cttatgggcc tgttctccat 3900 ctacaccggc ttcatctaca acgagtgctt cagtcgcgcc accagcatct tcccctcggg 3960 ctggagtgtg gccgccatgg ccaaccagtc tggctggagt gatgcattcc tggcccagca 4020 4080. ccgatgctt accctggacc cggtgtcttc ctgggaccct acccctttgg catcgatcct atttggagcc tggctgccaa cccttgagc ttcctcaact ccttcaagat 4140 gaagatgtcc gtcatcctgg gcgtcgtgca catggccttt ggggtggtcc tcggagtctt 4200. caaccacgtg cactttggcc agaggcaccg gctgctgctg gagacgctgc cggagctcac cttcctgctg ggactcttcg gttacctcgt gttcctagtc atctacaagt ggctgtgtgt 4320 ctgggctgcc agggccgcct cggcccccag catcctcatc cacttcatca acatgttcct 4380 cttctcccac agccccagca acaggctgct ctacccccgg caggaggtgg tccaggccac 4440 gctggtggtc ctggccttgg ccatggtgcc catcctgctg cttggcacac ccctgcacct 4500 gctgcaccgc caccgccgcc gcctgcggag gaggcccgct gaccgacagg aggaaaaaaa 4560 ggccgggttg ctggacctgc ctgacgcatc tgtgaatggc tggagctccg atgaggaaaa 4620 ggcagggggc ctggatgatg aaggaggc cgagctcgtc ccctccgagg tgctcatgca 4680 ccaggccatc cacaccatcg agttctgcct gggctgcgtc tccaacaccg cctctacct 4740 gcgcctgtgg gccctgagcc tggcccacgc ccagctgtcc gaggttctgt gggccatggt 4800 gatgcgcata ggcctgggcc tgggccggga ggtgggcgtg gcggctgtgg tgctggtccc 4860 catctttgcc gcctttgccg tgatgaccgt ggctatcctg ctggtgatgg agggactctc 4920 agccttcctg cacgccctgc ggctccactg ggtggaattc cagaacaagt tctactcagg 4980 cacgggctac aagctgagtc ccttcacctt cgctgccaca gatgactagt aagtcgacgg 5040 atcccccggg ctgcaggaat tcgagcatct taccgccatt tatacccata tttgttctgt 5100 ttttcttgat ttgggtatac atttaaatgt tataaaaca aaatggtggg gcaatcattt 5160 acatttttag ggatatgtaa ttactagttc aggtgtattg ccacaagaca aacatgttaa 5220 gaaactttcc cgttatttac gctctgttcc tgttaatcaa cctctggatt acaaaatttg 5280 tgaaagattg actgatattc ttaactatgt tgctcctttt acgctgtgtg gatatgctgc 5340 tttaatgcct ctgtatcatg ctattgcttc cgtacggct ttcgttttct cctccttgta 5400 taaatcctgg ttgctgtctc tttatgagga gttgtggccc gttgtccgtc aacgtggcgt 5460 ggtgtgctct gtgtttgctg acgcaacccc cactggctgg ggcattgcca ccacctgtca 5520 actccttct gggactttcg ctttccccct cccgatcgcc acggcagaac tcatcgccgc 5580 ctgccttgcc cgctgctgga caggggctag gttgctgggc actgaaatt ccgtggtgtt 5640 gtcggggaag ctgacgtcct ttcgaattcg atatcaagct gtacctttaa gaccaatgac 5700 ttacaaggca gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct 5760 aattcactcc caacgaagac aagatctgct ttttgcttgt actgggtctc tctggttaga 5820 ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata 5880 aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta 5940 gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca 6000 tcttattatt cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt 6060 gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa 6120 agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca 6180 tgtctggctc tagctatccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt 6240 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc 6300 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggtagc 6360 ccgcctaatg agcgggcttt tttttcttag gccttcttcc gcttcctcgc tcactgactc 6420 gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 6480 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 6540 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 6600 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 6660 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 6720 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 6780 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 6840 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 6900 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 6960 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 7020 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 7080 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 7140 tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 7200 tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 7260 cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 7320 aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 7380 atttcgttca tccatagttg cctgactcct gcaaaccacg ttgtggtaga attggtaaag 7440 agagtcgtgt aaaatcga gttcgcacat cttgttgtct gattattgat ttttggcgaa 7500 accatttgat catatgacaa gatgtgtatc taccttaact taatgattttt gataaaaatc 7560 attaggtacc tgtacattta tattggctca tgtccaacat taccgccatg ttg 7613 <210> 26 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Made in Lab - section of plasmid construct <400> 26 gatcacgaga ctagcctcga gaagcttgat cgattggctc cggtgcc 47 <210> 27 <211> 7646 <212> DNA <213> Artificial Sequence <220> <223> Made in lab - plasmid construct <400> 27 ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60 ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120 gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180 gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtgtcgtga 240 cgcgggatcc gccaccatgg gctccatgtt tcggagcgag gaggtggccc tggtccagct 300 ctttctgccc acagcggctg cctacacctg cgtgagtcgg ctgggcgagc tgggcctcgt 360 ggagttcaga gacctcaacg cctcggtgag cgccttccag agacgctttg tggttgatgt 420 tcggcgctgt gaggagctgg agaagacctt caccttcctg caggaggagg tgcggcgggc 480 tgggctggtc ctgcccccgc caaaggggag gctgccggca cccccacccc gggacctgct 540 gcgcatccag gaggagacgg agcgcctggc ccaggagctg cgggatgtgc ggggcaacca 600 gcaggccctg cgggcccagc tgcaccagct gcagctccac gccgccgtgc tacgccaggg 660 ccatgaacct cagctggcag ccgcccacac agatggggcc tcagagga cgcccctgct 720 ccaggcccc ggggggccgc accaggacct gagggtcaac tttgtggcag gtgccgtgga 780 gccccacaag gcccctgccc tagcgcct gctctggagg gcctgcagag gcttcctcat 840 tgccagcttc agggagctgg agcagccgct ggagcacccc gtgacggggcg agccagccac 900 gtggatgacc ttcctcatct cctactgggg tgagcagatc ggacagaga tccgcaagat 960 cacggactgc ttccactgcc acgtcttccc gtttctgcag caggaggagg cccgcctcgg ggccctgcag cagctgcaac agcagagcca ggagctgcag gaggtcctcg gggagacaga gcggttcctg agccaggtgc taggccgggt gctgcagctg ctgccgccag ggcaggtgca 1140 ggtccacaag atgaaggccg tgtacctggc cctgaaccag tgcagcgtga gcaccacgca caagtgcctc attgccgagg cctggtgctc tgtgcgagac ctgcccgccc tgcaggaggc 1260 cctgcgggac agctcgatgg aggagggagt gagtgccgtg gctcaccgca tcccctgccg 1320. ggacatgccc cccacactca tccgcaccaa ccgcttcacg gccagcttcc agggcatcgt 1380 ggatgcctac ggcgtgggcc gctaccagga ggtcaacccc gctccctaca ccatcatcac 1440 cttccccttc ctgtttgctg tgatgttcgg ggatgtgggc cacgggctgc tcatgttcct 1500 cttcgccctg gccatggtcc ttgcggagaa ccgaccggct gtgaaggccg cgcagaacga 1560 gatctggcag actttcttca ggggccgcta cctgctcctg cttatgggcc tgttctccat 1620 ctacaccggc ttcatctaca acgagtgctt cagtcgcgcc accagcatct tcccctcggg 1680 ctggagtgtg gccgccatgg ccaaccagtc tggctggagt gatgcattcc tggcccagca 1740 cacgatgctt accctggacc ccaacgtcac cggtgtcttc ctgggaccct acccctttgg 1800 catcgatcct atttggagcc tggctgccaa ccacttgagc ttcctcaact ccttcaagat 1860 gaagatgtcc gtcatcctgg gcgtcgtgca catggccttt ggggtggtcc tcggagtctt 1920 caaccacgtg cactttggcc agaggcaccg gctgctgctg gagacgctgc cggagctcac 1980 cttcctgctg ggactcttcg gttacctcgt gttcctagtc atctacaagt ggctgtgtgt 2040 ctgggctgcc agggccgcct cggcccccag catcctcatc cacttcatca acatgttcct 2100 cttctcccac agccccagca acaggctgct ctacccccgg caggaggtgg tccaggccac 2160 gctggtggtc ctggccttgg ccatggtgcc catcctgctg cttggcacac ccctgcacct 2220 gctgcaccgc caccgccgcc gcctgcggag gaggcccgct gaccgacagg aggaaaacaa 2280 ggccgggttg ctggacctgc ctgacgcatc tgtgaatggc tggagctccg atgaggaaaa 2340 ggcagggggc ctggatgatg aaggaggc cgagctcgtc ccctccgagg tgctcatgca 2400 ccaggccatc cacaccatcg agttctgcct gggctgcgtc tccaacaccg cctctacct 2460 gcgcctgtgg gccctgagcc tggcccacgc ccagctgtcc gaggttctgt gggccatggt 2520 gatgcgcata ggcctgggcc tgggccggga ggtgggcgtg gcggctgtgg tgctggtccc 2580 catctttgcc gcctttgccg tgatgaccgt ggctatcctg ctggtgatgg agggactctc 2640 agccttcctg cacgccctgc ggctccactg ggtggaattc cagaacaagt tctactcagg 2700 cacgggctac aagctgagtc ccttcacctt cgctgccaca gatgactagt aagtcgacgg 2760 atcccccggg ctgcaggaat tcgagcatct taccgccatt tatacccata tttgttctgt 2820 ttttcttgat ttgggtatac atttaaatgt tataaaaca aaatggtggg gcaatcattt 2880 acatttttag ggatatgtaa ttactagttc aggtgtattg ccacaagaca aacatgttaa 2940 gaaactttcc cgttatttac gctctgttcc tgttaatcaa cctctggatt acaaaatttg 3000 tgaaagattg actgatattc ttaactatgt tgctcctttt acgctgtgtg gatatgctgc 3060 tttaatgcct ctgtatcatg ctattgcttc cgtacggct ttcgttttct cctccttgta 3120 taaatcctgg ttgctgtctc tttatgagga gttgtggccc gttgtccgtc aacgtggcgt 3180 ggtgtgctct gtgtttgctg acgcaacccc cactggctgg ggcattgcca ccacctgtca 3240 actccttct gggactttcg ctttccccct cccgatcgcc acggcagaac tcatcgccgc 3300 ctgccttgcc cgctgctgga caggggctag gttgctgggc actgaaatt ccgtggtgtt 3360 gtcggggaag ctgacgtcct ttcgaattcg atatcaagct gtacctttaa gaccaatgac 3420 ttacaaggca gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct 3480 aattcactcc caacgaagac aagatctgct ttttgcttgt actgggtctc tctggttaga 3540 ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata 3600 aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta 3660 gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca 3720 tcttattatt cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt 3780 gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa 3840 agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca 3900 tgtctggctc tagctatccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt 3960 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc 4020 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggtagc 4080 ccgcctaatg agcgggcttt tttttcttag gccttcttcc gcttcctcgc tcactgactc 4140 gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 4200 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 4260 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 4320 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 4380 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 4440 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 4500 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 4560 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 4620 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 4680 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 4740 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 4800 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 4860 tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 4920 tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 4980 cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 5040 aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 5100 atttcgttca tccatagttg cctgactcct gcaaaccacg ttgtggtaga attggtaaag 5160 agagtcgtgt aaaatatcga gttcgcacat cttgttgtct gattattgat ttttggcgaa 5220 accatttgat catatgacaa gatgtgtatc taccttaact taatgatttt gataaaaatc 5280 attaggtacc tgtacattta tattggctca tgtccaacat taccgccatg ttgacattga 5340 ttattgacta gttattaata gtaatcaatt acggggtcat tagttcatag cccatatatg 5400 gagttccgcg ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc 5460 cgcccattga cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat 5520 tgacgtcaat gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat 5580 catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat 5640 gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc 5700 gctattacca tggtgatgcg gttttggcag tacatcaatg ggcgtggata gcggtttgac 5760 tcacggggat ttccaagtct ccaccccatt gacgtcaatg ggagtttgtt ttggcaccaa 5820 aatcaacggg actttccaaa atgtcgtaac aactccgccc cattgacgca aatgggcggt 5880 aggcgtgtac ggtgggaggt ctatataagc agagctcgtt tagtgaaccg gggtctctct 5940 ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca ctgcttaagc 6000 ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg 6060 gtaactagag atccctcaga cccttttagt cagtgtggaa aatctctagc agtggcgccc 6120 gaacagggac ttgaaagcga aagggaaacc agaggagctc tctcgacgca ggactcggct 6180 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 6240 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 6300 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 6360 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 6420 agaaacatca gaaggctgta gaaacat gggacagcta caccaccc ttcagacagg 6480 atcagagaa cttagatcat tatatatac agtagcaacc ctctattgtg tgcatcaaag 6540 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 6600 taagaccacc gcacagcaag cggccgctga tcttcagacc tggagga gatatgaggg 6660 acaatggag aagtgatta tataatata aagtagtaa attgaacca ttaggagtag 6720 cacccaccaa ggcaaagaga agagtggtgc aggagaaaa agagcagtg ggataggag 6780 ctttgttcct tgggttctg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 6840 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 6900 gggctattga ggcgcacag catctgttgc aactcacagt ctggggcatc aagcagctcc 6960 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 7020 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gatgctagt tggagtaata 7080 aatctctgga acagatttgg aatcacacga cctggatgga gtgggacaga gaaattaaca 7140 attacacaag cttaatacac tccttaattg aagaatcgca aaaccagcaa gaaaagaatg 7200 aacaagaatt attggaatta gataaatggg caagtttgtg gaattggttt aacataacaa 7260 attggctgtg gtatataaa ttatcataa tgatagtagg aggcttggta ggtttaagaa 7320 tagtttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 7380 ttcagaccca cctcccaacc ccgaggggac ccgacaggcc cgaaggaata gaagaagaag 7440 gtggagagag agacagagac agatccattc gattagtgaa cggatctcga cggtatcggt 7500 taacttttaa aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca 7560 taatagcaac agacatacaa actaaagaat tacaaaaaca aattacaaaa attcaaaatt 7620 ttatcgatca cgagactagc ctcgag 7646 <210> 28 <211> 234 <212> DNA <213> human immunodeficiency virus <400> 28 tggaagggct aattcactcc caacgaagac aagatctgct tttgcttgt actgggtctc 60 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 120 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 180 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agca 234 <210> 29 <211> 132 <212> DNA <213> Simian virus 40 <400> 29 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120 tatcatgtct gg 132 <210> 30 <211> 160 <212> DNA <213> Simian virus 40 <400> 30 tcccgccct aactccgcc atcccgccc taactccgcc cagttccgcc cattctccgc 60 cccatggctg actaattttt tttattatg cagaggccga ggccgcctcg gcctctgagc 120 tattccagaa gtagtgagga ggctttttg gaggcctagg 160 <210> 31 <211> 1015 <212> DNA <213> Artificial Sequence <220> <223> Made in Lab <400> 31 tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 60 tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 120 aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 180 tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 240 tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 300 cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 360 agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 420 tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 480 aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 540 ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 600 cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct gaagccagtt 660 accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 720 ggttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 780 ttgatcttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 840 gtcatgagat tatcaaaaag gatcttcacc tagatcctttt taaattaaaa atgaagtttt 900 aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 960 gaggcaccta tctcagcgat ctgtctattt cgtcatcca tagttgcctg actcc 1015 <210> 32 <211> 139 <212> DNA <213> Escherichia coli <400> 32 gtagaattgg taaagagagt cgtgtaaaat atcgagttcg cacatcttgt tgtctgatta 60 ttgatttttg gcgaaaccat ttgatcatat gacaagatgt gtatctacct taacttaatg 120 attttgataa aatcatta 139 <210> 33 <211> 577 <212> DNA <213> Human betaherpesviruses 5 <400> 33 acattgatta tgactagtt attatagta atchattacg gggtcattag ttcatagccc 60 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgccca 120 cgacccccgc ccattgacgt caataatgac gtagttccc atagtaacgc caatagggac 180 tttccattga cgtcaatggg tggatttt acggtaaact gcccacttgg cagtacatca 240 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 300 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tcacgtatt 360 agtcatcgct attaccatgg tgatgcggtt tggcagtac atcaatgggc gtggatagcg 420 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg 480 gcaccaaaat caacgggact ttccaaatg tcgtaacaac tccgccccat tgacgcaat 540 gggcggtagg cgtgtacggt gggaggtcta tataagc 577 <210> 34 <211> 188 <212> DNA <213> human immunodeficiency virus <400> 34 gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact 60 gcttaagcct caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg 120 tgactctggt aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag 180 tggcgcc 188 <210> 35 <211> 45 <212> DNA <213> Human immunodeficiency virus 1 <400> 35 tgagtacgcc aaaaatttg actagcggag gctagaagga gagag 45 <210> 36 <211> 362 <212> DNA <213> human immunodeficiency virus <400> 36 atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgcgatgg gaaaaattc 60 ggttaaggcc agggggaaag aaaaataata aattaaaaca tatagtatgg gcaagcaggg 120 agctagaacg attcgcagtt aatcctggcc tgttagaaac atcagaaggc tgtagacaaa 180 tactgggaca gctacaacca tcccttcaga caggatcaga agaacttaga tcattatata 240 atacagtagc aaccctct tgtgtgcatc aaaggataga gataaagac accaaggaag 300 ctttagacaa gagagaga gagacaaca aaagtagac caccgcacag caagcggccg 360 ct 362 <210> 37 <211> 858 <212> DNA <213> Artificial Sequence <220> <223> Made in Lab - plasmid element <400> 37 gatcttcaga cctggaggag gagatatgag ggacaatttgg agagtgaat tataata 60 taaagtagta aaattgaac cattaggagt agcacccacc aaggxaag gagagtggt 120 gcagagagaa aaagagcag tgggaatagg agctttgttc cttggttct tgggagcagc 180 aggaagcact atgggcgcag cgtcaatgac gctgacggta caggccagac aattattgtc 240 tggtatagtg cagcagcaga acaatttgct gaggctatt gaggcgcaac agcatctgtt 300 gcaaccaca gtctggggca tcaagcagct ccaggcaaga atcctggctg tggaagata 360 cctaaaggat cacagctcc tgggatttg gggttgctct ggaaaactca tttgcaccac 420 tgctgtgcct tggaatgcta gttggagtaa taaatctctg gaacagattt ggaatcacac 480 gacctggatg gagtgggaca gagaaattaa caattacaca agcttaatac actccttaat 540 tgaagaatcg caaaaccagc aagaaaagaa tgaacaagaa ttattggaat tagataaatg 600 ggcaagtttg tggaattggt ttaacataac aaattggctg tggtataataa aattattcat 660 aatgatagta ggaggcttgg taggtttaag aatagttttt gctgtacttt ctatagtgaa 720 tagagttagg cagggatatt caccattatc gtttcagacc cacctcccaa ccccgagggg 780 acccgacagg cccgaaggaa tagaagaaga aggtggagag agagacagag acagatccat 840 tcgattagtg aacggatc 858 <210> 38 <211> 118 <212> DNA <213> human immunodeficiency virus <400> 38 ttttaaaaga aaagggggga ttgggggta cagtgcaggg gaaagaatag tagacataat 60 agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttt 118 <210> 39 <211> 3847 <212> DNA <213> Artificial Sequence <220> <223> Made in lab - plasmid backbone construct <400> 39 60. aacttgttta ttgcagctta taatggttac aaataagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 180. tatcatgtct ggctctagct atcccgcccc taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg 240 aggccgcctc ggcctctgag ctattccaga agtagggg aggctttttt ggaggcctag 300. gtagcccgcc taatgagcgg gcttttttttt cttaggcctt cttccgcttc ctcgctcact 360 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 420 atacggttat ccacagaatc aggggatac gcaggaaga acatgtgagc aaaaggccag 540. ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 660 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 720 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 780 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 840 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 900 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 960 agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 1020 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 1080 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 1140 gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 1200 atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat 1260 gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc 1320 tgtctattc gttcatccat agttgcctga ctcctgcaaa ccacgttgtg gtagaattgg 1380 taaaagagat cgtgtaaaat atcgagttcg cacatcttgt tgtctgatta ttgatttttg 1440 gcgaaacat ttgatcatat gacaagatgt gtatctacct taacttaatg attttgataa 1500 aaatcattag gtacctgtac atttatattg gctcatgtcc aacattaccg ccatgttgac 1560 attgattatt gactagttat taatagtaat caattacggg gtcattagtt catagcccat 1620 atatggagtt ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg 1680 acccccgcc attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt 1740 tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag 1800 tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc 1860 attatgccca gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag 1920 tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt 1980 ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc 2040 accaaaatca acgggacttt ccaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata tagcagagc tcgtttagtg aaccggggtc 2160 tctctggtta gaccagatct gagcctggga gctctctggc taactaggga acccactgct tagcctcaa taaagcttgc cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac taggatccc tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta gaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg ggaaaaaatt cggttaaggc caggggaaa gaaaaaatat aaattaaaac atatagtatg ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg ctgttagaaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag atcattatat aatacagtag caaccctcta ttgtgtgcat aaaaaaaaaaaaaaaaaaaaaaaaaaaaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac 2820 aaaagtaaga ccaccgcaca gcaagcggcc gctgatcttc agacctggag gaggagat 2880 gaggacaat tggagtg aattatataa ataataagta gtaaaaattg aaccattagg 2940 agtagcaccc accaaggca agaagagt ggtgcagaga gaaaaaagg cagtgggaat 3000 aggagctttg ttccttgggt tcttgggagc agcaggaagc actatggggcg cagcgtcaat 3060 gacgctgacg gtacaggcca gandattatt gtctggtata gtgcagcagc agaacaattt 3120 gctgaggggct attgaggcgc aacagcatct gttgcaactc acagctggg gcatcaagca 3180 gctccaggca agaatcctgg ctgtggaaag atacctaag gatcacagc tcctggggt 3240 ttggggttgc tctggaaac tcatttgcac cactgctgtg ccttggaatg ctagttggag 3300 tataaatct ctggaacaga tttggaatca cacgacctgg atggagtggg acagagaaat 3360 taacaattac acaagcttta tacactcctt attgagaa tcgcaaacc agcaaaaa 3420 gatgaacaa gatttattgg aattagaata atgggcaagt ttgtggaatt ggtttaacat 3480 aacaaattgg ctgtggtata taaaattatt cataatgata gtaggaggct tggtaggttt 3540 aagaatagtt tttgctgtac tttctatagt gaatagagtt aggcagggat attcaccatt 3600 atcgtttcag acccacctcc caaccccgag gggacccgac aggcccgaag gaatagaaga 3660 agaaggtgga gagagagaca gagacagatc cattcgatta gtgaacggat ctcgacggta 3720 tcggttaact tttaaaagaa aaggggggat tggggggtac agtgcagggg aaagaatagt 3780 agacataata gcaacagaca tacaaactaa agaattacaa aaacaaatta caaaaattca 3840 aaatttt 3847

Claims

1. 1. A transfer plasmid comprising an expression cassette comprising a coding polynucleotide encoding a T cell immune regulator 1 (TCIRG1) polypeptide and a promoter, said polynucleotide being operably linked to said promoter, said transfer plasmid comprising an RNA-OUT repressor and a CMV IE promoter and a polynucleotide sharing at least 95% identity with SEQ ID NO:23, 25, or 27.

2. 2. The transfer plasmid of claim 1, wherein said RNA-OUT repressor shares at least 95% identity or at least 99% identity with SEQ ID NO:

32.

3. 3. The transfer plasmid of claim 1 or claim 2, wherein the CMV IE promoter shares at least 95% identity or at least 99% identity with SEQ ID NO:

33.

4. A transfer plasmid according to any one of claims 1 to 3, comprising a pCCL backbone.

5. 5. The transfer plasmid of claim 4, wherein the pCCL backbone shares at least 95%, at least 98%, or 100% identity with SEQ ID NO:

39.

6. The transfer plasmid of any one of claims 1 to 5, wherein the promoter is an EFS promoter.

7. 7. The transfer plasmid of claim 6, wherein the EFS promoter shares at least 95%, at least 99%, or 100% identity with SEQ ID NO:

2.

8. A transfer plasmid according to any one of claims 1 to 7, wherein the coding polynucleotide shares at least 95%, at least 99%, or 100% identity with SEQ ID NO:

3.

9. The transfer plasmid of claim 1 , wherein the TCIRG1 polypeptide shares at least 95%, at least 99%, or 100% identity with SEQ ID NO:

5.

10. 10. The transfer plasmid of claim 1, wherein the expression cassette comprises a Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE).

11. The transfer plasmid of claim 10, wherein the WPRE has at least 95%, at least 98%, or 100% identity to SEQ ID NO:

4.

12. 12. The transfer plasmid of any one of claims 1 to 11, wherein the expression cassette comprises a polynucleotide that shares at least 95%, at least 98%, or 100% identity with SEQ ID NO:

1.

13. 13. The transfer plasmid of any one of claims 1 to 12, wherein the expression cassette is flanked by a 5' long terminal repeat (LTR) and a 3' LTR, optionally wherein the 5' LTR is SEQ ID NO: 34 and / or the 3' LTR is SEQ ID NO:

28.

14. A lentiviral particle produced by transfecting a host cell with a transfer plasmid according to any one of claims 1 to 13, wherein the expression cassette comprises the polynucleotide sequence of SEQ ID NO:

1.

15. A modified cell produced by transfecting a cell with the lentiviral particle of claim 14.

16. (a) lacks an endogenous functional TCIRG1 gene; (b) derived from a subject having or suspected of having infantile malignant osteopetrosis (IMO); (c) expresses TCIRG1 at a level similar to the expression level of TCIRG1 observed in osteoclasts that have a functional TCIRG1 gene; and / or (d) expresses TCIRG1 at a level similar to that observed in osteoclasts derived from subjects who do not have or are not suspected of having IMO; The modified cell of claim 15.

17. The modified cell of any one of claims 15 to 16, which is a hematopoietic stem cell (HSC) or a CD34+ progenitor cell.

18. 18. The modified cells of claim 17, derived from HSCs isolated by apheresis from a subject having or suspected of having IMOs, optionally following mobilization of the HSCs by administration of G-CSF, plerixafor, or a combination of G-CSF and plerixafor, and optionally derived from a population of cells enriched for CD34+ cells by magnetic capture.

19. A pharmaceutical composition comprising the modified cell of any one of claims 15 to 18.

20. 1. An in vitro or ex vivo method of modifying one or more cells in a subject having or suspected of having an IMO, comprising: (a) providing peripheral blood mononuclear cells (PBMCs) mobilized from a subject by administering to the subject a composition comprising G-CSF, plerixafor, or a combination of G-CSF and plerixafor; (b) enriching CD34+ cells from the PBMCs by magnetic separation to generate a population of CD34-enriched cells; (c) isolating the CD34-enriched cells in a 5' to 3' order. (i) lentiviral 5′ long terminal repeat (LTR); (ii) an expression cassette, and (iii) lentivirus 3′LTR and contacting the lentiviral particle of claim 14 with the recombinant lentiviral genome comprising wherein the recombinant lentiviral genome is replication-incompetent.

21. 19. A pharmaceutical composition for use in a method of treating infantile malignant osteopetrosis (IMO) in a human subject having or suspected of having IMO, comprising the modified cells of any one of claims 15 to 18, wherein said method comprises autologous treatment and optionally administration of said pharmaceutical composition is performed via intravenous infusion.

22. (a) the method repopulates the HSC niche with modified cells expressing TCIRG1; (b) the method causes the engineered cells expressing TCIRG1 to repopulate the osteoclast niche; (c) the method treats, ameliorates, prevents, reduces, inhibits, or alleviates IMO; and / or (d) the method extends the average overall survival of the treated subjects by at least 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more.

22. The pharmaceutical composition of claim 21.

23. (a) the subject exhibited symptoms of IMO prior to treatment; (b) the subject is identified as having reduced or undetectable expression of TCIRG1 prior to treatment; (c) the subject has been identified as having a mutated TCIRG1 gene; and / or (b) the subject is an infant; The pharmaceutical composition according to any one of claims 21 to 22.

24. 14. A method for producing lentiviral particles comprising transfecting a packaging cell line with the transfer plasmid of any one of claims 1 to 13 and optionally one or more additional plasmids, and culturing said packaging cell line, wherein said transfer plasmid is stably propagated, and optionally wherein said transfer plasmid is stably propagated at 30-37°C in a bacterial host using shake flasks or fermentation for at least 1, 2, 3, 4, 5, 6, or 7 days.

25. 25. A lentiviral particle produced according to the method of claim 24.

Images