Method for determining titer of RNA viral vectors
Patent Information
- Application Number
- JP2025023503
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-09-04
- Filing Date
- 2025-02-17
- Publication Date
- 2025-09-17
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current methods for determining the titer of recombinant lentiviral vectors are either time-consuming, taking at least seven days, or non-specific, making it urgent to develop a rapid and accurate method for titer evaluation.
A method involving the use of PCR and RT-PCR to determine the copy number of a sequence element in a sample containing an RNA viral vector, allowing for the rapid calculation of the RNA copy number of the viral vector by subtracting the DNA copy number from the total copy number, thereby determining the titer within 2 hours.
This method enables rapid and specific determination of the titer of RNA viral vectors, such as lentiviral vectors, within 2 hours, improving the efficiency of in-process monitoring and product control during vector production.
Smart Images

Figure 00000021_0000 
Figure 00000021_0001 
Figure 00000022_0000
Abstract
Description
Technical Field
[0001] Cross - reference to related applications This application claims priority to Chinese Patent Application No. 202010922956 filed on September 4, 2020, the entire content of which is incorporated herein by reference.
[0002] Sequence Listing This application is electronically submitted in ASCII format and includes a sequence listing that is incorporated herein by reference in its entirety. The ASCII copy created on September 2, 2021 is named 11 299 - 009941 - WO0_ST25.txt and has a size of 2 KB .
[0003] The present disclosure relates to a method for rapidly determining the titer of RNA virus vectors such as lentiviral vectors.
Background Art
[0004] Gene therapy refers to introducing exogenous therapeutic genes into target cells to correct or compensate for diseases caused by gene defects or abnormalities. Alternatively, the product expressed by the exogenous gene can act for treatment at the treatment target.
[0005] The exogenous gene can be transduced or delivered via a viral vector or a non - viral vector. Commonly used non - viral vectors include liposomes, dendrimers, non - natural cationic polymers, natural polysaccharides, etc. Non - viral gene delivery vectors are relatively safe and stable, but their transfection efficiency is usually low. Viral vectors package foreign genes into the capsid of natural viruses and Foreign genes can be introduced into cells using infectivity. Common viral vectors include retroviruses (recombinant retroviruses, rRV), recombinant lentiviruses (rL V), adenoviruses (recombinant adenoviruses, rAd), and adeno-associated viruses ( recombinant adeno-associated viruses, rAAV). The transduction efficiency of viral vectors is much higher than that of non-viral vectors. Therefore, viral vectors are particularly suitable for infecting target cells that are difficult to infect, such as lymphocytes.
[0006] Recombinant lentiviral vectors can be based on HIV-1 (human immunodeficiency virus type I). Unlike other retroviral vectors, lentiviral vectors have the ability to infect both dividing and non-dividing cells. Recombinant lentiviral vectors have high biological titers and low immunogenicity in vivo and in vitro, so they have become the first choice transgenic vectors for CAR- T cells and gene therapy. Currently, the most common assays for determining the titer of recombinant lentiviral vectors
[0007] include the p24 Elisa method and functional titer quantification methods. The p24 Elisa method takes one day to obtain results, while the latter requires at least seven days and can be non-specific. Therefore, there is an urgent need to develop a method for rapidly evaluating the titer of lentiviral vectors.
Summary of the Invention
Problems to be Solved by the Invention
[0008] Therefore, there is an urgent need to develop a method for rapidly evaluating the titer of lentiviral vectors.
Means for Solving the Problems
[0009] The present disclosure provides a method for determining the titer of an RNA viral vector in a sample. The method comprises , (a) providing a sample comprising an RNA viral vector and a DNA molecule, or adding a DNA molecule to a sample comprising an RNA viral vector, wherein both the RNA viral vector and the DNA molecule comprise a sequence element; (b) obtaining a first portion and a second portion from the sample; and (c) performing a polymerase chain reaction (PCR) on the first portion to determine the copy number (n1) of the sequence element in the first portion, and performing reverse transcription PCR (RT-PCR) on the second portion to determine the copy number (n 2) of the sequence element in the second portion, wherein the RNA copy number of the RNA viral vector in the sample is determined by the difference between n 1 and n2, i.e., n2 - n1. 1 and n2, i.e., n2 - n1. 1 and n2, i.e., n2 - n1.
[0010] The method may further comprise step (d) of determining the infectivity titer of the RNA viral vector based on the RNA copy number of the RNA viral vector in the sample.
[0011] The method may further comprise step (d) of determining the titer of the RNA viral vector based on the RNA copy number in the sample.
[0012] The RNA viral vector can be a retroviral vector such as a lentiviral vector.
[0013] The sequence element can be a regulatory element, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE ).
[0014] The sequence element can be a long terminal repeat (LTR) or a promoter.
[0015] PCR can amplify a region of a sequence element using a primer pair. RT-P CR can amplify a region of a sequence element using a primer pair.
[0016] Both PCR and RT-PCR can amplify a region of a sequence element using a primer pair, respectively. amplify.
[0017] The primer pair can include two primers containing the nucleotide sequences shown in (i) SEQ ID NO: 1 and SEQ ID NO: 2, respectively; (ii) SEQ ID NO: 3 and SEQ ID NO: 4, respectively; or (iii) SEQ ID NO: 5 and SEQ ID NO: 6, respectively shown.
[0018] PCR can be quantitative PCR (qPCR). RT-PCR can be RT-qPCR (real-time time quantitative reverse transcription PCR).
[0019] The DNA molecule can be a DNA plasmid. In one embodiment, the DNA plasmid is a pa ckaging plasmid, an envelope plasmid, and / or a transfer plasmid mid.
[0020] In certain embodiments, the infectivity titer of an RNA viral vector is determined by (RNA copy number of the RNA viral vector × infectivity titer of the positive control) / RNA copy number of the positive control, where the positive control is an RNA viral vector with a known infectivity titer. ined, and the positive control is an RNA viral vector with a known infectivity titer. ined.
[0021] The titer of the RNA viral vector can be determined within 2 hours.
[0022] The titer can be a physical titer or an infectivity titer.
[0023] The present disclosure provides a method for rapidly determining the titer of an RNA viral vector (e.g., a lentiviral vector). It provides a method for rapidly determining the titer of an RNA viral vector (e.g., a lentiviral vector).
[0024] A first aspect of the present disclosure provides a method for rapidly determining the titer (e.g., infectivity titer or physical titer) of an RNA viral vector (e.g., a lentiviral vector), the method comprising: (a) providing a sample to be tested, the sample comprising an RNA viral vector (e.g., a lentiviral vector) and a DNA molecule (e.g., a DNA plasmid); (b) performing RT-PCR and PCR reactions on the sample, respectively, to obtain the copy number of a sequence element (e.g., the WPRE element) in the sample, the copy number of the sequence element (e.g., the WPRE element) comprising the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the copy number of the DNA molecule (e.g., a DNA plasmid) containing the sequence element (e.g., the WPRE element); and (c) determining the titer of the RNA viral vector (e.g., a lentiviral vector) based on the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) in the sample. In one embodiment, the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) in the sample is determined by the following formula: the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the DNA molecule (e.g., a DNA plasmid) containing the sequence element (e.g., the WPRE element), the copy number of the sequence element (e.g., the WPRE element) comprising the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the copy number of the DNA molecule (e.g., a DNA plasmid) containing the sequence element (e.g., the WPRE element). (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the copy number of the DNA molecule (e.g., a DNA plasmid) containing the sequence element (e.g., the WPRE element). (e.g., a DNA plasmid) containing the sequence element (e.g., the WPRE element). (e.g., the WPRE element) in the sample. And (c) determining the titer of the RNA viral vector (e.g., a lentiviral vector) based on the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) in the sample. (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) in the sample. (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) in the sample.
[0025] In one embodiment, the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) in the sample is determined by the following formula: the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the DNA molecule (e.g., (e.g., the WPRE element) in the sample is determined by the following formula: the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the DNA molecule (e.g., (e.g., the WPRE element) in the sample is determined by the following formula: the RNA copy number of the RNA viral vector (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the DNA molecule (e.g., (e.g., a lentiviral vector) containing the sequence element (e.g., the WPRE element) and the copy number of the DNA molecule (e.g., , the total copy number with the copy number of a DNA molecule (e.g., a DNA plasmid) - sequence element (e.g., WPRE element) can be calculated using the copy number of a DNA molecule (e.g., a DNA plasmid) containing . While the total copy number is obtained using RT-PCR, the copy number of the DNA molecule is obtained using PCR.
[0026] The symbol "-" refers to subtraction to obtain a difference.
[0027] In one embodiment, "based on the RNA copy number of the RNA viral vector" in step (c) performs the calculation using formula Q1 to obtain the titer of an RNA viral vector (e.g., a lentiviral vector).
[0028] Q1 = (copy number of viral vector RNA in the sample * titer of positive control) / copy number of viral vector RNA in the positive control The positive control refers to an RNA viral vector (e.g., a lentiviral vector) having a known titer (e.g., infectious titer or physical titer). The method for assaying the titer and RNA copy number of the positive control may be the same as that for assaying those of the sample being tested.
[0029] The RNA copy number of the RNA viral vector (e.g., a lentiviral vector) in the sample being tested is the following formula: the total copy number of an RNA viral vector (e.g., a lentiviral vector) containing a sequence element (e.g., WPRE element) and the copy number of a DNA molecule (e.g., a DNA plasmid) containing a sequence element (e.g., W PRE element) - the copy number of a DNA molecule (e.g., a DNA plasmid) containing a sequence element (e.g., WPRE element) The copy number can be obtained using. While the total copy number is obtained by RT-PCR In contrast, the copy number of DNA molecules is obtained by PCR.
[0030] In one embodiment, the titer is an infectious titer or a functional titer. In another embodiment, the titer is a physical titer.
[0031] In certain embodiments, the sample being tested is an RNA viral vector (e.g., a lentiviral vector) packaging supernatant, a purified intermediate product, or the final product in the research and development and manufacturing processes of an RNA viral vector ( e.g., a lentiviral vector), or is derived therefrom. of those or derived therefrom.
[0032] In one embodiment, the PCR includes real-time PCR, quantitative PCR, quantitative real-time PC R or qPCR. Quantitative PCR uses, for example, SYBR Green dye (Thermo F isher Scientific). qPCR can be real-time PCR using a double-stranded DNA-binding dye as a reporter (non-specific detection). In one embodiment PCR is quantitative PCR using SYBR Green dye. qPCR can be real-time PCR using the fluorescence reporter probe method (specific detection). In one embodiment PCR is TaqMan real-time PCR.
[0033] In certain embodiments, RT-PCR can be similar to the RT-qPCR described herein. the same.
[0034] In one embodiment, in the RT-PCR reaction, a primer pair (e.g., an upstream primer and downstream primers) to specifically amplify sequence elements (e.g., WP RE elements) on RNA viral vectors (e.g., lentiviral vectors) and DNA molecules (e.g., DNA plasmids), thereby obtaining cycle threshold (Ct) values for specifically amplifying sequence elements (e.g., WPRE elements) on RNA viral vectors (e.g., lentiviral vectors) and DNA molecules (e.g., DNA plasmids).
[0035] In one embodiment, the upstream primer and the downstream primer are used to amplify a sequence element (e.g., WPRE element) in PCR or RT-P CR.
[0036] In certain embodiments, the upstream primer and the downstream primer are as follows.
[0037] Primer pair 1: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO: 1); Downstream primer: acaacaccacggaattgtca (SEQ ID NO: 2).
[0038] Primer pair 2: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO: 3); Downstream primer: gatgatttccccgacaacac (SEQ ID NO: 4).
[0039] Primer pair 3: Upstream primer: gtgttgtcggggaaatcatc (SEQ ID NO: 5); Downstream primer: gagatccgactcgtctgagg (SEQ ID NO: 6).
[0040] In one embodiment, in the PCR reaction, a primer pair (e.g., the upstream primer and Using a downstream primer), a sequence element (e.g., a WPRE element) on a DNA molecule (e.g., plasmid DNA) is specifically amplified, thereby obtaining a Ct value for specifically amplifying a sequence element (e.g., a WPRE element) on a DNA molecule (e.g., plasmid DNA). For example, a WPRE element) is specifically amplified, thereby obtaining a Ct value for specifically amplifying a sequence element (e.g., a WPRE element) on a DNA molecule (e.g., plasmid DNA). For example, a WPRE element) is specifically amplified, thereby obtaining a Ct value for specifically amplifying a sequence element (e.g., a WPRE element) on a DNA molecule (e.g., plasmid DNA). is obtained.
[0041] In certain embodiments, the upstream primer and the downstream primer are as follows. is as follows.
[0042] Primer pair 1: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO: 1); Downstream primer: acaacaccacggaattgtca (SEQ ID NO: 2).
[0043] Primer pair 2: Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO: 3); Downstream primer: gatgatttccccgacaacac (SEQ ID NO: 4).
[0044] Primer pair 3: Upstream primer: gtgttgtcggggaaatcatc (SEQ ID NO: 5); Downstream primer: gagatccgactcgtctgagg (SEQ ID NO: 6).
[0045] In one embodiment, based on the Ct value of specific amplification of a sequence element (e.g., a WPRE element) of a DNA molecule (e.g., plasmid DNA), the copy number of the DNA molecule (e.g., plasmid DNA) is obtained. Based on the Ct value of specific amplification of a sequence element (e.g., a WPRE element) of a DNA molecule (e.g., plasmid DNA), the copy number of the DNA molecule (e.g., plasmid DNA) is obtained. is obtained.
[0046] In certain embodiments, the copy number of the sequence element (e.g., a WPRE element) obtained after PCR is the same (or substantially the same) as the copy number of the DNA molecule (e.g., plasmid DNA). is.
[0047] In certain embodiments, the copy number of a sequence element (e.g., WPRE element) obtained after RT-PCR is identical (or substantially identical) to the sum of the RNA copy number of an RNA viral vector (e.g., a lentiviral vector) and the copy number of a DNA molecule (e.g., plasmid DNA).
[0048] In one embodiment, the total copy number of an RNA viral vector (e.g., a lentiviral vector) and a DNA molecule (e.g., plasmid DNA) is calculated using Equation Q2 using the Ct values of the specific amplification of a sequence element (e.g., WPRE element) on the RNA viral vector (e.g., a lentiviral vector) and the DNA molecule (e.g., plasmid DNA). Q2 = copy number of RNA and / or DNA = (copy number of nucleic acid of sample in each reaction well × 1000 × dilution factor) / amount of sample added to each reaction well.
[0049]
[0050] Copy number of nucleic acid of sample in each reaction well = 10^ (aX+b) , where X is the average Ct value of the sample, a is the coefficient obtained by standard curve fitting, and b is the intercept obtained by standard curve fitting.
[0051] In one embodiment, based on (i) the total copy number of an RNA viral vector (e.g., a lentiviral vector) RNA and a DNA molecule (e.g., plasmid DNA), and (ii ) the copy number of the DNA molecule (e.g., plasmid DNA), Equation Q3 is used to determine the RNA of the RNA viral vector (e.g., a lentiviral vector) in the sample being tested. Calculate the copy number.
[0052] Q3 = Total copy number of RNA virus vector (e.g., lentiviral vector) RNA and DNA A molecule (e.g., plasmid DNA) - Copy number of DNA molecule (e.g., plasmid DNA).
[0053] In one embodiment, the upstream and downstream primers used to specifically amplify sequence elements (e.g., WPRE element) are from the detection kit of Lenti-X (trademark) qRT-PCR Tit ration Kit (Takara). In one embodiment, the DNA plasmid is a packaging plasmid or is derived therefrom. In one embodiment, the DNA plasmid is an envelope plasmid or is derived therefrom. In one embodiment, the DNA plasmid is a transfer plasmid or is derived therefrom.
[0054] In one embodiment, the DNA plasmid is a packaging plasmid or is derived therefrom. In one embodiment, the DNA plasmid is an envelope plasmid or is derived therefrom. In one embodiment, the DNA plasmid is a transfer plasmid or is derived therefrom. In one embodiment, the DNA plasmid is a packaging plasmid or is derived therefrom. In one embodiment, the DNA plasmid is an envelope plasmid or is derived therefrom. In one embodiment, the DNA plasmid is a transfer plasmid or is derived therefrom. In one embodiment, the DNA plasmid is a packaging plasmid or is derived therefrom. In one embodiment, the DNA plasmid is an envelope plasmid or is derived therefrom. In one embodiment, the DNA plasmid is a transfer plasmid or is derived therefrom. mid or is derived therefrom.
[0055] In one embodiment, the method also uses a positive control.
[0056] In one embodiment, the method is a non-diagnostic and non-therapeutic method.
[0057] In one embodiment, the method is an in vitro method.
[0058] In one embodiment, the concentration of the RNA virus vector (e.g., lentiviral vector) in the sample to be tested is 5×10 ~5×10 5 ~5×10 9 Transducing units / ml (TU / ml), 1 ×10 6 ~8×10 8 TU / ml, or 5×10 6 ~5×108 It is TU / ml.
[0059] Within the scope of the present disclosure, the above technical features and the technical features specifically described below (such as embodiments) can be combined with each other to form new or preferable technical solutions. It should be understood that it is possible. to form new or preferable technical solutions.
Brief Description of the Drawings
[0060]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
DETAILED DESCRIPTION OF THE INVENTION
[0061] The present disclosure provides a method for determining the titer of an RNA viral vector in a sample. The method , (a) providing a sample containing an RNA viral vector and a DNA molecule, or adding a DNA molecule to a sample containing an RNA viral vector, wherein both the RNA viral vector and the DNA molecule contain a sequence element; (b) obtaining a first portion and a second portion from the sample; and (c) performing a polymerase chain reaction (PCR) on the first portion to determine the copy number (n1) of the sequence element in the first portion, and performing reverse transcription PCR (RT-PCR) on the second portion to determine the copy number (n of the sequence element in the second portion 2) determining, wherein the RNA copy number of the RNA virus vector in the sample is n including a step determined by the difference between n1 and n2, i.e., n2 - n1.
[0062] The method may further include step (d) of determining the infectivity titer of the RNA virus vector based on the RNA copy number of the RNA virus vector in the sample.
[0063] The method may further include step (d) of determining the titer of the RNA virus vector based on the RNA copy number in the sample.
[0064] The RNA virus vector can be a retroviral vector such as a lentiviral vector. It can be.
[0065] The sequence element can be a regulatory element, for example, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
[0066] The sequence element can be a long terminal repeat (LTR) or a promoter.
[0067] PCR can amplify the region of the sequence element using a primer pair. RT-PCR can amplify the region of the sequence element using a primer pair.
[0068] PCR and RT-PCR can each amplify the region of the sequence element using a primer pair. It can be amplified.
[0069] The primer pair can include two primers containing the nucleotide sequences shown in (i) SEQ ID NO: 1 and SEQ ID NO: 2, respectively; (ii) SEQ ID NO: 3 and SEQ ID NO: 4, respectively; or (iii) SEQ ID NO: 5 and SEQ ID NO: 6, respectively.
[0070] PCR can be quantitative PCR (qPCR). RT-PCR can be RT-qPCR.
[0071] The DNA molecule can be a DNA plasmid. In one embodiment, the DNA plasmid is a packaging plasmid, an envelope plasmid, and / or a transfer plasmid.
[0072] In certain embodiments, the infectivity titer of an RNA viral vector is determined by ((RNA copy number of the RNA viral vector × infectivity titer of the positive control) / RNA copy number of the positive control), where the positive control is an RNA viral vector having a known infectivity titer.
[0073] The titer of the RNA viral vector can be determined within 2 hours.
[0074] The titer can be a physical titer or an infectivity titer.
[0075] The physical titer measures the amount of virus particles in a sample and can be based on the presence of viral nucleic acid or viral proteins, such as p24. The functional titer or infectivity titer measures how many of the produced virus particles can actually infect cells. Assays for infectivity titer can include infecting target cell lines with the virus and assaying for gene expression, or quantifying the number of virus copies integrated into the genome of the target cells.
[0076] In certain embodiments, the physical titer can be evaluated based on the viral RNA copy number. In one embodiment, the physical titer is the number of viral RNA copies per 1 ml or 1 μl. - It is a single number. The physical titer can be determined by quantitative PCR, for example, using SYBR green dye, or by TaqMan PCR. The viral genome copy number in 1 ml of sample can be calculated from a standard curve generated from serial dilutions of a standard nucleic acid with a known copy number (e.g., an RNA standard, an RNA virus standard such as a lentivirus standard). For example, the infectivity titer can be determined based on the infection units determined by a proviral integration titer assay. For example, the infectivity titer can be determined through transduction of cells using serial dilutions of an RNA virus vector and calculation by quantitative PCR (e.g., TaqMan PCR) of the copy of the integrated vector per cell.
[0077] In certain embodiments, for biosafety reasons, the RNA virus genome (e.g., the lentivirus genome) is modified and the cis - and trans - acting viral sequences are separated over 3 - 4 different plasmids. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. The production of lentiviral vectors uses transient transfection of cells, such as human embryonic kidney (293T) cells, with high concentrations of various plasmids.
[0078] In certain embodiments, for biosafety reasons, the RNA virus genome (e.g., the lentivirus genome) is modified and the cis - and trans - acting viral sequences are separated over 3 - 4 different plasmids. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. For example, the structural and functional proteins of the virus can be provided in trans and encoded by one or two packaging plasmids, while the envelope plasmid encodes the glycoprotein of vesicular stomatitis virus envelope (VSV - G), and the transfer plasmid encodes the target transgene flanked by all the cis - acting viral sequences necessary for packaging the RNA genome. The production of lentiviral vectors uses transient transfection of cells, such as human embryonic kidney (293T) cells, with high concentrations of various plasmids. Can be achieved by Yon, which means that even after concentration, residual plasmid DN exists in the vector preparation. A means there is.
[0079] In certain embodiments, an RNA virus vector (e.g., a lentiviral vector) sample may also contain a DNA molecule (e.g., plasmid DNA). In certain embodiments an RNA virus vector (e.g., a lentiviral vector) sample does not contain a DNA molecule (e.g., plasmid DNA).
[0080] In certain embodiments, the method may include adding a DNA molecule to a sample containing an RNA virus vector. When added to the sample, the DNA molecule is about 10 2 copies / μl to about 10 8 copies / μl, about 10 3 copies / μl to about 10 8 copies / μl, about 10 4 copies / μl to about 10 8 copies / μl, about 10 5 copies / μl to about 10 8 copies / μl, about 10 6 copies / μl to about 10 8 copies / μl, about 10 3 copies / μl to about 10 7 copies / μl, about 10 4 copies / μl to about 10 7 copies / μl, about 10 5 copies / μl to about 10 7 copies / μl, about 10 6 copies / μl to about 10 7 copies / μl, about 10 3 copies / μl to about 10 6 copies / μl, about 10 4 copies / μl to about 10 6 copies / μl, about 105 copies / μl ~about 10 6 copies / μl, about 10 2 copies / μl ~ about 10 3 copies / μl, about 10 2 copy - / μl ~ about 10 4 copies / μl, about 10 2 copies / μl ~ about 10 5 copies / μl, about 1 0 2 copies / μl ~ about 10 6 copies / μl, about 10 3 copies / μl ~ about 10 4 copies / μ l, about 10 3 copies / μl ~ about 10 5 copies / μl, about 10 3 copies / μl ~ about 10 6 co pies / μl, about 10 4 copies / μl ~ about 10 7 copies / μl, about 10 4 copies / μl ~ about 10 6 copies / μl, about 10 4 copies / μl ~ about 10 5 having a concentration in the range of copies / μl obtained.
[0081] In certain embodiments, the titer (infectious titer or physical titer) of the RNA virus vector is , equal to (number of RNA copies in the sample * titer of the positive control) / number of RNA copies of the positive control, wherein the positive control is an RNA virus vector having a known titer (infectious titer or physical titer). The symbol "*" refers to multiplication. The symbol " / " refers to division.
[0082] The present disclosure provides a method for determining the titer of an RNA virus vector (e.g., a lentiviral vector) in a sample. This method comprises (a) an RNA virus vector (e.g., a lenti Providing a sample containing a lentiviral vector and free plasmid DNA; (b) Performing RT-PCR and PCR reactions on the sample respectively to obtain the copy number of the lentiviral vector RNA containing the WPRE element and the copy number of the free plasmid DNA containing the WPRE element in the sample; and (c) Determining the titer of the lentiviral vector based on the copy number of the lentiviral vector RNA may be included. This method provides several advantages. This method can rapidly determine the titer of an RNA virus vector (for example, a lentiviral vector) within, for example, 2 hours. It can be used to rapidly and quantitatively evaluate the titer of intermediate products in the production process of an RNA virus vector (for example, a lentiviral vector), and can help control the amount of the final product of the virus vector. Sequence elements (for example, WPRE elements) can be amplified by a quantitative method, such as RT-PCR. The copy number of DNA molecules (for example, plasmid DNA) and the copy number of RNA virus vectors (for example, lentiviral vectors) in the sample can be determined. By subtracting the copy number of DNA molecules (for example, plasmid DNA) from the total copy number of DNA molecules (for example, plasmid DNA) and RNA virus vectors (for example, lentiviral vectors) RNA, the titer of the RNA virus vector (for example, the lentiviral vector) can be rapidly and specifically determined. In addition, the experimental design and operation of this method are simple.
[0083]
[0084] Thus, the assay of the titer of an RNA virus vector (e.g., a lentiviral vector) can be carried out quickly, efficiently and specifically within 2 hours. This method can calculate the titer of a sample using the titer of a positive control, which helps to quickly adjust the amount of the viral vector. This method provides a simple operation process, a short detection time, a fast feedback of the detection result, and reliable results. It is very suitable for determining the titer of an RNA virus vector (e.g., a lentiviral vector) at various stages of the development or production process of the RNA virus vector (e.g., a lentiviral vector). In certain embodiments, RT-PCR and PCR are each performed on a sample containing an RNA virus vector. RT-PCR amplifies both vector RNA and DNA, while PCR (without reverse transcriptase) amplifies only DNA. The copy number of the viral vector (RNA) can be calculated by the difference between (i) the total copy number of the viral vector (RNA) and DNA (e.g., plasmid DNA) containing a sequence element (e.g., WPRE element) obtained by RT-PCR, and (ii) the copy number of DNA (e.g., plasmid DNA) containing a sequence element (e.g., WPRE element) obtained by PCR. Based on the RNA copy number of the RNA virus vector (e.g., a lentiviral vector) in the sample, the titer (e.g., the infectious titer) of the RNA virus vector (e.g., a lentiviral vector) can be determined.
[0085]
[0086]
[0087] Furthermore, the method substantially reduces non-specific interference from plasmids or other nucleic acids and can achieve rapid quantification. Furthermore, the method can provide specific quantitative results within 2 hours, and these can be used to rapidly and quantitatively evaluate the titer of intermediate products in the lentiviral vector production process . Furthermore, in practice, the physical or functional titer of the final product can be controlled
[0088] The term "vector" is used herein to refer to a nucleic acid molecule capable of transferring or transporting another nucleic acid molecule . The transferred nucleic acid is generally ligated to, for example inserted into, the vector nucleic acid molecule . The vector may contain sequences that direct autonomous replication within the cell or may contain sequences sufficient to enable integration into the host cell DNA. Useful vectors include, for example, plasmids (e.g., DNA plasmids or RNA plasmids ), transposons, cosmids, bacterial artificial chromosomes, and viral vectors . Useful viral vectors include, for example, retroviruses and lentiviruses
[0089] The term "viral vector" typically refers to a nucleic acid molecule (e.g., a transfer plasmid) containing viral-derived nucleic acid elements that facilitate the transfer of nucleic acid molecules or integration into the genome of the cell , or to either a viral particle that mediates nucleic acid transfer. The viral particle may contain, in addition to the nucleic acid, various viral components and sometimes host cell components. The term "viral vector" can refer to either a virus or viral particle capable of transferring nucleic acid into a cell, or to the transferred nucleic acid itself . The viral particle may contain, in addition to the nucleic acid, various viral components and sometimes host cell components. The term "viral vector" can refer to either a virus or viral particle capable of transferring nucleic acid into a cell, or to the transferred nucleic acid itself. The v Viral vectors and transfer plasmids contain structural and / or functional genetic elements mainly derived from viruses.
[0090] The cycle threshold (Ct) can refer to the cycle number at which a significant increase in fluorescence above the baseline signal is detected.
[0091] The term "about" with respect to a numerical value refers to ±10% of the recited numerical value. In other words, the value can be within the range of 90% to 110% of the recited value.
[0092] RNA Viruses and Retroviruses RNA viruses are viruses that have RNA (ribonucleic acid) as their genetic material.
[0093] This nucleic acid can be single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA).
[0094] RNA viruses include, but are not limited to, the families Astroviridae, Caliciviridae, Picornaviridae, Coronaviridae, Retroviridae, Togaviridae, Alphatetraviridae, Birnaviridae, Cystoviridae, Nodaviridae, and Permutotetraviridae and Flaviviridae. By way of example, the family Astroviridae includes human astroviruses, the family Caliciviridae includes Norwalk viruses, the family Picornaviridae includes Coxsackieviruses, hepatitis A virus, polioviruses, rhinoviruses, bimo viruses, como viruses, nepoviruses, nodaviruses, picornaviruses, potyviruses, sobemo viruses, and luteoviruses subsets It includes viruses such as coronavirus and SARS virus, and the Retroviridae family includes alpharetrovirus, betaretrovirus, deltaretrovirus, lentivirus and spumavirus, the Togaviridae family includes rubella virus and alpha virus, the Flaviviridae family includes hepatitis C virus, flavivirus, calmo virus, dianthoviruses, pestivirus genus, statoviruses, tombusvirus genus, single-stranded RN A bacteriophage, and a subset of the luteovirus genus (barley yellow dwarf virus s).
[0095] In certain embodiments, the RNA virus can be a coronavirus family virus, a pneumovirus family virus, a paramyxovirus family virus, a picornavirus family virus, or an orthomyxo virus family virus. In certain embodiments, the coronavirus family virus is coronavirus or SARS, the pneumovirus family virus is human respiratory syncytial virus (HRSV), the paramyxovirus family virus is human parainfluenza virus, measles virus or mumps virus, the picornavirus family virus is rhinovirus, and the orthomyxovirus family virus is influenza virus. In certain embodiments, the RNA virus is a pneumovirus family virus . In one embodiment, the RNA virus is HRSV.
[0096] Non-limiting examples of RNA viruses include human respiratory syncytial virus, Ebola virus, co Rhinovirus, rhinovirus, parainfluenza virus, human immunodeficiency virus, Rotavirus, picornavirus, bluetongue virus, alphavirus, cala Virus, flow virus, holdei virus, potex virus, rubivirus, tobura Virus, tricornavirus, thymovirus, apple chlorotic leaf spot virus (apple chlorotic leaf spot virus), beet Yellowing virus, hepatitis E virus, cereal virus, delta virus, emaravirus, hi Grevirus, idaeovirus, ulmia virus, polemovirus, sobemovirus, Tenuivirus, ambravirus, varicosavirus, etc. are also included. RNA virus can be derived from virus classification orders such as Mononegavirales, Nidovirales, Picornavirales and Tymovirales and so on.
[0097] Retrovirus Retroviruses are RNA viruses that reverse-transcribe their genomic RNA into a DNA copy and then integrate that DNA into the host genome. Once the virus is integrated into the host genome, it is called a provirus. The provirus functions as a template for RNA polymerase and directs the expression of the RNA molecule encoding the structural proteins and enzymes necessary to produce new virus particles.
[0098] The Retroviridae family can be divided into two subfamilies: Orthoretrovirinae and Spumaretrovirinae The Orthoretrovirinae subfamily includes the following genera: Alpha retrovirus (such as avian leukosis virus and Rous sarcoma virus); beta retrovirus Viruses (such as mouse mammary tumor virus); gammaretroviruses (such as mouse leukemia virus and feline leukemia virus); deltaretroviruses (such as bovine leukemia virus and the human T-lymphotropic virus that causes cancer); epsilonretroviruses; and lentiviruses (such as human immunodeficiency virus type 1 and simian and feline immunodeficiency viruses ) are included. The Spumaretrovirinae subfamily includes the following genera: Bovispumavirus (Bovispumavirus); Equispumavirus (Equispumavirus); Felispumavirus (Felispumavirus); Prosimiispumavirus (Prosimiispumavirus); and Simiispumavirus (Simiispumavirus).
[0099] Non-limiting examples of retroviruses include Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, mouse stem cell virus (MSCV) and Rous sarcoma virus (RSV) and lentivirus.
[0100] The term "retroviral vector" refers to a viral vector or plasmid mainly derived from a retrovirus, including structural and functional genetic elements or parts thereof. The terms "retroviral vector" and "retrovirus" may be used interchangeably.
[0101] As used herein, the terms "retrovirus" or "retroviral vector" are meant to include "lentivirus" and "lentiviral vector".
[0102] Lentivirus Examples of lentiviruses include, but are not limited to, HIV (human immunodeficiency virus; including HIV-1 type and HIV-2 type); Visna maedi virus (VMV); Caprine arthritis encephalitis virus (CAEV); Equine infectious anemia virus (EIAV); Feline immunodeficiency virus (FIV); Bovine immunodeficiency virus (BIV); and Simian immunodeficiency virus (SIV). The term "lentiviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof, mainly derived from lentivirus, including long terminal repeats (LTRs). In certain embodiments, the term "lentiviral vector" may be used to refer to a lentiviral transfer plasmid and / or infectious lentiviral particles.
[0103] The terms "lentiviral vector" and "lentivirus" may be used interchangeably.
[0104] Sequence element In PCR or RT-PCR, primers targeting the sequence element may be used to amplify the sequence element. Sequence elements include specific viral components, cloning sites, promoters, motors, control elements, regulatory elements, heterologous nucleic acids (e.g., the transgene itself), and the like.
[0105] Non-limiting examples of sequence elements include LTR, WPRE, promoter, etc. The vectors include CMV promoter, U6 promoter, PGK promoter, etc. and so on.
[0106] When referring to array elements in this specification, the arrays of these elements exist in RNA form in an RNA viral vector or an RNA virus (e.g., a lentiviral vector or a lentivirus), and exist in DNA form in a DNA molecule (e.g., a plasmid). It should be understood.
[0107] "Control element" or "regulatory element" can be in the untranslated region of the vector, such as the origin of replication, selection cassette, promoter, enhancer, translation start signal (e.g., Shine-Dalgarno sequence, Kozak sequence), intron, polyadenylation sequence, 5' and 3' untranslated regions, and these interact with host cell proteins to carry out transcription and / or translation.
[0108] In certain embodiments, the array element can be a regulatory element, such as a post-transcriptional regulatory element, polyadenylation site, transcription termination signal, etc. In certain embodiments, the array element can be the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In certain embodiments, the array element can be the post-transcriptional regulatory element present in hepatitis B virus (HPRE). In certain embodiments, the expression of a heterologous sequence in a viral vector is increased by incorporating a post-transcriptional regulatory element, an efficient polyadenylation site, and optionally a transcription termination signal into the vector. Various post-transcriptional regulatory elements, such as the woodchuck hepatitis virus post-transcriptional regulatory element ( WPRE; Zufferey et al., 1999, J. Virol., 73:28 WPRE; Zufferey et al., 1999, J. Virol., 73:28 86); Post-transcriptional regulatory elements present in hepatitis B virus (HPRE) (Huang et al., Mol. Cell. Biol., 5:3864); and others (Liu et al., 1995, Genes Dev., 9:1766) can increase the expression of different nucleic acids in proteins. In certain embodiments, the vectors of the present invention include post-transcriptional regulatory elements such as WPRE or HPRE.
[0109] For example, WPRE can refer to a region similar to the hepatitis B virus post-transcriptional regulatory element (HBV PRE) present in the genomic sequence of the woodchuck hepatitis virus (GenBank accession section number J04514), and the 592 nucleotides from positions 1093 to 1684 of this genomic sequence correspond to the post-transcriptional regulatory region (Journal of Vir ology, Vol. 72, p. 5085-5092, 1998). Analysis using retroviral vectors has revealed that WPRE inserted into the 3' untranslated region of the gene of interest increases the amount of protein produced. It has also been reported that the introduction of WPRE suppresses mRNA degradation (Journal of Vi rology, Vol. 73, p. 2886-2892, 1999).
[0110] In certain embodiments, the sequence elements can be regulatory elements, such as introns, enhancer elements, etc. Regulatory sequences useful herein can also include introns, such as those located between the promoter / enhancer sequence and the coding sequence. One exemplary intron sequence is derived from SV40 and is called the SV40 intron.
[0111] Other enhancer elements that can be used in the vector include, for example, ubiquitin enhancers and CMB enhancers. Further regulatory elements that can be used include, for example, aptazymes, miRNAs, and miRNA binding elements. In certain embodiments, the sequence element can be an LTR. Each end of the provirus is a structure called a "long terminal repeat" or "LTR". The term "long terminal repeat (LTR)" refers to a domain of base pairs located at the ends of retroviral DNA that are direct repeats in the context of their native sequences and include the U3, R, and U5 regions. LTRs generally provide essential functions for the expression of retroviral genes (e.g., promotion, initiation, and polyadenylation of gene transcripts) and viral replication. LTRs contain a number of regulatory signals, including transcriptional control elements, polyadenylation signals, as well as sequences necessary for replication and integration of the viral genome. Viral LTRs are divided into three regions called U3, R, and U5. The U3 region contains enhancer and promoter elements. The U5 region is the sequence between the primer binding site and the R region and contains a polyadenylation sequence. The R (repeat) region is adjacent to the U3 and U5 regions. LTRs are composed of the U3, R, and U5 regions and appear at both the 5' and 3' ends of the viral genome. Adjacent to the 5' LTR are the sequences necessary for reverse transcription of the genome (tRNA primer binding site) and the sequences necessary for efficient packaging of viral RNA into particles (Psi site).
[0112]
[0113] This is the case. In various embodiments, the vector includes a modified 5' LTR and / or 3' LTR . Either or both of the LTRs may include one or more modifications including, but not limited to, one or more deletions, insertions or substitutions. Modifications of the 3' LTR are often made to improve the safety of lentiviral or retroviral systems by conferring replication deficiency on the virus . A "self-inactivating" (SIN) vector refers to a replication-deficient vector, e.g., a retroviral or lentiviral vector, in which the right (3') LTR enhancer promoter region known as the U3 region is modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication . This is because the right (3') LTR U3 region is used as a template for the left (5') LTR U3 region during viral replication, and thus viral transcripts cannot be produced without the U3 enhancer promoter . In a further embodiment, the 3' LTR is modified such that the U5 region is replaced, for example, with an ideal poly(A) sequence. It should be noted that modifications to the LTR, e.g., to the 3' LTR, 5' LTR, or both the 3' and 5' LTRs, are also included in the present disclosure . Safety is further enhanced by replacing the U3 region of the 5' LTR with a heterologous promoter to drive transcription of the viral genome during production of viral particles . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus . This is because the right (3') LTR U3 region is used as a template for the left (5') LTR U3 region during viral replication, and thus viral transcripts cannot be produced without the U3 enhancer promoter . This is because the right (3') LTR U3 region is used as a template for the left (5') LTR U3 region during viral replication, and thus viral transcripts cannot be produced without the U3 enhancer promoter . In a further embodiment, the 3' LTR is modified such that the U5 region is replaced, for example, with an ideal poly(A) sequence. It should be noted that modifications to the LTR, e.g., to the 3' LTR, 5' LTR, or both the 3' and 5' LTRs, are also included in the present disclosure . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus . It should be noted that modifications to the LTR, e.g., to the 3' LTR, 5' LTR, or both the 3' and 5' LTRs, are also included in the present disclosure . Safety is further enhanced by replacing the U3 region of the 5' LTR with a heterologous promoter to drive transcription of the viral genome during production of viral particles
[0114] . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus . Examples of heterologous promoters that can be used include, for example, viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (e.g., immediate early), Moloney - murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus Examples include the Rous (HSV) (thymidine kinase) promoter. A typical promoter can drive high-level transcription in a Tat-independent manner. Since the viral production sys tem lacks a complete U3 sequence, this substitution reduces the possibility of recombination to generate replication-competent viruses.
[0115] In certain embodiments, the sequence element can be a packaging sequence. As used herein, the terms "packaging signal" or "packaging sequence" refer to a sequence located within the retroviral genome that is necessary for inserting viral RNA into the viral capsid or particle. See, for example, Clever et al., 1995. J. of Virology, Vol. 69, No. 4; pp. 2101-2109. Some retroviral vectors use the minimal packaging signal (also called the psi [Ψ] sequence) necessary for capsid formation of the viral genome. Thus, as used herein, the terms "packaging sequence," "packaging signal," "psi," and the symbol "Ψ" are used with respect to the non-coding sequences necessary for capsid formation of the retroviral RNA strand during viral particle formation.
[0116] In certain embodiments, the sequence element can be a TAR element. In certain embodiments, the viral vector includes a TAR element, which can be a sequence element. The term "TAR" refers to the "trans-activation response" gene element located in the R region of the lentiviral (e.g., HIV) LTR. This element interacts with the lentiviral trans-activation factor (tat) gene element to enhance viral replication.
[0117] In certain embodiments, the array element can be an R region. The "R region" begins at the start of the cap group (i.e., the start of transcription) and ends just prior to the start of the polyA tract, referring to the region within the retroviral LTR. The R region is also defined as adjacent to the U3 and U5 regions as well. The R region plays a role in moving the nascent DNA from one end of the genome to the other during reverse transcription.
[0118] In certain embodiments, the array element can be a FLAP element. As used herein, the term "FLAP element" refers to a nucleic acid, the sequence of which includes the central polypurine tract and the central termination sequence (cPPT and CTS) of a retrovirus, such as HIV-1 or HIV-2. Suitable FLAP elements are described in U.S. Patent No. 6,682,90 7, and Zennou, et al., 2000, Cell, 101:173. During reverse transcription of HIV-1, central initiation at the central polypurine tract (cPPT) and central termination at the central termination sequence (CTS) result in the formation of a triple-stranded DNA structure: the HIV-1 central DNA flap. In certain embodiments, a retroviral or lentiviral vector backbone includes one or more FLAP elements upstream or downstream of the heterologous gene of interest in the vector. For example, in certain embodiments, the transfer plasmid includes a FLAP element. In one embodiment, the vectors of the present disclosure include a FLAP element isolated from HIV-1.
[0119] In certain embodiments, the array element can be an export element. In one embodiment, In contrast, retroviral or lentiviral transfer vectors contain one or more exons. The term "export element" refers to the process by which RNA is transported from the nucleus to the cytoplasm of a cell. Refers to a cis-acting post-transcriptional regulatory element that regulates the transport of transcripts. Examples of RNA export elements Examples include, but are not limited to, the human immunodeficiency virus (HIV) rev response element ( RRE) (e.g. Cullen et al., 1991. J. Virol. 65:1 053; and Cullen et al., 1991. Cell 58:423. and the Hepatitis B virus post-transcriptional regulatory element (HPRE). The RNA export element is located within the 3'UTR of a gene and contains one or more copies. It can be inserted as a
[0120] In certain embodiments, the sequence element is a transcription termination signal or a polyadenylation sequence. Elements that direct efficient termination and polyadenylation of the heterologous nucleic acid transcript may be used in the preparation of a heterologous nucleic acid. Increases gene expression. Transcription termination signals are generally located downstream of polyadenylation signals. In certain embodiments, the vector encodes the polypeptide to be expressed. As used herein, a "poly A site" includes a polyadenylation sequence 3' of a polynucleotide. The term "polyA sequence" refers to a sequence that is generated by RNA polymerase II and terminates the polyA sequence. A polyadenylation sequence refers to a DNA sequence that directs both the cleavage and polyadenylation of a first RNA transcript. The sequence promotes mRNA stability by adding a polyA tail to the 3' end of the coding sequence. The polyA signal can promote transcription and thus contribute to improving translation efficiency. Ideal polyA sequence (e.g., AATAAA, ATTAAA, AGTAAA), bovine Growth hormone poly A sequence (BGHpA), rabbit beta globin poly A sequence (rβgpA ), or another suitable heterologous or endogenous poly A sequence known in the art. The po lyadenylation sequence also includes SV40 poly A, bGH poly A, and synthetic poly A tails .
[0121] In certain embodiments, the array element can be an insulator element. In certain embodiments , the retroviral vector or lentiviral vector further includes one or more ins ulator elements. The insulator element is mediated by a cis-acting element present in genomic DNA and can result in deregulation of the expression of the inserted sequence, the integration site effect (i.e., position effect; e.g., Burgess-Beusse et al , 2002, Proc. Natl. Acad. Sci., USA, 99:16433 ; and Zhan et al., 2001, Hum. Genet., 109:471 are referenced), and can contribute to protecting the lentiviral expression sequence, e.g., a therapeutic polypeptide . In some embodiments, the transfer vector includes one or more ins ulator elements of the 3' LTR, and when the provirus is integrated into the host genome, the provirus replicates the 3' LTR, resulting in the provirus containing one or more ins ulators in both the 5' LTR and the 3' LTR. Insulators suitable for use in the present invention include, but are not limited to, the chicken beta globin insulator (Chung et al., 1993. Cell 74:505, incorporated herein by reference; Chu ng et al., 1997. PNAS 94:575; and Bell et al ). , 1999. See Cell 98:387). Examples of insulator elements include, but are not limited to, insulators from the beta-globin locus such as the chicken HS4 .
[0122] In certain embodiments, the array element can be a heterologous nucleic acid such as an antibiotic resistance gene, GFP (green fluorescent protein ), a transgene, and the like.
[0123] A variety of sources of retroviral and / or lentiviral sequences can be used, or combined, without impairing the ability of the transfer vector described herein to perform its function, and many substitutions and changes in certain lentiviral sequences can be tolerated . Further, a variety of lentiviral vectors are known in the art, and many of them can be adapted to generate the viral vectors or transfer plasmids of the present disclosure. See Naldini et al., (1996a, 1 996b, and 1998); Zufferey et al., (1997); Dul l et al., 1998, U.S. Patent No. 6,013,516; and 5,994,1 36.
[0124] RT-PCR RT-PCR (reverse transcription-polymerase chain reaction) is a technique that combines reverse transcription (RT) of RNA and polymerase chain amplification (PCR) of cDNA . First, cDNA is synthesized from RNA by reverse transcriptase, and then the cDNA is used as a template to amplify and synthesize the target fragment by DNA polymerase . The RT-PCR technique is highly sensitive and versatile, and is used in cells . can be used to detect gene expression levels in cells and the content of RNA virus in cells or culture supernatants. In certain embodiments, the RT-PCR reaction system comprises primers, reverse transcriptase, PCR enzyme, buffer, dNTP and other components and is obtained.
[0125] In RT-PCR, viral RNA is first converted to cDNA and then quantified using PCR (e.g., , real-time PCR, quantitative PCR or qPCR).
[0126] In the present disclosure, RT-PCR can be used to detect both DNA and RNA in the same sample.
[0127] In one embodiment, reaction tubes and control tubes are provided. The reaction tube contains the sample to be tested and all reaction systems for RT-PCR. The control tube contains the same sample as the reaction tube and a PCR reaction system (e.g., an RT-PCR reaction system excluding reverse transcriptase). In the reaction tube, both RNA and DNA are amplified to obtain the Ct value of specifically amplified sequence elements (e.g., WPRE element). The copy number calculated for the reaction tube is the RNA copy number of the RNA virus vector (e.g., lentiviral vector) + the copy number of the DNA molecule (e.g., plasmid DNA).
[0128] In the control tube, without reverse transcriptase, the RNA of the RNA virus vector (e.g., lentiviral vector) cannot be amplified, and only the DNA molecule (e.g., plasmid DNA) is amplified to obtain the Ct value of a specific amplified sequence element (e.g., WPRE element). Obtained. The copy number obtained therefrom is the DNA copy number of a DNA molecule (e.g., plasmid DNA). Next, the RNA copy number of an RNA virus vector (e.g., a lentiviral vector) can be obtained by subtracting the DNA copy number (n1) in the control tube from the copy numbers of RNA and DNA in the reaction tube (n2), i.e., n2 - n1 = the RNA copy number of the RNA virus vector (e.g., a lentiviral vector) (shown in Figure 6).
[0129] Positive control The positive control can be a virus vector having a known titer, infectivity titer, or physical titer (e.g., an RNA virus vector such as a lentiviral vector) (e.g., LV-CAR001 available from Shanghai CBMG Biotechnology Co., Ltd.).
[0130] In certain embodiments, the positive control also contains DNA and RNA, and the calculation methods for the copy number and titer of the positive control are the same as those for the sample being tested.
[0131] The present invention can be better understood by referring to the following non-limiting examples presented to more fully illustrate the preferred embodiments of the present invention. The present disclosure will be further described below in connection with specific, specific embodiments. It is understood that these embodiments are used only to exemplify the present invention and are not used to limit the scope of the present invention. The specific experimental methods that do not specify the specific conditions in the following examples are generally the corresponding conventional conditions, e.g., Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring H arbor Laboratory Press, 1989) or follow the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight.
[0132] Unless otherwise specified, all reagents and materials used in the examples of this disclosure are commercially available .
[0133] [Example 1] Apparatus: Quantstudio (trademark) DX (ABI) 1. Reagent Preparation The experiment was conducted on ice. A sufficient volume of master reaction mixture (MRM) was prepared. [Table 1]
[0134] 2. Sample Dilution The samples to be tested were diluted to an appropriate concentration (10 5 ~10 9 TU / ml) with EASY dilution buffer.
[0135] 3. Sample Lysis 2 μl of diluted virus and 18 μl of virus lysis buffer were added, mixed well, and incubated at room temperature for 1 - 5 minutes.
[0136] 4. Establishment of Standard Curve Using Lenti - X RNA Control Dilution Template Standard dilutions were performed in clean 0.2 ml PCR tubes. Referring to Figure 1, serial dilutions of the RNA standard were made. After each tube was mixed well, the next tube was diluted.
[0137] 5×10 7 Copies / μl was used as the highest point of the standard curve, and EASY dilution buffer was used as the negative control (NTC, 0 copies / μl). It was used as a negative control (NTC, 0 copies / μl).
[0138] A 5.96-well PCR plate was placed on ice. 18.4 μl of MRM (three parallel samples) was pipetted into the appropriate wells. It was pipetted into the appropriate wells.
[0139] 6. Using a pipette, 1.6 μl of the standard dilutions, NTC, and samples (three parallel samples) were transferred to a 96-well PCR plate. They were transferred to a 96-well PCR plate.
[0140] 7. Centrifuge at 2000 rpm for 2 minutes at 4°C to remove air bubbles.
[0141] 8. The PCR program was set according to Figure 2. The 96-well plate was filled and the program was started. It was started.
[0142] 9. Data processing 1) Standard curve: The average Ct value of the Lenti-X RNA control serial dilutions was linearly related to the RNA copy number (log scale). It was linearly related to the RNA copy number (log scale).
[0143] 2) The RNA copy number of the samples in each reaction well was calculated based on the average Ct value of the diluted samples. The average Ct value obtained from the serial dilutions of the lentivirus standard in the kit was used as the X-axis. It was used as the X-axis. The corresponding logarithmic value of the lentivirus standard RNA copy number was used as the Y-axis. It was used as the Y-axis. The standard curve was obtained by fitting to the calculation formula Y = aX + b. .
[0144] Y: Logarithmic value of the RNA copy number of the RNA standard or the lentiviral vector being tested (base 10) X: Average Ct value obtained from the standard or sample a: Coefficient obtained by standard curve fitting b: Intercept obtained by standard curve fitting A (copy number of nucleic acid in each reaction well) = 10^ (aX+b) 3) Copy number of RNA in the original sample (copies / ml) = 5 × 10 7 copies / μl Results: 1. Standard curve A standard curve was created using a standard with a known copy number (e.g., RNA standard), and the copy number of the unknown sample was calculated. The dilution of the Lenti-X RNA standard and the virus sample was performed as shown in Figure 1. The program shown in Figure 2 was used for PCR amplification. The standard curve was plotted based on the Ct value and the corresponding virus copy number (Figure 3). By measuring the standard product, the obtained detection values can be fitted. The fitted data showed a good linear correlation (R ≥ 0.9999), indicating that the detection method has good stability and accuracy. 2
[0145] 2. Dissociation curve The dissociation curve (Figure 4) can verify the specificity of the amplification product and the state of the product by examining the number and position of the peaks. Different peaks represent different products.
[0146] If there are two peaks or even multiple peaks, it indicates that the specificity of the primer is not high, that is, the obtained Ct value is not reliable. Here, the dissociation curve obtained by the real-time quantitative PCR reaction has only one sharp peak, indicating that the primer in this reaction system has high specificity. The product amplified by this method is stable and accurate, and the detection data is reliable.
[0147] 3. Amplification Curve (Figure 5) The amplification curve of real-time quantitative PCR can reflect the amplification efficiency of the reaction. High and consistent amplification efficiency is the key to successful detection. If the amplification efficiency is not consistent, the gradient of the amplification efficiency curve does not have the same gradient, is not parallel, indicating that the primer efficiencies are not the same or that there is contamination inhibiting PCR in individual samples or reaction wells. From Figure 5, it can be seen that the amplification curves obtained using this method are substantially parallel, and the slopes are similar or substantially the same, indicating that the method of the present invention has high amplification efficiency.
[0148] 4. Calculation Results
Table 2
[0149] From the Ct SD values, it can be seen that the samples tested were substantially parallel to each other. The melting temperatures (Tm) of the products after specific amplification were all around 75°C, indicating good primer amplification efficiency and no non-specific amplification. By comparing with a positive control with a known infectious titer, the infectious titer of the sample can also be quickly calculated / estimated. It is very important to obtain the lentivirus titer of the sample in a timely manner. This method shows good applicability for the rapid detection of lentivirus titer.
[0150] The parameters of the qPCR program are shown in Figure 2. The total time from the start to the end of the program is 1 hour and 20 minutes. When the sample preparation time and the data processing time after the qPCR program are combined, the total time can be within 2 hours.
[0151] Conclusion Typically, it may take 3 to 7 days to determine the infectivity titer of a lentiviral vector.
[0152] Lentiviral vectors are fragile and prone to degradation, so there is a need to develop a rapid titering method for in-process monitoring during lentiviral vector production. Using this method, the infectivity titer (or physical titer) of a lentiviral vector can be determined efficiently, rapidly (e.g., within 2 hours), and specifically. Using the method, the titer of intermediate samples in the production process can be rapidly determined, the amount of intermediate products can be determined, and the concentration of the final product can be controlled. The scope of the present disclosure is not limited by what has been specifically shown and described above. Those skilled in the art will recognize that there are suitable alternatives to the illustrated examples of materials, configurations, structures, and dimensions. A number of references, including patents and various publications, are cited and discussed in the description of the present invention. The citation and discussion of such references are provided merely to clarify the description of the present disclosure, and do not admit that any reference is prior art to the invention described herein. All references cited and discussed in this specification are hereby incorporated by reference in their entirety. Variations, modifications, and other implementations of what is described herein will occur to those skilled in the art without departing from the spirit and scope of the present invention. Specific embodiments of the present disclosure have been shown and described, but it will be apparent to those skilled in the art that changes and modifications can be made without departing from the spirit and scope of the present invention.
[0153] The matters described in the foregoing description and the accompanying drawings are provided only by way of example and not as limitations. They are not provided as limitations.
Claims
1. 1. A method for determining the titer of an RNA viral vector in a sample, comprising: (a) providing a sample comprising an RNA viral vector and a DNA molecule, or Adding a DNA molecule to a sample containing a viral vector, said RNA virus both the vector and the DNA molecule contain sequence elements; (b) obtaining a first portion and a second portion from the sample; and (c) performing a polymerase chain reaction (PCR) on the first portion to obtain the first determining the number of copies (n1) of the sequence element in the first portion and inverting the number of copies (n2) of the sequence element in the second portion; A PCR reaction (RT-PCR) is then performed to determine the number of copies of the sequence element in the second portion. (n2) determining the RNA code of the RNA viral vector in the sample; The number of pieces is determined by the difference between n1 and n2, i.e., n2-n1. 。
2. The RNA viral vector is then subjected to a step of:
10. The method of claim 1, further comprising the step (d) of determining the infectious titer of the viral vector. 。
3. 2. The method of claim 1, wherein the RNA viral vector is a retroviral vector. 。
4. 4. The method of claim 3, wherein the retroviral vector is a lentiviral vector. 。
5. The method of claim 1 , wherein the sequence element is a regulatory element.
6. The regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Item 5. The method according to item 5.
7. 2. The method of claim 1, wherein the sequence element is a long terminal repeat (LTR) or a promoter. How to.
8. 2. The method of claim 1, wherein the PCR amplifies the region of the sequence element using a primer pair. Method of posting.
9. The RT-PCR uses a primer pair to amplify the region of the sequence element.
1. The method according to claim 1.
10. The PCR and the RT-PCR each use a primer pair to The method of claim 1, wherein the region of
11. The primer pair comprises: (i) SEQ ID NO:1 and SEQ ID NO:2, respectively; (ii) SEQ ID NO: SEQ ID NO:3 and SEQ ID NO:4, respectively; or (iii) SEQ ID NO:5 and SEQ ID NO:6, Any of claims 8 to 10, comprising two primers each containing the nucleotide sequence shown in The method according to any one of the above.
12. The PCR is quantitative PCR (qPCR), and the RT-PCR is RT-qPCR. The method of claim 1 .
13. The method of claim 1, wherein the titer is a physical titer or an infectious titer.
14. The method of claim 1 , wherein the DNA molecule is a DNA plasmid.
15. 15. The method of claim 14, wherein the DNA plasmid is a packaging plasmid.
16. The infectious titer of the RNA viral vector is The positive control was determined by dividing the positive control by the number of copies of the RNA. and the positive control is an RNA viral vector having a known infectious titer. The method described above.
17. 3. The method of claim 2, wherein the titer of the RNA viral vector is determined within 2 hours. method.