Compounds and methods for reducing SNCA expression

Abstract

To provide compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SNCA mRNA in a cell or animal, and in certain instances reducing the amount of alpha-synuclein protein in a cell or animal.SOLUTION: A compound useful for reducing expression of SNCA mRNA is an oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80% complementary to any of specific nucleobase sequences when measured across the entire nucleobase sequence of the modified oligonucleotide, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.SELECTED DRAWING: None

Description

Technical Field

[0001] Sequence Listing This application has been filed with an electronic sequence listing. The sequence listing corresponds to a file entitled BIOL0289WOSEQ_ST25.txt, created on October 18, 2018, and having a size of 712 KB. The information of the electronic form of the sequence listing and the file entitled BIOL0289WOSEQ_ST25.txt is hereby incorporated by reference in its entirety into this specification.

[0002] Technical Field Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of alpha-synuclein (SNCA) mRNA in a cell or animal, and optionally for reducing the amount of alpha-synuclein protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or feature of a neurodegenerative disease. Such symptoms and features include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, decreased cognitive function, and dementia. Such neurodegenerative diseases include Parkinson's disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronal Gaucher's disease, and Alzheimer's disease.

Background Art

[0003] Alpha-synuclein is a small, highly charged protein of 140 amino acid residues, which is mainly expressed in neurons of the central nervous system (CNS), and is localized in presynaptic terminals in close proximity to synaptic vesicles (Iwai, et al., Neuron. 1995. 14:467-475). Alpha-synuclein is encoded by the SNCA gene. Alpha-synuclein can associate with lipid membranes by forming amphipathic alpha-helices, as shown in in vitro studies (Davidson, et al., J. Biol. Chem. 1998. 273:9443-9449). Although the function of alpha-synuclein has not yet been fully elucidated, some studies have suggested that alpha-synuclein is involved in the regulation of synaptic transmission, synaptic vesicle density, and neuronal plasticity (Cabin et al., J. Neurosci. 2002. 22:8797-8807). Alpha-synuclein has been suggested to have a chaperone function, as shown by its effectiveness in preventing protein aggregation in in vitro assays (Souza et al., FEBS Lett. 2000. 474:116-119). Furthermore, in vivo studies have demonstrated that the chaperone activity of alpha-synuclein serves to promote the assembly of the SNARE complex, which is essential for neurotransmitter release at presynaptic terminals in the brain (Burre et al., Science. 329:1663-1667). Since a decrease in the assembly of the SNARE complex is associated with neuropathy, this indicates a link between presynaptic alpha-synuclein aggregates and neurodegeneration (Kramer and Schulz-Schaeffer, J. Neurosci. 2007. 27:1405-1410). The knockout mouse model of alpha-synuclein is not lethal, and the brain morphology is in a complete state, suggesting that alpha-synuclein is not required for neuronal development and / or that compensatory pathways exist (Abeliovich et al., Neuron. 2000. 25:239-252).

[0004] Mistaken folding, aggregation, and fibrillation of alpha-synuclein are involved as important factors in several neurodegenerative diseases such as Parkinson's disease, Lewy body variant Alzheimer's disease, diffuse Lewy body disease, Lewy body variant dementia, and multiple system atrophy (Schulz-Schaeffer Acta Neuropathol. 2010. 120:131-143, Yoshida. Neuropathology. 2007. 27:484-4 93). In each of these cases, the alpha-synuclein protein is misfolded and aggregates into Lewy bodies and Lewy neurite aggregates (Uversky. J. Neurochem. 2007. 103:17-37). Several recent studies have shown that the lipid environment that promotes the folding of alpha-synuclein also accelerates the aggregation of alpha-synuclein, suggesting that the lipid-related conformation of alpha-synuclein may be related to the misfolding of alpha-synuclein in neurodegenerative diseases (Conway et al., Science. 2001. 294:6-9, Lee et al., J. Biol. Chem. 2002. 277:671-678). Mutations at position 53 where alanine changes to threonine and at position 30 where alanine changes to proline have been shown to cause alpha-synuclein to adopt a random coil state and thus be more prone to aggregation (Clayton and George, J. Neurosci. 1999. 58:120-129).

[0005] Currently, there is a lack of acceptable treatment options for neurodegenerative diseases such as Parkinson's disease, Lewy body variant dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronal Gaucher's disease, and Alzheimer's disease. Accordingly, it is an object of the present specification to provide compounds, methods, and pharmaceutical compositions for treating such diseases. SUMMARY OF THE INVENTION

[0006] This specification provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SNCA mRNA in cells or animals, and in certain embodiments, reducing the amount of alpha-synuclein protein. In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the animal has Parkinson's disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronal Gaucher's disease, or Alzheimer's disease. In certain embodiments, the compound useful for reducing the expression of SNCA mRNA is an oligomeric compound. In certain embodiments, the compound useful for reducing the expression of SNCA mRNA is a modified oligonucleotide.

[0007] Also provided are methods useful for ameliorating at least one symptom or feature of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is Parkinson's disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronal Gaucher's disease, and Alzheimer's disease. In certain embodiments, the symptoms or features include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, decline in cognitive function, and dementia. In certain embodiments, amelioration of these symptoms results in improved motor function, reduction of alpha-synuclein aggregates, suppression of neurodegeneration, and / or suppression of dementia.

Mode for Carrying Out the Invention

[0008] It should be understood that both the foregoing summary and the following detailed description are illustrative and explanatory only and are not restrictive. In this specification, unless specifically stated otherwise, the use of the singular includes the plural. As used herein, unless specifically stated otherwise, the use of "or" means "and / or". Further, the use of the terms "including" and other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more sub-units, unless specifically stated otherwise.

[0009] The section headings used in this specification are for organizational purposes only and are not to be construed as limiting the subject matter described. All materials or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby incorporated by reference in their entirety and in part as if fully set forth herein.

[0010] Definitions Unless otherwise defined, the terms used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein, as well as their procedures and techniques, are those commonly used and well known in the art. To the extent permitted, all patents, applications, published applications, and other publications and other data referred to throughout this disclosure are hereby incorporated by reference in their entirety.

[0011] Unless otherwise specified, the following terms have the following meanings.

[0012] Definitions As used herein, "2'-deoxynucleoside" means a nucleoside containing a 2'-H (H) deoxyribose sugar moiety as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0013] As used herein, "2'-substituted nucleoside" means a nucleoside containing a 2'-substituted sugar moiety. As used herein, "2'-substituted" in connection with the sugar moiety means a sugar moiety containing at least one 2'-substituent other than H or OH.

[0014] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached at the 5-position. 5-Methylcytosine is a modified nucleobase.

[0015] As used herein, "administering" means providing a pharmaceutical agent to an animal.

[0016] As used herein, "animal" means a human or a non-human animal.

[0017] As used herein, "antisense activity" means any detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such target nucleic acid as compared to the level of the target nucleic acid or target protein in the absence of the antisense compound.

[0018] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0019] As used herein, "ameliorate" in relation to treatment means that at least one symptom is improved compared to not treating the same symptom. In certain embodiments, amelioration is a decrease in the severity or frequency of a symptom, or a delay in the onset of a symptom or a deceleration in the progression of the severity or frequency of a symptom. In certain embodiments, the symptom or feature is a motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, a decrease in cognitive function and / or dementia. In certain embodiments, amelioration of these symptoms results in an improvement in motor function, a decrease in alpha-synuclein aggregates, suppression of neurodegeneration and / or suppression of dementia.

[0020] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside containing a bicyclic sugar moiety.

[0021] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety containing two rings, wherein the second ring is formed via a bridge connecting two atoms of the first ring. By being formed, a bicyclic structure is formed. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.

[0022] As used herein, "cleavable moiety" means an atomic bond or atomic group that is cleaved under physiological conditions, e.g., inside a cell, an animal, or a human.

[0023] As used herein, "complementary" in relation to an oligonucleotide means that when the nucleobase sequence of the oligonucleotide is aligned in the opposite direction with the nucleobase sequence of another nucleic acid, at least 70% of the nucleobases of such oligonucleotide or one or more regions thereof can hydrogen bond with the nucleobases of another nucleic acid or one or more regions thereof. Complementary nucleobases mean nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids do not necessarily have complementary nucleobases at each respective nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in relation to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at each respective nucleoside of the oligonucleotide.

[0024] As used herein, "linking group" means an atomic group that is directly or indirectly attached to an oligonucleotide. Linking groups include a linking moiety and a linking linker that attaches such linking moiety to the oligonucleotide.

[0025] As used herein, "linking linker" means an atomic group that includes at least one bond connecting a linking moiety and an oligonucleotide.

[0026] As used herein, the term "linking moiety" means a moiety that is attached to an oligonucleotide via a linking linker.

[0027] As used herein, in an oligonucleotide, "consecutive" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are directly adjacent to each other. For example, "consecutive nucleobases" means nucleobases that are sequentially directly adjacent to each other.

[0028] As used herein, the term "constrained ethyl" or "cEt" or "cEt-modified sugar" means a β-D-ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the carbon at the 4'-position and the carbon at the 2'-position of the β-D-ribosyl sugar moiety, and the bridge has the formula 4'-CH(CH 3 )-O-2', and the methyl group of the bridge is in the S configuration.

[0029] As used herein, the term "cEt nucleoside" means a nucleoside containing a cEt-modified sugar.

[0030] As used herein, the term "chiral-rich population" means a plurality of molecules having the same molecular formula, wherein the number or proportion of sub-molecules within the population containing a specific stereochemical configuration at a specific chiral center is greater than the number or proportion of sub-molecules within the same population that would be predicted to contain the same specific stereochemical configuration at the same specific chiral center if the specific chiral center were stereorandom. A chiral-rich population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound containing a modified oligonucleotide.

[0031] As used herein, "gapmer" means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support cleavage by RNase H and are positioned between two outer regions each having one or more nucleosides, wherein the nucleosides included in the internal region are chemically different from the nucleosides included in the outer regions. The internal region may be referred to as a "gap" and the outer regions may be referred to as "wings". Unless otherwise specified, "gapmer" refers to a sugar motif. Unless otherwise specified, the sugar moiety of the nucleosides in the gap of the gapmer is unmodified 2'-deoxyribosyl. Accordingly, the term "MOE gapmer" refers to a gapmer having a sugar motif in which both wings are 2'-MOE nucleosides and the gap is 2'-deoxynucleoside. Unless otherwise specified, an MOE gapmer may include one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern by sugar modification.

[0032] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to the effect of a decrease in the amount or activity of that target nucleic acid by the intervention of an oligomeric compound.

[0033] As used herein, "hybridization" means the formation or annealing of complementary oligonucleotides and / or nucleic acids. Without being limited to a particular mechanism, hydrogen bonding occurs in the most common mechanism of hybridization, which can be Watson-Crick type, Hoogsteen type or reverse Hoogsteen type hydrogen bonding between complementary nucleobases.

[0034] As used herein, the term "internucleoside linkage" is a covalent bond between adjacent nucleosides within an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced by a sulfur atom.

[0035] As used herein, "linker nucleoside" means a nucleoside that directly or indirectly links an oligonucleotide to a moiety. Linker nucleosides are located within the linking linker of an oligomeric compound. A linker nucleoside is not considered part of the oligonucleotide portion of an oligomeric compound even if it is adjacent to an oligonucleotide.

[0036] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that does not form a bridge between two atoms of the sugar to form a second ring, e.g., a modified sugar moiety containing substituents and the like.

[0037] As used herein, "mismatch" or "non-complementary" means that when a first and a second oligonucleotide are aligned, the nucleobase of the first oligonucleotide is not complementary to the corresponding nucleobase of the second oligonucleotide or a target nucleic acid.

[0038] As used herein, "MOE" means methoxyethyl. "2'-MOE" or "2'-MOE modified sugar" means a 2'-OCH 2 CH 2 OCH 3 group that replaces the 2'-OH group of a ribosyl sugar moiety.

[0039] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE-modified sugar. As used herein, "motif" means a pattern of unmodified portions and / or modified sugar portions, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0040] As used herein, "mRNA" means an RNA transcript encoding a protein, and includes pre-mRNA and mature mRNA unless otherwise specified.

[0041] As used herein, "neurodegenerative disease" means a pathological condition characterized by a progressive loss of the structure or function of neurons, including neuron death. In certain embodiments, the neurodegenerative disease is Parkinson's disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronal Gaucher's disease, and Alzheimer's disease.

[0042] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, "modified nucleobase" is a moiety other than unmodified A, T, C, U, or G that is capable of base pairing with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can base pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any modification of the sugar or internucleoside linkage.

[0043] As used herein, "nucleoside" means a compound containing a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside containing a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides lacking a nucleobase. A "linked nucleoside" is a nucleoside that is linked in a continuous sequence (i.e., there is no additional nucleoside between the linked nucleosides).

[0044] As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more additional features such as a linking group or a terminal group. The oligomeric compound may or may not form a pair with a second oligomeric compound complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an oligomeric compound that is not paired. The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of the oligomeric duplex can be referred to as a "duplex-forming oligomeric compound".

[0045] As used herein, "oligonucleotide" means a chain of linked nucleosides connected via internucleoside linkages, and each nucleoside and internucleoside linkage may or may not be modified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that contains no nucleoside modifications and no internucleoside modifications.

[0046] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to an animal. With a particular such carrier, the pharmaceutical composition It can be formulated, for example, as tablets, pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions and medicinal drops for oral intake by a subject. In certain embodiments, the pharmacologically acceptable carrier or diluent is sterile water, sterile physiological saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

[0047] As used herein, "pharmacologically acceptable salt" means a physiologically and pharmacologically acceptable salt of a compound. The pharmacologically acceptable salt retains the desired biological activity of the parent compound and does not impart undesirable toxic effects to such activity.

[0048] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, the pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a specific cell line.

[0049] As used herein, "prodrug" means a therapeutic agent in an in vitro form that is converted into a different form in an animal or its cells. Typically, the conversion of a prodrug in an animal body is facilitated by the action of an enzyme (e.g., an endogenous enzyme or a viral enzyme) or a chemical present in a cell or tissue and / or by physiological conditions.

[0050] As used herein, "decrease or inhibit the amount or activity" refers to a decrease or blockage of transcriptional expression or activity as compared to the transcriptional expression or activity in an untreated sample or a control sample, and does not necessarily indicate a complete disappearance of the transcriptional expression or activity.

[0051] As used herein, the term "RNAi compound" means an antisense compound that at least partially acts via RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs such as microRNA mimics. In certain embodiments, the RNAi compound modulates the amount, activity, and / or splicing of the target nucleic acid. The term RNAi compound excludes antisense compounds that act via RNase H.

[0052] As used herein, "self-complementary" in relation to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0053] As used herein, "standard cell assay" means the assays described in Example 10 and suitable variations thereof.

[0054] As used herein, "standard in vivo assay" means the experiments described in Example 22 and suitable variations thereof.

[0055] As used herein, in a molecular population having the same molecular formula, "stereorandom chiral center" means a chiral center having a random stereochemical configuration. For example, in a molecular population containing a stereorandom chiral center, the number of molecules in which the stereorandom chiral center has an (S) configuration may or may not be the same as the number of molecules in which the stereorandom chiral center has an (R) configuration. The stereochemical configuration of a chiral center is considered random if it results from a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate nucleoside internucleoside linkage.

[0056] As used herein, the term "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety As used herein, "unmodified sugar moiety" means the 2'-OH(H) ribosyl moiety found in RNA ("unmodified RNA sugar moiety") or the 2'-H(H) deoxyribosyl moiety found in DNA ("unmodified DNA sugar moiety"). The unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar substitute.

[0057] As used herein, "sugar substitute" means a modified sugar moiety having a moiety other than a furanosyl moiety that can link a nucleobase to another group such as an internucleoside linkage, a linking group, or a terminal group of an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or a target nucleic acid.

[0058] As used herein, "target nucleic acid" and "target RNA" mean a nucleic acid that is designed such that an antisense compound affects it.

[0059] As used herein, "target region" means a part of a target nucleic acid that is designed such that an oligomeric compound hybridizes to it.

[0060] As used herein, "terminal group" means a chemical group or atomic group covalently linked to the end of an oligonucleotide.

[0061] As used herein, "therapeutically effective amount" means the amount of a pharmaceutical agent that provides a therapeutic benefit to an animal. For example, the symptoms of a disease are improved by a therapeutically effective amount.

[0062] The present disclosure provides the following numbered non-limiting embodiments.

[0063] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence containing at least 12, 13, 14, 15, 16, or 17 nucleobases of any one of SEQ ID NOs: 2193, 1703, 28 to 1702, 1704 to 2192, and 2194 to 2793, said oligomeric compound.

[0064] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the modified oligonucleotide has an isologous portion of nucleobases 50915 to 50943 of SEQ ID NO: 2, has an isologous portion of nucleobases 19630 to 19656 of SEQ ID NO: 2, has an isologous portion of nucleobases 28451 to 28491 of SEQ ID NO: 2, has an isologous portion of nucleobases 48712 to 48760 of SEQ ID NO: 2, has an isologous portion of nucleobases 23279 to 23315 of SEQ ID NO: 2, has an isologous portion of nucleobases 20964 to 21018 of SEQ ID NO: 2, has an isologous portion of nucleobases 22454 to 22477 of SEQ ID NO: 2, has an isologous portion of nucleobases 72294 to 72321 of SEQ ID NO: 2, has an isologous portion of nucleobases 20549 to 20581 of SEQ ID NO: 2, or has an isologous portion of nucleobases 27412 to 27432 of SEQ ID NO: 2 and has a nucleobase sequence complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, said oligomeric compound.

[0065] Embodiment 3. The oligomeric compound according to Embodiment 1 or 2, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any one of the nucleobase sequences of SEQ ID NOs: 1 to 6 when measured over the entire nucleobase sequence of the modified oligonucleotide.

[0066] Embodiment 4. The modified oligonucleotide is an oligomeric compound according to any one of Embodiments 1 to 3, comprising at least one modified nucleoside.

[0067] Embodiment 5. The modified oligonucleotide is an oligomeric compound according to Embodiment 4, comprising at least one modified nucleoside containing a modified sugar moiety.

[0068] Embodiment 6. The modified oligonucleotide is an oligomeric compound according to Embodiment 5, comprising at least one modified nucleoside containing a bicyclic sugar moiety.

[0069] Embodiment 7. The modified oligonucleotide comprises at least one modified nucleoside containing a bicyclic sugar moiety having a 2'-4' bridge, and the 2'-4' bridge is -O-CH 2 - and -O-CH(CH 3 )-, and is an oligomeric compound according to Embodiment 6.

[0070] Embodiment 8. The modified oligonucleotide is an oligomeric compound according to any one of Embodiments 4 to 7, comprising at least one modified nucleoside containing a non-bicyclic modified sugar moiety.

[0071] Embodiment 9. The modified oligonucleotide is an oligomeric compound according to Embodiment 8, comprising at least one modified nucleoside containing a non-bicyclic modified sugar moiety containing a 2'-MOE modified sugar or a 2'-OMe modified sugar.

[0072] Embodiment 10. The modified oligonucleotide is an oligomeric compound according to any one of Embodiments 4 to 9, comprising at least one modified nucleoside containing a sugar substitute.

[0073] Embodiment 11. The modified oligonucleotide is an oligomeric compound according to Embodiment 10, comprising at least one modified nucleoside containing a sugar substitute selected from morpholino and PNA.

[0074] Embodiment 12. The modified oligonucleotide has a 5'-region consisting of 1 to 5 linked 5'-region nucleosides, a central region consisting of 6 to 10 linked central region nucleosides, and a 3'-region consisting of 1 to 5 linked 3'-region nucleosides having a sugar motif, where each of the 5'-region nucleosides and each of the 3'-region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains an unmodified 2'-deoxyribosyl sugar moiety, the oligomeric compound according to any one of Embodiments 1 to 11.

[0075] Embodiment 13. The modified oligonucleotide contains at least one modified internucleoside linkage, the oligomeric compound according to any one of Embodiments 1 to 12.

[0076] Embodiment 14. Each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, the oligomeric compound according to Embodiment 13.

[0077] Embodiment 15. At least one internucleoside linkage is a phosphorothioate internucleoside linkage, the oligomeric compound according to Embodiment 13 or 14.

[0078] Embodiment 16. The modified oligonucleotide contains at least one phosphodiester internucleoside linkage, the oligomeric compound according to Embodiment 13 or 15.

[0079] Embodiment 17. Each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage, the oligomeric compound according to any one of Embodiments 13, 15, or 16.

[0080] Embodiment 18. The modified oligonucleotide contains at least one modified nucleobase, the oligomeric compound according to any one of Embodiments 1 to 17.

[0081] Embodiment 19. The oligomeric compound according to Embodiment 18, wherein the modified nucleobase is 5-methylcytosine.

[0082] Embodiment 20. The oligomeric compound according to any one of Embodiments 1 to 19, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 20, 15 to 25, 16 to 20, 18 to 22 or 18 to 20 linked nucleosides.

[0083] Embodiment 21. The oligomeric compound according to any one of Embodiments 1 to 20, wherein the modified oligonucleotide consists of 17 or 20 linked nucleosides.

[0084] Embodiment 22. The oligomeric compound according to any one of Embodiments 1 to 21, which consists of the modified oligonucleotide.

[0085] Embodiment 23. The oligomeric compound according to any one of Embodiments 1 to 21, which comprises a binding group containing a binding moiety and a binding linker.

[0086] Embodiment 24. The oligomeric compound according to Embodiment 23, wherein the binding group comprises a GalNAc cluster containing 1 to 3 GalNAc ligands.

[0087] Embodiment 25. The oligomeric compound according to Embodiment 23 or 24, wherein the binding linker consists of a single bond.

[0088] Embodiment 26. The oligomeric compound according to Embodiment 24, wherein the binding linker is cleavable.

[0089] Embodiment 27. The oligomeric compound according to Embodiment 26, wherein the binding linker contains 1 to 3 linker nucleosides.

[0090] Embodiment 28. The oligomeric compound according to any one of Embodiments 23 to 27, wherein the linking group is bonded to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

[0091] Embodiment 29. The oligomeric compound according to any one of Embodiments 23 to 27, wherein the linking group is bonded to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.

[0092] Embodiment 30. The oligomeric compound according to any one of Embodiments 1 to 29, which contains a terminal group.

[0093] Embodiment 31. The oligomeric compound according to any one of Embodiments 1 to 30, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0094] Embodiment 32. The oligomeric compound according to any one of Embodiments 1 to 26 or 28 to 30, which does not contain a linker nucleoside.

[0095] Embodiment 33. An oligomeric double strand containing the oligomeric compound according to any one of Embodiments 1 to 30 or 32.

[0096] Embodiment 34. An antisense compound containing or consisting of the oligomeric compound according to any one of Embodiments 1 to 32 or the oligomeric double strand according to Embodiment 33.

[0097] Embodiment 35. A pharmaceutical composition containing the oligomeric compound according to any one of Embodiments 1 to 32 or the oligomeric double strand according to Embodiment 33 and a pharmaceutically acceptable carrier or diluent.

[0098] Embodiment 36. The following formula

[0099]

Chemical formula

[0100] A modified oligonucleotide or a salt thereof according to this. If it is consistent with the definitions and disclosures herein, embodiments 36 compounds may be prepared by intentionally controlling the stereochemistry of any or all of the linkages, or without intentionally controlling the stereochemistry of any of the linkages.

[0101] Embodiment 37. The following formula

[0102]

Chemical formula

[0103] A modified oligonucleotide or a salt thereof according to this. If it is consistent with the definitions and disclosures herein, embodiments 37 compounds may be prepared by intentionally controlling the stereochemistry of any or all of the linkages, or without intentionally controlling the stereochemistry of any of the linkages.

[0104] Embodiment 38. The following formula

[0105]

Chemical formula

[0106] A modified oligonucleotide or a salt thereof according to this. If it is consistent with the definitions and disclosures herein, embodiments 38 compounds may be prepared by intentionally controlling the stereochemistry of any or all of the linkages, or without intentionally controlling the stereochemistry of any of the linkages.

[0107] Embodiment 39. The following formula

[0108]

Chemical formula

[0109] A modified oligonucleotide or a salt thereof according to this. If it is consistent with the definitions and disclosures herein, embodiments 39 compounds may be prepared by intentionally controlling the stereochemistry of any or all of the linkages, or without intentionally controlling the stereochemistry of any of the linkages.

[0110] Embodiment 40. The following formula

[0111]

Chemical formula

[0112] A modified oligonucleotide or a salt thereof according to. Compounds of Embodiment 40 may be prepared by intentionally controlling the stereochemistry of any or all of the linkages or without intentionally controlling the stereochemistry of any of the linkages, provided that they are consistent with the definitions and disclosures herein.

[0113] Embodiment 41. The modified oligonucleotide according to any one of Embodiments 36 to 40, which is the sodium salt of the above formula.

[0114] Embodiment 42. A population rich in chirality of the modified oligonucleotide according to any one of Embodiments 36 to 40, the population being rich in modified oligonucleotides containing at least one specific phosphorothioate nucleoside internucleoside linkage having a specific stereochemical configuration.

[0115] Embodiment 43. The population rich in chirality according to Embodiment 42, wherein the population is rich in modified oligonucleotides containing at least one specific phosphorothioate nucleoside internucleoside linkage having an (Sp) configuration.

[0116] Embodiment 44. The population rich in chirality according to Embodiment 42, wherein the population is rich in modified oligonucleotides containing at least one specific phosphorothioate nucleoside internucleoside linkage having an (Rp) configuration.

[0117] Embodiment 45. The population rich in chirality according to Embodiment 42, wherein the population is rich in modified oligonucleotides having a specific stereochemical configuration independently selected for each phosphorothioate nucleoside internucleoside linkage.

[0118] Embodiment 46. The population is a chirality-rich population according to Embodiment 45, which is rich in modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage.

[0119] Embodiment 47. The population is a chirality-rich population according to Embodiment 45, which is rich in modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0120] Embodiment 48. The population is a chirality-rich population according to Embodiment 45, which is rich in modified oligonucleotides having an (Rp) configuration at one specific phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0121] Embodiment 48. The population is a chirality-rich population according to Embodiment 42 or Embodiment 45, which is rich in modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations in the 5' to 3' direction.

[0122] Embodiment 49. The population is a chirality-rich population according to Embodiment 42 or Embodiment 45, which is rich in modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations in the 5' to 3' direction.

[0123] Embodiment 50. The population is a chirality-rich population of oligomeric compounds according to any one of Embodiments 1 to 32, wherein all phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0124] Embodiment 51. A pharmaceutical composition comprising a modified oligonucleotide according to any one of Embodiments 36 to 40 and a pharmaceutically acceptable diluent or carrier.

[0125] Embodiment 52. The pharmaceutical composition according to Embodiment 51, wherein the pharmacologically acceptable diluent is artificial cerebrospinal fluid.

[0126] Embodiment 53. The pharmaceutical composition according to Embodiment 50, which essentially consists of the modified oligonucleotide and artificial cerebrospinal fluid.

[0127] Embodiment 54. A method comprising administering the pharmaceutical composition according to any one of Embodiments 35 or 51 to 53 to an animal.

[0128] Embodiment 55. A method for treating a disease associated with SNCA, comprising administering to an individual suffering from or at risk of developing a disease associated with SNCA the pharmaceutical composition according to any one of Embodiments 35 or 51 to 53 in a therapeutically effective amount, thereby treating the disease associated with SNCA.

[0129] Embodiment 56. The method according to Embodiment 55, wherein the disease associated with SNCA is a neurodegenerative disease.

[0130] Embodiment 57. The method according to Embodiment 56, wherein the neurodegenerative disease is any one of Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronal Gaucher's disease, and Alzheimer's disease.

[0131] Embodiment 58. The method according to Embodiment 56, wherein at least one symptom or feature of the neurodegenerative disease is improved.

[0132] Embodiment 59. The method according to Embodiment 58, wherein the symptom or feature is any one of motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, decline in cognitive function, and dementia.

[0133] I. Specific Oligonucleotide In certain embodiments, provided herein is an oligomeric compound comprising an oligonucleotide consisting of linked nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. A modified oligonucleotide comprises at least one modification relative to an unmodified RNA or unmodified DNA. That is, a modified oligonucleotide comprises at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.

[0134] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety, or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0135] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is an acyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such a sugar surrogate may comprise one or more substitutions corresponding to substitution of other types of modified sugar moieties.

[0136] In certain embodiments, the modified sugar moiety is an acyclic modified sugar moiety comprising a furanosyl ring having one or more substituents that do not crosslink two atoms of the furanosyl ring to form a bicyclic structure. Such non-crosslinking substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2′, 4′, and / or 5′ positions. In certain embodiments, one or more non-crosslinking substituents of the acyclic modified sugar moiety are branched. Examples of suitable 2′-substituents for an acyclic modified sugar moiety include 2′-F, 2′-OCH 3 ("OMe" or "O-methyl"), and 2′-O(CH 2 ) 2 OCH 3 ("MOE"), but are not limited thereto. In certain embodiments, the 2′-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF3 , O-C 1 -C 10 alkoxy, O-C 1 -C 10 substituted alkoxy, O-C 1 -C 10 alkyl, O-C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, aralkyl, aralkyl, O-aralkyl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(=O)-N(R m )(R n )(wherein each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10 alkyl), and selected from among the 2'-substituents described in Cook et al., U.S. 6,531,584, Cook et al., U.S. 5,859,221, and Cook et al., U.S. 6,005,087. Specific embodiments of these 2'-substituents further include one or more substituents independently selected from among hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of suitable 4'-substituents for the non-bicyclic modified sugar moiety include alkoxy( For example, those described in Manoharan et al., WO2015 / 106128, including but not limited to methoxy), alkyl, are included. Examples of suitable 5'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety includes two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties and modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836), etc.

[0137] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 ) 3 NH 2 , CH 2 CH=CH 2 , OCH 2 CH=CH 2 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamides (OCH 2 C(=O)-N(R m )(R n )) and includes a sugar moiety containing a non-bridging 2'-substituent selected therefrom, where each R m and R n is independently H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

[0138] In certain embodiments, the acyclic modified nucleoside of a 2'-substituted nucleoside is F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C(=O)-N(H)CH 3 ("NMA") and includes a sugar moiety containing a non-bridging forming 2'-substituent selected from the group consisting of.

[0139] In certain embodiments, the 2'-substituted acyclic modified nucleoside includes a sugar moiety containing a non-bridging forming 2'-substituent selected from F, OCH 3 , and OCH 2 CH 2 OCH 3 .

[0140] Certain modified sugar moieties include substituents that crosslink between two atoms of the furanosyl ring to produce a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a crosslink between the 4'-position and the 2'-position of the furanose ring atoms. Examples of sugar substituents that form a crosslink from such a 4'-position to the 2'-position include 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2'("LNA"), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -O-2'("ENA"), 4'-CH(CH 3)-O-2’(referred to as "constrained ethyl" or "cEt"), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4’-CH(CH 2 OCH 3 )-O-2’(“constrained MOE” or “cMOE”) and its analogs (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022,193), 4’-C(CH 3 )(CH 3 )-O-2’ and its analogs (see, e.g., Seth et al., U.S. 8,278,283), 4’-CH 2 -N(OCH 3 )-2’ and its analogs (see, e.g., Prakash et al., U.S. 8,278,425), 4’-CH 2 -O-N(CH 3 )-2’(see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4’-CH 2 -C(H)(CH 3 )-2’(see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118 - 134), 4’-CH 2 -C(=CH 2 )-2’ and its analogs (see, e.g., Seth et al., U.S. 8,278,426), 4’-C(R a R b )-N(R)-O-2’, 4’-C(R a R b )-O-N(R)-2’, 4’-CH 2 -O-N(R)-2’, as well as 4’-CH 2 -N(R)-O-2’(where each R, R a , and R b is independently H, a protecting group, or C 1 -C 12(which is alkyl) (see, for example, Imanishi et al., U .S. 7,427,672), but is not limited thereto.

[0141] In certain embodiments, such cross-linking from the 4'-position to the 2'-position is independently -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a ) 2 -, -S(=O) x -, and -N(R a )-, and includes 1 to 4 linked groups independently selected from where x is 0, 1, or 2, n is 1, 2, 3, or 4, each R a and R b is independently H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substituted C 5 -C 7alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) 2 -J 1 ), or sulfoxyl (S(=O)-J 1 ), and each J 1 and J 2 is independently H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl, or a protecting group.

[0142] Additional bicyclic sugar moieties are known in the art, for example, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456, Koshkin et al., Tetrahedron, 1998, 54, 3607-3630, Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222, Singh et al., J. Org. Chem., 1998, 63, 10035-10039, Srivastava et al., J. Am. Chem. Soc., 20017, 129, 8362-8379, Wengel et a., U.S. 7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S. 6,770,748, Imanishi et al., U.S. RE44,779, Wengel et al., U.S. 6,794,499, Wengel et al., U.S. 6,670,461, Wengel et al., U.S. 7,034,133, Wengel et al., U.S. 8,080,644, Wengel et al., U.S. 8,034,909, Wengel et al., U.S. 8,153,365, Wengel et al., U.S. 7,572,582, and Ramasamy et al., U.S. 6,525,191, Torsten et al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al., WO2007 / 134181, Seth et al., U.S. 7,547,684, Seth et al., U.S. 7,666,854, Seth et al., U.S. 8,088,746, Seth et al., U.S. 7,750,131, Seth et al., U.S. 8,030,467, Seth et al., U.S. 8,268,980, Seth et al., U.S. 8,546,556, Seth et al., U.S. 8,530,640, Migawa et al., U.S. 9,012,421, Seth et al ., U.S. 8,501,805, as well as U.S. Patent Publications Allerson et al., US2008 / 0039618 and Migawa et al., US2015 / 0191727.

[0143] In certain embodiments, the bicyclic sugar moiety and the nucleosides in which such bicyclic sugar moieties are incorporated are further defined by the stereoconfiguration. For example, LNA nucleosides (described herein) may be in the α-L configuration or the β-D configuration.

[0144]

Chemical formula

[0145] α-L-methyleneoxy (4'-CH 2-O-2’) or α-L-LNA bicyclic nucleosides have been incorporated into antisense-active oligonucleotides (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). As used herein, the general description of bicyclic nucleosides includes both enantiomeric configurations. Where the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0146] In certain embodiments, the modified sugar moiety includes one or more non-bridge-forming sugar substituents and one or more bridge-forming sugar substituents (e.g., 5'-substituted sugars and 4'-2' bridged sugars).

[0147] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atoms of the sugar moiety are replaced with, for example, sulfur, carbon, or nitrogen atoms. In certain such embodiments, such modified sugar moieties also include bridge-forming substituents and / or non-bridge-forming substituents described herein. For example, certain sugar surrogates include a 4'-sulfur atom as well as substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and / or substitution at the 5'-position.

[0148] In certain embodiments, the sugar surrogate includes a ring having other than 5 atoms. For example, in certain embodiments, the sugar surrogate includes a 6-membered tetrahydropyran ("THP"). Such tetrahydropyran may be further modified or substituted. Nucleosides containing such modified tetrahydropyran include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, C.J. Bioorg. & Med.Chem. 2002, 10, 841-854), fluoro HNA:

[0149]

Chemical formula

[0150] ((“F-HNA”, see, for example, Swayze et al., U.S. 8,088,904, Swayze et al., U.S. 8,440,803, Swayze et al., U.S. 8,796,437, and Swayze et al., U.S. 9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and the formula

[0151] [Chemical Formula]

[0152] [wherein, independently for each of the modified THP nucleosides, Bx is a nucleobase moiety, T 3 and T 4 are each independently a internucleoside linker that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T 3 and T 4 is a internucleoside linker that links the modified THP nucleoside to the remainder of the oligonucleotide, and one of T 3 and T 4 is H, a hydroxyl protecting group, a linked moiety, or a 5'-terminal group or 3'-terminal group, q 1 q 2 q 3 q 4 q 5 q 6 and q 7 are each independently H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, or substituted C2 -C 6 is alkynyl, R 1 and R 2 each is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 、SJ 1 、N 3 、OC(=X)J 1 、OC(=X)NJ 1 J 2 、NJ 3 C(=X)NJ 1 J 2 、and CN, where X is O, S or NJ 1 and each J 1 、J 2 、and J 3 is independently H or C 1 -C 6 alkyl.] Nucleosides containing additional modified THP compounds having

[0153] In certain embodiments, q 1 、q 2 、q 3 、q 4 、q 5 、q 6 and q 7 are each H, providing modified THP nucleosides. In certain embodiments, q 1 、q 2 、q 3 、q 4 、q 5 、q 6 and q 7 at least one of is other than H. In certain embodiments, q 1 、q 2 、q 3 、q 4 、q 5 、q 6 and q 7 at least one of is methyl. In certain embodiments, R 1 and R 2 provide modified THP nucleosides where one of is F. In certain embodiments, R1 is F, R 2 is H, and in certain embodiments, R 1 is methoxy, R 2 is H, and in certain embodiments, R 1 is methoxyethoxy, R 2 is H.

[0154] In certain embodiments, the sugar substitute comprises a ring having five or more atoms and two or more heteroatoms. For example, the use of nucleosides containing a morpholino sugar moiety and oligonucleotides of such nucleosides has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503 - 4510 and Summerton et al., U.S. 5,698,685, Summerton et al., U.S. 5,166,315, Summerton et al., U.S. 5,185,444, and Summerton et al., U.S. 5,034,506). As used herein, the term "morpholino" refers to the following structure

[0155]

Chemical formula

[0156] and means a sugar substitute having the same. In certain embodiments, for example, morpholino may be modified by addition of various substituents or modification of various substituents from the above morpholino structure. Such sugar substitutes are referred to herein as "modified morpholino".

[0157] In certain embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853 - 5865), and Manoharan et including, but not limited to, the nucleosides and oligonucleotides described in al., WO2011 / 133876.

[0158] Many other bicyclic and tricyclic sugars and sugar substitute ring systems are known in the art and can be used in modified nucleosides.

[0159] 2. Specific Modified Nucleobases In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides called abasic nucleosides that do not contain a nucleobase.

[0160] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl-substituted pyrimidines or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2-substituted purines, N-6-substituted purines and O-6-substituted purines. In certain embodiments, the modified nucleobase is 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH 3 ) uracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azathymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methyl Selected from guanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl-4-N-benzoylcytosine, 5-methyl-4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which a purine or pyrimidine base is replaced by another heterocycle such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Antisense Drug Technology, Chapters 6 and 15, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0161] Publications teaching the preparation of some of the above-described modified nucleobases and other modified nucleobases include Manohara et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., U.S.4,845,205, Spielvogel et al., U.S.5,130,302, Rogers et al., U.S.5,134,066, Bischofberger et al., U.S.5,175,273, Urdea et al., U.S.5,367,066, Benner et al., U.S.5,432,272, Matteucci et al., U.S.5,434,257, Gmeiner et al., U.S.5,457,187, Cook et al., U.S.5,459,255, Froehler et al., U.S.5,484,908, Matteucci et al., U.S.5,502,177, Hawkins et al., U.S.5,525,711, Haralambidis et al., U.S.5,552,540, Cook et al., U.S.5,587,469, Froehler et al., U.S.5,594,121, Switzer et al., U.S.5,596,091, Cook et al., U.S.5,614,617, Froehler et al., U.S.5,645,985, Cook et al., U.S.5,681,941, Cook et al., U.S.5,811,534, Cook et al., U.S.5,750,692, Cook et al., U.S.5,948,903, Cook et al., U.S.5,587,470, Cook et al., U.S.5,457,191, Matteucci et al., U.S.5,763,588, Froehler et al., U.S.5,830,653, Cook et al., U.S.5,808,027, Cook et al., 6,166,199, and Matteucci et al., U.S.6,005,096, but are not limited thereto.

[0162] 3. Specific Modified Nucleoside Linkages In certain embodiments, any internucleoside linkage may be used to link the nucleosides of a modified oligonucleotide together. The two main types of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphates containing phosphorothioate ("P=S") and phosphorodithioate ("HS-P=S"), but are not limited thereto. Representative phosphorus-free internucleoside linking groups include methylene methylimino (-CH 2 -N(CH 3 )-O-CH 2 -), thiodiester, thiocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH 2 -O-); and N,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 )-), but are not limited thereto. Modified internucleoside linkages can typically be used to modify, and typically enhance, the nuclease resistance of oligonucleotides compared to naturally occurring phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free internucleoside linkages are well known to those of skill in the art.

[0163] Representative internucleoside linkages having chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages, or as a population of modified oligonucleotides containing phosphorothioate linkages having a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, where all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be made using synthetic methods in which the stereochemical configuration of each phosphorothioate bond is randomly selected. Nevertheless, as will be well understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specifically selected stereochemical configuration. In certain embodiments, a specific phosphorothioate bond in a specific configuration is present in at least 65% of the molecules in the population. In certain embodiments, a specific phosphorothioate bond in a specific configuration is present in at least 70% of the molecules in the population. In certain embodiments, a specific phosphorothioate bond in a specific configuration is present in at least 80% of the molecules in the population. In certain embodiments, a specific phosphorothioate bond in a specific configuration is present in at least 90% of the molecules in the population. In certain embodiments, a specific phosphorothioate bond in a specific configuration is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be made using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) phosphorothioates and / or (Sp) phosphorothioates each have the following formula.

[0164]

Chemical formula

[0165] including one or more of, where "B" represents a nucleobase. Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or in a specific stereochemical configuration.

[0166] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH 2 -N(CH 3 )-O-5'), amide-3 (3'-CH 2 -C(=O)-N(H)-5'), amide-4 (3'-CH 2 -N(H)-C(=O)-5'), formacetal (3'-O-CH 2 -O-5'), methoxypropyl, and thioformacetal (3'-S-CH 2 -O-5'). Further neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylic acid esters, carboxamides, sulfides, sulfonic acid esters, and amides (e.g., Carbohydrate Modifications in Antisense Research; Y.S.Sanghvi and P.D.Cook, Eds., ACS Symposium Series 580; see Chapters 3 and 4, 40 - 65). Further neutral internucleoside linkages include nonionic linkages containing a mixture of N, O, S, and CH 2 constituent moieties.

[0167] B. Specific Motifs In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, a modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of the sugar moiety, nucleobase, and internucleoside linkage are each independent of one another. Accordingly, a modified oligonucleotide can be represented by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, a nucleobase motif represents a modification to a nucleobase independent of the sequence of nucleobases).

[0168] 1. Specific Sugar Motifs In certain embodiments, an oligonucleotide comprises one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif. In certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0169] In certain embodiments, the modified oligonucleotide has a region with a gapmer motif Comprising or consisting of, the gap motif is defined by two outer regions, namely "wings", and a central region, namely an inner region, namely a "gap". Such three regions of the gap motif (5'-wing, gap, and 3'-wing) form a continuous nucleoside sequence, where at least some of the sugar moieties of the nucleosides in each wing are different from at least some of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar moieties of the nucleosides closest to the gap in each wing (the most 3'-terminal nucleoside of the 5'-wing and the most 5'-terminal nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides in which a sugar moiety is different from the sugar moieties of one or more other nucleosides of that gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0170] In certain embodiments, both wings of the gapmer contain 1 to 5 nucleosides. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of the gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of the gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of the gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of the gapmer are modified nucleosides.

[0171] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gap of the gapmer is an unmodified 2'-deoxynucleoside.

[0172] In certain embodiments, the gapmer is a deoxy gapmer. In embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides, and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside.

[0173] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, which is referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniform modification comprises the same 2'-modification.

[0174] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer can be described using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. Where a particular modification follows such terminology, the modification is a modification at each sugar moiety of each wing, and the gap nucleosides comprise unmodified deoxynucleoside sugars. Thus The 5-10-5 MOE gapmer consists of five linked MOE-modified nucleosides in the 5'-wing, ten linked deoxynucleosides in the gap, and five linked MOE nucleosides in the 3'-wing.

[0175] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.

[0176] 2. Specific nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, no nucleobase is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0177] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3’ end of the oligonucleotide. In certain embodiments, the block is within the 3 nucleosides at the 3’ end of the oligonucleotide. In certain embodiments, the block is at the 5’ end of the oligonucleotide. In certain embodiments, the block is within the 3 nucleosides at the 5’ end of the oligonucleotide.

[0178] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0179] 3. Specific internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified internucleoside linkages and / or unmodified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all of the internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages of the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the internucleoside linkages at the terminus are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein such at least one phosphodiester linkage is not a terminal internucleoside linkage and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, none of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages of both wings are (Sp) phosphorothioate and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched in modified oligonucleotides that comprise such an internucleoside linkage motif.

[0180] C. Specific length It is possible to increase or decrease the length without losing the activity of the oligonucleotide. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides 13 to 25 nucleobases in length for their ability to induce cleavage of target RNA in an oocyte injection model. A 25-nucleobase oligonucleotide with 8 or 11 mismatched bases near the ends of the oligonucleotide was able to direct specific cleavage of the target mRNA, although to a lesser extent than an oligonucleotide without mismatches. Similarly, target-specific cleavage was achieved using 13-nucleobase oligonucleotides such as those with 1 or 3 mismatches.

[0181] In certain embodiments, the oligonucleotides (including modified oligonucleotides) can have any length within a wide range. In certain embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X ≦ Y.For example, in certain embodiments, the oligonucleotide is 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, 29-30. It consists of linked nucleosides of 1 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30.

[0182] D. Specific modified oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modification motif and full length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise specified, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of the sugar modification. For example, the internucleoside linkages within the wing region of a sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independently of the sugar gapmer pattern of modification. Unless otherwise specified, all modifications are independent of the nucleobase sequence.

[0183] E. Specific populations of modified oligonucleotides A population of modified oligonucleotides in which all of the modified oligonucleotides have the same molecular formula can be a stereorandom population or a population rich in chirality. In a stereorandom population, all chiral centers of all modified oligonucleotides are stereorandom. In a population rich in chirality, at least one specific chiral center in the modified oligonucleotides of that population is not stereorandom. In certain embodiments, the modified oligonucleotides of a population rich in chirality are rich in β-D-ribosyl sugar moieties, and all phosphorothioate internucleotide linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a population rich in chirality are rich in both β-D-ribosyl sugar moieties and at least one specific phosphorothioate internucleotide linkage in a specific stereochemical configuration.

[0184] F. Nucleic Acid Base Sequences In certain embodiments, an oligonucleotide (unmodified or modified) is specified by its nucleic acid base sequence. In certain embodiments, the oligonucleotide has a nucleic acid base sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of the oligonucleotide has a nucleic acid base sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleic acid base sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0185] II. Specific Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of oligonucleotides (modified or unmodified) and optionally one or more linking groups and / or terminal groups. A linking group consists of one or more linking moieties and a linking linker that links such a linking moiety to an oligonucleotide. A linking group may be attached to either one or both ends and / or any position internal to an oligonucleotide. In certain embodiments, a linking group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a linking group attached to either one or both ends of an oligonucleotide is a terminal group. In certain such embodiments, a linking group or terminal group is attached to the 3'-end and / or 5'-end of an oligonucleotide. In certain such embodiments, a linking group (or terminal group) is attached to the 3'-end of an oligonucleotide. In certain embodiments, a linking group is attached near the 3'-end of an oligonucleotide. In certain embodiments, a linking group (or terminal group) is attached to the 5'-end of an oligonucleotide. In certain embodiments, a linking group is attached near the 5'-end of an oligonucleotide. Examples of terminal groups include, but are not limited to, linking groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides independently modified or unmodified.

[0186]

[0187] A. Certain Linking Groups In certain embodiments, the oligonucleotide is covalently attached to one or more linking groups. In certain embodiments, the linking group modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, intracellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the linking group imparts new properties to the attached oligonucleotide, such as a fluorophore or reporter group that enables detection of the oligonucleotide. Specific linking groups and linkages have been described previously, for example, cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309, Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocolesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol residue or undecyl residue (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118, Kabanov et al., FEBS Lett., 1990, 259, 327-330, Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651 - 3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777 - 3783), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969 - 973), or palmitoyl portions of adamantaneacetic acid (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229 - 237), octadecylamine portions or hexylamino-carbonyl-oxy cholesterol portions (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923 - 937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734 - 740), or GalNAc clusters (e.g., WO2014 / 179620), etc.

[0188] 1. Linking moiety The linking moiety includes, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocolesterol, cholate moieties, folates, lipids, phospholipids, biotin, phenazines, phenanthridines, anthraquinones, adamantanes, acridines, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0189] In certain embodiments, the linking moiety comprises an active drug substance such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic drug, antibacterial drug or antibiotic, etc.

[0190] 2. Linking linker The linking moiety is attached to the oligonucleotide via a linking linker. In certain oligomeric compounds, the linking linker is a single chemical bond (i.e., the linking moiety is directly attached to the oligonucleotide via a single bond). In certain embodiments, the linking linker comprises a chain structure such as a hydrocarbyl chain or an oligomer made up of repeating units such as ethylene glycol units, nucleoside units, or amino acid units.

[0191] In certain embodiments, the linking linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the linking linker comprises a group selected from an alkyl group, an amino group, an oxo group, an amide group, and an ether group. In certain embodiments, the linking linker comprises a group selected from an alkyl group and an amide group. In certain embodiments, the linking linker comprises a group selected from an alkyl group and an ether group. In certain embodiments, the linking linker comprises at least one phosphorus moiety. In certain embodiments, the linking linker comprises at least one phosphate group. In certain embodiments, the linking linker contains at least one neutral linking group.

[0192] In certain embodiments, the linking linker is a bifunctional linking moiety including the above linking linker, for example, a linking group useful for attaching to a parent compound such as an oligonucleotide provided herein, which is known in the art. Generally, a bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to bind to a specific site of the parent compound, and the other is selected to bind to the linking group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic reagents for reaction with nucleophilic groups and nucleophilic reagents for reaction with electrophilic groups. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0193] Examples of linking linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), N-(4-(maleimidomethyl)cyclohexane-1-carboxy)sulfosuccinimide (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other linking linkers include substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl, or substituted or unsubstituted C 2 -C 10 alkynyl, including, but not limited to, a non-limiting list of preferred substituents including hydroxyl group, amino group, alkoxy group, carbox yl group, benzyl group, phenyl group, nitro group, thiol group, thioalkoxy group, halogen group, alkyl group, aryl group, alkenyl group, and alkynyl group.

[0194] In certain embodiments, the linking linker comprises from 1 to 10 linker nucleosides. In certain embodiments, the linking linker comprises from 2 to 5 linker nucleosides. In certain embodiments, the linking linker comprises exactly 3 linker nucleosides. In certain embodiments, the linking linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise a heterocyclic base selected from optionally protected purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoyl cytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyl adenine, guanine and 2-N-isobutyryl guanine. Typically, it is desirable for the linker nucleosides to be cleaved from the oligomeric compound after the oligomeric compound has reached the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0195] In this specification, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide composed of a specific number or a specific range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and such an oligomeric compound also comprises a linking group that includes a linker nucleoside, those linker nucleosides are not added to the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a linking group that includes 1 to 10 linker nucleosides adjacent to the nucleosides of such modified oligonucleotide. The total number of consecutive linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and having no linking group. The total number of consecutive linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, the linking linker includes 10 or fewer linker nucleosides. In certain embodiments, the linking linker includes 5 or fewer linker nucleosides. In certain embodiments, the linking linker includes 3 or fewer linker nucleosides. In certain embodiments, the linking linker includes 2 or fewer linker nucleosides. In certain embodiments, the linking linker includes 1 or fewer linker nucleosides.

[0196] In certain embodiments, it is desirable for the linking group to be cleaved from the oligonucleotide. For example, in certain situations, an oligomeric compound containing a particular linking moiety is better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable for the linking group to be cleaved to release the unbound oligonucleotide or the parent oligonucleotide. Thus, a particular linking linker may include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms having one, two, three, four, or five or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or inside an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0197] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both of the esters of phosphodiester. In certain embodiments, the cleavable moiety includes a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the linking moiety or linking group.

[0198] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked via a cleavable bond to each other and / or to the remainder of the oligomeric compound. In certain embodiments, such a cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to a nucleoside at the 3' or 5' terminus of the oligonucleotide by a phosphonucleoside internucleoside bond and is covalently linked to the remainder of the linking linker or moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0199] B. Specific terminal groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphanates including 5'-vinylphosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleoside is an abasic nucleoside.

[0200] III. Oligomeric duplex In certain embodiments, the oligomeric compounds described herein include oligonucleotides and have nucleobase sequences complementary to the nucleobase sequences of a target nucleic acid. In certain embodiments, the oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex includes a first oligomeric compound having a region complementary to the target nucleic acid and a second oligomeric compound having a region complementary to such first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and an optional linking group, and (2) a second modified or unmodified oligonucleotide and an optional linking group. One or both of the oligomeric compounds of the oligomeric duplex may include a linking group. The oligonucleotides of each oligomeric compound of the oligomeric duplex may include non-complementary overhanging nucleosides.

[0201] IV. Antisense Activity In certain embodiments, the oligomeric compound and the oligomeric duplex can hybridize to a target nucleic acid to provide at least one antisense activity, and such oligomeric compound and oligomeric duplex are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces or inhibits the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, the antisense compound selectively affects one or more target nucleic acids. Such an antisense compound hybridizes to one or more target nucleic acids to provide one or more desired antisense activities and includes a nucleobase sequence that does not hybridize to one or more non-target nucleic acids or that hybridizes to one or more non-target nucleic acids such that it does not provide a substantial undesired antisense activity.

[0202] In certain antisense activity, hybridization of an antisense compound with a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, a particular antisense compound results in cleavage of the target nucleic acid through the mediation of RNase H. RNase H is an intracellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides are tolerated in the gap of a gapmer.

[0203] In certain antisense activity, an antisense compound or a portion of the antisense compound is incorporated into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, a particular antisense compound results in cleavage of the target nucleic acid by argonaute. The antisense compound incorporated into RISC is an RNAi compound. The RNAi compound may be double-stranded (siRNA) or single-stranded (ssRNA).

[0204] In certain embodiments, hybridization of an antisense compound with a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in modification of the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid inhibits the binding interaction between the target nucleic acid and a protein or another nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in modification of the translation of the target nucleic acid.

[0205] Antisense activity can be observed directly or indirectly. In certain embodiments, for the observation or detection of antisense activity, an observation or detection is made regarding a change in the amount of the target nucleic acid or the protein encoded by such target nucleic acid, a change in the ratio of nucleic acid or protein splice variants, and / or a change in phenotype in a cell or animal.

[0206] V. Specific target nucleic acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, such as intron regions, exon regions, and untranslated regions. In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain such embodiments, the target region is the entire intron. In certain embodiments, the target region extends to the intron / exon junction. In certain embodiments, the target region is at least 50% within the intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrotransposon. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, intron RNA molecules.

[0207] A. Complementarity / mismatch to the target nucleic acid It is possible to introduce mismatched bases without abolishing the activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) reported that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was effective in vitro and in It has been demonstrated that Vivo has the ability to suppress the expression of both bcl-2 and bcl-xL. Furthermore, this oligonucleotide showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16: 3341-3358, 1988) tested a series of tandem 14-nucleotide oligonucleotides, as well as 28-nucleotide oligonucleotides and 42-nucleotide oligonucleotides composed of two or three of such tandem oligonucleotides each, in a rabbit reticulocyte assay for their ability to stop the translation of human DHFR. Each of the three 14-nucleotide oligonucleotides alone was able to inhibit translation, although at a lower level than the 28-nucleotide oligonucleotide or the 42-nucleotide oligonucleotide.

[0208] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and includes a region that is 100% or perfectly complementary to the target nucleic acid. In certain embodiments, the perfectly complementary region is 6-20, 10-18, or 18-20 nucleotides in length.

[0209] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases to the target nucleic acid. In certain embodiments, such mismatches reduce the antisense activity against the target, but the activity against non-targets is greatly suppressed. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3' end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5' end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3' end of the wing region.

[0210] B.SNCA In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid, wherein the target nucleic acid is SNCA. In certain embodiments, the SNCA nucleic acid has the sequences set forth in SEQ ID NO: 1 (GENBANK accession number: NM_000345.3), SEQ ID NO: 2 (GENBANK accession number: NT_016354.20, excision (TRUNC) 30800000-30919000), SEQ ID NO: 3 (GENBANK accession number: JN709863.1), SEQ ID NO: 4 (GENBANK accession number: BC013293.2), SEQ ID NO: 5 (GENBANK accession number: NM_001146055.1), and SEQ ID NO: 6 (GENBANK accession number: HQ830269.1).

[0211] In certain embodiments, SNCA is achieved by contacting cells with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 The amount of mRNA decreases, and in certain embodiments, the amount of alpha-synuclein protein decreases. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting cells in an animal with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 improves one or more symptoms or characteristics of a neurodegenerative disease. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the symptoms or characteristics are motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, decline in cognitive function, and dementia. In certain embodiments, contacting cells in an animal with an oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 results in improvement of motor function, reduction of alpha-synuclein aggregates, suppression of neurodegeneration, and / or suppression of dementia. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.

[0212] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically suitable tissue. In certain embodiments, the pharmacologically suitable tissues are cells and tissues including the central nervous system (CNS). Such cells and tissues include the motor cortex, prefrontal cortex, caudate nucleus, amygdala, pons, substantia nigra, putamen, cerebral peduncle, corpus callosum, dorsal cochlear nucleus (DCN), entorhinal Cortex, hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculus, and basal forebrain nucleus.

[0213] VI. Specific pharmaceutical compositions In certain embodiments, described herein is a pharmaceutical composition comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0214] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0215] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more additives. In certain embodiments, the additives are selected from water, saline solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0216] In certain embodiments, the oligomeric compounds may be mixed with pharmacologically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions vary depending on a number of criteria, including but not limited to the route of administration, the extent of the disease, or the dosage to be administered.

[0217] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmacologically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds, including one or more oligonucleotides, can provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to an animal, such as a human. Thus, for example, the present disclosure also provides pharmacologically acceptable salts of oligomeric compounds, prodrugs, and derivatives of such prodrugs. The present invention also relates to pharmacologically acceptable salts and other bioequivalents of the prodrug. Suitable pharmacologically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more linking groups attached to the oligonucleotide, where the linking groups are cleaved by endogenous nucleases in the body.

[0218] Lipid moieties are used in various ways in nucleic acid medicine. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made of a mixture of cationic and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceutical agents to certain cells or tissues. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0219] In certain embodiments, the pharmaceutical composition includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful in the preparation of certain pharmaceutical compositions, such as pharmaceutical compositions containing hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethyl sulfoxide are used.

[0220] In certain embodiments, the pharmaceutical composition includes one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition includes liposomes coated with tissue-specific antibodies.

[0221] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Some such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is an absolute ethanol solution containing 3 w / v% benzyl alcohol, 8 w / v% of the non-polar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300. The proportions of such co-solvent systems can vary quite widely without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can vary, for example, other surfactants may be used instead of Polysorbate 80™, the fractional amount of polyethylene glycol may vary, polyethylene glycol may be replaced with other biocompatible polymers such as polyvinylpyrrolidone, and other sugars or polysaccharides may be used in place of dextrose.

[0222] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In some of such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution such as water or a physiologically compatible buffer, e.g., Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or act as preservatives). In certain embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Certain pharmaceutical compositions for injection are presented in unit dosage forms, e.g., ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions dissolved in an oily or aqueous vehicle and may contain formulatory agents such as suspending agents, stabilizers and / or dispersing agents. Specific solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents, and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes. An aqueous suspension injection solution may be included.

[0223] VII. Specific Compositions 1. Compound No. 763085 In certain embodiments, Compound 763085 is characterized as a 5-10-5 MOE gapmer having the sequence (in the 5' to 3' direction) CAGACTGTAATCTAGGACCC (incorporated herein as SEQ ID NO: 1887), where each of nucleotides 1-5 and 16-20 (in the 5' to 3' direction) contains a 2'-MOE modification, each of nucleotides 6-15 is a 2'-deoxynucleotide, where the internucleoside linkages between nucleotides 2-3, 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleotides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, where each cytosine is 5-methylcytosine.

[0224] In certain embodiments, Compound 763085 has the following chemical notation: mCes Aeo Geo Aeo mCes Tds Gds Tds Ads Ads Tds mCds Tds Ads Gds Geo Aeo mCes mCes mCe, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage is.

[0225] In certain embodiments, Compound 763085 is represented by the following chemical structure.

[0226]

Chemical Structure

[0227] 2. Compound No. 763364 In certain embodiments, Compound No. 763364 is characterized as a 5-10-5 MOE gapmer having the sequence ACGACATTTTCTTGCCTCTT (incorporated herein as SEQ ID NO: 2166) (in the 5' to 3' direction), where each of nucleotides 1-5 and 16-20 (in the 5' to 3' direction) contains a 2'-MOE modification, each of nucleotides 6-15 is a 2'-deoxynucleotide, where the internucleotide linkages between nucleotides 2-3, 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleotide linkages, and the internucleotide linkages between nucleotides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleotide linkages, where each cytosine is 5-methylcytosine.

[0228] In certain embodiments, Compound No. 763364 has the following chemical notation: Aes mCeo Geo Aeo mCes Ads Tds Tds Tds Tds mCds Tds Tds Gds mCds mCeo Teo mCes Tes Te, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleotide linkage, and o = phosphodiester internucleotide linkage is.

[0229] In certain embodiments, Compound No. 763364 is represented by the following chemical structure.

[0230] [Chem.]

[0231] 3. Compound No. 763391 In certain embodiments, Compound No. 763391 is characterized as a 5-10-5 MOE gapmer having the sequence GTTTTCATCAATATCTGCAA (incorporated herein as SEQ ID NO: 2193) (in the 5’ to 3’ direction), where each of nucleotides 1-5 and 16-20 (in the 5’ to 3’ direction) includes a 2’-MOE modification, each of nucleotides 6-15 is a 2’-deoxynucleotide, where the internucleotide linkages between nucleotides 2-3, 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleotide linkages, and the internucleotide linkages between nucleotides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleotide linkages, where each cytosine is 5-methylcytosine.

[0232] In certain embodiments, Compound No. 763391 is characterized by the following chemical notation: Ges Teo Teo Teo Tes mCds Ads Tds mCds Ads Ads Td s Ads Tds mCds Teo Geo mCes Aes Ae, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2’-MOE modified sugar, d = 2’-deoxyribose sugar, s = phosphorothioate internucleotide linkage, and o = phosphodiester internucleotide linkage is.

[0233] In certain embodiments, Compound 763391 is represented by the following chemical structure.

[0234] [Chemical Formula]

[0235] 4. Compound 789243 In certain embodiments, Compound 789243 is characterized as a 5-10-5 MOE gapmer having the sequence TGAATTCCTTTACACCACAC (incorporated herein as SEQ ID NO: 1639) in the 5' to 3' direction, where each of nucleotides 1-5 and 16-20 (in the 5' to 3' direction) includes a 2'-MOE modification, each of nucleotides 6-15 is a 2'-deoxynucleotide, where the internucleotide linkages between nucleotides 2-3 and 17-18 are phosphodiester internucleotide linkages, and the internucleotide linkages between nucleotides 1-2, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13- 14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleotide linkages, where each cytosine is 5-methylcytosine.

[0236] In certain embodiments, Compound 789243 is characterized by the following chemical notation: Tes Geo Aes Aes Tes Tds mCds mCds Tds Tds Tds Ads mCds Ads mCds mCes Aeo mCes Aes mCe, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleotide linkage, and o = Phosphodiester nucleoside internucleoside linkage is as follows.

[0237] In certain embodiments, Compound No. 789243 is represented by the following chemical structure.

[0238] [Chemical Formula]

[0239] 5. Compound No. 827599 In certain embodiments, Compound No. 827599 is characterized as a 5-10-5 MOE gapmer having the sequence ACAGAT ATTTTTGTTCTGCC (incorporated herein as SEQ ID NO: 1703), where each of nucleotides 1-5 and 16-20 (in the 5' to 3' direction) contains a 2'-MOE modification, each of nucleotides 6-15 is a 2'-deoxynucleotide, where the internucleoside linkages between nucleotides 2-3, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleotides 1-2, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, where each cytosine is 5-methylcytosine.

[0240] In certain embodiments, Compound No. 827599 is characterized by the following chemical notation: Aes mCeo Aes Ges Aes Tds Ads Tds Tds Tds Tds Tds Gds Tds Tds mCeo Teo Ges mCes mCe, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE modified sugar, d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage is.

[0241] In certain embodiments, Compound No. 827599 is represented by the following chemical structure.

[0242]

Chemical formula

[0243] VIII. Specific comparative control compositions In certain embodiments, Compound No. 387978 described in the previous WO2012 / 068405 incorporated herein by reference is a 5-10-5 MOE gapmer having the sequence TCCTTGGCCTTTGAAAGTCC (incorporated herein as SEQ ID NO: 21) (in the 5' to 3' direction), where each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is 5-methylcytosine, and each of nucleosides 1 to 5 and 16 to 20 (in the 5' to 3' direction) contains 2'-MOE modified sugar. This compound is used as a comparative control compound. Compound No. 387978 was selected as a comparative control compound because it was potent in repeated dosing studies of human SNCA mRNA reduction and did not show overt toxicity in various tests described in WO2012 / 068405. Therefore, based on the disclosure of WO2012 / 068405, Compound No. 387978 was considered a potent compound with an acceptable tolerance profile.

[0244] In certain embodiments, compound 387985 described in prior WO2012 / 068405, which is incorporated herein by reference, is a 5-10-5 MOE gapmer having the sequence CCAACATTTGTCACTTGCTC (incorporated herein as SEQ ID NO: 22) (in the 5' to 3' direction), where each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is 5-methylcytosine, and each of nucleotides 1-5 and 16-20 (in the 5' to 3' direction) of the nucleosides contains a 2'-MOE modified sugar, and this compound is used as a comparative control compound. Compound 387985 was potent in repeated dosing studies of human SNCA mRNA reduction and showed no overt toxicity in the various tests described in WO2012 / 068405, and thus this compound was selected as a comparative control compound. Accordingly, based on the disclosure of WO2012 / 068405, compound 387985 was considered a potent compound with an acceptable tolerability profile. Compound 387985 was selected as a comparative control compound.

[0245] In certain embodiments, the compounds described herein are superior to the compounds described in WO2012 / 068405 in that they exhibit one or more improved properties such as potency and tolerability.

[0246] Compound 763085 For example, as described in Example 10 (below), compound 763085 showed an IC of less than 0.44 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM. 50 In the same test, the comparative control compound 387985 showed an IC of 5.00 μM. 50 Thus, in this assay, compound 763085 was clearly more potent than the comparative control compound 387985.

[0247] For example, as described in Example 11 (below), compound 763085 showed an IC of 0.47 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM. 50was shown. In the same test, the comparative control compound 387985 had an IC 50 of 4.20 μM. Therefore, in this assay, compound 763085 was clearly more potent than the comparative control compound 387985.

[0248] For example, as described in Example 17 (below), in wild-type C57 / Bl6 mice, when treated with 700 μg of oligonucleotide by ICV administration, after 3 hours, compound 763085 showed a Functional Observation Battery (FOB) score of 0.8 and 1.3, while the comparative control compound 387985 showed an FOB score of 6.0. Therefore, in this assay, compound 763085 was clearly more tolerable than the comparative control compound 387985.

[0249] Compound 763364 For example, as described in Example 10 (below), compound 763364 had an IC 50 less than 0.44 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM. In the same test, the comparative control compound 387985 had an IC 50 of 5.00 μM. Therefore, in this assay, compound 763364 was clearly more potent than the comparative control compound 387985.

[0250] For example, as described in Example 11 (below), compound 763364 had an IC 50 of 0.86 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM. In the same test, the comparative control compound 387985 had an IC 50 of 4.20 μM. Therefore, in this assay, compound 763364 was clearly more potent than the comparative control compound 387985.

[0251] Compound 763391 For example, as described in Example 10 (below), when compound 763391 was tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM, it showed IC 50 values of 0.94 μM and 2.49 μM in SHSH-SY5Y cells. In the same test, the comparative control compound 387985 showed an IC 50 value of 5.00 μM. Therefore, in this assay, compound 763391 is clearly more potent than the comparative control compound 387985.

[0252] For example, as described in Example 11 (below), when compound 763391 was tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM, it showed an IC 50 value of 1.10 μM in SHSH-SY5Y cells. In the same test, the comparative control compound 387985 showed an IC 50 value of 4.20 μM. Therefore, in this assay, compound 763391 is clearly more potent than the comparative control compound 387985.

[0253] For example, as described in Example 17 (below), in wild-type C57 / Bl6 mice, when treated with 700 μg of oligonucleotide by ICV administration, after 3 hours, compound 763391 showed FOB scores of 0.0 and 2.3, while the comparative control compound 387985 showed an FOB score of 6.0. Therefore, in this assay, compound 763391 is clearly more tolerable than the comparative control compound 387985.

[0254] For example, as described in Example 18 (below), in Sprague Dawley rats, when treated with 3 mg of oligonucleotide by IT administration, after 3 hours, compound 763391 showed FOB scores of 0.0 and 1.3, while the comparative control compound 387985 showed an FOB score of 3.8. Therefore, in this assay, compound 763391 is clearly more tolerable than the comparative control compound 387985.

[0255] Compound 789243 For example, as described in Example 10 (below), compound 789243 showed an IC 50 of 2.40 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM. In the same test, comparative control compound 387985 showed an IC 50 of 5.00 μM. Therefore, in this assay, compound 789243 is clearly more potent than comparative control compound 387985.

[0256] For example, as described in Example 11 (below), compound 789243 showed IC 50 values of 2.25 μM and 1.90 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM. In the same test, comparative control compound 387985 showed an IC 50 of 4.20 μM. Therefore, in this assay, compound 789243 is clearly more potent than comparative control compound 387985.

[0257] For example, as described in Example 17 (below), in wild-type C57 / Bl6 mice, when treated with 700 μg of oligonucleotide by ICV administration, after 3 hours, compound 789243 showed FOB scores of 0.3 and 0.0, while comparative control compound 387985 showed an FOB score of 6.0. Therefore, in this assay, compound 789243 is clearly more tolerable than comparative control compound 387985.

[0258] For example, as described in Example 18 (below), in Sprague Dawley rats, when treated with 3 mg of oligonucleotide by IT administration, after 3 hours, compound 789243 showed FOB scores of 1.8 and 1.5, while comparative control compound 387985 showed an FOB score of 3.8. Therefore, in this assay, compound 789243 is clearly more tolerable than comparative control compound 387985.

[0259] Compound 827599 For example, as described in Example 10 (below), compound 827599 showed an IC of 0.40 μM in SHSH-SY5Y cells when tested at concentrations of 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM. 50 In the same test, the comparative control compound 387985 showed an IC 50 of 5.00 μM. Therefore, in this assay, compound 827599 is clearly more potent than the comparative control compound 387985.

[0260] For example, as described in Example 11 (below), compound 827599 showed an IC of 0.40 μM in SHSH-SY5Y cells when tested at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM. 50 In the same test the comparative control compound 387985 showed an IC of 4.20 μM. 50 Therefore, in this assay, compound 827599 is clearly more potent than the comparative control compound 387985.

[0261] For example, as described in Example 17 (below), in wild-type C57 / Bl6 mice, when treated with 700 μg of oligonucleotide by ICV administration, after 3 hours, compound 827599 showed a FOB score of 0.0, and the comparative control compound 387985 showed a FOB score of 6.0. Therefore, in this assay, compound 827599 is clearly more tolerable than the comparative control compound 387985.

[0262] For example, as described in Example 18 (below), in Sprague Dawley rats, when treated with 3 mg of oligonucleotide by IT administration, after 3 hours, compound 827599 showed a FOB score of 2.0, and the comparative control compound 387985 showed a FOB score of 3.8. Therefore, in this assay, compound 827599 is clearly more tolerable than the comparative control compound 387985.

[0263] IX. Specific Hot Spot Regions 1. Nucleobases 50915 - 50943 of SEQ ID NO: 2 In certain embodiments, nucleobases 50915 - 50943 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobases 50915 - 50943 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0264] The nucleobase sequences of SEQ ID NOs: 243, 1601 - 1603, and 2188 - 2197 are complementary to nucleobases 50915 - 50943 of SEQ ID NO: 2.

[0265] In certain embodiments, at least a 45% reduction of SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleobases 50915 - 50943 of SEQ ID NO: 2.

[0266] 2. Nucleobases 19630 - 19656 of SEQ ID NO: 2 In certain embodiments, nucleobases 19630 - 19656 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobases 19630 - 19656 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0267] The nucleobase sequences of SEQ ID NOs: 1103, 1700, 1701, 1702, 1703, 1704, 1705, 1706 and 1707 are complementary to nucleobases 19630 to 19656 of SEQ ID NO: 2.

[0268] In certain embodiments, a modified oligonucleotide complementary to nucleobases 19630 to 19656 of SEQ ID NO: 2 is used to reduce the RNA of SNCA in vitro in a standard cell assay by at least 48%.

[0269] 3. Nucleobases 28451 to 28491 of SEQ ID NO: 2 In certain embodiments, nucleobases 28451 to 28491 of SEQ ID NO: 2 contain a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobases 28451 to 28491 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0270] The nucleobase sequences of SEQ ID NOs: 1168, 1882, 1883, 1884, 1885, 1886, 1887, 1888, 1889, 1890, 1891, 1892 and 1893 are complementary to nucleobases 28451 to 28491 of SEQ ID NO: 2.

[0271] In certain embodiments, a modified oligonucleotide complementary to nucleobases 28451 to 28491 of SEQ ID NO: 2 is used to reduce the RNA of SNCA in vitro in a standard cell assay by at least 47%.

[0272] 4. Nucleobases 48712 to 48760 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 48712 to 48760 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleic acid bases 48712 to 48760 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleic acid bases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0273] The nucleic acid base sequences of SEQ ID NOs: 471, 1585 to 1588, and 2157 to 2166 are complementary to nucleic acid bases 48712 to 48760 of SEQ ID NO: 2.

[0274] In certain embodiments, at least a 40% reduction of SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleic acid bases 48712 to 48760 of SEQ ID NO: 2.

[0275] 5. Nucleic acid bases 23279 to 23315 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 23279 to 23315 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleic acid bases 23279 to 23315 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleic acid bases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0276] The nucleobase sequences of SEQ ID NO: 164, 1130-1133, and 1797-1810 are complementary to nucleobases 23279-23315 of SEQ ID NO: 2.

[0277] In certain embodiments, at least a 57% reduction in SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleobases 23279-23315 of SEQ ID NO: 2.

[0278] 6. Nucleobases 20964-21018 of SEQ ID NO: 2 In certain embodiments, nucleobases 20964-21018 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobases 20964-21018 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate nucleoside linkages and phosphodiester nucleoside linkages.

[0279] The nucleobase sequences of SEQ ID NO: 391, 468, 1112-1116, and 1723-1741 are complementary to nucleobases 20964-21018 of SEQ ID NO: 2.

[0280] In certain embodiments, at least a 42% reduction in SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleobases 20964-21018 of SEQ ID NO: 2.

[0281] 7. Nucleobases 22454-22477 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 22454 to 22477 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleic acid bases 22454 to 22477 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleic acid bases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0282] The nucleic acid base sequences of SEQ ID NOs: 88, 1123 to 1126, and 1778 to 1782 are complementary to nucleic acid bases 22454 to 22477 of SEQ ID NO: 2.

[0283] In certain embodiments, at least a 50% reduction of SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleic acid bases 22454 to 22477 of SEQ ID NO: 2.

[0284] 8. Nucleic acid bases 72294 to 72321 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 72294 to 72321 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleic acid bases 72294 to 72321 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleic acid bases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0285] The nucleobase sequences of SEQ ID NO: 1323 and 2345 - 2353 are complementary to nucleobases 72294 - 72321 of SEQ ID NO: 2.

[0286] In certain embodiments, at least a 58% reduction of SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleobases 72294 - 72321 of SEQ ID NO: 2.

[0287] 9. Nucleobases 20549 - 20581 of SEQ ID NO: 2 In certain embodiments, nucleobases 20549 - 20581 of SEQ ID NO: 2 contain a hot - spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobases 20549 - 20581 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0288] The nucleobase sequences of SEQ ID NO: 314 and 1107 - 1110 are complementary to nucleobases 20549 - 20581 of SEQ ID NO: 2.

[0289] In certain embodiments, at least a 58% reduction of SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleobases 20549 - 20581 of SEQ ID NO: 2.

[0290] 10. Nucleobases 27412 - 27432 of SEQ ID NO: 2 In certain embodiments, nucleic acid bases 27412-27432 of SEQ ID NO: 2 include a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleic acid bases 27412-27432 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 17 or 20 nucleic acid bases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer or a mixed gapmer of cEt and MOE. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0291] The nucleic acid base sequences of SEQ ID NOs: 468, 1113-1114, and 1163 are complementary to nucleic acid bases 27412-27432 of SEQ ID NO: 2.

[0292] In certain embodiments, at least a 62% reduction in SNCA RNA in vitro in a standard cell assay is achieved by a modified oligonucleotide complementary to nucleic acid bases 27412-27432 of SEQ ID NO: 2.

[0293] Non-limiting disclosure and incorporation by reference Each of the documents and patent publications described herein is incorporated by reference in its entirety.

[0294] Although specific compounds, compositions, and methods described herein have been specifically described according to certain embodiments, the following examples are used only to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. described in this application is incorporated herein by reference in its entirety.

[0295] In the sequence listing attached to this application, each sequence is identified as either "RNA" or "DNA" as needed, but in reality, their sequences are modified by arbitrarily combining chemical modifications. This may be done. Those skilled in the art will readily understand that it is optional in some cases to so specify as “RNA” or “DNA” to represent a modified oligonucleotide. For example, for an oligonucleotide containing a nucleoside with a 2’-OH sugar moiety and a thymine base, it could be represented as DNA with a modified sugar (2’-OH instead of 2’-H of DNA), or as RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those contained in the Sequence Listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to nucleic acids having modified nucleic acid bases. As a further example, without limitation, an oligomeric compound having a nucleic acid base sequence “ATCGATCG” encompasses any oligomeric compound having such a nucleic acid base sequence, whether modified or unmodified, including compounds containing RNA bases such as an RNA base having the sequence “AUCGAUCG” and RNA bases having some DNA bases, such as some RNA bases and “AUCGATCG”, but not limited thereto, and also oligomeric compounds having other modified nucleic acid bases, such as, for example, “AT m CGAUCG”, etc., where m C represents a cytosine base containing a methyl group at the 5-position.

[0296] The specific compounds described herein (e.g., modified oligonucleotides) have one or more chiral centers, giving rise to enantiomers, diastereomers, and other stereoisomeric configurations, which can be defined in terms of absolute stereochemistry as (R) or (S), α or β as in the case of sugar anomers, or (D) or (L) as in the case of amino acids, etc. Compounds provided herein that are depicted or described as having a specific stereoisomeric configuration include only the indicated compounds. Compounds provided herein that are depicted or described without defining stereochemistry include all possible isomers, including, unless otherwise specified, their stereorandom and optically pure forms. Similarly, tautomers of the compounds of this specification are also included, unless otherwise specified. Unless otherwise specified, compounds described herein are intended to include the corresponding salt forms.

[0297] Compounds described herein include modifications in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein that contain a hydrogen atom 1 encompass every possible deuterium substitution for each of the H hydrogen atoms. Isotope substitutions encompassed by the compounds herein 1 include replacing 2 H with 3 H or 12 replacing 13 C with 14 C or 14 replacing 15 N with 16 replacing 17 O with 18 O or 32 replacing 33 S with 34 S, 35 S, or 36Substitutions including, but not limited to, S may be included. In certain embodiments, non-radioactive isotope substitutions can confer new properties beneficial for use as therapeutic or research means to oligomeric compounds. In certain embodiments, radioactive isotope substitutions render the compounds suitable for research purposes or diagnostic purposes such as imaging.

Examples

[0298] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Further, where specific embodiments are described, the inventors intend the general applicability of those specific embodiments. For example, the disclosure of an oligonucleotide having a particular motif provides a reasonable basis for further oligonucleotides having the same or similar motifs. Also, for example, where a particular high-affinity modification occurs at a particular position, other high-affinity modifications at the same position are considered appropriate unless otherwise specified.

[0299] Example 1: MOE and cEt 5-8-4 gapmer with mixed nucleoside linkages In vitro effect (single dose) on human SNCA Modified oligonucleotides complementary to human SNCA nucleic acid were designed and tested for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0300] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using a modified oligonucleotide at a concentration of 7,000 nM or, for the untreated control group, without using a modified oligonucleotide, by electroporation. Approximately 24 hours later, RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The human primer-probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT (referred to herein as SEQ ID NO: 11), reverse sequence GAGCACTTGTACAGGATGGAACAT (referred to herein as SEQ ID NO: 12), probe sequence TGCTCCCAAGTTTCTTGAGATCTGCTGACA (referred to herein as SEQ ID NO: 13)) was used to measure the mRNA level. The mRNA level of SNCA was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the following table as the rate of decrease in the amount of SNCA mRNA compared to untreated control cells (these conditions represent the "standard cell assay"). The modified oligonucleotides marked with an asterisk (*) target the amplicon region of the primer-probe set. Additional test methods may be used to measure the potency and efficacy of the oligonucleotides targeting the amplicon region. Compound 387978, which was previously disclosed in WO2012 / 068405, was also tested and used as a comparative control oligonucleotide. Compound 387978 is a 5-10-5 MOE gapmer in which each internucleoside linkage is a phosphorothioate internucleoside linkage and each cytosine residue is 5-methylcytosine.

[0301] The modified oligonucleotides in Tables 1 to 7 are a mixed 5-8-4 gapmer of MOE and cEt. The gapmer is 17 nucleobases in length, where the central gap segment contains 8 2'-deoxynucleosides, the 5'-terminal wing segment contains 5 2'-MOE nucleosides, and the 3'-terminal wing segment containing 2 cEt nucleosides and 2 2'-MOE nucleosides are adjacent. The sugar motif of the gapmer is (in the 5' to 3' direction) eeeee dddddddd kkee, where "d" represents 2'-deoxyribose sugar, "e" represents 2'-MOE modified sugar, and "k" represents cEt modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosine. The internucleoside linkages are a mixture of phosphodiester linkages and phosphorothioate linkages. The internucleoside linkage motif of the gapmer is (in the 5' to 3' direction) sooosssssssssoss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "start site" indicates the most 5'-terminal nucleoside in the human nucleic acid sequence that the gapmer is complementary to. The "stop site" indicates the most 3'-terminal nucleoside in the human nucleic acid sequence that the gapmer is complementary to.

[0302] Each modified oligonucleotide described in the following table is complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, which is the human SNCA nucleic acid sequence, as shown in the table. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to that particular nucleic acid. The value of 0% decrease indicates that there was no effect of the compound in the cells or that the mRNA concentration increased. As shown below, the modified oligonucleotides complementary to human SNCA decreased the amount of human SNCA mRNA.

[0303]

Table 1-1

[0304]

Table 1-2

[0305]

Table 1-3

[0306]

Table 1-4

[0307]

Table 1-5

[0308]

Table 2-1

[0309]

Table 2-2

[0310]

Table 2-3

[0311]

Table 2-4

[0312]

Table 2-5

[0313]

Table 3-1

[0314]

Table 3-2

[0315]

Table 3-3

[0316]

Table 3-4

[0317]

Table 3-5

[0318]

Table 4-1

[0319]

Table 4-2

[0320]

Table 4-3

[0321]

Table 4-4

[0322]

Table 4-5

[0323]

Table 5-1

[0324]

Table 5-2

[0325]

Table 5-3

[0326]

Table 5-4

[0327]

Table 5-5

[0328]

Table 6-1

[0329]

Table 6-2

[0330]

Table 6-3

[0331]

Table 6-4

[0332]

Table 6-5

[0333]

Table 7-1

[0334]

Table 7-2

[0335] Example 2: In vitro effect (single-dose) of MOE and cEt 4-9-4 gapmer with mixed nucleoside linkages on human SNCA Modified oligonucleotides complementary to human SNCA nucleic acid were designed and tested as described in Example 1 for their in vitro effect on SNCA mRNA. A series of experiments with similar culture conditions were conducted to test the modified oligonucleotides.

[0336] The modified oligonucleotides marked with an asterisk (*) target the amplicon region of the primer-probe set. Additional test methods may be used to measure the potency and efficacy of the oligonucleotides targeting the amplicon region. Compound No. 387978, which was previously disclosed in WO2012 / 068405, was also tested and used as a comparative control oligonucleotide. Compound No. 387978 is a 5-10-5 MOE gapmer in which each internucleoside linkage is a phosphorothioate internucleoside linkage and each cytosine residue is 5-methylcytosine.

[0337] The modified oligonucleotides of Tables 7 to 13 are 4-9-4 gapmers of MOE and cEt. The gapmer is 17 nucleobases in length, where the central gap segment contains 9 2'-deoxynucleosides, and wing segments at both the 5' and 3' termini containing 2 2'-MOE nucleosides and 2 cEt nucleosides are adjacent. The sugar motif of the gapmer is eekkdddddddddkkee (in the 5' to 3' direction), where "d" represents 2'-deoxyribose sugar, "e" represents 2'-MOE modified sugar, and "k" represents cEt modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosine. The internucleoside linkages are a mixture of phosphodiester linkages and phosphorothioate linkages. The internucleoside linkage motif of the gapmer is sooosssssssssoss (in the 5' to 3' direction), where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "start site" indicates the most 5'-terminal nucleoside in the human nucleic acid sequence that is the target of complementarity of the gapmer. The "stop site" indicates the most 3'-terminal nucleoside in the human nucleic acid sequence that is the target of complementarity of the gapmer.

[0338] Each modified oligonucleotide described in the table below is complementary to SEQ ID NO: 1 or SEQ ID NO: 2, which is the human SNCA nucleic acid sequence, as shown in the table. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to that specific nucleic acid. The value of a 0% reduction rate indicates that there was no effect by the compound in the cells or that the mRNA concentration increased. As shown below, the modified oligonucleotides complementary to human SNCA decreased the amount of human SNCA mRNA.

[0339]

Table 8-1

[0340]

Table 8-2

[0341]

Table 8-3

[0342]

Table 8-4

[0343]

Table 9-1

[0344]

Table 9-2

[0345]

Table 9-3

[0346]

Table 9-4

[0347]

Table 10-1

[0348]

Table 10-2

[0349]

Table 10-3

[0350]

Table 10-4

[0351]

Table 11-1

[0352]

Table 11-2

[0353]

Table 11-3

[0354]

Table 11-4

[0355]

Table 12-1

[0356]

Table 12-2

[0357]

Table 12-3

[0358]

Table 12-4

[0359]

Table 12-5

[0360]

Table 13-1

[0361]

Table 13-2

[0362]

Table 13-3

[0363]

Table 13-4

[0364] Example 3: In Vitro Effect of an MOE and cEt 4-9-4 Gapmer with a Mixed Nucleoside Linkage on Human SNCA (Single Dose) Modified oligonucleotides complementary to the human SNCA nucleic acid were designed and tested as described in Example 1 for their in vitro effect on the mRNA of SNCA. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0365] The modified oligonucleotides in Tables 14 to 23 are MOE and cEt 4-9-4 gapmers. The gapmer is 17 nucleobases in length, where the central gap segment is nine It contains 2'-deoxynucleosides, and wing segments at both the 5'-end and 3'-end containing two 2'-MOE nucleosides and two cEt nucleosides are adjacent. The sugar motif of the gapmer is eekkdddddddddkkee (in the 5' to 3' direction), where "d" represents 2'-deoxyribose sugar, "e" represents 2'-MOE modified sugar, and "k" represents cEt modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosine. The internucleoside linkages are a mixture of phosphodiester linkages and phosphorothioate linkages. The internucleoside linkage motif of the gapmer is sooosssssssssoss (in the 5' to 3' direction), where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "starting site" indicates the most 5'-terminal nucleoside in the human nucleic acid sequence that is the target of complementarity of the gapmer. The "termination site" indicates the most 3'-terminal nucleoside in the human nucleic acid sequence that is the target of complementarity of the gapmer.

[0366] Each modified oligonucleotide described in the following table is complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, which is a human SNCA nucleic acid sequence, as shown in the table. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to that specific nucleic acid. The value of a reduction rate of 0% indicates that there was no effect by the compound in the cells or that the mRNA concentration increased. As shown below, the modified oligonucleotides complementary to human SNCA decreased the amount of human SNCA mRNA.

[0367]

Table 14-1

[0368]

Table 14-2

[0369]

Table 14-3

[0370]

Table 14-4

[0371]

Table 15-1

[0372]

Table 15-2

[0373]

Table 15-3

[0374]

Table 15-4

[0375]

Table 16-1

[0376]

Table 16-2

[0377]

Table 16-3

[0378]

Table 16-4

[0379]

Table 16-5

[0380]

Table 16-6

[0381]

Table 17-1

[0382]

Table 17-2

[0383]

Table 17-3

[0384]

Table 17-4

[0385]

Table 17-5

[0386]

Table 17-6

[0387]

Table 17-7

[0388]

Table 18-1

[0389]

Table 18-2

[0390]

Table 18-3

[0391]

Table 18-4

[0392]

Table 19-1

[0393]

Table 19-2

[0394]

Table 19-3

[0395]

Table 19-4

[0396]

Table 19-5

[0397]

Table 19-6

[0398]

Table 20-1

[0399]

Table 20-2

[0400]

Table 20-3

[0401]

Table 20-4

[0402]

Table 21-1

[0403]

Table 21-2

[0404]

Table 21-3

[0405]

Table 21-4

[0406]

Table 21-5

[0407]

Table 22-1

[0408]

Table 22-2

[0409]

Table 22-3

[0410]

Table 22-4

[0411]

Table 23-1

[0412]

Table 23-2

[0413]

Table 23-3

[0414] Example 4: In Vitro Effect of MOE and cEt 5-8-4 Gapmer with Mixed Nucleoside Linkages on Human SNCA (Single Dose) Modified oligonucleotides complementary to human SNCA nucleic acid were designed and their effects on SNCA mRNA in vitro were tested. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0415] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with a modified oligonucleotide at a concentration of 1,000 nM, or without a modified oligonucleotide for the untreated control group. Approximately 24 hours later, RNA was isolated from the cells and, as described in Example 1, the SNCA mRNA level was measured by quantitative real-time PCR using the human primer-probe set RTS2621. The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the following table as the reduction rate of the amount of SNCA mRNA compared to untreated control cells.

[0416] The modified oligonucleotides in Tables 24 to 28 are 4-9-4 gapmers of MOE and cEt. The gapmer is 17 nucleobases in length, where the central gap segment contains 9 2'-deoxynucleosides, and wing segments at both the 5' and 3' ends containing 2 2'-MOE nucleosides and 2 cEt nucleosides are adjacent. The sugar motif of the gapmer is (in the 5' to 3' direction) eekkdddddddddkkee, where "d" represents 2'-deoxyribose sugar, "e" represents 2'-MOE modified sugar, and "k" represents cEt modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosine. The internucleoside linkages are a mixture of phosphodiester linkages and phosphorothioate linkages. The internucleoside linkage motif of the gapmer is (in the 5' to 3' direction) sooosssssssssoss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "start site" indicates the most 5'-end nucleoside in the human nucleic acid sequence that is the target of the complementarity of the gapmer. The "stop site" indicates the most 3'-end nucleoside in the human nucleic acid sequence that is the target of the complementarity of the gapmer. indicates the most 3'-end nucleoside in the human nucleic acid sequence that is the target of the complementarity of the gapmer.

[0417] Each modified oligonucleotide described in the following table is complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, which is a human SNCA nucleic acid sequence, as shown in the table. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to its specific nucleic acid. The value of a reduction rate of 0% indicates that there was no effect of the compound in the cells or that the mRNA concentration increased. As shown below, the modified oligonucleotides complementary to human SNCA decreased the amount of human SNCA mRNA.

[0418]

Table 24-1

[0419]

Table 24-2

[0420]

Table 24-3

[0421]

Table 24-4

[0422]

Table 24-5

[0423]

Table 24-6

[0424]

Table 24-7

[0425]

Table 25-1

[0426]

Table 25-2

[0427]

Table 25-3

[0428]

Table 25-4

[0429]

Table 26-1

[0430]

Table 26-2

[0431]

Table 26-3

[0432]

Table 26-4

[0433]

Table 26-5

[0434]

Table 27-1

[0435]

Table 27-2

[0436]

Table 27-3

[0437]

Table 27-4

[0438]

Table 28-1

[0439]

Table 28-2

[0440]

Table 28-3

[0441]

Table 28-4

[0442]

Table 28-5

[0443]

Table 28-6

[0444] Example 5: In Vitro Effect of a 5-10-5 MOE Gapmer with a Mixed Nucleoside Linkage on Human SNCA (Single Dose) Modified oligonucleotides complementary to human SNCA nucleic acid were designed and tested for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0445] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with a modified oligonucleotide at a concentration of 4,000 nM or without a modified oligonucleotide for the untreated control group. Approximately 24 hours later, RNA was isolated from the cells, and the SNCA mRNA level was measured by quantitative real-time PCR using the human primer-probe set RTS2621 as described in Example 1. The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the following table as the reduction rate of the amount of SNCA mRNA compared to untreated control cells.

[0446] The modified oligonucleotides of Tables 29 - 44 are 5 - 10 - 5 MOE gapmers. The gapmer is 20 nucleobases in length, where the central gap segment contains 10 2'-deoxynucleosides, flanked by 5'- and 3'-wing segments each containing 5 2'-MOE nucleosides. The sugar motif of the gapmer is (in the 5' to 3' direction) eeeee ddddddddddeeeee, where "d" represents 2'-deoxyribose sugar and "e" represents 2'-MOE modified sugar. All cytosine residues throughout each gapmer are 5 - methylcytosine. The internucleoside linkages are a mixture of phosphodiester and phosphorothioate linkages. The internucleoside linkage motif of the gapmer is (in the 5' to 3' direction) sooosssssssssssooss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "start site" indicates the most 5'-end nucleoside in the human nucleic acid sequence that the gapmer is complementary to. The "stop site" indicates the most 3'-end nucleoside in the human nucleic acid sequence that the gapmer is complementary to.

[0447] Each modified oligonucleotide described in the table below is complementary to SEQ ID NO:1 or SEQ ID NO:2, which is the human SNCA nucleic acid sequence, as shown in the table. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to that particular nucleic acid. A value of 0% decrease indicates that there was no effect of the compound in the cells or that the mRNA concentration increased. As shown below, the modified oligonucleotides complementary to human SNCA decreased the amount of human SNCA mRNA.

[0448]

Table 29 - 1

[0449]

Table 29 - 2

[0450]

Table 29-3

[0451]

Table 29-4

[0452]

Table 29-5

[0453]

Table 29-6

[0454]

Table 30-1

[0455]

Table 30-2

[0456]

Table 30-3

[0457]

Table 30-4

[0458]

Table 30-5

[0459]

Table 30-6

[0460]

Table 31-1

[0461]

Table 31-2

[0462]

Table 31-3

[0463]

Table 31-4

[0464]

Table 32-1

[0465]

Table 32-2

[0466]

Table 32-3

[0467]

Table 32-4

[0468]

Table 32-5

[0469]

Table 32-6

[0470]

Table 33-1

[0471]

Table 33-2

[0472]

Table 33-3

[0473]

Table 33-4

[0474]

Table 34-1

[0475]

Table 34-2

[0476]

Table 34-3

[0477]

Table 34-4

[0478]

Table 35-1

[0479]

Table 35-2

[0480]

Table 35-3

[0481]

Table 35-4

[0482]

Table 35-5

[0483]

Table 35-6

[0484]

Table 36-1

[0485]

Table 36-2

[0486]

Table 36-3

[0487]

Table 36-4

[0488]

Table 37-1

[0489]

Table 37-2

[0490]

Table 37-3

[0491]

Table 37-4

[0492]

Table 38-1

[0493]

Table 38-2

[0494]

Table 38-3

[0495]

Table 38-4

[0496]

Table 39-1

[0497]

Table 39-2

[0498]

Table 39-3

[0499]

Table 39-4

[0500]

Table 40-1

[0501]

Table 40-2

[0502]

Table 40-3

[0503]

Table 40-4

[0504]

Table 40-5

[0505]

Table 40-6

[0506]

Table 41-1

[0507]

Table 41-2

[0508]

Table 41-3

[0509]

Table 41-4

[0510]

Table 41-5

[0511]

Table 41-6

[0512]

Table 42-1

[0513]

Table 42-2

[0514]

Table 42-3

[0515]

Table 42-4

[0516]

Table 42-5

[0517]

Table 42-6

[0518]

Table 43-1

[0519]

Table 43-2

[0520]

Table 43-3

[0521]

Table 43-4

[0522]

Table 43-5

[0523]

Table 43-6

[0524]

Table 44

[0525] Example 6: Design of a Human SNCA Complementary Gapmer with Mixed Nucleoside Linkages Modified oligonucleotides complementary to human SNCA nucleic acids were designed. The modified oligonucleotides in Table 45 are gapmers. Gapmers have a central gap segment that contains 2'-deoxynucleosides and is flanked by wing segments at both the 5' and 3' ends that contain 2'-MOE nucleosides and cEt nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosine. The internucleoside linkages are a mixture of phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages. The columns for sequence and chemical notation detail sequences that include 5-methylcytosine, sugar chemistry, and internucleoside linkage chemistry, where the subscript "d" represents 2'-deoxyribose sugar, the subscript "e" represents 2'-MOE modified sugar, the subscript "k" represents cEt modified sugar, the subscript "o" represents phosphodiester internucleoside linkage, the subscript "s" represents phosphorothioate internucleoside linkage, and the superscript "m" before a cytosine residue indicates 5-methylcytosine. "Start site" indicates the most 5' end nucleoside in the human nucleic acid sequence that is the target of complementarity of the gapmer. "Stop site" indicates the most 3' end nucleoside in the human nucleic acid sequence that is the target of complementarity of the gapmer.

[0526] As shown in the table below, each modified oligonucleotide listed is complementary to SEQ ID NO: 2 or SEQ ID NO: 5, which is the human SNCA nucleic acid sequence. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to that particular nucleic acid. In Table 45, the "SEQ ID NO:" column first shows the SEQ ID NO. including the modification, and then shows the SEQ ID NO. of the corresponding nucleobase sequence without the presented modification. For example, in the first column, the "SEQ ID NO:" column shows " m Ces m CeoTeoTeoTdsAds m CdsAds m Cds m CdsAds m CdsAds mIndicate "2805" in the left part of the column for "CkoTesGesGe", and then indicate "1038" in the right part of the column for the nucleic acid base sequence CCTTTACACCACACTGG corresponding thereto.

[0527]

Table 45-1

[0528]

Table 45-2

[0529]

Table 45-3

[0530]

Table 45-4

[0531]

Table 45-5

[0532]

Table 45-6

[0533]

Table 45-7

[0534] Example 7: In vitro effect of modified oligonucleotides against human SNCA (multiple administrations) The modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. The comparative control oligonucleotide 387978 was also tested. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 0.55 μM, 1.67 μM, 5.00 μM, and 15.00 μM using electroporation as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The mRNA level of SNCA was adjusted according to the total R NA content measured by RIBOGREEN®. The results are shown in the table below as the reduction rate of the SNCA mRNA amount compared to the untreated control. A value of 0% reduction rate indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the table below, the mRNA level of SNCA decreased in a dose-dependent manner in the cells treated with the modified oligonucleotides. The IC50 was calculated using the formula "log (inhibitor) vs. response - variable slope (4-parameter)" with Prism6 software.

[0535]

Table 46-1

[0536]

Table 46-2

[0537]

Table 47-1

[0538]

Table 47-2

[0539]

Table 48

[0540]

Table 49-1

[0541]

Table 49-2

[0542] Example 8: In Vitro Effect of Modified Oligonucleotides Against Human SNCA (Multiple Doses) Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 0.48 μM, 1.44 μM, 4.33 μM, and 13.00 μM using electroporation as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The mRNA level of SNCA was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the table below as the reduction rate of the SNCA mRNA amount compared to the untreated control. A value of 0% reduction rate indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the table below, the mRNA level of SNCA decreased in a dose-dependent manner in cells treated with the modified oligonucleotide.

[0543]

Table 50

[0544]

Table 51-1

[0545]

Table 51-2

[0546]

Table 52

[0547]

Table 53

[0548]

Table 54

[0549] Example 9: In Vitro Effect of Modified Oligonucleotides Against Human SNCA (Multiple Doses) Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. Comparative control oligonucleotide 397978 was also tested. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 0.11 μM, 0.33 μM, 1.00 μM, and 3.00 μM using electroporation as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the table below as the percentage decrease in the SNCA mRNA amount compared to the untreated control. A value of 0% decrease indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the table below, the SNCA mRNA level decreased in a dose-dependent manner in cells treated with the modified oligonucleotides.

[0550]

Table 55

[0551]

Table 56

[0552]

Table 57

[0553]

Table 58

[0554] Example 10: In vitro effect of modified oligonucleotides against human SNCA (multiple administrations) Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. Compound 387985, which was disclosed in WO2012 / 068405 previously, was also tested as a comparative control oligonucleotide. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 0.44 μM, 1.33 μM, 4.00 μM, and 12.00 μM using electroporation as specified in the table below. After a treatment period of about 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the table below as the reduction rate of the SNCA mRNA amount compared to the untreated control. A value of 0% reduction rate indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the table below, the SNCA mRNA level decreased in a dose-dependent manner in the cells treated with the modified oligonucleotides.

[0555]

Table 59

[0556]

Table 60

[0557]

Table 61

[0558]

Table 62

[0559]

Table 63

[0560]

Table 64

[0561]

Table 65

[0562]

Table 66

[0563]

Table 67

[0564]

Table 68

[0565]

Table 69

[0566] Example 11: In Vitro Effect of Modified Oligonucleotides Against Human SNCA (Multiple Doses) Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. Compound No. 387985, which was disclosed in WO2012 / 068405 previously, was also tested as a comparative control oligonucleotide. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM using electroporation as specified in the following table. After a treatment period of about 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. Human SNCA primer-probe set RTS2621 (described in Example 1 above) was used to measure the mRNA level. The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the following table as the reduction rate of the SNCA mRNA amount compared to the untreated control. A value of 0% reduction rate indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the following table, the mRNA level of SNCA decreased in a dose-dependent manner in the cells treated with the modified oligonucleotide.

[0567]

Table 70

[0568]

Table 71

[0569] Example 12: In Vitro Effect of Modified Oligonucleotides Against Human SNCA (Multiple Doses) Modified oligonucleotides selected from the above examples were tested in A431 cells at various doses. Cells were seeded at a density of 5,000 cells per well and transfected by free uptake with modified oligonucleotides at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the table below as the rate of decrease in the amount of SNCA mRNA compared to untreated controls. A value of 0% for the rate of decrease indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the table below, the mRNA level of SNCA decreased in a dose-dependent manner in cells treated with the modified oligonucleotide.

[0570]

Table 72

[0571] Example 13: In Vitro Effect of Modified Oligonucleotides on Rhesus SNCA (Multiple Doses) Some of the above-mentioned modified oligonucleotides are complementary to rhesus monkeys. Human-monkey cross-reactive modified oligonucleotides selected from the above examples were tested at various doses in LLC-MK2 monkey cells. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 6.9 nM, 20.5 nM, 61.8 nM, 185.2 nM, 500.0 nM, 1700.0 nM, 5000.0 nM, and 15,000.0 nM using electroporation as specified in the table below. After a treatment period of about 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The mRNA level of SNCA was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the table below as the rate of decrease in the amount of SNCA mRNA compared to untreated controls. The 50% inhibitory concentration (IC 50 ) of each oligonucleotide is also shown in the table below. A value of 0% decrease indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown in the table below, the mRNA level of SNCA decreased in a dose-dependent manner in cells treated with the modified oligonucleotides.

[0572] [Table 73]

[0573] Example 14: In Vitro Effect of Modified Oligonucleotides on Monkey SNCA (Multiple Doses) Some of the above-mentioned modified oligonucleotides are complementary to rhesus monkeys. Human-monkey cross-reactive modified oligonucleotides selected from the above examples were tested at various doses in LLC-MK2 monkey cells. In the following table, modified oligonucleotides with 1 to 3 mismatches to the rhesus monkey sequence are marked. Cells were seeded at a density of 20,000 cells per well and transfected with modified oligonucleotides at concentrations of 0.032 μM, 0.160 μM, 0.800 μM, 4.000 μM, and 20.000 μM using electroporation as specified in the following table. After a treatment period of about 24 hours, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the following table as the reduction rate of the SNCA mRNA amount compared to untreated controls. As shown in the following table, the mRNA level of SNCA decreased in a dose-dependent manner in cells treated with the modified oligonucleotide.

[0574]

Table 74

[0575] Example 15: Effect of Modified Oligonucleotides on Human SNCA in Human Neurons by Free Uptake (Single Dose) Selected modified oligonucleotides complementary to human SNCA were tested for their effect on SCNA mRNA levels in human neurons in vitro by free uptake. Neurons derived from human iPS cells were seeded at a density of 35,000 cells per well. Approximately 24 hours later, 20 μM of the modified oligonucleotide was added and incubated with the cultured cells for 7 days. After 7 days, total RNA was isolated from the cells and the SNCA mRNA level was measured by quantitative real-time PCR. The mRNA level was measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The SNCA mRNA level was adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the following table as the reduction rate of the SNCA mRNA amount compared to untreated control cells. As shown below, the modified oligonucleotide complementary to human SNCA decreased the amount of human SNCA mRNA.

[0576]

Table 75-1

[0577]

Table 75-2

[0578] Example 16: Effect of Modified Oligonucleotides on Human SNCA in Human Neurons by Free Uptake (Multiple Doses) Selected modified oligonucleotides complementary to human SNCA were tested for their effect on SCNA mRNA levels in human neurons in vitro by free uptake. Human iPS cell-derived neurons were seeded at a density of 35,000 cells per well and incubated with oligonucleotides at 247.00 nM, 740.70 nM, 2.22 μM, 6.66 μM, or 20.00 μM. After a 5-day treatment period, total RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR. The mRNA levels were measured using the human SNCA primer-probe set RTS2621 (described in Example 1 above). The SNCA mRNA levels were adjusted according to the total RNA content measured by RIBOGREEN®. The results are shown in the table below as the reduction rate of the SNCA mRNA amount compared to untreated control cells. A value of 0% reduction rate indicates that there was no effect of the compound on the cells or that the mRNA concentration increased. As shown below, the modified oligonucleotides complementary to human SNCA reduced the amount of human SNCA mRNA.

[0579]

Table 76

[0580] Example 17: Tolerance of Modified Oligonucleotides Complementary to Human SNCA in Mice (Dose 700 μg) The above-described modified oligonucleotide was tested in mice to evaluate the tolerability of the oligonucleotide. Compound No. 387985 disclosed in WO2012 / 068405 was also tested and used as a comparative control oligonucleotide. Wild-type C57 / Bl6 mice were each administered a single ICV dose of 700 μg of the oligonucleotide described in the following table. Each treatment group consisted of 4 mice. Four mice in one group were administered PBS as a negative control. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were: (1) the mice were lively, attentive, and responsive; (2) the mice were in a standing or hunched position when unstimulated; (3) the mice showed some movement when unstimulated; (4) the mice showed forward movement after being lifted; (5) the mice showed some movement after being lifted; (6) the mice reacted when their tails were pinched; (7) the breathing was regular. Each mouse was given a subscore for each of these seven criteria, with 0 if the criterion was met and 1 if it was not (Functional Observation Composite Score or FOB). After evaluating all seven criteria, the scores for each mouse were summed, and the average value within each treatment group was determined. The results are shown in the following table.

[0581]

Table 77

[0582]

Table 78

[0583]

Table 79

[0584]

Table 80

[0585]

Table 81

[0586]

Table 82

[0587] Example 18: Tolerance of a Modified Oligonucleotide Complementary to Human SNCA in Rats (Dose 3 mg) The above-described modified oligonucleotide was tested in rats to evaluate the tolerance of the oligonucleotide. Compound No. 387985, which was disclosed in WO2012 / 068405 previously, was also tested as a comparative control oligonucleotide. Sprague Dawley rats were each administered a single intrathecal (IT) dose of 3 mg of the oligonucleotide described in the following table. Each treatment group consisted of 4 rats. Four rats in one group were administered PBS as a negative control. Three hours after the injection, the movement of 7 different sites of the body was evaluated for each rat. The 7 sites of the body were: (1) the tail of the rat, (2) the posterior posture of the rat, (3) the hind limbs of the rat, (4) the hind feet of the rat, (5) the forelimbs of the rat, (6) the anterior posture of the rat, and (7) the head of the rat. For each of the 7 different sites of the body, each rat was given a subscore, with 0 if the body site was moving and 1 if the body site was paralyzed. After evaluating each of the 7 sites of the body, the subscores of each rat were totaled, and then the average value was determined for each group. For example, if 3 hours after the IT administration of 3 mg, the tail, head, and all other evaluated body sites of the rat were moving, the total score would be 0. If in another rat, 3 hours after the IT administration of 3 mg, its tail was not moving but all other evaluated body sites were moving, the score would be 1. The results are shown as the average score of each treatment group.

[0588]

Table 83

[0589]

Table 84

[0590]

Table 85

[0591]

Table 86

[0592]

Table 87

[0593]

Table 88

[0594]

Table 89

[0595] Example 19: Efficacy of Modified Oligonucleotides Complementary to Human SNCA in Transgenic Mice The above modified oligonucleotides were tested in an SNCA PAC transgenic mouse model using a bacterial P1 artificial chromosome (PAC) containing the entire wild-type human SNCA gene.

[0596] Treatment SNCA PAC mice were divided into groups of 4 - 8 mice each. Two groups were tested with each compound. Each group received a single ICV bolus injection of the oligonucleotide at doses of 10 μg, 30 μg, 100 μg, 300 μg, or 700 μg and were sacrificed after 2 weeks. The PBS injection group was used as a control group for comparison with the oligonucleotide treatment groups.

[0597] RNA Analysis Two weeks later, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and subjected to real-time PCR analysis to measure the mRNA expression of SNCA using the primer-probe set hSNCA LTS00672 (forward sequence TGGCAGAAGCAGCAGGAAA (designated as SEQ ID NO: 14 herein), reverse sequence TCCTTGGTTTTGGAGCCTACA (designated as SEQ ID NO: 15 herein), probe sequence 5’-FAM-CAAAAGAGGGTGTTCTC-3’MGB (designated as SEQ ID NO: 16 herein)). The results are shown as the rate of change of mRNA relative to the PBS control, normalized by cyclophilin A.

[0598] As shown in the table below, treatment with the modified oligonucleotide resulted in a significant decrease in SNCA mRNA compared to the PBS control. The results are a combination of two separate test results. The ROUT was used at 1% to exclude animals from the analysis to exclude outliers. In 763085, 3 animals were excluded by the ROUT analysis method, and 1 animal did not survive the surgery. In 763364, 2 animals were excluded by the ROUT analysis method. In 763391, 1 animal was excluded at a value of 253% of the control, and 3 animals did not survive the surgery. In 789243, 1 animal was excluded by the ROUT analysis method. In 827599, 4 animals were excluded by the ROUT analysis method.

[0599]

Table 90

[0600] Example 20: Efficacy of Modified Oligonucleotides Complementary to Human SNCA in Transgenic Mice The above modified oligonucleotide was tested in an SNCA PAC transgenic mouse model using a bacterial P1 artificial chromosome (PAC) containing the entire wild-type human SNCA gene.

[0601] Treatment SNCA PAC mice were divided into groups of 10 mice each. Two groups were tested with each compound. Each group received a single ICV bolus injection of the oligonucleotide at doses of 10 μg, 30 μg, 100 μg, 300 μg, or 700 μg and were sacrificed after 2 weeks. The PBS injection group was used as a control group for comparison with the oligonucleotide treatment groups.

[0602] RNA analysis After 2 weeks, the mice were sacrificed, and RNA was extracted from the cortical brain tissue for real-time PCR analysis. The primer-probe set hSNCA LTS00672 (forward sequence TGGCAGAAGCAGCAGGAAA (referred to herein as SEQ ID NO: 14), reverse sequence TCCTTGGTTTTGGAGCCTACA (referred to herein as SEQ ID NO: 15), probe sequence 5’-FAM-CAAAAGAGGGTGTTCTC-3’MGB (referred to herein as SEQ ID NO: 16)) was used to measure the mRNA expression of SNCA. The results are shown as the rate of change of mRNA relative to the PBS control, normalized by cyclophilin A.

[0603] As shown in the table below, treatment with the modified oligonucleotide resulted in a significant decrease in SNCA mRNA compared to the PBS control. Animals were excluded from the analysis using ROUT at 1% to exclude outliers. The values in the table below are the average values of 10 animals per group, except for the group at a dose of 700 μg, which is the average value of 7 animals.

[0604]

Table 91

[0605] Example 21: Efficacy of Human SNCA-Targeted Modified Oligonucleotides in Non-Human Primates (2-Week Study) The efficacy of the above modified oligonucleotide was further evaluated in non-human primates (NHP).

[0606] Treatment Female cynomolgus monkeys were each divided into groups of 4 NHPs. Each group received a single IT bolus injection of 35 mg of modified oligonucleotides 789243, 763391, 763364, 763085, or 827599. One group of NHPs received an injection of artificial cerebrospinal fluid (aCSF). The aCSF injection group was used as a control group for comparison with the oligonucleotide treatment groups. Two weeks later, the NHPs were sacrificed and tissues were collected for analysis.

[0607] RNA analysis RNA was extracted from various neural tissues and real-time PCR analysis was performed for SNCA mRNA expression as in the previous example. The results are shown as the rate of change in mRNA relative to the aCSF control, normalized by NHP cyclophilin A. As shown in the table below, treatment with the modified oligonucleotides resulted in a decrease in SNCA mRNA in some treatment groups compared to the PBS control. Since only the cauda equina was obtained in one lumbar sample and samples from the lumbar region could not be obtained, the lumbar spinal cord is the average of 3 NHPs for 763391.

[0608]

Table 92

[0609] Example 22: Efficacy of human SNCA-directed modified oligonucleotides in non-human primates (13-week study) The above modified oligonucleotides were further evaluated for efficacy and tolerability in non-human primates (NHPs).

[0610] Treatment Female cynomolgus monkeys were each divided into groups of 4 NHPs. Each group received IT bolus injections of 35 mg of compound 763391 or compound 827599 on days 1 and 14, and then once monthly for a total of 5 times. One group of NHPs received an injection of aCSF instead of an oligonucleotide. The aCSF injection group was used as a control group for comparison with the oligonucleotide treatment groups. One week after the final dose, the NHPs were sacrificed and tissues were collected for analysis.

[0611] RNA analysis RNA was extracted from various nerve tissues, and real-time PCR analysis was performed on the mRNA expression of SNCA as in the above example. The results are shown as the change rate of mRNA relative to the aCSF control, normalized by cyclophilin A.

[0612] As shown in the following table, treatment with the modified oligonucleotide resulted in a decrease in SNCA mRNA compared to the PBS control.

[0613]

Table 93

[0614]

Table 94

[0615]

Table 95

[0616] Example 23: Treatment (preventive treatment) of SNCA pathology in a preformed fibril (PFF) model in wild-type mice Experimental model The mouse PFF (preformed fibril) model is an experimental model used to investigate therapeutic agents for Parkinson's disease and is described in Luk, et.al., Science. 2012 Nov 16;338(6109):949-53. Intracerebral injection of preformed SNCA fibrils once causes Lewy body pathology, which is a characteristic of Parkinson's disease.

[0617] Modified oligonucleotide Compound 678363 is a 4-8-5 gapmer of MOE and cEt that is 100% complementary to mouse SNCA and has the sequence TTTAATTACTTCCACCA (incorporated herein as SEQ ID NO: 23) in the 5’ to 3’ direction, has a sugar motif of (in the 5’ to 3’ direction): eeekddddddddkeeee, where “d” represents 2’-deoxyribose sugar, “e” represents 2’-MOE modified sugar, “k” represents cEt modified sugar, and has a internucleoside linkage motif of (in the 5’ to 3’ direction): soosssssssssooss, where “o” represents a phosphodiester internucleoside linkage and “s” represents a phosphorothioate internucleoside linkage.

[0618] Experimental procedure Three groups of 12 wild-type B6C3F1 mice were treated according to the following table. 700 μg of modified oligonucleotide or PBS was administered on day 0 by ICV (intracerebroventricular) injection, and preformed fibrils were administered into the striatum on day 14. On day 56, a wire hang test was performed to measure motor function, and the mice were sacrificed and subjected to mRNA analysis and histological analysis. P-α-Syn aggregates in the substantia nigra were stained and quantified. Mouse primer probe set Mouse SNCA mRNA was measured by RT-PCR as described above using RTS2956 (forward sequence GTCATTGCACCCAATCTCCTAAG (SEQ ID NO: 17 herein), reverse sequence GACTGGGCACATTGGAACTGA (SEQ ID NO: 18 herein), probe sequence CGGCTGCTCTTCCATGGCGTACAA (SEQ ID NO: 19 herein)). The mRNA level of SNCA was normalized to cyclophilin A and shown as a percentage of the mRNA level of PBS-treated mice. As shown in the following table, in modified oligonucleotide-treated mice, the mRNA of SNCA was decreased, the aggregates in the substantia nigra were fewer, and the ability in the wire hang test was improved compared to PBS-treated mice.

[0619]

Table 96

[0620] Example 24: Treatment of SNCA pathology in a preformed fibril (PFF) model in mice (treatment after symptom onset) Experimental procedure Three groups of 12 wild-type B6C3F1 mice were treated as follows in the table below. Preformed fibrils were administered into the striatum on day 0, and 700 μg of modified oligonucleotide or PBS was administered by ICV (intracerebroventricular) injection on day 14. On day 56, a wire hang test was performed to measure motor function, and the mice were sacrificed for mRNA analysis and histological analysis. Phosphorylated-α-Syn aggregates in the substantia nigra were stained and quantified. Mouse SNCA mRNA was measured as in the previous example and normalized to PBS-treated mice. As shown in the table below, in modified oligonucleotide-treated mice, SNCA mRNA was decreased, aggregates in the substantia nigra were fewer, and the ability in the wire hang test was improved compared to PBS-treated mice.

[0621] [Table 97]

[0622] Example 25: Treatment of SNCA pathology in a preformed fibril (PFF) model in mice (long-term preventive treatment) Experimental procedure Three groups of 12 wild-type B6C3F1 mice were treated as follows in the table below. 700 μg of modified oligonucleotide (control or treatment) or PBS was administered by ICV (intracerebroventricular) injection on day 0, preformed fibrils were administered into the striatum on day 14, and an additional 700 μg of modified oligonucleotide or PBS was administered by ICV on day 90.

[0623] The control group included a PBS treatment group and a compound 676630 treatment group. Compound 676630 is a 5-10-5 MOE gapmer having a sequence of CCTATAGGACTATCCAGGAA (incorporated herein as SEQ ID NO: 2795) that is not complementary to mouse SNCA, and having a internucleoside linkage motif of sooosssssssssssoos in the 5'-to-3' direction, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage.

[0624] On day 180, the mice were sacrificed and subjected to mRNA analysis and histological analysis. Phosphorylated α-Syn aggregates and neurite pathology in the substantia nigra were stained and quantified for 6 mice in each group. Further, the number of TH (tyrosine hydroxylase) positive cells in the substantia nigra pars compacta (SNpc), which is a measure of dopaminergic neuron death, was quantified for 6 mice in each group. The results are shown in comparison with the PBS treatment group. As shown in the following table, in mice treated with compound 677363, the mRNA of SNCA was decreased, the aggregates in the substantia nigra were less, and the neurite pathology in the substantia nigra was decreased compared to PBS-treated mice and 676630-treated mice.

[0625]

Table 98

[0626] Example 26: Tolerance in Mice of Modified Oligonucleotides Complementary to Human SNCA (Dose 700 μg) The above modified oligonucleotides were tested against compounds 1233344 and 1233345 (described below) to evaluate the tolerance of the oligonucleotides.

[0627] Compound 1233344 is a 15-mer gapmer complementary to SNCA having the sequence CTACATAGAGAACAC (incorporated herein as SEQ ID NO: 2796) (in the 5’ to 3’ direction), where the most 5’-end nucleoside targeted by such gapmer in SEQ ID NO: 1 is at position 370, where each of nucleosides 1-3, nucleoside 13, and nucleoside 14 (in the 5’ to 3’ direction) contains an LNA sugar modification, each of nucleosides 4-12 and nucleoside 15 is a deoxynucleoside, and the internucleoside linkages between nucleosides are phosphorothioate internucleoside linkages. Compound 1233344 has the following chemical notation: C lnas T lnas A lnas C ds A ds T ds A ds G ds A ds G ds A ds A ds C lnas A lnas C d characterized in that, A = adenine nucleobase, C = cytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, d = 2’-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and lna = LNA-modified sugar and is.

[0628] Compound 1233345 is a 15-mer gapmer complementary to SNCA, having the sequence GCCTACATAGAGAAC (incorporated herein as SEQ ID NO: 2797) (in the 5’ to 3’ direction), where the most 5’-end nucleoside targeted by such gapmer in SEQ ID NO: 1 is at position 372, where each of nucleosides 1-3, nucleoside 13, and nucleoside 14 (in the 5’ to 3’ direction) contains an LNA sugar modification, each of nucleosides 4-12 and nucleoside 15 is a deoxynucleoside, and the internucleoside linkages between nucleosides are phosphorothioate internucleoside linkages. Compound 1233345 has the following chemical notation: G lnas C lnas C lnas T ds A ds C ds A ds T ds A ds G ds A ds G ds A lnas A lnas C d characterized in that, A = adenine nucleobase, C = cytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, d = 2’-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and lna = LNA-modified sugar is.

[0629] Treatment Wild-type C57BL / 6 mice were each given a single ICV administration of 700 μg of the modified oligonucleotide described in the following table. Each treatment group consisted of 4 mice. Four mice in one group were administered PBS as a negative control. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were: (1) the mice were lively, attentive, and responsive, (2) the mice were in a standing or hunched position when unstimulated, (3) the mice showed some movement when unstimulated, (4) the mice showed forward movement after being lifted, (5) the mice showed some movement after being lifted, (6) the mice reacted when their tails were pinched, (7) the breathing was regular. Each mouse was given a subscore for each of these seven criteria, with 0 if the criterion was met and 1 if it was not (Functional Observation Composite Score or FOB). After evaluating all seven criteria, the scores for each mouse were totaled, and the average value within each treatment group was determined. The results are shown in the following table.

[0630] [Table 99] In one aspect, the present invention may be as follows. [Aspect 1] An oligomeric compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80% complementary to any of the nucleobase sequences of SEQ ID NOs: 1 to 6 when measured over the entire nucleobase sequence of the modified oligonucleotide, and comprises at least one modification selected from a modified sugar, a sugar substitute, and a modified internucleoside linkage. [Aspect 2] An oligomeric compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12, 13, 14, 15, 16, or 17 nucleobases of any of SEQ ID NOs: 2193, 1703, 28 to 1702, 1704 to 2192, and 2194 to 2793. [Aspect 3] An oligomeric compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the modified oligonucleotide is (i) an equivalent-length portion of nucleic acid bases 50915 to 50943 of SEQ ID NO: 2, (ii) an equivalent-length portion of nucleic acid bases 19630 to 19656 of SEQ ID NO: 2, (iii) an equivalent-length portion of nucleic acid bases 28451 to 28491 of SEQ ID NO: 2, (iv) an equivalent-length portion of nucleic acid bases 48712 to 48760 of SEQ ID NO: 2, (v) an equivalent-length portion of nucleic acid bases 23279 to 23315 of SEQ ID NO: 2, (vi) an equivalent-length portion of nucleic acid bases 20964 to 21018 of SEQ ID NO: 2, (vii) an equivalent-length portion of nucleic acid bases 22454 to 22477 of SEQ ID NO: 2, (viii) an equivalent-length portion of nucleic acid bases 72294 to 72321 of SEQ ID NO: 2, (ix) an equivalent-length portion of nucleic acid bases 20549 to 20581 of SEQ ID NO: 2, or (x) an equivalent-length portion of nucleic acid bases 27412 to 27432 of SEQ ID NO: 2 and having a nucleobase sequence complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of the oligomeric compound described above. [Aspect 4] The oligomeric compound according to any one of Aspects 1 to 3, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any one of the nucleobase sequences of SEQ ID NOs: 1 to 6 when measured over the entire nucleobase sequence of the modified oligonucleotide. [Aspect 5] (i) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 243, 1601 to 1603, and 2188, 2189, 2190, 2191, 2192, 2193, 2194, 2195, 2196, and 2197. (ii) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 1103, 1700, 1701, 1702, 1703, 1704, 1705, 1706, and 1707. (iii) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 1168, 1882, 1883, 1884, 1885, 1886, 1887, 1888, 1889, 1890, 1891, 1892, and 1893. (iv) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 471, 1585 to 1588, and 2157 to 2166. (v) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 164, 1130 to 1133, and 1797 to 1810. (vi) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 391, 468, 1112 to 1116, and 1723 to 1741. (vii) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 88, 1123 to 1126, and 1778 to 1782. (viii) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 1323 and 2345 to 2353. (ix) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 314 and 1107 to 1110. (x) The nucleobase sequence of the modified oligonucleotide contains at least 12 consecutive nucleobases of SEQ ID NO: 468, 1113 to 1114, and 1163. The compound according to Aspect 4. [Aspect 6] The modified oligonucleotide is an oligomeric compound according to any one of Aspects 1 to 5, comprising at least one modified nucleoside. [Aspect 7] The modified oligonucleotide is an oligomeric compound according to Aspect 6, comprising at least one modified nucleoside comprising a modified sugar moiety. [Aspect 8] The modified oligonucleotide is an oligomeric compound according to Aspect 7, comprising at least one modified nucleoside comprising a bicyclic sugar moiety. [Aspect 9] The modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, and the 2'-4' bridge is -O-CH 2 - and -O-CH(CH 3 ), and is an oligomeric compound according to Aspect 8. [Aspect 10] The modified oligonucleotide is an oligomeric compound according to any one of Aspects 6 to 9, comprising at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. [Aspect 11] The modified oligonucleotide is an oligomeric compound according to Aspect 10, comprising at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2'-MOE modified sugar or a 2'-OMe modified sugar. [Aspect 12] The modified oligonucleotide is an oligomeric compound according to any one of Aspects 6 to 11, comprising at least one modified nucleoside comprising a sugar substitute. [Aspect 13] The modified oligonucleotide is an oligomeric compound according to Aspect 12, comprising at least one modified nucleoside comprising a sugar substitute selected from morpholino and PNA. [Aspect 14] The modified oligonucleotide is a 5'-region consisting of 1 to 5 linked 5'-region nucleosides, a central region consisting of 6 to 10 linked central region nucleosides, and a 3'-region consisting of 1 to 5 linked 3'-region nucleosides having a sugar motif comprising, wherein each of said 5'-region nucleosides and each of said 3'-region nucleosides comprises a modified sugar moiety, and each of said central region nucleosides comprises an unmodified 2'-deoxyribosyl sugar moiety, the oligomeric compound according to any one of aspects 1 to 13. [Aspect 15] The modified oligonucleotide comprises at least one modified internucleoside linkage, the oligomeric compound according to any one of aspects 1 to 14. [Aspect 16] Each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, the oligomeric compound according to aspect 15. [Aspect 17] At least one internucleoside linkage is a phosphorothioate internucleoside linkage, the oligomeric compound according to aspect 15 or 16. [Aspect 18] The modified oligonucleotide comprises at least one phosphodiester internucleoside linkage, the oligomeric compound according to aspect 15 or 17. [Aspect 19] Each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage, the oligomeric compound according to any one of aspects 15, 17, or 18. [Aspect 20] The modified oligonucleotide comprises at least one modified nucleobase, the oligomeric compound according to any one of aspects 1 to 19. [Aspect 21] The modified nucleobase is 5-methylcytosine, the oligomeric compound according to aspect 20. [Aspect 22] The modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 20, 15 to 25, 16 to 20, 18 to 22 or 18 to 20 linked nucleosides, the oligomeric compound according to any one of aspects 1 to 21. [Aspect 23] The modified oligonucleotide consists of 17 or 20 linked nucleosides, the oligomeric compound according to any one of aspects 1 to 22. [Aspect 24] Consisting of the modified oligonucleotide, the oligomeric compound according to any one of aspects 1 to 23. [Aspect 25] An oligomeric compound according to any one of Aspects 1 to 23, comprising a binding group containing a binding moiety and a binding linker. [Aspect 26] The oligomeric compound according to Aspect 25, wherein the binding group comprises a GalNAc cluster containing 1 to 3 GalNAc ligands. [Aspect 27] The oligomeric compound according to Aspect 25 or 26, wherein the binding linker consists of a single bond. [Aspect 28] The oligomeric compound according to Aspect 26, wherein the binding linker is cleavable. [Aspect 29] The oligomeric compound according to Aspect 28, wherein the binding linker comprises 1 to 3 linker nucleosides. [Aspect 30] The oligomeric compound according to any one of Aspects 25 to 29, wherein the binding group is bound to the modified oligonucleotide at the 5'-end of the modified oligonucleotide. [Aspect 31] The oligomeric compound according to any one of Aspects 25 to 29, wherein the binding group is bound to the modified oligonucleotide at the 3'-end of the modified oligonucleotide. [Aspect 32] An oligomeric compound according to any one of Aspects 1 to 31, comprising a terminal group. [Aspect 33] The oligomeric compound according to any one of Aspects 1 to 32, wherein the oligomeric compound is a single-stranded oligomeric compound. [Aspect 34] The oligomeric compound according to any one of Aspects 1 to 28 or 30 to 32, wherein the oligomeric compound does not contain a linker nucleoside. [Aspect 35] An oligomeric duplex comprising the oligomeric compound according to any one of Aspects 1 to 32 or 34. [Aspect 36] An antisense compound comprising or consisting of the oligomeric compound according to any one of Aspects 1 to 34 or the oligomeric duplex according to Aspect 35. [Aspect 37] A pharmaceutical composition comprising the oligomeric compound according to any one of Aspects 1 to 34 or the oligomeric duplex according to Aspect 35 and a pharmaceutically acceptable carrier or diluent. [Aspect 38] The following formula

Chemical formula

Claims

[Claim 1] The invention described in the specification.

Images