Modified natural killer (NK) cells for immunotherapy

Abstract

To provide modified natural killer (NK) cells for immunotherapy.SOLUTION: Provided is a modified lymphocyte that expresses at least one predetermined endogenous gene and further exhibits a loss of function of at least one predetermined target.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 806,457, filed February 15, 2019; U.S. Provisional Patent Application No. 62 / 841,066, filed April 30, 2019; U.S. Provisional Patent Application No. 62 / 841,684, filed May 1, 2019; and U.S. Provisional Patent Application No. 62 / 943,649, filed December 4, 2019, the entire contents of each of which are expressly incorporated by reference herein.

[0002] The present invention relates to modified natural killer (NK) cells for immunotherapy. [Background technology]

[0003] NK cells are useful for immunotherapeutic approaches, for example in the context of immuno-oncology. NK cells are a type of cytotoxic innate lymphoid cell. NK cells play an important role in tumor immunity, and the cytotoxic activity of NK cells is tightly controlled by a network of activating and inhibitory pathways (see, for example, Non-Patent Document 1, which is incorporated herein by reference in its entirety).

[0004] The use of naturally derived or engineered NK cells in immunotherapeutic approaches, for example via autologous or allogeneic NK cell transfer, has been reported, and while some success has been achieved, such approaches are typically characterized by suboptimal NK cell responses. In the context of immuno-oncology, this suboptimal response is believed to be, at least in part, directed against the tumor, utilizing NK cell inhibitory pathways to suppress cytotoxic NK cell activity, limit NK cell infiltration, and / or inhibit NK cell proliferation and survival. Thus, the application of NK cells in the treatment of solid tumors has met with limited success.

[0005] For example, early work is being done to focus NK cell responses to specific cells by expressing chimeric antigen receptors in NK cells that target NK cells to tumor cells, or by modulating activating or inhibitory NK cell pathways to achieve stronger and / or more sustained NK cell responses. See, e.g., J. Immunol. 1999, 144: 1111-1123 (2002); and J. Immunol. 1999, 144: 1111-1123 (2002), which are incorporated by reference in their entireties.

[0006] In pursuit of an off-the-shelf allogeneic NK cell therapy that can be used in combination with therapeutic antibodies, an induced pluripotent stem cell line has been developed in which the cells express an enhanced version of CD16 (hnCD16), and NK cells are derived from this iPSC line. See, for example, Non-Patent Document 4, which is incorporated herein by reference in its entirety. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Gras Navarro A, Bjorklund AT and Chekenya M (2015)Front.Immunol.6:202 [Non-Patent Document 2] Jing Y,et al.(2015)PLoS ONE 10(3):e0121788 [Non-Patent Document 3] Oberschmidt O, Kloess S and Koehl U (2017) Front. Immunol. 8:654 [Non-Patent Document 4] Li et al.,Cell Stem Cell.2018 Aug 2;23(2):181-192.e5 Summary of the Invention [Problem to be solved by the invention]

[0008] However, so far all these approaches have met with limited success, and therefore there remains a need for the development of better therapeutic approaches for immunotherapy. [Means for solving the problem]

[0009] Some aspects of the disclosure provide compositions, cells, cell populations, methods, strategies, and therapies useful in the context of immunotherapeutic approaches, such as, for example, immuno-oncological therapeutic approaches. In some embodiments, the disclosure provides modified NK cells (or other lymphocytes) useful in NK cell therapy, such as, for example, in the context of immunotherapeutic approaches. In some embodiments, the cells and cell populations provided herein are characterized by one or more modifications that enhance their efficacy in immunotherapeutic approaches. For example, in some embodiments, NK cells are provided that comprise one or more modifications that result in loss of function of a gene or protein associated with inhibition of NK cell function in a therapeutic context, and / or one or more modifications that result in expression of an exogenous nucleic acid or protein associated with enhanced NK cell function in a therapeutic context. In some embodiments, the disclosure provides modified NK cells derived from induced pluripotent cells (iPSCs). NK cells derived from iPSCs are also referred to herein as iNK cells. In some embodiments, modified iNK cells are provided that are derived from somatic cells, such as, for example, but not limited to, fibroblasts, peripheral blood cells, or developmentally mature T cells (T cells that have undergone thymic selection). In some embodiments, the NK or iNK cells provided herein comprise one or more genomic edits, such as, for example, indels or insertions of exogenous nucleic acid constructs resulting from cleaving a genomic locus with an RNA-guided nuclease. The use of RNA-guided nuclease technology in the context of generating modified NK and iNK cells allows for the engineering of complex modifications with enhanced properties relevant to clinical applications.

[0010] Some aspects of the present disclosure provide NK cells with complex editing strategies, and consequently complex genomic modifications, that allow for the generation of advanced NK cell products for clinical applications, such as, for example, immuno-oncology therapeutic approaches. In some embodiments, the modified NK cells provided herein may serve as an off-the-shelf clinical solution for patients with or diagnosed with a hyperproliferative disease, such as, for example, cancer. In some embodiments, the modified NK cells exhibit enhanced survival, proliferation, NK cell response level, NK cell response duration, resistance to NK cell depletion, and / or target recognition, as compared to non-modified NK cells. For example, the modified NK cells provided herein may comprise genomic edits that result in expression of a chimeric antigen receptor (CAR) of interest, such as, for example, a CAR targeting mesothelin, EGFR, HER2, and / or MICA / B; expression of a CD16 variant, such as, for example, a non-naturally occurring CD16 variant such as hnCD16 (see, for example, Zhu et al., Blood 2017, 130:4452, the contents of which are incorporated herein by reference in their entirety); expression of an IL15 / IL15RA fusion; loss of function of TGFβ receptor 2 (TGFβR2); and / or expression of a dominant negative variant of TGFβR2; loss of function of ADORA2A; loss of function of B2M; expression of HLA-G; loss of function of CIITA; loss of function of PD1; loss of function of TIGIT; and / or loss of function of CISH; or any combination of two or more thereof, in the modified NK cell. In one embodiment, the modified NK cell comprises genomic edits that result in loss of function of TGFβR2 and loss of function of CISH. In one embodiment, the modified NK cell comprises a genomic edit that results in a loss of function of TGFβR2 and a loss of function of TIGIT. In one embodiment, the modified NK cell comprises a genomic edit that results in a loss of function of TGFβR2 and a loss of function of ADORA2A. In one embodiment, the modified NK cell comprises a genomic edit that results in a loss of function of TGFβR2 and a loss of function of NKG2A. In one embodiment, the modified NK cell comprises a genomic edit that results in a loss of function of CISH and a loss of function of TIGIT.In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of CISH and a loss of function of ADORA2A. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of CISH and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of TIGIT and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of ADORA2A and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of TIGIT. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of ADORA2A. In one embodiment, the modified NK cells comprise a genomic edit that results in a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of ADORA2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of TGFβR2, a loss of function of ADORA2A, and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of CISH, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of CISH, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of CISH, a loss of function of ADORA2A, and a loss of function of NKG2A. In one embodiment, the modified NK cells comprise genomic edits that result in a loss of function of TIGIT, a loss of function of ADORA2A, and a loss of function of NKG2A.

[0011] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0012] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, expression of soluble MICA and / or MICB, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0013] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an exogenous IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, expression of soluble MICA and / or MICB, expression of exogenous IL-12, expression of exogenous IL-18, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0014] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, expression of exogenous IL-12, expression of exogenous IL-18, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0015] In one aspect, the disclosure features an engineered lymphocyte, the engineered lymphocyte does not express endogenous CD3, CD4, and / or CD8; and expresses at least one endogenous gene encoding: (i) CD56 (NCAM), CD49, and / or CD45; (ii) an NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) a natural cytotoxicity receptor; or any combination of two or more thereof, the engineered lymphocyte further comprising: (1) (i) a chimeric antigen; (ii) a non-naturally occurring variant of the immunoglobulin gamma Fc domain receptor III (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) interleukin 12 receptor (IL-12R), or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) a nucleic acid sequence encoding a leukocyte surface antigen cluster of differentiation (LEA) receptor (CAR); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CpG2); and / or (2) at least one exogenous nucleic acid construct encoding: (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen alpha chain genes, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof. In one embodiment, the modified lymphocyte exhibits a loss of function of TGFβR2 and a loss of function of CISH.In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH and a loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TIGIT and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of ADORA2A and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of ADORA2A, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of ADORA2A, and a loss of function of NKG2A, hi one embodiment, the modified lymphocytes exhibit a loss of function of TIGIT, a loss of function of ADORA2A, and a loss of function of NKG2A.

[0016] In one embodiment, the modified lymphocyte does not express endogenous CD3, CD4, and / or CD8; and expresses at least one endogenous gene encoding: (i) CD56 (NCAM), CD49, and / or CD45; (ii) an NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) a native cytotoxicity receptor; or any combination of two or more thereof, and the modified lymphocyte further expresses: (1) (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of immunoglobulin gamma Fc region receptor III (FcγRIII, CD16); (iii) interleukin 15 (IL-15); ( (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) interleukin-12 receptor (IL-12R), or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) a nucleic acid sequence encoding the leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof, and / or (2) exhibits a loss of function of transforming growth factor beta receptor 2 (TGFβR2), cytokine-inducible SH2-containing protein (CISH), or a combination thereof.

[0017] In some embodiments, the nucleic acid construct is an expression construct comprising a nucleic acid sequence encoding a gene product listed in (1)(i)-(1)(ix), or any combination thereof, operably linked to a promoter that drives expression of the nucleic acid sequence in a target cell, e.g., in an engineered lymphocyte, e.g., an engineered NK cell, provided herein. In some embodiments, the promoter is specifically expressed in the target cell, e.g., the promoter is a lymphocyte or NK cell specific promoter. In some embodiments, the promoter is a CD56 (NCAM) promoter. In some embodiments, the promoter is a CD49 promoter. In some embodiments, the promoter is a CD45 promoter. In some embodiments, the promoter is an FcγRIII promoter. In some embodiments, the promoter is an NKG2D promoter. In some embodiments, the promoter is a CD69 promoter.

[0018] In some embodiments, an exogenous nucleic acid construct encoding a gene product listed in (1) is knocked into a genomic locus encoding a gene product listed in (2), resulting in loss of function of the gene product listed in (2) and expression of the gene product encoded by the exogenous nucleic acid construct driven by a heterologous promoter or by an endogenous promoter of the genomic locus into which the exogenous nucleic acid construct is knocked in.

[0019] In some embodiments, an exogenous nucleic acid construct encoding a gene product listed in (1) is knocked into a "safe harbor" locus, such as, for example, the ROSA26 locus, the collagen locus, or the AAVSI genomic locus.

[0020] In some embodiments, the two or more HLA class II histocompatibility antigen alpha chain genes are selected from HLA-DQA1, HLA-DRA, HLA-DPA1, HLA-DMA, HLA-DQA2, and HLA-DOA. In some embodiments, the two or more HLA class II histocompatibility antigen beta chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5.

[0021] In some embodiments, the engineered lymphocyte comprises a rearranged endogenous T cell receptor (TCR) locus, in some embodiments, the rearranged TCR comprises a rearrangement of a TCRαVJ and / or a TCRβV(D)J section and a complete V domain exon.

[0022] In some embodiments, the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

[0023] In some embodiments, the IL-15R variant is a constitutively active IL-15R variant. In some embodiments, the constitutively active IL-15R variant is a fusion between IL-15R and an IL-15R agonist, such as, for example, an IL-15 protein or an IL-15R-binding fragment thereof. In some embodiments, the IL-15R agonist is IL-15, or an IL-15R-binding variant thereof. Exemplary suitable IL-15R variants include, but are not limited to, those described in, for example, Mortier E et al, 2006; The Journal of Biological Chemistry 2006 281:1612-1619; or Bessard-A et al., Mol Cancer Ther. 2009 Sep;8(9):2736-45, the entire contents of each of which are incorporated herein by reference. Additional suitable variants will be apparent to one of skill in the art based on this disclosure and knowledge in the art. The disclosure is not limited in this respect.

[0024] In some embodiments, the TGFβR2 is a dominant-negative mutant of TGFβ receptor II (DN-TGFβR2).

[0025] In some embodiments, the CAR is capable of binding to mesothelin, EGFR, HER2, MICA / B, BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptides (i.e. E7), EBV viral peptides, CD70, WT1, CEA, EGFRvIII, IL13Rα2, GD2, CA125, CD7, EpCAM, Muc16, and / or CD30.

[0026] In some embodiments, the modified lymphocytes are derived from pluripotent or multipotent stem cells. In some embodiments, the pluripotent stem cells are hematopoietic stem cells (HSCs). In some embodiments, the pluripotent stem cells are induced pluripotent stem cells (iPSCs). In some embodiments, the pluripotent stem cells are embryonic stem cells (ESCs).

[0027] In some embodiments, the modified lymphocytes are derived from pluripotent or multipotent stem cells that comprise at least one or more exogenous nucleic acid constructs encoding any of (1)(i)-(1)(ix), or any combination thereof; and / or at least one genomic modification that results in a loss-of-function of any of (2)(i)-(2)(xi), or any combination thereof, in the lymphocyte.

[0028] In some embodiments, the modified lymphocytes are derived from pluripotent or multipotent stem cells that comprise at least one genomic modification that results in a loss of function of any of (2)(i)-(2)(xi), or any combination thereof, in the lymphocyte.

[0029] In some embodiments, at least one genomic modification that results in one or more of (2)(i)-(2)(xi) loss of function in a lymphocyte comprises insertion of an exogenous nucleic acid construct.

[0030] In some embodiments, the exogenous nucleic acid construct encodes any of (1)(i)-(1)(ix), or any combination thereof.

[0031] In some embodiments, the engineered lymphocytes exhibit loss of function of two or more of the genes / proteins listed in (2).

[0032] In some embodiments, the engineered lymphocyte comprises an indel or insertion of an exogenous nucleotide construct into a genomic locus harboring a gene or encoding a protein of (2).

[0033] In some embodiments, the engineered lymphocytes comprise an indel or insertion of an exogenous nucleotide construct into a genomic locus that harbors two or more (2) genes or encodes proteins.

[0034] In some embodiments, the modified lymphocytes are obtained by editing a genomic locus with an RNA-guided nuclease. In some embodiments, the RNA-guided nuclease is a CRISPR / Cas nuclease. In some embodiments, the RNA-guided nuclease is selected from the group consisting of SpCas9, SaCas9, (KKH)SaCas9, AsCpf1 (AsCas12a), LbCpf1, (LbCas12a), CasX, CasY, Cas12h1, Cas12i1, Cas12c1, Cas12c2, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, AaCas12b, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9, BhCas12b, and BhCas12b V4.

[0035] In some embodiments, the modified lymphocytes are obtained by editing two or more genomic loci carrying genes encoding any of the (2) proteins. In some embodiments, at least two of the two or more genomic loci carrying genes encoding any of the (2) proteins are edited by different RNA-guided nucleases. In some embodiments, at least one of the two or more genomic loci carrying genes encoding any of the (2) proteins is edited by Cas9 and at least one of the loci is edited by Cpf1.

[0036] In some embodiments, the modified lymphocytes express endogenous CD56, CD49, and CD45.

[0037] In some embodiments, the modified lymphocytes are natural killer (NK) cells.

[0038] In another aspect, the disclosure features an engineered cell, the engineered cell comprising: (1) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of immunoglobulin gamma Fc domain receptor III (FcγRIII, cluster of differentiation 16 (CD16)); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R), or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) a site-specific exogenous nucleic acid construct encoding the leukocyte surface antigen cluster of differentiation (LA-E); (ix) leukocyte surface antigen cluster of differentiation (CD47) (CD47); or any combination of two or more thereof, and / or (2) (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) a site-specific exogenous nucleic acid construct encoding the leukocyte surface antigen cluster of differentiation (LA-E); (ix) leukocyte surface antigen cluster of differentiation (LA-E); or any combination of two or more thereof, (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen alpha chain genes, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof. In one embodiment, the modified cells exhibit a loss of function of TGFβR2 and a loss of function of CISH. In one embodiment, the modified cells exhibit a loss of function of TGFβR2 and a loss of function of TIGIT. In one embodiment, the modified cells exhibit a loss of function of TGFβR2 and a loss of function of ADORA2A. In one embodiment, the modified cells exhibit a loss of function of TGFβR2 and a loss of function of NKG2A. In one embodiment, the modified cells exhibit a loss of function of CISH and a loss of function of TIGIT. In one embodiment, the modified cells exhibit a loss of function of CISH and a loss of function of ADORA2A.In one embodiment, the modified cells exhibit a loss of function of CISH and a loss of function of NKG2A. In one embodiment, the modified cells exhibit a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified cells exhibit a loss of function of TIGIT and a loss of function of NKG2A. In one embodiment, the modified cells exhibit a loss of function of ADORA2A and a loss of function of NKG2A. In one embodiment, the modified cells exhibit a loss of function of TGFβR2, a loss of function of CISH and a loss of function of TIGIT. In one embodiment, the modified cells exhibit a loss of function of TGFβR2, a loss of function of CISH and a loss of function of ADORA2A. In one embodiment, the modified cells exhibit a loss of function of TGFβR2, a loss of function of CISH and a loss of function of NKG2A. In one embodiment, the modified cells exhibit a loss of function of TGFβR2, a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified cells exhibit a loss of function of TGFβR2, a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified cells exhibit a loss of function of TGFβR2, a loss of function of TIGIT and a loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified cells exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of CISH, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of TIGIT, loss of function of ADORA2A, and loss of function of NKG2A.

[0039] In one embodiment, the engineered cell comprises at least one exogenous nucleic acid construct encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of immunoglobulin gamma Fc region receptor III (FcγRIII, cluster of differentiation 16 (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R), or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) exhibits a loss of function of transforming growth factor beta receptor 2 (TGFβR2), cytokine-inducible SH2-containing protein (CISH), or a combination thereof.

[0040] In some modified cell embodiments, the exogenous nucleic acid construct comprising an exogenous nucleic acid construct, e.g., an modified lymphocyte provided herein, is an expression construct comprising a nucleic acid sequence encoding a gene product listed in (1)(i) through (1)(x), operably linked to a promoter that drives expression of the nucleic acid sequence in a target cell, e.g., in a modified lymphocyte, e.g., an modified NK cell provided herein. In some embodiments, the promoter is specifically expressed in the target cell, e.g., the promoter is a lymphocyte or NK cell specific promoter. In some embodiments, the promoter is a CD56 (NCAM) promoter. In some embodiments, the promoter is a CD49 promoter. In some embodiments, the promoter is a CD45 promoter. In some embodiments, the promoter is an FcγRIII promoter. In some embodiments, the promoter is an NKG2D promoter. In some embodiments, the promoter is a CD69 promoter.

[0041] For example, in some embodiments of engineered cells, such as engineered lymphocytes, provided herein, an exogenous nucleic acid construct encoding a gene product listed in (1) is knocked into a genomic locus encoding a gene product listed in (2), resulting in loss of function of the gene product listed in (2) and expression of the gene product encoded by the exogenous nucleic acid construct driven by a heterologous promoter or by an endogenous promoter of the genomic locus into which the exogenous nucleic acid construct is knocked in.

[0042] In some embodiments, modified cells, e.g., modified lymphocytes provided herein, comprise a loss of function in two or more HLA class II histocompatibility alpha chain genes, and / or two or more HLA class II histocompatibility beta chain genes, selected from HLA-DQA1, HLA-DRA, HLA-DPA1, HLA-DMA, HLA-DQA2, and HLA-DOA. In some embodiments, the two or more HLA class II histocompatibility beta chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5.

[0043] In some embodiments, the modified cell is an immune cell. In some embodiments, the immune cell is a lymphocyte. In some embodiments, the lymphocyte is a NK cell. In some embodiments, the lymphocyte is an iNK cell.

[0044] In some embodiments, the modified cells are pluripotent or multipotent stem cells, such as, for example, iPS cells, or hematopoietic stem cells, or differentiated cells derived from such pluripotent or multipotent stem cells, such as, for example, iNK cells.

[0045] In some embodiments, the engineered cells do not express endogenous T cell co-receptors.

[0046] In some embodiments, the lymphocytes are T cells.

[0047] In some embodiments, the engineered cell comprises a rearranged endogenous TCR locus, wherein the rearranged TCR comprises a rearrangement of the TCRαVJ and / or TCRβV(D)J sections and all V-domain exons.

[0048] In some embodiments, the engineered cells express at least one endogenous gene encoding: (i) CD56 (NCAM), CD49, and / or CD45; (ii) NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) a natural cytotoxicity receptor; or any combination of two or more thereof.

[0049] In some embodiments, the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

[0050] In some embodiments, the modified cells express at least one NK cell biomarker, hi some embodiments, the NK cell biomarker is CD56, CD49, and / or CD45.

[0051] In one aspect, disclosed herein is a cell population comprising a modified lymphocyte as described herein, or a modified cell as described herein.

[0052] In one aspect, disclosed herein is a pharmaceutical composition comprising the cell populations disclosed herein.

[0053] In another aspect, the present disclosure provides an isolated population of lymphocytes, the population comprising at least 1×10 3 , at least 1 × 10 4 , at least 1 × 10 5 , at least 2 × 10 5 , at least 3 × 10 5 , at least 4 × 10 5, at least 5 × 10 5 , at least 1 × 10 6 , at least 2 × 10 6 , at least 3 × 10 6 , at least 4 × 10 6 , at least 5 × 10 6 , at least 1 × 10 7 , at least 1 × 10 7 , at least 2 × 10 7 , at least 3 × 10 7 , at least 4 × 10 7 , at least 5 × 10 7 , at least 1 × 10 8 , at least 2 × 10 8 , at least 3 × 10 8 , at least 4 × 10 8 , at least 5 × 10 8 , at least 1 × 10 9 , at least 1 × 10 9 , at least 2 × 10 9 , at least 3 × 10 9 , at least 4 × 10 9 , at least 5 × 10 9 , at least 1 × 10 10 , at least 2 × 10 10 , at least 3 × 10 10 , at least 4 × 10 10 , at least 5 × 10 10 , at least 1 × 10 11 , or at least 1 × 10 12(c) express endogenous CD56 (NCAM), CD49, and / or CD45; (d) express (i) a NK cell receptor (cluster of differentiation 16 (CD16)); (ii) a NK cell receptor (cluster of differentiation 16 (CD16)); (iii) a NK cell receptor (cluster of differentiation 16 (CD16)); (iv) a NK cell receptor (cluster of differentiation 16 (CD16)); or (v) a NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group 2 member D (NKG2D); (iii) CD69; (iv) a native cytotoxicity receptor; or any combination of two or more thereof, and the modified lymphocytes are further in a population expressing at least one endogenous gene encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of immunoglobulin gamma Fc region receptor III (FcγRIII, CD16); (iii) interleukin-15 (IL-15); (iv) an IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin-12 (IL (vi) IL-12 receptor (IL-12R), or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) at least one exogenous nucleic acid construct encoding: (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIG IT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) cluster of differentiation 32B (CD32B,(xi) T-cell receptor alpha constant (TRAC); or any combination of two or more thereof. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of CISH. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2 and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH and a loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TIGIT and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TIGIT and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of ADORA2A and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of CISH, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of TGFβR2, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of TIGIT, and a loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of TIGIT, and a loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit a loss of function of CISH, a loss of function of ADORA2A, and a loss of function of NKG2A. In one embodiment,The engineered lymphocytes exhibit loss of function of TIGIT, loss of function of ADORA2A, and loss of function of NKG2A.

[0054] In one embodiment, the isolated population of muscle cells comprises at least 1×10 3 , at least 1 × 10 4 , at least 1 × 10 5 , at least 2 × 10 5 , at least 3 × 10 5 , at least 4 × 10 5 , at least 5 × 10 5 , at least 1 × 10 6 , at least 2 × 10 6 , at least 3 × 10 6 , at least 4 × 10 6 , at least 5 × 10 6 , at least 1 × 10 7 , at least 1 × 10 7 , at least 2 × 10 7 , at least 3 × 10 7 , at least 4 × 10 7 , at least 5 × 10 7 , at least 1 × 10 8 , at least 2 × 10 8 , at least 3 × 10 8 , at least 4 × 10 8 , at least 5 × 10 8 , at least 1 × 10 9 , at least 1 × 10 9 , at least 2 × 10 9 , at least 3 × 10 9 , at least 4 × 10 9 , at least 5 × 10 9 , at least 1 × 10 10 , at least 2 × 10 10 , at least 3 × 10 10 , at least 4 × 10 10 , at least 5 × 10 10 , at least 1 × 10 11 , or at least 1 × 10 12(c) express endogenous CD56 (NCAM), CD49, and / or CD45; and (d) express at least one endogenous gene encoding: (i) an NK cell receptor (cluster of differentiation 16 (CD16)); (ii) natural killer group 2 member D (NKG2D); (iii) CD69; (iv) a natural cytotoxicity receptor; or any combination of two or more thereof; (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of immunoglobulin gamma Fc region receptor III (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R), or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof, and / or (2) exhibits a loss of function of transforming growth factor beta receptor 2 (TGFβR2), cytokine-inducible SH2-containing protein (CISH), or a combination thereof.

[0055] In some embodiments, the rearranged TCR locus comprises a rearrangement of a TCR αVJ and / or a TCR βV(D)J section and a complete V domain exon, In some embodiments, the rearranged endogenous TCR locus consists of no more than two rearranged alleles.

[0056] In some embodiments, the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

[0057] In some embodiments, the ex vivo population of lymphocytes does not contain more than 1%, more than 0.1%, more than 0.001%, more than 0.0001%, more than 0.00001%, more than 0.000001%, more than 0.0000001%, more than 0.00000001%, more than 0.000000001%, more than 0.000000001%, or more than 0.00000000001% of cells expressing reprogramming factors from the exogenous nucleic acid construct.

[0058] In some embodiments, the ex vivo population of lymphocytes does not include cells expressing a reprogramming factor from an exogenous nucleic acid construct, hi some embodiments, the reprogramming factor is Oct-4 and / or Sox-2.

[0059] In some embodiments, the ex vivo population of lymphocytes does not include cells harboring an episomal expression construct encoding a reprogramming factor.

[0060] In some embodiments, each cell in the ex vivo population of lymphocytes comprises the same combination of exogenous nucleic acid constructs listed in (1) and loss-of-functions listed in (2).

[0061] In some embodiments, the ex vivo population of lymphocytes is less than 0.001%, less than 0.002%, less than 0.003%, less than 0.004%, less than 0.005%, less than 0.006%, less than 0.007%, less than 0.008%, less than 0.009%, less than 0.01%, less than 0.02%, less than 0.03%, less than 0.04%, less than 0.05%, less than 0.06%, less than 0. The translocation comprises less than 0.07%, less than 0.08%, less than 0.09%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% of cells carrying a chromosomal translocation.

[0062] In another aspect, the disclosure provides a method of treating a subject comprising administering any modified lymphocyte, any modified cell, any pharmaceutical composition, or isolated ex vivo cell population as described in this disclosure to a subject in need thereof. In some embodiments, the subject has or has been diagnosed with a proliferative disease. In some embodiments, the proliferative disease is cancer. In some embodiments, the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC), or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical and HPV+ head and neck cancers, oral cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcoma, and hematological cancers such as ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

[0063] In some embodiments, a method of generating modified lymphocytes, modified cells, cell populations, or isolated ex vivo populations of lymphocytes of the present disclosure comprises: (a) obtaining induced pluripotent stem cells (iPSCs); (b) modifying the iPSCs, or an undifferentiated or differentiated daughter cell thereof, to include expressing at least one exogenous gene of (1) and / or to include a loss-of-function of at least one gene of (2); and (c) directing differentiation of the iPSCs into hematopoietic lineage cells, wherein the hematopoietic lineage cells retain the edited locus contained in the iPSCs.

[0064] In some embodiments, the directing differentiation step comprises: (i) contacting iPSCs with a composition comprising a BMP pathway activator and optionally bFGF to obtain mesodermal cells; (ii) contacting mesodermal cells with a composition comprising a BMP pathway activator, bFGF, and a WNT pathway activator to obtain mesodermal cells with definitive hemogenic endothelial (HE) differentiation potential, wherein the mesodermal cells with definitive hemogenic endothelial (HE) differentiation potential can provide hematopoietic lineage cells; the mesodermal cells and mesodermal cells with definitive HE differentiation potential are obtained in steps (i) and (ii) without a step of forming embryoid bodies; the hematopoietic lineage cells comprise definitive hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSCs), hematopoietic multipotent progenitor cells (MPPs), pre-T cell precursors, pre-NK cell precursors, T cell precursors, NK cell precursors, T cells, NK cells, NKT cells, or B cells.

[0065] In some embodiments, directing differentiation of iPSCs into hematopoietic cells further comprises contacting mesodermal cells having definitive HE differentiation potential with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells.

[0066] In some embodiments, the step of directing differentiation further comprises contacting the definitive HE cells with a composition comprising a BMP activator, and optionally a ROCK inhibitor, and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L, and IL11, to obtain hematopoietic multipotent progenitor cells (MPPs).

[0067] In some embodiments, the step of directing differentiation further comprises contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, and IL7, and optionally one or more of a BMP activator, a ROCK inhibitor, TPO, VEGF, and bFGF, to obtain pre-T cell precursors, T cell precursors, and / or T cells.

[0068] In some embodiments, the directing differentiation step further comprises contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7, and IL15, and optionally one or more of a BMP activator, a ROCK inhibitor, VEGF, and bFGF, to obtain pre-T cell precursors, T cell precursors, and / or T cells.

[0069] In some embodiments, the method of generating modified lymphocytes, modified cells, cell populations, or isolated ex vivo populations of lymphocytes of the present disclosure further comprises, prior to step c), contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor to seed and expand the cells.

[0070] In some embodiments, the method of generating an engineered lymphocyte, engineered cell, cell population, or isolated ex vivo population of lymphocytes of the present disclosure further comprises detecting a rearranged T cell receptor (TCR) locus in a hematopoietic lineage cell. In some embodiments, the method further comprises selecting a hematopoietic lineage cell comprising a rearranged TCR locus based on a TCR encoded by the rearranged TCR locus that binds to an antigen of interest. In some embodiments, the antigen of interest is a tumor antigen.

[0071] In another aspect, the disclosure provides a method comprising: reprogramming a donor cell to a pluripotent state; editing a target locus in the donor cell genome; and differentiating the reprogrammed donor cell into a lymphocyte. In some embodiments, the editing is performed before or during the step of reprogramming the donor cell to a pluripotent state. In some embodiments, the donor cell is a fibroblast, a peripheral blood cell, a lymphocyte, or a T cell.

[0072] In another aspect, the disclosure provides a method comprising differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising: (1) a nucleic acid encoding (i) a chimeric antigen receptor (CAR); (ii) a nucleic acid encoding a non-naturally occurring variant of immunoglobulin gamma Fc region receptor III (FcγRIII, CD16); (iii) a nucleic acid encoding interleukin 15 (IL-15); (iv) a nucleic acid encoding IL-15R, or a variant thereof; (v) an IL-15R; (vi) a nucleic acid encoding IL-12R, or a variant thereof; (vii) a nucleic acid encoding human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte cluster of differentiation CD47 (CD47); or any combination of two or more thereof, and (2) an exogenous nucleic acid comprising: (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (A (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-279); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen alpha chain genes, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof, wherein the indel or insertion results in a loss of function of the gene product encoded by the respective locus. In one embodiment, the method comprises differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells comprise an indel or insertion of exogenous nucleic acid in TGFβR2 and CISH, wherein the indel or insertion results in a loss of function of the gene product encoded by TGFβR2 and / or CISH.In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2 and TIGIT, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2 and / or TIGIT. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2 and ADORA2A, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2 and / or ADORA2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2 and NKG2A, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2 and / or NKG2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or insertion of an exogenous nucleic acid in CISH and TIGIT, the indel or insertion resulting in a loss of function of a gene product encoded by CISH and / or TIGIT. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or insertion of an exogenous nucleic acid in CISH and ADORA2A, the indel or insertion resulting in a loss of function of a gene product encoded by CISH and / or ADORA2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or insertion of an exogenous nucleic acid in CISH and NKG2A, the indel or insertion resulting in a loss of function of a gene product encoded by CISH and / or NKG2A.In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TIGIT and ADORA2A, the indel or insertion resulting in a loss of function of a gene product encoded by TIGIT and / or ADORA2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TIGIT and NKG2A, the indel or insertion resulting in a loss of function of a gene product encoded by TIGIT and / or NKG2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in ADORA2A and NKG2A, the indel or insertion resulting in a loss of function of a gene product encoded by ADORA2A and / or NKG2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2, CISH, and TIGIT, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2, CISH, and / or TIGIT. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2, CISH, and ADORA2A, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2, CISH, and / or ADORA2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises an indel or insertion of exogenous nucleic acid in TGFβR2, CISH, and NKG2A, wherein the indel or insertion results in a loss of function of the gene product encoded by TGFβR2, CISH, and / or NKG2A.In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2, TIGIT, and ADORA2A, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2, TIGIT, and / or ADORA2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or an insertion of an exogenous nucleic acid in TGFβR2, TIGIT, and NKG2A, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2, TIGIT, and / or NKG2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or insertion of an exogenous nucleic acid in TGFβR2, ADORA2A, and NKG2A, the indel or insertion resulting in a loss of function of a gene product encoded by TGFβR2, ADORA2A, and / or NKG2A. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, the genetically modified pluripotent stem cell comprising an indel or insertion of an exogenous nucleic acid in CISH, TIGIT, and ADORA2A, the indel or insertion resulting in a loss of function of a gene product encoded by CISH, TIGIT, and / or ADORA2A. In one embodiment, a method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises an indel or an insertion of an exogenous nucleic acid in CISH, TIGIT, and NKG2A, wherein the indel or insertion results in a loss of function of a gene product encoded by CISH, TIGIT, and / or NKG2A. In one embodiment, a method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises an indel or an insertion of an exogenous nucleic acid in CISH, ADORA2A, and NKG2A, wherein the indel or insertion results in a loss of function of a gene product encoded by CISH, ADORA2A, and / or NKG2A.In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises an indel or insertion of exogenous nucleic acid in TIGIT, ADORA2A, and NKG2A, wherein the indel or insertion results in a loss of function of the gene product encoded by TIGIT, ADORA2A and / or NKG2A.

[0073] In some embodiments, the exogenous nucleic acid of (2) is the exogenous nucleic acid of (1). In some embodiments, the pluripotent stem cell is an iPS cell. In some embodiments, the differentiating step comprises contacting the pluripotent stem cell with a differentiation medium or a series of differentiation media.

[0074] That is, the gist of the present invention relates to the following. Item 1 (a) does not express endogenous CD3, CD4, and / or CD8; (b) (i) CD56 (NCAM), CD49, and / or CD45; (ii) NK cell receptor immunoglobulin gamma Fc region receptor III (FcγRIII, cluster of differentiation 16 (CD16)); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptors; or any combination of two or more thereof; moreover, (1) (i) Chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of FcγRIII (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) Leukocyte surface antigen differentiation antigen group CD47 (CD47); or any combination of two or more thereof, and / or (2) (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more of them The modified lymphocyte exhibits loss of at least one function of Section 2 The lymphocytes (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A 2. The modified lymphocyte of claim 1, which exhibits a loss of function of Section 3 3. The modified lymphocyte of paragraph 1 or 2, wherein the lymphocyte comprises a rearranged endogenous T cell receptor (TCR) locus. Section 4 The modified lymphocyte of paragraph 3, wherein the rearranged TCR comprises a rearrangement of a TCRαVJ and / or a TCRβV(D)J section and a complete V domain exon. Section 5 5. The modified lymphocyte of paragraph 1, 2, 3 or 4, wherein the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b. Section 6 Item 6. The modified lymphocyte of any one of Items 1 to 5, wherein the IL-15R mutant is a constitutively active IL-15R mutant and / or the IL12-R mutant is a constitutively active IL12-R mutant. Section 7 7. The modified lymphocyte of paragraph 6, wherein the constitutively active IL-15R variant is a fusion of IL-15R and an IL-15R agonist (IL-15RA) and / or the constitutively active IL-12R variant is a fusion of IL-12R and an IL-12R agonist (IL-12RA). Section 8 8. The modified lymphocyte of paragraph 7, wherein the IL-15R agonist is IL-15 or an IL-15R-binding variant thereof; and / or the IL-12R agonist is IL-12 or an IL-12R-binding variant thereof. Section 9 9. The modified lymphocyte of any one of paragraphs 1 to 8, wherein the loss of TGFβR2 is associated with exogenous expression of a dominant negative mutant form of TGFβ receptor II (DN-TGFβR2). Item 10 2. The modified lymphocyte of paragraph 1, wherein the CAR is capable of binding to mesothelin, EGFR, HER2, MICA / B, BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptide (i.e., E7), EBV viral peptide, CD70, WT1, CEA, EGFRvIII, IL13Rα2, and GD2, CA125, CD7, EpCAM, Muc16, or CD30. Section 11 Item 11. The modified lymphocyte according to any one of items 1 to 10, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell. Item 12 The modified lymphocyte of paragraph 11, wherein the pluripotent stem cell is a hematopoietic stem cell (HSC). Item 13 12. The modified lymphocyte of claim 11, wherein the pluripotent stem cell is an induced pluripotent stem cell (iPSC). Item 14 The modified lymphocyte of paragraph 11, wherein the pluripotent stem cell is an embryonic stem cell (ESC). Item 15 12. The modified lymphocyte of any one of paragraphs 1-11, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell comprising at least one or more exogenous nucleic acid constructs encoding any of (1)(i)-(1)(xi), or any combination thereof; and / or at least one genomic modification that results in a loss of function of any of (2)(i)-(2)(xi), or any combination thereof, in the lymphocyte. Section 16 16. The modified lymphocyte of claim 15, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell comprising at least one genomic modification that results in a loss of function of any of (2)(i)-(2)(xi), or any combination thereof, in the lymphocyte. Item 17 17. The modified lymphocyte of claim 15 or 16, wherein at least one genomic modification that results in a loss of function of one or more of (2)(i) to (2)(xi) in the lymphocyte comprises insertion of an exogenous nucleic acid construct. Section 18 18. The modified lymphocyte of paragraph 17, wherein the exogenous nucleic acid construct encodes any of (1)(i)-(1)(ix) or any combination thereof. Item 19 Item 19. The modified lymphocyte of any one of items 1 to 18, wherein the lymphocyte exhibits loss of function of two or more of the genes / proteins listed in (2). Item 20 20. The modified lymphocyte of any one of claims 1 to 19, wherein the lymphocyte comprises an indel or an insertion of an exogenous nucleotide construct into a genomic locus that harbors a gene or encodes a protein of (2). Section 21 21. The modified lymphocyte of any one of claims 1 to 20, wherein the lymphocyte comprises an indel or insertion of an exogenous nucleotide construct into two or more genomic loci that harbor a gene or encode a protein of (2). Section 22 22. The modified lymphocyte of any one of items 1 to 21, wherein the lymphocyte is obtained by editing a genomic locus with an RNA-guided nuclease. Section 23 23. The modified lymphocyte of claim 22, wherein the RNA-guided nuclease is a CRISPR / Cas nuclease. Section 24 23. The modified lymphocyte of claim 22, wherein the RNA-guided nuclease is selected from the group consisting of SpCas9, SaCas9, (KKH)SaCas9, AsCpf1 (AsCas12a), LbCpf1, (LbCas12a), CasX, CasY, Cas12h1, Cas12i1, Cas12c1, Cas12c2, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, AaCas12b, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9, BhCas12b, and BhCas12b V4. Section 25 Item 25. The modified lymphocyte of any one of items 1 to 24, wherein the lymphocyte is obtained by editing two or more genomic loci carrying a gene encoding any one of the proteins of (2). Section 26 26. The modified lymphocyte of claim 25, wherein at least two of the two or more genomic loci carrying a gene encoding any of the proteins of (2) are edited by different RNA-guided nucleases. Section 27 26. The modified lymphocyte of claim 25, wherein at least one of the two or more genomic loci carrying a gene encoding any of the proteins of (2) is edited by Cas9, and at least one of the loci is edited by Cpf1. Section 28 Item 28. The modified lymphocyte according to any one of items 1 to 27, wherein the modified lymphocyte expresses endogenous CD56, CD49, and CD45. Section 29 Item 30. The modified lymphocyte according to any one of Items 1 to 28, wherein the lymphocyte is a natural killer (NK) cell. Section 30 (1) (i) Chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of FcγRIII (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) Leukocyte surface antigen differentiation antigen group CD47 (CD47); or any combination of two or more thereof, and / or (2) (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof. Section 31 The modified cell comprises: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) The modified cell of paragraph 30, which exhibits loss of function of TGFβR2, CISH, and TIGIT; TGFβR2, CISH, and ADORA2A; TGFβR2, CISH, and NKG2A; TGFβR2, TIGIT, and ADORA2A; TGFβR2, TIGIT, and NKG2A; TGFβR2, ADORA2A, and NKG2A; CISH, TIGIT, and ADORA2A; CISH, TIGIT, and NKG2A; CISH, ADORA2A, and NKG2A; or TIGIT, ADORA2A, and NKG2A. Section 32 32. The modified cell of claim 30 or 31, wherein the modified cell is an immune cell. Item 33 33. The modified cell of claim 32, wherein the immune cell is a lymphocyte. Section 34 The modified cell of paragraph 33, wherein the lymphocyte is a NK cell. Item 35 31. The modified cell of paragraph 30, wherein the cell is a pluripotent stem cell or a differentiated daughter cell derived therefrom. Section 36 36. The modified cell of clause 34 or clause 35, wherein the modified cell does not express an endogenous T cell co-receptor. Section 37 34. The modified cell of paragraph 33, wherein the lymphocyte is a T cell. Section 38 The modified cell of paragraph 30, wherein the cell comprises a rearranged endogenous TCR locus, and the rearranged TCR comprises a rearrangement of a TCRαVJ and / or a TCRβV(D)J section and a complete V domain exon. Item 39 The modified cell comprises: (i) CD56 (NCAM), CD49, and / or CD45; (ii) FcγRIII (CD16); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptors; or any combination of two or more of them 39. The modified cell of any one of paragraphs 30 to 38, which expresses at least one endogenous gene encoding Section 40 40. The modified cell of paragraph 39, wherein the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b. Section 41 41. The modified cell of any one of paragraphs 30 to 40, wherein the cell expresses at least one NK cell biomarker. Section 42 The modified cell of paragraph 41, wherein the NK cell biomarker is CD56, CD49, and / or CD45. Section 43 A cell population comprising the modified lymphocyte according to any one of items 1 to 28, or the modified cell according to any one of items 30 to 42. Section 44 A pharmaceutical composition comprising the cell population described in item 43. Section 45 At least 1×10 3 , at least 1 × 10 4 , at least 1 × 10 5 , at least 2 × 10 5 , at least 3 × 10 5 , at least 4 × 10 5 , at least 5 × 10 5 , at least 1 × 10 6 , at least 2 × 10 6 , at least 3 × 10 6 , at least 4 × 10 6 , at least 5 × 10 6 , at least 1 × 10 7 , at least 1 × 10 7 , at least 2 × 10 7 , at least 3 × 10 7 , at least 4 × 10 7 , at least 5 × 107 , at least 1 × 10 8 , at least 2 × 10 8 , at least 3 × 10 8 , at least 4 × 10 8 , at least 5 × 10 8 , at least 1 × 10 9 , at least 1 × 10 9 , at least 2 × 10 9 , at least 3 × 10 9 , at least 4 × 10 9 , at least 5 × 10 9 , at least 1 × 10 10 , at least 2 × 10 10 , at least 3 × 10 10 , at least 4 × 10 10 , at least 5 × 10 10 , at least 1 × 10 11 , or at least 1 × 10 12 wherein at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, at least 99.99%, at least 99.999%, or substantially 100% of the lymphocytes are (a) comprises a rearranged T cell receptor (TCR) locus; (b) does not express endogenous CD3; (c) express endogenous CD56 (NCAM), CD49, and / or CD45; (d) (i) FcγRIII (CD16); (ii) natural killer group 2 member D (NKG2D); (iii) CD69; (iv) natural cytotoxicity receptors; or any combination of two or more of them wherein the modified lymphocytes further comprise: (1) (i) chimeric antigen receptor (CR); (ii) non-naturally occurring variants of the immunoglobulin gamma Fc region receptor III (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) Leukocyte surface antigen differentiation antigen group CD47 (CD47); or any combination of two or more thereof, and / or (2) (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof. Section 46 the modified lymphocytes comprising: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) The isolated population of lymphocytes of clause 45, which exhibits loss of function of TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A. Section 47 47. The isolated population of lymphocytes of paragraph 45 or 46, wherein the rearranged TCR locus comprises a rearrangement of a TCRαVJ and / or a TCRβV(D)J section and a complete V domain exon. Section 48 48. The isolated ex vivo population of lymphocytes of paragraph 47, wherein the rearranged endogenous TCR locus consists of no more than two rearranged alleles. Section 49 46. ​​The ex vivo population of isolated lymphocytes of paragraph 45, wherein said natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b. Section 50 50. The ex vivo population of isolated lymphocytes of any one of paragraphs 45 to 49, wherein the population does not contain more than 1%, more than 0.1%, more than 0.001%, more than 0.0001%, more than 0.00001%, more than 0.000001%, more than 0.0000001%, more than 0.00000001%, more than 0.000000001%, more than 0.000000001%, or more than 0.00000000001% of cells expressing reprogramming factors from an exogenous nucleic acid construct. Section 51 51. The ex vivo population of isolated lymphocytes of paragraph 50, wherein said population does not contain cells expressing reprogramming factors from an exogenous nucleic acid construct. Section 52 52. The ex vivo population of isolated lymphocytes of paragraph 50 or paragraph 51, wherein said reprogramming factors are Oct-4 and / or Sox-2. Section 53 46. ​​The ex vivo population of isolated lymphocytes of paragraph 45, wherein said population is free of cells harboring an episomal expression construct encoding a reprogramming factor. Section 54 54. The ex vivo population of isolated lymphocytes of any one of claims 45 to 53, wherein each cell within the cell population comprises the same combination of (1) and (2). Section 55 the cell population is less than 0.001%, less than 0.002%, less than 0.003%, less than 0.004%, less than 0.005%, less than 0.006%, less than 0.007%, less than 0.008%, less than 0.009%, less than 0.01%, less than 0.02%, less than 0.03%, less than 0.04%, less than 0.05%, less than 0.06%, less than 0.07%, less than 0.08%, less than 0.09%, 55. The ex vivo population of isolated lymphocytes of any one of paragraphs 45 to 54, comprising less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% of cells carrying a chromosomal translocation. Section 56 A method of treating a subject, comprising administering to a subject in need thereof the lymphocyte of any one of paragraphs 1-29, the modified cell of any one of paragraphs 30-42, the cell population of paragraph 41, the pharmaceutical composition of paragraph 44, or the ex vivo population of isolated lymphocytes of any one of paragraphs 45-55. Section 57 57. The method of claim 56, wherein the subject has or has been diagnosed with a proliferative disease. Section 58 58. The method of claim 57, wherein the proliferative disease is cancer. Section 59 59. The method of claim 58, wherein the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC) or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical and HPV+ head and neck cancer, oral cavity cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcoma, and hematological cancers such as ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM). Item 60 (a) obtaining induced pluripotent stem cells (iPSCs); (b) modifying the iPSCs, or undifferentiated or differentiated daughter cells thereof, to include expressing at least one exogenous nucleic acid expression construct of (1) and / or to include a loss of function of at least one gene of (2); (c) directing the differentiation of the iPSCs into hematopoietic lineage cells. 54. A method for generating an ex vivo population of lymphocytes according to any one of paragraphs 1 to 29, modified cells according to any one of paragraphs 30 to 42, cell population of paragraph 43, or isolated lymphocytes according to any one of paragraphs 44 to 54, comprising: Section 61 The step that directs differentiation is (i) contacting iPSCs with a composition comprising a BMP pathway activator and optionally bFGF to obtain mesodermal cells; (ii) contacting the mesodermal cells with a composition comprising a BMP pathway activator, bFGF, and a WNT pathway activator to obtain mesodermal cells with definitive hemogenic endothelial (HE) differentiation potential, wherein the mesodermal cells with definitive hemogenic endothelial (HE) differentiation potential are capable of providing hematopoietic lineage cells; Mesodermal cells and mesodermal cells with definitive HE differentiation potential are obtained in steps (i) and (ii) without a step of forming embryoid bodies; 61. The method of claim 60, wherein the hematopoietic cells comprise definitive hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSC), hematopoietic multipotent progenitor cells (MPP), pre-T cell precursors, pre-NK cell precursors, T cell precursors, NK cell precursors, T cells, NK cells, NKT cells, or B cells. Section 62 62. The method of claim 61, wherein the step of directing differentiation of iPSCs into hematopoietic cells further comprises contacting said mesodermal cells having definitive HE differentiation potential with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells. Section 63 63. The method of claim 60, 61, or 62, further comprising contacting said definitive HE cells with a composition comprising a BMP activator, and optionally a ROCK inhibitor, and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L, and IL11, to obtain hematopoietic multipotent progenitor cells (MPPs). Section 64 64. The method of any one of items 60 to 63, further comprising the step of contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, and IL7, and optionally one or more of a BMP activator, a ROCK inhibitor, TPO, VEGF, and bFGF, to obtain pre-T cell precursors, T cell precursors, and / or T cells. Section 65 64. The method of any one of items 60 to 63, further comprising the step of contacting said definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7, and IL15, and optionally one or more of a BMP activator, a ROCK inhibitor, VEGF, and bFGF, to obtain pre-NK cell precursors, NK cell precursors, and / or NK cells. Section 66 Item 66. The method according to any one of items 60 to 65, further comprising, prior to step c), contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor to seed and grow the cells. Section 67 66. The method of any one of items 60 to 65, further comprising the step of detecting a rearranged T cell receptor (TCR) locus in the hematopoietic cell. Section 68 68. The method of claim 67, further comprising selecting the hematopoietic cell comprising the rearranged TCR locus based on the TCR encoded by the rearranged TCR locus binding to an antigen of interest. Section 69 69. The method of claim 68, wherein the antigen of interest is a tumor antigen. Section 70 reprogramming the donor cells to a pluripotent state; editing a target locus in the donor cell genome; differentiating the reprogrammed donor cells into lymphocytes; The method comprising: Section 71 71. The method of paragraph 70, wherein said editing is performed before or during the step of reprogramming said donor cells to a pluripotent state. Section 72 72. The method of claim 70 or 71, wherein the donor cells are fibroblasts, peripheral blood cells, lymphocytes, or T cells. Section 73 (1) (i) a nucleic acid sequence encoding a chimeric antigen receptor (CAR); (ii) a nucleic acid sequence encoding a non-naturally occurring variant of FcγRIII (CD16); (iii) a nucleic acid sequence encoding interleukin 15 (IL-15); (iv) a nucleic acid sequence encoding interleukin-15 receptor (IL-15R) or a variant thereof; (v) a nucleic acid sequence encoding interleukin 12 (IL12); (vi) a nucleic acid sequence encoding the interleukin-12 receptor (IL-12R) or a variant thereof; (vii) a nucleic acid sequence encoding human leukocyte antigen G (HLA-G); (viii) a nucleic acid sequence encoding human leukocyte antigen E (HLA-E); (ix) a nucleic acid sequence encoding the leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof. (2) (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1, PD-279); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more of them comprising an indel or insertion of exogenous nucleic acid in one or more of the loci of A method comprising differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the indels or insertions result in a loss of function of the gene product encoded by the respective locus. Section 74 Indels or insertions in the exogenous nucleic acid (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A 74. The method of claim 73, wherein the indel or insertion results in a loss of function of a gene product encoded by the respective locus. Section 75 75. The method of claim 73 or 74, wherein the exogenous nucleic acid of (2) is the exogenous nucleic acid of (1). Section 76 76. The method of claim 73 or 75, wherein the pluripotent stem cells are iPS cells. Section 77 76. The method of claim 73 or 75, wherein the differentiating step comprises contacting the pluripotent stem cells with a differentiation medium or a series of differentiation media. Section 78 30. The modified lymphocyte of any one of items 1 to 29, wherein the two or more HLA class II histocompatibility antigen α-chain genes are selected from HLA-DQA1, HLA-DRA, HLA-DPA1, HLA-DMA, HLA-DQA2, and HLA-DOA. Section 79 30. The modified lymphocyte according to any one of items 1 to 29, wherein the two or more HLA class II histocompatibility antigen β chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5. Section 80 The modified lymphocyte of any one of paragraphs 1 to 29 and 78 to 79, the modified cell of any one of paragraphs 30 to 42, the cell population of paragraph 43, the pharmaceutical composition of paragraph 44, the ex vivo population of isolated lymphocytes of any one of paragraphs 45 to 55, or the method of any one of paragraphs 56 to 77, wherein the exogenous nucleic acid expression construct comprises a coding nucleic acid sequence recited in (1) under the control of a heterologous promoter. Section 81 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, ex vivo population of isolated lymphocytes, or method of paragraph 80, wherein the heterologous promoter is a NK cell specific promoter. Section 82 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, isolated ex vivo population of lymphocytes, or method of paragraph 80, wherein the NK cell-specific promoter is a promoter of a gene known to be specifically expressed in NK cells, or a variant thereof. Section 83 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, isolated ex vivo population of lymphocytes, or method of paragraph 80, wherein the NK cell-specific promoter is a CD56 (NCAM), CD49, or CD45 promoter, or a variant thereof. Section 84 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, isolated ex vivo population of lymphocytes, or method of paragraph 80, wherein the NK cell-specific promoter is an FcγRIII promoter, an NKG2D promoter, a CD69 promoter, or a natural cytotoxic receptor promoter, or a variant thereof. Section 85 85. A method comprising the step of administering the modified lymphocyte, modified cell, or cell population of any one of paragraphs 1 to 84 to a subject in need thereof. Section 86 86. The method of claim 85, wherein the subject has or has been diagnosed with a proliferative disease. Section 87 87. The method of claim 86, wherein the proliferative disease is cancer. Section 88 88. The method of claim 87, wherein the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC) or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical and HPV+ head and neck cancers, oral cavity cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcoma, and hematological cancers such as ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM). Effect of the Invention

[0075] The present invention may provide modified natural killer (NK) cells for immunotherapy. [Brief description of the drawings]

[0076] [Figure 1A-1B] We show that robust single and dual gene editing of TGFBR2 and CISH was achieved in NK cells. Targeting TGFBR2 and CISH alone or simultaneously in NK cells with CRISPR-Cpf1 resulted in in / del in both targets in >80% of NK cells, and >90% of NK cells were viable at 72 hours post-editing. [Figure 2A-2B]As analyzed across three unique donors and five independent experiments, we show that spheroid normalization maintains the same efficacy pattern observed with non-normalized data. Each group of single knockout (SKO) NKs was significantly more efficient at reducing SK-OV-3 spheroid size than control NKs, and the double knockout (DKO) NK group was significantly more efficient at reducing SK-OV-3 spheroid size than the SKO NK group. Figure 2A shows SK-OV-3 spheriod analysis at 10:1 E:T with 10 ng / mL TGFβ (three donors, five independent experiments). Figure 2B has error bars that are SEM. Statistical significance is the result of two-way ANOVA analysis. Two-way ANOVA analysis excludes time points >104 hours due to missing time points in some experiments. Mixed model analysis yields the same or improved statistical significance between groups when all time points are considered. [Figure 3A-3B] We show that CISH / TGFBR2 double knockout NK cells exhibit superior effector function than single knockout or control NK cells in SK-OV-3 spheroid assays, even at low NK effector to target cell (E:T) ratios. Figure 3A shows SK-OV-3 spheroid analysis at 20:1 E:T with 10 ng / mL TGF-β as analyzed in 3 unique donors and 5 independent experiments. Figure 3B shows SK-OV-3 spheroid analysis at 10:1 E:T with 10 ng / mL TGF-β as analyzed in 4 unique donors and 7 independent experiments. These subtle differences between different E:T ratios in all conditions suggest that the effector cell phenotype is driven by the knockout and not the NK cell to target ratio. [Figure 4A-4B]We show that CISH / TGFBR2 double knockout NK cells exhibit superior effector function than single knockout or control NK cells in PC-3 spheroid assays, even at low NK effector to target cell (E:T) ratios. Figure 4A shows PC-3 spheroid analysis at 20:1 E:T with 10 ng / mL TGF-β as analyzed in 5 independent experiments with 3 unique donors. Figure 4B shows PC-3 spheroid analysis at 10:1 E:T with 10 ng / mL TGF-β as analyzed in 7 independent experiments with 4 unique donors. These subtle differences between different E:T ratios in all conditions suggest that the effector cell phenotype is driven by the knockout and not the NK cell to target ratio. [Figure 5A-5B] Figure 5 shows that CISH / TGFBR2 double knockout NK cells exhibit superior effector function than single knockout or control NK cells in SK-OV-3 and PC-3 spheroid assays in the absence of exogenous cytokines. Figure 5A shows SK-OV-3 spheroid analysis at 10:1 E:T in the absence of exogenous cytokines as analyzed in 4 unique donors and 7 independent experiments. Figure 5B shows PC-3 spheroid analysis at 10:1 E:T in the absence of exogenous cytokines as analyzed in 4 unique donors and 7 independent experiments. [Figure 6A] Figure 1 shows that IFN-γ concentration correlates with NK cell efficacy in spheroid assays. SK-OV-3 spheroid assays were performed at various E:T ratios with 10 ng / mL TGF-β and 5 ng / mL IL-15. 5:1 and 10:1 E:T assays were performed in 7 independent experiments with 4 unique donors. 20:1 E:T assays were performed in 5 independent experiments with 3 unique donors. [Figure 6B]We show that the concentration of TNF-α correlates with NK cell efficacy in the spheroid assay. SK-OV-3 spheroid assays were performed at various E:T ratios with 10 ng / mL TGF-β and 5 ng / mL IL-15. Assays of 5:1 and 10:1 E:T were performed in seven independent experiments with four unique donors. Assays of 20:1 E:T were performed in five independent experiments with three unique donors. [Figure 6C] Marker expression in CISH / TGFBR2 double knockout (DKO) NK cells is shown. Control (non-edited) and double knockout NK cells were harvested for staining 72 hours after editing. Expression of NK activation markers CD25 and CD69 was quantified. Double KO NK cells expressed significantly higher levels of activation markers CD25 and CD69 compared to control NK cells. [Figure 6D] Antitumor activity of NK cells measured in an in vivo model. NSG mice received an intraperitoneal injection of 500,000 luciferase-labeled SKOV3 tumor cells. Seven days after tumor implantation, 10 million edited (CISH / TGFBR2 double knockout) or unedited (control) NK cells were injected intraperitoneally into tumor-bearing mice. Tumor burden was monitored weekly by IP administration of luciferin and IVIS imaging. Two-way ANOVA was performed on day 34 to determine statistical significance between control and DKO NK cell groups (****, P<0.0001) [Figure 7A] 1 shows robust single-gene editing of TIGIT achieved in NK cells across two independent experiments and three unique donors. [Figure 7B] 1 shows robust single-gene editing of NKG2A achieved in NK cells across two independent experiments and three unique donors. [Figure 7C] 1 shows robust single-gene editing of ADORA2A achieved in NK cells across three independent experiments and three unique donors. [Figure 8A-8B]Figure 8 shows that TIGIT single knockout NK cells exhibit superior effector function than unedited control NK cells in an in vitro spheroid assay at different effector cell to target cell (E:T) ratios. Figure 8A shows tumor spheroid analysis at an E:T of 20:1 as analyzed across two independent experiments with two unique donors. The intensity of red objects was measured every 2 hours over a period of 6 days with an Incucyte imaging system. Figure 8B shows tumor spheroid analysis at effector to target ratios of 1.25:1, 2.5:1, 5:1, 10:1, and 20:1 as analyzed across two independent experiments with two unique donors. The intensity of red objects 100 hours after addition of NK cells is shown. [Figure 9A-9B] Figure 9 shows that NKG2A single knockout NK cells exhibit superior effector function than unedited control NK cells in an in vitro spheroid assay at different effector cell to target cell (E:T) ratios. Figure 9A shows tumor spheroid analysis at an E:T of 20:1 as analyzed across two independent experiments with two unique donors. The intensity of red objects was measured every 2 hours over a period of 6 days with an Incucyte imaging system. Figure 9B shows tumor spheroid analysis at E:T ratios of 1.25:1, 2.5:1, 5:1, 10:1, and 20:1 as analyzed across two independent experiments with two unique donors. The intensity of red objects 100 hours after addition of NK cells is shown. [Figure 10A-10B]Figure 10 shows that ADORA2A single knockout NK cells exhibit superior effector function than unedited control NK cells in an in vitro spheroid assay at different effector cell to target cell (E:T) ratios. Figure 10A shows tumor spheroid analysis at an E:T of 20:1 as analyzed across two independent experiments with two unique donors. The intensity of red objects was measured every 2 hours over a period of 6 days with an Incucyte imaging system. Figure 10B shows tumor spheroid analysis at E:T ratios of 1.25:1, 2.5:1, 5:1, 10:1, and 20:1 as analyzed across two independent experiments with two unique donors. The intensity of red objects 100 hours after addition of NK cells is shown. [Figure 11] 1 shows TGFbR2 / CISH / TIGIT triple gene editing achieved in NK cells. [Figure 12A-12B] Figure 12 shows that TGFbR2 / CISH / TIGIT triple knockout NK cells exhibit superior effector function than unedited control NK cells in an in vitro spheroid assay at different effector cell to target cell (E:T) ratios. Figure 12A shows tumor spheroid analysis at E:T of 20:1. The intensity of red objects was measured every 2 hours over 6 days with an Incucyte imaging system. Figure 12B shows tumor spheroid analysis at E:T of 5:1, 10:1, and 20:1. The intensity of red objects 100 hours after adding NK cells is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0077] Some aspects of the present disclosure provide strategies, compositions, and methods useful for engineering "off-the-shelf" allogeneic cells that can be used in clinical applications. Some aspects of the present disclosure provide strategies, compositions, and methods useful for engineering pluripotent or multipotent stem cells (e.g., induced pluripotent stem cells (iPSCs) or hematopoietic stem cells (HSCs) that can be used to derive differentiated daughter cells, such as engineered lymphocytes, such as iNK cells. Both graft-versus-host and host-versus-graft immune reactivity is a major challenge for clinical applications of allogeneic cells. Some aspects of the present disclosure provide strategies, compositions, and methods for engineering cells that address various aspects of immune reactivity typically encountered with unmodified cell grafts in an allogeneic environment.

[0078] Some aspects of the present disclosure provide strategies, compositions, and methods useful for overcoming "non-self" host-versus-graft immune reactivity, for example, by eliminating MHC class I and II function in target cells for allogeneic clinical applications. For example, in some embodiments, MHC class I and II functionality is achieved by causing loss of function of B2M (class I) and CIITA (class II) and / or two or more MHC class II α and / or β chains, as described in more detail elsewhere herein.

[0079] Some aspects of the present disclosure provide strategies, compositions, and methods useful for overcoming "loss of self" host-versus-graft immune reactivity, e.g., by introducing an exogenous expression construct comprising a nucleic acid sequence encoding an NK inhibitory modality into target cells for allogeneic clinical applications. For example, in some embodiments, such "loss of self" immune reactivity is addressed by effecting transgenic expression of HLA-G, HLA-E, and / or CD47 in target cells for allogeneic clinical applications.

[0080] Some aspects of the present disclosure provide strategies, compositions, and methods useful for overcoming graft-versus-host T cell receptor (TCR) alloreactivity by removing endogenous TCR function. For example, in some embodiments, strategies, compositions, and methods useful for generating modified cells for allogeneic clinical applications from pluripotent or multipotent stem cells are provided herein, comprising engineering the stem cells to comprise immune-modulating modifications as described herein, and then differentiating the stem cells into cell types, such as lymphocytes, e.g., iNK cells, for administration to patients in need thereof for immunotherapy. In some embodiments, the multipotent or multipotent stem cells are derived from cells, e.g., T cells, that express TCR or comprise rearranged TCR loci, and in some such embodiments, differentiated lymphocytes derived from such engineered stem cells express TCR and may be targets for TCR alloreactivity. In some such embodiments, it is advantageous to effect loss of function of the endogenous TCR expression product, and the present disclosure provides strategies, compositions, and methods useful for achieving such loss of function in the respective cells, for example, by effecting loss of function of TRAC, as described in more detail elsewhere herein.

[0081] Some aspects of the present disclosure relate to the generation of modified NK cells (or other lymphocytes) that are useful as therapeutic agents, e.g., in the context of immuno-oncology. For example, at least some of the modified NK cells provided herein exhibit enhanced NK cell response properties, such as, for example, enhanced target recognition, enhanced NK cell response level and / or duration, improved NK cell survival, delayed NK cell depletion, enhanced target recognition, and / or recognition of targets not typically recognized by unmodified NK cells, as compared to unmodified NK cells.

[0082] Some aspects of the disclosure provide compositions, methods, and strategies for generating modified NK cells. In some embodiments, such modified NK cells are generated by editing the genome of a mature NK cell. In some embodiments, modified NK cells are generated by editing the genome of a cell from which the NK cell is derived, either in vitro or in vivo. In some embodiments, the cell from which the NK cell is derived is a stem cell, such as, for example, a hematopoietic stem cell (HSC), or a pluripotent stem cell, such as, for example, an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell). For example, in some embodiments, the genome of an ES cell, iPS cell, or hematopoietic stem cell is edited, followed by differentiation of the edited stem cell into a NK cell to generate the modified NK cell. In some embodiments, where the generation of modified NK cells involves differentiation of modified NK cells from iPS cells, genome editing may occur at any suitable time during the generation, maintenance, or differentiation of the iPS cells. For example, where a donor cell is to be reprogrammed into an iPS cell, the donor cell, e.g., a somatic cell such as a fibroblast or T lymphocyte, may be subjected to the gene editing approaches described herein prior to reprogramming into an iPS cell, during the reprogramming procedure, or after the donor cell is reprogrammed into an iPS cell.

[0083] NK cells derived from iPS cells are also referred to herein as iNK cells. In some embodiments, the present disclosure provides compositions, methods, and strategies for generating iNK cells derived from developmentally mature cells, also referred to as somatic cells, such as, for example, fibroblasts or peripheral blood cells.

[0084] In some embodiments, the present disclosure provides compositions, methods, and strategies for generating iNK cells derived from developmentally mature T cells (T cells that have undergone thymic selection). One of the characteristics of developmentally mature T cells is a rearranged T cell receptor locus. During T cell maturation, the TCR locus undergoes V(D)J rearrangement to generate complete V domain exons. These rearrangements are retained throughout the reprogramming of T cells into induced pluripotent stem (iPS) cells and throughout the differentiation of the resulting iPS cells into somatic cells.

[0085] One advantage of using T cells to generate iPS cells is that T cells can be relatively easily edited, for example, by CRISPR-based or other gene editing methods.

[0086] Another advantage of using T cells to generate iPS cells is that the rearranged TCR locus allows for genetic tracking of individual cells and their daughter cells. If the reprogramming, proliferation, culture, and / or differentiation strategy involved in generating NK cells is the clonal expansion of a single cell, the rearranged TCR locus can be used as a genetic marker to unambiguously identify the cell and its daughter cells. This allows for the characterization of cell populations as bona fide clones, or the identification of mixed populations, or the identification of contaminating cells within a clonal population.

[0087] A third advantage of using T cells to generate iNK cells with multiple edits is that certain karyotypic abnormalities associated with chromosomal translocations are selected for in T cell cultures. Such abnormalities raise concerns when editing cells with CRISPR technology, especially when generating cells with multiple edits.

[0088] A fourth advantage of using iPS cells derived from T cells as a starting point for deriving therapeutic lymphocytes is that it allows the expression of a prescreened TCR in lymphocytes, for example via selecting T cells for binding activity to a specific antigen, such as a tumor antigen, reprogramming the selected T cells into iPS cells, and then deriving lymphocytes from these iPS cells (e.g., T cells) that express the TCR. This strategy would also allow for activating TCRs in other cell types, for example by genetic or epigenetic strategies.

[0089] A fifth advantage of using T cell-derived iPS cells as the starting point for iNK differentiation is that the T cells retain at least part of their "epigenetic memory" throughout the reprogramming process, and therefore subsequent differentiation of the same or closely related cell type, such as iNK cells, may be more efficient and / or result in a higher quality cell population compared to approaches using unrelated cells, such as fibroblasts, as the starting point for iNK induction.

[0090] Definitions and Abbreviations Unless otherwise stated, each of the following terms has the meaning set forth in this section.

[0091] The indefinite articles "a" and "an" refer to at least one of the associated noun and are used interchangeably with the terms "at least one" and "one or more." For example, "a module" means at least one module, or one or more modules.

[0092] The conjunctions "or" and "and / or" are used interchangeably as non-exclusive disjunctions.

[0093] "Subject" means a human or non-human animal. A human subject may be of any age (e.g., infant, child, young adult, or adult) and may be suffering from a disease or in need of alteration of a gene or a specific combination of genes. Alternatively, the subject may be an animal, which term includes, but is not limited to, mammals, more specifically, non-human primates, rodents (e.g., mice, rats, hamsters, etc.), rabbits, guinea pigs, dogs, cats, etc. In certain embodiments of the present disclosure, the subject is a farm animal, such as, for example, a cow, horse, sheep, or goat. In certain embodiments, the subject is poultry.

[0094] The terms "treatment", "treat" and "treating" refer to clinical interventions aimed at reversing, alleviating, delaying the onset, inhibiting progression, and / or preventing or delaying recurrence of a disease or disorder, or one or more symptoms thereof, as described herein. For example, treatment in the form of modified NK cells or modified NK cell populations as described herein may be administered to a subject after one or more symptoms have appeared and / or after a disease has been diagnosed. Treatment may be administered in the absence of symptoms, e.g., to prevent or delay the onset of symptoms, or to inhibit the onset or progression of a disease. For example, treatment may be administered to a susceptible individual (e.g., in light of genetic or other susceptibility factors) prior to the onset of symptoms. Treatment may also be continued after symptoms have resolved, e.g., to prevent or delay recurrence.

[0095] "Prevent," "preventing," and "prevention" refer to the prevention of a disease in a mammal, such as a human, including (a) avoiding or eliminating a disease; (b) affecting a predisposition to a disease; or (c) preventing or delaying the onset of at least one symptom of a disease.

[0096] The terms "polynucleotide", "nucleotide sequence", "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", and "oligonucleotide" refer to a series of nucleotide bases (also referred to as "nucleotides") in DNA and RNA, meaning any chain of two or more nucleotides. Polynucleotide, nucleotide sequence, nucleic acid, etc. refer to compositions that may be single-stranded or double-stranded chimeric mixtures or derivatives or modified versions thereof. They may also be modified, for example, at the base moiety, sugar moiety, or phosphate backbone to improve the stability of the molecule, its hybridization parameters, etc. Nucleotide sequences typically carry genetic information, including, but not limited to, information used by cellular machinery to make proteins and enzymes. These terms include double-stranded or single-stranded genomic DNA, RNA, any synthetic and genetically engineered polynucleotides, and both sense and antisense polynucleotides. These terms also include nucleic acids containing modified bases.

[0097] Conventional IUPAC notation is used in the nucleotide sequences presented herein, as shown in Table 1 below (see also Cornish-Bowden A, Nucleic Acids Res. 1985 May 10;13(9):3021-30, which is incorporated herein by reference). However, it should be noted that "T" indicates "thymine or uracil" where the sequence may be encoded by either DNA or RNA, for example in a gRNA targeting domain.

[0098] [Table 1]

[0099] The terms "protein," "peptide," and "polypeptide" are used interchangeably and refer to a continuous chain of amino acids linked together through peptide bonds. The term includes individual proteins, groups or complexes of proteins that bind together, as well as fragments or portions, variants, derivatives, and analogs of such proteins. Peptide sequences are presented herein using conventional notation, starting with the amino or N-terminus on the left and proceeding to the carboxyl or C-terminus on the right. Standard one-letter or three-letter abbreviations may be used.

[0100] "Variant" refers to an entity, such as a polypeptide, polynucleotide, or small molecule, that exhibits significant structural identity with a reference entity, but that is structurally different from the reference entity in the presence or level of one or more chemical moieties compared to the reference entity. In many embodiments, a variant is also functionally different from the reference entity. In general, whether a particular entity is appropriately considered to be a "variant" of a reference is based on the degree of structural identity with the reference entity.

[0101] As used herein, the term "endogenous" in the context of a nucleic acid (e.g., a gene, a genomic region encoding a protein, a promoter) refers to a naturally occurring nucleic acid or protein in its natural location, e.g., within the genome of a cell. In contrast, the term "exogenous" as used herein in the context of a nucleic acid, e.g., an expression construct, a cDNA, an indel, and a nucleic acid vector, refers to a nucleic acid that has been artificially introduced into the genome of a cell, e.g., using gene editing or genetic engineering techniques, such as CRISPR-based editing techniques.

[0102] The terms "RNA-guided nuclease" and "RNA-guided nuclease molecule" are used interchangeably herein. In some embodiments, the RNA-guided nuclease is an RNA-guided DNA endonuclease enzyme. In some embodiments, the RNA-guided nuclease is a CRISPR nuclease. Non-limiting examples of RNA-guided nucleases are listed in Table 2 below, and the methods and compositions disclosed herein may use any combination of RNA-guided nucleases disclosed herein or known to one of skill in the art. One of skill in the art will be aware of additional nucleases and nuclease variants suitable for use in the context of the present disclosure, and it will be understood that the present disclosure is not limited in this respect.

[0103] [Table 2]

[0104] Additional suitable RNA-guided nucleases, such as, for example, Cas9 and Cas12 nucleases, will be apparent to those skilled in the art in light of the present disclosure, and the present disclosure is not limited by the exemplary suitable nucleases provided herein. In some embodiments, the suitable nuclease is a Cas9 or Cpf1 (Cas12a) nuclease. In some embodiments, the present disclosure also encompasses nuclease variants, such as, for example, Cas9 or Cpf1 nuclease variants. Nuclease variants refer to nucleases that comprise an amino acid sequence characterized by one or more amino acid substitutions, deletions, or additions compared to the wild-type amino acid sequence of the nuclease. Suitable nucleases and nuclease variants may also include a purification tag (e.g., a polyhistidine tag) and a signaling peptide that comprises or consists of, for example, a nuclear localization signal sequence. Some non-limiting examples of suitable nucleases and nuclease variants are described in more detail elsewhere herein and also include those described in PCT Application No. PCT / US2019 / 22374, filed March 14, 2019, entitled "Systems and Methods for the Treatment of Hemoglobinopathies," the entire contents of which are incorporated herein by reference.

[0105] In some embodiments, the RNA-guided nuclease is an Acidaminococcus sp. Cpf1 variant (AsCpf1 variant). Suitable Cpf1 nuclease variants, including suitable AsCpf1 variants, will be known or apparent to those of skill in the art based on this disclosure, including, but not limited to, Cpf1 variants disclosed herein or otherwise known in the art. For example, in some embodiments, the RNA-guided nuclease is an Acidaminococcus sp. Cpf1RR variant (AsCpf1-RR). In another embodiment, the RNA-guided nuclease is a Cpf1RVR variant. For example, suitable Cpf1 variants include those having an M537R substitution, an H800A substitution, and / or an F870L substitution, or any combination thereof (numbering scheme follows the AsCpf1 wild-type sequence).

[0106] The term "hematopoietic stem cell" or "definitive hematopoietic stem cell," as used herein, refers to a CD34+ stem cell that can give rise to both mature myeloid and lymphoid cell types, including T cells, natural killer cells, and B cells.

[0107] As used herein, the terms "reprogramming" or "dedifferentiation" or "increasing cell potential" or "increasing developmental potential" refer to a method of increasing the potential of a cell or dedifferentiating a cell into a less differentiated state. For example, a cell with increased potential has more developmental plasticity (i.e., can differentiate into more cell types) compared to the same cell in a non-reprogrammed state. In other words, a reprogrammed cell is in a less differentiated state than the same cell in a non-reprogrammed state. In some embodiments, the term "reprogramming" refers to dedifferentiating a somatic cell or pluripotent stem cell into a pluripotent stem cell, also called an induced pluripotent stem cell or iPS cell. Suitable methods for generating iPS cells from somatic cells or pluripotent stem cells are well known to those skilled in the art.

[0108] As used herein, the term "differentiation" is the process by which an unspecialized ("uncaptured") or less specialized cell acquires the characteristics of a specialized cell, such as, for example, a blood cell or a muscle cell. A differentiated or differentiation-induced cell is a cell that has taken on a more specialized ("captured") status within a cell lineage. For example, iPS cells, when treated with appropriate differentiation factors in cell culture medium, can differentiate into a variety of more differentiated cell types, such as, for example, neural or hematopoietic stem cells, lymphocytes, cardiomyocytes, and other cell types. Appropriate methods, differentiation factors, and cell culture media for differentiating pluripotent and multipotent cell types into more differentiated cell types are well known to those skilled in the art. The term "captured", when applied to the process of differentiation, refers to a cell that has progressed to a point in the differentiation pathway, where, under normal circumstances, it continues to differentiate into a particular cell type or subset of cell types, and under normal circumstances, it cannot differentiate into a different cell type or back into a less differentiated cell type.

[0109] As used herein, the term "differentiation marker", "differentiation marker gene" or "differentiation gene" refers to a gene or protein whose expression occurs in a cell, such as a pluripotent cell, and is indicative of cell differentiation. Differentiation marker genes include, but are not limited to, the following genes: CD34, CD4, CD8, CD3, CD56 (NCAM), CD49, CD45; NK cell receptor (cluster of differentiation 16 (CD16)), natural killer group 2 member D (NKG2D), CD69, NKp30, NKp44, NKp46, CD158b, FOXA2, FGF5, SOX17, XIST, NODAL, COL3A1, OTX2, DUSP6, EOMES, NR2F2, NR0B1, CXCR4, CYP2B6, GATA3, GATA4, ERBB4, GATA6, HOXC6, INHA, SMAD6, RORA, NIPBL, TNFSF11, CDH11, ZIC4, GAL, SOX3, PITX2, APOA2, CXCL5, CER1, FOXQ1, MLL5, DPP10, GSC, PCDH10, CTCFL, PCDH20, TSHZ1, MEGF10, MYC, DKK1, BMP2, LEFTY2, HES1, CDX2, GNAS, EGR1, COL3A1, TCF4, HEPH, KDR , TOX, FOXA1, LCK, PCDH7, CD1DFOXG1, LEFTY1, TUJ1, Tgene(Brachyury), ZIC1, GATA1, GATA2, HDAC4, HDAC5, HDAC7, HDAC9, NOTCH1, NOTCH2, NOTCH4, PAX5, RBPJ, RUNX1, STAT1, and STAT3.

[0110] As used herein, the terms "differentiation marker gene profile" or "differentiation gene profile," "differentiation gene expression profile," "differentiation gene expression signature," "differentiation gene expression panel," "differentiation gene panel," or "differentiation gene signature" refer to the expression or expression levels of multiple differentiation marker genes.

[0111] As used herein in the context of the developmental potential of a cell, the term "differentiation potential" or "developmental potential" refers to the sum of all developmental options (i.e., developmental potential) accessible to a cell. The continuum of cell potential includes, but is not limited to, totipotent cells, pluripotent cells, multipotent cells, oligopotent cells, unipotent cells, and terminally differentiated cells.

[0112] As used herein, the term "pluripotency" refers to the ability of a cell to form all lineages of the body or somatic cells (i.e., a proper embryo). For example, an embryonic stem cell is a type of pluripotent stem cell that can form cells from each of the three germ layers: ectoderm, mesoderm, and endoderm. Pluripotency is a continuum of developmental potential ranging from incomplete or partial pluripotent cells that cannot give rise to a complete organism (e.g., epiblast stem cells or EpiSCs) to more primitive pluripotent cells that can give rise to a complete organism (e.g., embryonic stem cells or induced pluripotent stem cells).

[0113] As used herein, the term "induced pluripotent stem cells" or "iPS cells" refers to stem cells obtained by a process of reprogramming differentiated somatic cells, such as adult, neonatal, or fetal cells, into cells capable of differentiating into tissues of the three germ layers, mesoderm, endoderm, and ectoderm, or the dermal layer. IPS cells are not found in nature.

[0114] As used herein, the term "embryonic stem cell" refers to a pluripotent stem cell derived from the inner cell mass of the blastocyst of an embryo. Embryonic stem cells are pluripotent and give rise to all three derivatives of the primary germ layers, ectoderm, endoderm, and mesoderm, during development. They do not contribute to the extraembryonic membranes or placenta, i.e., they are not totipotent.

[0115] As used herein, the term "pluripotent stem cell" refers to a cell that has the developmental potential to differentiate into one or more germ layer (ectoderm, mesoderm, and endoderm) cells, but not into all three. Thus, pluripotent cells may also be referred to as "partially differentiated cells." Pluripotent cells are well known in the art, and examples of pluripotent cells include adult stem cells, such as hematopoietic stem cells and neural stem cells. "Pluripotency" indicates that a cell may form many types of cells in a given lineage, but may not form cells of other lineages. For example, a pluripotent hematopoietic cell can form many different types of blood cells (red, white, platelets, etc.), but cannot form neural cells. Thus, the term "pluripotency" refers to a state of a cell that has a degree of developmental potential that is less than totipotency and pluripotency.

[0116] Pluripotency can be determined, in part, by assessing the pluripotency characteristics of the cells, including, but not limited to: (i) pluripotent stem cell morphology; (ii) unlimited self-renewal potential; (iii) expression of pluripotent stem cell markers, including, but not limited to, SSEA1 (mouse only), SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30, and / or CD50; (iv) ability to differentiate into all three somatic lineages (ectoderm, mesoderm, and endoderm); (v) formation of teratomas composed of the three somatic lineages; and (vi) formation of embryoid bodies composed of cells from the three somatic lineages.

[0117] As used herein, the term "pluripotent stem cell morphology" refers to the classical morphological characteristics of embryonic stem cells. Normal embryonic stem cell morphology is characterized by a small, round shape, a high nuclear to cytoplasmic ratio, prominent presence of nucleoli, and typical intercellular spacing.

[0118] Genome editing system The present disclosure relates to the generation of modified NK cells, e.g., NK cells, whose genomes have been modified or that are derived from pluripotent or multipotent stem cells, e.g., HSCs, ES cells, or iPS cells, whose genomes have been modified. The NK cells and stem cells provided herein can be modified using any gene editing technique known to one of skill in the art, including, for example, using genome editing systems such as CRISPR.

[0119] The term "genome editing system" refers to any system with RNA-guided DNA editing activity. The genome editing system of the present disclosure comprises at least two components, a guide RNA (gRNA) and an RNA-guided nuclease, adapted from the naturally occurring CRISPR system. These two components bind to a specific nucleic acid sequence to form a complex that can edit the DNA in or around the nucleic acid sequence, for example, by generating one or more single-strand breaks (SSBs or nicks), double-strand breaks, and / or point mutations.

[0120] Naturally occurring CRISPR systems are evolutionarily organized into two classes and five types (Makarova et al. Nat Rev Microbiol. 2011 Jun;9(6):467-477 (Makarova), incorporated herein by reference), and while the genome editing system of the present disclosure may adapt components of any type or class of naturally occurring CRISPR systems, the embodiments presented herein are generally adapted from class 2, and type II or type V CRISPR systems. Class 2 systems, including types II and V, are characterized by a relatively large multi-domain RNA-guided nuclease protein (e.g., Cas9 or Cpf1) and one or more guide RNAs (e.g., crRNA, optionally tracrRNA), which form a ribonucleoprotein (RNP) complex that associates with (targets) and cleaves specific loci complementary to the target (or spacer) sequence of the crRNA. The genome editing system according to the present disclosure similarly targets and edits cellular DNA sequences, but is significantly different from naturally occurring CRISPR systems. For example, the unimolecular guide RNAs described herein do not occur in nature, and both the guide RNAs and RNA-guided nucleases according to the present disclosure may incorporate any number of modifications that do not occur in nature.

[0121] The genome editing system may be implemented in a variety of ways (e.g., administered or delivered to a cell or subject), and different implementations may be suitable for different applications. For example, the genome editing system, in certain embodiments, is implemented as a protein / RNA complex (ribonucleoprotein, or RNP), which may be included in a pharmaceutical composition, optionally including a pharma- ceutically acceptable carrier and / or encapsulant, such as lipid or polymer microparticles or nanoparticles, micelles, liposomes, etc. In certain embodiments, the genome editing system is implemented as one or more nucleic acids (optionally with one or more additional components) encoding the RNA-guided nuclease and guide RNA components described above; in certain embodiments, the genome editing system is implemented as one or more vectors comprising such nucleic acids, e.g., viral vectors, such as adeno-associated viruses; in certain embodiments, the genome editing system is implemented as any combination of the foregoing. Additional or modified implementations that operate according to the principles described herein will be apparent to those skilled in the art and are within the scope of the present disclosure.

[0122] It should be noted that the genome editing system of the present disclosure may or may not target a single specific nucleotide sequence, and two or more specific nucleotide sequences can be edited in parallel by using two or more guide RNAs. The use of multiple gRNAs is referred to throughout this disclosure as "multiplexing" and can be used to target multiple unrelated target sequences of interest, or to create multiple SSBs or DSBs within a single target domain, and in some cases to make specific edits within such target domains. For example, WO 2015 / 138510 by Maeder et al. (Maeder), incorporated herein by reference, describes a genome editing system for correcting a point mutation in the human CEP290 gene (C.2991+1655A to G), which results in the creation of a cryptic splice site, thereby reducing or eliminating the function of the gene. Maeder's genome editing system utilizes two guide RNAs that target sequences on either side (i.e., flanking) of the point mutation to create a DSB flanking the mutation. This then facilitates the deletion of the intervening sequence containing the mutation, thereby eliminating the cryptic splice site and restoring normal gene function.

[0123] As another example, WO 2016 / 073990 by Cotta-Ramusino et al. ("Cotta-Ramusino"), incorporated herein by reference, describes a genome editing system that utilizes two gRNAs in combination with a Cas9 nickase (a single-stranded nick-generating Cas9, such as S. pyogenes D10A), an arrangement referred to as the "dual nickase system." The Cotta-Ramusino dual nickase system is configured to generate two nicks in opposite strands of the sequence of interest that are offset by one or more nucleotides, which combine to create a double-stranded break with an overhang (5' in the case of Cotta-Ramusino, but 3' overhangs are also possible). The overhangs can then facilitate homology-directed repair events in some circumstances. And as another example, WO 2015 / 070083 by Palestrant et al. ("Palestrant," incorporated herein by reference) describes a gRNA (referred to as a "controller RNA") that targets a nucleotide sequence encoding Cas9, which may be included in a genome editing system comprising one or more additional gRNAs, for example, to allow for transient expression of Cas9 that may otherwise be constitutively expressed in some virally transduced cells. These multiplexing applications are intended to be illustrative rather than limiting, and one of skill in the art will understand that other multiplexing applications are generally compatible with the genome editing systems described herein.

[0124] Genome editing systems can, in some cases, create double-stranded breaks that are repaired by cellular DNA double-stranded break mechanisms, such as NHEJ or HDR. These mechanisms are described throughout the literature, for example, in Davis & Maizels, PNAS, 111(10):E924-932, March 11, 2014 (Davis) (describing Alt-HDR); Frit et al. DNA Repair 17(2014)81-97 (Frit) (describing Alt-NHEJ); and Iyama and Wilson III, DNA Repair (Amst.) 2013-Aug;12(8):620-636 (Iyama) (describing canonical HDR and NHEJ pathways in general).

[0125] When a genome editing system functions by forming DSBs, such a system optionally includes one or more components that promote or facilitate a particular mode of double-stranded break repair or a particular repair outcome. For example, Cotta-Ramusino also describes a genome editing system in which a single-stranded oligonucleotide "donor template" is added; the donor template can be incorporated into the target region of the cellular DNA that is cut by the genome editing system, resulting in a change in the target sequence.

[0126] In certain embodiments, the genome editing system modifies the target sequence or modifies the expression of a gene in or near the target sequence without causing single-strand or double-strand breaks. For example, the genome editing system may include an RNA-guided nuclease fused to a functional domain that acts on DNA, thereby modifying the target sequence or its expression. As an example, the RNA-guided nuclease may be bound (e.g., fused) to a cytidine deaminase functional domain and may function by generating a targeted C to A substitution. Exemplary nuclease / deaminase fusions are described in Komor et al. Nature 533, 420-424 (19 May 2016) ("Komor"), which is incorporated by reference. Alternatively, genome editing systems may utilize cleavage-inactivating (i.e., "dead") nucleases, such as dead Cas9 (dCas9), which may function by forming a stable complex on one or more targeted regions of cellular DNA, thereby disrupting functions involving the targeted regions, including, but not limited to, mRNA transcription, chromatin remodeling, and the like.

[0127] Guide RNA (gRNA) molecules The terms "guide RNA" and "gRNA" refer to any nucleic acid that facilitates the specific binding (or "targeting") of an RNA-guided nuclease, such as Cas9 or Cpf1, to a target sequence, such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular (comprising a single RNA molecule, also referred to as chimeric) or modular (comprising two or more, typically two separate RNA molecules, such as crRNA and tracrRNA, that are typically linked together by duplexing). gRNAs and their component parts are described throughout the literature, for example, in Briner et al. (Molecular Cell 56(2), 333-339, October 23, 2014 (Briner), incorporated by reference), and Cotta-Ramusino.

[0128] In bacteria and archaea, type II CRISPR systems generally comprise an RNA-guided nuclease protein, such as Cas9; a CRISPR RNA (crRNA) that includes a 5' region that is complementary to an exogenous sequence; and a trans-activating crRNA (tracrRNA) that includes a 5' region that is complementary to and forms a duplex with the 3' region of the crRNA. Without intending to be bound by any theory, it is believed that this duplex promotes the formation of the Cas9 / gRNA complex and is necessary for its activity. During the adaptation of type II CRISPR systems for use in gene editing, in one non-limiting example, it was discovered that the crRNA and tracrRNA can be linked into a single unimolecular or chimeric guide RNA by a four-nucleotide (e.g., GAAA) "tetraloop" or "linker" sequence that bridges the complementary regions of the crRNA (at its 3' end) and the tracrRNA (at its 5' end). (Mali et al. Science. 2013 Feb 15;339(6121):823-826 ("Mali"); Jiang et al. Nat Biotechnol. 2013 Mar;31(3):233-239 ("Jiang"); and Jinek et al., 2012 Science Aug. 17;337(6096):816-821 ("Jinek"), all of which are incorporated by reference herein.

[0129] Guide RNAs, whether monopartite or modular, include a "targeting domain" that is fully or partially complementary to a target domain in a target sequence, such as a DNA sequence in the genome of a cell for which editing is desired. Targeting domains have been referred to by various names in the literature, including, but not limited to, "guide sequence" (Hsu et al., Nat Biotechnol. 2013 Sep;31(9):827-832, ("Hsu"), incorporated herein by reference), "complementary region" (Cotta-Ramusino), "spacer" (Briner), and collectively "crRNA" (Jiang). Regardless of the name given to them, targeting domains are typically 10-30 nucleotides in length, and in certain embodiments 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and are located at or near the 5' end in the case of Cas9 gRNAs, and at or near the 3' end in the case of Cpf1 gRNAs.

[0130] In addition to the targeting domain, gRNAs typically (though not necessarily, for example, as discussed below) contain multiple domains that may affect the formation or activity of a gRNA / Cas9 complex. For example, as described above, the duplex structure formed by the first and second complementary domains of the gRNA (also referred to as the repeat:anti-repeat duplex) may interact with the recognition (REC) lobe of Cas9 to mediate the formation of a Cas9 / gRNA complex. (Nishimasu et al., Cell 156, 935-949, February 27, 2014 (Nishimasu 2014) and Nishimasu et al., Cell 162, 1113-1126, August 27, 2015 (Nishimasu 2015), both of which are incorporated herein by reference). It should be noted that the first and / or second complementary domains may contain one or more polyA stretches that may be recognized as termination signals by RNA polymerase. Therefore, the sequences of the first and second complementary domains are optionally modified, for example, through the use of AG swaps as described in Briner, or alternatively, AU swaps, to remove these regions to facilitate complete in vitro transcription of RNA. These and other similar modifications to the first and second complementary domains are within the scope of the present disclosure.

[0131] Along with the first and second complementary domains, Cas9g RNAs typically contain two or more additional duplex regions that are involved in nuclease activity in vivo, but not necessarily in vitro. (Nishimasu 2015). The first stem-loop 1, located near the 3' portion of the second complementary domain, is variously referred to as the "proximal domain" (Cotta-Ramusino), "stem-loop 1" (Nishimasu 2014 and 2015), and "nexus" (Briner). One or more additional stem-loop structures are generally present near the 3' end of the gRNA, the number varying by species, with S. pyogenes gRNAs typically containing two 3' stem-loops (a total of four stem-loop structures including repeat:anti-repeat duplexes), while S. aureus and other species have only one (a total of three stem-loop structures). A description of conserved stem-loop structures (and gRNA structures more generally), organized by species, is provided in Briner.

[0132] While the above description has focused on gRNAs for use with Cas9, it should be understood that other RNA-guided nucleases have been discovered or invented (or may be discovered in the future) that utilize gRNAs that differ in some respects from those described thus far. For example, Cpf1 (CRISPR from "Prevotella and Franciscella 1") is a recently discovered RNA-guided nuclease that does not require a tracrRNA to function. (Zetsche et al., 2015, Cell 163, 759-771 October 22, 2015 (Zetsche I), incorporated herein by reference). gRNAs for use in the Cpf1 genome editing system generally include a targeting domain and a complementary domain (alternately referred to as a "handle"). It should also be noted that in gRNAs for use with Cpf1, the targeting domain is typically at or near the 3' end rather than the 5' end as described above for Cas9 gRNA (the handle is at or near the 5' end of the Cpf1 gRNA).

[0133] Those skilled in the art will understand that while structural differences may exist between gRNAs from different prokaryotic species, or between gRNAs of Cpf1 and Cas9, the principles by which gRNAs operate are generally consistent. Because of this consistency of operation, gRNAs may be broadly defined by their targeting domain sequences, and those skilled in the art will understand that a given targeting domain sequence may be incorporated into any suitable gRNA, including monomolecular or chimeric gRNAs, or gRNAs that include one or more chemical and / or sequence modifications (substitutions, additional nucleotides, truncations, etc.). Thus, for economy of presentation in this disclosure, gRNAs may be described solely in terms of their targeting domain sequences.

[0134] More generally, those skilled in the art will understand that some aspects of the present disclosure relate to systems, methods, and compositions that can be implemented using multiple RNA-guided nucleases. For this reason, unless otherwise specified, the term gRNA should be understood to encompass any suitable gRNA that can be used with any RNA-guided nuclease, not just gRNAs that are compatible with a particular species of Cas9 or Cpf1. By way of example, the term gRNA may, in certain embodiments, include gRNAs for use with class 2 CRISPR systems, such as type II or type V, or with any RNA-guided nuclease present in a CRISPR system, or with RNA-guided nucleases derived from or adapted from them.

[0135] In some embodiments, the guide RNA used comprises modifications compared to standard gRNA scaffolds. Such modifications may comprise, for example, chemical modifications of parts of the gRNA, such as the nucleobases or backbone moieties. In some embodiments, such modifications may also comprise the presence of DNA nucleotides within the gRNA, for example within or outside the targeting domain. In some embodiments, modifications may comprise elongation of the gRNA scaffold, for example by addition of 1-100 nucleotides, including RNA and / or DNA nucleotides, to the distal end of the targeting domain, for example to the 3' or 5' end of the guide RNA.

[0136] In general, gRNAs contain ribose, a five-membered sugar ring with oxygen. Exemplary modified gRNAs include, but are not limited to, replacement of oxygen in ribose (e.g., with sulfur (S), selenium (Se), or alkylene, such as methylene or ethylene); addition of double bonds (e.g., replacing ribose with cyclopentenyl or cyclohexenyl); ribose ring contraction (e.g., forming a four-membered ring of cyclobutane or oxetane); ribose ring expansion (e.g., forming a six- or seven-membered ring with additional carbon or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino, which also has a phosphoramidate backbone). Most of the sugar analog modifications are located at the 2' position, but other sites, including the 4' position, are also amenable to modification. In certain embodiments, the gRNA comprises a 4'-S, 4'-Se, or 4'-C-aminomethyl-2'-O-Me modification.

[0137] In certain embodiments, deazanucleotides, such as 7-deaza-adenosine, may be incorporated into the gRNA. In certain embodiments, O- and N-alkylated nucleotides, such as N6-methyladenosine, may be incorporated into the gRNA. In certain embodiments, one or more or all of the nucleotides in the gRNA are deoxyribonucleotides.

[0138] In certain embodiments, as used herein, a gRNA may be a modified or unmodified gRNA. In certain embodiments, a gRNA may include one or more modifications. In certain embodiments, the one or more modifications may include a phosphorothioate linkage modification, a phosphorodithioate (PS2) linkage modification, a 2'-O-methyl modification, or a combination thereof. In certain embodiments, the one or more modifications may be at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof.

[0139] In certain embodiments, the gRNA modifications may comprise one or more phosphorodithioate (PS2) linkage modifications.

[0140] In some embodiments, the gRNA used herein comprises one or more or a stretch of deoxyribonucleic acid (DNA) bases, also referred to herein as a "DNA extension." In some embodiments, the gRNA used herein comprises a DNA extension at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the DNA extension is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, The DNA extension may be 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DNA bases long. For example, in certain embodiments, the DNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA bases long. In certain embodiments, the DNA extension may include one or more DNA bases selected from adenine (A), guanine (G), cytosine (C), or thymine (T). In certain embodiments, the DNA extension comprises the same DNA bases. For example, the DNA extension may comprise a stretch of adenine (A) bases. In certain embodiments, the DNA extension may comprise a stretch of thymine (T) bases. In certain embodiments, the DNA extension comprises a combination of different DNA bases. In certain embodiments, the DNA extension may comprise a sequence as set forth in Table 3. In certain embodiments, the gRNA used herein comprises a DNA extension and one or more phosphorothioate bond modifications, one or more phosphorodithioate (PS2) bond modifications, one or more 2'-O-methyl modifications, or a combination thereof. In certain embodiments, the one or more modifications may be at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof.In certain embodiments, the gRNA comprising the DNA extension may comprise a sequence set forth in Table 3 that comprises the DNA extension. Without wishing to be bound by theory, it is contemplated that any DNA extension may be used herein as long as it does not hybridize to the target nucleic acid targeted by the gRNA and exhibits increased editing at the target nucleic acid site compared to a gRNA that does not comprise such a DNA extension.

[0141] In some embodiments, a gRNA as used herein comprises one or more or a stretch of ribonucleic acid (RNA) bases, also referred to herein as an "RNA extension." In some embodiments, a gRNA as used herein comprises an RNA extension at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the RNA extension is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, The RNA extension may be 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 RNA bases in length. For example, in certain embodiments, the RNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA bases in length. In certain embodiments, the RNA extension may comprise one or more RNA bases selected from adenine (rA), guanine (rG), cytosine (rC), or uracil (rU), where "r" represents RNA, 2'-hydroxy. In certain embodiments, the RNA extension comprises the same RNA bases. For example, the RNA extension may comprise a stretch of adenine (rA) bases. In certain embodiments, the RNA extension comprises a combination of different RNA bases. In certain embodiments, the RNA extension may comprise a sequence as set forth in Table 3. In certain embodiments, the gRNA used herein comprises an RNA extension and one or more phosphorothioate linkage modifications, one or more phosphorodithioate (PS2) linkage modifications, one or more 2'-O-methyl modifications, or a combination thereof. In certain embodiments, the one or more modifications may be at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the gRNA comprising the RNA extension may comprise a sequence shown in Table 3, which comprises the RNA extension.The gRNA comprising an RNA extension at the 5' end of the gRNA may comprise a sequence disclosed herein. The gRNA comprising an RNA extension at the 3' end of the gRNA may comprise a sequence disclosed herein.

[0142] It is contemplated that the gRNA used herein may also include an RNA extension and a DNA extension. In certain embodiments, the RNA extension and the DNA extension may both be at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the RNA extension is at the 5' end of the gRNA and the DNA extension is at the 3' end of the gRNA. In certain embodiments, the RNA extension is at the 3' end of the gRNA and the DNA extension is at the 5' end of the gRNA.

[0143] In some embodiments, a gRNA containing a modification, e.g., a DNA extension at the 5' end, is complexed with an RNA-guided nuclease, e.g., AsCpf1 nuclease, to form an RNP, which is then used to edit a target cell, e.g., an NK cell.

[0144] Examples of suitable 5' extensions of Cpf1 guide RNAs are shown in the table below.

[0145] [Table 3]

[0146] Additional suitable gRNA modifications will be apparent to one of skill in the art based on the present disclosure. Suitable gRNA modifications include, for example, those described in PCT Application No. PCT / US2018 / 054027, filed October 2, 2018, entitled "MODIFIED CPF1 GUIDERNA," PCT Application No. PCT / US2015 / 000143, filed December 3, 2015, entitled "GUIDE RNA WITH CHEMICAL MODIFICATION," PCT Application No. PCT / US2016 / 026028, filed April 5, 2016, entitled "CHEMICALLY MODIFIED GUIDE RNAS FOR CRISPR / CAS-MEDIATED GENE REGULATION," and PCT Application No. PCT / US2016 / 026028, filed April 5, 2016, entitled "NUCLEASE-MEDIATED GENOME EDITING OF PRIMARY CELLS AND ENRICHMENT," each of which is incorporated herein by reference in its entirety. Examples of such compounds include those described in PCT application PCT / US2016 / 053344, filed September 23, 2016, entitled "THEREOF."

[0147] gRNA design Methods for target sequence selection and validation, as well as off-target analysis, are described, for example, in Mali; Hsu; Fu et al., 2014 Nat biotechnol 32(3):279-84, Heigwer et al., 2014 Nat methods 11(2):122-3; Bae et al. (2014) Bioinformatics 30(10):1473-5; and Xiao A et al. (2014) Bioinformatics 30(8):1180-1182. Each of these references is incorporated herein by reference. As a non-limiting example, gRNA design may involve the use of software tools to optimize the selection of potential target sequences that correspond to the user's target sequence, such as, for example, minimizing total off-target activity across the genome. Off-target activity is not limited to cleavage, but cleavage efficiency at each off-target sequence may be predicted, for example, using an experimentally derived weighting scheme. These and other guide selection methods are detailed in Maeder and Cotta-Ramusino.

[0148] In certain embodiments, one or more or all nucleotides in the gRNA are modified. Strategies for modifying gRNAs are described in International Publication No. WO 2019 / 152519, published August 8, 2019, the contents of which are expressly incorporated herein by reference.

[0149] Non-limiting examples of guide RNAs suitable for certain embodiments encompassed by the present disclosure are provided herein, for example, in the table below. From the disclosure of the targeting domain sequence as either a DNA or RNA sequence, the skilled artisan will be able to envisage suitable guide RNA sequences for a specifc nuclease, such as, for example, Cas9 or Cpf-1 nuclease. For example, a guide RNA comprising a targeting sequence consisting of RNA nucleotides comprises an RNA sequence corresponding to the targeting domain sequence provided as a DNA sequence, which comprises uracils instead of thymidine nucleotides. For example, a guide RNA comprising a targeting domain sequence consisting of RNA nucleotides, represented by the DNA sequence TCTGCAGAAATGTTCCCCGT (SEQ ID NO: __), has a targeting domain of the corresponding RNA sequence UCUGCAGAAAUGUUCCCCGU (SEQ ID NO: __). As will be clear to the skilled artisan, such targeting sequences will be linked to a suitable guide RNA scaffold, such as, for example, a crRNA scaffold sequence or a chimeric crRNA / tracer RNA scaffold sequence. Suitable gRNA scaffold sequences are known to the skilled artisan. For AsCpf1, for example, a suitable scaffold sequence comprises the sequence UAAUUUCUACUCUUGUAGAU (SEQ ID NO: ), and is added to the 5' end of the targeting domain. In the above example, this would result in a Cpf1 guide RNA of the sequence UAAUUUCUACUCUUGUAGAUUCUGCAGAAAUGUUCCCCGU (SEQ ID NO: ). One of skill in the art will further understand how to modify such a guide RNA, for example, by adding a DNA extension (e.g., in the above example, adding a 25-mer DNA extension as described herein would result in, for example, [ka] The exemplary targeting sequences provided herein are not limiting, and additional suitable sequences, such as variants of the specific sequences disclosed herein, will be apparent to those skilled in the art based on the present disclosure in light of their general knowledge in the art.

[0150] In some embodiments, the gRNA for use in the present disclosure is a gRNA that targets TIGIT (TIGIT gRNA). In some embodiments, the gRNA that targets TIGIT is one or more of the gRNAs listed in Table 4.

[0151] [Table 4]

[0152] [Table 5]

[0153] [Table 6]

[0154] [Table 7]

[0155] [Table 8]

[0156] [Table 9]

[0157] [Table 10]

[0158] [Table 11]

[0159] [Table 12]

[0160] In some embodiments, the gRNA for use in the present disclosure is a gRNA that targets ADORA2a (ADORA2a gRNA). In some embodiments, the gRNA that targets ADORA2a is one or more of the gRNAs listed in Table 5.

[0161] [Table 13]

[0162] [Table 14]

[0163] [Table 15]

[0164] [Table 16]

[0165] [Table 17]

[0166] [Table 18]

[0167] [Table 19]

[0168] [Table 20]

[0169] In some embodiments, the gRNA for use in the present disclosure is a gRNA that targets TGFβR2 (TGFbetaR2 gRNA). In some embodiments, the gRNA that targets TGFβR2 is one or more of the gRNAs listed in Table 6.

[0170] [Table 21]

[0171] [Table 22]

[0172] [Table 23]

[0173] [Table 24]

[0174] [Table 25]

[0175] [Table 26]

[0176] In some embodiments, the gRNA for use in the present disclosure is a CISH-targeting gRNA (CISH gRNA). In some embodiments, the CISH-targeting gRNA is one or more of the gRNAs listed in Table 7.

[0177] [Table 27]

[0178] [Table 28]

[0179] [Table 29]

[0180] [Table 30]

[0181] In some embodiments, the gRNA for use in this disclosure is a gRNA that targets B2M (B2M gRNA). In some embodiments, the gRNA that targets B2M is one or more of the gRNAs listed in Table 8.

[0182] [Table 31]

[0183] [Table 32]

[0184] [Table 33]

[0185] [Table 34]

[0186] [Table 35]

[0187] [Table 36]

[0188] In some embodiments, the gRNA for use in the present disclosure is a gRNA that targets NKG2A (NKG2A gRNA). In some embodiments, the gRNA that targets NKG2A is one or more of the gRNAs listed in Table 9.

[0189] [Table 37]

[0190] [Table 38]

[0191] [Table 39]

[0192] In some embodiments, a gRNA for use in this disclosure is a gRNA that targets PD1. In some embodiments, a gRNA for use in this disclosure is a gRNA that targets PD1. B2M and PD1 targeting gRNAs for use in this disclosure are further described in WO2015161276 and WO2017152015 by Welstead et al. ("Welstead"), both of which are incorporated by reference in their entireties.

[0193] RNA-guided nuclease RNA-guided nucleases according to the present disclosure include, but are not limited to, naturally occurring class 2 CRISPR nucleases such as Cas9 and Cpf1, as well as other nucleases derived from or obtained therefrom.Functionally, RNA-guided nucleases are defined as nucleases that (a) interact (e.g., complex) with gRNA; and (b) bind to and optionally cleave or modify a target region of DNA together with gRNA, which comprises (i) a sequence complementary to the targeting domain of gRNA, and optionally (ii) an additional sequence referred to as "protospacer adjacent motif" or "PAM", which will be described in more detail below.As the following examples illustrate, RNA-guided nucleases can be broadly defined by their PAM specificity and cleavage activity, even though there may be variation between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. Those skilled in the art will appreciate that some aspects of the present disclosure relate to systems, methods, and compositions that may be implemented using any suitable RNA-guided nuclease with a particular PAM specificity and / or cleavage activity. For this reason, unless otherwise specified, the term RNA-guided nuclease should be understood as a generic term and is not limited to any particular type (e.g., Cpf1 versus Cas9), species (e.g., S. aureus versus S. pyogenes), or variation (e.g., truncated or split versus full-length; engineered versus native PAM specificity, etc.) of RNA-guided nuclease.

[0194] The PAM sequence takes its name from its sequence relationship to a "protospacer" sequence that is complementary to the gRNA targeting domain (or "spacer"). Together with the protospacer sequence, the PAM sequence defines a target region or sequence for a particular RNA-guided nuclease / gRNA combination.

[0195] Different RNA-guided nucleases may require different sequential relationships between the PAM and the protospacer. For example, Cas9 nuclease recognizes the PAM sequence 3' of the protospacer while:

[0196] Cpf1, on the other hand, generally recognizes the PAM sequence 5' of the protospacer.

[0197] In addition to recognizing specific sequence orientations of PAM and protospacer, RNA-guided nucleases may also recognize specific PAM sequences. For example, S. aureus Cas9 recognizes the NNGRRT or NNGRRV PAM sequence, in which the N residue is adjacent to the 3' of the region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes the NGG PAM sequence. And F. novicida Cpf1 recognizes the TTN PAM sequence. PAM sequences have been identified for various RNA-guided nucleases, and a strategy for identifying novel PAM sequences has been described by Shmakov et al., 2015, Molecular Cell 60, 385-397, November 5, 2015. It should also be noted that an engineered RNA-guided nuclease may have a PAM specificity that differs from that of the reference molecule (e.g., in the case of an engineered RNA-guided nuclease, the reference molecule may be a naturally occurring variant from which the RNA-guided nuclease is derived, or may be a naturally occurring variant with the greatest amino acid sequence homology with the engineered RNA-guided nuclease).

[0198] In addition to their PAM specificity, RNA-guided nucleases can be characterized by their DNA cleavage activity: while natural RNA-guided nucleases typically form DSBs in target nucleic acids, engineered mutants have been generated that produce only SSBs or do not cleave at all (discussed above) Ran & Hsu, et al., Cell 154(6), 1380-1389, September 12, 2013 (Ran), incorporated herein by reference).

[0199] Cas9 Crystal structures have been determined for S. pyogenes Cas9 (Jinek 2014) and S. aureus Cas9 complexed with a single guide RNA and target DNA (Nishimasu 2014; Anders 2014; and Nishimasu 2015).

[0200] Naturally occurring Cas9 protein comprises two lobes, a recognition (REC) lobe and a nuclease (NUC) lobe, each of which comprises a specific structural and / or functional domain. The REC lobe comprises an arginine-rich bridged helix (BH) domain and at least one REC domain (e.g., a REC1 domain, optionally a REC2 domain). The REC lobe does not share structural similarity with other known proteins, suggesting that it is a unique functional domain. While not wishing to be bound by any theory, mutational analysis suggests specific functional roles for the BH and REC domains: the BH domain appears to play a role in gRNA:DNA recognition, while the REC domain is believed to interact with the repeat:anti-repeat duplex of the gRNA and mediate the formation of the Cas9 / gRNA complex.

[0201] The NUC lobe comprises a RuvC domain, an HNH domain, and a PAM interaction (PI) domain. The RuvC domain shares structural similarity with retroviral integrase superfamily members and cleaves the non-complementary (i.e., bottom) strand of the target nucleic acid. It may be formed from two or more split RuvC motifs (such as RuvCI, RuvCII, and RuvCIII in S. pyogenes and S. aureus). Meanwhile, the HNH domain is structurally similar to the HNN endonuclease motif and cleaves the complementary (i.e., top) strand of the target nucleic acid. As the name suggests, the PI domain contributes to PAM specificity.

[0202] While certain functions of Cas9 are linked to (but not necessarily fully determined by) the specific domains described above, these and other functions may be mediated or influenced by other Cas9 domains, or by multiple domains on either lobe. For example, as described in Nishimasu 2014, in S. pyogenes Cas9, the repeat:anti-repeat duplex of the gRNA fits into a groove between the REC and NUC lobes, and nucleotides in the duplex interact with amino acids in the BH, PI, and REC domains. Some nucleotides in the first stem-loop structure also interact with amino acids in multiple domains (PI, BH, and REC1), as do some nucleotides in the second and third stem-loops (RuvC and PI domains).

[0203] Cpf1 The crystal structure of Acidaminococcus sp. Cpf1 complexed with crRNA and with a double-stranded (ds) DNA target, such as the TTTN PAM sequence, has been solved by Yamano et al. (Cell. 2016 May 5;165(4):949-962 (Yamano), incorporated herein by reference). Like Cas9, Cpf1 has two lobes, the REC (recognition) lobe and the NUC (nuclease) lobe. The REC lobe contains the REC1 and REC2 domains, which have no similarity to any known protein structure. Meanwhile, the NUC lobe contains three RuvC domains (RuvC-I, -II, and -III) and one BH domain. However, in contrast to Cas9, the Cpf1 REC lobe lacks an HNH domain and contains a structurally unique PI domain, three wedge (WED) domains (WED-I, -II, and -III), and a nuclease (Nuc) domain, among other domains that lack similarity to known protein structures.

[0204] While Cas9 and Cpf1 share similarities in structure and function, it should be understood that certain Cpf1 activities are mediated by structural domains that are not similar to any of the Cas9 domains. For example, cleavage of the complementary strand of target DNA appears to be mediated by the Nuc domain, which is sequence- and spatially distinct from the HNH domain of Cas9. Furthermore, the non-targeting portion (handle) of Cpf1 gRNA adopts a pseudoknot structure rather than the stem-loop structure formed by the repeat:anti-repeat duplex in Cas9 gRNA.

[0205] Modification of RNA-guided nucleases While the RNA-guided nucleases described above have activities and properties that may be useful for a variety of applications, one of skill in the art will recognize that RNA-guided nucleases can also be optionally modified to alter cleavage activity, PAM specificity, or other structural or functional characteristics.

[0206] Turning first to modifications that alter cleavage activity, mutations that reduce or eliminate the activity of domains in the NUC lobe are described above. Exemplary mutations that may be generated in the RuvC domain, Cas9 HNH domain, or Cpf1 Nuc domain are described in Ran and Yamano, as well as Cotta-Ramusino. In general, mutations that reduce or eliminate the activity of one of the two nuclease domains result in an RNA-guided nuclease with nickase activity, but it should be noted that the type of nickase activity varies depending on which domain is inactivated. As an example, inactivation of the RuvC domain or Cas9 HNH domain results in a nickase.

[0207] Modifications of PAM specificity compared to naturally occurring Cas9 reference molecules have been described by Kleinstiver et al. for both S. pyogenes (Kleinstiver et al., Nature. 2015 Jul 23; 523(7561): 481-5 (Kleinstiver I)) and S. aureus (Kleinstiver et al., Nat Biotechnol. 2015 Dec; 33(12): 1293-1298 (Kleinstiver II)). Kleinstiver et al. also describe modifications that improve the targeting fidelity of Cas9 (Nature, 2016 Jan 28; 529, 490-495 (Kleinstiver III)). Each of these references is incorporated herein by reference.

[0208] RNA-guided nucleases are split into two or more parts, as described by Zetsche et al. (Nat Biotechnol. 2015 Feb;33(2):139-42 (Zetsche II), incorporated by reference), and Fine et al. (Sci Rep. 2015 Jul.1;5:10777 (Fine), incorporated by reference).

[0209] In certain embodiments, the RNA-guided nuclease may be size-optimized or truncated, for example, through one or more deletions that reduce the size of the nuclease while still maintaining gRNA binding, target and PAM recognition, and cleavage activity. In certain embodiments, the RNA-guided nuclease is covalently or non-covalently linked to another polypeptide, nucleotide, or other structure, optionally by a linker. Exemplary linked nucleases and linkers are described by Guilinger et al., Nature Biotechnology 32, 577-582 (2014), which is incorporated by reference for all purposes herein.

[0210] The RNA-guided nuclease also optionally includes a label, including but not limited to a nuclear localization signal, to facilitate the translocation of the RNA-guided nuclease protein into the nucleus. In certain embodiments, the RNA-guided nuclease may incorporate a C-terminal and / or N-terminal nuclear localization signal. Nuclear localization sequences are known in the art and described in Maeder and elsewhere.

[0211] The list of modifications above is intended to be exemplary in nature, and those skilled in the art will understand in light of the present disclosure that other modifications may be possible or desirable in certain applications. Thus, for the sake of brevity, the exemplary systems, methods, and compositions of the present disclosure are presented with reference to specific RNA-guided nucleases, but it should be understood that the RNA-guided nucleases used may be modified in a manner that does not change their principle of operation. Such modifications are within the scope of the present disclosure.

[0212] Exemplary suitable nuclease mutants include, but are not limited to, AsCpf1 mutants comprising M537R, H800A, and / or F870L substitutions, or any combination thereof (numbering scheme refers to the AsCpf1 wild-type sequence). Other suitable modifications of the AsCpf1 amino acid sequence are known to those of skill in the art. Some exemplary sequences of wild-type AsCpf1 and AsCpf1 mutants are provided below.

[0213] His-AsCpf1-sNLS-sNLSH800A amino acid sequence (SEQ ID NO:[XX]) [ka]

[0214] Cpf1 variant 1 amino acid sequence (SEQ ID NO:[XX]) [ka]

[0215] Cpf1 mutant type 2 amino acid sequence (SEQ ID NO:[XX]) [ka]

[0216] Cpf1 variant 3 amino acid sequence (SEQ ID NO: 1096) [ka]

[0217] Cpf1 variant 4 amino acid sequence (SEQ ID NO: 1097) [ka]

[0218] Cpf1 variant 5 amino acid sequence (SEQ ID NO: 1107) [ka]

[0219] Cpf1 variant 6 amino acid sequence (SEQ ID NO: 1108) [ka]

[0220] Cpf1 mutant 7 amino acid sequence (SEQ ID NO:[[XX]]) [ka]

[0221] An exemplary AsCpf1 wild-type amino acid sequence (SEQ ID NO:[[XX]]): [ka]

[0222] Nucleic acid encoding an RNA-guided nuclease For example, provided herein are nucleic acids encoding RNA-guided nucleases, such as Cas9, Cpf1, or functional fragments thereof. Exemplary nucleic acids encoding RNA-guided nucleases have been previously described (see, e.g., Cong 2013; Wang 2013; Mali 2013; Jinek 2012).

[0223] In some cases, the nucleic acid encoding the RNA-guided nuclease may be a synthetic nucleic acid sequence. For example, the synthetic nucleic acid molecule may be chemically modified. In certain embodiments, the mRNA encoding the RNA-guided nuclease may have one or more (e.g., all) of the following characteristics: it may be capped; it may be polyadenylated; it may be substituted with 5-methylcytidine and / or pseudouridine.

[0224] Synthetic nucleic acid sequences can also be codon-optimized, e.g., at least one uncommon or less common codon is replaced by a common codon. For example, synthetic nucleic acids can direct the synthesis of optimized messenger mRNA, e.g., optimized for expression in a mammalian expression system as described herein. An example of a codon-optimized Cas9 coding sequence is provided in Cotta-Ramusino.

[0225] Additionally, or alternatively, the nucleic acid encoding the RNA-guided nuclease may comprise a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art.

[0226] Functional analysis of candidate molecules Candidate RNA-guided nucleases, gRNAs, and their complexes can be evaluated by standard methods known in the art. See, for example, Cotta-Ramusino. The stability of RNP complexes can be evaluated by differential scanning fluorimetry, as described below.

[0227] Differential Scanning Fluorometry (DSF) The thermal stability of a ribonucleoprotein (RNP) complex comprising a gRNA and an RNA-guided nuclease can be measured by DSF. The DSF technique measures the thermal stability of a protein, which can be increased under favorable conditions, such as the addition of a binding RNA molecule, e.g., gRNA.

[0228] The DSF assay can be performed according to any suitable protocol and can be used in any suitable setting, including, but not limited to, (a) testing different conditions (e.g., different stoichiometric ratios of gRNA:RNA-guided nuclease protein, different buffers, etc.) to identify optimal conditions for RNP formation; and (b) testing modifications (e.g., chemical modifications, sequence modifications, etc.) of the RNA-guided nuclease and / or gRNA to identify modifications that improve RNP formation or stability. One readout of the DSF assay is the change in melting temperature of the RNP complex; a relatively high change suggests that the RNP complex is more stable (and therefore may have greater activity, or more favorable formation kinetics, disassembly kinetics, or another functional property) compared to a standard RNP complex characterized by a lower change. When the DSF assay is deployed as a screening tool, a threshold melting temperature change can be identified, whereby the result is one or more RNPs that have a melting temperature change equal to or greater than the threshold. For example, the threshold can be 5-10°C (e.g., 5°C, 6°C, 7°C, 8°C, 9°C, 10°C) or more, and the result can be one or more RNPs characterized by a melting temperature shift above the threshold.

[0229] Two non-limiting examples of DSF assay conditions are as follows: To determine the best solution for forming RNP complexes, a fixed concentration (e.g., 2 μM) of Cas9+10×SYPRO Orange® (Life Technologies, Catalog No. S-6650) in water is dispensed into a 384-well plate. Then, equimolar amounts of gRNA diluted in solutions with various pH and salt are added. After 10 minutes of incubation at room temperature and brief centrifugation to remove any air bubbles, a gradient is run from 20° C. to 90° C. in 1° C. increments every 10 seconds using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ Thermal Cycler with Bio-Rad CFX Manager software.

[0230] The second assay consists of mixing various concentrations of gRNA with a fixed concentration (e.g., 2 μM) of Cas9i in optimal buffer from assay 1 above and incubating in a 384-well plate (e.g., 10 min at room temperature). An equal volume of optimal buffer + 10x SYPRO Orange® (Life Technologies, Cat. No. S-6650) is added and the plate is sealed with Microseal® B adhesive (MSB-1001). After a brief centrifugation to remove any air bubbles, a gradient is run from 20°C to 90°C in 1°C increments every 10 seconds using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ Thermal Cycler with Bio-Rad CFX Manager software.

[0231] Genome editing strategies Using the genome editing system described above, in various embodiments of the present disclosure, editing (i.e., modifying) within a target region of DNA in a cell or obtained from a cell. A variety of strategies for making specific edits are described herein, and these strategies are generally described by the desired repair outcome, the number and location of individual edits (e.g., SSBs or DSBs), and the target sites of such edits.

[0232] Genome editing strategies involving the formation of SSBs or DSBs are characterized by repair outcomes including: (a) deletion of all or part of the target region; (b) insertion into or replacement of all or part of the target region; or (c) disruption of all or part of the target region. This grouping is not intended to limit or be bound by any particular theory or model, but is provided solely for economy of presentation. Those skilled in the art will understand that the listed outcomes are not mutually exclusive, and some repairs may result in other outcomes. Description of a particular editing strategy or method should not be understood to require a particular repair outcome unless otherwise specified.

[0233] Replacement of the target region generally involves the replacement of all or part of the sequence present in the target region with a homologous sequence, for example, through gene correction or gene conversion, which are two repair outcomes mediated by the HDR pathway. HDR is facilitated by the use of a donor template, which can be single-stranded or double-stranded, as described in more detail below. The single-stranded or double-stranded templates can be exogenous, in which case they facilitate gene correction, or they can be endogenous (e.g., a homologous sequence in the cell genome), and facilitate gene conversion. The exogenous template can have an asymmetric overhang (i.e., the portion of the template that is complementary to the site of the DSB can be offset in the 3' or 5' direction, rather than being centrally located within the template), as described, for example, by Richardson et al. (Nature Biotechnology 34,339-344 (2016), (Richardson), incorporated by reference). If the template is single stranded, it can correspond to either the complementary (top) or non-complementary (bottom) strand of the target region.

[0234] Gene constructs In some aspects, the present disclosure provides engineered cells with complex editing strategies, and consequently complex genomic modifications, that enable the generation of advanced NK cell products for clinical applications, such as, for example, immuno-oncology therapeutic approaches.

[0235] In some embodiments, the genomic modification is introduced by the use of one or more HDR expression constructs. In some embodiments, the genomic modification is introduced by the use of one or more HDR expression constructs. In some embodiments, the one or more HDR expression constructs comprise one or more donor HDR templates. In some embodiments, the one or more donor HDR templates comprise one or more expression cassettes encoding one or more cDNAs. In some embodiments, the donor HDR template comprises one expression cassette. In some embodiments, the donor HDR template comprises two expression cassettes. In some embodiments, the donor HDR template comprises three expression cassettes. In some embodiments, the donor HDR template comprises four expression cassettes. In some embodiments, the donor HDR template comprises five expression cassettes. In some embodiments, the donor HDR template comprises six expression cassettes. In some embodiments, the donor HDR template comprises seven expression cassettes. In some embodiments, the donor HDR template comprises 8 expression cassettes. In some embodiments, the donor HDR template comprises 9 expression cassettes. In some embodiments, the donor HDR template comprises 10 expression cassettes. In some embodiments, one or more expression cassettes are monocistronic. In some embodiments, one or more expression cassettes are bicistronic.

[0236] In some embodiments, the one or more expression cassettes comprise one cDNA. In some embodiments, the one or more expression cassettes comprise two cDNAs. In some embodiments, the one or more expression cassettes comprise three cDNAs. In some embodiments, the one or more expression cassettes comprise four cDNAs. In some embodiments, the one or more expression cassettes comprise five cDNAs. In some embodiments, the one or more expression cassettes comprise six cDNAs. In some embodiments, the one or more expression cassettes comprise seven cDNAs. In some embodiments, the one or more expression cassettes comprise eight cDNAs. In some embodiments, the one or more expression cassettes comprise nine cDNAs. In some embodiments, the one or more expression cassettes comprise ten cDNAs. In some embodiments, the one or more expression cassettes comprise one or more cDNAs separated by a 2A sequence. In some embodiments, the one or more expression cassettes comprise two cDNAs separated by a 2A sequence. In some embodiments, the one or more expression cassettes comprise three cDNAs separated by a 2A sequence.

[0237] In some embodiments, the HDR expression construct comprises one or more cDNAs driven by a heterologous promoter.

[0238] In some embodiments, the one or more expression cassettes comprise cDNA for expression of one or more genes listed in Table 10.

[0239] In some embodiments, the HDR expression construct comprises one or more donor templates for inserting inactivating mutations into a target gene, the gene product having less or no function (partially or completely inactivated). In some embodiments, the HDR expression construct comprises one or more donor templates for inserting inactivating mutations into a target gene, the gene product having no function (completely inactivated).

[0240] In some embodiments, the modified cells of this disclosure comprise at least one exogenous nucleic acid construct encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of two or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of three or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of four or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of five or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of six or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of seven or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of eight or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of nine or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of ten or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10.

[0241] In some embodiments, the modified NK cells of this disclosure comprise at least one exogenous nucleic acid construct encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of two or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of three or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of four or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of five or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of six or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of seven or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of eight or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of nine or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of this disclosure comprise any combination of ten or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10.

[0242] In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least one or more genes listed in Table 11, or any combination of two or more thereof. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least two or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least three or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least four or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least five or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least six or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least seven or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least eight or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least nine or more genes listed in Table 11. In some embodiments, the modified cells of the disclosure exhibit loss of function of at least 10 or more genes listed in Table 11.

[0243] In some embodiments, the modified NK cells of this disclosure exhibit a loss of function of at least one or more genes listed in Table 11, or any combination of two or more thereof. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least two or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least three or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least four or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least five or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least six or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least seven or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least eight or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure exhibit a loss of function of at least nine or more genes listed in Table 11. In some embodiments, the modified cells of the disclosure exhibit loss of function of at least 10 or more genes listed in Table 11.

[0244] In some embodiments, the modified cells of this disclosure comprise at least one exogenous nucleic acid construct encoding a cDNA of one or more genes listed in Table 10 and exhibit a loss of function of at least one gene listed in Table 11. In some embodiments, the modified cells of this disclosure comprise any combination of two or more exogenous nucleic acid constructs encoding one or more genes listed in Table 10 and the cDNA of at least one gene listed in Table 11. In some embodiments, the modified cells of this disclosure comprise at least one exogenous nucleic acid construct encoding a cDNA of one or more genes listed in Table 10 and exhibit a loss of function of two or more genes listed in Table 11. In some embodiments, the modified cells of this disclosure comprise two or more exogenous nucleic acid constructs encoding a cDNA of one or more genes listed in Table 10 and exhibit a loss of function of two or more genes listed in Table 11.

[0245] As described in Ran and Cotta-Ramusino, gene conversion and correction are sometimes facilitated by creating one or more nicks within or around the target region. Sometimes, a double nickase strategy is used to create two offset SSBs, followed by a single DSB with an overhang (e.g., a 5' overhang).

[0246] The interruption and / or deletion of all or part of the target sequence can be achieved by various repair outcomes. As an example, the sequence can be deleted by simultaneously generating two or more DSBs flanking the target region, which are then excised when the DSBs are repaired, as described by Maeder for LCA10 mutations. As another example, the sequence can be interrupted by the formation of a double-stranded break with a single-stranded overhang, followed by a deletion generated by terminal nucleotide hydrolysis processing of the overhang before repair.

[0247] One particular subset of target sequence interruptions is mediated by the formation of indels in the target sequence, in which the repair outcome is typically mediated by the NHEJ pathway (including Alt-NHEJ). NHEJ is referred to as an "error-prone" repair pathway due to its association with indel mutations. However, in some cases, DSBs are repaired by NHEJ without alteration of the surrounding sequence (so-called "perfect" or "scarless" repair); this generally requires that both ends of the DSB are completely ligated. On the other hand, indels are thought to result from enzymatic processing of free DNA ends before they are ligated, which adds and / or removes nucleotides to one or both strands of one or both free ends.

[0248] Because enzymatic processing of free DSB ends can be stochastic in nature, indel mutations tend to be variable, occur along a distribution, and can be influenced by a variety of factors, including the specific target site, the cell type used, and the genome editing strategy used. Nevertheless, it is possible to make limited generalizations about indel formation: deletions formed by repair of a single DSB are most commonly in the range of 1-50 bp, but can be greater than 100-200 bp. Insertions formed by repair of a single DSB tend to be shorter, often containing short duplications of sequences immediately surrounding the break site. However, it is possible to obtain larger insertions, and in these cases the insertion sequence is often traced to other regions of the genome or to plasmid DNA present in the cell.

[0249] Indel mutations, and genome editing systems configured to generate indels, are useful for interrupting target sequences, for example, when the generation of a specific final sequence is not required and / or when frameshift mutations are tolerated. They may also be useful in situations where a specific sequence is preferred, insofar as the desired specific sequence tends to preferentially result from the repair of an SSB or DSB at a given site. Indel mutations are also useful tools for evaluating or screening the activity of specific genome editing systems and their components. In these and other settings, indels can be characterized by (a) their relative and absolute frequency in the genome of cells contacted with the genome editing system, and (b) the distribution of numerical differences, e.g., ±1, ±2, ±3, etc., relative to the unedited sequence. As an example, in a lead discovery setting, multiple gRNAs can be screened to identify the gRNA that most efficiently drives cleavage at the target site based on indel reads under controlled conditions. Guides that generate indels at or above a threshold frequency, or a specific distribution of indels, can be selected for further research and development. The frequency and distribution of indels can also be useful as a readout to evaluate different genome editing system implementations or formulations and delivery methods, for example, by keeping the gRNA constant and varying other specific reaction conditions or delivery methods.

[0250] Multiple Strategies While the above exemplary strategies focus on the repair outcome mediated by a single DSB, two or more DSBs may be generated at either the same or different loci using the genome editing system according to the present disclosure. Editing strategies including the formation of multiple DSBs or SSBs are described, for example, in Cotta-Ramusino. In some embodiments where multiple edits are made in the genome of the NK cell or the cell from which the NK cell is derived, the edits are made simultaneously or in close temporal proximity. In some such embodiments, the two or more genome edits are effected by two or more different RNA-guided nucleases. For example, one of the genome edits may be effected by saCas9 (in association with the respective saCas9 guide RNA) and a different genome edit may be effected by Cpf1 (in association with the respective Cpf1 guide RNA). In some embodiments, the use of RNA-guided nucleases in the context of different multiplex genome editing approaches is advantageous compared to using the same RNA-guided nuclease for two or more edits, and may reduce the likelihood or frequency of undesirable effects, such as off-target cleavage and the occurrence of genome translocations.

[0251] Donor Mold Design Donor template design is described in detail in, for example, Cotta-Ramusino. DNA oligomer donor templates (oligodeoxynucleotides or ODNs), which can be single-stranded (ssODN) or double-stranded (dsODN), can be used to facilitate HDR-based repair of DSBs, which is particularly useful for introducing modifications into target DNA sequences, inserting new sequences into target sequences, or completely replacing target sequences.

[0252] Whether single-stranded or double-stranded, the donor template will generally contain regions that are homologous to regions of DNA in or near (e.g., flanking or adjacent to) the target sequence to be cleaved. These regions of homology are referred to herein as "homology arms" and are shown diagrammatically below. [5' homology arm]--[substitution sequence]--[3' homology arm]

[0253] The homology arms may have any suitable length (including no nucleotides if only one homology arm is used), and the 3' and 5' homology arms may have the same length or may differ in length. Selection of the appropriate homology arm length may be influenced by various factors, such as a desire to avoid homology or microhomology with certain sequences, such as Alu repeat sequences or other highly common elements. For example, the 5' homology arm may be shortened to avoid sequence repeat elements. In other embodiments, the 3' homology arm may be shortened to avoid sequence repeat elements. In some embodiments, both the 5' and 3' homology arms may be shortened to avoid inclusion of certain sequence repeat elements. Additionally, some homology arm designs may improve editing efficiency or increase the frequency of the desired repair outcome. For example, Richardson et al. Nature Biotechnology 34, 339-344 (2016) (Richardson), incorporated by reference, found that the relative asymmetry of the 3' and 5' homology arms of a single-stranded donor template affects the rate and / or outcome of repair.

[0254] The replacement sequence in the donor template has been described elsewhere, including Cotta-Ramusino et al. The replacement sequence can be of any suitable length (including zero nucleotides when the desired repair outcome is a deletion) and typically includes one, two, three or more sequence modifications to the native sequence in the cell that is desired to be edited. One common sequence modification involves modifying the native sequence to repair a mutation associated with the disease or condition that is desired to be treated. Another common sequence modification involves modifying one or more sequences that are complementary to or code for the PAM sequence of the RNA-guided nuclease or the targeting domain of the gRNA used to generate the SSB or DSB, to reduce or eliminate recurrent cleavage of the target site after the replacement sequence is integrated into the target site.

[0255] When a linear ssODN is used, it can be configured to (i) anneal to a nicked strand of a target nucleic acid, (ii) anneal to an intact strand of a target nucleic acid, (iii) anneal to a plus strand of a target nucleic acid, and / or (iv) anneal to a minus strand of a target nucleic acid. The ssODN can have any suitable length, such as, for example, about, at least, or 150-200 nucleotides or less (e.g., 150, 160, 170, 180, 190, or 200 nucleotides).

[0256] It should be noted that the template nucleic acid can also be a nucleic acid vector, such as a viral genome, or a circular double-stranded DNA, such as a plasmid. The nucleic acid vector comprising the donor template can include other coding or non-coding elements. For example, the template nucleic acid can be delivered as part of a viral genome (e.g., in an AAV or lentiviral genome), including certain genomic backbone elements (e.g., inverted terminal repeats in the case of an AAV genome), and optionally including additional sequences encoding gRNAs and / or RNA-guided nucleases. In certain embodiments, the donor template can be flanked or flanked by target sites recognized by one or more gRNAs, facilitating the formation of free DSBs at one or both ends of the donor template, which can participate in the repair of the corresponding SSBs or DSBs formed in cellular DNA using the same gRNA. Exemplary nucleic acid vectors suitable for use as donor templates are described in Cotta-Ramusino.

[0257] Whatever format is used, the template nucleic acid can be designed to avoid undesired sequences, in certain embodiments, one or both homology arms can be shortened to avoid overlap with certain sequence repeat elements, e.g., Alu repeats, LINE elements, etc.

[0258] Quantitative measurement of on-target gene editing It should be noted that the genome editing system of the present disclosure allows for the detection and quantitative measurement of on-target gene editing outcomes, including targeted integration. The compositions and methods described herein may rely on the use of a donor template that comprises a 5' homology arm, a cargo, one or more priming sites, a 3' homology arm, and optionally a stuffer sequence. For example, WO 2019 / 014564 by Ramusino et al. (Ramusino), the entire contents of which are incorporated herein by reference, describes compositions and methods that allow for quantitative analysis of on-target gene editing outcomes, including targeted integration events, by embedding one or more primer binding sites (i.e., priming sites) in the donor template that are substantially identical to the priming sites present in the targeted genomic DNA locus (i.e., the target nucleic acid). The priming site is embedded in the donor template such that successful targeted integration of the donor template incorporates the priming site from the donor template into the target nucleic acid such that, if homologous recombination between the donor template and the target nucleic acid occurs, at least one amplicon can be generated to quantitatively determine the outcome of the on-target editing.

[0259] In some embodiments, the target nucleic acid comprises a donor template comprising a first priming site (P1) and a second priming site (P2); and a cargo sequence, a first priming site (P1'), and a second priming site (P2'), where P2' is located 5' from the cargo sequence, P1' is located 3' from the cargo sequence (i.e., A1--P2'-N--P1'-A2), where P1' is substantially identical to P1, and P2' is substantially identical to P2. After precise homology-driven targeted integration, three amplicons are generated using a single PCR reaction with two oligonucleotide primers. The first amplicon, amplicon X, is generated from the primer binding sites (P1 and P2) originally present in the genomic DNA, and may be sequenced and analyzed for on-target editing events that do not result in targeted integration (e.g., insertion, deletion, gene conversion). The remaining two amplicons are mapped to the 5' and 3' junctions after homology-driven targeted integration. The second amplicon, amplicon Y, results from the amplification of the nucleic acid sequence between P1 and P2' following the targeted integration event at the target nucleic acid, thereby amplifying the 5' junction. The third amplicon, amplicon Z, results from the amplification of the nucleic acid sequence between P1' and P2' following the targeted integration event at the target nucleic acid, thereby amplifying the 3' junction. Sequencing these amplicons provides a quantitative assessment of the targeted integration at the target nucleic acid, in addition to information about the fidelity of the targeted integration. To avoid any bias inherent in the size of the amplicon, a stuffer sequence may be optionally included in the donor template to keep all three expected amplicons the same length.

[0260] Implementation of genome editing systems: delivery, formulation, and routes of administration As discussed above, the genome editing system of the present disclosure can be implemented in any suitable manner, meaning that the components of the system, including but not limited to the RNA-guided nuclease, gRNA, any donor template nucleic acid, can be delivered, formulated, or administered in any suitable form or combination of forms that result in the transduction, expression, or introduction of the genome editing system and / or cause the desired repair result in a cell, tissue, or subject. The genome editing system according to the present disclosure can incorporate multiple gRNAs, multiple RNA-guided nucleases, and other components such as proteins, and various implementations will be apparent to those skilled in the art based on the principles shown in the system of the present disclosure. In some embodiments, the genome editing system of the present disclosure is delivered to a cell as a ribonucleoprotein (RNP) complex. In some embodiments, one or more RNP complexes are delivered to a cell sequentially in any order or simultaneously.

[0261] Nucleic acids encoding various elements of the genome editing system according to the present disclosure can be administered to a subject or delivered into a cell by methods known in the art or as described herein. For example, the DNA encoding the RNA-guided nuclease and / or the DNA encoding the gRNA, and the donor template nucleic acid can be delivered, for example, by a vector (e.g., a viral vector or a non-viral vector), a non-vector-based method (e.g., using naked DNA or DNA complexes), or a combination thereof. In some embodiments, the genome editing system of the present disclosure is delivered by AAV.

[0262] Nucleic acids encoding genome editing systems or components thereof can be delivered directly to cells as naked DNA or RNA, for example, by transfection or electroporation, or can be conjugated to molecules (e.g., N-acetylgalactosamine) that facilitate uptake by target cells (e.g., red blood cells, HSCs). In some embodiments, the genome editing systems of the present disclosure are delivered into cells by electroporation.

[0263] One promising solution for improving cell therapy process consists of direct delivery of active proteins into human cells. Protein delivery agent Feldan Shuttle is a protein-based delivery agent designed for cell therapy (Del'Guidice et al., PLoS One. 2018 Apr 4; 13(4): e0195558, which is incorporated by reference in its entirety). In some embodiments, the genome editing system of the present disclosure is delivered into cells by Feldan Shuttle.

[0264] The modified cells of the present disclosure may be administered by any known route of administration known to one of skill in the art at the time of filing this application. In some embodiments, the modified cells of the present disclosure are administered intravenously (IV). In some embodiments, the modified NK cells of the present disclosure are administered intravenously (IV).

[0265] As used herein, "dose" refers to a specific amount of a pharmacologically active substance to be administered to a subject at a given time. Unless otherwise specified, the doses described refer to NK cells with complex genomic modifications that allow for the generation of advanced NK cell products for clinical applications. In some embodiments, the dose of modified NK cells refers to an effective amount of modified NK cells. For example, in some embodiments, the dose or effective amount of modified NK cells is about 1×10 per dose. 9 ~5×10 9 modified NK cells, or approximately 2 x 10 9 ~5×10 9 In some embodiments, the dose or effective amount of modified NK cells is about 3×10 per dose. 9 ~5×10 9 modified NK cells, or approximately 4 x 10 9 ~5×10 9 The term refers to modified NK cells.

[0266] Generation of modified iNK cells Some aspects of the present disclosure relate to the generation of genetically modified NK cells derived from stem cells, e.g., from pluripotent cells such as HSCs, or derived from multipotent stem cells, e.g., from ES cells or iPS cells. In some embodiments where the genetically modified iNK cells are derived from iPS cells, the iPS cells are derived from somatic donor cells. In some embodiments where the genetically modified iNK cells are derived from iPS cells, the iPS cells are derived from pluripotent donor cells, e.g., from HSCs.

[0267] The genomic edits present in the final iNK cells may be made during the iPS cell state and / or at any stage of the process of reprogramming the donor cells to an iPS cell state, such as at any stage of the process of differentiating the iPS cells to an iNK state, such as, for example, an iPS cell-derived HSC state intermediate state, or up to a final iNK cell state, or to a final iNK cell state. In some embodiments, the one or more genomic edits present in the modified iNK cells provided herein are made prior to reprogramming the donor cells to an iPS cell state. In some embodiments, all edits present in the modified iNK cells provided herein are made simultaneously, close in time, and / or at the same cell stage of the reprogramming / differentiation process, such as, for example, at the donor cell stage, during the reprogramming process, at the iPS cell stage, or during the differentiation process. In some embodiments, two or more edits present in the modified iNK cells provided herein are made at different time points and / or at different cell stages of the reprogramming / differentiation process. For example, in some embodiments, an edit is made at the donor cell stage and a different edit is made at the iPS cell stage; in some embodiments, an edit is made at the reprogramming stage and a different edit is made at the iPS cell stage. These examples are provided to illustrate some of the strategies presented herein and are not intended to be limiting.

[0268] Various cell types can be used as donor cells that can be subjected to the reprogramming, differentiation, and genome editing strategies provided herein for the induction of modified iNK cells. The cells that can be subjected to the reprogramming, differentiation, and genome editing strategies provided herein can be any suitable cell type. For example, donor cells can be pluripotent stem cells or differentiated cells, such as somatic cells, such as fibroblasts or T lymphocytes.

[0269] In some embodiments, the donor cell is a human cell. In some embodiments, the donor cell is a non-human primate cell. In some embodiments, the donor cell is a mammalian cell. In some embodiments, the donor cell is a somatic cell. In some embodiments, the donor cell is a stem or progenitor cell. In certain embodiments, the donor cell is not part of a human embryo and its derivation does not involve the destruction of a human embryo.

[0270] In some embodiments, provided herein are iNK cells having one or more genomic alterations and methods of deriving such iNK cells (e.g., knocking out a gene undesirable for an immuno-oncological therapeutic approach and / or knocking in an exogenous nucleic acid, e.g., an expression construct encoding a gene product desirable for an immuno-oncological therapeutic approach). In some embodiments, the iNK cells are derived from iPS cells that are derived from somatic donor cells. Any suitable somatic cells may be used for the generation of iPS cells and, in turn, the generation of iNK cells. Suitable strategies for deriving iPS cells from a variety of somatic donor cell types have been described and are known in the art. In some embodiments, the somatic donor cells are fibroblasts. In some embodiments, the somatic donor cells are T cells.

[0271] For example, in some embodiments, the somatic donor cells from which iPS cells, and subsequently iNK cells, are derived are developmentally mature T cells (T cells that have undergone thymic selection). One characteristic of developmentally mature T cells is a rearranged T cell receptor locus. During T cell maturation, the TCR locus undergoes V(D)J rearrangement to generate complete V domain exons. These rearrangements are retained throughout the reprogramming of T cells into induced pluripotent stem (iPS) cells and throughout the differentiation of the resulting iPS cells into somatic cells.

[0272] In certain embodiments, the somatic donor cells are CD8 + T cells, CD8 + Naive T cells, CD4 + central memory T cells, CD8 + central memory T cells, CD4 + Effector memory T cells, CD4 + Effector memory T cells, CD4 + T cells, CD4 + Stem cell memory T cell, CD8 + Stem cell memory T cell, CD4 + Helper T cells, regulatory T cells, cytotoxic T cells, natural killer T cells, CD4+ naive T cells, TH17CD4 + T cells, TH1CD4 + T cells, TH2CD4 + T cells, TH9CD4 + T cells, CD4 + Foxp3 + T cells, CD4 + CD25 + CD127 - T cells, or CD4 + CD25 + CD127 - Foxp3 + T cells.

[0273] One advantage of using T cells to generate iPS cells is that T cells can be relatively easily edited, for example, by CRISPR-based methods or other gene editing methods. Another advantage of using T cells to generate iPS cells is that the rearranged TCR locus allows genetic tracking of individual cells and their daughter cells. If the reprogramming, proliferation, culture, and / or differentiation strategy involved in generating NK cells is the clonal expansion of a single cell, the rearranged TCR locus can be used as a genetic marker to unambiguously identify the cell and its daughter cells. This allows the characterization of a cell population as a true clone, or the identification of a mixed population, or the identification of contaminating cells within a clonal population.

[0274] A third advantage of using T cells to generate iNK cells with multiple edits is that certain karyotypic abnormalities associated with chromosomal translocations are selected for in T cell cultures. Such abnormalities raise concerns when editing cells with CRISPR technology, especially when generating cells with multiple edits.

[0275] A fourth advantage of using iPS cells derived from T cells as a starting point for deriving therapeutic lymphocytes is that it allows the expression of a prescreened TCR in lymphocytes, for example via selecting T cells for binding activity to a specific antigen, such as a tumor antigen, reprogramming the selected T cells into iPS cells, and then deriving lymphocytes from these iPS cells (e.g., T cells) that express the TCR. This strategy would also allow for activating TCRs in other cell types, for example by genetic or epigenetic strategies.

[0276] A fifth advantage of using T cell-derived iPS cells as the starting point for iNK differentiation is that the T cells retain at least part of their "epigenetic memory" throughout the reprogramming process, and therefore subsequent differentiation of the same or closely related cell type, such as iNK cells, may be more efficient and / or result in a higher quality cell population compared to approaches using unrelated cells, such as fibroblasts, as the starting point for iNK induction.

[0277] In certain embodiments, the donor cell being engineered, e.g., the reprogrammed cell and / or the cell whose genome has been edited, is selected from the group consisting of long term hematopoietic stem cells, short term hematopoietic stem cells, multipotent progenitor cells, lineage restricted progenitor cells, lymphoid progenitor cells, myeloid progenitor cells, common myeloid progenitor cells, erythroid progenitor cells, megakaryocyte erythroid progenitor cells, retinal cells, photoreceptor cells, rod cells, cone cells, retinal pigment epithelial cells, trabecular meshwork cells, cochlear hair cells, outer hair cells, inner hair cells, pulmonary epithelial cells, bronchial epithelial cells, alveolar epithelial cells, pulmonary epithelial progenitor cells, striated muscle cells, cardiac muscle cells, muscle satellite cells, neuronal cells, Neuronal stem cells, mesenchymal stem cells, induced pluripotent stem (iPS) cells, embryonic stem cells, fibroblasts, monocyte-derived macrophages or dendritic cells, megakaryocytes, neutrophils, eosinophils, basophils, mast cells, reticulocytes, B cells (e.g., precursor B cells, pre-B cells, pro-B cells, memory B cells, plasma B cells, etc.), gastrointestinal epithelial cells, bile duct epithelial cells, pancreatic duct epithelial cells, intestinal stem cells, hepatic parenchymal cells, hepatic stellate cells, Kupffer cells, osteoblasts, osteoclasts, adipocytes, preadipocytes, pancreatic islet cells (e.g., beta cells, alpha cells, delta cells), pancreatic exocrine cells, Schwann cells, or oligodendrocytes.

[0278] In certain embodiments, the donor cells are circulating blood cells, such as, for example, reticular cells, megakaryocyte erythroid progenitor (MEP) cells, myeloid progenitor cells (CMP / GMP), lymphoid progenitor (LP) cells, hematopoietic stem / progenitor cells (HSC), or endothelial cells (EC). In certain embodiments, the donor cells are bone marrow cells (e.g., reticular cells, erythroid cells (e.g., erythroblasts), MEP cells, myeloid progenitor cells (CMP / GMP), LP cells, erythroblast progenitor cells (EP), HSC, multipotent progenitor (MPP) cells, endothelial cells (EC), hemogenic endothelial (HE) cells, or mesenchymal stem cells). In certain embodiments, the donor cells are myeloid progenitor cells (e.g., common myeloid progenitor (CMP) cells or granulocyte macrophage progenitor (GMP) cells). In certain embodiments, the donor cells are lymphoid progenitor cells, such as, for example, common lymphoid progenitor cells (CLPs). In certain embodiments, the donor cells are erythroid progenitor cells (e.g., MEP cells). In certain embodiments, the donor cells are hematopoietic stem / progenitor cells (e.g., long-term HSCs (LT-HSCs), short-term HSCs (ST-HSCs), MPP cells, or lineage-restricted progenitor (LRP) cells). In certain embodiments, the donor cells are CD34 + cells, CD34 + CD90 + cells, CD34 + CD38 - cells, CD34 + CD90 + CD49f + CD38 - CD45RA - cells, CD105 + cells, CD31 + , or CD133 + Cells, or CD34 + CD90 + CD133 + In certain embodiments, the donor cells are cord blood CD34 + HSPC, umbilical vein endothelial cells, umbilical artery endothelial cells, amniotic fluid CD34 + Cells, amniotic fluid endothelial cells, placental endothelial cells, or placental hematopoietic CD34 + In certain embodiments, the donor cells are mobilized peripheral blood hematopoietic CD34 +cells (after the patient has been treated with a mobilizing agent such as G-CSF or plerixafor, for example). In certain embodiments, the donor cells are peripheral blood endothelial cells.

[0279] In some embodiments, the donor cells are dividing cells. In other embodiments, the donor cells are non-dividing cells.

[0280] In some embodiments, modified iNK cells resulting from the reprogramming, differentiation, and editing methods and strategies provided herein are administered to a subject in need thereof, e.g., in the context of an immuno-oncological therapeutic approach. In some embodiments, donor cells, or any cells at any stage of the reprogramming, differentiation, and editing strategies provided herein, can be maintained in culture or preserved using any suitable method known in the art (e.g., freezing in liquid nitrogen), e.g., for characterization or administration to a subject in need thereof.

[0281] Cell Reprogramming A cell with increased cellular differentiation potential has more developmental plasticity (i.e., can differentiate into more cell types) compared to the same cell in an unreprogrammed state, or in other words, the reprogrammed cell is in a less differentiated state than the same cell in an unreprogrammed state.

[0282] The reprogramming of cells of the present disclosure can be carried out by utilizing several methods. Examples of several methods for reprogramming somatic cells of the present disclosure are described in WO 2017 / 078807 to Valamehr et al. ("Valamehr") and WO 2010 / 108126 to Mendlein et al. ("Mendlein"), the contents of which are incorporated herein by reference in their entirety, without limitation.

[0283] Briefly, a method for directing differentiation of a pluripotent stem cell into a definitive hematopoietic lineage cell includes the steps of: (i) contacting a pluripotent stem cell with a composition comprising a BMP activator, and optionally bFGF, to initiate differentiation and proliferation of mesodermal cells from the pluripotent stem cell; (ii) contacting a mesodermal cell with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor (the composition optionally does not include a TGFβ receptor / ALK inhibitor), to initiate differentiation and proliferation of mesodermal cells having definitive HE differentiation potential from the mesodermal cell; (iii) contacting a mesodermal cell having definitive HE differentiation potential with a ROCK inhibitor; bFGF, The method may include contacting a composition comprising one or more growth factors and cytokines selected from the group consisting of VEGF, SCF, IGF, EPO, IL6, and IL11; and optionally a Wnt pathway activator (the composition optionally does not include a TGFβ receptor / ALK inhibitor) to initiate differentiation and proliferation of definitive hemogenic endothelium from mesodermal cells derived from pluripotent stem cells having the ability to differentiate into definitive hemogenic endothelial cells; and optionally exposing the pluripotent stem cells, mesodermal cells derived from pluripotent stem cells, mesodermal cells having hemogenic endothelium, and / or definitive hemogenic endothelial cells to a low oxygen tension of between about 2% and about 10%.

[0284] In some embodiments of the method for inducing differentiation of a pluripotent stem cell into a cell of hematopoietic lineage, the method further comprises contacting the pluripotent stem cell with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor (the composition does not include a TGFβ receptor / ALK inhibitor) to seed and expand the pluripotent stem cell. In some embodiments, the pluripotent stem cell is an iPSC. In some embodiments, the iPSC is a naive iPSC. In some embodiments, the iPSC comprises one or more genetic imprints, and the one or more genetic imprints contained in the iPSC are retained in the hematopoietic cells derived from the pluripotent stem cell differentiated therefrom.

[0285] In some embodiments of the method for directing differentiation of pluripotent stem cells into hematopoietic cells, the differentiation of the pluripotent stem cells into hematopoietic cells is void of embryoid body generation and in a monolayer culture format.

[0286] In some embodiments of the above method, the obtained pluripotent stem cell-derived definitive hemogenic endothelial cells are CD34+. In some embodiments, the obtained definitive hemogenic endothelial cells are CD34+CD43-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CD43-CXCR4-CD73-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CXCR4-CD73-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CD43-CD93-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CD93-.

[0287] In some embodiments of the above method, the method further comprises: (i) contacting the definitive hemogenic endothelium derived from the pluripotent stem cell with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of VEGF, bFGF, SCF, Flt3L, TPO, and IL7; and optionally, a BMP activator, to initiate differentiation of the definitive hemogenic endothelium into a pre-T cell precursor; and, optionally, (ii) contacting the pre-T cell precursor with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, and IL7, but not including one or more of VEGF, bFGF, TPO, a BMP activator, and a ROCK inhibitor, to initiate differentiation of the pre-T cell precursor into a T cell precursor or a T cell. In some embodiments of the method, the T cell precursor derived from the pluripotent stem cell is CD34+CD45+CD7+. In some embodiments of the methods, the pluripotent stem cell-derived T cell progenitors are CD45+CD7+.

[0288] In some further embodiments of the above methods for directing differentiation of pluripotent stem cells into hematopoietic lineage cells, the method further comprises: (i) contacting the definitive hemogenic endothelium derived from the pluripotent stem cell with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of VEGF, bFGF, SCF, Flt3L, TPO, IL3, IL7, and IL15; optionally, a BMP activator, to initiate differentiation of the definitive hemogenic endothelium into a pre-NK cell precursor; and optionally, (ii) contacting the pluripotent stem cell derived pre-NK cell precursor with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, IL3, IL7, and IL15, wherein the medium does not comprise one or more of VEGF, bFGF, TPO, BMP activators, and a ROCK inhibitor, to initiate differentiation of the pre-NK cell precursor into a NK cell precursor or a NK cell. In some embodiments, the pluripotent stem cell derived NK progenitor cells are CD3-CD45+CD56+CD7+. In some embodiments, the pluripotent stem cell derived NK cells are CD3-CD45+CD56+, and optionally further defined by NKp46+, CD57+, and CD16+.

[0289] In some further embodiments of the above methods for directing pluripotent stem cells to differentiate into NK cells, the method further comprises knocking out the gene Nrg1 in the pluripotent stem cells.

[0290] In some embodiments, the disclosure provides a method for initiating differentiation and proliferation of mesodermal cells from pluripotent stem cells, comprising: (i) contacting a pluripotent stem cell with a composition comprising a BMP activator, and optionally bFGF, to initiate differentiation and proliferation of mesodermal cells from the pluripotent stem cells; (ii) contacting a mesodermal cell with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, but not including a TGFβ receptor / ALK inhibitor, to initiate differentiation and proliferation of mesodermal cells having definitive HE differentiation potential from the mesodermal cells; (iii) contacting a mesodermal cell having definitive HE differentiation potential with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; and optionally a Wnt pathway activator, wherein the composition does not include a TGFβ receptor / ALK inhibitor, to initiate differentiation and proliferation of definitive hemogenic endothelium from mesodermal cells having definitive HE differentiation potential; and (iv) contacting a mesodermal cell having definitive HE differentiation potential with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; (v) contacting a pre-T cell precursor with a composition comprising a growth factor and a cytokine selected from the group consisting of one or more of SCF, Flt3L, and IL7, wherein the composition does not comprise one or more of VEGF, bFGF, TPO, a BMP activator, and a ROCK inhibitor, to initiate differentiation of the pre-T cell precursor into a T cell precursor or a T cell; and optionally exposing the seeded pluripotent stem cells, mesoderm cells, mesoderm cells with definitive HE differentiation potential, and / or definitive hemogenic endothelium to a low oxygen tension of between about 2% and about 10%. In some embodiments, group II of the above methods further comprises contacting iPSCs with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor, but not a TGFβ receptor / ALK inhibitor, to seed and expand the pluripotent stem cells, and / or wherein the pluripotent stem cells.In some embodiments, the pluripotent stem cell is an iPSC. In some embodiments, the iPSC is a naive iPSC. In some embodiments of the method, the differentiation of the pluripotent stem cell into T cell lineage lacks the generation of embryoid body and is in monolayer culture form.

[0291] In some embodiments, the disclosure provides a method for initiating differentiation and proliferation of mesodermal cells from pluripotent stem cells, comprising: (i) contacting the pluripotent stem cells with a composition comprising a BMP activator, and optionally bFGF, to initiate differentiation and proliferation of mesodermal cells from the pluripotent stem cells; (ii) contacting the mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, and optionally no TGFβ receptor / ALK inhibitor, to initiate differentiation and proliferation of mesodermal cells having definitive HE differentiation potential from the mesodermal cells; and (iii) contacting the mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, and optionally no TGFβ receptor / ALK inhibitor, to initiate differentiation and proliferation of mesodermal cells having definitive HE differentiation potential from the mesodermal cells. (iv) contacting mesodermal cells having the definitive HE differentiation potential with a composition comprising one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; a ROCK inhibitor; optionally a Wnt pathway activator; and optionally no TGFβ receptor / ALK inhibitor, and initiating differentiation and proliferation of pluripotent stem cell-derived definitive hematopoietic endothelium from pluripotent stem cell-derived mesodermal cells having definitive HE differentiation potential; (v) initiating differentiation of the pluripotent stem cell-derived pre-NK cell precursors into definitive hematopoietic endothelial pre-NK cell precursors; (vi) contacting the pluripotent stem cell-derived pre-NK cell precursors with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL3, IL7, and IL15; and optionally a BMP activator. and optionally exposing the seeded pluripotent stem cells, pluripotent stem cell-derived mesoderm cells, and / or definitive hemogenic endothelium to a low oxygen tension of about 2% to about 10%.In some embodiments, the method for generating Group II pluripotent stem cell-derived NK lineage cells further comprises contacting iPSCs with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor, but not a TGFβ receptor / ALK inhibitor, and seeding and expanding the iPSCs. In some embodiments, the iPSCs are naive iPSCs. In some embodiments, the method for generating pluripotent stem cell-derived NK lineage cells lacks the generation of embryoid bodies and is in a monolayer culture format.

[0292] In some embodiments, the present disclosure provides a method for the production of ... and optionally contacting a composition comprising one or more growth factors and cytokines selected from the group consisting of: F, IGF, EPO, IL6, and IL11; a ROCK inhibitor; optionally a Wnt pathway activator; and optionally no TGFβ receptor / ALK inhibitor; initiating differentiation and proliferation of pluripotent stem cell-derived definitive hemogenic endothelium from pluripotent stem cell-derived mesodermal cells having definitive HE differentiation potential; and optionally exposing the seeded pluripotent stem cells, pluripotent stem cell-derived mesodermal cells, and / or definitive hemogenic endothelium to a low oxygen tension of about 2% to about 10%. In some embodiments, the above method for generating definitive hemogenic endothelium from pluripotent stem cells further comprises contacting the iPSCs with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor, but not a TGFβ receptor / ALK inhibitor, and seeding and expanding the iPSCs; and / or the iPSCs are naive iPSCs. In some embodiments, the iPSCs comprise one or more genetic imprints, and the one or more genetic imprints contained in the iPSCs are retained in the definitive hemogenic endothelium derived from the pluripotent stem cells differentiated therefrom. In some embodiments, the above method for differentiating iPSCs into cells of definitive hemogenic endothelium lacks the generation of embryoid bodies and is in a monolayer culture form.

[0293] In some embodiments, the disclosure provides a method for initiating differentiation and proliferation of mesodermal cells derived from iPSCs, comprising: (i) contacting iPSCs with a composition comprising a BMP activator, and optionally bFGF, to initiate differentiation and proliferation of mesodermal cells derived from the iPSCs; (ii) contacting pluripotent stem cell-derived mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, but not including a TGFβ receptor / ALK inhibitor, to initiate differentiation and proliferation of mesodermal cells having definitive HE differentiation potential from the mesodermal cells; and (iii) contacting mesodermal cells having definitive HE differentiation potential with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; and optionally a Wnt pathway activator, wherein the composition does not include a TGFβ receptor / ALK inhibitor, to initiate differentiation and proliferation of definitive hemogenic endothelium from mesodermal cells having definitive HE differentiation potential. (iv) contacting the definitive hemogenic endothelium with a composition comprising one or more growth factors and cytokines selected from the group consisting of BMP activators, ROCK inhibitors, TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L, and IL11 to initiate differentiation of the definitive hemogenic endothelium into pre-HSCs; and (v) contacting the pre-HSCs with a composition comprising one or more growth factors and cytokines selected from the group consisting of BMP activators, TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L, and IL11 to initiate differentiation of the definitive hemogenic endothelium into pre-HSCs. The present invention provides a method for generating hematopoietic multipotent progenitor cells derived from pluripotent stem cells, comprising contacting the pre-HSCs with a composition comprising one or more growth factors and cytokines selected from the group consisting of CF, IL6, and IL11, but not including a ROCK inhibitor, to initiate differentiation of the pre-HSCs into hematopoietic multipotent progenitor cells; and optionally exposing the seeded pluripotent stem cells, mesoderm cells, and / or definitive hemogenic endothelium to a low oxygen tension of about 2% to about 10%. In some embodiments, the method for generating hematopoietic multipotent progenitor cells derived from pluripotent stem cells further comprises contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor, but not including a TGFβ receptor / ALK inhibitor, to seed and expand the pluripotent stem cells.In some embodiments, the pluripotent stem cell is an iPSC. In some embodiments, the iPSC is a naive iPSC. In some embodiments, the iPSC comprises one or more genetic imprints, and the one or more genetic imprints contained in the iPSC are retained in the hematopoietic multipotent progenitor cells derived from the pluripotent stem cell differentiated therefrom. In some embodiments, the differentiation of the pluripotent stem cell into the hematopoietic multipotent progenitor cells using the above method lacks the generation of embryoid bodies and is in a monolayer culture form.

[0294] In some embodiments, the present disclosure provides compositions comprising one or more cell populations generated from the culture platform disclosed herein: (i) CD34+ definitive hemogenic endothelial (iCD34) derived from pluripotent stem cells, where iCD34 cells have the capacity to differentiate into multipotent progenitor cells, T cell progenitors, NK cell progenitors, T cells, NK cells, NKT cells, and B cells, and iCD34 cells are CD34+CD43-; (ii) definitive hemogenic endothelial (iHE) cells, where iHE cells are CD34+; and at least one of CD43-, CD93-, CXCR4-, CD73-, and CXCR4-CD73-; (iii) definitive HSC derived from pluripotent stem cells, where iHSC are CD34+CD45+; (iv) hematopoietic multipotent progenitor cells derived from pluripotent stem cells. (v) progenitor T cell cells (wherein the T cell precursors are CD34+CD45+CD7+ or CD34-CD45+CD7+); (vi) T cells (wherein the T cells are CD45+CD3+CD4+ or CD45+CD3+CD8+); (vii) NK cell precursors (wherein the NK cell precursors are CD45+CD56+CD7+); (viii) NK cells (wherein the NK cells are CD3-CD45+CD56+ and optionally further defined by NKp46+, CD57+, and CD16+); (ix) NKT cells (wherein the NKT cells are CD45+Vα24Jα18+CD3+); (x) B cells (wherein the B cells are CD45+CD19+).

[0295] In some embodiments, the disclosure provides one or more cell lines, or clonal cells, generated using the methods disclosed herein: (i) CD34+ definitive hemogenic endothelial (iCD34) derived from pluripotent stem cells, where iCD34 cells have the capacity to differentiate into multipotent progenitor cells, T cell progenitors, NK cell progenitors, T cells, NK cells, and NKT cells, and iCD34 cells are CD34+CD43-; (ii) definitive hemogenic endothelial (iHE), where iHE cell lines or clonal cells are CD34+; and at least one of CD43-, CD93-, CXCR4-, CD73-, and CXCR4-CD73-; (iii) definitive HSC, where iHSC are CD34+CD45+; (iv) hematopoietic multipotent progenitor cells (iMPPs). (wherein the iMPP cells are CD34+CD45+); (v) T cell precursor cells (wherein the T cell precursor cells are CD34+CD45+CD7+ or CD34-CD45+CD7+); (vi) T cells (wherein the T cells are CD45+CD3+CD4+ or CD45+CD3+CD8+); (vii) NK cell precursor cells (wherein the NK cell precursor cells are CD45+CD56+CD7+); (viii) NK cells (wherein the NK cells are CD3-CD45+CD56+ and optionally further defined by NKp46+, CD57+, and CD16+); (ix) NKT cells (wherein the NKT cells are CD45+Vα24Jα18+CD3+); (x) B cells (wherein the B cells are CD45+CD19+).

[0296] In some embodiments, the disclosure provides a method of promoting hematopoietic self-renewal, reconstitution or engraftment using one or more of the cell populations, cell lines or clonal cells generated using the disclosed methods: (i) CD34+ definitive hemogenic endothelial (iCD34) from pluripotent stem cells (wherein the iCD34 cells have the capacity to differentiate into pluripotent progenitor cells, T cell progenitors, NK cell progenitors, T cells, NK cells, and NKT cells, and the iCD34 cells are CD34+CD43-); (ii) definitive hemogenic endothelial (iHE) (wherein the iHE cell line or clonal cells are CD34+; and at least one of CD43-, CD93-, CXCR4-, CD73-, and CXCR4-CD73-); (iii) definitive HSC (wherein the iHSC are CD34+CD45+); (iv) (v) hematopoietic multipotent progenitor cells (wherein the iMPP cells are CD34+CD45+); (v) T cell progenitor cells (wherein the T cell progenitor cells are CD34+CD45+CD7+ or CD34-CD45+CD7+); (vi) T cells (wherein the T cells are CD45+CD3+CD4+ or CD45+CD3+CD8+); (vii) NK cell progenitor cells (wherein the NK cell progenitor cells are CD45+CD56+CD7+); (viii) NK cells (wherein the NK cells are CD3-CD45+CD56+ and optionally further defined by NKp46+, CD57+, and CD16+); (ix) NKT cells (wherein the NKT cells are CD45+Vα24Jα18+CD3+); (x) B cells (wherein the B cells are CD45+CD19+).

[0297] In some embodiments, the disclosure provides a method of generating hematopoietic cells with enhanced therapeutic properties, the method comprising obtaining iPSCs comprising one or more genetic imprints; and directing differentiation of the iPSCs into hematopoietic cells. The directed differentiation further comprises: (i) contacting the pluripotent stem cells with a composition comprising a BMP pathway activator, and optionally bFGF, to obtain mesodermal cells; and (ii) contacting the mesodermal cells with a composition comprising a BMP pathway activator, bFGF, and a WNT pathway activator to obtain mesodermal cells with definitive hemogenic endothelial (HE) differentiation potential, the mesodermal cells with definitive hemogenic endothelial (HE) differentiation potential being capable of providing hematopoietic cells. Preferably, mesodermal cells and mesodermal cells with definitive HE differentiation potential are obtained in steps (i) and (ii) without a step of forming embryoid bodies, and the obtained hematopoietic lineage cells comprise definitive hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSCs), hematopoietic multipotent progenitor cells (MPPs), pre-T cell precursors, pre-NK cell precursors, T cell precursors, NK cell precursors, T cells, NK cells, NKT cells, or B cells. Furthermore, the hematopoietic lineage cells retain the genetic imprint contained in the iPSCs for directed differentiation.

[0298] In some embodiments, the directed differentiation step of the above method comprises the steps of: (i) contacting mesodermal cells having definitive HE differentiation potential with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells; (ii) contacting the definitive HE cells with a composition comprising a BMP activator, and optionally a ROCK inhibitor, and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L, and IL11 to obtain hematopoietic multipotent progenitor cells (MPPs); and (iii) contacting the definitive HE cells with a composition comprising a BMP activator, and optionally a ROCK inhibitor, and one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, and IL7 to obtain hematopoietic multipotent progenitor cells (MPPs). and optionally one or more of a BMP activator, a ROCK inhibitor, TPO, VEGF, and bFGF to obtain pre-T cell precursors, T cell precursors, and / or T cells; or (iv) contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7, and IL15, and optionally one or more of a BMP activator, a ROCK inhibitor, VEGF, and bFGF to obtain pre-T cell precursors, T cell precursors, and / or T cells.

[0299] Briefly, the method may comprise the steps of reprogramming a mature origin T cell or B cell to obtain an induced pluripotent stem cell; and detecting the presence in the iPSC or hematopoietic cells derived therefrom of the same specific V(D)J recombination as that contained in the mature T cell or B cell from which the iPSC was generated. In some embodiments, the method further comprises isolating the iPSC or hematopoietic cells comprising the same V(D)J recombination as that of the mature T cell or B cell. In some embodiments, the method comprises, prior to reprogramming the origin cells, obtaining a mature origin T cell or B cell for reprogramming; and determining the V(D)J recombination contained in an immunoglobulin (Ig) or T cell receptor (TCR) specific for the mature origin T cell or B cell.

[0300] "Pluripotency factors" or "reprogramming factors" refer to agents that can increase the developmental potential of a cell, either alone or in combination with other agents. Pluripotency factors include, but are not limited to, polynucleotides, polypeptides, and small molecules that can increase the developmental potential of a cell. Exemplary pluripotency factors include, for example, transcription factors and small molecule reprogramming agents.

[0301] Several different cell types from all three germ layers have been shown to be suitable for somatic cell reprogramming, including, but not limited to, liver and stomach (Aoi et al., 2008); pancreatic beta cells (Stadtfeld et al., 2008); mature B lymphocytes (Hanna et al., 2008); human skin fibroblasts (Takahashi et al., 2007; Yu et al., 2007; Lowry et al., 2008; Aasen et al., 2008); meningeal cells (Qin et al., 2008); neural stem cells (DiSteffano et al., 2008); and neural progenitor cells (Eminli et al., 2008). Thus, the present disclosure contemplates, in part, methods for reprogramming and / or programming cells from any cell lineage.

[0302] The present disclosure contemplates, in part, altering the differentiation potential of a cell by contacting the cell with one or more inhibitors and / or activators to modulate the epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life and / or protein activity of components of cellular pathways relevant to determining or influencing cellular differentiation potential.

[0303] Thus, in various embodiments, the present disclosure uses predictable and highly controlled methods for gene expression that allow reprogramming or dedifferentiation and programming or differentiation of somatic cells in vitro or in vivo as discussed elsewhere herein. However, as described above, deliberate genetic manipulation of cells is not preferred as it can alter the cell genome and cause genetic or epigenetic abnormalities. In contrast, the compositions and methods of the present disclosure provide inhibitors and / or activators that non-genetically alter the differentiation potential of cells by mimicking the cell's intrinsic developmental potential pathway to achieve reprogramming and / or programming of the cell.

[0304] Small molecules in reprogramming Reprogramming of somatic cells into induced pluripotent stem cells has also been achieved by retroviral infection of defined genes (e.g., Oct-3 / 4, Sox-2, Klf-4, c-Myc, and Lin28) in combination with small molecules.

[0305] In some embodiments, the disclosure provides a method of altering the potency of a cell comprising contacting the cell with one or more inhibitors and / or activators, or a composition comprising the same, wherein the one or more inhibitors and / or activators modulate at least one component of a cellular pathway associated with the differentiation potential of the cell, thereby altering the differentiation potential of the cell. In certain embodiments, the one or more inhibitors and / or activators modulate one or more components of a cellular pathway associated with the differentiation potential of the cell, thereby altering the differentiation potential of the cell. In certain related embodiments, the modulation of the components is synergistic, enhancing the overall effectiveness of altering the differentiation potential of the cell. The differentiation potential of a cell may be altered to a higher differentiation potential state (e.g., from a differentiated cell to a pluripotent, multipotent, or totipotent cell) or to a lower differentiation potential state (e.g., from a totipotent, multipotent, or pluripotent cell to a differentiated somatic cell) compared to a basal differentiation potential state. In yet another embodiment, the differentiation potential of a cell may be altered more than once. For example, a cell may be first reprogrammed to a higher differentiation potential state and then programmed to a specific somatic cell.

[0306] In another embodiment, a method of the disclosure provides for increasing the differentiation potential of a cell, wherein the cell is reprogrammed or dedifferentiated to a totipotent state, comprising contacting the cell with a composition comprising one or more inhibitors and / or activators, wherein the one or more inhibitors and / or activators modulate at least one component of a cellular pathway associated with the totipotency of the cell, thereby increasing the differentiation potential of the cell to the totipotent state.

[0307] In certain embodiments, a method of increasing the differentiation potential of a cell to a pluripotent state comprises contacting the cell with one or more inhibitors and / or activators, where the one or more inhibitors and / or activators modulate at least one component of a cellular pathway associated with the differentiation potential of the cell, thereby increasing the differentiation potential of the cell to a pluripotent state.

[0308] In another specific embodiment, a method of increasing the differentiation potential of a cell to a pluripotent state comprises contacting the cell with one or more inhibitors and / or activators, where the one or more inhibitors and / or activators modulate at least one component of a cellular pathway associated with the differentiation potential of the cell, thereby increasing the differentiation potential of the cell to a pluripotent state.

[0309] In certain embodiments, the method of increasing the differentiation potential of a cell further comprises contacting the totipotent, pluripotent or multipotent cell with a second composition, wherein the second composition modulates at least one component of the differentiation potential pathway of the cell to reduce the totipotency, pluripotency or pluripotency of the cell and differentiate the cell into a mature somatic cell.

[0310] In another related embodiment, the present disclosure provides a method of reprogramming a cell comprising contacting a cell with a composition comprising one or more inhibitors and / or activators, wherein the one or more inhibitors and / or activators modulate at least one component of a cellular pathway or pathway associated with cellular reprogramming, thereby reprogramming the cell.

[0311] In other embodiments, the present disclosure provides a method of dedifferentiating a cell to a higher potency state comprising contacting the cell with a composition comprising one or more activators, wherein the one or more inhibitors and / or activators modulate at least one component of a cellular pathway associated with dedifferentiation of the cell to a higher potency state, thereby dedifferentiating the cell to a non-differentiable state.

[0312] According to various embodiments of the present disclosure, the repressor may be an antibody or antibody fragment, an intrabody, a transbody, a DNAzyme, ssRNA, dsRNA, mRNA, antisense RNA, ribozyme, antisense oligonucleotide, pri-miRNA, shRNA, antagomir, aptamer, siRNA, dsDNA, ssDNA; a polypeptide or an active fragment thereof, a peptidomimetic, a peptoid, or a small organic molecule. Polypeptide-based repressors include, but are not limited to, fusion polypeptides. Polypeptide-based repressors also include transcription repressors, which may be fusion polypeptides and / or artificially designed transcription repressors, as described elsewhere herein.

[0313] According to various other embodiments, the activator may be an antibody or antibody fragment, mRNA, a bifunctional antisense oligonucleotide, dsDNA, a polypeptide or active fragment thereof, a peptidomimetic, a peptoid, or a small organic molecule.

[0314] In some embodiments, the inhibitor regulates at least one component of a cell's potency pathway by a) inhibiting at least one component; b) deinhibiting an inhibitor of the at least one component; or c) inhibiting an activator of the at least one component. In related embodiments, the one or more inhibitors may regulate at least one component in a pathway associated with cell potency by a) deinhibiting at least one component; b) inhibiting an inhibitor of the at least one component; or c) deinhibiting an activator of the at least one component.

[0315] In certain embodiments, the one or more repressors modulate at least one component of a cellular pathway associated with the differentiation potential of a cell by: a) repressing a histone methyltransferase or repressing at least one component's epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity; or b) derepressing a demethylase or activating at least one component's epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity.

[0316] In a related embodiment, the activator regulates at least one component of a cellular pathway associated with the differentiation potential of a cell by: a) activating at least one component; b) activating a repressor of a repressor of at least one component; or c) activating an activator of the at least one component.

[0317] In certain embodiments, the one or more activators modulate at least one component by: a) activating a histone demethylase or activating the epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity of at least one component; or b) activating a repressor of a histone methyltransferase or activating a repressor of the epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life and / or protein activity of at least one component.

[0318] In various other embodiments, the disclosure contemplates, in part, a method of reprogramming a cell comprising contacting a cell with one or more inhibitory factors, where the one or more inhibitory factors regulate at least one component of a cellular pathway or pathway associated with reprogramming of the cell, thereby reprogramming the cell.

[0319] In various other embodiments, the disclosure contemplates, in part, a method of reprogramming a cell comprising contacting the cell with a composition comprising one or more activating agents, where the one or more activating agents modulate at least one component of a cellular pathway or pathway associated with reprogramming the cell, thereby reprogramming the cell.

[0320] While some exemplary methods for reprogramming / NK cell differentiation are provided herein, these are exemplary and are not intended to limit the scope of the disclosure. Additional suitable methods for reprogramming / NK cell differentiation will be apparent to those of skill in the art based on the present disclosure in light of their knowledge in the art.

[0321] Methods for culturing NK cells on a feeder layer or with feeder cells are detailed, for example, in EP 3184109 by Valamehr et al. ("Valamehr"), which is incorporated herein by reference in its entirety.

[0322] In general, any type of NK cell population can be cultured using a variety of methods and devices. The choice of culture equipment is usually based on the scale and purpose of the culture. Scaling up of cell culture preferably involves the use of dedicated devices. Equipment for large-scale clinical grade NK cell production is detailed, for example, in Spanholtz et al. (PLoS ONE 2010;5:e9221) and Sutlu et al. (Cytotherapy 2010, Early Online 1-12).

[0323] The above-described methods for culturing an NK cell population in vitro can, inter alia, result in a cultured population of NK cells.

[0324] Editing Types Some aspects of the present disclosure provide NK cells with complex editing strategies, and consequently complex genomic modifications, that allow for the generation of advanced NK cell products for clinical applications, such as, for example, immuno-oncology therapeutic approaches. In some embodiments, the modified NK cells provided herein may serve as an off-the-shelf clinical solution for patients with or diagnosed with a hyperproliferative disease, such as, for example, cancer. In some embodiments, the modified NK cells exhibit enhanced survival, proliferation, NK cell response level, NK cell response duration, resistance to NK cell depletion, and / or target recognition, as compared to non-modified NK cells. For example, the modified NK cells provided herein may comprise genomic edits that result in expression of a chimeric antigen receptor (CAR) of interest, such as, for example, a CAR targeting mesothelin, EGFR, HER2, and / or MICA / B; which may express a CD16 variant, such as, for example, hnCD16; expression of an IL15 / IL15RA fusion; loss of function of TGFβ receptor 2 (TGFβR2); and / or expression of a dominant negative variant of TGFβR2; loss of function of ADORA2A; loss of function of B2M; expression of HLA-G; loss of function of CIITA; loss of function of PD1; loss of function of TIGIT; and / or loss of function of CISH; or any combination of two or more thereof, in the modified NK cell.

[0325] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0326] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, expression of soluble MICA and / or MICB, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0327] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, expression of soluble MICA and / or MICB, expression of exogenous IL-12, expression of exogenous IL-18, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0328] In some embodiments, the modified NK cells provided herein may comprise a genomic edit that results in, for example, expression of an exogenous CD16 variant such as hnCD16, expression of an IL15 / IL15RA fusion, expression of exogenous HLA-G, expression of exogenous DN-TGFβR2, expression of exogenous IL-12, expression of exogenous IL-18, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0329] The modified NK cells may exhibit one or more edits in the genome that result in a loss of function of a target gene, and / or one or more modifications that result in a gain of function or overexpression of a gene product, e.g., a protein, from an exogenous nucleic acid construct, e.g., an expression construct comprising a cDNA encoding the gene product, that is integrated into the genome of the modified NK cell or provided in an extrachromosomal manner, e.g., in the form of an episomal expression construct.

[0330] Loss of function of a target gene is characterized by a reduction in expression of the target gene based on a genomic modification, such as, for example, RNA-guided nuclease-mediated cut of the target gene, resulting in inactivation or reduced expression or function of the encoded gene product.

[0331] Gain of function of a gene product is characterized, for example, by increased expression (also referred to herein as overexpression) of a gene product, such as a protein, in a cell, which can include, for example, an increase in the expression level of the gene product, or expression of a gene product in a cell that does not express the gene product endogenously, e.g., from an endogenous gene.

[0332] In some embodiments, the increase in expression of gene product is achieved by introducing into cells an exogenous nucleic acid construct that encodes the gene product, such as an exogenous nucleic acid construct that comprises a cDNA that encodes the gene product under the control of a heterologous promoter.In some embodiments, the exogenous nucleic acid construct is integrated into a specific locus, for example, via HDR-mediated gene editing, as described in more detail elsewhere herein.Methods for effecting loss-of-function editing, as well as methods for increasing expression of gene product, for example, via RNA-guided nuclease technology, are well known to those skilled in the art.

[0333] Several exemplary gene products, one or more of which may be overexpressed in the modified NK cells provided in some embodiments of the present disclosure, are listed in Table 10 below.

[0334] [Table 40]

[0335] Several exemplary target genes, one or more of which are modified to exhibit loss-of-function in the modified NK cells provided in some embodiments of the present disclosure, are listed in Table 11 below.

[0336] [Table 41]

[0337] The present disclosure encompasses modified NK cells that exhibit any of the edits and / or increased expression of gene products listed in Tables 7 and 8, as well as any combination of such edits and / or increased expression of gene products listed in these tables. For example, the present disclosure should be understood to encompass embodiments in which modified NK cells are provided that comprise a single edit listed in Table 10 or Table 11, such as, for example, a loss of function of ADORA2A, or a loss of function of B2M, or an increased expression of HLA-G. The present disclosure should be understood to encompass embodiments in which modified NK cells are provided that comprise a single edit listed in Table 11, such as, for example, a loss of function of ADORA2A or a loss of function of B2M; and an increased expression of HLA-G, and an increased expression of a gene product listed in Table 10. It should further be understood that the present disclosure encompasses embodiments in which modified NK cells are provided that comprise two or more edits listed in Table 11, and an increased expression of a single gene product listed in Table 10. It should further be understood that the present disclosure encompasses embodiments in which modified NK cells are provided that comprise a single edit listed in Table 11 and increased expression of two or more gene products listed in Table 10. It should further be understood that the present disclosure encompasses embodiments in which modified NK cells are provided that comprise two or more edits listed in Table 11 and increased expression of two or more gene products listed in Table 10.

[0338] To illustrate some of the configurations of engineered NK cells encompassed by this disclosure, several exemplary non-limiting embodiments are provided below and elsewhere herein. In some embodiments, engineered NK cells are provided that exhibit a loss of function of ADORA2A. In some embodiments, engineered NK cells are provided that exhibit a loss of function of B2M. In some embodiments, engineered NK cells are provided that exhibit a loss of function of TGFbRII. In some embodiments, engineered NK cells are provided that exhibit a loss of function of ADORA2A and B2M. In some embodiments, engineered NK cells are provided that exhibit a gain of function of hnCD16. In some embodiments, engineered NK cells are provided that exhibit a gain of function of a CAR, e.g., CAR binding Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1, or a different target, e.g., as disclosed herein or otherwise known in the art. In some embodiments, engineered NK cells are provided that exhibit a gain of function of HLA-G. In some embodiments, engineered NK cells are provided that exhibit a gain of function of a single chain IL-15 / IL-15R fusion protein. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of hnCD16. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of a CAR, e.g., CAR binding Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1, or a different target, e.g., as disclosed herein or otherwise known in the art. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of HLA-G. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of a single chain IL-15 / IL-15R fusion protein. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of hnCD16 and a dominant negative TGFbRII variant.In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and a gain of function of a CAR, such as, for example, CAR binding Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1, or a different target, such as those disclosed herein or otherwise known in the art, and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and a gain of function of HLA-G and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and a gain of function of a single chain IL-15 / IL-15R fusion protein and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A, CISH, and B2M, and a gain of function of hnCD16 and HLA-G. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of a single chain IL-15 / IL-15R fusion protein, HLA-G, and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of hnCD16 and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of a CAR, e.g., CAR binding Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1, or a different target, e.g., as disclosed herein or otherwise known in the art, and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of HLA-G and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of a single chain IL-15 / IL-15R fusion protein and a dominant negative TGFbRII mutant.In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT, CISH, and B2M, and gain of function of hnCD16 and HLA-G. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of a single chain IL-15 / IL-15R fusion protein, HLA-G, and a dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A, TIGIT, PD-1, and B2M, and gain of function of a single chain IL-1 / IL-15R fusion protein, HLA-G, and a dominant negative TGFbRII variant.

[0339] It should be understood that the exemplary embodiments provided herein are intended to illustrate some examples of NK cells encompassed by the present disclosure. Additional configurations are encompassed that are not detailed herein for the sake of brevity, but such embodiments will be readily apparent to one of ordinary skill in the art based on the present disclosure.

[0340] Chimeric antigen receptors (CARs) As used herein, the term "chimeric antigen receptor" or "CAR" refers to a receptor protein that has been engineered to confer new capabilities to target specific proteins to cells expressing the CAR. Within the context of the present disclosure, NK cells engineered to comprise a CAR may be used in immunotherapy to target and destroy cells associated with a disease or disorder, such as, for example, cancer cells.

[0341] CARs of interest include, but are not limited to, CARs targeting mesothelin, EGFR, HER2, and / or MICA / B. To date, mesothelin-targeted CAR T cell therapy has shown early evidence of efficacy in Phase I clinical trials in subjects with mesothelioma, non-small cell lung cancer, and breast cancer (NCT02414269). Similarly, CARs targeting EGFR, HER2, MICA / B have shown promise in early studies (see, e.g., Li et al. (2018), Cell Death & Disease, 9(177); Han et al. (2018) Am. J. Cancer Res., 8(1):106-119; and Demoulin 2017) Future Oncology, 13(8), the entire contents of each of which are expressly incorporated herein by reference in their entirety).

[0342] CARs are well known to those of skill in the art and include, for example, those described in WO 13 / 063419 (mesothelin), WO 15 / 164594 (EGFR), WO 13 / 063419 (HER2), WO 16 / 154585 (MICA and MICB), the entire contents of each of which are expressly incorporated herein by reference in their entirety. Any suitable CAR, NK-CAR, or other binding agent that targets cells, such as NK cells, to target cells, such as, for example, cells associated with a disease or disorder, may be expressed in the modified NK cells provided herein. Exemplary CARs and binders include, but are not limited to, CARs and binders that bind to BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptides (i.e. E7), EBV viral peptides, CD70, WT1, CEA, EGFRvIII, IL13Rα2, and GD2, CA125, CD7, EpCAM, Muc16, CD30. Additional suitable CARs and binders for use in the engineered NK cells provided herein will be apparent to the skilled artisan based on this disclosure and general knowledge in the art. Such additional suitable CARs include those described in Figure 3 of Davies and Maher, Adoptive T-cell Immunotherapy of Cancer Using Chimeric Antigen Receptor-Grafted T Cells, Archivum Immunologiae et Therapiae Experimentalis 58(3):165-78 (2010), the entire contents of which are incorporated herein by reference.

[0343] The modified NK cells provided herein, in some embodiments, may comprise a CAR and a CD16 variant, e.g., hnCD16, or may comprise a CAR without a CD16 variant. Any cell expressing CD16 or a variant thereof would be suitable for combination therapy with, for example, a monoclonal antibody, e.g., a monoclonal antibody used in cancer therapy, or an Fc fusion protein that targets diseased cells.

[0344] Knock-ins and knock-outs In some embodiments, the modified cells may express one or more of exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, loss of function of TGFβR2, exogenous DN-TGFβR2, and / or loss of function of ADORA2A. In yet other embodiments, the modified cells may comprise a loss of function of B2M, exogenous HLA-G, loss of function of CIITA, loss of function of PD1, loss of function of TIGIT, or loss of function of CISH.

[0345] In some embodiments, the engineered cells may express one or more of exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0346] In some embodiments, the engineered cells may express one or more of exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, soluble MICA and / or MICB, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0347] In some embodiments, the engineered cells may express one or more of exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, exogenous IL-12, exogenous IL-18, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0348] In some embodiments, the engineered cells may express one or more of exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, exogenous IL-12, exogenous IL-18, soluble MICA and / or MICB, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0349] As used herein, the term "express" or "expression" refers to the process of producing a polypeptide, including transcription and translation. Expression may be increased by several approaches, including, for example, increasing the number of genes that encode the polypeptide, increasing transcription of the genes (such as by placing the genes under the control of a constitutive promoter), increasing translation of the genes and knocking out competing genes, or a combination of these and / or other approaches.

[0350] As used herein, the term "knock-in" refers to the addition of a targeted gene to a genetic locus in a cell.

[0351] As used herein, the term "knockout" refers to an inactivating mutation of a targeted gene, where the product of the targeted gene comprises a loss of function.

[0352] As used herein, the term "loss of function" refers to an inactivating mutation of a target gene, where the gene product has less or no function (partially or completely inactivated). As used herein, the term "complete loss of function" refers to an inactivating mutation of a target gene, where the gene product has no function (completely inactivated).

[0353] As used herein, the term "hnCD16a" refers to a high affinity, uncleavable mutant of CD16, a low affinity Fcγ receptor involved in antibody-dependent cellular cytotoxicity (ADCC). Typically, CD16 is cleaved during ADCC, and hnCD16CAR does not undergo this cleavage, thus maintaining the ADCC signal longer. In some embodiments, hnCD16a is disclosed in Blood 2016 128:3363, the contents of which are expressly incorporated herein by reference.

[0354] As used herein, the term "MICA / B" refers to MHC class I chain-related proteins A (MICA) and B (MICB), which are polymorphic proteins induced upon cellular stress, injury, or (malignant) transformation and function as a "kill me" signal via the natural killer group 2, member D receptor expressed on cytotoxic lymphocytes. MICA / B is not thought to be constitutively expressed by healthy normal cells, but expression has been reported in most tumor types. An exemplary sequence for MICA is set forth in NG_034139.1, and an exemplary sequence for MICB is set forth in NG_021405.1.

[0355] As used herein, the term "AAVSI" refers to adeno-associated integration site 1.

[0356] As used herein, the term "2A" refers to the self-cleaving 2A peptide.

[0357] As used herein, the term "TGFβRII" or "TGFbetaR2" refers to a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with TGF-β receptor type 1, and binds to TGF-β. This receptor / ligand complex phosphorylates proteins that then enter the nucleus and regulate the transcription of genes associated with cell proliferation, cell cycle arrest, wound healing, immunosuppression, and tumorigenesis. Exemplary sequences of TGFβRII are set forth in KR710923.1, NM_001024847.2, and NM_003242.5.

[0358] As used herein, the term "DN-TGFβRII" refers to a dominant-negative TGFβ receptor II (which can be expressed from an NK-specific promoter), where TGFβRII plays a key role in T cell differentiation and when KO'd in iPSCs inhibits CD34+ differentiation; KO must be performed later, but DN can be expressed from an NK-specific promoter (turned on after CD34+diff). In some embodiments, DN-TGFβRII is disclosed in Immunity. 2000 Feb;12(2):171-81, the contents of which are expressly incorporated herein by reference.

[0359] Strategies used by tumor cells to protect themselves from the effects of TGF-β can be engineered to protect tumor-specific cytotoxic T lymphocytes (CTLs) from the inhibitory effects of tumor-secreted TGF-β. Tumor-specific CTLs expressing dominant-negative TGFβ receptor II (e.g., TGFβRIIDNR sequence) have selective functional and survival advantages over unmodified CTLs in the presence of TGF-β-secreting tumors (Bollard et al., 2002 Blood. 2002 May 1; 99(9):3179-87, incorporated herein by reference in its entirety). Thus, in some embodiments, modified cells of the present disclosure express a DN-TGFβRII construct. In some embodiments, the DN-TGFβRII construct is driven by the EF1a long promoter. In some embodiments, the DN-TGFβRII construct is knocked into the ADORA2A locus using S. pyogenes gRNA. In some embodiments, the DN-TGFβRII construct comprises a TGFβRIIDNR sequence, followed immediately by a 2A sequence, followed by a truncated EGFR sequence (EGFRt) to allow tracking of cells that efficiently express the construct. In some embodiments, the DN-TGFβRII construct is generated as a long single-stranded DNA molecule. In some embodiments, the DN-TGFβRII construct is delivered to cells in RNPs. In some embodiments, the DN-TGFβRII construct is delivered to cells by AAV delivery (e.g., via AAV6).

[0360] As used herein, the term "neural cell adhesion molecule" (NCAM), also referred to as CD56, refers to a homophilic binding glycoprotein expressed on the surface of neurons, glial cells, and skeletal muscle, as well as certain cells of the hematopoietic system. Expression of CD56 is associated with, but not limited to, natural killer cells. Exemplary sequences of NCAM are set forth in NM_000615.6, NM_181351.4, NM_001076682.3, NM_001242608.1, and NM_001242607.1.

[0361] As used herein, the term "CISH" refers to cytokine-inducible SH2-containing proteins, see, e.g., Delconte et al., Nat Immunol. 2016 Jul;17(7):816-24, which is incorporated by reference in its entirety. An exemplary sequence for CISH is set forth as NG_023194.1.

[0362] As used herein, the term "IL-15 / IL15RA" or "interleukin-15" (IL-15) refers to a cytokine that is structurally similar to interleukin-2 (IL-2). Like IL-2, IL-15 binds to and signals through a complex consisting of the IL-2 / IL-15 receptor beta chain (CD122) and the common gamma chain (gamma-C, CD132). IL-15 is secreted by mononuclear phagocytes (and some other cells) following infection with a virus. This cytokine induces cell proliferation of natural killer cells, cells of the innate immune system whose main role is to kill virus-infected cells. IL-15 receptor alpha (IL15RA) specifically binds IL-15 with very high affinity and can bind IL-15 independently of the other subunits. This property suggests that IL-15 can be produced by one cell, taken up by another cell, and then presented to a third party cell. IL15RA has been reported to enhance cell proliferation and expression of the apoptosis inhibitors BCL2L1 / BCL2-XL and BCL2. Exemplary sequences for IL-15 are set forth in NG_029605.2 and exemplary sequences for IL-15RA are set forth in NM_002189.4.

[0363] IL-15 is a key cytokine that promotes NK cell proliferation and memory T cell homeostasis. IL-15 and its receptor chain, IL-15Ra, are essential for NK survival and do not stimulate regulatory T cells. IL-15 / IL-15Ra binds to the beta and gamma subunits of the IL-2 receptor, thereby activating JAK1 / 3 and STAT5. In some embodiments, modified cells (e.g., NK cells) of the present disclosure express exogenous IL-15 / IL-15Ra. In some embodiments, exogenous IL-15 / IL-15Ra is expressed as a membrane-bound IL15.IL15Ra complex as described in Imamura et al., Blood. 2014 Aug 14;124(7):1081-8 and Hurton LV et al., PNAS, 2016, which are incorporated by reference in their entireties. In some embodiments, exogenous IL-15 / IL-15Ra is expressed as a soluble IL15Ra.IL15 complex as described in Mortier E et al, JBC 2006; Bessard A, Mol Cancer Ther 2009; and Desbois M, JI 2016, which are incorporated herein by reference in their entirety. In some embodiments, modified cells (e.g., NK cells) of the present disclosure express membrane-bound IL15.IL15Ra complexes and soluble IL15Ra.IL15 complexes. In some embodiments, modified cells (e.g., NK cells) of the present disclosure express membrane-bound IL15.IL15Ra complexes with cleavable linkers. Knockout of CISH is associated with further enhancing IL-15 signaling as described in Delconte P, Nat Immunol 2016, which are incorporated herein by reference in their entirety. In some embodiments, modified cells (e.g., NK cells) of the present disclosure express loss of function of CISH. In some embodiments, modified cells (e.g., NK cells) of the present disclosure express exogenous IL-15 / IL-15Ra and loss of function of CISH.

[0364] As used herein, the term "ADORA2A" refers to the adenosine A2A receptor, which encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptor is a seven-transmembrane protein that responds to extracellular signals and activates intracellular signaling pathways. As an adenosine receptor of the A2A subtype, the protein uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) families of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, brain and kidney blood flow, immune function, pain control, and sleep. It has been implicated in pathophysiological conditions, such as inflammatory diseases and neurodegenerative disorders. An exemplary sequence of ADORA2a is described in NG_052804.1.

[0365] As used herein, the term "B2M" (β2 microglobulin) refers to a serum protein found in association with the heavy chain of major histocompatibility complex (MHC) class I on the surface of nearly all nucleated cells. The protein has a predominantly β-pleated sheet structure and can form amyloid fibrils in some pathological conditions. The encoded antimicrobial protein exhibits antimicrobial activity in amniotic fluid. An exemplary sequence for B2M is described in NG_012920.2.

[0366] As used herein, the term "CD32B" refers to the low affinity immunoglobulin gamma Fc region receptor II-b protein, which in humans is encoded by the FCGR2B gene. See, for example, Rankin-CT et al., CD32B, the human inhibitory Fc-gamma receptor IIB, as a target for monoclonal antibody therapy of B-cell lymphoma. Blood 2006 108(7):2384-91, the entire contents of which are incorporated herein by reference.

[0367] As used herein, the term "CD47", which may also be referred to as "integrin-associated protein" (IAP), refers to a transmembrane protein encoded by the CD47 gene in humans. CD47 belongs to the immunoglobulin superfamily, partners with membrane integrins, and also binds to the ligands thrombospondin-1 (TSP-1) and signal regulatory protein alpha (SIRPα). CD47 acts as a signal to macrophages, allowing CD47-expressing cells to escape macrophage attack. See, for example, Deuse-T, et al., Nature Biotechnology 2019 37:252-258, the entire contents of which are incorporated herein by reference.

[0368] As used herein, the term "HLA-E" refers to HLA class I histocompatibility antigen, alpha chain E, which may also be referred to as MHC class I antigen E. Human HLA-E protein is encoded by the HLA-E gene. Human HLA-E is a non-classical MHC class I molecule, characterized by limited polymorphism and lower cell surface expression than its classical paralogs. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is membrane anchored. HLA-E binds a limited subset of peptides derived from the leader peptides of other class I molecules. HLA-E expressing cells avoid allogeneic responses and lysis by NK cells. See, for example, Geornalusse-G et al., Nature Biotechnology 2017 35(8), the entire contents of which are incorporated herein by reference. Exemplary sequences of HLA-E proteins are described in NM_005516.6.

[0369] In some embodiments, two or more HLA class II histocompatibility antigen alpha chain genes and / or two or more HLA class II histocompatibility antigen alpha chain genes are knocked out, e.g., by genome editing, in the modified lymphocytes provided herein. For example, in some embodiments, two or more HLA class II histocompatibility antigen alpha chain genes selected from HLA-DQA1, HLA-DRA, HLA-DPA1, HLA-DMA, HLA-DQA2, and HLA-DOA are knocked out. As another example, in some embodiments, two or more HLA class II histocompatibility antigen beta chain genes selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5 are knocked out. See, e.g., Crivello et al., J Immunol January 2019, ji1800257; DOI: https: / / doi.org / 10.4049 / jimmunol.1800257, the entire contents of which are incorporated by reference herein.

[0370] As used herein, the term "HLA-G" refers to HLA non-classical class I heavy chain paralogs. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is membrane anchored. HLA-G is expressed on placental cells of fetal origin. HLA-G is a ligand for the NK cell inhibitory receptor KIR2DL4, and thus expression of this HLA by trophoblasts protects HLA from NK cell-mediated death. See, for example, Favier et al., Tolerogenic Function of Dimeric Forms of HLA-G Recombinant Proteins: A Comparative Study In Vivo PLOS One 2011, the entire contents of which are incorporated herein by reference. An exemplary sequence of HLA-G is set forth as NG_029039.1.

[0371] As used herein, the term "CIITA" refers to a protein located in the nucleus that acts as a positive regulator of class II major histocompatibility complex gene transcription and is referred to as the "master regulator" of the expression of these genes. The protein also binds GTP and uses the GTP binding to facilitate its transport into the nucleus. Once in the nucleus, it does not bind DNA and functions in a coactivator-like manner, utilizing its intrinsic acetyltransferase (AT) activity. Mutations in this gene have been associated with Bare Lymphocyte Syndrome Type II (also known as Hereditary MHC Class II Deficiency or HLA Class II Deficiency Combined Immunodeficiency), rheumatoid arthritis, multiple sclerosis, and possibly increased susceptibility to myocardial infarction. See, for example, Chang et al., J Exp Med 180:1367-1374; and Chang et al., Immunity. 1996 Feb;4(2):167-78, the entire contents of each of which are incorporated herein by reference. An exemplary sequence for CIITA is set forth as NG_009628.1.

[0372] As used herein, the term "PD1" programmed cell death protein 1, also known as CD279 (cluster of differentiation 279), refers to a protein found on the surface of cells that regulates the immune system's response to the body's cells by downregulating the immune system and promotes self-tolerance by suppressing inflammatory activity of T cells. This prevents autoimmune disease, but also prevents the immune system from killing cancer cells. Killing PD-1 is an immune checkpoint that prevents autoimmunity through two mechanisms. First, it promotes apoptosis (programmed cell death) of antigen-specific T cells in lymph nodes. Second, it reduces apoptosis of regulatory T cells (anti-inflammatory, inhibitory T cells). An exemplary sequence for PD1 is set forth as NM_005018.3.

[0373] As used herein, the term "TIGIT" refers to a member of the PVR (poliovirus receptor) family of immunoglobulin proteins. The product of this gene is expressed on several classes of T cells, including follicular B helper T cells (TFH). The protein has been shown to bind with high affinity to PVR; this binding is thought to aid in the interaction between TFH and dendritic cells to regulate T cell-dependent B cell responses. An exemplary sequence of TIGIT is set forth in NM_173799.4.

[0374] As used herein, the term "NLRC5" refers to the NOD-like receptor family CARD domain containing 5 intracellular proteins that play a role in the immune system. NLRC5 is a pattern recognition receptor that is believed to be involved in natural immunity against viruses by regulating interferon activity. An exemplary sequence of NLRC5 is listed as NM_032206.4.

[0375] As used herein, the term "CTLA4" refers to a member of the immunoglobulin superfamily that transmits inhibitory signals to T cells. The protein includes a V domain, a transmembrane domain, and a cytoplasmic tail. An exemplary sequence of CTLA4 is set forth as AF414120.1.

[0376] As used herein, the term "LAG3" refers to lymphocyte activation protein 3, which belongs to the Ig superfamily and contains four extracellular Ig-like domains. An exemplary sequence of LAG3 is set forth as NM_002286.6.

[0377] As used herein, the term "CBLB" refers to an E3 ubiquitin protein ligase that promotes proteosome-mediated protein degradation by transferring ubiquitin from an E2 ubiquitin-conjugating enzyme to a substrate. The encoded protein is involved in regulating immune responses by limiting T cell receptor, B cell receptor, and high affinity immunoglobulin epsilon receptor activation. An exemplary sequence of CBLB is set forth as KR709533.1.

[0378] As used herein, the term "NKG2A" refers to a protein belonging to the killer cell lectin-like receptor family, also referred to as the NKG2 family, a group of transmembrane proteins preferentially expressed in NK cells. This protein family is characterized by a type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1 / CD94, and is implicated in the recognition of MHC class I HLA-E molecules in NK cells. See, for example, Kamiya-T et al., J Clin Invest 2019 https: / / doi.org / 10.1172 / JCI123955, the entire contents of which are incorporated herein by reference. An exemplary sequence of NKG2A is set forth as AF461812.1.

[0379] As used herein, the term "CCR5" refers to a member of the beta chemokine receptor family, which is predicted to be a seven-transmembrane protein similar to G protein-coupled receptors. The protein is expressed by T cells and macrophages and is known to be an important co-receptor for the entry of macrophage-tropic viruses, including HIV, into host cells. An exemplary sequence for CCR5 is set forth as U54994.1.

[0380] As used herein, the term "SOCS" refers to a family of genes involved in the inhibition of the JAK-STAT signaling pathway.

[0381] As used herein, the term "BIM" refers to a pro-apoptotic member of the BCL-2 protein family that interacts with other members of the BCL-2 protein family, including BCL2, BCL2L1 / BCL-X(L), and MCL1, and functions as an activator of apoptosis.

[0382] As used herein, the term "FAS" refers to a member of the TNF receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death.

[0383] As used herein, the term "GITR" refers to tumor necrosis factor receptor superfamily member 18 (TNFRSF18), also known as activation-induced TNFR family receptor (AITR) or glucocorticoid-inducible TNFR-related protein, which has been implicated in the interaction between activated T lymphocytes and endothelial cells and in regulating T cell receptor-mediated cell death.

[0384] As used herein, the term "sortilin" refers to the VPS10-related sortilin family of proteins.

[0385] As used herein, the term "TIM3" refers to the T-cell immunoglobulin and mucin domain-containing-3 (TIM-3) protein, which in humans is encoded by the HAVCR2 gene.

[0386] As used herein, the term "CD96" or "TACTILE" refers to a type I membrane protein that plays a role in adhesive interactions of activated T cells and NK cells during the late stages of the immune response.

[0387] As used herein, the term "IL1R8" refers to a member of the interleukin-1 receptor family and is similar to the interleukin-1 accessory protein.

[0388] As used herein, the terms "KIR2DL1," "KIR2DL2," and "KIR2DL3" refer to killer cell immunoglobulin-like receptors (KIRs), transmembrane glycoproteins expressed by natural killer cells and a subset of T cells.

[0389] As used herein, the term "CDK8" refers to a member of the cyclin-dependent protein kinase (CDK) family that functions as a regulator of cell cycle progression.

[0390] As used herein, the term "CXCR3" refers to a G protein-coupled receptor with selectivity for three chemokines designated CXCL9 / Mig (interferon-g-inducible monokine), CXCL10 / IP10 (interferon-g-inducible 10 kDa protein), and CXCL11 / I-TAC (interferon-g-inducible T cell a-chemoattractant).

[0391] As used herein, the term "CCR7" refers to a member of the G protein-coupled receptor family that is expressed in various lymphoid tissues and activates B and T lymphocytes.

[0392] As used herein, the term "EP4" refers to a member of the G protein-coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T cell factor signaling.

[0393] As used herein, the term "IL-2" refers to interleukin-2, a secreted cytokine important in the proliferation of T and B lymphocytes.

[0394] As used herein, the term "IL-12" refers to interleukin-12, a cytokine that acts on T cells and natural killer cells.

[0395] As used herein, the term "IL-18" refers to interleukin-18, a proinflammatory cytokine primarily involved in polarized T helper 1 (Th1) and natural killer (NK) cell immune responses.

[0396] As used herein, the term "CXCR1" refers to a member of the G protein-coupled receptor family. This protein is the receptor for interleukin 8 (IL8).

[0397] As used herein, the term "CX3CR1" refers to a transmembrane protein and chemokine involved in leukocyte adhesion and migration.

[0398] As used herein, the term "mTRAIL" refers to a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein preferentially induces apoptosis in transformed and tumor cells.

[0399] As used herein, the term "TOSO" refers to the Fc fragment of the IgM receptor. As used herein, the term "CD16" refers to the receptor for the Fc portion of immunoglobulin G, which is involved in the removal of antigen-antibody complexes from the circulation as well as other antibody-dependent responses.

[0400] In some embodiments, modified cells are provided herein that exhibit loss of function of TRAC. The term "TRAC" refers to the T cell receptor alpha subunit (constant) encoded by the TRAC locus. Cells that exhibit loss of function of TRAC do not express a T cell receptor (TCR). In some embodiments, modified cells are provided herein, such as, for example, pluripotent or multipotent stem cells or their differentiated daughter cells (e.g., iNK cells), derived from cells that express TCR or derived from cells with a rearranged endogenous TCR locus, such as, for example, T cells. In some embodiments, such cells comprise a modification that results in loss of function of TRAC and therefore do not express a functional TCR. Suitable methods and compositions for causing loss of function of TRAC will be apparent to one of skill in the art based on the present disclosure. Such methods and compositions include, but are not limited to, those disclosed in PCT Application No. PCT / US2015 / 026504, entitled "CRISPR-CAS-related methods, compositions and components for cancer immunotherapy," PCT Application No. PCT / US2016 / 024353, entitled "CRISPR-CAS-related methods, compositions and components," and PCT Application No. PCT / US2017 / 020598, entitled "CRISPR-CPF1-related methods, compositions and components for cancer immunotherapy," the entire contents of each of which are incorporated by reference herein.

[0401] The present disclosure particularly encompasses variants of the above genes and CARs, including variants having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the above identified gene sequences. As used herein, the term "percent (%) sequence identity" or "percent (%) identity", which also includes "homology", is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to the amino acid residues or nucleotides of a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, without considering conservative substitutions as part of the sequence identity. Optimal alignment of sequences for comparison may be generated by means of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, by means of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, by means of the similarity search method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85, 2444, or by means of computer programs which use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA from the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0402] Knock-ins and knock-outs can be achieved by genome editing techniques, including CRISPR / Cas technology, known to those skilled in the art. Single-cut and multiplex editing strategies are suitable for achieving the desired product configurations provided herein, such strategies being described herein or otherwise known to those skilled in the art.

[0403] In some embodiments, exemplary modified cells, such as modified pluripotent cells or their differentiated progeny, such as iNK cells or other modified lymphocyte types, are evaluated for their ability to escape the immune system of a non-self host, such as a patient in need of immunotherapy. In some embodiments, such evaluation comprises an in vitro assay. Suitable in vitro assays for such evaluation are known to those of skill in the relevant art, and include, but are not limited to, a mixed lymphocyte reactivity (MLR) assay. For example, this assay and other suitable assays are described in Abbas et al., Cellular and Molecular Immunology, 7th edition, ISBN 9781437735734, the entire contents of which are incorporated herein by reference. Other suitable assays will be apparent to those of skill in the art in light of the present disclosure.

[0404] How to use A variety of diseases may be ameliorated by introducing the modified cells of the present invention into a subject. Examples of diseases include, but are not limited to, solid tumors, including, but not limited to, tumors of the brain, prostate, breast, lung, colon, uterus, skin, liver, bone, pancreas, ovary, testis, bladder, kidney, head, neck, stomach, cervix, rectum, larynx, or esophagus; and cancers, including, but not limited to, acute and chronic leukemia, lymphoma, multiple myeloma, and myelodysplastic syndromes, malignant hematological diseases.

[0405] Certain embodiments of the invention relate to methods of treating a subject in need thereof by administering to the subject a composition comprising any of the cells described herein. In certain embodiments, the terms "treat", "treatment" and the like are used herein generally to mean obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing the disease and / or therapeutic in terms of partially or completely curing the adverse effects attributable to the disease. As used herein, "treatment" covers any treatment of disease in a mammal, including preventing the disease from occurring in a subject who may be predisposed to the disease but has not yet been diagnosed as having it; inhibiting the disease, i.e., arresting its development; or relieving the disease, i.e., causing regression of the disease. The therapeutic agent or composition may be administered before, during, or after the onset of the disease or injury. Of particular interest in the treatment of ongoing disease is that the treatment stabilizes or reduces undesirable clinical symptoms in the patient.

[0406] In certain embodiments, the subject has a disease, condition, and / or injury that can be treated, ameliorated, and / or improved by cell therapy. In some embodiments, it is contemplated that the subject in need of cell therapy is a subject having an injury, disease, or condition whereby cell therapy, e.g., a treatment in which cellular material is administered to the subject, can treat, improve, ameliorate, and / or reduce the severity of at least one symptom associated with the injury, disease, or condition. In certain embodiments, subjects in need of cell therapy are contemplated, including, but not limited to, bone marrow or stem cell transplant candidates; subjects who have undergone chemotherapy or radiation therapy; subjects who have or are at risk of developing a proliferative disorder or cancer, e.g., a hematopoietic proliferative disorder or cancer; subjects who have or are at risk of developing a tumor, e.g., a solid tumor; subjects who have or are at risk of developing a viral infection or a disease associated with a viral infection.

[0407] According to the present invention further provides a pharmaceutical composition comprising hematopoietic cells derived from pluripotent cells produced by the methods and compositions disclosed herein, the pharmaceutical composition further comprising a pharmaceutically acceptable vehicle. In some embodiments, the pharmaceutical composition comprises T cells derived from pluripotent cells produced by the methods and compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises NK cells derived from pluripotent cells produced by the methods and compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises CD34HE cells derived from pluripotent cells produced by the methods and compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises HSCs derived from pluripotent cells produced by the methods and compositions disclosed herein.

[0408] The present invention further provides a therapeutic use of the above pharmaceutical composition by introducing the composition into a subject suitable for adoptive cell therapy, wherein the subject has an autoimmune disorder; a hematological malignancy; a solid tumor; or an infection associated with HIV, RSV, EBV, CMV, adenovirus, or BK polyomavirus.

[0409] The isolated pluripotent stem cell-derived hematopoietic cells may comprise at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% T cells, NK cells, NKT cells, CD34+HE cells, or HSC. In some embodiments, the isolated pluripotent stem cell-derived hematopoietic cells comprise about 95% to about 100% T cells, NK cells, NKT cells, CD34+HE cells, or HSC. In some embodiments, the invention provides pharmaceutical compositions comprising purified T cells, NK cells, NKT cells, CD34+HE cells, or HSC, e.g., compositions comprising an isolated population of about 95% T cells, NK cells, NKT cells, CD34+HE cells, or HSC, to treat a subject in need of cell therapy.

[0410] In some embodiments, the pharmaceutical composition comprises an isolated population of hematopoietic cells derived from pluripotent stem cells, wherein the population has less than about 0.1%, 0.5%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, or 30% iPSC-derived T cells, NK cells, NKT cells, CD34+HE cells, or HSC. The isolated population of induced hematopoietic cells in some embodiments may have more than about 0.1%, 0.5%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, or 30% T cells, NK cells, NKT cells, CD34+HE cells, or HSC. In other embodiments, the isolated population of induced hematopoietic cells may have about 0.1% to about 1%, about 1% to about 3%, about 3% to about 5%, about 10% to about 15%, about 15% to about 20%, about 20% to 25%, about 25% to 30%, about 30% to 35%, about 35% to 40%, about 40% to 45%, about 45% to 50%, about 60% to 70%, about 70% to 80%, about 80% to 90%, about 90% to 95%, or about 95% to about 100% T cells, NK cells, NKT cells, CD34+HE cells or HSCs.

[0411] In certain embodiments, the induced hematopoietic cells may comprise about 0.1%, about 1%, about 3%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, or about 100% T cells, NK cells, NKT cells, CD34+ HE cells or HSCs.

[0412] As those skilled in the art will appreciate, both autologous and allogeneic immune cells can be used for cell therapy. Autologous cell therapy can have reduced infection, reduced chance of GvHD, and rapid immune reconstitution. Allogeneic cell therapy can provide immune-mediated graft-versus-malaria (GVM) effects and reduced recurrence rates. Based on the specific condition of the patient or subject in need of cell therapy, those skilled in the art will be able to determine which specific type of therapy to administer.

[0413] In certain embodiments, the induced hematopoietic cells of the pharmaceutical composition of the present invention are allogeneic to the subject. In certain embodiments, the induced hematopoietic cells of the pharmaceutical preparation of the present invention are autologous to the subject. In the case of autologous transplantation, the isolated population of induced hematopoietic cells is either fully or partially HLA-matched to the patient. In another embodiment, the induced hematopoietic cells are not HLA-matched to the subject.

[0414] The induced hematopoietic cells provided by the present invention may be administered to a subject without ex vivo or in vitro expansion prior to administration. In certain embodiments, the isolated population of induced hematopoietic cells is regulated and treated ex vivo with one or more agents to obtain immune cells with improved therapeutic potential. The regulated population of induced hematopoietic cells may be washed to remove the therapeutic agent, and the improved population is administered to a patient without further expanding the population ex vivo.

[0415] In other embodiments, the invention provides an isolated population of induced hematopoietic cells that are expanded prior to modulating the isolated population or subpopulation of T lymphocytes with one or more agents. The isolated population of induced hematopoietic lineage cells can be recombinantly produced to express TCR, CAR or other proteins.

[0416] In the case of genetically engineered induced hematopoietic cells expressing recombinant TCRs or CARs, either before or after genetic modification of the cells, see, e.g., U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; and 7,144,575. The methods described in U.S. Pat. Nos. 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005 may be used to activate and proliferate cells.

[0417] cancer Cancers that are suitable therapeutic targets of the present disclosure include cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, eye, gastrointestinal, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. Furthermore, the cancer may be specifically of the following histological types, but is not limited to: malignant neoplasms; carcinomas; undifferentiated carcinomas; giant and spindle cell carcinomas; small cell carcinomas; papillary carcinomas; squamous cell carcinomas; lymphoepithelial carcinomas; basal cell carcinomas; calcifying cell carcinomas; transitional cell carcinomas; papillary transitional cell carcinomas; adenocarcinomas; malignant gastrinomas; cholangiocarcinomas; hepatocellular carcinomas; combined hepatocellular carcinomas and cholangiocarcinomas; trabecular adenocarcinomas; adenoid cystic carcinomas; adenocarcinomas in carcinoma adenomatous polyps; familial adenomatous polyposis adenocarcinomas; solid tumors; malignant carcinomas. Noid tumor;Branching duct alveolar adenocarcinoma;Papillary adenocarcinoma;Chromophobe carcinoma;Esinophilic carcinoma;Osinophilic adenocarcinoma;Basophilic carcinoma;Clear cell adenocarcinoma;Granular cell carcinoma;Follicular adenocarcinoma;Papillary and follicular adenocarcinoma;Noncapsular sclerosing carcinoma;Adrenal cortical carcinoma;Endometroid carcinoma;Skin adnexal carcinoma;Apocrine adenocarcinoma;Sebaceous gland adenocarcinoma;Ear canal adenocarcinoma;Mucinous epidermoid;Cystadenocarcinoma;Papillary cystadenocarcinoma;Papillary serous cystadenocarcinoma;Mucinous cystadenocarcinoma;Mucinous adenocarcinoma;Signet ring cell carcinoma;Invasive ductal carcinoma;Medullary carcinoma;Lobular carcinoma cancer;i...

Claims

1. (a) does not express endogenous CD3, CD4, and / or CD8; (b) (i) CD56 (NCAM), CD49, and / or CD45; (ii) NK cell receptor immunoglobulin gamma Fc region receptor III (FcγRIII, cluster of differentiation 16 (CD16)); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptors; or any combination of two or more thereof; moreover, （１） (i) chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of FcγRIII (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a mutant form thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R), or a mutant form thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen differentiation antigen group CD47 (CD47); or any combination of two or more thereof, and / or （２） (i) Transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more of them The modified lymphocyte exhibits loss of at least one function of:

2. The lymphocytes (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A The modified lymphocyte of claim 1 , which exhibits a loss of function of

3. 3. The modified lymphocyte of claim 1 or 2, wherein the lymphocyte comprises a rearranged endogenous T cell receptor (TCR) locus.

4. The modified lymphocyte of claim 3 , wherein the rearranged TCR comprises a rearrangement of a TCRα VJ and / or a TCRβ V(D)J section and a complete V domain exon.

5. The modified lymphocyte of claim 1, 2, 3, or 4, wherein the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

6. 6. The modified lymphocyte of any one of claims 1-5, wherein the IL-15R variant is a constitutively active IL-15R variant and / or the IL12-R variant is a constitutively active IL12-R variant.

7. 7. The modified lymphocyte of claim 6, wherein the constitutively active IL-15R variant is a fusion of IL-15R and an IL-15R agonist (IL-15RA) and / or the constitutively active IL-12R variant is a fusion of IL-12R and an IL-12R agonist (IL-12RA).

8. 8. The modified lymphocyte of claim 7, wherein the IL-15R agonist is IL-15 or an IL-15R-binding variant thereof; and / or the IL-12R agonist is IL-12 or an IL-12R-binding variant thereof.

9. 9. The modified lymphocyte of any one of claims 1 to 8, wherein the loss of TGFβR2 is associated with exogenous expression of a dominant negative mutant form of TGFβ receptor II (DN-TGFβR2).

10. 2. The modified lymphocyte of claim 1, wherein the CAR is capable of binding to mesothelin, EGFR, HER2, MICA / B, BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Mucl, HPV viral peptide (i.e., E7), EBV viral peptide, CD70, WT1, CEA, EGFRvIII, IL13Rα2, and GD2, CA125, CD7, EpCAM, Mucl6, or CD30.

11. The modified lymphocyte of any one of claims 1 to 10, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell.

12. The modified lymphocyte of claim 11 , wherein the pluripotent stem cell is a hematopoietic stem cell (HSC).

13. 12. The modified lymphocyte of claim 11, wherein the pluripotent stem cell is an induced pluripotent stem cell (iPSC).

14. The modified lymphocyte of claim 11 , wherein the pluripotent stem cell is an embryonic stem cell (ESC).

15. 12. The modified lymphocyte of any one of claims 1-11, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell comprising at least one or more exogenous nucleic acid constructs encoding any of (1)(i)-(1)(xi), or any combination thereof; and / or at least one genomic modification that results in a loss-of-function of any of (2)(i)-(2)(xi), or any combination thereof, in the lymphocyte.

16. 16. The modified lymphocyte of Claim 15, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell that comprises at least one genomic modification that results in a loss of function of any of (2)(i)-(2)(xi), or any combination thereof, in the lymphocyte.

17. 17. The modified lymphocyte of Claim 15 or Claim 16, wherein at least one genomic modification that results in a loss of function of one or more of (2)(i)-(2)(xi) in the lymphocyte comprises insertion of an exogenous nucleic acid construct.

18. 18. The modified lymphocyte of Claim 17, wherein the exogenous nucleic acid construct encodes any of (1)(i)-(1)(ix), or any combination thereof.

19. The modified lymphocyte of any one of claims 1 to 18, wherein the lymphocyte exhibits loss of function of two or more of the genes / proteins listed in (2).

20. 20. The modified lymphocyte of any one of claims 1-19, wherein the lymphocyte comprises an indel or insertion of an exogenous nucleotide construct into a genomic locus that harbors a gene or encodes a protein of (2).

21. 21. The modified lymphocyte of any one of claims 1-20, wherein the lymphocyte comprises an indel or insertion of an exogenous nucleotide construct into two or more genomic loci that harbor a gene or encode a protein of (2).

22. 22. The modified lymphocyte of any one of claims 1 to 21, wherein the lymphocyte is obtained by editing a genomic locus with an RNA-guided nuclease.

23. 23. The modified lymphocyte of claim 22, wherein the RNA-guided nuclease is a CRISPR / Cas nuclease.

24. The RNA-guided nuclease is SpCas9, SaCas9, (KKH)SaCas9, AsCpf1 (AsCas12a), LbC pf1, (LbCas12a), CasX, CasY, Cas12h1, Cas12i1, Cas12c1, Cas12c2, eSpC as9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, AaCas12b, e voCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9, BhCas12b, and BhCas12b 23. The modified lymphocyte of claim 22, selected from the group consisting of V4.

25. 25. The modified lymphocyte of any one of claims 1 to 24, wherein the lymphocyte is obtained by editing two or more genomic loci carrying genes encoding any of the proteins of (2).

26. The modified lymphocyte of Claim 25, wherein at least two of the two or more genomic loci harboring a gene encoding any of the proteins of (2) are edited by different RNA-guided nucleases.

27. 26. The modified lymphocyte of claim 25, wherein at least one of the two or more genomic loci harboring a gene encoding any of the proteins of (2) is edited by Cas9 and at least one of the loci is edited by Cpf1.

28. The modified lymphocyte of any one of claims 1 to 27, wherein the modified lymphocyte expresses endogenous CD56, CD49, and CD45.

29. The modified lymphocyte of any one of claims 1 to 28, wherein the lymphocyte is a natural killer (NK) cell.

30. （１） (i) chimeric antigen receptor (CAR); (ii) a non-naturally occurring variant of FcγRIII (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a mutant form thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R), or a mutant form thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen differentiation antigen group CD47 (CD47); or any combination of two or more thereof, and / or （２） (i) Transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof.

31. The modified cell comprises: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) The modified cell of claim 30, which exhibits loss of function of TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A.

32. The modified cell of claim 30 or 31, wherein the modified cell is an immune cell.

33. 33. The modified cell of claim 32, wherein the immune cell is a lymphocyte.

34. 34. The modified cell of claim 33, wherein the lymphocyte is a NK cell.

35. 31. The modified cell of claim 30, wherein the cell is a pluripotent stem cell, or a differentiated daughter cell derived therefrom.

36. 36. The modified cell of claim 34 or claim 35, wherein the modified cell does not express an endogenous T cell co-receptor.

37. 34. The modified cell of claim 33, wherein the lymphocyte is a T cell.

38. The modified cell of claim 30, wherein the cell comprises a rearranged endogenous TCR locus, and the rearranged TCR comprises a rearrangement of a TCRα VJ and / or a TCRβ V(D)J section and a complete V domain exon.

39. The modified cell comprises: (i) CD56 (NCAM), CD49, and / or CD45; (ii) FcγRIII (CD16); (iii) natural killer group 2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptors; or any combination of two or more of them 39. The modified cell of any one of claims 30 to 38, which expresses at least one endogenous gene encoding

40. 40. The modified cell of claim 39, wherein the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

41. The modified cell of any one of claims 30 to 40, wherein the cell expresses at least one NK cell biomarker.

42. 42. The modified cell of claim 41, wherein the NK cell biomarker is CD56, CD49, and / or CD45.

43. A cell population comprising a modified lymphocyte according to any one of claims 1 to 28, or a modified cell according to any one of claims 30 to 42.

44. A pharmaceutical composition comprising the cell population described in claim 43.

45. At least 1 x 10 ３ , at least 1 × 10 ４ , at least 1 × 10 ５ , at least 2 × 10 ５ , at least 3 × 10 ５ , at least 4 × 10 ５ , at least 5 × 10 ５ , at least 1 × 10 ６ , at least 2 × 10 ６ , at least 3 × 10 ６ , at least 4 × 10 ６ , at least 5 × 10 ６ , at least 1 × 10 ７ , at least 1 × 10 ７ , at least 2 × 10 ７ , at least 3 × 10 ７ , at least 4 × 10 ７ , at least 5 × 10 ７ , at least 1 × 10 ８ , at least 2 × 10 ８ , at least 3 × 10 ８ , at least 4 × 10 ８ , at least 5 × 10 ８ , at least 1 × 10 ９ , at least 1 × 10 ９ , at least 2 × 10 ９ , at least 3 × 10 ９ , at least 4 × 10 ９ , at least 5 × 10 ９ , at least 1 × 10 １０ , at least 2 × 10 １０ , at least 3 × 10 １０ , at least 4 × 10 １０ , at least 5 × 10 １０ , at least 1 × 10 １１ , or at least 1×10 １２ at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, at least 99.99%, at least 99.999%, or substantially 100% of the lymphocytes are (a) comprises a rearranged T cell receptor (TCR) locus; (b) does not express endogenous CD3; (c) expresses endogenous CD56 (NCAM), CD49, and / or CD45; (d) (i) FcγRIII (CD16); (ii) natural killer group 2 member D (NKG2D); (iii) CD69; (iv) natural cytotoxicity receptors; or any combination of two or more of them 1. An isolated population of lymphocytes in a population expressing at least one endogenous gene encoding （１） (i) chimeric antigen receptor (CR); (ii) a non-naturally occurring variant of the immunoglobulin gamma Fc region receptor III (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R), or a mutant form thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R), or a mutant form thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen differentiation antigen group CD47 (CD47); or any combination of two or more thereof, and / or （２） (i) Transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more thereof.

46. the modified lymphocytes comprising: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) the isolated population of lymphocytes described in claim 45, exhibiting loss of function of TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A.

47. 47. The isolated population of lymphocytes of claim 45 or 46, wherein the rearranged TCR locus comprises a rearrangement of a TCRαVJ and / or a TCRβV(D)J section and a complete V domain exon.

48. 48. The isolated ex vivo population of lymphocytes of claim 47, wherein said rearranged endogenous TCR locus consists of no more than two rearranged alleles.

49. 46. ​​The ex vivo population of isolated lymphocytes of claim 45, wherein the natural cytotoxicity receptor is NKp30, NKp44, NKp46, and / or CD158b.

50. 50. The ex vivo population of isolated lymphocytes of any one of claims 45-49, wherein the population does not contain more than 1%, more than 0.1%, more than 0.001%, more than 0.0001%, more than 0.00001%, more than 0.000001%, more than 0.0000001%, more than 0.00000001%, more than 0.000000001%, more than 0.000000001%, or more than 0.00000000001% of cells expressing reprogramming factors from an exogenous nucleic acid construct.

51. 51. The ex vivo population of isolated lymphocytes of claim 50, wherein said population does not include cells expressing reprogramming factors from an exogenous nucleic acid construct.

52. 52. The ex vivo population of isolated lymphocytes of claim 50 or claim 51, wherein said reprogramming factors are Oct-4 and / or Sox-2.

53. 46. ​​The ex vivo population of isolated lymphocytes of claim 45, wherein said population is free of cells harboring an episomal expression construct encoding a reprogramming factor.

54. 54. The ex vivo population of isolated lymphocytes of any one of claims 45 to 53, wherein each cell within the cell population comprises the same combination of (1) and (2).

55. the cell population is less than 0.001%, less than 0.002%, less than 0.003%, less than 0.004%, less than 0.005%, less than 0.006%, less than 0.007%, less than 0.008%, less than 0.009%, less than 0.01%, less than 0.02%, less than 0.03%, less than 0.04%, less than 0.05%, less than 0.06%, less than 0.07%, less than 0.08%, less than 0.09%, 55. The ex vivo population of isolated lymphocytes of any one of claims 45-54, comprising less than 1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% of cells carrying a chromosomal translocation.

56. 56. A method of treating a subject comprising administering to a subject in need thereof a lymphocyte according to any one of claims 1 to 29, a modified cell according to any one of claims 30 to 42, a cell population according to claim 41, a pharmaceutical composition according to claim 44, or an ex vivo population of isolated lymphocytes according to any one of claims 45 to 55.

57. 57. The method of claim 56, wherein the subject has or has been diagnosed with a proliferative disease.

58. 58. The method of claim 57, wherein the proliferative disease is cancer.

59. 59. The method of claim 58, wherein the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC), or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical and HPV+ head and neck cancers, oral cavity cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcoma, and hematological cancers such as ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

60. (a) obtaining induced pluripotent stem cells (iPSCs); (b) modifying the iPSCs, or undifferentiated or differentiated daughter cells thereof, to include expressing at least one exogenous nucleic acid expression construct of (1) and / or to include a loss-of-function of at least one gene of (2); (c) directing the differentiation of the iPSCs into hematopoietic lineage cells; 55. A method of generating an ex vivo population of lymphocytes according to any one of claims 1-29, modified cells according to any one of claims 30-42, the population of cells of claim 43, or isolated lymphocytes according to any one of claims 44-54, comprising:

61. The step of directing differentiation is (i) contacting iPSCs with a composition comprising a BMP pathway activator and optionally bFGF to obtain mesodermal cells; (ii) contacting said mesodermal cells with a composition comprising a BMP pathway activator, bFGF, and a WNT pathway activator to obtain mesodermal cells with definitive hematopoietic endothelial (HE) differentiation potential, said mesodermal cells with definitive hematopoietic endothelial (HE) differentiation potential being capable of providing hematopoietic lineage cells; Mesodermal cells and mesodermal cells with definitive HE differentiation potential are obtained in steps (i) and (ii) without a step of forming embryoid bodies; 61. The method of claim 60, wherein the hematopoietic cells comprise definitive hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSCs), hematopoietic multipotent progenitor cells (MPPs), pre-T cell precursors, pre-NK cell precursors, T cell precursors, NK cell precursors, T cells, NK cells, NKT cells, or B cells.

62. 62. The method of claim 61 , wherein the step of directing differentiation of iPSCs into hematopoietic cells further comprises contacting the mesodermal cells having definitive HE differentiation potential with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells.

63. 63. The method of claim 60, 61, or 62, further comprising contacting the definitive HE cells with a composition comprising a BMP activator, and optionally a ROCK inhibitor, and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L, and IL11, to obtain hematopoietic multipotent progenitor cells (MPPs).

64. 64. The method of any one of claims 60 to 63, further comprising the step of contacting said definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, and IL7, and optionally one or more of a BMP activator, a ROCK inhibitor, TPO, VEGF, and bFGF, to obtain pre-T cell precursors, T cell precursors, and / or T cells.

65. 64. The method of any one of claims 60-63, further comprising the step of contacting said definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7, and IL15, and optionally one or more of a BMP activator, a ROCK inhibitor, VEGF, and bFGF, to obtain pre-NK cell precursors, NK cell precursors, and / or NK cells.

66. 66. The method of any one of claims 60 to 65, further comprising, prior to step c), contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor to seed and expand the cells.

67. 66. The method of any one of claims 60 to 65, further comprising detecting a rearranged T cell receptor (TCR) locus in said hematopoietic cells.

68. 68. The method of claim 67, further comprising selecting the hematopoietic cell comprising the rearranged TCR locus based on the TCR encoded by the rearranged TCR locus binding to an antigen of interest.

69. 69. The method of claim 68, wherein the antigen of interest is a tumor antigen.

70. reprogramming the donor cells to a pluripotent state; editing a target locus in the donor cell genome; differentiating the reprogrammed donor cells into lymphocytes; The method comprising:

71. 71. The method of claim 70, wherein said editing is performed before or during the step of reprogramming said donor cells to a pluripotent state.

72. 72. The method of claim 70 or 71, wherein the donor cells are fibroblasts, peripheral blood cells, lymphocytes, or T cells.

73. （１） (i) a nucleic acid sequence encoding a chimeric antigen receptor (CAR); (ii) a nucleic acid sequence encoding a non-naturally occurring variant of FcγRIII (CD16); (iii) a nucleic acid sequence encoding interleukin 15 (IL-15); (iv) a nucleic acid sequence encoding the interleukin-15 receptor (IL-15R) or a variant thereof; (v) a nucleic acid sequence encoding interleukin 12 (IL12); (vi) a nucleic acid sequence encoding the interleukin 12 receptor (IL-12R) or a variant thereof; (vii) a nucleic acid sequence encoding human leukocyte antigen G (HLA-G); (viii) a nucleic acid sequence encoding human leukocyte antigen E (HLA-E); (ix) a nucleic acid sequence encoding the leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof. （２） (i) Transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1, PD-279); (vi) cytokine-inducible SH2-containing proteins (CISH); (vii) class II, major histocompatibility complex, transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) Differentiation antigen group 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant (TRAC); or any combination of two or more of them comprising an indel or insertion of exogenous nucleic acid in one or more of the loci of A method comprising differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the indels or insertions result in a loss of function of the gene product encoded by the respective locus.

74. Indels or insertions in the exogenous nucleic acid (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A and the indel or insertion results in a loss of function of a gene product encoded by the respective locus.

75. The method of claim 73 or claim 74, wherein the exogenous nucleic acid (2) is the exogenous nucleic acid (1).

76. 76. The method of claim 73 or claim 75, wherein the pluripotent stem cells are iPS cells.

77. 76. The method of claim 73 or claim 75, wherein the differentiating step comprises contacting the pluripotent stem cells with a differentiation medium or a series of differentiation media.

78. 30. The modified lymphocyte of any one of claims 1 to 29, wherein the two or more HLA class II histocompatibility antigen alpha chain genes are selected from HLA-DQA1, HLA-DRA, HLA-DPA1, HLA-DMA, HLA-DQA2, and HLA-DOA.

79. 30. The modified lymphocyte of any one of claims 1 to 29, wherein the two or more HLA class II histocompatibility antigen β chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5.

80. The modified lymphocyte of any one of claims 1 to 29 and 78 to 79, the modified cell of any one of claims 30 to 42, the cell population of claim 43, the pharmaceutical composition of claim 44, the ex vivo population of isolated lymphocytes of any one of claims 45 to 55, or the method of any one of claims 56 to 77, wherein the exogenous nucleic acid expression construct comprises a coding nucleic acid sequence recited in (1) under the control of a heterologous promoter.

81. 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, ex vivo population of isolated lymphocytes, or method of claim 80, wherein said heterologous promoter is a NK cell specific promoter.

82. 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, isolated ex vivo population of lymphocytes, or method of claim 80, wherein the NK cell-specific promoter is a promoter of a gene known to be specifically expressed in NK cells, or a variant thereof.

83. 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, isolated ex vivo population of lymphocytes, or method of claim 80, wherein the NK cell-specific promoter is a CD56 (NCAM), CD49, or CD45 promoter, or a variant thereof.

84. 81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, isolated ex vivo population of lymphocytes, or method of claim 80, wherein the NK cell-specific promoter is an FcγRIII promoter, an NKG2D promoter, a CD69 promoter, or a natural cytotoxicity receptor promoter, or a variant thereof.

85. 85. A method comprising the step of administering the modified lymphocytes, modified cells, or cell population of any one of claims 1 to 84 to a subject in need thereof.

86. 86. The method of claim 85, wherein the subject has or has been diagnosed with a proliferative disease.

87. 87. The method of claim 86, wherein the proliferative disease is cancer.

88. 88. The method of claim 87, wherein the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC), or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical and HPV+ head and neck cancers, oral cavity cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcoma, and hematological cancers such as ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

Images