Antisense nucleic acid and use of the same

Abstract

To provide a technique capable of recovering a normal Fukutin protein.SOLUTION: An antisense nucleic acid is a morpholino oligomer in which a range of position 2044 to position 2068 of a base sequence shown by sequence number 1 is used as a target sequence, any consists of one base sequence of the following (a) to (c): (a) a base sequence expressed by sequence number 2 or sequence number 3; (b) a base sequence having 90% or higher identity with the base sequence expressed by sequence number 2 or sequence number 3; and (c) a base sequence in which one or several bases are deleted, substituted or added in the base sequence expressed by sequence number 2 or sequence number 3.SELECTED DRAWING: Figure 14

Description

Technical Field

[0001] The present disclosure relates to antisense nucleic acids.

Background Art

[0002] Fukuyama type congenital muscular dystrophy (hereinafter also abbreviated as "FCMD") is known as an autosomal recessive genetic disease. In FCMD, the O-mannosyl glycan modification of α-dystroglycan, which connects the cell membrane and the basement membrane of skeletal muscle, is deficient due to an abnormality in the fukutin gene, and the binding between the cell membrane and the basement membrane via this glycan breaks down, resulting in the development of severe muscular dystrophy (Non-Patent Document 1). In the majority of FCMD patients, a retrotransposon (SVA: Sine-VNTR-Alu) insertion mutation is observed in the fukutin gene (Non-Patent Document 2). Patients homozygous for this insertion mutation account for about 80% of all FCMD patients, and the remaining 20% are compound heterozygous patients with point mutations or the like in one allele of the fukutin gene. In about 1% of Japanese FCMD patients, point mutations are observed deep within the gene (Non-Patent Document 3). All carriers of this DIV (deep intronic variant) are compound heterozygous patients with SVA insertion (Non-Patent Document 4). Since this DIV generates a splice donor site in the intron, abnormal splicing is caused and a pseudo-exon is generated. As a result, a stop codon is induced by frameshift, causing the mRNA of the fukutin protein to decay (Non-Patent Document 3). Compound heterozygous patients with both DIV and SVA insertion generally exhibit particularly severe clinical characteristics.

Prior Art Documents

Non-Patent Documents

[0003]

Non-Patent Document 1

Non-Patent Document 2

[0004] FCMD is a severe disease that leads to death in the teens, but since no radical treatment method has been established yet, the establishment of its treatment method is strongly desired. For this reason, a technology capable of restoring the production of normal fukutin protein has been demanded. [Means for Solving the Problems]

[0005] The present disclosure can be realized in the following forms.

[0006] (1) According to one embodiment of the present disclosure, an antisense nucleic acid is provided. This antisense nucleic acid has at least a part of the range from position 1998 to position 2094 of the nucleotide sequence shown in SEQ ID NO: 1 as a target sequence, and is a morpholino oligomer consisting of any one of the following nucleotide sequences (a) to (f): (a) the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3; (b) a nucleotide sequence having 80% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3; (c) a nucleotide sequence in which one or several nucleotides are deleted, substituted or added in the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3; (d) the nucleotide sequence represented by any one of SEQ ID NOs: 33 to 35; (e) a nucleotide sequence having 80% or more identity with the nucleotide sequence represented by any one of SEQ ID NOs: 33 to 35; (f) a nucleotide sequence in which one or several nucleotides are deleted, substituted or added in the nucleotide sequence represented by any one of SEQ ID NOs: 33 to 35. According to the antisense nucleic acid of this embodiment, the pseudo exon can be skipped, so that the mRNA of normal fukutin can be expressed. As a result, the expression of normal fukutin protein can be restored.

[0007] (2) In the antisense nucleic acid described in (1) above, a morpholino oligomer consisting of any one of the nucleotide sequences (a) to (c) above may have the range from position 2044 to position 2068 of the nucleotide sequence shown in SEQ ID NO: 1 as a target sequence. According to the antisense nucleic acid of this embodiment, the pseudo exon can be skipped, so that the mRNA of normal fukutin can be expressed. As a result, the expression of normal fukutin protein can be restored.

[0008] (3) In the antisense nucleic acid described in (1) or (2) above, the base length may be 20 bases or more and 33 bases or less. According to the antisense nucleic acid of this embodiment, the pseudo exon can be efficiently skipped.

[0009] (4) In the antisense nucleic acid according to any one of (1) to (3) above, the morpholino oligomer may be a phosphorodiamidate morpholino oligomer. According to this form of antisense nucleic acid, the toxicity of the pharmaceutical composition can be reduced.

[0010] (5) According to another form of the present disclosure, a pharmaceutical composition for treating Fukuyama-type muscular dystrophy is provided. This pharmaceutical composition contains, as an active ingredient, one or more of the antisense nucleic acids described in any one of (1) to (4) above. According to this form of pharmaceutical composition, in Fukuyama-type muscular dystrophy caused by DIV in the fukutin gene, pseudo-exons can be skipped, so that mRNA of normal fukutin protein can be expressed. As a result, the expression of normal fukutin protein can be restored.

[0011] Note that the present disclosure can be realized in various forms. For example, it can be realized in forms such as a method for treating Fukuyama-type muscular dystrophy, a method for delaying the progression of Fukuyama-type muscular dystrophy, the use of an antisense nucleic acid for producing a therapeutic agent for Fukuyama-type muscular dystrophy, the use of an antisense nucleic acid for skipping pseudo-exons in Fukuyama-type muscular dystrophy to restore the expression of mRNA of normal fukutin protein, and the use of an antisense nucleic acid for restoring the O-mannose-type sugar chain modification of α-dystroglycan in Fukuyama-type muscular dystrophy.

Brief Description of the Drawings

[0012]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Mode for Carrying Out the Invention

[0013] The fukutin gene is located on chromosome 9 (Chromosome 9:105,558,122-105,653,820). The chromosome in the GenBank (registered trademark) reference sequence of the database published by NCBI (National Center for Biological Information) is 38 (GRCh38:CM000671.2). The mRNA of the fukutin gene is indicated by the accession number NM_001079802.2.

[0014] Figure 1 is an explanatory diagram showing the generation of pseudo-exons caused by DIV. In Figure 1, the normal fukutin gene is compared with the fukutin gene in FCMD (Fukuyama type muscular dystrophy) with DIV. Here, DIV (deep intronic variant) means a point mutation (c.647+2084G>T) deep in the gene. As shown in Figure 1, since DIV generates a splice donor site in the intron, it causes abnormal splicing. As a result, a pseudo-exon is generated between two exons, and a stop codon is induced by frameshift, causing the mRNA of the fukutin protein to decay. The intron where DIV is located has conventionally been considered to be intron 5 between exon 5 and exon 6, but due to a change in notation, it has been re-registered in the database as intron 6 between exon 6 and exon 7.

[0015] As shown in the examples described below, the inventor of the present application designed and conducted experiments on a plurality of antisense nucleic acids targeting the intron sequence that causes abnormal splicing and its flanking regions. As a result, an antisense nucleic acid that can skip the pseudo-exon and rescue the mRNA of the normal fukutin protein was identified. Then, from the perspective of toxicity, it was assumed that morpholino oligomers would be used as antisense nucleic acids applicable to the treatment of FCMD. Furthermore, as a result of this morpholino nucleic acid being able to restore normal fukutin protein, it was confirmed that the O-mannose type glycosylation of α-dystroglycan, which is deficient in FCMD, was restored and the function of muscle tubes was restored, leading to the completion of the present invention.

[0016] According to one embodiment of the present disclosure, an antisense nucleic acid is provided. This antisense nucleic acid uses at least a part of the range from the 1998th to the 2094th positions of the base sequence represented by SEQ ID NO: 1 as a target sequence and is a morpholino oligomer consisting of any one of the following base sequences (a) to (f): (a) The base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3, (b) A base sequence having 80% or more identity with the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3, (c) A base sequence in which one or several bases are deleted, substituted, or added in the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3, (d) The base sequence represented by any one of SEQ ID NOs: 33 to 35, (e) A base sequence having 80% or more identity with the base sequence represented by any one of SEQ ID NOs: 33 to 35, (f) A base sequence in which one or several bases are deleted, substituted, or added in the base sequence represented by any one of SEQ ID NOs: 33 to 35.

[0017] The nucleotide sequence represented by SEQ ID NO: 1 is a nucleotide sequence corresponding to intron 6 containing DIV (c.647+2084G>T) among the genomic sequences of the fukutin gene. The antisense nucleic acid of the present disclosure suppresses the above abnormal splicing in the pre-mRNA, which is the primary transcript, at the transcription stage of the gene represented by SEQ ID NO: 1, and suppresses the generation of pseudo exons. In the following description, this is also referred to as "exon skipping". According to the antisense nucleic acid of the present disclosure, as a result of exon skipping, the occurrence of frameshift is suppressed and the induction of stop codons is suppressed, so that normal fukutin mRNA can be expressed and the production of normal fukutin protein can be restored. As a result, the O-mannosyl glycan modification of α-dystroglycan can be restored and the function of muscle cells can be restored.

[0018] The nucleotide sequence represented by SEQ ID NO: 2 (TGCTACCTTTACATCAGATTCTGCT) is a sequence complementary to the nucleotide sequence positions 2044 to 2068 of the nucleotide sequence shown in SEQ ID NO: 1, and the nucleotide sequence represented by SEQ ID NO: 3 (ACTGCTACCTTTACATCAGATTCTGCT) is a sequence complementary to the nucleotide sequence positions 2044 to 2070 of the nucleotide sequence shown in SEQ ID NO: 1. Also, the nucleotide sequence represented by SEQ ID NO: 33 (TCTGCTATTCAAAGTAGACTGTAAC) is a sequence complementary to the nucleotide sequence positions 2025 to 2049 of the nucleotide sequence shown in SEQ ID NO: 1, the nucleotide sequence represented by SEQ ID NO: 34 (AACATCATTATCGCTGATTTCAAAAGGAGA) is a sequence complementary to the nucleotide sequence positions 1998 to 2027 of the nucleotide sequence shown in SEQ ID NO: 1, and the nucleotide sequence represented by SEQ ID NO: 35 (ATGTGAAAATACTTACAAATATTTACTGCT) is a sequence complementary to the nucleotide sequence positions 2065 to 2094 of the nucleotide sequence shown in SEQ ID NO: 1. The antisense nucleic acid of the present disclosure targets at least a part of the range of nucleotide sequence positions 1998 to 2094 of the nucleotide sequence shown in SEQ ID NO: 1 and contains a sequence complementary to this target sequence, but does not need to be completely complementary. That is, as long as it can form a hybrid with the target sequence, it may contain mismatches. More specifically, it is preferably an antisense nucleic acid consisting of the nucleotide sequence of (a) or (d) above, but may also be an antisense nucleic acid consisting of any one of the nucleotide sequences of (b), (c), (e), (f) above. Also, as an example of a preferred embodiment, the antisense nucleic acid of the present disclosure may be a morpholino oligomer consisting of any one of the nucleotide sequences of (a) to (c) above. An example of a preferred embodiment of the antisense nucleic acid of the present disclosure targets the nucleotide sequence positions 2044 to 2068 of the nucleotide sequence shown in SEQ ID NO: 1 and contains a sequence complementary to this target sequence, but does not need to be completely complementary. That is, as long as it can form a hybrid with the target sequence, it may contain mismatches. More specifically, it is preferably an antisense nucleic acid consisting of the nucleotide sequence of (a) above, but may also be an antisense nucleic acid consisting of the nucleotide sequence of (b) or (c) above.

[0019] In the present disclosure, the "identity" of a nucleotide sequence means the maximum identity (%) of the resulting sequences when two sequences to be compared are aligned by introducing gaps as necessary. The identity of a nucleotide sequence can be calculated, for example, using blastn of NCBI BLAST (http: / / blast.ncbi.nlm.nih.gov / ) which implements the BLAST algorithm. In the above (b) "a nucleotide sequence having 80% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3", from the viewpoint of suppressing a decrease in specificity, the identity is more preferably 82% or more, further preferably 84% or more, particularly preferably 86% or more, even more preferably 88% or more, still more preferably 90% or more, particularly still more preferably 92% or more, especially preferably 94% or more, particularly even more preferably 96% or more, and most preferably 98% or more. In the above (c) "a nucleotide sequence in which one or several nucleotides are deleted, substituted or added in the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3", "one or several nucleotides" are preferably 1 to 10 nucleotides, more preferably 1 to 8 nucleotides, further preferably 1 to 6 nucleotides, even more preferably 1 to 4 nucleotides, and still more preferably 1 to 2 nucleotides from the viewpoint of suppressing a decrease in specificity. The length of the antisense nucleic acid in the above (b) and the above (c) is not particularly limited, but from the viewpoint of suppressing a decrease in synthesis efficiency while suppressing a decrease in specificity, it is preferably 16 to 37 bases, more preferably 18 to 35 bases, further preferably 20 to 33 bases, even more preferably 22 to 31 bases, and still more preferably 23 to 30 bases.In the above (e), "a base sequence having 80% or more identity with the base sequence represented by any one of SEQ ID NOs: 33 to 35", from the viewpoint of suppressing a decrease in specificity, the identity is more preferably 82% or more, further preferably 84% or more, particularly preferably 86% or more, even more preferably 88% or more, still more preferably 90% or more, particularly even more preferably 92% or more, especially preferably 94% or more, particularly even more preferably 96% or more, and most preferably 98% or more. In the above (f), "a base sequence in which one or several bases are deleted, substituted or added in the base sequence represented by any one of SEQ ID NOs: 33 to 35", "one or several bases" are preferably 1 to 10 bases, more preferably 1 to 8 bases, further preferably 1 to 6 bases, even more preferably 1 to 4 bases, and still more preferably 1 to 2 bases from the viewpoint of suppressing a decrease in specificity. The length of the antisense nucleic acid in the above (e) and the above (f) is not particularly limited, but from the viewpoint of suppressing a decrease in synthesis efficiency while suppressing a decrease in specificity, it is preferably 16 bases or more and 37 bases or less, more preferably 18 bases or more and 35 bases or less, further preferably 20 bases or more and 33 bases or less, even more preferably 22 bases or more and 31 bases or less, and still more preferably 23 bases or more and 30 bases or less.

[0020] The antisense nucleic acid of the present disclosure is formed of a morpholino oligomer, so it has low toxicity and excellent resistance to enzymatic degradation. A morpholino oligomer is a kind of nucleotide analog and is an oligonucleotide having a morpholine ring instead of deoxyribose or ribose. The morpholino oligomer is not particularly limited, but from the viewpoint of reducing toxicity, it is preferably a phosphorodiamidate morpholino oligomer (PMO).

[0021] In addition, the antisense nucleic acids of the present disclosure may include substitution of non-bridging oxygen in the phosphodiester bond. For example, phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl phosphotriester, H-phosphonate, such as 3'-alkylene phosphonate, 5'-alkylene phosphonate, ethyl and other alkyl phosphonates including chiral phosphonate, phosphinate, such as phosphoramidate including 3'-aminophosphoramidate and aminoalkyl phosphoramidate, thionophosphoramidate, thionoalkyl phosphonate, thionoalkyl phosphotriester, selenophosphate or boranophosphate may be included. Such modifications are expected to improve resistance to nuclease degradation.

[0022] Furthermore, the antisense nucleic acid of the present disclosure preferably contains one or more sugar moieties that are mono- or di-substituted at the 2', 3' and / or 5' positions, such as -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl or aralkyl in which one or more heteroatoms may be present in between; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; O-, S- or N-allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; -methoxyethoxy; -dimethylaminooxyethoxy; -dimethylaminoethoxyethoxy and the like. The sugar moiety may be pyranose or its derivative, or deoxypyranose or its derivative, preferably ribose or its derivative, or deoxyribose or its derivative. Preferred derivatized sugar moieties include locked nucleic acid (LNA), in which the 2'-carbon atom is linked to the 3'- or 4'-carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. Preferred LNA includes 2'-O,4'-C-ethylene-bridged nucleic acid (Morita et al., 2001, Nucleic Acid Res Supplement No.1: 241-242). These substitutions improve RNaseH resistance and nuclease resistance, and are expected to improve the affinity for the target RNA.

[0023] In addition, the antisense nucleic acid of the present disclosure may contain a spacer. The spacer is present between adjacent nucleotides constituting the antisense nucleic acid, thereby providing a space between regular sequences of the nucleic acid sequence. Since the spacer is not complementary to the target sequence, it is assumed that the spacer does not bind to the target sequence. In addition, the 5'-end and / or 3'-end of the antisense nucleic acid of the present disclosure may be modified. This modification is not particularly limited, and examples thereof include triethylene glycol (TEG) modification, hexaethylene glycol (HEG) modification, and dodecaethylene glycol (DODEG) modification.

[0024] The antisense nucleic acid of the present disclosure preferably has high solubility in physiological saline. High solubility in physiological saline can suppress precipitation during formulation storage and precipitation when using an infusion solution containing salts. As a result, a decrease in quality can be suppressed, and toxicity during drug administration can be suppressed, thereby enhancing the utility value as an active ingredient of a pharmaceutical composition. The solubility in physiological saline is preferably 20 mg / mL or more, more preferably 30 mg / mL or more, still more preferably 40 mg / mL or more, and particularly preferably 50 mg / mL or more. The solubility of the antisense nucleic acid in physiological saline can be evaluated by dissolving the antisense nucleic acid in physiological saline at a target concentration and checking for the presence or absence of precipitation after a certain period of time.

[0025] Needless to say, it is preferable that an antisense nucleic acid with high safety be used as an active ingredient of a medicine. Safety can be evaluated, for example, using the blood aspartate aminotransferase (AST) value, alanine aminotransferase (ALT) value, blood urea nitrogen (BUN) value, and creatinine value after administration of the antisense nucleic acid as indicators. Specifically, for example, after administering an antisense nucleic acid to healthy mice, the blood AST value, ALT value, BUN value, and creatinine value are measured, and when an increase exceeding 1.3 times the measured value of the control group (solvent administration or no treatment) is observed, it is determined as an abnormal value, and it is preferable that no abnormal value is observed in any of the values. More specifically, an antisense nucleic acid solution is prepared using a 5% glucose aqueous solution and intravenously administered to 6-week-old male C57BL / 6J mice at a dose of 60 mg / kg. Blood is collected the next day, and the blood AST value, ALT value, BUN value, and creatinine value are measured. It may also be determined as an abnormal value when an increase exceeding 1.3 times the measured value of the control group (solvent administration or no treatment) is observed.

[0026] The antisense nucleic acid of the present disclosure can be produced using known nucleic acid synthesis methods. As known methods, for example, the methods described in International Publication WO2009 / 064471 or International Publication WO2013 / 100190 may be used.

[0027] The suppression of the expression of abnormal fukutin mRNA and the restoration of the expression of normal fukutin mRNA can be confirmed, for example, by introducing the antisense nucleic acid of the present disclosure into cells derived from FCMD patients and using known mRNA measurement methods such as quantitative RT-PCR with the cells as samples. Also, the restoration of the production of normal fukutin protein can be confirmed, for example, by introducing the antisense nucleic acid of the present disclosure into cells derived from FCMD patients and using known protein measurement methods such as ELISA and Western blotting with the cells as samples. Since the expression level of normal fukutin protein correlates with the expression level of normal fukutin mRNA produced by normal splicing, by measuring the expression level of normal fukutin mRNA, it is possible to indirectly evaluate that the production of normal fukutin protein has been restored.

[0028] According to another aspect of the present disclosure, a pharmaceutical composition for treating Fukuyama-type muscular dystrophy is provided. This pharmaceutical composition contains one or more of the antisense nucleic acids of the present disclosure as an active ingredient. The pharmaceutical composition of the present disclosure can restore the expression of normal fukutin mRNA and the production of normal fukutin protein by exon skipping. As a result, the O-mannosyl glycan modification of α-dystroglycan can be restored, and the function of muscle tubes can be restored. Therefore, the pharmaceutical composition of the present disclosure can be used for the treatment of FCMD caused by DIV in the fukutin gene. Note that the treatment of FCMD includes slowing down the progression of FCMD.

[0029] The pharmaceutical composition of the present invention contains the antisense nucleic acid of the present disclosure as an active ingredient, and may be formulated by appropriately blending a pharmaceutically acceptable carrier or additive. Specifically, it can be made into oral preparations such as tablets, coated tablets, pills, powders, granules, capsules, solutions, suspensions, emulsions, etc.; parenteral preparations such as injections, infusions, suppositories, ointments, patches, etc. Preferably, it is a parenteral preparation. The injection may be a freeze-dried preparation. The blending ratio of the carrier or additive may be appropriately set based on the range usually adopted in the pharmaceutical field. The carrier or additive is not particularly limited, and examples thereof include various carriers such as water, physiological saline, other aqueous solvents, aqueous or oily bases, excipients, binders, pH adjusters, disintegrants, absorption promoters, lubricants, coloring agents, flavoring agents, fragrances, and other various additives.

[0030] The additives that can be mixed into tablets, capsules, etc. are not particularly limited. For example, binders such as gelatin, corn starch, tragacanth, gum arabic, etc., excipients such as crystalline cellulose, swelling agents such as corn starch, gelatin, alginic acid, etc., lubricants such as magnesium stearate, sweeteners such as sucrose, lactose, saccharin, etc., flavoring agents such as peppermint, perilla oil, cherry, etc. are used. When the dosage unit form is a capsule, a liquid carrier such as an oil may be further contained in the above types of materials. The sterile composition for injection can be prepared according to normal pharmaceutical operations (for example, dissolving or suspending the active ingredient in a solvent such as water for injection or natural vegetable oil). The aqueous liquid for injection is not particularly limited. For example, physiological saline, isotonic solutions containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sucrose, sodium chloride, etc.) may be used, and appropriate solubilizing agents such as alcohol (for example, ethanol), polyalcohol (for example, propylene glycol, polyethylene glycol), nonionic surfactants (for example, polysorbate, HCO-50) may be used in combination. The oily liquid is not particularly limited. For example, sesame oil, soybean oil, etc. may be used, and benzyl benzoate, benzyl alcohol, etc., which are solubilizing agents, may be used in combination. Also, it may be formulated with buffers (for example, phosphate buffer, sodium acetate buffer), soothing agents (for example, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (for example, human serum albumin, polyethylene glycol, etc.), preservatives (for example, benzyl alcohol, phenol, etc.), antioxidants, etc. Furthermore, it may be a freeze-dried preparation.

[0031] The pharmaceutical composition of the present disclosure can be administered to humans suffering from FCMD caused by DIV in the fukutin gene. The administration route is not particularly limited, but parenteral administration is preferred. The parenteral administration may be any of systemic administration such as intravenous administration, intramuscular administration, transdermal administration, and topical administration such as transmucosal administration. Further, the antisense nucleic acid, which is an active ingredient of the pharmaceutical composition of the present disclosure, may be administered in the form of a non-viral vector or a viral vector. Furthermore, methods of introducing antisense nucleic acid using liposomes (liposome method, HVJ-liposome method, cationic liposome method, lipofection method, Lipofectamine method, etc.), microinjection method, method of transferring antisense nucleic acid into cells together with a carrier (metal particles) using a gene gun, methods of administering in combination with ultrasonic introduction method, etc. may also be used.

[0032] The dosage of the pharmaceutical composition of the present disclosure varies depending on the type of antisense nucleic acid contained, dosage form, administration route, age and weight of the patient. However, when administered in the form of an injection, about 0.01 mg to about 60 g per day, preferably about 0.1 mg to about 24 g per day, more preferably about 0.1 mg to about 6 g per day may be administered. The administration interval can be set from once a day to several times a day, or at intervals of one day to two weeks.

[0033] According to other aspects of the present disclosure, a method for treating Fukuyama-type muscular dystrophy is provided. This treatment method is characterized by administering an effective amount of the antisense nucleic acid of the present disclosure to FCMD patients caused by DIV in the fukutin gene. Further, according to other aspects of the present disclosure, there is provided the use of the antisense nucleic acid of the present disclosure for manufacturing a therapeutic agent for FCMD caused by DIV in the fukutin gene. Further, according to other aspects of the present disclosure, there is provided the use of the antisense nucleic acid of the present disclosure for skipping pseudoexons and restoring the expression of normal fukutin protein mRNA in FCMD caused by DIV in the fukutin gene. Further, according to other aspects of the present disclosure, there is provided the use of the antisense nucleic acid of the present disclosure for restoring the O-mannose-type glycosylation of α-dystroglycan in FCMD caused by DIV in the fukutin gene.

Example

[0034] Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to the following examples.

[0035] <Experiment 1> 1. Samples and methods (1) Samples, etc. Cell lines of fibroblasts, lymphoblasts, and myoblasts were obtained from a compound heterozygous FCMD patient (KG-105) with both DIV and SVA insertions and healthy controls, respectively (Taniguchi-Ikeda, M. et al. iScience, (2021) 24, 103140). The use of human cells was approved by the Fujita Health University Human Research and Ethics Committee (Research numbers: HG20-033 and HM20-563). All experiments included 2-3 repetitions and were repeated at least twice to confirm the reproducibility of the results.

[0036] (2) Design and synthesis of antisense nucleic acid Antisense nucleic acids (hereinafter also referred to as ASO) were designed to target potential splicing control elements of the pseudo-exon and its flanking sequences in the FKTN intron. The sequences were analyzed using predictable online tools. As such tools, ESE Finder 3.0 (http: / / krainer01.cshl.edu / cgibin / tools / ESE3 / esefinder.cgi?process=home) and Human Splicing Finder (https: / / hsf.genomnis.com / sequence) were used. Based on the prediction, the ASO was designed to cover the SF2 / ASF, SC35, SRp40, SRp55 motifs, 3' and 5' splice sites. The specificity of the ASO was analyzed using NCBI nucleotide BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and potential off-targets were identified. A total of 16 ASOs shown in SEQ ID NOs: 4 to 19 and a sense oligonucleotide (SON) as a non-binding control were synthesized using 2'-O-methylribose chemistry (Ajinomoto BioPharma Bioservices). ASO design parameters such as melting temperature, GC content, free energy of the ASO, ASO-ASO complex, and binding energy between the ASO and the target sequence were evaluated using RNA Structure software (https: / / rna.urmc.rochester.edu / RNAstructureWeb / ). The sequences and results are shown in Table 1. Based on the results of the screening using 2'-O-methylribose, two morpholino oligomers (hereinafter also referred to as PMO), 25-mer ASO 15.1 (SEQ ID NO: 2: TGCTACCTTTACATCAGATTCTGCT) and 27-mer ASO 15.2 (SEQ ID NO: 3: ACTGCTACCTTTACATCAGATTCTGCT), were designed and purchased from Gene Tools LLC.

[0037]

Table 1

[0038] (3) Cell culture All patient-derived cells were from a single patient with a compound heterozygote of SVA insertion and DIV (Taniguchi-Ikeda, M. et al. iScience, (2021) 24, 103140). Primary fibroblasts derived from FCMD patients and cells derived from healthy controls were cultured in Dulbecco's Modified Eagle Medium (DMEM, manufactured by Fujifilm Wako Pure Chemical Corporation) supplemented with 20% fetal bovine serum (FBS, manufactured by Biowest) and 1% penicillin-streptomycin (manufactured by Thermo Fisher Scientific). Primary lymphoblasts (KG-105) derived from FCMD patients and cells derived from healthy controls (lot#3450) were cultured in RPMI-1640 (manufactured by Fujifilm Wako Pure Chemical Corporation) supplemented with 10% FBS and 1% penicillin-streptomycin. The cells were maintained at 37°C, 5% CO 2 and subcultured twice a week. For the minigene splicing assay, FKTN knockout HEK293T cells (Taniguchi-Ikeda, M. et al. iScience, (2021) 24, 103140) were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. Primary myoblasts (KG-105) derived from FCMD patients (Taniguchi-Ikeda, M. et al. iScience, (2021) 24, 103140) and human skeletal myoblasts (manufactured by Gibco) were used as controls. The myoblasts were maintained at 37°C, 5% CO 2 in DMEM supplemented with 20% FBS and 1% penicillin-streptomycin. Differentiation of myoblasts into myotubes was induced by replacing the original medium with DMEM supplemented with 2% horse serum and 1% penicillin-streptomycin.

[0039] (4) Cell transfection Fibroblasts were seeded at 5.0×10 in a 6-well plate the day before transfection 5Cells were seeded at a density of cells / well. To control the transfection efficiency, a GFP expression plasmid was used and GFP-positive cells were visualized by fluorescence microscopy. Subsequently, cells were transfected with the ASO using Lipofectamine 3000 (#2056216, manufactured by Life Technologies) and FuGENE HD Transfection Reagent (E2311, manufactured by Promega). Twenty-four hours after transfection, the cells were further treated with cycloheximide 100 μg / ml (manufactured by Sigma-Aldrich) for 16 hours to inhibit decay via nonsense. Then, the cells were harvested with a cell scraper, washed with phosphate-buffered saline (PBS, manufactured by Fujifilm Wako Pure Chemical Corporation), and RNA was isolated. For the results, quantitative RT-PCR using sequence-specific TaqMan probes complementary to the mis-spliced transcript and the correct transcript, respectively, was used for analysis. The ASO was introduced into lymphoblasts by electroporation using a Nepa21 pulse generator (manufactured by Nepa Gene). The cells were suspended in OPTI-MEM (manufactured by Life Technologies), and 10 μg of ASO was added at a density of 2×10 6 cells per electrode chamber. The electrical pulse was irradiated at 275 V, pulse length 1.0 mV, pulse interval 50.0, and decay constant 40%. Immediately after transfection, 1 ml of RPMI-1640 containing 20% FBS, 1% GlutaMAX (#35050-061, manufactured by Life Technologies), and MEM NEAA (#11140-050, manufactured by Life Technologies) was added, and the cells were transferred to a collagen-coated dish. After 48 hours, the cells were harvested and analyzed for RNA and protein. Muscle tubes derived from FCMD patients were treated with PMO diluted in 1 ml of 10 μM medium and 6 μM Endo-Porter (manufactured by Gene Tools LLC), and then incubated at 37°C, 5% CO 2 for 48 hours prior to immunohistochemical staining.

[0040] (5) RNA Isolation, RT-PCR, Quantitative RT-PCR Total RNA was isolated using the Nucleospin RNA Isolation Kit (manufactured by Macherey-Nagel), and reverse transcription PCR was performed using random primers according to the manufacturer's instructions with the Super-Script III First-strand Synthesis System for RT-PCR (manufactured by Invitrogen) to synthesize a single-stranded cDNA template. The total RNA concentration and purity were measured using a Nanodrop 1000 spectrophotometer (manufactured by NanoDrop). The transcript was amplified using Ex-Taq polymerase (manufactured by Takara) and the primer pair FCMDex4F (SEQ ID NO: 20: CATGCGATCCACTGGTAGTC), FCMDex6-7 (SEQ ID NO: 21: GGTACTGCTGAAAGAATGCTCG) (Taniguchi-Ikeda, M. et al. Nature, 2011: 478, 127-131). The PCR products were separated by electrophoresis on a 2% agarose gel. For quantitative RT-PCR analysis, a transcript-specific TaqMan probe set (manufactured by Sigma-Aldrich) was used, and the expression values were normalized using GAPDH as an internal standard. The forward primer for GAPDH is represented by SEQ ID NO: 22 (GGGTGTAACCATGAGAAGTATGA), the reverse primer is represented by SEQ ID NO: 23 (GGCATGGACTGTGGTCATGAG), and the probe is represented by SEQ ID NO: 24 (ACAGCCTCAAGATCATCAGCAATGCCTCCT). TaqMan probe set 1 was designed to detect normal transcripts, and probe set 2 was designed to detect pathogenic transcripts. The forward primer for probe set 1 is represented by SEQ ID NO: 25 (GAGACTTAAAGAACACATTGACAGGA), the reverse primer is represented by SEQ ID NO: 26 (CTTCCAGTCCATCAACAGTAACTTG), and the probe is represented by SEQ ID NO: 27 (TGTAACTCTGGCCTGTCAAAAGCTCCTGGA).The forward primer of probe set 2 is represented by SEQ ID NO: 28 (TTCCGAAAGTTACAGTTTGGTCG), the reverse primer is represented by SEQ ID NO: 29 (GCTACCTTTACATCAGATTCTGCTA), and the probe is represented by SEQ ID NO: 30 (ACATCATTATCGCTGTCAAAAGCTCCTGGA). TaqMan Fast Universal PCR Master Mix (manufactured by Thermo Fisher Scientific) was used as a 2× master mix, and the reaction was loaded onto a 7500 Fast Real-Time PCR System (manufactured by Thermo Fisher Scientific).

[0041] (6) Mini-gene splicing assay In FKTN, a genomic region containing an intron with DIV and exons located on both sides thereof was amplified from the genomic DNA of a patient using PrimeSTAR GXL DNA polymerase (manufactured by Takara). The forward primer was represented by SEQ ID NO: 31 (5’-ATCCATGGTTGAAGGCTGGTTTCGGATA-3’), and the reverse primer was represented by SEQ ID NO: 32 (5’-CCATGGTCTGAAAGAATGCTCGAGCTTC-3). The primers each contained a restriction enzyme site for EcoRI (manufactured by Takara) and SacI (manufactured by New England Biolabs). The PCR product was double-digested with restriction enzymes and purified by gel electrophoresis. The purified product was subcloned into the EcoRI and SacI sites of the pNLF1-C (CMV / Hygro) NanoLuc vector (N1361, manufactured by Promega) using DNA Ligation Kit Ver.2.1 (manufactured by Takara). The vector was transformed into Escherichia coli JM109 competent cells (#AK71012N, manufactured by Takara). Since the patient was heterozygous for the SVA insertion and DIV, the wild type and the pathogenic vector were isolated from different clones, respectively. Both mini-genes were verified using colony PCR and Sanger sequencing. FKTN knockout HEK293T cells were seeded at 5×10 per well in a 96-well, white / transparent, tissue culture-treated plate (#353377, manufactured by Falcon) in 0.9 ml of medium (total volume). 4Cells were seeded. The cells were co-transfected with 100 ng of wild-type and pathogenic mini-gene constructs and ASO using Lipofectamine 3000 (#2056216, manufactured by Invitrogen) transfection reagent. As a positive control, a pNFL1-C construct without the mini-gene inserted was introduced. After 36 hours, the expression level of NanoLuc was measured using the Nano-Glo Luciferase Assay System (N1110, manufactured by Promega) according to the manufacturer's instructions. Luminescence was measured using a 2030 ARVO X Series Multi-Label Reader (manufactured by Perkin Elmer) 10 minutes after mixing with 100 μL of Nano-Glo Luciferase Assay Reagent.

[0042] (7) Western blot analysis Lymphoblasts were homogenized using RIPA buffer (20 mM Tris-Cl, 150 mM NaCl, 5 mM EDTA (pH 7.4), 1% Triton X-100 (Triton is a registered trademark), 1% sodium deoxycholate, 0.1% SDS) containing a protease inhibitor cocktail (manufactured by Nacalai Tesque). The sample was rotated at 4°C for 30 minutes and then centrifuged at 8000 rpm for 15 minutes. The supernatant was collected and then immunoprecipitated using FKTN beads containing the polyclonal goat anti-FKTN antibody 106G2 that recognizes the full-length FKTN protein lacking the N-terminal domain (Taniguchi-Ikeda, M. et al. Nature, 2011: 478, 127-131). The beads were rotated at 4°C overnight, centrifuged at 12000 rpm for 30 seconds, washed three times each with RIPA buffer and 0.1% Triton X-100, and eluted with 0.1 M glycine (pH 2.5). The sample was diluted with NuPAGE LDS Sample Buffer (manufactured by Thermo Fisher Scientific) and NuPAGE Sample Reducing Agent (manufactured by Thermo Fisher Scientific) containing 1 M dithiothreitol and incubated at 70°C for 10 minutes. The denatured protein sample was loaded onto a NuPAGE 4%-12% Bis-Tris gel and then electrophoresed at 100 V (constant) for 90 minutes using 1×NuPAGE SDS Running Buffer on an XCell SureLock Mini-Cell module (manufactured by Novex). Then, the sample was transferred to a polyvinylidene fluoride membrane at 40 V (constant) for 1 hour using 1×NuPAGE Transfer Buffer. Then, the membrane was incubated with the primary antibody (anti-FKTN antibody RY213) diluted with a blocking solution (Tris-buffered saline with Tween (TBS-T) containing 5% skim milk and 0.1% Tween) at 4°C overnight. Then, the membrane was incubated with the secondary antibody (anti-rabbit IgG, HRP-conjugated) in the blocking solution at room temperature for 1 hour and then washed three times for 10 minutes each with TBS-T.Chemiluminescence was detected using Pierce ECL Plus Western Blotting Substrate (#32132, manufactured by Thermo Fisher Scientific) and imaged using Image-Quant LAS 4000 Mini (manufactured by GE Healthcare Bio-Sciences AB).

[0043] (8) Immunohistochemical staining The myotubes were washed twice with PBS, fixed with 4% paraformaldehyde at room temperature for 30 minutes, then washed twice with PBS, and blocked with 0.3% Triton-X 100 (manufactured by Fujifilm Wako Pure Chemical Corporation) in PBS containing 10% normal donkey serum for 60 minutes. Incubation with the primary antibody diluted in the blocking buffer (0.05% Tween in PBS) was performed overnight. Then, the samples were washed three times with the blocking buffer for 10 minutes each time, and incubated with the secondary antibody diluted in the blocking buffer at room temperature for 1 hour. As antibodies, anti-α-DG (monoclonal, IIH6, manufactured by Santa Cruz Biotechnology), anti-myosin heavy chain (monoclonal, MF20, manufactured by R&D Systems), anti-laminin (L9393, rabbit polyclonal, manufactured by Sigma-Aldrich), anti-mouse IgM, Alexa Fluor 647 (manufactured by Thermo Fisher Scientific), goat anti-mouse IgG2b, Alexa Fluor 488 (manufactured by Thermo Fisher Scientific), and 4',6-diamidino-2-phenylindole (DAPI, manufactured by Sigma-Aldrich) were used. The samples were washed three times with the blocking solution, mounted with Prolong Gold Antifade Reagent (manufactured by Thermo Fisher Scientific), and then observed with a confocal microscope (LSM 980, manufactured by Carl Zeiss).

[0044] (9) Statistical analysis Prism version 9.2.0 (GraphPad) was used for graph creation and data analysis. The data were analyzed using one-way ANOVA, and a post-hoc Bonferroni test was performed to determine statistical significance. Significance was set at *P ≤ 0.05 and **P ≤ 0.01. The data are presented as mean ± standard deviation.

[0045] 2. Results (1) Design of antisense oligonucleotides Using the online tools ESE Finder 3.0 (http: / / krainer01.cshl.edu / cgibin / tools / ESE3 / esefinder.cgi?process=home) and Human Splicing Finder (https: / / hsf.genomnis.com / sequence), potential splicing control elements within the DIV-containing sequences were searched. Compared to the wild-type sequence, the predicted c.647+2084G>T variant had a disruption in the existing binding site for serine / arginine (SR) protein 40 (SRp40), resulting in the formation of a new binding site for SR protein 55 (SRp55). This disruption may activate an intronic cryptic donor site, resulting in abnormal splicing. As shown in Table 1 above, for the initial screening, a total of 16 19-26 mer 2'-O-methyl ASOs were designed to anneal to the splicing machinery access to prevent the inclusion of pseudo-exons. Therefore, the ASO target sites were placed at the 3' and 5' splice sites and exonic splicing enhancer motifs recognized by human SF2 / ASF, SC35, SRp40, and SRp55 proteins. The most effective ASO sequences were identified during preliminary experiments using 2'-O-methyl ASOs and were synthesized using PMO chemistry for use in subsequent experiments. This ASO did not recognize off-target sequences with more than 14 bases of similarity (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). ASO-target interactions can be avoided if there are three single-base mismatches (Aartsma-Rus, A. et al. Gene Ther., 2004: 11, 1391-1398). However, no off-target sequences with four or fewer single-base mismatches were found.

[0046] (2) Restoration of FKTN normal mRNA expression by pseudo-exon skipping of ASO To investigate whether ASO treatment induces pseudo-exon skipping at the FKTN pre-mRNA level, skin-derived fibroblasts were obtained from a FCMD patient with compound heterozygous SVA insertion and DIV (Taniguchi-Ikeda, M. et al. iScience, (2021) 24, 103140).

[0047] Figure 2 is an explanatory diagram showing the results of ASO treatment as primary screening. In Figure 2, the results of gel electrophoresis of RT-PCR products of RNA samples isolated from ASO-treated patient-derived fibroblasts are shown. In Figure 2 and Figure 3 described later, the upper band (about 300 bp) represents the mis-spliced transcript generated by the DIV allele, and the lower band (about 200 bp) represents the normal transcript. Also, NT indicates non-treatment. In Figures 2 and 3, SON treatment was used as a control. As shown in Figure 2, according to the results of agarose gel electrophoresis in a preliminary experiment using 2'-O-methyl ASO, it was found that treatment with ASO-9, 11, 14, 15, 16 decreased the mis-spliced transcript.

[0048] Using a GFP expression plasmid, GFP-positive cells were visualized with a fluorescence microscope to measure the transfection efficiency. The transfection efficiency was 50%, but the cell viability was low due to the toxicity of the transfection reagent. In the second screening, fibroblasts were treated separately with ASO-9, 11, 14, 15, 16 and with combinations of ASO-9 + 16, 11 + 14, 11 + 15, 11 + 14 + 15. The use of different transfection reagents increased the cell viability and increased the transfection efficiency up to 70%.

[0049] Figure 3 is an explanatory diagram showing the results of ASO treatment as secondary screening. In Figure 3, the results of gel electrophoresis of RT-PCR products of RNA samples isolated from ASO-treated patient-derived fibroblasts are shown. As shown in Figure 3, a significant decrease in mis-spliced transcripts was observed in all cases.

[0050] Figure 4 is an explanatory diagram showing the relative expression level of normal FKTN mRNA. Figure 5 is an explanatory diagram showing the relative expression level of mis-spliced FKTN mRNA. Figures 4 and 5 quantitatively represent the results of the RT-qPCR assay. As shown in Figure 4, according to quantitative RT-PCR analysis, in the ASO-15 treatment, the combination treatment of ASO9 and ASO-16, and the combination treatment of ASO-11, ASO-14, and ASO-15, in particular, a tendency for an increase in the level of normal transcripts was observed. Also, as shown in Figure 5, in all ASO treatment groups, mis-spliced transcripts decreased compared to cells treated with sense oligonucleotide (SON).

[0051] ASO-15 was considered to cover the binding sites of SF2 / ASF, SC35, SRp40, and SRp55 and to be the most effective in skipping pseudo-exons. Since ASO-15 showed superiority in terms of inducing pseudo-exon skipping, a dose-dependent study was conducted with the concentration of ASO-15 set at 0.1 - 3.0 μmol / L. Patient-derived fibroblasts were treated with ASO-15 at each concentration, and quantitative RT-PCR was performed using the collected RNA samples. Also, ASO-15 was electroporated into patient-derived lymphoblasts and DIV carrier lymphoblasts.

[0052] FIG. 6 is an explanatory diagram showing the results of the dose-dependent treatment of ASO-15. In FIG. 6, the relative expression levels are shown when the levels of normal transcripts (Normal) and mis-spliced transcripts (Mis-splied) in cells treated with SON are set to 1, respectively. As shown in FIG. 6, the expression of normal transcripts was significantly increased by the treatment with 0.5 μmol / L of ASO-15.

[0053] FIG. 7 is an explanatory diagram showing the results of the treatment of ASO-15 on patient-derived lymphoblasts. In FIG. 7, the vertical axis indicates the recovery rate (Recovery, %) of normal FKTN mRNA. Also in FIG. 7, NT indicates the non-treatment group, T indicates the treatment group, and Carrier indicates the lymphoblast-like cells of the patient's mother. As shown in FIG. 7, when ASO-15 was electroporated into patient-derived lymphoblasts and DIV carrier lymphoblasts, the recovery rate of correctly spliced transcripts increased by 80%. When GFP-positive cells were measured with a fluorescence microscope 24 hours and 48 hours after transfection, the transfection efficiency increased up to 80%.

[0054] (3) Pseudo-exon skipping of ASO in the mini-gene splicing reporter assay FIG. 8 is an explanatory diagram showing an overview of the pseudo-exon skipping strategy in the mini-gene splicing reporter assay. As shown in FIG. 8, a luciferase-based splicing assay was performed using FKTN knockout HEK293T cells expressing a splicing reporter (mini-gene) construct with a wild-type or pathogenic allele. By using Sanger sequencing, it was confirmed that such a construct has no mutants other than DIV. As a result of the mutation, the pathogenic mini-gene models an abnormal splicing process and contains a pseudo-exon that inhibits the expression of NanoLuc. In this case, an increase in the expression level of NanoLuc means the skipping of the pseudo-exon and the recovery of normal transcripts.

[0055] Figure 9 is an explanatory diagram showing the NanoLuc expression level. In Figure 9, the NanoLuc expression levels (NLuc expression level) in each of the control vector (Cont), wild-type minigene (WT), pathogenic minigene (PT), and negative control (Nega) are shown. As shown in Figure 9, compared with the wild-type minigene construct, the expression of NanoLuc was significantly lower in the minigene variant with DIV. This indicates that the minigene sequence is in the correct frame. Next, the pathogenic minigene and each ASO were co-introduced into FKTN knockout HEK293T cells to evaluate the possibility of pseudo-exon skipping.

[0056] Figures 10 and 11 are explanatory diagrams showing the NanoLuc expression levels by ASO treatment. Figure 10 shows the results of treating the minigene with DIV with each ASO, and Figure 11 shows the results of treating the minigene with DIV with a combination of each ASO. As shown in Figures 10 and 11, especially by the administration of ASO-15, the level of the repaired transcript increased significantly. This was consistent with the results obtained in fibroblasts and lymphoblasts treated with ASO. Next, RT-PCR analysis was used to evaluate the effectiveness of ASO-15 against the minigene.

[0057] Figure 12 is an explanatory diagram showing the results of the efficacy evaluation of ASO-15 against the minigene. In Figure 12, the results of gel electrophoresis of RT-PCR products in the minigene co-introduced with ASO-15 or SON15 into FKTN knockout HEK293T cells are shown. The upper band represents the mis-spliced transcript, and the lower band represents the normal transcript. In Figure 12, Non treated indicates the non-treated group, WT indicates the wild-type minigene, PT indicates the pathogenic minigene with DIV, SO indicates the sense oligonucleotide (SON) as a non-binding control, and Nega indicates the negative control. As shown in Figure 12, only normal transcripts were obtained from FKTN knockout HEK cells transfected with the wild-type minigene, but mis-spliced transcripts were amplified in cells transfected with the pathogenic minigene. When the cells transfected with the pathogenic minigene were treated with ASO-15, the transcripts returned to normal ones.

[0058] (4) Production of FKTN normal protein and recovery of functional glycosylation of α-DG by pseudo-exon skipping of ASO(POM) In cultured lymphoblastoid cells derived from FCMD patients and heterozygous DIV, immunoprecipitation and Western blotting were performed to detect the endogenously expressed FKTN protein. The endogenous FKTN protein is scarce and difficult to detect. Therefore, normal (Hn) FKTN and abnormal splicing (Hp) SVA-inserted FKTN cDNA constructs were overexpressed in FKTN knockout HEK 293T cells as controls. The antisense nucleic acids used in the subsequent experiments are morpholino nucleic acids having the sequences shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0059] Figure 13 is an explanatory diagram showing the results of immunoprecipitation analysis of the FKTN protein in patient-derived lymphoblasts. The band at approximately 55 kDa in Figure 13 indicates the normal FKTN protein, and the band at approximately 62 kDa indicates the abnormal FKTN protein derived from the SVA insertion allele. The image on the left side of the paper in Figure 13 shows a representative Western blot in the overexpression of normal FKTN cDNA and the overexpression of FKTN cDNA with a homozygous SVA insertion in HEK293T cells. The image in the center of the paper in Figure 13 shows the endogenous FKTN protein detected in patient-derived lymphoblasts with homozygous SVA insertions or heterozygous SVA / DIV. The image on the right side of the paper in Figure 13 shows a comparison between patient-derived lymphoblasts with heterozygous SVA / DIV treated with ASO-15(POM) and normal FKTN.

[0060] As shown in Figure 13, when patient-derived lymphoblasts carrying DIV were treated with ASO-15(POM), the normal FKTN protein (approximately 55 kDa) was detected. This indicates that the pseudoexon was effectively skipped by ASO-15(POM). Although the cleaved FKTN protein was not detected, this is presumably due to the nonsense-mediated mRNA decay mechanism (Kobayashi, K. et al., Journal of Human Genetics, 2017: 62, 945-948). Next, to evaluate the functional recovery of FKTN against ASO treatment, α-DG glycosylation and laminin clustering assays were performed on myotubes derived from FCMD patients with DIV.

[0061] Figure 14 is an explanatory diagram showing the results of immunohistochemistry of α-DG and laminin clustering assay in patient-derived myotubes. In Figure 14, the upper row shows normal human skeletal myotubes (Normal), the middle row shows myotubes derived from FCMD patients with DIV before ASO (POM) administration (FCMD(NT)), and the lower row shows myotubes derived from FCMD patients with DIV after ASO (POM) administration (FCMD(ASO)). Also, from the left side to the right side of the paper, myosin heavy chain (MHC), glycosylated α-DG, laminin clustering, merged image of glycosylated α-DG and laminin, DAPI staining of nuclei, and merged image of all signals are shown, and all scale bars are 20 μm.

[0062] As shown in Figure 14, glycosylation of α-DG was not detected in untreated myotubes. In contrast, after treatment with ASO-15 (POM), functionally glycosylated α-DG was restored, and its characteristics were almost the same as those of the normal control. The laminin-binding domain of α-DG was specifically recognized by the monoclonal antibody IIH6. According to the results of the laminin clustering assay, it was shown that the ability of laminin to bind to functional α-DG was increased compared to untreated myotubes. This indicates that the functional O-mannose glycosylation of α-DG was restored. That is, it became clear that pseudo-exon skipping by ASO (POM) restored normal protein production and functional O-mannose glycosylation of α-DG.

[0063] <Experiment 2> The effects of exon skipping were confirmed for five types of morpholino oligomers consisting of the nucleotide sequences represented by SEQ ID NOs: 2, 3, 33, 34, or 35. The antisense nucleic acids having the nucleotide sequences represented by SEQ ID NO: 2 (TGCTACCTTTACATCAGATTCTGCT), SEQ ID NO: 3 (ACTGCTACCTTTACATCAGATTCTGCT), SEQ ID NO: 33 (TCTGCTATTCAAAGTAGACTGTAAC), SEQ ID NO: 34 (AACATCATTATCGCTGATTTCAAAAGGAGA), and SEQ ID NO: 35 (ATGTGAAAATACTTACAAATATTTACTGCT) were all phosphorodiamidate morpholino oligomers (POMs) and were purchased from Gene Tools LLC. In Experiment 2, cell culture, transfection, RNA isolation, and quantitative RT-PCR were performed in the same manner as the method described in Experiment 1, except that the morpholino oligomers shown in SEQ ID NOs: 2, 3, 33 to 35 were used. As the cells, myoblasts derived from a compound heterozygous FCMD patient (KG-105) with DIV and SVA insertion and human skeletal myoblasts (manufactured by Gibco) were used. In quantitative RT-PCR, in the same manner as the method described in Experiment 1, sequence-specific TaqMan probes complementary to the normal transcript and the mis-spliced transcript were used to analyze the expression of mRNA.

[0064] Figure 15 is an explanatory diagram showing the relative expression levels of mRNA, which is a normal transcript, in Experiment 2. In Figure 15, "no administration" indicates a control group in which transfection of morpholino oligomers was not performed on myoblasts derived from an FCMD patient, and "normal" indicates the results when human skeletal myoblasts were used. Also, in Figure 15, the relative expression levels of mRNA when "normal" was set to 1 are shown. The data from two replicates are plotted and the average value is shown as a bar graph. As shown in Figure 15, when any of the five types of morpholino oligomers was used, a tendency for an increase in the expression level of normal mRNA was recognized as compared with no administration.

[0065] FIG. 16 is an explanatory diagram showing the relative expression levels of mRNAs, which are abnormal transcription products, in Experiment 2. In FIG. 16, “no administration” indicates a control group in which transfection of morpholino oligomers was not performed on myoblasts derived from FCMD patients. Also, FIG. 16 shows the relative expression levels of mRNAs when “no administration” is set to 100, and plots the data of three replicates and shows the average value as a bar graph. As shown in FIG. 16, when any of the five types of morpholino oligomers was used, the expression level of abnormal mRNA was significantly decreased compared to no administration, indicating that mis-splicing can be suppressed. Therefore, according to the results shown in FIGS. 15 and 16, when any of the five types of morpholino oligomers consisting of the nucleotide sequences represented by SEQ ID NOs: 2, 3, 33 to 35 was used, the pseudo exon could be skipped, resulting in suppression of the expression of abnormal mRNA and an increase in the expression level of normal mRNA. As a result, it is suggested that the expression of normal fukutin protein can be restored, and as a result, the O-mannose type glycosylation of α-dystroglycan can be restored, and the function of muscle tubes can be restored.

[0066] The present invention is not limited to the above-described embodiments, and can be realized in various configurations without departing from the gist thereof. For example, the embodiments and examples corresponding to the technical features in each form described in the summary of the invention can be appropriately replaced or combined in order to solve some or all of the above-described problems or to achieve some or all of the above-described effects. Also, if the technical feature is not described as essential in this specification, it can be appropriately deleted.

Claims

1. An antisense nucleic acid comprising: At least a part of the range from positions 1998 to 2094 of the base sequence shown in SEQ ID NO: 1 is used as a target sequence, A morpholino oligomer having any one of the following base sequences (a) to (f): Antisense nucleic acid: (a) a base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3; (b) a nucleotide sequence having 80% or more identity to the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3; (c) a base sequence in which one or several bases are deleted, substituted or added in the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3; (D) a base sequence represented by any one of SEQ ID NOs: 33 to 35; (e) a base sequence having 80% or more identity to any one of the base sequences represented by SEQ ID NO: 33 to SEQ ID NO: 35; (f) A base sequence represented by any one of SEQ ID NOs: 33 to 35, in which one or several bases have been deleted, substituted or added.

2. 2. The antisense nucleic acid of claim 1 , The range of positions 2044 to 2068 of the base sequence shown in SEQ ID NO: 1 is used as a target sequence, An antisense nucleic acid which is a morpholino oligomer consisting of any one of the base sequences (a) to (c) above.

3. The antisense nucleic acid according to claim 1 or 2, The base length is 20 bases or more and 33 bases or less. Antisense nucleic acid.

4. The antisense nucleic acid according to claim 1 or 2, the morpholino oligomer is a phosphorodiamidate morpholino oligomer; Antisense nucleic acid.

5. A pharmaceutical composition for treating Fukuyama muscular dystrophy, comprising: The composition contains one or more of the antisense nucleic acids according to claim 1 or 2 as an active ingredient. Pharmaceutical compositions.

Images