Recombinant adeno-associated virus for treatment of grn-associated adult-onset neurodegeneration

Abstract

To provide a recombinant AAV (rAAV) suitable for use in treating adult onset neurodegeneration caused by granulin haploinsufficiency, such as progranulin (PGRN)-related frontotemporal dementia (FTD).SOLUTION: The rAAV comprises (a) an adeno-associated virus 1 (AAV1) capsid, and (b) a vector genome packaged in the AAV capsid, wherein the vector genome comprises AAV inverted terminal repeats, a coding sequence for human progranulin, and regulatory sequences which direct expression of the progranulin. Also provided is a method for treating a human patient having PGRN-FTD and other adult onset neurodegeneration caused by granulin haploinsufficiencies, the method comprising delivering to the central nervous system (CNS) a recombinant adeno-associated virus having an adeno-associated virus 1 capsid.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit and priority of U.S. Provisional Application No. 62 / 809,329, filed on February 22, 2019, U.S. Provisional Application No. 62 / 923,812, filed on October 21, 2019, and U.S. Provisional Application No. 62 / 969,108, filed on February 2, 2020, which are hereby incorporated by reference in their entirety for all purposes.

Background Art

[0002] Frontotemporal dementia (FTD) is a fatal neurodegenerative disease that typically appears in a person's 60s or 70s and is associated with impairments in executive function, behavior, speech, or language comprehension. These symptoms are related to characteristic patterns of brain atrophy that affect the frontal and temporal cortices. Patients generally show a progressive course, and the average survival time from symptom onset is 8 years (Coyle - Gilchrist IT, et al. Neurology. 2016;86(18):1736 - 43).

[0003] FTD is highly heritable, and approximately 40% of patients have a positive family history (Rohrer JD, et al. Neurology. 2009;73(18):1451 - 6). In 5 - 10% of FTD patients, pathogenic loss - of - function mutations can be identified in the granulin (GRN) gene, which encodes the ubiquitously expressed lysosomal protein progranulin (PGRN) (Rohrer JD, et al. Neurology. 2009;73(18):1451 - 6). Carriers of GRN mutations show rapid and extensive brain atrophy and may present with clinical features of other neurodegenerative diseases such as progressive supranuclear palsy, basal ganglia syndromes, Parkinson's disease, dementia with Lewy bodies, or Alzheimer's disease (Le Ber I, et al. Brain: a journal of neurology. 2008;131(3):732 - 46). GRN mutations are inherited in an autosomal - dominant form and have a penetrance of over 90% by the age of 70 (Gass J, et al. Human molecular genetics. 2006;15(20):2988 - 3001). Inheritance of a single GRN mutation causes FTD and other late - onset neurodegenerative diseases, but patients with homozygous loss - of - function mutations present with neuronal ceroid lipofuscinosis (NCL, Batten disease) at a much earlier stage of life, characterized by the accumulation of autofluorescent material (lipofuscin) within neuronal lysosomes, rapid cognitive decline, and retinal degeneration (Smith Katherine R, et al. American Journal of Human Genetics. 2012;90(6):1102 - 7). Patients heterozygous for GRN mutations have a much - delayed onset of symptoms but ultimately develop lysosomal storage lesions in the same brain and retina as NCL patients and similarly experience progressive neurodegeneration (Ward ME, et al. Science Translational Medicine. 2017;9(385), Gotzl JK, et al. Acta neuropathologica. 2014;127(6):845 - 60).Progranulin has recently been found to play an important role in lysosomal function by promoting the acidification of lysosomes and functioning as a chaperone for lysosomal proteases including cathepsin D (CTSD) (Beel S, et al. Human molecular genetics. 2017 Aug 1;26(15):2850-2863, Tanaka Y, et al. Human molecular genetics. 2017;26(5):969-88). Mutations in the gene encoding CTSD also result in the NCL phenotype and support the general pathophysiology associated with defective lysosomal protease activity (Siintola E, et al. Brain: a journal o. f neurology. 2006;129(Pt 6):1438-45).

[0004] Currently, there is no therapy that modifies the adult-onset neurodegenerative diseases caused by GRN haploinsufficiency. Disease management includes supportive care and symptomatic treatment aimed at reducing the behavioral, cognitive, and / or motor symptoms associated with the disease (Tsai and Boxer, 2016, J Neurochem. 138 Suppl 1:211-21). Furthermore, screening individuals with a family history of dementia may allow more patients to be reached at an earlier stage, but it is not currently applied considering the lack of treatment. Therefore, this disease spectrum represents an area with high unmet medical needs.

[0005] What is needed is a treatment for adult-onset neurodegenerative diseases associated with GRN haploinsufficiency and the symptoms associated therewith. SUMMARY OF THE INVENTION

[0006] Provided is a suitable recombinant adeno-associated virus (rAAV) for use in the treatment of neurodegeneration caused by progranulin (PGRN)-related frontotemporal dementia (FTD) and other adult-onset neurodegenerative diseases associated with GRN haploinsufficiency. The rAAV comprises an adeno-associated virus type 1 capsid and a vector genome packaged into the AAV capsid, the vector genome comprising AAV inverted terminal repeats (ITRs), a coding sequence encoding human progranulin, and regulatory sequences directing the expression of progranulin. In certain embodiments, the vector genome comprises AAV 5’ inverted terminal repeats (ITRs), a human PGRN coding sequence, regulatory elements directing its expression, and AAV 5’ ITRs.

[0007] Also provided is a pharmaceutical composition comprising an aqueous liquid and recombinant adeno-associated virus (rAAV). In certain embodiments, the aqueous liquid comprises an artificial cerebrospinal fluid comprising a surfactant suitable for intrathecal administration.

[0008] Provided is a method of treating a human patient having progranulin-related frontotemporal dementia (FTD) neurodegeneration or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency. The method comprises delivering an rAAV comprising a coding sequence of human progranulin to the central nervous system (CNS). A recombinant adeno-associated virus (rAAV) having an adeno-associated virus type 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence of human progranulin, and regulatory sequences directing the expression of progranulin.

[0009] rAAV1.hPGRN is provided for use in a method of treating a human patient having progranulin-related frontotemporal dementia (FTD) neurodegeneration or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency. The method comprises administering to the CNS a recombinant adeno-associated virus (rAAV) having an adeno-associated virus 1 (AAV1) capsid that targets upper layer cells and that further comprises a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human progranulin, and regulatory sequences that direct the expression of progranulin in upper layer cells. In one embodiment, secreted human progranulin is expressed following delivery of the rAAV1 gene therapy.

[0010] A method is provided for treating a human patient having a brain lesion associated with progranulin-related frontotemporal dementia (FTD) neurodegeneration or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency. The method comprises administering to the central nervous system (CNS) a recombinant adeno-associated virus (rAAV) having an adeno-associated virus 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human progranulin, and regulatory sequences that direct the expression of progranulin.

[0011] In certain embodiments, the methods provided herein may further comprise (a) non-invasively assessing the patient for a decrease in retinal storage lesions as a predictor of a decrease in brain lesions, (b) performing magnetic resonance imaging to evaluate brain volume, and / or (c) measuring the concentration of progranulin in the CSF.

[0012] These and other aspects of the invention will become apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0013]

Figure 1

Figure 2

Figures 3A - 3D

Figures 4A - 4G

Figures 5A - 5D

Figures 6A - 6C

Figures 7A - 7C

Figures 8A - 8C

Figure 9

Figure 10

Figures 11A - 11B

Figures 12A - 12D

Figure 13

Figure 14

Mode for Carrying Out the Invention

[0014] Recombinant AAVs (rAAVs) suitable for use in the treatment of neurodegenerative conditions associated with GRN-haploinsufficiency, such as progranulin (PGRN)-related frontotemporal dementia (FTD), and compositions containing them are provided. In certain preferred embodiments, the rAAV comprises an adeno-associated virus type 1 capsid and a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human progranulin, and regulatory sequences that direct the expression of progranulin. In certain embodiments, the vector genome comprises an AAV 5’ inverted terminal repeat (ITR), a human PGRN coding sequence, and regulatory elements that direct its expression, as well as an AAV 3’ ITR. Pharmaceutical compositions comprising an aqueous liquid and recombinant AAV (rAAV) are also provided. In certain embodiments, the aqueous liquid comprises an artificial cerebrospinal fluid containing a surfactant suitable for intrathecal administration. Also provided are methods for treating a human patient having PGRN-FTD and / or for treating a patient having a brain lesion associated with PGRN-FTD. In certain embodiments, methods for treating or reducing microgliosis in a patient are provided. The methods comprise delivering rAAV.PGRN to the central nervous system (CNS). In certain embodiments, the methods provided herein may further comprise monitoring the treatment by (a) non-invasively assessing the patient for a decrease in retinal accumulation lesions as a predictor of a decrease in brain lesions, (b) performing magnetic resonance imaging to assess brain volume, and / or (c) measuring the concentration of PGRN in the CSF. Optionally, the concentration of PGRN in the plasma may be measured.

[0015] As used herein, the terms “AAV.hPGRN” or “rAAV.hPGRN” are used to refer to a recombinant adeno-associated virus having an AAV capsid that has within it a vector genome comprising a coding sequence for human progranulin under the control of regulatory sequences. A particular capsid type may be specified; for example, AAV1.hPGRN refers to a recombinant AAV having an AAV1 capsid, and AAVhu68.hPGRN refers to an AAVhu Recombinant AAV having a capsid, and AAV5.hPGRN refers to recombinant AAV having an AAV5 capsid.

[0016] "Recombinant AAV" or "rAAV" is a DNAse-resistant viral particle comprising two elements, an AAV capsid, and a vector genome containing at least a non-AAV coding sequence packaged within the AAV capsid. Unless otherwise specified, this term can be used interchangeably with the phrase "rAAV vector". rAAV is a "replication-defective virus" or "replication-defective viral vector" because it lacks any functional AAV rep gene or functional AAV cap gene and cannot produce progeny. In certain embodiments, the only AAV sequences are the AAV inverted terminal repeats (ITRs), which are typically located at the 5' and 3' termini of the vector genome to enable the genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid.

[0017] As used herein, "vector genome" refers to the nucleic acid sequence packaged inside an rAAV capsid that forms a viral particle. Such nucleic acid sequence includes the AAV inverted terminal repeats (ITRs). In the examples herein, the vector genome includes, at least 5' to 3', an AAV 5' ITR, a coding sequence, and an AAV 3' ITR. ITRs from AAV2, an AAV from a source different from the capsid, or other than full-length ITRs can be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV that provides the rep function or trans-complementary AAV during production. Additionally, other ITRs can be used. Further, the vector genome includes control sequences that direct the expression of the gene product. Suitable components of the vector genome are discussed in more detail herein.

[0018] Therapeutic proteins and coding sequences: rAAV contains a coding sequence for a human progranulin (hPGRN) protein or a variant thereof and performs one or more of the biological functions of hPGRN. The coding sequence of this protein is engineered into the vector genome for expression in the central nervous system (CNS).

[0019] HuPGRN1 most commonly features the 593 - amino - acid sequence of GenBank NP_002078 reproduced in SEQ ID NO:1. This sequence has a signal peptide at positions 1 - 17 together with the secreted progranulin protein or secreted granulin containing amino acids 18 - about 593. This protein can be cleaved into eight chains: granulin 1 (also known as granulin G: about aa58 - about amino acid 113), granulin 2 (about amino acids 123 - about 179), granulin 3 (about amino acids 206 - about amino acid 261), granulin 4 (about amino acids 281 - about amino acid 336), granulin 5 (about amino acids 364 - about amino acid 417), granulin 6 (about amino acids 442 - about amino acid 496), and granulin 7 (about amino acids 518 - about amino acid 573), with reference to the numbering of SEQ ID NO:1. In certain embodiments, the native signal peptide can be replaced with a heterologous signal peptide. However, other embodiments may include progranulin with an exogenous signal peptide (e.g., human IL2 leader). See, for example, www.signalpeptide.de / index.php?m = listspdb_mammalia. Thus, fusion proteins containing progranulin and / or its fragments are contemplated. Such fusion proteins may include one or more of the active GRNs (e.g., GRN1, 2, 3, 4, 4, 6, or 7) in various combinations with each other, or one or more of these peptides may be combined with full - length PGRN or another protein or peptide (e.g., another active protein or peptide and / or a signal peptide exogenous to human PGRN).

[0020] The vector genome carries the coding sequence of this protein and in human cells (particularly, In the central nervous system, it is engineered to express a protein. In certain embodiments, the coding sequence is found in GenBank: NM_002087.3 and reproduced as SEQ ID NO: 2.

[0021] In certain embodiments, the coding sequence is provided as SEQ ID NO: 3. Certain other embodiments include coding sequences that are 95% - 99.9% or 100% identical to SEQ ID NO: 3, including values in between. In some embodiments, the coding sequence is codon-optimized for better therapeutic outcomes (e.g., enhanced expression in mammalian cells). Identity can be evaluated over the coding sequence of full-length progranulin with a signal (leader) sequence, over progranulin without a signal (leader) sequence, or over the length of the coding sequence of a fusion protein as defined herein. In certain embodiments, the coding sequence is provided as SEQ ID NO: 3. Certain other embodiments include coding sequences that are less than 95% - 100% identical to SEQ ID NO: 4. Identity can be evaluated over the coding sequence of full-length progranulin with a signal (leader) sequence, over progranulin without a signal (leader) sequence, or over the length of the coding sequence of a fusion protein as defined herein.

[0022] Preferably, these coding sequences encode full-length progranulin. However, other embodiments may include an active granulin chain with a heterologous signal peptide (e.g., human IL2 leader). Also, see, for example, www.signalpeptide.de / index.php?m=listspdb_mammalia.

[0023] In certain embodiments, fragments of the coding sequence of human PGRN (e.g., SEQ ID NO: 3 or SEQ ID NO: 4), or sequences that are about 95% to 99.9% or 100% identical thereto, may be utilized. Such fragments may encode an active human GRN (aa18 - 593), or a fusion peptide comprising a heterologous signal peptide together with the active human GRN. In certain embodiments, one or more of the coding sequences of one or more of the active GRNs (e.g., GRN1, 2, 3, 4, 4, 6, or 7) may be included in the vector genome in various combinations with each other, or one or more of these peptides may be combined with the full-length PGRN or another coding sequence.

[0024] Without wishing to be bound by theory, AAV-mediated PGRN expression in a subset of CNS cells (e.g., ependymal cells) is thought to provide a depot of the secreted protein. The secreted PGRN protein (and / or one or more GRNs) is taken up by other cells via sortilin or the mannose-6-phosphate receptor and then transported to the lysosome. In certain embodiments, the secreted protein is progranulin. In certain embodiments, the secreted protein is granulin. In certain embodiments, the secreted protein comprises a mixture of progranulin and granulin.

[0025] In certain embodiments, in addition to the coding sequence of progranulin, another non-AAV coding sequence, such as a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest may be included. Useful gene products include miRNAs. miRNAs and other small interfering nucleic acids control gene expression through cleavage / degradation of target RNA transcripts or translational repression of target messenger RNA (mRNA). miRNAs are typically naturally expressed as final 19-25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors, which are then processed into miRNA duplexes and further into "mature" single-stranded miRNA molecules. This mature miRNA induces a multi-protein complex miRISC that , for example, identifies the target site of the target mRNA within the 3′UTR region, inducing the multi-protein complex miRISC.

[0026] In certain embodiments, the expression cassette further comprises one or more miRNA target sequences that suppress the expression of hPGRN in the dorsal root ganglion (drg). In certain embodiments, the expression cassette comprises at least two tandem repeats of a drg-specific miRNA target sequence, and the at least two tandem repeats comprise at least a first miRNA target sequence and at least a second miRNA target sequence, which may be the same or different. In certain embodiments, the tandem miRNA target sequences are contiguous or separated by a spacer of 1 to 10 nucleic acids, and the spacer is not a miRNA target sequence. In certain embodiments, there are at least two drg-specific miRNA target sequences located 3' to the hPGRN coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is within 20 nucleotides from the 3' end of the hPGRN coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3' end of the hPGRN coding sequence. In certain embodiments, the miRNA tandem repeat comprises a length of 200 to 1200 nucleotides. In certain embodiments, there are at least two drg-specific miRNA target sequences located 5' to the hPGRN coding sequence. In certain embodiments, the at least two drg-specific miRNA target sequences are located both 5' and 3' to the hPGRN coding sequence. In certain embodiments, the at least first miRNA target sequence and / or the at least second miRNA target sequence of the expression cassette mRNA or DNA plus strand is selected from (i) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 32), (ii) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 33), (iii) AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 34), and (iv) AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 35). In certain embodiments, two or more contiguous miRNA target sequences are contiguous and not separated by a spacer.In certain embodiments, two or more miRNA target sequences are separated by a spacer, and each spacer is independently selected from one or more of (A) GGAT, (B) CACGTG, or (C) GCATGC. In certain embodiments, a spacer located between miRNA target sequences may be located 3’ of the first miRNA target sequence and / or 5’ of the last miRNA target sequence. In certain embodiments, the spacers between miRNA target sequences are the same. See U.S. Provisional Patent Application No. 62 / 783,956, filed December 21, 2018, and International Patent Application No. PCT / US19 / 67872, filed February 12, 2020 (which are incorporated herein by reference).

[0027] AAV1 AAVhu68 from clade F can be used to generate vectors that target and express hPGRN within the CNS. However, unexpectedly, AAV1-mediated PGRN delivery was observed to provide superior PGRN expression in the CNS compared to AAVhu68, despite equivalent plasma concentrations being observed. The inventors discovered that intrathecal delivery of rAAV1.PGRN is an attractive delivery route for the therapies described herein. Accordingly, in particularly desirable embodiments, the AAV1 capsid is selected.

[0028] In certain embodiments, a composition is provided that includes an aqueous liquid suitable for intrathecal injection and a stock of rAAV having an AAV capsid that preferentially targets ependymal cells, wherein the rAAV further includes a vector genome having a PGRN coding sequence for delivery to the central nervous system (CNS). In certain embodiments, the composition is formulated for suboccipital injection (into the cisterna magna). In certain embodiments, the rAAV is administered via computed tomography (CT)-guided AAV injection. In certain embodiments, a single dose of the composition is administered to a patient.

[0029] The AAV1 capsid refers to a capsid having an AAV vp1 protein, an AAV vp2 protein, and an AAV vp3 protein. In certain embodiments, the AAV1 capsid is composed of AAV vp1 protein, AAV vp2 protein, and AAV vp3 protein in a predetermined ratio of about 1:1:10 and is assembled into a T1 icosahedral capsid of 60 total vp proteins. The AAV1 capsid can package a genomic sequence to form an AAV particle (e.g., a recombinant AAV where the genome is a vector genome). Typically, the capsid nucleic acid sequence encoding the longest vp protein (i.e., VP1) is expressed in trans during the production of rAAV having the AAV1 capsid. See, for example, U.S. Patent Nos. 6,759,237, 7,105,345, 7,186,552, 8,637,255, and 9,567,607, which are incorporated herein by reference.

[0030] The coding sequence of the capsid is not present in the finally assembled rAAV1.hPGRN. However, such sequences are utilized in the production of recombinant AAV. In certain embodiments, the coding sequence of the AAV1 capsid is the full-length AAV1 VP1 protein of SEQ ID NO: 26, or any nucleic acid sequence encoding its VP2 region or VP3 region. See, for example, U.S. Patent Nos. 6,759,237, 7,105,345, 7,186,552, 8,637,255, and 9,567,607 (which are incorporated herein by reference). In certain embodiments, the coding sequence of the AAV1 capsid is SEQ ID NO: 25. In some embodiments, the AAV1 capsid is a protein produced from the coding sequence of SEQ ID NO: 25 with or without post-translational modifications. However, variants of this coding sequence can be engineered and / or other coding sequences can be reverse-translated for a desired expression system using the amino acid sequences of AAV1 VP1, AAV1 VP2, and / or AAV VP3.

[0031] In certain embodiments, a composition comprising recombinant AAV1 having a capsid, based on the numbering of the primary sequence of AAV1 VP1 reproduced in SEQ ID NO: 26, contains five amino acids (N57, N383, N512, and N718) that are highly deamidated. [Table 1]

[0032] In certain embodiments, AAV1 is characterized by a capsid composition of a heterogeneous population of deamidated VP isoforms as defined in the following table, based on the total amount of VP protein in the capsid determined using mass spectrometry. In certain embodiments, the AAV capsid is modified at one or more of the following positions within the ranges provided below, as determined using mass spectrometry. Residue numbers are based on the published AAV1 sequence reproduced in SEQ ID NO: 26. [Table 2]

[0033] Suitable modifications include those described in the above paragraphs that are deamidation-labeled and incorporated herein. In certain embodiments, one or more of the following positions, or glycines following N, are modified as described herein. In certain embodiments, AAV1 mutants are constructed in which the glycines following N at positions 57, 383, 512, and / or 718 are conserved (i.e., remain unmodified). In certain embodiments, the NG at the four positions shown above is conserved in the native sequence. Residue numbers are based on the published AAV1 VP1 reproduced in SEQ ID NO: 26. In certain embodiments, artificial NG is introduced at a position different from one of the positions identified in the above table.

[0034] rAAV vector As described above, recombinant AAV having an AAV1 capsid is a preferred vector described herein for the treatment of FTD. In certain embodiments, for example, the following examples Alternatively (e.g., AAVhu68 or AAV5), other AAV capsids can be used to generate rAAV. In certain embodiments, the AAV1 capsid can be selected and one or more of the elements of the vector genome containing the coding sequence of hPGRN can be replaced.

[0035] As used herein, the AAVhu68 capsid refers to the capsid defined in WO2018 / 160582 (incorporated herein by reference). As described herein, rAAVhu68 has an rAAVhu68 capsid and is produced in a production system that expresses a capsid from an AAVhu68 nucleic acid sequence (SEQ ID NO: 30) encoding the vp1 amino acid sequence of SEQ ID NO: 31, and optionally, an additional nucleic acid sequence (e.g., a sequence encoding a vp3 protein that does not contain the unique regions of vp1 and / or vp2). rAAVhu68 obtained from production using a single nucleic acid sequence vp1 produces a heterogeneous population of vp1 protein, vp2 protein, and vp3 protein. The AAVhu68 capsid contains subpopulations within the vp1 protein, vp2 protein, and vp3 protein and has modifications from the predicted amino acid residues of SEQ ID NO: 31. These subpopulations contain at least deamidated asparagine (N or Asn) residues. For example, asparagine in the asparagine-glycine pair is highly deamidated. In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 30, or the complementary strand thereto, e.g., the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 proteins can alternatively or additionally be expressed from a nucleic acid sequence different from vp1, e.g., to vary the ratio of vp proteins in a selected expression system. In certain embodiments, also provided is a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence (about aa203-736) of SEQ ID NO: 31 or the complementary strand thereto, the corresponding mRNA or tRNA (about nt607-about nt2211 of SEQ ID NO: 30), which does not contain the vp1 unique region (about aa1-about aa137) and / or the vp2 unique region (about aa1-about aa202). In certain embodiments, also provided is a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence (about aa138-736) of SEQ ID NO: 31 or the complementary strand thereto, the corresponding mRNA or tRNA (nt411-2211 of SEQ ID NO: 30), which does not contain the vp1 unique region (about aa1-about 137).

[0036] As used herein, the AAV5 capsid has the predicted amino acid sequence of SEQ ID NO: 29. In certain embodiments, the AAV5 capsid is expressed from the nucleic acid sequence of SEQ ID NO: 28.

[0037] The genomic sequence that is packaged into the AAV capsid and delivered to the host cell typically consists of, at a minimum, a transgene, its regulatory sequences, and AAV inverted terminal repeats (ITRs). Both single-stranded AAV and self-complementary (sc) AAV are included in rAAV. The transgene is a nucleic acid coding sequence that is heterologous to the vector sequence encoding the polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operably linked to regulatory elements in a manner that allows for transcription, translation, and / or expression of the transgene in the cells of the target tissue.

[0038] The AAV sequences of the vector typically include cis-acting 5' and 3' inverted terminal repeat sequences (see, e.g., B.J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequences are approximately 145 bp in length. Preferably, the entire sequence that substantially encodes the ITRs is used within the molecule, although some minor modifications of these sequences are tolerated. The ability to modify these ITR sequences is within the scope of the art. (See, e.g., Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); an (See K.Fisher et al., J.Virol., 70:520 532(1996)). An example of such a molecule used in the present invention is a "cis-acting" plasmid containing a selected transgene sequence and a transgene in which the associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. In one embodiment, the ITR is derived from an AAV different from the one supplying the capsid. In one embodiment, it is an ITR sequence derived from AAV2. A shortened version of the 5' ITR, designated ΔITR, in which the D sequence and the terminal resolution site (trs) are deleted, has been described. In other embodiments, full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV origins may be selected. If the origin of the ITR is from AAV2 and the AAV capsid is from another AAV origin, the resulting vector may be referred to as a pseudotype. However, other configurations of these elements may also be suitable.

[0039] In addition to the major elements described above for recombinant AAV vectors, the vector also includes conventional control elements necessary to enable its transcription, translation, and / or expression in a manner that allows the transgene to be operably linked to the transgene in cells transfected with the plasmid vector or infected with the virus produced by the present invention. As used herein, an "operably linked" sequence includes both an expression control sequence adjacent to the gene of interest and an expression control sequence that acts in trans or remotely to control the gene of interest.

[0040] The regulatory control element typically includes, as part of the expression control array, for example, a promoter array located between a selected 5' ITR array and the coding array. A constitutive promoter, an adjustable promoter [see, for example, WO2011 / 126808 and WO2013 / 04943], a tissue-specific promoter, or a promoter responsive to physiological cues can be used in the vectors described herein. The promoter can be from different sources, such as the human cytomegalovirus (CMV) immediate early enhancer / promoter, the SV40 early enhancer / promoter, the JC polyomavirus promoter, the myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, the herpes simplex virus (HSV-1) latency-associated promoter (LAP), the Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, the neuron-specific promoter (NSE), the platelet-derived growth factor (PDGF) promoter, hSYN, the melanin-concentrating hormone (MCH) promoter, CBA, the matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter. In addition to the promoter, the vector can include one or more other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, such as WPRE, sequences that enhance translation efficiency (i.e., the Kozak consensus sequence), sequences that enhance protein stability, and, optionally, sequences that enhance the secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the expression cassette includes one or more expression enhancers. In one embodiment, the expression cassette includes two or more expression enhancers. These enhancers can be the same or different from each other. For example, the enhancer can include the CMV immediate early enhancer. This enhancer can be present in two copies located adjacent to each other. Alternatively, the double copy of the enhancer is interrupted by one or more sequences.In yet another embodiment, the expression cassette further comprises an intron, such as the chicken beta-actin intron. Other suitable introns include those known in the art, for example, as described in International Publication No. WO2011 / 126808. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences can be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which is engineered upstream of the polyA sequence and downstream of the coding sequence. (See, for example, MA Zanta-Boussif, et al, Gene Therapy (2009) 16:605-619).

[0041] In one embodiment, the vector genome comprises an AAV 5’ ITR, a promoter, an optional enhancer, an optional intron, a coding sequence of human PGRN, or a fusion protein comprising the same, a polyA, and an AAV 3’ ITR. In certain embodiments, the vector genome comprises an AAV 5’ ITR, a promoter, an optional enhancer, an optional intron, a coding sequence of human PGRN, or a fusion protein comprising the same, a polyA, and an AAV 3’ ITR. In certain embodiments, the vector genome comprises an AAV 5’ ITR, a promoter, an optional enhancer, an optional intron, a huPGRN coding sequence, a polyA, and an AAV 3’ ITR. In certain embodiments, the vector genome comprises an AAV2 5’ ITR, an EF1a promoter, an optional enhancer, an optional promoter, huPGRN, an SV40 polyA, and an AAV2 3’ ITR. In certain embodiments, the vector genome is an AAV2 5’ ITR, a UbC promoter, an optional enhancer, an optional intron, huPGRN, an SV40 polyA, and an AAV2 3’ ITR. In certain embodiments, the vector genome is an AAV2 5’ ITR, a CB7 promoter, an intron, huPGRN, an SV40 polyA, and an AAV2 3’ ITR. In certain embodiments, the vector genome is an AAV2 5’ ITR, a CB7 promoter, an intron, huPGRN, a rabbit β-globin polyA, and an AAV2 3’ ITR. See, for example, SEQ ID NO: 22 (EF1a.huPGRN.SV40), SEQ ID NO: 23 (UbC.PI.huPGRN.SV40), or SEQ ID NO: 24 (CB7.CI.hPGRN1.rGB). The coding sequence of huPGRN is selected from the sequences defined herein. See, for example, SEQ ID NO: 3 or a sequence 95% to 99.9% identical thereto, or SEQ ID NO: 4 or a sequence 95% to 99.9% identical thereto, or a fragment thereof as defined herein.Exemplary arrays of vector elements used in the following examples are provided, for example, by SEQ ID NO: 6 (rabbit globin polyA), AAV ITR (SEQ ID NO: 7 and 8), human CMV IE promoter (SEQ ID NO: 9), CB promoter (SEQ ID NO: 10), chimeric intron (SEQ ID NO: 11), UbC promoter (SEQ ID NO: 12), EF-1a promoter (SEQ ID NO: 17), intron (SEQ ID NO: 13), and SV40 late polyA (SEQ ID NO: 14). Other elements of the vector genome or variations on these sequences can be selected for the vector genome for particular embodiments of the invention.

[0042] Vector production For use in the production of AAV viral vectors (e.g., recombinant (r)AAV), the expression cassette can be carried on any suitable vector, e.g., a plasmid, that is delivered to a packaging host cell. Plasmids useful in the present invention can be engineered, inter alia, to be suitable for in vitro replication and packaging in prokaryotic cells, insect cells, mammalian cells. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of ordinary skill in the art.

[0043] Methods for generating and isolating AAV suitable for use as a vector are known in the art. Generally, see, for example, Grieger & Samulski, 2005, “Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications,” Adv. Biochem. Engin / Biotechnol. 99:119 - 145, Buning et al., 2008, “Recent developments in adeno-associated virus vector technology,” J. Gene Med. 10:717 - 733, and the references cited below (these Each of which is hereby incorporated by reference in its entirety). To package the transgene into the virion, the ITR is the only AAV component that is required in cis in the same construct as the nucleic acid molecule containing the expression cassette. The cap and rep genes can be supplied in trans.

[0044] In one embodiment, the expression cassette described herein is engineered into a genetic element (e.g., a shuttle plasmid) that introduces an immunoglobulin construct sequence carried thereon into a packaging host cell to produce a viral vector. In one embodiment, the selected genetic element can be delivered to the AAV packaging cell by any suitable method including transfection, electroporation, liposome delivery, membrane fusion technology, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Stable AAV packaging cells can also be generated. Alternatively, the expression cassette can be used to generate a viral vector other than AAV or for the production of a mixture of antibodies in vitro. The methods used to generate such constructs are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0045] The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid that lacks the desired genomic sequence packaged therein. These can be referred to as "empty" capsids. Such capsids may not contain a detectable genomic sequence of the expression cassette or may contain only a partially packaged genomic sequence that is insufficient to achieve expression of the gene product. These empty capsids are non-functional for introducing the gene of interest into the host cell.

[0046] The recombinant adeno-associated virus (AAV) described in this specification may be produced using known techniques. See, for example, WO2003 / 042397; WO2005 / 033321, WO2006 / 110689, US7588772B2. Such methods include culturing a host cell containing a nucleic acid sequence encoding an AAV capsid protein, a functional rep gene, an expression cassette consisting of at least AAV inverted terminal repeats (ITRs) and a transgene, and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein. Methods for producing the capsid, the coding sequences therefor, and methods for producing rAAV viral vectors are described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100(10), 6081-6086(2003) and US2013 / 0045186A1.

[0047] In one embodiment, a production cell culture useful for producing recombinant AAV is provided. Such cell cultures include a nucleic acid that expresses an AAV capsid protein in a host cell, a nucleic acid molecule suitable for packaging into the AAV capsid, e.g., a vector genome containing AAV ITRs, and a non-AAV nucleic acid sequence encoding a gene product operably linked to a sequence that directs expression of the product in the host cell, as well as sufficient AAV rep functions and adenovirus helper functions to permit packaging of the nucleic acid molecule into a recombinant AAV capsid. In one embodiment, the cell culture is composed of mammalian cells (e.g., human embryonic kidney 293 cells, among others) or insect cells (e.g., baculovirus).

[0048] Typically, the rep functions are derived from the same AAV source as the AAV that provides the ITRs flanking the vector genome. In the examples herein, AAV2 ITRs are selected and AAV2 rep is used. The coding sequence is reproduced in SEQ ID NO: 27. Optionally, other r An ep array or another rep source (and optionally another ITR source) may be selected. For example, rep can be, but is not limited to, AAV1 rep protein, AAV2 rep protein, or rep78, rep68, rep52, rep40, rep68 / 78, and rep40 / 52, or fragments thereof. Optionally, the rep and cap arrays are on the same genetic element in the cell culture. A spacer may be present between the rep sequence and the cap gene. Any of these AAV or mutant AAV capsid sequences may be under the control of an exogenous regulatory sequence that directs their expression in the host cell.

[0049] In one embodiment, the cells are produced in a suitable cell culture (e.g., HEK293) cells. Methods for producing the gene therapy vectors described herein are methods well known in the art, including, for example, the production of plasmid DNA used for the production of gene therapy vectors, the production of vectors, and the purification of vectors. In some embodiments, the gene therapy vector is an AAV vector, and the generated plasmids are an AAV cis-plasmid encoding the AAV genome and the gene of interest, an AAV trans-plasmid containing the AAV rep and cap genes, and an adenovirus helper plasmid. The vector production process may include method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of cells with plasmid DNA, medium exchange to serum-free medium after transfection, and recovery of cells and culture medium containing the vector.

[0050] In certain embodiments, the manufacturing process of rAAV.hPGRN involves transient transfection of HEK293 cells with plasmid DNA. Single or multiple batches are produced by PEI-mediated triple transfection of HEK293 cells in a PALL iCELLis bioreactor. The harvested AAV material is sequentially purified, when possible, by clarification, TFF, affinity chromatography, and anion exchange chromatography in a disposable closed bioprocessing system.

[0051] Cells and culture medium containing the recovered vector are herein referred to as the crude cell harvest. In yet another system, the gene therapy vector is introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, see generally, e.g., Zhang et al., 2009, “Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production,” Human Gene Therapy 20:922-929 (each of which is incorporated herein by reference in its entirety). Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of which are incorporated herein by reference in their entirety: 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065 (which are incorporated herein by reference).

[0052] The crude cell harvest is then subjected to additional method steps such as concentration of the vector harvest, diafiltration of the vector harvest, micro-solubilization of the vector harvest, nuclease digestion of the vector harvest, filtration of the micro-solubilized intermediate, rough purification by chromatography, rough purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration for the preparation of the bulk vector.

[0053] Two-step affinity chromatography purification at high salt concentration, followed by anion exchange resin Chromatography is used to purify the vector drug product and remove empty capsids. These methods are described in more detail in International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016 (which is incorporated herein by reference). Methods for purifying AAV8: International Patent Application No. PCT / US2016 / 065976, filed December 9, 2016, and methods for purifying rh10: International Patent Application No. PCT / US16 / 66013, filed December 9, 2016, entitled "Scalable Purification Method for AAVrh10" (also filed December 11, 2015), and methods for purifying AAV1: International Patent Application No. PCT / US2016 / 065974, filed December 9, 2016, and "Scalable Purification Method for AAV1", filed December 11, 2015, are all incorporated herein by reference.

[0054] To calculate the content of empty and filled particles, the VP3 band volume for a selected sample (e.g., in the examples herein, a preparation purified with an iodixanol gradient, where the number of GCs = the number of particles) is plotted against the loaded GC particles. Using the resulting linear equation (y = mx + c), the number of particles in the band volume of the test article peak is calculated. Then, the number of particles per 20 μL loaded (pt) is multiplied by 50 to obtain particles (pt) / mL. Pt / mL is divided by GC / mL to obtain the ratio of particles to genomic copies (pt / GC). Pt / mL ~ GC / mL gives the empty pt / mL. The percentage of empty particles is obtained by dividing the empty pt / mL by the pt / mL and then multiplying by 100.

[0055] In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330, Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method involves subjecting the AAV stock to SDS-polyacrylamide gel electrophoresis consisting of any gel capable of separating the three capsid proteins (e.g., a gradient gel containing 3-8% Tris-acetate in buffer), then running the gel until the sample material separates, and blotting the gel onto a nylon or nitrocellulose membrane (preferably nylon). An anti-AAV capsid antibody is then used as the primary antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used that includes means for detecting the binding to the primary antibody, preferably an anti-IgG antibody containing a detection molecule covalently bound to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. A method for detecting the binding is used to semi-quantitatively determine the binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emission, electromagnetic radiation, or a color change, most preferably a chemiluminescence detection kit. For example, in SDS-PAGE, samples from column fractions can be taken and heated in an SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and the capsid proteins are resolved in a precast gradient polyacrylamide gel (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, namely SYPRO Ruby or Coomassie staining, may also be performed.In one embodiment, the concentration of the AAV vector genome (vg) in the column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the sample is further diluted, and the DNA sequence between the primers and the primers. is amplified using a TaqMan™ fluorescent generating probe specific to . The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. A plasmid DNA containing the same sequence as that contained in the AAV vector is utilized to create a standard curve in the Q-PCR reaction. The vector genome titer is determined by normalizing the Ct value obtained from the sample to the Ct value of the plasmid standard curve. An endpoint assay based on digital PCR can also be used.

[0056] In one aspect, an optimized q-PCR method is used that utilizes a broad-spectrum serine protease, such as Proteinase K (e.g., commercially available from Qiagen). More specifically, the optimized qPCR genomic titer assay is similar to a standard assay except that after DNase I digestion, the sample is diluted with Proteinase K buffer, treated with Proteinase K, and subsequently heat inactivated. Appropriately, the sample is diluted with an amount of Proteinase K buffer equal to the sample size. The Proteinase K buffer can be concentrated more than 2-fold. Typically, the Proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55 °C for about 15 minutes, but can also be carried out at a lower temperature (e.g., about 37 °C to about 50 °C) for a longer time (e.g., about 20 minutes to about 30 minutes), or at a higher temperature (e.g., up to about 60 °C) for a shorter time (e.g., about 5 - 10 minutes). Similarly, the heat inactivation is generally about 95 °C for about 15 minutes, but the temperature can be lowered (e.g., about 70 - about 90 °C) and the time can be extended (e.g., about 20 minutes to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in a standard assay.

[0057] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for measuring single-stranded and self-complementary AAV vector genomic titers by ddPCR have been described. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2):115 - 25. doi:10.1089 / hgtb.2013.131. Epub 2014 Feb 14.

[0058] Briefly, a method for separating rAAV particles with packaged genome sequences from genome-defective AAV intermediates includes subjecting a suspension containing recombinant AAV viral particles and AAV capsid intermediates to high performance liquid chromatography, in which the AAV viral particles and AAV intermediates are bound to a strong anion exchange resin equilibrated at high pH and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at about 260 and about 280. The pH can be adjusted depending on the AAV selected. See, for example, WO2017 / 160360 (AAV9), WO2017 / 100704 (AAVrh10), WO2017 / 100676 (e.g., AAV8), and WO2017 / 100674 (AAV1), which are incorporated herein by reference. In this method, AAV full capsids are recovered from the fraction that elutes when the A260 / A280 ratio reaches the infection point. In one example, for the affinity chromatography step, the diafiltered product may be applied to Capture Select™ Poros-AAV2 / 9 affinity resin (Life Technologies), which efficiently captures AAV2 serotypes. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while the AAV particles are efficiently captured.

[0059] composition As used herein, at least one rAAV.hPGRN stock (e.g., rAAV stock Compositions are provided that include a stock of rAAV vectors, optionally including carriers, excipients and / or preservatives. An rAAV stock refers to multiple rAAV vectors that are the same, e.g., in the amounts described below in the discussion of concentrations and dosage units.

[0060] In certain embodiments, the composition comprises a viral stock that is a recombinant AAV (rAAV) suitable for use in treating progranulin-related frontotemporal dementia (FTD), the rAAV comprising: (a) an adeno-associated virus type 1 capsid; and (b) a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human progranulin, and regulatory sequences that direct the expression of progranulin. In certain embodiments, the vector genome comprises a promoter, an enhancer, an intron, a coding sequence for human PGRN, and a polyadenylation signal. In certain embodiments, the intron consists of elements of a chicken beta-actin splice donor and a rabbit beta splice acceptor. In certain embodiments, the vector genome further comprises AAV2 5’ ITR and AAV2 3’ ITR, which flank all elements of the vector genome.

[0061] rAAV.hPGRN is preferably suspended in a physiologically compatible carrier and can be administered to a human or non-human mammalian patient. In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt, or a mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. Since the pH of cerebrospinal fluid is about 7.28 - about 7.32, or about 7.2 - about 7.4 for intrathecal delivery, a pH within this range is desirable, although for intravenous delivery, a pH of about 6.8 - about 7.2 may be desirable. However, other pHs within the broadest range, and sub-ranges of these, may be selected for other delivery routes.

[0062] In certain embodiments, the formulation may contain a buffered aqueous saline solution that does not contain sodium bicarbonate. Such a formulation may contain a buffered aqueous saline solution such as Harvard buffer, and in water, contains one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and mixtures thereof. The aqueous solution may further contain Kolliphor® P188, which is a poloxamer, commercially available from BASF and previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2 or 7.4.

[0063] In another embodiment, the formulation may contain a buffered aqueous saline solution and contains 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% Kolliphor® 188. See, for example, harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard buffer is preferred.

[0064] In other embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycolate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0065] In another embodiment, the composition contains a carrier, diluent, excipient and / or adjuvant No. Suitable carriers can be easily selected by those skilled in the art considering the indications for which the introduced virus is targeted. For example, one suitable carrier contains physiological saline and can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile physiological saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to the injection tube but do not interfere with rAAV binding activity in vivo.

[0066] Optionally, in addition to rAAV and the carrier, the composition may contain other conventional pharmaceutical ingredients such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0067] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffer solutions, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present invention into suitable host cells. Specifically, the rAAV vector-delivered transgene can be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, etc.

[0068] In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition can be transported as a concentrate that is diluted for administration to the subject. In other embodiments, the composition can be lyophilized and reconstituted at the time of administration.

[0069] Suitable surfactants or combinations of surfactants may be selected from among non-toxic non-ionic surfactants. In one embodiment, for example, a primary hydroxyl group-terminated bifunctional block copolymer surfactant such as Pluronic® F68 [BASF], also known as poloxamer 188, which has a neutral pH and an average molecular weight of 8400, is selected. Other surfactants and other poloxamers, i.e., non-ionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS15 (macrogol-15 hydroxystearate), LABRASOL (glyceryl polyoxycaprylate), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol may be selected. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named using three-digit numbers following the letter "P" (for poloxamer), where the first two digits multiplied by 100 give the approximate molecular mass of the polyoxypropylene core and the last digit multiplied by 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount of up to about 0.0005% to about 0.001% of the suspension.

[0070] The vector is administered in an amount sufficient to transfect cells and provide a sufficient level of gene transfer and expression without undue adverse effects or medically acceptable physiology Provide a therapeutic effect with an effect, which can be determined by those skilled in the art. Optionally, routes other than intrathecal administration, such as direct delivery to a desired organ (e.g., liver (optionally via the hepatic artery), lung, heart, eye, kidney), oral, inhalation, intranasal, intratracheal, intraarterial, intravitreal, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral administration routes, etc. can be used. The administration routes may be combined if desired.

[0071] The dose of the viral vector mainly depends on factors such as the condition being treated, the age, weight, and health status of the patient, and thus can vary among patients. For example, the therapeutically effective human dosage of the viral vector is generally in the range of about 25 to about 1000 microliters to about 100 mL (for treating an average subject weighing 70 kg), about 1×10 9 ~1×10 16 The concentration of the genomic viral vector (including all integers or fractional amounts within that range, preferably, for a human patient, 1.0×10 12 GC~1.0×10 14 GC) is a solution. In one embodiment, the composition contains at least 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 GC per dose, including all integers or fractional amounts within the range, and is formulated to contain such. In another embodiment, the composition contains at least 1×10 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractions within the range 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 15 , 2×10 15 , 3×10 15, 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 is formulated to contain GC. In one embodiment, for human application, the dose can be in the range of 1×10 10 to about 1×10 12 GC per dose, including all integers or fractional amounts within the range.

[0072] In certain embodiments, the dose is in the range of about 1×10 9 GC / g brain mass to about 1×10 12 GC / g brain mass. In certain embodiments, the dose is in the range of about 1×10 10 GC / g brain mass to about 3.33×10 11 GC / g brain mass. In certain embodiments, the dose is in the range of about 3.33×10 11 GC / g brain mass to about 1.1×10 12 GC / g brain mass. In certain embodiments, the dose is in the range of about 1×10 12 GC / g brain mass to about 3.33×10 13 GC / g brain mass. In certain embodiments, the dose is lower than 3.33×10 11 GC / g brain mass. In certain embodiments, the dose is lower than 1.1×10 12 GC / g brain mass. In certain embodiments, the dose is lower than 3.33×10 13 GC / g brain mass.

[0073] In certain embodiments, the dose is about 1×10 10 GC / g brain mass. In certain embodiments, the dose is about 2×10 10 GC / g brain mass. In certain embodiments, the dose is about 2×10 10 GC / g brain mass. In certain embodiments, the dose is about 3×10 10 GC / g brain mass. In certain embodiments, the dose is about 4×10 10 GC / g brain mass . In certain embodiments, the dose is about 5×10 10GC / g brain mass. In certain embodiments, the dosage is about 6×10 10 GC / g brain mass. In certain embodiments, the dosage is about 7×10 10 GC / g brain mass. In certain embodiments, the dosage is about 8×10 10 GC / g brain mass. In certain embodiments, the dosage is about 9×10 10 GC / g brain mass. In certain embodiments, the dosage is about 1×10 11 GC / g brain mass. In certain embodiments, the dosage is about 2×10 11 GC / g brain mass. In certain embodiments, the dosage is about 3×10 11 GC / g brain mass. In certain embodiments, the dosage is about 4×10 11 GC / g brain mass.

[0074] In certain embodiments, the dosage is a uniform dosage in the range of about 1.44×10 13 ~4.33×10 14 GC of rAAV and is administered to humans. In certain embodiments, the dosage is a uniform dosage in the range of about 1.44×10 13 ~2×10 14 GC of rAAV and is administered to humans. In certain embodiments, the dosage is a uniform dosage in the range of about 3×10 13 ~1×10 14 GC of rAAV and is administered to humans. In certain embodiments, the dosage is a uniform dosage in the range of about 5×10 13 ~1×10 14 GC of rAAV and is administered to humans.

[0075] In some embodiments, the composition is formulated in dosage units and may contain an amount of AAV in the range of about 1×10 13 ~8×10 14 GC. In some embodiments, the composition is formulated in dosage units and may contain an amount of rAAV in the range of about 1.44×10 13 ~4.33×10 14 GC. In some embodiments, the composition is formulated in dosage units and may contain an amount of rAAV in the range of about 3×10 13 ~1×10 14It may contain an amount of rAAV within the range of GC. In some embodiments, the composition is formulated in dosage units, about 5×10 13 ~1×10 14 It may contain an amount of rAAV within the range of GC.

[0076] In certain embodiments, rAAV is administered to the subject as a single dose. In certain embodiments, multiple doses (e.g., 2 doses) are desired.

[0077] The dosage may be adjusted to balance the therapeutic benefit against any side effects, and such dosage may vary depending on the therapeutic use for which the recombinant vector is utilized. The expression level of the transgene can be monitored to determine the dosing frequency that results in a viral vector, preferably an AAV vector containing a mini-gene. Optionally, a dosing regimen similar to that described for therapeutic purposes can be utilized for immunization using the compositions of the invention.

[0078] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to a route of drug administration via injection into the spinal canal, more specifically, by injection into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / subtemporal, and / or C1-2 puncture. For example, the material can be introduced by lumbar puncture to diffuse across the subarachnoid space. In another example, the injection may be into the cisterna magna or via parenchymal delivery. In certain embodiments, rAAV is administered via a suboccipital injection into the cisterna magna (intracisternal) guided by computed tomography (CT). In certain embodiments, the patient is administered as a single dose.

[0079] As used herein, the terms "intracisternal delivery" or "intracisternal administration" refer to a direct route of drug administration to the cerebrospinal fluid of the cisterna magna of the medulla oblongata, more specifically, by suboccipital puncture, or by direct injection into the cisterna magna, or by a permanently placed tube.

[0080] In certain embodiments, the stock of rAAV.hPGRN is formulated in intrathecal final formulation buffer (ITFFB; artificial CSF containing 0.001% Pluronic F-68). The batch is frozen, then thawed, pooled if necessary, adjusted to the target concentration, sterile filtered through a 0.22 μm filter, and filled into vials. In certain embodiments, the suspension containing the formulation buffer of rAAV1.hPGRN is adjusted to pH 7.2 - 7.4.

[0081] In one embodiment, the volume for delivery of the dose of rAAV1.hPGRN provided herein can be determined by one of ordinary skill in the art. For example, a volume of about 1 μL to 150 mL may be selected, and for adults, a higher volume may be selected. Typically, a suitable volume for neonates is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For the preteen and teen generations, a volume of up to about 50 mL may be selected. In yet other embodiments, the patient can receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects, and such dosage may vary depending on the therapeutic use for which the recombinant vector is utilized.

[0082] In certain embodiments, the composition comprises rAAV.EF1a.huPGRN.SV40, rAAV.UbC.PI.huPGRN.SV40, or rAAVCB7.CI.hPGRN1.rGB. Compositions in which the rAAV capsid is AAVhu68, AAV5, or AAV1 are exemplified in the following examples. In a particularly preferred embodiment, the rAAV is AAV1. In certain embodiments, the coding sequence of huPGRN is selected from the sequences defined herein. For example, see SEQ ID NO: 3 or a sequence 95% - 99.9% identical thereto, or SEQ ID NO: 4 or a sequence 95% - 99.9% identical thereto, or a fragment thereof as defined herein. Exemplary sequences of vector elements used in the following examples are provided, for example, by SEQ ID NO: 6 (rabbit globin polyA), AAV ITR (SEQ ID NOs: 7 and 8), human CMV IE promoter (SEQ ID NO: 9), CB promoter (SEQ ID NO: 10), chimeric intron (SEQ ID NO: 11), UbC promoter (SEQ ID NO: 12), EF-1a promoter (SEQ ID NO: 17), intron (SEQ ID NO: 13), and SV40 late polyA (SEQ ID NO: 14).

[0083] Use As used herein, PGRN haploinsufficiency refers to a patient having a mutation in the PGRN gene that results in deficient levels of PGRN and / or GRN. The target population for rAAV1-PGRN therapy includes patients having PGRN haploinsufficiency and / or other patients having deficient levels of PGRN or GRN. In certain embodiments, the patient is heterozygous for the PGRN mutation. In yet another embodiment, the patient is homozygous for the PGRN mutation. In certain embodiments, the patient is administered an immunosuppressive regimen in combination with the rAAV1-mediated hPGRN therapy provided herein.

[0084] In certain embodiments, rAAV1.PGRN is useful for the treatment of patients with GRN haploinsufficiency. Such patients may have been diagnosed with, or may be pre-symptomatic for, adult-onset neurodegenerative disease caused by GRN haploinsufficiency. rAAV1.PGRN can be administered as a single dose via computerized tomography (CT)-guided infusions into the cisterna magna (intracisternal [ICM]) via suboccipital injection. The single dose is administered at a predetermined dose level. This route of administration was selected due to the excellent brain transduction achieved by single ICM injection in NHP. In certain embodiments, administration of the vector into the ICM also results in a reduced anti-PGRN T cell response as compared to other routes of administration (e.g., injection into the lateral ventricle). In a common procedure, ICM injection (also known as suboccipital puncture) was previously replaced by lumbar puncture. However, other dosing levels and delivery routes may be selected and / or used in conjunction with this rAAV1-mediated hPGRN therapy as well be.

[0085] In certain embodiments, the rAAV1-mediated therapy described herein can provide PGRN expression in humans without a GRN mutation (haploinsufficient) at approximately average and normal physiological levels. However, the treatment can provide a therapeutic effect even when the increase in PGRN expression is lower than normal levels, providing from about 40% to 99% of normal average levels, e.g., 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or other values in between. In certain embodiments, this can result from an increase in PGRN levels of at least 5% to about 70%, or more, above the expression level of the patient prior to treatment. In certain embodiments, the treatment provides therapeutic efficacy in which administration of rAAV1-mediated hPGRN results in an increase in the level of PGRN in the CSF (e.g., 10-fold to 40-fold higher than normal levels).

[0086] In certain embodiments, efficacy is evaluated by one or more of an increase in the level of progranulin protein in CSF and / or a change in the thickness of the cerebral cortex. In certain embodiments, the efficacy of rAAV1-mediated therapy is evaluated after administration of a single ICM dose and is measured by one or more of long-term survival and improvement in clinical symptoms and daily function as evaluated by the Mini-Mental State Examination (MMSE), Clinical Global Impression of Change (CGI-C), Frontal Assessment Battery (FAB), Frontotemporal Dementia Rating Scale (FRS), Frontal Behavior Inventory (FBI), Unified Parkinson's Disease Rating Scale (UPDRS), verbal fluency test, Clinical Dementia Rating Sum of Boxes for Frontotemporal Lobar Degeneration (CDR-FTLD sb), and / or Neuropsychiatric Inventory (NPI). In certain embodiments, efficacy is demonstrated by improvement in the CSF levels of neurofilament light chain (NFL), tau, phosphorylated tau, and inflammatory markers, and / or an increase in the plasma level of progranulin. In certain embodiments, efficacy is evaluated by measuring a decrease or reversal in the level of microgliosis.

[0087] In certain embodiments, efficacy is measured by improvement in one or more of the clinical symptoms associated with GRN patients, including, for example, behavioral deficits (disinhibition, apathy, loss of empathy or sympathy, compulsive or stereotyped behavior, or orolingual tendencies) and cognitive deficits (decreased executive function that does not significantly affect episodic memory or visuospatial skills).

[0088] In certain embodiments, improvement is observed in some other more atypical symptoms, including psychiatric features (delusions, hallucinations, and compulsive behaviors) and / or other cognitive impairments (episodic memory impairment, apraxia, and visuospatial dysfunction). The assessment may be performed using the FTDC criteria, including brain imaging for signs of frontal and / or temporal lobe degeneration, assessment of reduction on clinical assessment scales (such as the Clinical Dementia Rating for Frontotemporal Lobar Degeneration [CDR-FTLD], Frontal Behavioral Inventory [FBI], Neuropsychiatric Inventory [NPI], and Frontotemporal Dementia Rating Scale [FRS]), and ultimately, genetic testing to confirm pathogenic GRN mutations. Biomarkers in cerebrospinal fluid (CSF) may be used, including tau and amyloid-β, as well as amyloid positron emission tomography (PET) imaging.

[0089] In certain embodiments, improvement is observed in GRN mutation carriers with primary progressive aphasia (PPA), which is characterized by symptoms related to speech and language. These may be diagnosed using guidelines based on the Mesulam criteria that distinguish the three clinical types of PPA: semantic variant PPA (svPPA), non-fluent variant PPA (nfvPPA), and logopenic variant PPA (lvPPA) (Gorno-Tempini et al., (2011) “Classification of primary progressive aphasia and its variants.” Neurology. 76(11):1006-14). NfvPPA presents with a deficit in the ability to generate speech Thus, the basic features include agrammatism, effortful speech, and speech production deficits in language generation. svPPA presents a deficit in the ability to understand word meaning, and the basic features include word naming and word comprehension impairments. lvPPA is characterized by difficulty in finding appropriate words during conversation, but is not accompanied by a decline in word understanding. The basic main feature of lvPPA is a deficit in word recall and sentence repetition ability. GRN mutation carriers are most common in nfvPPA, but may have a wider range of symptoms across the clinical spectrum of PPA, leading to a diagnosis of "PPA - not otherwise specified" (Gorno - Tempini et al., 2011; Woollacott and Rohrer, 2016).

[0090] A method of treating a human patient having a neurodegenerative condition associated with GRN haploinsufficiency is provided. In certain embodiments, the condition is progranulin - related frontotemporal dementia (FTD). The method includes delivering a coding sequence of progranulin to the central nervous system (CNS) via a recombinant adeno - associated virus (rAAV) having an adeno - associated virus 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome including AAV inverted terminal repeats, a coding sequence of human progranulin, and regulatory sequences that direct the expression of progranulin.

[0091] A method for treating a human patient having a brain lesion associated with frontotemporal dementia associated with progranulin or another neurodegenerative condition associated with GRN haploinsufficiency is provided. The method includes administering a coding sequence of progranulin to the central nervous system (CNS) via a recombinant adeno - associated virus (rAAV) having an adeno - associated virus 1 (AAV1) capsid, the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome including AAV inverted terminal repeats, a coding sequence of human progranulin, and regulatory sequences that direct the expression of progranulin.

[0092] In certain embodiments, the methods provided herein may further include monitoring treatment by (a) non-invasively assessing a patient for a decrease in retinal accumulative lesions as a predictor of a decrease in brain lesions, (b) performing magnetic resonance imaging to evaluate brain volume, and / or (c) measuring the concentration of progranulin in CSF. Optionally, the concentration of progranulin in plasma may be evaluated.

[0093] In certain embodiments, the efficacy of the rAAV.hPGRN composition is evaluated by one or more of primarily cognitive methods, primarily behavioral methods, or cognitive / other methods. Suitable evaluations are described below.

[0094] Major cognitive evaluations include a verbal fluency test, the clinical dementia ratio for FTLD, or the Mini-Mental State Examination (MMSE). The verbal fluency test may be performed by presenting the same picture / photo to each subject and asking for a verbal description. During the description, the speech rate (words per minute) is counted, recorded, and ultimately compared to the rate that reflects typically developing adults. CDR-FTLD is an extended version of the classical CDR and has historically been used to assess the severity of spectrum disorders of Alzheimer's disease. This evaluation includes the original six domains of the CDR (memory, orientation, judgment and problem solving, social adaptation, home situation and hobbies, caregiving situation), as well as two additional domains of language and behavior, and is more sensitive in detecting FTLD decline. An evaluation of "0" indicates normal behavior or language, and scores of "1", "2", or "3" indicate mild to severe impairment. The "sum of boxes", or the sum of the individual domain scores, is used to determine the overall severity of dementia. The MMSE is an 11-question overall cognitive evaluation widely used in clinical and research practice. Questions may include, for example, asking "What year is this? What season is it? What day is it? What day of the week is it? What month is it?", and for each correct answer One point is given for each, and the maximum score is given for each question. The upper limit of the total score is 30 points, and there are two cut-offs at 24 points and 27 points. These cut-offs are indicators of cognitive decline.

[0095] The main motor evaluations include, for example, the Unified Parkinson's Disease Rating Scale (UPDRS). The UPDRS is a four-part evaluation of 42 items in several domains related to parkinsonism, such as mentation, behavior, mood, and activities of daily living. Each item typically includes a rating scale ranging from 0 (typically indicating no impairment) to 4 (typically indicating the most severe impairment). The scores for each part are aggregated to provide the severity of the disease, and a high score of 199 points indicates the worst / most complete impairment.

[0096] The main behavioral evaluations include, for example, the Neuropsychiatric Inventory (NPI) or the Frontal Behavioral Inventory (FBI). The NPI is used to elucidate the presence of psychopathology in patients with brain disorders. Initially, it was developed for use in the Alzheimer's disease population, but it may be useful for evaluating changes in behavior in other conditions. This evaluation consists of 10 behavioral domains and two autonomic areas, and among them, there are four scores: frequency, severity, overall burden, and caregiver burden. The total score of the NPI is obtained by adding the domain scores of the behavioral domains and subtracting the score of the caregiver burden. The FBI is a 24-item evaluation aimed at evaluating behaviors and personality changes particularly related to bvFTD and distinguishing FTD from other dementias. Since patients diagnosed with bvFTD generally do not have sufficient insight into these types of changes, this is conducted as a face-to-face interview with the primary caregiver. Focusing on several areas related to behavior and personality, each question is scored from 0 (none) to 3 (severe / most cases). The total score can be used to provide insight into the severity of the disease and evaluate changes over time.

[0097] For both other / cognitive and motor evaluations, for example, the Columbia-Suicide Severity Rating Scale (C-SSRS), Clinical Global Impression of Change (CGI-C), Frontal Assessment Battery (FAB), and / or Frontotemporal Dementia Rating Scale (FDR) are included. The C-SSRS is a three-component scale that measures suicidal thoughts, the intensity of thoughts, and suicidal behavior through questions for evaluating suicidal thoughts and actions. The results of this evaluation consist of a suicidal behavior lethality assessment, a suicidal thoughts score, and a suicidal thoughts intensity assessment directly obtained from the scale. A thoughts score exceeding 0 may indicate the need for intervention based on the evaluation guidelines. The intensity assessment ranges from 0 to 25, with 0 representing no support for suicidal thoughts. The CGI-C is one of three brief and widely used evaluations, consisting of three items and evaluated by clinicians and observers. The CGI-C is evaluated on a 7-point scale ranging from 1 (very much improved) to 7 (very much deteriorated), starting from registration in the study, regardless of whether the improvement is entirely due to treatment. The FAB is a simple evaluation to assist in differentiating between frontotemporal dementia phenotype dementia and Alzheimer's type dementia. This is particularly useful in patients with mild dementia (MMSE>24). The evaluation consists of six parts addressing the areas of cognition, movement, and behavior, with a total score of 18, and a higher score indicating better performance. The FDR is a simple staging evaluation for patients with frontotemporal dementia, detecting differences in the disease progression of FTD subtypes over time. This simple interview is conducted with the primary caregiver, consists of 30 items, and is classified as "never occurs," "occurs sometimes," or "always occurs." Then, a percentage score is calculated and converted to a logit score and finally to a severity score. The severity score ranges from "very mild" to "most severe."

[0098] Other measures of efficacy include an increase in survival time from the time of diagnosis after the onset of symptoms, which is a measure of efficacy. Currently, the average lifespan of patients diagnosed with neurodegeneration caused by GRN mutations is 7 to 11 years from the onset of symptoms. Another measure of efficacy is in the target population It is the stabilization and / or increase in atrophy in the thickness of the medial prefrontal cortex and parietal regions, which are the most commonly affected brain regions across all clinical symptoms. This can be evaluated using MRI or other imaging techniques. Further evaluations include biochemical biomarkers. The levels of PGRN protein in CSF and plasma are measured as a readout of AAV transduction and are expected to increase in patients after administration of rAAV1.hPGRN. In other embodiments, the CSF levels of neurofilament light chain (NFL), tau, phosphorylated tau, and other inflammatory markers are evaluated. In certain embodiments, the modulation and / or decrease in the levels of these biomarkers correlates with efficacy.

[0099] The following examples focus on the treatment of specific conditions related to heterozygous GRN haploinsufficiency, but in certain embodiments, the vectors and compositions described herein can be used for the treatment of other diseases, such as diseases associated with homozygous mutations in the GRN gene, including neuronal ceroid lipofuscinosis, cancer (e.g., ovarian cancer, breast cancer, adrenal cancer, and / or pancreatic cancer), atherosclerosis, type 2 diabetes, and metabolic disorders.

[0100] As used herein, the term computed tomography (CT) refers to a radiography in which a three-dimensional image of a body structure is constructed by a computer from a series of planar cross-sectional images created along an axis.

[0101] The term "substantial homology" or "substantial similarity," when referring to a nucleic acid or a fragment thereof, means that when optimally aligned with another nucleic acid (or its complementary strand) with appropriate nucleotide insertions or deletions, there is nucleotide sequence identity in at least about 95 - 99% of the aligned sequences. Preferably, the homology is over the full-length sequence, or its open reading frame, or another suitable fragment at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0102] In the context of nucleic acid sequences, the terms "sequence identity", "percent sequence identity", or "percent identical" refer to residues in two sequences that are the same when aligned to maximize correspondence. The length of the sequence identity comparison can span the full length of the genome, the full length of the gene coding sequence, or, preferably, a fragment of at least about 500 - 5000 nucleotides. However, for example, identity between smaller fragments of at least about 9 nucleotides, usually at least about 20 - 24 nucleotides, at least about 28 - 32 nucleotides, or at least about 36 or more nucleotides may also be desired. Similarly, "percent sequence identity" can be readily determined for the amino acid sequence over the full length of a protein or a fragment thereof. Preferably, the fragment is at least about 8 amino acids in length and can be up to about 700 amino acids in length. Examples of preferred fragments are described herein.

[0103] The terms "substantially homologous" or "substantially similar", when referring to an amino acid or a fragment thereof, mean amino acid sequence identity in at least about 95 - 99% of the aligned sequences when optimally aligned with another amino acid (or its complementary strand) with appropriate amino acid insertions or deletions. Preferably, the homology is over the full length sequence, or a protein thereof, such as a cap protein, a rep protein, or a fragment thereof that is at least 8 amino acids in length, or more preferably, at least 15 amino acids in length. Examples of preferred fragments are described herein.

[0104] The term "highly conserved" means at least 80% identity, preferably at least 90% identity, more preferably greater than 97% identity. Identity is readily determined by one of ordinary skill in the art using algorithms and computer programs known to those of ordinary skill in the art.

[0105] Generally, when referring to "identity", "homology", or "similarity" between two different adeno-associated viruses, "identity", "homology", or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to multiple nucleic acid sequences or protein (amino acid) sequences, and when compared to a reference sequence, often includes corrections for missing or added bases or amino acids. In the examples, the publicly available AAV9 sequence is used as a reference point for AAV alignment. The alignment is performed using any of a variety of publicly available or commercially available multiple sequence alignment programs. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "MAP", and "MEME", which are accessible through web servers on the Internet. Other sources of such programs are known to those of skill in the art. Alternatively, the Vector NTI utility can also be used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using the program Fasta™, which is part of the GCG version 6.1 program. Fasta™ provides an alignment of the best overlapping regions and percent sequence identity between a query sequence and a search sequence. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (word size 6 and NOPAM factor for the scoring matrix), as provided in GCG version 6.1 (incorporated herein by reference). Multiple sequence alignment programs such as "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and the "Match-Box" program are also available for amino acid sequences. Generally, any of these programs are used with their default settings, but those of skill in the art can change these settings as needed.Alternatively, one of ordinary skill in the art can utilize another algorithm or computer program to provide at least the level of identity or alignment as provided by the reference algorithms and programs. For example, see J.D. Thomson et al, Nucl. Acids Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999).

[0106] Note that the terms “a” or “an” refer to one or more. Accordingly, the terms “a” (or “an”), “one or more”, and “at least one” are used interchangeably herein.

[0107] The terms “comprise”, “comprises”, and “comprising” should be construed inclusively rather than exclusively. The terms “consist”, “consisting”, and their variants should be construed exclusively rather than inclusively. Although various embodiments herein are presented using the word “comprising”, in other situations, related embodiments are intended to be construed and described using the words “consisting of” or “consisting essentially of”.

[0108] As used herein, the term “about” means a variability of 10% (±10%, e.g., ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±8, ±9, ±10, or a value in between) from a given reference, unless otherwise specified.

[0109] As used herein, the terms "disease", "disorder", and "condition" are used interchangeably to denote an abnormal condition in a subject.

[0110] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to published documents that provide one of ordinary skill in the art with a general guide to the many terms used herein.

[0111] The term "expression" is used herein in its broadest sense and includes the production of RNA or RNA and protein. With respect to RNA, the terms "expression" or "translation" specifically relate to the production of peptides or proteins. Expression can be transient or stable.

[0112] As used herein, "expression cassette" refers to a nucleic acid molecule comprising a coding sequence, a promoter, and may include other regulatory sequences therefor, and the cassette can be delivered to a packaging host cell by a genetic element (e.g., a plasmid) and packaged into the capsid of a viral vector (e.g., a viral particle). Typically, such an expression cassette for producing a viral vector includes a coding sequence of a gene product described herein adjacent to a packaging signal of the viral genome, and other expression control sequences such as those described herein.

[0113] As used herein, the term "operably linked" refers to both an expression control sequence contiguous with a gene of interest and an expression control sequence that acts in trans or at a distance to control the gene of interest.

[0114] When used with reference to a protein or nucleic acid, the term "heterologous" indicates that the protein or nucleic acid contains two or more sequences or subsequences that are not found in nature in the same relationship to each other. For example, a nucleic acid having two or more sequences from unrelated genes arranged to create a novel functional nucleic acid is typically produced recombinantly. For example, in one embodiment, the nucleic acid has a promoter from one gene arranged to direct the expression of the coding sequence from a different gene. Thus, with respect to the coding sequence, the promoter is heterologous.

[0115] The term "translation" in the context of the present invention relates to the process at the ribosome where the mRNA strand controls a collection of amino acid sequences to produce a protein or peptide.

[0116] The following examples are illustrative only and are not intended to limit the present invention.

Example

[0117]

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

[0118] Example 1: Materials and Methods: Vector The engineered human PGRN cDNA was cloned into an expression construct containing the chicken beta-actin promoter with the cytomegalovirus immediate enhancer, a chimeric intron, and the rabbit beta-globin polyadenylation sequence (Figure 1). A second engineered human PGRN cDNA was cloned into an expression construct containing the human ubiquitin C promoter. The expression constructs were flanked by AAV2 inverted terminal repeats. Adeno-associated virus serotypes 1, 5, and human 68 (AAVhu68) were generated from this construct by triple transfection of HEK293 cells and purification by iodixanol as described previously (Lock M, et al. Hum Gene Ther. 2010;21(10):1259-71).

[0119] Animal procedures All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Breeding pairs of GRN knockout mice were purchased from The Jackson laboratory (stock number 013175) and colonies were maintained at the University of Pennsylvania. Wild-type C57BL / 6 (stock number 000664) served as controls. In the first study, 2-month-old mice were anesthetized with isoflurane and injected intracerebroventricularly (ICV) with 5 μL of 1×10 11 vector genome copies (GC). Sixty days after injection, the mice were euthanized by exsanguination under ketamine / xylazine anesthesia and death was confirmed by cervical dislocation. In the second study, mice were treated at 7 months of age and sacrificed at 11 months of age. At necropsy, serum was collected by cardiac puncture and CSF was collected by suboccipital puncture using a 32-gauge needle connected to a polyethylene tube. Serum and CSF samples were immediately frozen on dry ice and stored at -80 °C until analysis. The frontal cortex was harvested for biochemistry, immediately frozen on dry ice, and the remaining brain was fixed in 10% formalin for histology.

[0120] Rhesus monkeys aged 3 - 4 years were purchased from Covance. For vector administration, the animals were sedated with intramuscular dexmedetomidine and ketamine, and 3×10 in 1 mL of artificial CSF 13 GC AAV vectors were administered by single - injection into the cisterna magna (ICM). The needle placement was verified by myelography using a fluoroscope (OEC9800 C - Arm, GE) as described above (Katz N, et al. Hum Gene Ther Methods. 2018 Oct;29(5):212 - 219). The animals were euthanized by barbiturate overdose. The recovered tissues were immediately frozen on dry ice or fixed in 10% formalin for histology.

[0121] Histology and imaging diagnosis Mouse brains were fixed with 10% formalin, cryopreserved in sucrose, embedded in optimal cutting temperature (OCT) compound, and sectioned with a cryostat. Low magnification images of autofluorescent substances (lipofuscin) in the target regions were taken. Lipofuscin deposits were blindly quantified using ImageJ software. Non-human primate tissues were fixed with 10% formalin, embedded in paraffin, and stained with hematoxylin and eosin (H&E). Slides were reviewed by a committee-certified veterinary pathologist (ELB). For animals treated with the GFP vector, brain sections were stained with antibodies against olig2, GFAP, or NeuN. All sections were co-stained with antibodies against DAPI and GFP, followed by fluorescent secondary antibodies. Slides were scanned with a Leica Aperio Versa 200 slide scanner, downloaded from eSlide Manager, and analyzed with HALO imaging software (Indica Labs). Five regions of the right hemisphere were sampled for each animal, and cells were quantified using each cell type marker. Cells were detected by adjusting the following settings: "Minimum nuclear intensity", "Nuclear size", "Nuclear segmentation aggressiveness", and "Minimum nuclear roundness" under the Nuclear Detection tab. Criteria were then defined for each individual dye to further identify the cells and generate a quantitative total cell count for each marker. The settings were determined empirically based on the sensitivity and reliability of the detection of the desired cell type. In some cases, settings such as the detection of NeuN in the cytoplasm did not reflect the true intracellular localization of the marker but provided higher specificity and sensitivity of detection. All cells detected by automated means were manually verified. For neurons, the "Nuclear positive threshold" and "Cytoplasmic positive threshold" were adjusted under the "Dye 1" tab to detect only cells with NeuN present in both the nucleus and cytoplasm. For astrocytes, the DAPI and GFAP markers were selected and included in the count if present in both the nucleus and cytoplasm of the cells. For oligodendrocytes, cells were counted if both DAPI and olig2 were present in the nucleus but not in the cytoplasm of the cells.For co-localization, the same settings were used, with GFP included as an additional dye in the neurons, in both the nucleus, and in the astrocytes, in both the nucleus and the cytoplasm. Cells that did not express all of the selected markers were excluded from the resulting tables by "masking" them using the nuclear or cytoplasmic "mask" function. Since GFP-positive cells co-localizing with olig2 were rare, the transduced oligodendrocytes were counted manually. In some cases, parts of blood vessels or choroid plexus showing autofluorescence were manually outlined and excluded using the "scissors" tool. The values obtained were expressed as the percentage of GFP-positive cells for each cell type marker.

[0122] Sample preparation for hexosaminidase (Hex) assay Serum was used directly for the Hex activity assay, while brain samples were homogenized in lysis buffer (0.2% Triton-X100, 0.9% NaCl, pH 4.0), followed by clarification by three freeze-thaw cycles and centrifugation. Protein concentration was determined by Bradford assay. Measurement of Hex activity was performed as previously described (Hinderer C, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2014;22(12):2018-27).

[0123] ELISA Human progranulin (PGRN) was measured using the DuoSet ELISA kit (R&D #DY2420) with minor modifications. Briefly, high-binding polystyrene ELISA plates were coated overnight at 4°C with 5 μg / ml of human PGRN capture antibody diluted in phosphate-buffered saline (PBS). After washing, the plates were blocked with 1% bovine serum albumin (BSA) in PBS for 2 hours, followed by incubation with samples for 1 hour. Human and non-human primate CSF were diluted 1:5 in PBS, while mouse CSF samples were diluted 1:40. Brain samples were diluted in lysis buffer to a total protein concentration of 2 mg / ml. Bound antibodies were detected using biotinylated mouse anti-human progranulin antibody and streptavidin-HRP. The plates were developed for 20 minutes using tetramethylbenzidine substrate, and the reaction was stopped with 2N sulfuric acid, after which absorbance was measured at 450 nm.

[0124] Neutralizing antibody assay Neutralizing antibodies against AAVhu68 were evaluated as described above (Calcedo R, et al. J Infect Dis. 2009;199(3):381-90).

[0125] Statistics Comparisons of Hex enzyme activity, lipofuscin number, and CD68+ area in wild-type mice, GRN knockout mice, and AAV-treated GRN knockout mice were performed using one-way ANOVA followed by Tukey's post hoc multiple comparison test.

[0126] Example 2: AAV-Mediated Delivery of Human GRN Transgene in a Mouse Disease Model A recombinant AAV vector (CB7.CI.hPGRN.rBG) with an AAVhu68 capsid expressing human PGRN (SEQ ID NO: 3) under the control of the CB7 promoter and a chimeric intron was produced using, for example, the published triple transfection technology described in WO2018 / 160582.

[0127] The inventors evaluated AAV-mediated delivery of human GRN transgenes in a GRN knockout mouse model. Mice with heterozygous GRN mutations (GRN + / - ) do not exhibit the pathological features of GRN-related neurodegenerative diseases. This is probably because, within the lifespan of the mouse, the development of the sequelae of GRN haploinsufficiency, which first appears in humans decades later, is impossible. In contrast, in mice with a complete PGRN deficiency in GRN - / - , some of the initial features of GRN haploinsufficiency in humans (e.g., impairment of lysosomal function, accumulation of autofluorescent lysosomal storage material (lipofuscin), and activation of microglia) are reproduced, but GRN - / - mice do not show neuronal loss even by 2 years of age (Lui H, et al. Cell. 2016;165(4):921-35, Ward ME, et al. Sci Transl Med. 2017 Apr 12;9(385):pii:eaah5642). Both GRN + / - mice and GRN - / - mice have been reported to show behavioral abnormalities, but the findings are not consistent between groups (Ahmed Z, et al. Am J Pathol. 2010;177(1):311-24, Wils H, et al. The Journal of Pathology. 2012;228(1):67-76, Ghoshal N, et al. Neurobiology of Disease. 2012;45(1):395-408, Filiano AJ, et al. The Journal of neuroscience:the official journal of the Society for Neuroscience. 2013;33(12):5352-61, Yin F, et al. The FASEB Journal. 2010;24(12):4639-47). Similarly, some reports have shown a decrease in survival rate in GRN - / - mice, but other reports have shown that GRN - / -The mice were found to have a normal lifespan, consistent with the inventors' experience (Ahmed Z, et al. Am J Pathol. 2010;177(1):311-24, Wils H, et al. The Journal of Pathology. 2012;228(1):67-76). GRN - / - Although the mice do not show obvious neurodegeneration or neurological signs, due to the striking biochemical and histological similarities to GRN haploinsufficiency in humans, they represent a potentially useful model for evaluating novel therapies. Therefore, the inventors focused their analysis on these biochemical and histological findings in GRN - / - mice.

[0128] The aim of this study was to evaluate whether delivery of the human GRN gene to the brain could eliminate existing lysosomal storage materials and normalize lysosomal function in GRN - / - mice. In response to lysosomal accumulation, cells upregulate the expression of lysosomal enzymes, which can be used as biomarkers for lysosomal storage diseases (Hinderer C, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2014;22(12):2018-27, Gurda BL, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2016;24(2):206-16, Karageorgos LE, et al. Experimental Cell Research. 1997;234(1):85-97). We examined GRN at different ages and GRN - / - and GRN + / +The activity of the lysosomal enzyme hexosaminidase in brain tissue was evaluated from lipofuscin deposits in the mouse, as well as in the cortex, hippocampus, and thalamus (Figures 3A - 3D). The increase in hexosaminidase activity was evident throughout life, while lipofuscin showed progressive accumulation. Lipofuscin was evident as early as 2 months of age, consistent with previous findings (Klein ZA, et al. Neuron 2017;95(2):281 - 96 e6). Our first study was conducted using an AAV vector based on the natural isolate AAVhu68, which is closely related to AAV9, an isolate of clade F. GRN mice at 2 - 3 months of age - / - were treated with either an intracerebroventricular (ICV) injection of an AAVhu68 vector expressing human GRN or vehicle (PBS) (N = 10 per group). Additionally, a cohort of wild - type mice was injected with vehicle (N = 10). In small 2 - month - old mice, it is difficult to reliably administer the vector via the ICM route (the ROA used in NHP studies and the proposed FIH clinical trial), so the ICV ROA (which involves directly injecting the AAV vector into the CSF of the ventricle) was used. Previous studies have shown that ICV administration of AAVhu68 at the dose (10 11 GC) selected for this study is limited to brain regions near the injected ventricle, and it serves as a useful system to evaluate whether overall improvement of brain lesions can be achieved by the secretion of PGRN by a small cell population.

[0129] Two months after vector administration, the animals were euthanized and brains, CSF, and serum were collected. Transduction in the AAV - treated groups was confirmed by quantification of human PGRN protein levels in the brain (Figures 4A - 4F). PGRN is a measurable secreted protein in CSF and is decreased in the CSF of human GRN mutation carriers (Lui H, et al. Cell. 2016;165(4):921 - 35, Meeter LH, et al. Dement Geriatr Cogn Dis Extra. 2016;6(2):330 - 40). Therefore, we examined AAV - treated GRN / -The PGRN protein level in the CSF of mice was evaluated, revealing an average CSF concentration of 14 ng / mL. In contrast, in the vehicle-treated group, human PGRN was below the detection level (Figures 4A - 4F). The expression of PGRN was accompanied by the normalization of lysosomal enzyme expression, AAV-treated GRN - / - The Hex activity level in the brains of mice returned to nearly normal levels (Figures 4A - 4F).

[0130] GRN - / - After confirming PGRN expression in the brains of mice, it was evaluated whether PGRN expression reduced the number of lipofuscin deposits in the hippocampus, thalamus, and cortex. For this purpose, unstained fixed brain sections were placed on a coverslip, and autofluorescent lipofuscin was imaged blindly. AAV-treated GRN - / - Mice showed a reduction in lipofuscin in all brain regions compared to vehicle-treated GRN- / - mice and showed levels similar to those of age-matched wild-type controls (Figures 4A - 4F).

[0131] The first proof-of-concept study demonstrated the therapeutic activity of AAV-mediated PGRN expression in treated mice at an early stage when the accumulating substances had just begun to appear in the brain. Subsequently, the effect of gene transfer in aged mice with more severe existing pathologies was evaluated. In this study, 7-month-old GRN - / - Mice received a single ICV injection of an AAVhu68 vector expressing human PGRN or vehicle and were sacrificed at 11 months of age. In addition to extensive brain lipofuscin deposits (Figures 5A - 5D), 11-month-old GRN - / - Mice showed extensive microgliosis similar to patients with FTD caused by GRN mutations (Figures 6A - 6C) (Ahmed Z, et al. Journal of neuroinflammation. J Neuroinflammation. 2007 Feb 11;4:7). GRN gene transfer reduced brain Hex activity and lipofuscin deposits in aged mice, similar to the findings in younger animals (Figures 5A - 5D). Furthermore, the size and number of microglia were normalized in the brains of treated mice (Figures 6A - 6C).

[0132] Combined, an AAV vector expressing human PGRN was used to deliver GRN - / - by intracerebroventricular (ICV) delivery into the mouse brain, demonstrating that lipofuscin aggregates were removed, lysosomal enzyme activity was almost completely normalized, and an important aspect of the pathophysiology underlying GRN-related neurodegenerative diseases could be effectively corrected by PGRN gene delivery.

[0133] Example 3: AAV-Mediated GRN Gene Transfer in Non-Human Primates GRN - / -Findings in mice demonstrate that delivery of AAV vectors to the CSF can achieve sufficient brain transduction to produce therapeutic levels of PGRN and prevent or reverse the biochemical and histological findings associated with PGRN deficiency. To translate this approach to humans, studies were conducted in non-human primates using intracerebroventricular (ICM) delivery, a clinically relevant vector administration route. Intrathecal AAV delivery by injection into the cisterna magna is a minimally invasive approach that results in more extensive brain transduction than administration by lumbar puncture (Hinderer C, et al. Molecular therapy Methods & clinical development. 2014;1:14051). NHPs aged 3 - 10 years were utilized to represent the intended adult patient population. Cynomolgus monkeys (N = 2 per group) were administered a single ICM injection guided by imaging with AAV1, AAV5, or AAVhu68 vectors, which express human GRN from a transgene designated hPGRN (SEQ ID NO: 3) under the control of the chicken beta-actin promoter and CMV IE enhancer (referred to as the CB7 promoter). Additional groups were treated with AAVhu68 vectors carrying different engineered transgene sequences (hPGRN v2, SEQ ID NO: 4) expressed from the ubiquitin C promoter (UbC). Levels of human progranulin in the CSF were measured weekly, and at 35 days post-injection, the animals were sacrificed for histopathological analysis. A preliminary safety analysis was performed, including daily cage-side observations, a series of physical examinations, a complete blood count, a serum chemistry panel, CSF chemistry and cytology, and a complete necropsy with microscopic evaluation of the brain and spinal cord. The treatment groups are summarized in the following table.

Table 4

[0134] Robust PGRN expression was detected in the CSF of all NHPs after vector administration (Figure 7A). Two animals treated with the AAVhu68 vector showed CSF human PGRN levels up to 10-fold higher than those of healthy human controls, and GRN - / -It was similar to the level that reversed lysosomal abnormalities in the mouse brain. AAV5 treatment resulted in CSF expression levels that were nearly equivalent to those of AAVhu68. The expression of human PGRN was maximal in animals treated with the AAV1 vector, reaching more than 40 times normal human levels. Samples of NHP-derived CSF and plasma treated with the AAVhu68 and AAV1 vectors were tested for antibodies against human PGRN. All four animals expressed antibodies against the human transgene product (Figs. 8A–8C), which could account for the decrease in expression levels at the end of the study. The onset of the anti-human PGRN antibody response in CSF correlated with the transgene expression level and peaked at an early stage in the AAV1 group.

[0135] ICM delivery of AAV showed good tolerance in all treatment groups. No treatment-related abnormalities were identified by daily observation, physical examination, complete blood count, or serum chemistry panel. Similar to other ICM AAV studies using heterologous transgenes (Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10:79–88), CSF analysis revealed an asymptomatic lymphocytosis starting 7–21 days after injection for all vector serotypes, reflecting the antibody response to the transgene product (Figs. 8A–8C). The CSF cell count decreased from the peak level but remained elevated at necropsy for most animals. Brain and spinal cord histopathology was evaluated for the groups treated with AAV1 and AAVhu68. The findings were similar to those in previous ICM AAV studies (Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10:79–88, Hordeaux J, et al. Mol Ther Similar to (Methods Clin Dev. 2018;10:68 - 78), it is accompanied by minimal lymphocyte infiltration sometimes observed in the meninges and choroid plexus, as well as degeneration of sensory neurons and their associated axons in some dorsal root ganglia (DRG) and spinal cord sections. Similar to previous ICM AAV studies, the findings in sensory neurons were typically of minimal to mild severity and were not associated with clinical signs (Gurda BL, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2016;24(2):206 - 16, Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10:79 - 88, Hordeaux J, et al. Mol Ther Methods Clin Dev. 2018;10:68 - 78). No vector - related abnormalities were observed in the brain parenchyma of any of the animals.

[0136] CNS transduction after ICM administration of AAV1 and AAVhu68 vectors to non - human primates Different patterns We, the researchers, decided to further explore the differences in the transduction patterns of AAV1, AAV5, and AAVhu68 vectors from the significantly high PGRN expression in the CSF of NHPs treated with the AAV1 vector. A single ICM injection of an AAV1, AAV5, or AAVhu68 vector (3×10 13 GC, n = 2 per vector) expressing the GFP reporter gene was administered to NHPs. Animals were sacrificed 28 days after injection for histological analysis of brain transduction.

[0137] In immunohistochemistry, scattered patchy transduction was revealed throughout the brains of NHPs treated with AAV1 and AAVhu68 vectors (not shown). Minimal transduction was prominent in the brains of animals that received the AAV5 vector. To more precisely characterize the differences in transduction between AAV1 and AAVhu68, a semi-automated method was developed to quantify transduced cells in sections recovered from multiple brain regions. Using sections stained with fluorescently labeled antibodies against GFP and markers of specific cell types, the total numbers of neurons, oligodendrocytes, and astrocytes were quantified by staining for NeuN, olig2, and GFAP, followed by quantification of GFP-expressing cells of each type (Figures 9 and 10). AAV1 and AAVhu68 transduced less than 1 percent of each cell type in all regions examined. Neuronal transduction was approximately equivalent between the two vectors, although AAVhu68 appeared to transduce slightly more astrocytes and oligodendrocytes.

[0138] Given the dramatically high CSF PGRN levels achieved with AAV1, the nearly equivalent brain transduction observed with AAV1 and AAVhu68 vectors was unexpected. Ependymal cell transduction was evaluated by immunohistochemistry in multiple regions of the lateral and fourth ventricles of animals treated with AAVhu68 and animals treated with AAV1 (RA1826). Interestingly, multiple brain sections from AAV1-treated animals (RA1826), which included a portion of the ventricular system, showed extensive transduction of ependymal cells lining the ventricles, which was not observed in any of the AAVhu68-treated animals (not shown). Across all sampled regions, including the anterior, lateral, and posterior horns of the lateral ventricle and the fourth ventricle, an average of 48% of ependymal cells were transduced. In contrast, in the same brain regions of animals given the AAVhu68 vector, only 1-2% of ependymal cells were transduced. Only a small segment of one lateral ventricle was evaluable in the second AAV1-treated animal, which showed transduction of ~1% of ependymal cells, but the analysis was limited to a small sampling area. Considering that transduction of other cell types appears similar between the two serotypes, these findings suggest that highly transduced ependymal cells in AAV1-treated animals may be the source of the high levels of PGRN in the CSF. Due to the bystander effect mediated by secreted PGRN, FTD caused by GRN mutations is, exceptionally, suitable for AAV gene therapy. Since extracellular PGRN can be taken up by neurons, the high CSF PGRN levels achieved with the AAV1 vector (apparently mediated by robust ependymal cell transduction) make AAV1 an ideal option for GRN gene therapy.

[0139] Example 4: Recombinant AAV1.PGRN rAAV1.PGRN was generated by triple plasmid transfection of HEK293 cells using 1) an AAV cis plasmid (designated pENN.AAV.CB7.CI.hPGRN.rBG.KanR) encoding a transgene cassette adjacent to the AAV ITR, 2) an AAV trans plasmid (designated pAAV2 / 1.KanR) encoding the AAV2 rep and AAV1 cap genes, and 3) a helper adenovirus plasmid (designated pAdΔF6.KanR). The size of the vector genome packaged in rAAV1.PGRN is 4129 bases.

[0140] A. Sequence elements of the AAV vector genome plasmid A linear map of the vector genome from the cis plasmid (designated pENN.AAV.CB7.CI.hPGRN.rBG.KanR (p4862)) can be found in Figure 2.

[0141] The cis plasmid contains the following vector genome sequence elements: 1. Inverted terminal repeats (ITRs): The ITRs are identical inverted complementary sequences, and AAV2 (130 base pairs [bp], GenBank: NC_001401) flanks all elements of the vector genome. The ITR sequence functions as both the origin of replication of vector DNA and the packaging signal of the vector genome when AAV and adenovirus helper functions are provided in trans. Thus, the ITR sequence represents only the cis sequences required for replication and packaging of the vector genome. 2. Human cytomegalovirus immediate early enhancer (CMV IE): This enhancer sequence, from human CMV (382 bp, GenBank: K03104.1), increases the expression of the downstream transgene. 3. Chicken β-actin promoter (BA): This ubiquitous promoter (282 bp, GenBank: X00182.1) was selected to drive transgene expression in any CNS cell type. 4. Chimeric intron (CI): The hybrid intron contains elements of the chicken β-actin splice donor (973 bp, GenBank: X00182.1) and the rabbit β-globin splice acceptor. The intron is transcribed but is removed from the mature messenger RNA (mRNA) by splicing together with sequences at either end of it. The presence of the intron in the expression cassette has been shown to facilitate mRNA transport from the nucleus to the cytoplasm, thereby enhancing the accumulation of a certain level of mRNA for translation. This is a common feature in gene vectors intended to increase gene expression levels. 5. Coding sequence: The engineered cDNA of the human GRN gene encodes the human PGRN (hPGRN) protein, which is involved in lysosomal function and other nervous system roles (1785 bp, GenBank: NM_002087.3, 593 amino acids [aa], GenBank: NP_002078). 6. Rabbit β-globin polyadenylation signal (rBG PolyA): The rBG PolyA signal (127 bp, GenBank: V00882.1) promotes efficient polyadenylation of the introduced gene's mRNA in cis. This element functions as a signal for transcription termination, specific cleavage events at the 3'-end of the nascent transcript, and addition of a long polyadenyl chain.

[0142] B. AAV1 transplasmid: pAAV2 / 1.KanR (p0069) The AAV2 / 1 transplasmid is pAAV2 / 1.KanR (p0069). The pAAV2 / 1.KanR plasmid is 8113 bp in length and encodes the four wild-type AAV2 rep proteins required for replication and packaging of the AAV vector genome. pAAV2 / 1.KanR also encodes three wild-type AAV1 virion proteins, the capsid (Cap) proteins, and is assembled into the virion shell of AAV serotype 1 (AAV1) to accommodate the AAV vector genome. The AAV1 cap gene contained in pAAV2 / 1.KanR was isolated from a monkey source.

[0143] To generate the pAAV2 / 1.KanR construct, a 3.0 kilobase (kb) fragment from p5E18(2 / 2), a 2.3 kb fragment from pAV1H, and a 1.7 kb fragment from p5E18(2 / 2) were incorporated to form pAAV2 / 1(p0001), which contains AAV2 rep and AAV1 cap in an ampicillin resistance (AmpR) cassette (referred to as p5E18[2 / 1] in the literature). In this cloning strategy, the AAV p5 promoter, which normally drives rep expression, was moved from the 5' end of rep to the 3' end of cap, leaving a truncated p5 promoter upstream of rep. This truncated promoter downregulates rep expression and, as a result, plays a role in maximizing vector production (Xiao et al., (1999) Gene therapy vectors based on adeno-associated virus type 1. J Virol. 73(5):3994-4003).

[0144] To generate pAAV2 / 1.KanR for clinical product manufacture, the ampicillin resistance (AmpR) gene in the backbone sequence of pAAV2 / 1 was replaced with a kanamycin resistance (KanR) gene. All components of the transfer plasmid were verified by direct sequencing.

[0145] C. Adenovirus helper plasmid: pAdDeltaF6(KanR) Plasmid pAdDeltaF6(KanR) was constructed in the laboratory of Dr. Jame M. Wilson and colleagues at the University of Pennsylvania and is 15,774 bp in size. This plasmid contains regions of the adenovirus genome important for AAV replication, namely E2A, E4, and VA RNA (the function of adenovirus E1 is provided by HEK293 cells). However, this plasmid does not contain other adenovirus replication or structural genes. The plasmid does not contain cis elements important for replication such as adenovirus ITRs, and thus, the production of infectious adenovirus is not expected. The plasmid is derived from an Ad5 E1, E3 deletion molecular clone (pBHG10, a pBR322-based plasmid). Deletions were introduced into Ad5 to remove the expression of unnecessary adenovirus genes and reduce the amount of adenovirus DNA (from 32 kb to 12 kb). Finally, the ampicillin resistance gene was replaced with a kanamycin resistance gene to generate pAdDeltaF6(KanR). The remaining adenovirus genes of E2, E4, and VAI in this plasmid, together with E1 present in HEK293 cells, are necessary for AAV vector production. The vector is generated according to the following flowchart shown in Figures 13 and 14.

[0146] The final product should have a pH in the range of 6.2 - 7.7 as determined by USP<791>, an osmotic pressure of 260 - 320 mOsm / kg as determined by USP<785>, and a GC titer of 2.5×10 13 GC / mL or higher as determined by ddPCR (Lock et al, (2014). “Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR.” Hum Gene Ther Methods. 25(2):115 - 25).

[0147] Example 5: GRN - / -Identifying the minimal effective dose of rAAV1.PGRN in mice [Table 5]

[0148] Grn - / - The impact of different doses of rAAV1.PGRN on CNS pathology in a mouse model is evaluated as follows. Efficacy is assessed by the degree of reduction in brain accumulation pathology (lipofuscin), which serves as a quantitative outcome measure directly related to disease pathophysiology. In addition, a terminal blood draw for complete blood count and serum chemistry panel, as well as target organ histopathology, are included to identify disease-specific toxicities that may not be detected in NHP toxicity studies. Mice are treated at 5-6 months of age, when widespread lipofuscin accumulation is present, to recapitulate the disease state in older subjects with GRN haploinsufficiency. Grn - / - Mice were administered four doses of rAAV1.PGRN (1.30x10 11 GC, 4.40x10 10 GC, 1.30x10 10 GC, or 4.40x10 9 Grn treated with vehicle (N=15) or vehicle (ITFFB [artificial CSF containing 0.001% Pluronic F-68]) + / + Mice serve as normal controls. After 90 days of treatment, animals are sacrificed, brains harvested, sectioned, and lipofuscin lesions quantified. MED is the mean ± SD of vehicle-treated Grn mice. - / - The dose showing a significant reduction in brain accumulation lesions compared to non-treated mice was determined. Significance was determined using one-way ANOVA followed by Tukey's multiple comparison test (α=0.05) where appropriate.

[0149] Example 6: Toxicity studies in non-human primates rAAV1.CB7.CI.hPGRN.rBG is a non-replicating recombinant adeno-associated (AAV) vector consisting of serotype AAV1, which contains engineered human progranulin (PGRN) cDNA under the control of the chicken beta-actin promoter with a cytomegalovirus enhancer, and a rabbit beta-globin polyadenylation sequence adjacent to the AAV serotype 2 inverted terminal repeats, and was formulated in intrathecal final formulation buffer (ITFFB). The ddPCR titer was 2.04×10 13 GC / mL. The pH of the ITFFB was adjusted to pH 7.4 to maximize the solubility of the test article product. The control article was prepared on the day of dosing. The diluted article was kept on wet ice or at 2 - 8°C until dosing on the same day.

[0150] To investigate the toxicity of rAAV1.PGRN after ICM administration, a 90-day GLP-compliant safety study was conducted in adult cynomolgus monkeys. NHPs aged 3 - 10 years were used in this study to represent the intended adult human patient population. A 90-day evaluation period was selected to allow sufficient time for the secreted transgene product to reach stable steady-state levels after AAV administration of ICM. The cynomolgus monkeys received one of three dose levels of rAAV1.hPGRN or vehicle (ITFFB, N = 2), a total of 3.00×10 12 GC, a total of 1.00×10 13 GC, or a total of 3.00×10 13 GC (N = 3 per dose). The dose levels were selected to be equivalent to those evaluated in a planned minimum effective dose (MED) study when scaled by brain mass (assuming 0.4 g in mice and 90 g in cynomolgus monkeys). Baseline neurological examinations, clinical pathology (cell count with differential, clinical chemistry, and coagulation panel), CSF chemistry, and CSF cytology were performed. After administration of rAAV1.PGRN or vehicle, the animals were monitored daily for signs of pain and abnormal behavior.

[0151] Blood and CSF clinical pathological evaluations and neurological examinations were performed weekly for 30 days after rAAV1.PGRN or vehicle administration and then every 30 days thereafter. At baseline and every 30 days thereafter, anti-AAV1 neutralizing antibody (Nab) and the cytotoxic T lymphocyte (CTL) response to AAV1 and rAAV1.PGRN transgene products were evaluated by an interferon γ (IFN-γ) enzyme-linked immunosorbent spot (ELISpot) assay. [Table 6] [Table 7]

[0152] Ninety days after rAAV1.PGRN or vehicle administration, the animals were euthanized, tissues were harvested, and comprehensive microscopic histopathological examinations were performed. Additionally, lymphocytes were collected from the liver, spleen, and bone marrow to assess the presence of T cells that react to both the capsid and transgene products within these organs at necropsy.

[0153] The in vivo distribution of the vector was evaluated by qPCR in tissue samples. Also, vector genomes were quantified in serum and CSF samples. Vector excretion was evaluated by analysis of the vector genomes detected in urine and feces. Previous studies have demonstrated that the pattern of vector distribution after ICM administration is dose-independent, that the overall signal is greater in qPCR-based biodistribution assays with higher vector doses, and that sensitivity is highest in the detection of vector deposition in target tissues. Therefore, these analyses were performed only for the highest-dose cohort (Hordeaux et al., 2018b).

[0154] Evaluation of nerve conduction velocity The animals were sedated with a combination of ketamine / dexmedetomidine. The sedated animals were placed on the operating table in the lateral or supine position, and their body temperature was maintained with heat packs. An electronic warming device was not recommended because it might interfere with the acquisition of electrical signals.

[0155] In the sensory nerve conduction test (NCS), the probe of the stimulating device was placed on the median nerve such that the cathode was closest to the recording site. Two needle electrodes were inserted subcutaneously at the level of the distal phalanx of the second finger (reference electrode) and at the level of the proximal phalanx (recording electrode), while the ground electrode was placed proximal to the stimulating probe (cathode). A pediatric stimulating device was used. The induced responses were differentially amplified and displayed on a monitor. The initial acquisition stimulus intensity was set to 0.0 mA to confirm the absence of background electrical signals. To find the optimal stimulation position, the stimulus intensity was increased up to 10.0 mA, and trains of stimuli were generated while moving the probe along the median nerve until the optimal position, as determined by a definitive waveform, was found. With the probe kept at the optimal position, the stimulus intensity was gradually increased stepwise until the peak amplitude response no longer increased. Each stimulus response was recorded and saved in the software. The maximum of up to 10 maximum stimuli were averaged and reported for the median nerve. The distance (cm) from the recording site to the stimulating cathode was measured and entered into the software, and the conduction velocity was calculated using the rise latency of the response and the distance (cm). Both the conduction velocity and the mean value of the sensory nerve action potential (SNAP) amplitude were reported. Both median nerves on both sides were tested. All raw data generated by the equipment were retained as part of the clinical trial materials.

[0156] Figures 11A and 11B show the results of median sensory nerve conduction tests in NHP. At the administered doses, no effect on median sensory nerve conduction was observed. Preliminary histological analysis mainly showed findings in the DRG, TRG, spinal cord, and dorsal white matter tracts of the peripheral nerves (Figures 12A - 12D). These findings consisted of neuronal degeneration in the DRG / TRG and axonal degeneration (i.e., axonal injury) in the dorsal white matter tracts of the spinal cord and peripheral nerves. Overall, these findings were observed across all treatment groups, but at both time points, there was a tendency for higher incidence and severity in individual animals in the medium - and high - dose groups.

[0157] Considering the severity of GRN - related neurodegenerative diseases, it is expected that the benefit / risk profile of ICM administration of rAAV1.PGRN remains favorable.

[0158] Example 7: Human Trial Conduct a first - in - human (FIH) Phase 1 / 2 dose - escalation trial of single - dose rAAV1.hPGRN in patients with adult - onset neurodegenerative diseases caused by mutations in the GRN gene (see the following table). rAAV1.hPGRN is designed to replace the GRN gene. This FIH trial assesses safety and tolerability and collects preliminary data on efficacy. Up to 12 symptomatic heterozygous GRN mutation carriers will be treated with rAAV1.hPGRN, first followed for a period of 2 years (24 months), and long - term follow - up continued for 5 years after dosing. This trial provides data to support the initiation of a registration trial and utilizes the Phase 1 / 2 maximum - tolerated dose (MTD). This registration trial evaluates the effect of rAAV1.hPGRN on disease - related clinical outcomes and biomarkers. All trials involve the administration of a single ICM dose of rAAV1.hPGRN in adult patients with GRN - related neurodegenerative diseases.

Table 8 - 1

Table 8 - 2

Table 8-3

Table 8-4

[0159] Route of administration and treatment rAAV1.hPGRN is administered to the subject as a single dose on Day 1 via CT-guided suboccipital injection into the cisterna magna. On Day 1, a syringe containing rAAV1.hPGRN at an appropriate titer of 5.6 mL is prepared by the Investigational Pharmacy associated with the trial and delivered to the treatment room.

[0160] Before administration of the investigational drug, the subject is anesthetized, intubated, and the injection site is prepared and draped using aseptic technique. LP is performed to remove a predetermined volume of CSF, and then iodinated contrast agent is injected intrathecally (IT) to assist in visualization of the relevant anatomical structures of the cisterna magna. Intravenous (IV) contrast agent can be administered before or during the needle puncture as an alternative to IT contrast agent. The decision to use IV or IT contrast agent is left to the discretion of the interventional physician. Under fluoroscopic guidance, a spinal needle (22-25G) is advanced into the cisterna magna. A larger introducer needle may be used to assist in needle placement. After confirming needle placement, an extension set is attached to the spinal needle and filled with CSF. At the discretion of the interventional physician, a syringe containing contrast agent may be connected to the extension set and a small amount injected to confirm that the needle is placed within the cisterna magna. After confirming needle placement, a syringe containing rAAV1.hPGRN is connected to the extension set. The contents of the syringe are slowly injected over 1-2 minutes to deliver a volume of 5.0 mL.

[0161] Safety evaluations, including collection of adverse events (AE), physical / neurological examinations, vital signs, clinical laboratory tests (serum chemistry, hematology, coagulation, LFT, urinalysis), ECG, nerve conduction studies, and CSF cytology and chemistry (cell count, protein, glucose), are performed at the indicated times in the trial schedule.

[0162] Statistical comparisons for safety evaluations are not planned. All results are for descriptive purposes only. Data are enumerated and summary tables are created.

[0163] Statistical comparisons are performed for secondary and exploratory endpoints. Measurements at each time point are compared to the baseline values of each subject and, for each endpoint, to natural history data from healthy volunteers and GRN patients with comparable cohort characteristics, if available. All data are presented in the subject data listings. Categorical variables are summarized using frequencies and percentages, and continuous variables are summarized using descriptive statistics (number of non-missing observations, mean, standard deviation, median, minimum, and maximum). Graphical displays are presented appropriately.

[0164] The initial clinical symptoms of adult-onset neurodegeneration caused by GRN haploinsufficiency are heterogeneous. This heterogeneity leads to various diagnoses with additional symptoms that appear as the disease progresses. After symptom onset, typically, patients decline rapidly, so patients with any diagnosis of neurodegeneration can be treated as long as they have a confirmed pathogenic heterozygous GRN mutation. Patients may be screened using the CDR-FTLD global score. This assessment scale is designed to evaluate the severity of the disease in patients with FTLD spectrum diagnoses. Due to the overlap of other GRN-related diagnoses with FTLD-related symptoms and the number of domains captured by the CDR-FTLD global score (memory, orientation, judgment and problem-solving, social adaptation, home situation and hobbies, caregiving situation, behavior, and language), this scale can be used for diagnosis. If the CDR-FTLD global score exceeds 0.5 (including patients with mild symptoms) and is 1 or less, treatment of symptomatic patients will be possible at the early stage of neurodegeneration where the benefits of gene therapy are likely to be maximized. Treating patients at this early stage allows for the detection of subsequent changes or stabilization in disease progression and the delay in the onset of additional symptoms. However, in this population, the requirement that the CDR-FTLD global score be at least 0.5 excludes entry into motor-specialized diagnoses because the scale is not optimized to capture impairments in the motor phenotype.

[0165] This gene therapy is not expected to result in PGRN expression above physiological levels. Using the dose of rAAV1.hPGRN in non-clinical NHP studies (higher than the dose used in the FIH trial), it was found that PGRN was expressed in serum at near-normal levels after ICM administration of rAAV1.hPGRN. Subjects enrolled in the FIH trial initially had circulating PGRN levels of approximately 30% of normal values, so it is expected that circulating serum PGRN levels may recover to normal values. Blood tests in patients include a complete blood count (CB C) Screened through the panel, patients are monitored for tumors via MRI with gadolinium contrast agent of the brain and upper spine at the 5-year follow-up point.

[0166] In addition to measuring safety and tolerability as the primary endpoints, secondary and exploratory efficacy endpoints were selected for this study based on recent literature and in consultation with leading clinicians specializing in GRN-related neurodegeneration research. These endpoints track clinical outcomes and disease biomarkers for the purpose of identifying appropriate endpoints for subsequent registration trials.

[0167] Since neurodegeneration caused by GRN mutations ultimately leads to death, the impact of rAAV1.hPGRN on patient survival is also an efficacy endpoint of this study. However, since most patients have an average lifespan of 7 - 11 years from symptom onset, the study period and sample size may not be sufficient to demonstrate a survival benefit.

[0168] Evaluate the effects of rAAV1.hPGRN on clinical symptoms and patients' daily functions. Due to the heterogeneous phenotypes shown by the target patient population, functional and clinical scales are used to capture the progression of symptoms expressed across the range of clinical symptoms. The proposed study utilizes FAB, FRS, MMSE, CGI-C, NPI, and FBI to measure changes over time. These scales mainly measure abilities related to cognition, language, neuropsychological behavior, and daily function, providing information on the progression or stabilization of various clinical symptoms of the disease. UPDRS is also included to capture changes in motor symptoms. In the FIH, these efficacy assessments are essentially exploratory and are intended to capture over time the ability of rAAV.hPGRN to stabilize symptom reduction. Data from the FIH regarding the rate of further decline across various clinical parameters of patients with various clinical symptoms provide additional information for the selection of appropriate endpoints and are used to define clinically meaningful changes in registration trials.

[0169] Each clinical scale will be briefly described below. Clinical scales mainly measuring cognitive function CDR-FTLD: CDR-FTLD is an extended version of the classical Clinical Dementia Rating (CDR) scale, which has historically been used to evaluate the severity of AD spectrum disorders. This assessment includes the original six domains of CDR (memory, orientation, judgment and problem-solving, social adaptation, home situation and hobbies, caregiving situation). It also includes two additional domains of language and behavior that enable detection of decline in FTLD spectrum patients with higher sensitivity. An assessment score of 0 indicates normal behavior or language, and scores of 1, 2, or 3 indicate mild to severe impairment. The total CDR-FTLD assessment items (CDR-FTLD sb) represent the sum of individual domains and are used to determine the overall severity of dementia.

[0170] MMSE: MMSE is an 11-item global cognitive assessment widely used in clinical and research practice. Questions such as "What year is this? What season is it? What day is it? What day of the week is it? What month is it?" are asked, and 1 point is given for each correct answer, with a maximum score given for each question. The upper limit of the total score is 30 points, and there are two cutoffs of 24 points and 27 points. These cutoffs are indicators of cognitive function decline.

[0171] Verbal fluency test: Although not one of the proposed exploratory efficacy endpoints, the verbal fluency test is performed throughout the FIH trial. This may be done by presenting the same picture to each subject and asking for a verbal description. During the description, the speech rate (words per minute) is counted, recorded, and finally compared to the rate reflecting typically developing adults.

[0172] Clinical scales mainly measuring motor function UPDRS: The UPDRS is a four-part assessment of 42 items in several domains related to parkinsonism, such as mental state, behavior and mood, and activities in daily life. Each item includes a rating scale ranging from 0 (indicating no impairment) to 4 (indicating the most severe impairment). The scores for each part are aggregated to provide the severity of the disease, and a high score of 199 points indicates the worst / most severe impairment.

[0173] Clinical scale mainly measuring behavior NPI: The NPI is used to elucidate the presence of psychopathology in patients with brain disorders. Initially developed for use in the AD population, it is thought to be useful for assessing behavioral changes in other conditions. This assessment consists of 10 behavioral domains and 2 autonomic regions, and among them, there are 4 scores: frequency, severity, overall burden, and caregiver burden. The total score of the NPI is obtained by adding the domain scores of the behavioral domains and subtracting the score of the caregiver burden.

[0174] FBI: The FBI is a 24-item assessment of behavioral and personality changes particularly related to bvFTD, which differentiates bvFTD from other dementias. Since patients diagnosed with bvFTD generally have no awareness of these types of changes, this is conducted as a face-to-face interview with the primary caregiver. Focusing on several areas related to behavior and personality, each question is scored from 0 (none) to 3 (severe / almost always). The total score typically correlates with the severity of the disease and can be used to evaluate changes over time.

[0175] Clinical scale measuring both cognitive and motor functions CGI-C: The CGI-C is one of three brief and widely used assessments. It consists of 3 items and is evaluated by clinicians. The CGI-C is evaluated on a 7-point scale ranging from 1 (very improved) to 7 (very deteriorated), starting from study enrollment regardless of whether the improvement is entirely due to treatment.

[0176] FAB: The FAB is a simple assessment to assist in differentiating between frontotemporal dementia phenotype dementia and AD-type dementia. It is particularly useful in patients with mild dementia (MMSE > 24). This assessment consists of six parts and addresses the domains of cognition, movement, and behavior. A total score of 18 or higher indicates better performance.

[0177] FDR: The FDR is a simple staging assessment for patients diagnosed with frontotemporal dementia (FTD) subtypes (i.e., either bvFTD or PPA subtype). The FDR detects differences in the disease progression of FTD over time. This simple interview is conducted with the primary caregiver and consists of 30 items, which are classified as "never occurs," "occurs sometimes," or "always occurs." A percentage score is then calculated and converted to a logit score and finally to a severity score. The severity score ranges from "very mild" to "most severe."

[0178] Columbia Suicide Severity Rating Scale (C-SSRS): The C-SSRS score is not a primary exploratory efficacy endpoint for the FIH, but this assessment is conducted throughout the study. The C-SSRS is a three-part scale that measures suicidal thoughts, intensity of thoughts, and suicidal behavior. The results of this assessment consist of a suicidal behavior lethality assessment, a suicidal thoughts score, and a suicidal thoughts intensity assessment, which are obtained directly from the scale. A thoughts score greater than 0 may indicate the need for intervention based on the assessment guidelines. The intensity assessment ranges from 0 to 25, with 0 representing no support for suicidal thoughts.

[0179] As an additional exploratory endpoint, the survival rate of patients is evaluated. However, patients diagnosed with neurodegeneration due to GRN haploinsufficiency have an average lifespan of 7 to 11 years from the onset of symptoms. Therefore, the study period, sample size, and inclusion of subjects at the early stage of the disease may not be sufficient to demonstrate a survival benefit.

[0180] Administration of rAAV1.hPGRN reduces atrophy (loss of neurons), mainly in the frontal and temporal cortex, caused by GRN - related haploinsufficiency, and stabilizes total brain volume over time. MRI can be used to track changes in the thickness of the medial prefrontal cortex and parietal regions.

[0181] Biochemical biomarkers are also evaluated. The levels of PGRN protein in CSF and plasma are measured as a read - out of AAV transduction and increase in patients after administration of rAAV1.hPGRN. CSF levels of neurofilament light chain (NFL), tau, phosphorylated tau, and other inflammatory markers are also tracked. NFL is considered a general indicator of neuronal loss or damage. Tau and phosphorylated tau are associated with pathologies seen in AD, PD, and some forms of FTD.

[0182] Patients' blood tests are screened through a complete blood count (CBC) panel, and patients are monitored for tumors via MRI with gadolinium - based contrast agents of the brain and upper spine at the 5 - year follow - up time point.

[0183] A single administration of rAAV1.hPGRN is safe and well - tolerated after administration. A single administration of rAAV1.hPGRN improves survival and / or reduces disease progression as evaluated by clinical symptoms and the patient's daily function. The treatment delays the loss of neurocognitive function.

[0184] (Sequence Listing Free Text) The following information is provided for sequences containing free text under numerical identifier <223>.

Table 9 - 1

Table 9 - 2

Table 9 - 3

[0185] All documents cited in this specification are hereby incorporated by reference into this specification. U.S. Provisional Patent Application No. 62 / 809,329, filed on February 22, 2019, U.S. Provisional Patent Application No. 62 / 923,812, filed on October 21, 2019, and U.S. Provisional Patent Application No. 62 / 969,108, filed on February 2, 2020, together with their sequence listings, are hereby incorporated by reference in their entirety. Similarly, the sequence listing submitted herewith under the name "18-8663PCT_ST25.txt", as well as the sequences and text therein, are hereby incorporated by reference. Although the present invention has been described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to be within the scope of the appended claims.

Claims

1. A recombinant AAV (rAAV), (a) an AAV capsid derived from adeno-associated virus 1; (b) a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats (ITRs), a coding sequence for human Progranulin, and a regulatory sequence that directs expression of the Progranulin.

2. The rAAV of claim 1, wherein the coding sequence encodes the human progranulin protein of SEQ ID NO:

1.

3. The rAAV of claim 1 or 2, wherein the coding sequence for Progranulin is SEQ ID NO: 3, or a sequence at least 95% to 99.9% identical thereto.

4. The rAAV of any one of claims 1 to 3, wherein the vector genome comprises a promoter, an enhancer, an intron, a coding sequence for human progranulin, and a polyadenylation signal.

5. The rAAV of any one of claims 1 to 4, wherein the intron consists of a chicken beta actin splice donor and a rabbit β splice acceptor element.

6. The rAAV of any one of claims 1 to 5, wherein the AAV inverted terminal repeats (ITRs) are the AAV2 5'ITR and the AAV2 3'ITR, which flank the Progranulin coding and regulatory sequences.

7. The rAAV of any one of claims 1 to 6, wherein the vector genome comprises: (a) an EF-1a promoter and an SV40 late polyA; (b) a UbC promoter, an intron, and an SV40 late polyA; or (c) a CB7 promoter, a chimeric intron, and a rabbit globin polyA.

8. The rAAV of claim 7, wherein the vector genome comprises the sequence of SEQ ID NO:

24.

9. A pharmaceutical composition comprising an aqueous liquid suitable for intrathecal administration and a recombinant AAV (rAAV) suitable for use in the treatment of neurodegeneration caused by GRN-haploinsufficiency, said rAAV comprising: (a) an AAV capsid derived from adeno-associated virus 1; (b) a vector genome packaged in the AAV capsid, the vector genome comprising AAV inverted terminal repeats (ITRs), a coding sequence for human Progranulin, and a regulatory sequence that directs expression of the Progranulin.

10. The composition of claim 9 , wherein the coding sequence encodes the human progranulin protein of SEQ ID NO:

1.

11. The composition of claim 9 or 10, wherein the coding sequence for Progranulin is SEQ ID NO:3, or a sequence that is at least 95% to 99.9% identical to at least amino acids 18 to 593 of SEQ ID NO:

3.

12. The composition according to any one of claims 9 to 11, wherein the vector genome comprises a promoter, an enhancer, an intron, a coding sequence for the human Progranulin, and a polyadenylation signal.

13. The composition of any one of claims 9 to 12, wherein the intron consists of a chicken beta actin splice donor and a rabbit beta splice acceptor element.

14. The composition of any one of claims 9 to 13, wherein the AAV inverted terminal repeats (ITRs) are the AAV2 5'ITR and the AAV2 3'ITR, which flank the Progranulin coding sequence and the regulatory sequences of the vector genome.

15. The composition of any one of claims 9 to 14, wherein the vector genome comprises: (a) an EF-1a promoter and an SV40 late polyA; (b) a UbC promoter, an intron, and an SV40 late polyA; or (c) a CB7 promoter, a chimeric intron, and a rabbit globin polyA.

16. The rAAV of claim 15, wherein the vector genome comprises the sequence of SEQ ID NO:

24.

17. The composition according to any one of claims 9 to 16, wherein the composition comprises an artificial cerebrospinal fluid comprising a surfactant.

18. The composition of claim 17, wherein the surfactant is Pluronic F-68.

19. A recombinant AAV (rAAV) according to any one of claims 1 to 8 or a pharmaceutical composition according to any one of claims 9 to 18 for use in a method for the treatment of a patient with adult-onset neurodegeneration caused by GRN-haploinsufficiency.

20. Use of a recombinant AAV (rAAV) according to any one of claims 1 to 8 or a pharmaceutical composition according to any one of claims 9 to 18 in the manufacture of a medicament for treating a patient with adult-onset neurodegeneration caused by GRN-haploinsufficiency.

21. The composition comprises 1×10 １０ GC / g brain mass ~3.33x10 １１ 21. The use of claim 19 or 20, wherein the dose of GC / g brain mass is formulated to be administered intrathecally.

22. The patient is an adult human and has 1.44×10 １３ ~4.33 x 10 １４ 21. The use according to claim 19 or 20, wherein a dose of GC is administered.

23. The use of any one of claims 19 to 22, wherein the rAAV or composition is administrable in a regimen further comprising one or more of: (a) non-invasively assessing the patient for reduction in retinal storage pathology as a predictor of reduction in brain pathology; (b) performing magnetic resonance imaging to assess brain volume; and / or (b) measuring the concentration of progranulin concentration in the CSF.

24. The use according to any one of claims 19 to 23, wherein the rAAV comprising the coding sequence for Progranulin is delivered intrathecally via intracerebroventricular delivery or via intraparenchymal delivery.

25. 24. The use according to any one of claims 19 to 23, wherein the composition is administered as a single dose via computed tomography (CT)-guided suboccipital injection into the cisterna magna (intracisternal).

26. The method according to any one of claims 19 to 25, wherein the patient has progranulin-frontotemporal dementia.

2. The use according to claim 1 .

27. A method of treating a human patient with adult-onset neurodegeneration caused by granulin (GRN) haploinsufficiency, comprising delivering a recombinant adeno-associated virus (rAAV) having an AAV capsid of adeno-associated virus 1 (AAV1) to the central nervous system (CNS), the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human progranulin, and a regulatory sequence directing expression of the progranulin.

28. A method of treating a human patient with adult-onset neurodegeneration caused by granulin (GRN) haploinsufficiency, comprising administering to the central nervous system (CNS) a recombinant adeno-associated virus (rAAV) having an AAV capsid of adeno-associated virus 1 (AAV1) that targets ependymal cells, the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human Progranulin, and a regulatory sequence that directs expression of the Progranulin in the ependymal cells.

29. A method for treating a human patient having brain pathology associated with adult-onset neurodegeneration caused by granulin haploinsufficiency, comprising administering to the central nervous system a recombinant adeno-associated virus (rAAV) having an AAV capsid of adeno-associated virus 1 (AAV1), the rAAV further comprising a vector genome packaged within the AAV capsid, the vector genome comprising AAV inverted terminal repeats, a coding sequence for human Progranulin, and a regulatory sequence directing expression of the Progranulin.

30. The method of any one of claims 27 to 29, wherein the patient is administered an rAAV of any one of claims 1 to 8 or a pharmaceutical composition of any one of claims 9 to 18.

31. The patient receives 1×10 １０ GC / g brain mass ~3.33×10 １１ 31. The method of any one of claims 27 to 30, wherein the dose of GC / g brain mass is administered intrathecally.

32. The patient is an adult human and has 1.44×10 １３ ~4.33 x 10 １４ The method according to any one of claims 27 to 30, wherein a dose of GC is administered.

33. 33. The method of any one of claims 27-32, further comprising one or more of: (a) non-invasively assessing the patient for reduction in retinal storage pathology as a predictor of reduction in brain pathology; (b) performing magnetic resonance imaging to assess brain volume; and / or (c) measuring the concentration of progranulin concentration in the CSF.

34. The method of any one of claims 27 to 33, wherein the rAAV comprising the coding sequence for Progranulin is delivered intrathecally via intracerebroventricular delivery or via intraparenchymal delivery.

35. 34. The method of any one of claims 27-33, wherein the rAAV is administered as a single dose via computed tomography (CT)-guided suboccipital injection into the cisterna magna (intracisternal).

36. The method of any one of claims 27 to 35, wherein the patient has progranulin-associated frontotemporal dementia (FTD).

Images