Aav vector-mediated deletion of large mutational hotspot for treatment of duchenne muscular dystrophy

Abstract

To provide therapeutic targets for correction of a human dystrophin gene by gene editing, and methods of use.SOLUTION: The disclosure relates to a CRISPR-Cas system.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 833,760, filed on April 14, 2019, which is hereby incorporated by reference in its entirety. Description of Research Sponsored by the Federal Government This invention was made with government support under Grant No. R01AR069085 awarded by the National Institutes of Health. The government has certain rights in this invention. This disclosure relates to the field of gene expression modification, genome engineering, and genomic modification of genes using clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR - associated (Cas) 9 - based systems and viral delivery systems. This disclosure also relates to the field of genome engineering and genomic modification of genes in muscles such as skeletal muscle and cardiac muscle.

Background Art

[0002] Preamble CRISPR / Cas9-based gene editing systems can be used to introduce site-specific double-strand breaks at target genomic loci. This DNA cleavage stimulates the natural DNA repair machinery, resulting in one of two possible repair pathways. In the absence of a donor template, the cleavage is repaired by non-homologous end joining (NHEJ), an error-prone repair pathway that results in small insertions or deletions of DNA. This method can be used to intentionally disrupt, delete, or alter the reading frame of a target gene sequence. However, when a donor template is provided along with the nuclease, the cellular machinery repairs the cleavage by homologous recombination, which is enhanced several-fold in the presence of DNA cleavage. This method can be used to introduce specific changes in the DNA sequence at the target site. Engineered nucleases have been used for gene editing in various human stem cells and cell lines, as well as for gene editing in the mouse liver. However, a major hurdle in the implementation of these technologies is delivering them in vivo to specific tissues in a way that facilitates effective, efficient, and successful genome modification.

[0003] Hereditary genetic diseases have a devastating impact on children in the United States. These diseases currently have no cure and can only be managed by attempts to alleviate symptoms. For decades, the field of gene therapy has held promise for treating these diseases. However, this approach has been limited by technical hurdles related to the safe and efficient delivery of therapeutic genes to cells and patients. Duchenne muscular dystrophy (DMD) is a lethal genetic disease clinically characterized by muscle wasting, loss of ambulatory function, and typically death in the third decade of life due to the loss of functional dystrophin. DMD is the result of a hereditary or sporadic mutation in the dystrophin gene. Most mutations that cause DMD are the result of deletions of exons that push the translation reading frame out of frame. Most DMD mutations are deletions of one or more of its 79 exons (about 68%) that shift the reading frame and terminate the expression of the full-length transcript. Deletions most often occur within two "hot spots" of the gene that include exons 2-20 (about 1 / 3 of all deletions) and exons 45-55 (about 2 / 3 of all deletions). Patients with Becker muscular dystrophy (BMD) who have a naturally occurring in-frame deletion of the entire region of exons 45-55 of the dystrophin gene exhibit a late-onset disease and minimal skeletal muscle pathology. Dystrophin is a major component of a protein complex that is responsible for regulating the integrity and function of muscle cells. DMD patients typically lose the ability to physically support themselves during childhood, become progressively weaker during their teens, and die in their twenties. Current experimental gene therapy strategies for DMD require repeated administration of a transient gene delivery vehicle or rely on the permanent integration of foreign gene material into genomic DNA. Both of these methods have significant safety concerns. Furthermore, these strategies have been limited by their inability to deliver large and complex dystrophin gene sequences. There remains a need for more precise and efficient gene editing tools to correct and treat patients with mutations in the dystrophin gene. SUMMARY OF THE INVENTION

[0004] In some embodiments, the present disclosure relates to CRISPR-Cas systems. The CRISPR-Cas system may include one or more vectors encoding a composition comprising (a) a first guide RNA (gRNA) molecule targeting intron 44 of dystrophin, (b) a second gRNA molecule targeting intron 55 of dystrophin, (c) a Cas9 protein, and (d) one or more Cas9 gRNA scaffolds. In some embodiments, the system includes a single vector. In some embodiments, the system includes two or more vectors, and the two or more vectors include a first vector and a second vector. In some embodiments, (a) the first vector encodes the first gRNA molecule and the second gRNA molecule, and (b) the second vector encodes the Cas9 protein. In some embodiments, (a) the first vector encodes the first gRNA molecule, and (b) the second vector encodes the second gRNA molecule. In some embodiments, the first vector further encodes the Cas9 protein. In some embodiments, the second vector further encodes the Cas9 protein. In some embodiments, the expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes the MHCK7 promoter, the CK8 promoter, or the Spc512 promoter. In some embodiments, the single vector encodes the first gRNA molecule, the second gRNA molecule, and the Cas9 protein. In some embodiments, the vector includes at least one bidirectional promoter. In some embodiments, the bidirectional promoter includes a first promoter driving the expression of the first gRNA molecule and / or the second gRNA molecule, and a second promoter driving the expression of the Cas9 protein. In some embodiments, the first gRNA targets the polynucleotide of SEQ ID NO: 2 or a 5'-truncated form thereof. In some embodiments, the second gRNA targets the polynucleotide of SEQ ID NO: 3 or a 5'-truncated form thereof.In some embodiments, the Cas9 protein is a SpCas9 protein, a SaCas9 protein, or a St1Cas9 protein. In some embodiments, the Cas9 gRNA scaffold is a SaCas9 gRNA scaffold. In some embodiments, the SaCas9 gRNA scaffold comprises the polynucleotide of SEQ ID NO: 4 or is encoded by the polynucleotide of SEQ ID NO: 4. In some embodiments, the Cas9 protein is a SaCas9 protein encoded by the polynucleotide of SEQ ID NO: 11. In some embodiments, the vector comprises at least one polynucleotide selected from SEQ ID NOs: 1-13 and 24. In some embodiments, the vector comprises the polynucleotide sequence of SEQ ID NO: 24. In some embodiments, the vector comprises a polynucleotide sequence selected from SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 41, 42, 29, and 30. In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, or AAVrh.74. In some embodiments, the vector comprises a ubiquitous promoter or a tissue-specific promoter operably linked to a polynucleotide sequence encoding a first gRNA molecule, a second gRNA molecule, and / or a Cas9 protein. In some embodiments, the tissue-specific promoter is a muscle-specific promoter.

[0005] In a further aspect, the disclosure relates to a cell comprising the system described herein. Another aspect of the disclosure provides a kit comprising the system described herein. Another aspect of the disclosure provides a method for correcting a mutant dystrophin gene in a cell. The method may include administering the system described herein to the cell. Another aspect of the disclosure provides a method for genome editing of a mutant dystrophin gene in a subject. The method may include administering the system or cell described herein to the subject. The system or cell may be administered to the subject intramuscularly, intravenously, or a combination thereof.

[0006] Another aspect of the disclosure provides a method for treating a subject having a mutant dystrophin gene. The method may include administering the system or cell described herein to the subject. The system or cell may be administered to the subject intramuscularly, intravenously, or a combination thereof. The disclosure provides other aspects and embodiments that will become apparent in view of the following detailed description and the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS

[0007]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9A

Figure 9B

Figure 9C

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Mode for Carrying Out the Invention

[0008] Detailed Description As described herein, certain methods and engineered gRNAs have been found to be useful for a CRISPR / CRISPR-associated (Cas) 9-based gene editing system for altering expression, for genome engineering, and for correcting or reducing the effects of mutations in the dystrophin gene involved in genetic diseases such as DMD. The disclosed gRNAs were generated at target sites more suitable for clinical translation. For example, the gene encoding Streptococcus pyogenes Cas9 (SpCas9) is too large to be delivered by adeno-associated virus (AAV), a vector used for systemic gene delivery to muscle when all other necessary regulatory sequences are included. Instead, the disclosed gRNAs were selected and screened for use with Staphylococcus aureus Cas9 (SaCas9), which is approximately 1 kb smaller than SpCas9. The disclosed gRNAs targeting the human dystrophin gene sequence can be used by a CRISPR / Cas9-based system to target exons 45-55 of the human dystrophin gene that cause genomic deletions in this region to restore the expression of functional dystrophin in cells derived from DMD patients.

[0009] Also described herein are gene constructs, compositions, and methods for delivering a CRISPR / Cas9-based gene editing system and multiple gRNAs for targeting the dystrophin gene. The subject matter of the present disclosure also provides methods for delivering a gene construct (e.g., a vector) or a composition containing the same to skeletal and cardiac muscle. The vector can be an AAV, including a modified AAV vector. The subject matter of the present disclosure includes methods for delivering this class of therapeutic agents in an active form to skeletal or cardiac muscle that enable effective, efficient, and successful genome modification, and for rewriting the human genome for therapeutic applications and targeting model species for basic science applications. The method may also relate to the use of a single AAV vector for the delivery of all of the editing components necessary for the excision of exons 45-55 of dystrophin. The section headings used in this section and the overall disclosure in this specification are for organizational purposes only and are not intended to be limiting.

[0010] 1. Definitions Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document including the definitions will prevail. Preferred methods and materials are described below, but in the practice or testing of the present invention, methods and materials similar or equivalent to those described herein may be used. All publications, patent applications, patents, and other references mentioned in this specification are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting. As used in this specification, the terms "comprise(s)", "include(s)", "having", "has", "can", "contain(s)", and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not preclude additional acts or structures. Unless the context clearly dictates otherwise, the singular forms "a", "an", and "the" include plural references. This disclosure contemplates other embodiments that "comprise", "consist of", and "consist essentially of" the embodiments or elements shown herein, whether or not explicitly described.

[0011] Regarding the recitation of numerical ranges in this specification, each number between them with the same precision is explicitly contemplated. For example, for the range of 6 to 9, the numbers 7 and 8 in addition to 6 and 9 are contemplated, and for the range of 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated. As used herein, the terms "about" or "approximately" mean within an acceptable error range for a particular value determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within a range of 3 or more standard deviations in the context of implementations in the art. In other cases, "about" can mean within a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. In certain embodiments, the term "about" means within a range of 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) of the indicated reference value, unless otherwise specified or clear from the context (except when such a number exceeds 100% of the possible values). In other cases, particularly with respect to biological systems or biological processes, the term can mean within a range of the magnitude of the value, preferably within a range of 5-fold, more preferably within a range of 2-fold.

[0012] As used interchangeably herein, "adeno-associated virus" or "AAV" refers to a small virus belonging to the genus Dependovirus of the family Parvoviridae that infects humans and several other primate species. AAV is not currently known to cause disease and thus elicits a very mild immune response. As used herein, "binding region" refers to a region within a nuclease target region that is recognized and bound by a nuclease. As used interchangeably herein, "cardiac muscle" or "heart muscle" refers to a type of involuntary striated muscle found in the walls of the heart and histological support structures, i.e., the myocardium. Cardiac muscle is made up of cardiomyocytes or myocardiocytes. Cardiomyocytes exhibit striations similar to those in skeletal muscle cells, but unlike multinucleated skeletal cells, contain only one unique nucleus. In certain embodiments, "cardiac condition" refers to conditions associated with the myocardium, such as cardiomyopathy, heart failure, arrhythmia, and inflammatory heart disease.

[0013] As used herein, "coding sequence" or "coding nucleic acid" means a nucleic acid (RNA molecule or DNA molecule) that includes a nucleotide sequence encoding a protein. The coding sequence can further include a start signal and a stop signal operably linked to regulatory elements including a promoter signal and a polyadenylation signal capable of directing expression in a cell of an individual or mammal to which the nucleic acid is administered. The coding sequence may be codons that are optimized. As used herein, "complement" or "complementary" means a nucleic acid that can mean Watson-Crick type base pairs (e.g., A-T / U and C-G) or Hoogsteen type base pairs between nucleotides or nucleotide analogs of a nucleic acid molecule. "Complementarity" refers to a property shared between two nucleic acid sequences such that the nucleotide bases at each position are complementary when they are aligned antiparallel to each other.

[0014] As used herein, "correction," "genome editing," and "restoration" refer to changing a mutant gene that encodes a truncated protein or does not encode a protein at all such that expression of a full-length functional protein or a partially full-length functional protein is obtained. Correcting or restoring a mutant gene may involve exchanging a copy of the gene without a mutation, which involves a repair mechanism such as homology-directed repair (HDR), with a region of the gene with a mutation, or exchanging the entire mutant gene. Correcting or restoring a mutant gene may then involve repairing a frameshift mutation that results in a premature stop codon, an ectopic splice acceptor site, or an ectopic splice donor site by generating a double-strand break in the gene to be repaired using non-homologous end joining (NHEJ). NHEJ may add or delete at least one base pair during repair that can restore the appropriate reading frame and remove the premature stop codon. Correcting or restoring a mutant gene may involve disrupting an ectopic splice acceptor site or an ectopic splice donor sequence. Correcting or restoring a mutant gene may involve deleting a non-essential gene segment by the simultaneous action of two nucleases in the same DNA strand to remove the DNA between two nuclease target sites by NHEJ and restore the appropriate reading frame by repairing the DNA break.

[0015] The term "bidirectional promoter" refers to two or more promoters capable of driving the transcription of two separate sequences in both directions. In one embodiment, one promoter drives transcription from 5' to 3', and the other promoter drives transcription from 3' to 5'. In one embodiment, a bidirectional promoter is a double-stranded transcriptional control element that can drive the expression of at least two separate sequences, such as coding or non-coding sequences, in opposite directions. Such promoter sequences can be composed of, for example, two individual promoter sequences or a hybrid, chimeric, or fusion sequence containing at least their core sequences, or in other cases, a single transcriptional regulatory sequence capable of initiating transcription in both directions, or a packaging construct containing two promoters in opposite directions, such as one nucleotide sequence linked to the other (complementary) nucleotide sequence, composed of two individual promoter sequences that act in opposite directions. In some embodiments, the two individual promoter sequences may be in parallel, or a linker sequence can be positioned between the first and second sequences. The promoter sequence may be inverted for combination with another promoter sequence in the reverse orientation. Genes located on both sides of the bidirectional promoter can be operably linked to a single transcriptional control sequence or region that drives transcription in both directions. In other embodiments, the bidirectional promoters are not in parallel. For example, one promoter may drive transcription at the 5' end of a nucleotide fragment, and another promoter may drive transcription from the 3' end of the same fragment. In another embodiment, a first gene can be operably linked to a bidirectional promoter, with or without additional regulatory elements such as a reporter or terminator element, and a second gene can, in this case also with or without additional regulatory elements, be operably linked to the bidirectional promoter in the reverse direction by a complementary promoter sequence.

[0016] As used interchangeably herein, "donor DNA", "donor template", and "repair template" refer to double-stranded DNA fragments or double-stranded DNA molecules that contain at least a portion of the relevant gene. The donor DNA may encode a fully functional protein or a partially functional protein. As used interchangeably herein, "Duchenne muscular dystrophy" or "DMD" refers to a recessive and lethal X-linked disorder that causes muscle degeneration and ultimately death. DMD is a common hereditary monogenic disease that occurs in 1 in 3,500 males. DMD is the result of a hereditary or idiopathic mutation that causes a nonsense mutation or frameshift mutation in the dystrophin gene. Most of the dystrophin mutations that cause DMD are deletions of exons that disrupt the reading frame and cause premature translational termination in the dystrophin gene. DMD patients typically lose the ability to physically support themselves during childhood, become progressively weaker during their teens, and die in their twenties.

[0017] As used herein, "dystrophin" refers to a rod-shaped cytoplasmic protein that is part of a protein complex that connects the cytoskeleton of muscle fibers through the cell membrane to the surrounding extracellular matrix. Dystrophin provides structural stability to the dystroglycan complex of the cell membrane, which is responsible for regulating the integrity and function of muscle cells. As used interchangeably herein, the dystrophin gene or "DMD gene" is 2.2 million base pairs at locus Xp21. Primary transcription measures approximately 2,400 kb along with a mature mRNA of approximately 14 kb. Seventy-nine exons encode a protein that is over 3,500 amino acids. As used herein, "exons 45-55" of dystrophin refers to the region where approximately 45% of all dystrophin mutations are located. Deletions of exons 45-55 are associated with a very mild Becker phenotype and have been observed even in asymptomatic individuals. Multiexon skipping of exons 45-55 is beneficial for approximately 50% of all DMD patients.

[0018] As used interchangeably herein, "frameshift" or "frameshift mutation" refers to a type of gene mutation in which the addition or deletion of one or more nucleotides causes a shift in the reading frame of codons in the mRNA. A shift in the reading frame can result in changes in the amino acid sequence in protein translation, such as missense mutations or premature stop codons. As used herein, "functional" and "fully functional" refer to a protein having biological activity. A "functional gene" refers to a gene that is transcribed into an mRNA that is translated into a functional protein. As used herein, "fusion protein" refers to a chimeric protein produced by the joining of two or more genes that originally encode separate proteins. Translation of the fusion gene results in a single polypeptide having functional properties derived from each of the original proteins. As used herein, "gene construct" refers to a DNA molecule or RNA molecule that contains a nucleotide sequence encoding a protein. The coding sequence includes start and stop signals that are operably linked to regulatory elements, including a promoter signal and a polyadenylation signal, capable of directing expression in the cells of an individual to whom the nucleic acid molecule is administered. As used herein, the term "expression form" refers to a gene construct that includes the necessary regulatory elements operably linked to a coding sequence that encodes a protein such that the coding sequence is expressed when present in the cells of an individual.

[0019] As used herein, "genetic disease" refers to a disease caused, in whole or in part, directly or indirectly, by one or more abnormalities in the genome, especially a condition that exists from birth. The abnormality may be a mutation, insertion or deletion. The abnormality may affect the coding sequence of a gene or its regulatory sequence. Genetic diseases may include, but are not limited to, DMD, Becker muscular dystrophy (BMD), hemophilia, cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, hereditary disorders of liver metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom syndrome, retinoblastoma, and Tay-Sachs disease.

[0020] As used interchangeably herein, "homology-directed repair" or "HDR" refers to the mechanism in cells to repair double-stranded DNA damage when homologous portions of DNA are present in the nucleus, most often in the G2 and S phases of the cell cycle. HDR may use a donor DNA template to direct repair and may be used to introduce specific sequence changes to the genome, including targeted addition of entire genes. When the donor template is provided with a CRISPR / Cas9-based gene editing system, the cellular machinery repairs the cleavage by homologous recombination, which is enhanced several-fold in the presence of DNA cleavage. In the absence of homologous DNA portions, non-homologous end joining may occur instead. As used herein, "genome editing" refers to changing a gene. Genome editing may include correcting or restoring a mutant gene. Genome editing may also include knocking out a gene, such as a mutant gene or a normal gene. Genome editing may be used to treat a disease or enhance muscle repair by changing a related gene.

[0021] As used herein in the context of two or more nucleic acid or polypeptide sequences, "identical" or "identity" means that the sequences have the same residues at a particular percentage, meaning that the sequences are the same over a particular region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over a particular region, determining the number of positions at which identical residues occur in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions within the particular region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences are of different lengths or if one or more attached ends are created by the alignment and the particular region of comparison contains only a single sequence, the residues of the single sequence are included in the denominator rather than the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be determined manually or using a computer sequence algorithm such as BLAST or BLAST 2.0. As used interchangeably herein, "mutant gene" or "mutated gene" refers to a gene that has undergone a detectable mutation. A mutant gene has undergone changes such as loss, gain, or exchange of genetic material that affect the normal transmission and expression of the gene. As used herein, "disrupted gene" refers to a mutant gene that has a mutation that causes an early stop codon. A disrupted gene product is truncated compared to the full-length non-disrupted gene product.

[0022] As used herein, the "non-homologous end joining (NHEJ) pathway" refers to a pathway that repairs double-strand breaks in DNA by directly ligating the cut ends without the need for a homologous template. Template-independent religation of DNA ends by NHEJ is a stochastic error-prone repair process that introduces random microinsertions and microdeletions (indels) at the DNA break site. This method may be used to intentionally disrupt, delete, or alter the reading frame of a target gene sequence. NHEJ typically uses short homologous DNA sequences called microhomologies to direct repair. These microhomologies are often present within single-stranded overhangs at the ends of double-strand breaks. When the overhangs are perfectly complementary, NHEJ usually repairs the break accurately, but inaccurate repair resulting in nucleotide loss may also occur, and even more so when the overhangs are not complementary, inaccurate repair commonly occurs. As used herein, a "normal gene" refers to a gene that has not undergone changes such as loss, gain, or exchange of genetic material. A normal gene undergoes normal gene transmission and gene expression. For example, a normal gene may be a wild-type gene.

[0023] As used herein, "nuclease-mediated NHEJ" refers to NHEJ initiated after a nuclease such as a Cas9 molecule cleaves double-stranded DNA. As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" means at least two nucleotides that are covalently bonded together. A single-stranded description also defines the sequence of the complementary strand. Thus, a nucleic acid includes the complementary strand of the indicated single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid includes substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid includes a probe that hybridizes under stringent hybridization conditions. The nucleic acid may be single-stranded or double-stranded, or may contain portions of both double-stranded and single-stranded sequences. The nucleic acid may be either genomic DNA and cDNA, RNA, or a hybrid, where the nucleic acid may contain a combination of deoxyribonucleotides and ribonucleotides, as well as a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. The nucleic acid can be obtained by chemical synthesis methods or by recombinant methods.

[0024] As used herein, "operably linked" means that the expression of a gene is under the control of a promoter to which it is spatially connected. The promoter may be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene may be approximately the same as the distance between that promoter and the gene it controls within the gene from which the promoter is derived. As is known in the art, changes in this distance may be accommodated without loss of promoter function. As used herein, "partially functional" refers to a protein encoded by a mutant gene and having a biological activity that is less than that of the functional protein but greater than that of a non-functional protein. As used interchangeably herein, "premature stop codon" or "out-of-frame stop codon" refers to a nonsense mutation in a DNA sequence that becomes a stop codon at a position not normally found in the wild-type gene. A premature stop codon causes the protein to be truncated or shorter compared to the full-length version of the protein.

[0025] As used herein, "promoter" means a synthetic or naturally-derived molecule capable of conferring, activating, or enhancing nucleic acid expression in a cell. A promoter may include one or more specific transcriptional regulatory sequences for further enhancing expression and / or altering the spatial and / or temporal expression of the same. A promoter may include distal enhancers or silencer elements located thousands of base pairs from the transcription start site. A promoter may be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter may constitutively regulate the expression of a genetic component (constitutive promoter), or may differentially regulate in response to the cell, tissue, or organ in which expression occurs, the developmental stage at which expression occurs, or external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter, human U6 (hU6) promoter, and CMV IE promoter. Examples of muscle-specific promoters include the MHCK7 promoter, CK8 promoter, and Spc512 promoter.

[0026] As used herein, "skeletal muscle" refers to a type of striated muscle that is under the control of the somatic nervous system and attaches to bone by bundles of collagen fibers known as tendons. Skeletal muscle is composed of individual components known as myocytes or "muscle cells," which are sometimes colloquially referred to as "muscle fibers." Myocytes are formed from the fusion of developing myoblasts (a type of embryonic progenitor cell that gives rise to muscle cells) in a process known as myogenesis. These long, cylindrical multinucleated cells are also called myofibrils. As used herein, "skeletal muscle state" refers to conditions related to skeletal muscle, such as muscular dystrophy, aging, muscle degeneration, wound healing, and muscle weakness or atrophy. As used interchangeably herein, "subject" and "patient" refer to any vertebrate, including, but not limited to, mammals (e.g., cows, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, and mice, non-human primates (e.g., monkeys, e.g., cynomolgus monkeys or rhesus monkeys, chimpanzees, etc.) and humans). In some embodiments, the subject may be human or non-human. The subject or patient may have received other forms of treatment.

[0027] As used herein, "target gene" refers to any nucleotide sequence encoding a known or putative gene product. The target gene may be a mutant gene involved in a genetic disease. In certain embodiments, the target gene is the human dystrophin gene. In certain embodiments, the target gene is a mutant human dystrophin gene. As used herein, "target region" refers to the region of a target gene that is designed to be bound and cleaved by a CRISPR / Cas9-based gene editing system. As used herein, "transgene" refers to a gene or genetic material containing a gene sequence that is isolated from one organism and introduced into a different organism. This non-natural segment of DNA may retain the ability to produce RNA or protein in a transgenic organism, or it may alter the normal function of the genetic code of the transgenic organism. The introduction of a transgene may potentially change the phenotype of the organism. As used herein with respect to nucleic acids, "variant" means (i) a portion or fragment of a referenced nucleotide sequence, (ii) the complement of a referenced nucleotide sequence or a portion thereof, (iii) a nucleic acid that is substantially identical to the referenced nucleic acid or its complement, or (iv) a nucleic acid that hybridizes to the referenced nucleic acid, its complement, or a sequence substantially identical thereto under stringent conditions.

[0028] With respect to peptides or polypeptides whose amino acid sequences differ by amino acid insertions, deletions, or conservative substitutions, "variant" retains at least one biological activity. A variant can also mean a protein having an amino acid sequence that is substantially identical to the referenced protein having an amino acid sequence that retains at least one biological activity. Conservative substitution of an amino acid, i.e., substituting an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree, and distribution of charged regions), is typically recognized in the art as involving minor changes. These minor changes may be identified, as understood in the art, in part by considering the hydrophobicity-hydrophilicity index of the amino acids. Kyte et al., J. Mol. Biol. 157:105-132 (1982). The hydrophobicity-hydrophilicity index of an amino acid is based on consideration of its hydrophobicity and charge. It is known in the art that amino acids with similar hydrophobicity-hydrophilicity indices can be substituted and still retain protein function. In one aspect, amino acids with a hydrophobicity-hydrophilicity index of ±2 are substituted. The hydrophilicity of an amino acid may be used to indicate substitutions that result in a protein retaining its biological function. By considering the hydrophilicity of an amino acid in the context of a peptide, it becomes possible to calculate the maximum local average hydrophilicity of that peptide. Substitutions may be made with amino acids whose hydrophilicity values are within ±2 of each other. Both the hydrophobicity index and the hydrophilicity value of an amino acid are affected by the specific side chain of that amino acid. Consistent with the observed values, amino acid substitutions that are compatible with biological function depend on the relative similarity of the amino acids, particularly the side chains of those amino acids, as indicated by hydrophobicity, hydrophilicity, charge, size, and other properties.

[0029] As used herein, "vector" means a nucleic acid sequence containing an origin of replication. The vector may be a viral vector, bacteriophage, bacterial artificial chromosome or yeast artificial chromosome. The vector may be a DNA vector or an RNA vector. The vector may be a self-replicating extrachromosomal vector, preferably a DNA plasmid. Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure have the meanings commonly understood by those of ordinary skill in the art. For example, any terms and techniques used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, as well as protein and nucleic acid chemistry, and hybridization described herein are well known and commonly used in the art. The meaning and scope of the terms should be clear, but in the event of any potential ambiguity, the definitions provided herein will prevail over any dictionary or external definition. Further, unless the context requires otherwise, singular terms include pluralities and plural terms include singulars.

[0030] 2. Gene Constructs for Genome Editing of the Dystrophin Gene Provided herein are gene constructs for genome editing, genome alteration, and / or alteration of gene expression of the dystrophin gene. The dystrophin gene may be the human dystrophin gene. The gene construct includes at least one gRNA targeting the dystrophin gene sequence. The at least one gRNA may target the human dystrophin gene sequence and / or the rhesus dystrophin gene sequence and may be a SaCas9-compatible target. The disclosed gRNA may be included in a CRISPR / Cas9-based gene editing system using SaCas9 to target exons 45-55 of the human dystrophin gene. The disclosed gRNA that may be included in the CRISPR / Cas9-based gene editing system is capable of causing genomic deletions in the region of exons 45-55 of the human dystrophin gene to restore the expression of functional dystrophin in cells derived from DMD patients.

[0031] a. Dystrophin gene Dystrophin is a rod-shaped cytoplasmic protein that is part of a protein complex that connects the cytoskeleton of muscle fibers through the cell membrane to the surrounding extracellular matrix. Dystrophin provides structural stability to the dystroglycan complex of the cell membrane. The dystrophin gene is 2.2 million base pairs at locus Xp21. Primary transcription measures approximately 2,400 kb along with a mature mRNA of approximately 14 kb. Seventy-nine exons encode a protein of over 3,500 amino acids. Normal skeletal muscle tissue contains only small amounts of dystrophin, and the absence of its abnormal expression results in the development of severe and incurable pathologies. Some mutations in the dystrophin gene result in defective dystrophin and a severe dystrophy phenotype in affected patients. Some mutations in the dystrophin gene result in a partially functional dystrophin protein and a much milder dystrophy phenotype in affected patients.

[0032] DMD results from hereditary or spontaneous mutations that cause nonsense or frameshift mutations in the dystrophin gene. Spontaneous mutations and their consequences are relatively well understood for DMD. In-frame deletions occurring within the region of exons 45-55 contained within the rod domain (Figures 1 and 2) can produce a fairly functional dystrophin protein, and many carriers are asymptomatic or exhibit mild symptoms. Furthermore, theoretically, over 60% of patients could be treated by targeting this region as a whole (exons 45-55) or by targeting specific exons within this region of the dystrophin gene (e.g., targeting only exon 51). Efforts have been made to restore the disrupted dystrophin reading frame in DMD patients by skipping non-essential exons during mRNA splicing to produce an internally deleted but functional dystrophin protein (e.g., skipping of exon 51). Deletions of internal dystrophin exons (e.g., deletion of exon 51) retain an appropriate reading frame but cause a less severe Becker muscular dystrophy (BMD). The BMD genotype is similar to DMD in that the deletion is present within the dystrophin gene. However, the deletion in BMD leaves the reading frame intact. Thus, an internally shortened but partially functional dystrophin protein is produced. BMD has a wide range of phenotypes, but often, when the deletion is between exons 45-55 of dystrophin, the phenotype is much milder compared to DMD. Therefore, changing the DMD genotype to the BMD genotype is a common strategy for correcting dystrophin. There are many strategies for correcting dystrophin, but many of the strategies rely on restoring the reading frame of the endogenous dystrophin. This causes the disease genotype to shift from DMD to Becker muscular dystrophy. Many BMD patients have an intragenic deletion that maintains the translational reading frame, thereby producing a shorter but largely functional dystrophin protein.

[0033] In certain embodiments, modification of exons 45-55 to restore the reading frame (e.g., deletion or excision of exons 45-55 by NHEJ) ameliorates phenotypic DMD in a subject, including a DMD subject with a deletion mutation. Exons 45-55 of the dystrophin gene refer to the 45th exon, 46th exon, 47th exon, 48th exon, 49th exon, 50th exon, 51st exon, 52nd exon, 53rd exon, 54th exon, and 55th exon of the dystrophin gene. Mutations in the 45th-55th exon region are ideally suitable for permanent correction by NHEJ-based genome editing.

[0034] The gene constructs of the present disclosure may generate deletions in the dystrophin gene. The dystrophin gene may be the human dystrophin gene. In certain embodiments, the vector is configured to form two double-strand breaks (a first double-strand break and a second double-strand break) in two introns (a first intron and a second intron) that flank the target position of the dystrophin gene to delete a segment of the dystrophin gene that includes the dystrophin target position. The "dystrophin target position" can be a dystrophin exon target position or a dystrophin internal exon target position as described herein. Deletion of the dystrophin exon target position can optimize the dystrophin sequence in a subject suffering from Duchenne muscular dystrophy. For example, it can increase the function or activity of the encoded dystrophin protein and / or may lead to an improvement in the subject's disease condition. In certain embodiments, excision of the dystrophin exon target position restores the reading frame. The dystrophin exon target position can include one or more exons of the dystrophin gene. In certain embodiments, the dystrophin target position includes exon 51 of the dystrophin gene (e.g., the human dystrophin gene).

[0035] The gene constructs of the present disclosure can mediate highly efficient gene editing in the region of exons 45 to 55 of the dystrophin gene. The gene constructs of the present disclosure can restore dystrophin protein expression in cells derived from DMD patients. Exon skipping-mediated removal of exons 45-55 from dystrophin transcripts can be used to treat approximately 50% of all DMD patients. This class of dystrophin mutations is suitable for permanent correction by NHEJ-based genome editing and HDR. The gene constructs described herein were developed for targeted modification of exons 45-55 in the human dystrophin gene. The gene constructs of the present disclosure can be transfected into human DMD cells and mediate efficient gene modification and gene conversion into the correct reading frame. Protein restoration can be compatible with frame restoration and can be detected in the bulk population of CRISPR / Cas9-based gene editing system-treated cells.

[0036] b. CRISPR system The gene construct of the present disclosure may encode a CRISPR / Cas9-based gene editing system specific to the dystrophin gene. As used interchangeably herein, "clustered regularly interspaced short palindromic repeats" and "CRISPR" refer to genetic loci containing multiple short direct repeats found in approximately 40% of the sequenced bacterial and approximately 90% of the sequenced archaeal genomes. The CRISPR system is a microbial nuclease system involved in defense against invasion by phages and plasmids, providing a form of acquired immunity. The CRISPR locus in a microbial host includes a combination of CRISPR-associated (Cas) genes and non-coding RNA elements capable of programming the specificity of CRISPR-mediated nucleic acid cleavage. Short segments of foreign DNA, called spacers, are integrated into the genome between CRISPR repeats and serve as a "memory" of past exposure. Cas9 forms a complex with the 3' end of the sgRNA (also referred to interchangeably as "gRNA" herein), and the protein-RNA pair recognizes its genomic target by complementary base pairing between the 5' end of the sgRNA sequence and a predefined 20-bp DNA sequence known as the protospacer. This complex is directed to the homologous locus of the pathogen DNA via the region encoded within the crRNA, i.e., the protospacer, and the protospacer adjacent motif (PAM) within the pathogen genome. The non-coding CRISPR array is transcribed and cleaved within the direct repeat into individual spacer sequences that direct the Cas nuclease to the target site (protospacer). By simply exchanging the 20-bp recognition sequence of the expressed sgRNA, the Cas9 nuclease is directed to a new genomic target. CRISPR spacers are used to recognize and inactivate foreign genetic elements in a manner similar to RNAi in eukaryotes.

[0037] Three classes of CRISPR systems (Type I effector systems, Type II effector systems, and Type III effector systems) are known. The Type II effector system uses a single effector enzyme (Cas9) to cleave dsDNA and perform targeted DNA double-strand cleavage in four sequential steps. Compared to Type I and Type III effector systems, which require multiple different effectors that act as a complex, the Type II effector system can function in alternative contexts such as eukaryotic cells. The Type II effector system consists of a long pre-crRNA transcribed from a spacer-containing CRISPR locus, the Cas9 protein, and a tracrRNA involved in pre-crRNA processing. The tracrRNA hybridizes to the repeat region that separates the spacers of the pre-crRNA, initiating dsRNA cleavage by endogenous RNase III. After this cleavage, a second cleavage event occurs within each spacer by Cas9, producing mature crRNAs that continue to associate with tracrRNA and Cas9, forming the Cas9:crRNA-tracrRNA complex.

[0038] The Cas9:crRNA-tracrRNA complex unwinds the DNA double helix and searches for sequences complementary to the crRNA that cleaves. Target recognition occurs upon detection of complementarity between the "protospacer" sequence in the target DNA and the remaining spacer sequence in the crRNA. If the correct protospacer adjacent motif (PAM) is also present at the 3' end of the protospacer, Cas9 mediates cleavage of the target DNA. For protospacer targeting, there needs to be a protospacer adjacent motif (PAM), a short sequence recognized by the Cas9 nuclease required for DNA cleavage, immediately following the sequence. Different type II systems have different PAM requirements. The Streptococcus pyogenes CRISPR system may have a PAM sequence for this Cas9 (SpCas9) as 5'-NRG-3' (where R is A or G), which characterizes the specificity of this system in human cells. The unique ability of the CRISPR / Cas9-based gene editing system is the direct ability to simultaneously target multiple, mutually distinct genomic loci by co-expressing two or more sgRNAs and a single Cas9 protein. For example, the type II Streptococcus pyogenes system naturally prefers to use the "NGG" sequence where "N" can be any nucleotide, but also accepts other PAM sequences such as "NAG" in engineered systems (Hsu et al., Nature Biotechnology (2013) doi:10.1038 / nbt.2647). Similarly, Cas9 (NmCas9) derived from Neisseria meningitidis usually has the native PAM of NNNNGATT, but is active across a variety of PAMs including the highly degenerate NNNNGNNN PAM (Esvelt et al., Nature Methods (2013) doi:10.1038 / nmeth.2681).

[0039] The Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRR (R = A or G) (SEQ ID NO: 25) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, for example 3 to 5 bp, upstream of that sequence. In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRN (R = A or G) (SEQ ID NO: 26) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, for example 3 to 5 bp, upstream of that sequence. In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRT (R = A or G) (SEQ ID NO: 27) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, for example 3 to 5 bp, upstream of that sequence. In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRV (R = A or G) (SEQ ID NO: 28) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, for example 3 to 5 bp, upstream of that sequence. In the above-described embodiments, N can be any nucleotide residue, for example any of A, G, C or T. The Cas9 molecule can be engineered to alter the PAM specificity of the Cas9 molecule.

[0040] i) CRISPR / Cas9-based gene editing system The engineered form of the type II effector system of Streptococcus pyogenes has been shown to function in human cells for genome engineering. In this system, the Cas9 protein is directed to genomic target sites by a synthetically reconstituted "guide RNA" ("gRNA", also interchangeably used herein as chimeric single guide RNA ("sgRNA")) that generally obviates the need for RNase III and crRNA processing and is a crRNA-tracrRNA fusion. A CRISPR / Cas9-based engineered system for use in genome editing and treatment of genetic diseases is provided herein. The CRISPR / Cas9-based engineered system can be designed to target any gene, including genes involved in genetic diseases, aging, tissue regeneration, or wound healing. The CRISPR / Cas9-based gene editing system can comprise a Cas9 protein or a Cas9 fusion protein and at least one gRNA. In certain embodiments, the system comprises two gRNA molecules. The Cas9 fusion protein comprises domains having different activities, such as a transactivation domain, for example one that is endogenous to Cas9.

[0041] A target gene (e.g., the dystrophin gene, e.g., the human dystrophin gene) may be involved in any other process in which cell differentiation or gene activation may be desired, or may have mutations such as frameshift mutations or nonsense mutations. If the target gene has a mutation that results in a premature stop codon, an ectopic splice acceptor site, or an ectopic splice donor site, a CRISPR / Cas9-based gene editing system can be designed to recognize and bind to a nucleotide sequence upstream or downstream of the premature stop codon, ectopic splice acceptor site, or ectopic splice donor site. The CRISPR-Cas9-based system can also be used to disrupt normal gene splicing by inducing skipping of the premature stop codon or targeting splice acceptors and splice donors to restore the disrupted reading frame. The CRISPR / Cas9-based gene editing system may or may not mediate non-specific changes to the protein-coding regions of the genome.

[0042] (1) Cas9 molecule and Cas9 fusion protein The CRISPR / Cas9-based gene editing system can contain the Cas9 protein or a Cas9 fusion protein. The Cas9 protein is an endonuclease that cleaves nucleic acids, is encoded by the CRISPR locus, and is involved in the type II CRISPR system. The Cas9 protein is from Streptococcus pyogenes, Staphylococcus aureus (S. aureus), Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Alicycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp.) Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp.) Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp.) or may be derived from any bacterial or archaeal species, including but not limited to Verminephrobacter eiseniae. In certain embodiments, the Cas9 molecule is a Streptococcus pyogenes Cas9 molecule (also referred to herein as "SpCas9"). In certain embodiments, the Cas9 molecule is a Staphylococcus aureus Cas9 molecule (also referred to herein as "SaCas9").

[0043] The Cas9 molecule or Cas9 fusion protein is capable of interacting with one or more gRNA molecules and, together with the gRNA molecules, localizes to a site containing a target domain and, in certain embodiments, a PAM sequence. The ability of a Cas9 molecule or Cas9 fusion protein to recognize a PAM sequence can be determined, for example, using transformation assays known in the art. In certain embodiments, the ability of a Cas9 molecule or Cas9 fusion protein to interact with and cleave a target nucleic acid is dependent on a PAM sequence. The PAM sequence is a sequence within the target nucleic acid. In certain embodiments, cleavage of the target nucleic acid occurs upstream of the PAM sequence. Cas9 molecules derived from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRR (R = A or G) (SEQ ID NO: 25) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, e.g., 3 to 5 bp, upstream of that sequence. In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRN (R = A or G) (SEQ ID NO: 26) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, e.g., 3 to 5 bp, upstream of that sequence. In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRT (R = A or G) (SEQ ID NO: 27) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, e.g., 3 to 5 bp, upstream of that sequence. In certain embodiments, the Cas9 molecule of Staphylococcus aureus recognizes the sequence motif NNGRRV (R = A or G, V = A or C or G) (SEQ ID NO: 28) and directs cleavage of the target nucleic acid sequence 1 to 10 bp, e.g., 3 to 5 bp, upstream of that sequence. In the above embodiments, N can be any nucleotide residue, e.g., any of A, G, C, or T. The Cas9 molecule can be engineered to alter the PAM specificity of the Cas9 molecule.

[0044] In certain embodiments, the vector encodes at least one Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of NNGRRT (SEQ ID NO: 27) or NNGRRV (SEQ ID NO: 28). In certain embodiments, the at least one Cas9 molecule is a Staphylococcus aureus Cas9 molecule. In certain embodiments, the at least one Cas9 molecule is a mutant Staphylococcus aureus Cas9 molecule. Additionally or alternatively, the nucleic acid encoding the Cas9 molecule or Cas9 polypeptide may contain a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art. Exemplary codon-optimized nucleic acid sequences encoding the Cas9 molecule of Staphylococcus aureus and optionally containing a nuclear localization sequence (NLS) are shown in SEQ ID NOs: 31-37. Another exemplary codon-optimized nucleic acid sequence encoding the Cas9 molecule of Staphylococcus aureus contains nucleotides 1293-4451 of SEQ ID NO: 38.

[0045] In some embodiments, the nucleotide sequence encoding the Staphylococcus aureus Cas9 molecule contains the polynucleotide sequence of SEQ ID NO: 37. The amino acid sequence of the Staphylococcus aureus Cas9 molecule is shown in SEQ ID NO: 39. The amino acid sequence of the Staphylococcus aureus Cas9 molecule is shown in SEQ ID NO: 40. Alternatively or additionally, the CRISPR / Cas9-based gene editing system can include a fusion protein. The fusion protein contains two heterologous polypeptide domains, where the first polypeptide domain contains a Cas protein and the second polypeptide domain has an activity such as transcriptional activation activity, transcriptional repression activity, transcription termination factor activity, histone modification activity, nuclease activity, nucleic acid binding activity, methylase activity or demethylase activity. The fusion protein can include a Cas9 protein or a mutant Cas9 protein fused to a second polypeptide domain having an activity such as transcriptional activation activity, transcriptional repression activity, transcription termination factor activity, histone modification activity, nuclease activity, nucleic acid binding activity, methylase activity or demethylase activity.

[0046] (a) Transcriptional activation activity The second polypeptide domain may have transcriptional activation activity, i.e., a trans-activation domain. For example, gene expression of endogenous mammalian genes such as human genes can be achieved by targeting the fusion protein of iCas9 and the trans-activation domain to the mammalian promoter by a combination of gRNAs. The trans-activation domain can include a p300 protein, a VP16 protein, multiple types of VP16 proteins, such as a VP48 domain or a VP64 domain, or a p65 domain with NF kappa B transcriptional activator activity. For example, the fusion protein may be dCas9-VP64 or dCas9-p300. (b) Transcriptional repression activity The second polypeptide domain may have transcriptional repression activity. The second polypeptide domain may have Kruppel-associated box activity, such as a KRAB domain, ERF repressor domain activity, Mxil repressor domain activity, SID4X repressor domain activity, Mad-SID repressor domain activity, or TATA box binding protein activity. For example, the fusion protein may be dCas9-KRAB.

[0047] (c) Transcription termination factor activity The second polypeptide domain may have transcription termination factor activity. The second polypeptide domain may have eukaryotic termination factor 1 (ERF1) activity or eukaryotic termination factor 3 (ERF3) activity. (d) Histone modification activity The second polypeptide domain may have histone modification activity. The second polypeptide domain may have histone deacetylase activity, histone acetyltransferase activity, histone demethylase activity, or histone methyltransferase activity. The histone acetyltransferase may be a p300 protein or a CREB binding protein (CBP) protein or a fragment thereof. For example, the fusion protein may be dCas9-p300.

[0048] (e) Nuclease activity The second polypeptide domain may have nuclease activity different from that of the Cas9 protein. A nuclease, or a protein having nuclease activity, is an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases are usually further divided into endonucleases and exonucleases, although some enzymes may fall into both categories. Well-known nucleases are deoxyribonucleases and ribonucleases. (f) Nucleic acid binding activity The second polypeptide domain may be capable of having nucleic acid binding activity, or the nucleic acid binding protein-DNA binding domain (DBD) is an independently folded protein domain containing at least one motif that recognizes double-stranded DNA or single-stranded DNA. The DBD may be capable of recognizing a specific DNA sequence (recognition sequence), or may have a general affinity for a nucleic acid binding region selected from the group consisting of DNA, i.e., helix-turn-helix region, leucine zipper region, winged helix region, winged helix-turn-helix region, helix-loop-helix region, immunoglobulin fold, B3 domain, zinc finger, HMG-box, Wor3 domain, TAL effector DNA binding domain.

[0049] (g) Methylase activity The second polypeptide domain may have methylase activity including transferring a methyl group to DNA, RNA, protein, small molecule, cytosine or adenine. The second polypeptide domain may include a DNA methyltransferase. (h) Demethylase activity The second polypeptide domain may have demethylase activity. The second polypeptide domain can include enzymes that remove methyl (CH3-) groups from nucleic acids, proteins (especially histones), and other molecules. In another case, the second polypeptide can convert a methyl group to hydroxymethylcytosine in a mechanism for demethylating DNA. The second polypeptide can catalyze this reaction. For example, the second polypeptide that catalyzes this reaction can be Tet1.

[0050] (2) gRNA targeting the dystrophin gene The CRISPR / Cas9-based gene editing system includes at least one gRNA molecule, for example, two gRNA molecules. The gRNA provides targeting of the CRISPR / Cas9-based gene editing system. The gRNA is a fusion of two non-coding RNAs, namely, crRNA and tracrRNA. The sgRNA can target any desired DNA sequence by replacing the sequence encoding a 20bp protospacer that confers specific targeting by complementary bases that pair with the desired DNA target. The gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in the type II effector system. This duplex, which may include, for example, a 42-nucleotide crRNA and a 75-nucleotide tracrRNA, acts as a guide for Cas9 to cleave the target nucleic acid. The "target region", "target sequence" or "protospacer" may be used interchangeably herein and refers to the region of the target gene (e.g., the dystrophin gene) targeted by the CRISPR / Cas9-based gene editing system. The CRISPR / Cas9-based gene editing system may include at least one gRNA where each gRNA targets a different DNA sequence. The target DNA sequences may overlap. After the target sequence or protospacer, there is a PAM sequence at the 3' end of the protospacer. Different type II systems have different PAM requirements. For example, the type II system of Streptococcus pyogenes uses the "NGG" sequence where "N" can be any nucleotide. In some embodiments, the PAM sequence may be "NGG" where "N" can be any nucleotide. In some embodiments, the PAM sequence may be NNGRRT (SEQ ID NO: 27) or NNGRRV (SEQ ID NO: 28).

[0051] The number of gRNA molecules encoded by the gene constructs (e.g., AAV vectors) of the present disclosure can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least 45 different gRNAs or at least 50 different gRNAs. The number of gRNA molecules encoded by the gene constructs of the present disclosure can be less than 50 gRNAs, less than 45 different gRNAs, less than 40 different gRNAs, less than 35 different gRNAs, less than 30 different gRNAs, less than 25 different gRNAs, less than 20 different gRNAs, less than 19 different gRNAs, less than 18 different gRNAs, less than 17 different gRNAs, less than 16 different gRNAs, less than 15 different gRNAs, less than 14 different gRNAs, less than 13 different gRNAs, less than 12 different gRNAs, less than 11 different gRNAs, less than 10 different gRNAs, less than 9 different gRNAs, less than 8 different gRNAs, less than 7 different gRNAs, less than 6 different gRNAs, less than 5 different gRNAs, less than 4 different gRNAs or less than 3 different gRNAs.The number of gRNAs encoded by the gene constructs of the present disclosure can be between at least 1 gRNA to at least 50 different gRNAs, at least 1 gRNA to at least 45 different gRNAs, at least 1 gRNA to at least 40 different gRNAs, at least 1 gRNA to at least 35 different gRNAs, at least 1 gRNA to at least 30 different gRNAs, at least 1 gRNA to at least 25 different gRNAs, at least 1 gRNA to at least 20 different gRNAs, at least 1 gRNA to at least 16 different gRNAs, at least 1 gRNA to at least 12 different gRNAs, at least 1 gRNA to at least 8 different gRNAs, at least 1 gRNA to at least 4 different gRNAs, at least 4 gRNAs to at least 50 different gRNAs, at least 4 different gRNAs to at least 45 different gRNAs, at least 4 different gRNAs to at least 40 different gRNAs, at least 4 different gRNAs to at least 35 different gRNAs, at least 4 different gRNAs to at least 30 different gRNAs, at least 4 different gRNAs to at least 25 different gRNAs, at least 4 different gRNAs to at least 20 different gRNAs, at least 4 different gRNAs to at least 16 different gRNAs, at least 4 different gRNAs to at least 12 different gRNAs, at least 4 different gRNAs to at least 8 different gRNAs, at least 8 different gRNAs to at least 50 different gRNAs, at least 8 different gRNAs to at least 45 different gRNAs, at least 8 different gRNAs to at least 40 different gRNAs, at least 8 different gRNAs to at least 35 different gRNAs, 8 different gRNAs to at least 30 different gRNAs, at least 8 different gRNAs to at least 25 different gRNAs, 8 different gRNAs to at least 20 different gRNAs, at least 8 different gRNAs to at least 16 different gRNAs, or 8 different gRNAs to at least 12 different gRNAs.In certain embodiments, a gene construct (e.g., an AAV vector) encodes one gRNA molecule, namely, a first gRNA molecule, and optionally a Cas9 molecule. In certain embodiments, a first gene construct (e.g., a first AAV vector) encodes one gRNA molecule, namely, a first gRNA molecule, and optionally a Cas9 molecule, and a second gene construct (e.g., a second AAV vector) encodes one gRNA molecule, namely, a second gRNA molecule, and optionally a Cas9 molecule.

[0052] The gRNA molecule comprises a target domain (also referred to as a target sequence), which is a complementary polynucleotide sequence of a target DNA sequence followed by a PAM sequence. The gRNA may contain a "G" at the 5' end of the target domain or the complementary polynucleotide sequence. The target domain of the gRNA molecule may comprise a complementary polynucleotide sequence of at least 10 base pairs, at least 11 base pairs, at least 12 base pairs, at least 13 base pairs, at least 14 base pairs, at least 15 base pairs, at least 16 base pairs, at least 17 base pairs, at least 18 base pairs, at least 19 base pairs, at least 20 base pairs, at least 21 base pairs, at least 22 base pairs, at least 23 base pairs, at least 24 base pairs, at least 25 base pairs, at least 30 base pairs or at least 35 base pairs of the target DNA sequence followed by a PAM sequence. The target domain of the gRNA molecule may comprise a complementary polynucleotide sequence of less than 40 base pairs, less than 35 base pairs, less than 30 base pairs, less than 25 base pairs, less than 20 base pairs, less than 19 base pairs, less than 18 base pairs, less than 17 base pairs, less than 16 base pairs, less than 15 base pairs, less than 14 base pairs, less than 13 base pairs, less than 12 base pairs, less than 11 base pairs or less than 10 base pairs of the target DNA sequence followed by a PAM sequence. In certain embodiments, the target domain of the gRNA molecule has a length of 19 to 25 nucleotides. In certain embodiments, the target domain of the gRNA molecule is 20 nucleotides in length. In certain embodiments, the target domain of the gRNA molecule is 21 nucleotides in length. In certain embodiments, the target domain of the gRNA molecule is 22 nucleotides in length. In certain embodiments, the target domain of the gRNA molecule is 23 nucleotides in length.

[0053] The gRNA may target regions of the dystrophin gene (DMD). In certain embodiments, the gRNA may target at least one of an exon, intron, promoter region, enhancer region, or transcription region of the dystrophin gene. In certain embodiments, the gRNA molecule targets intron 44 of the human dystrophin gene. In certain embodiments, the gRNA molecule targets intron 55 of the human dystrophin gene. In some embodiments, the first gRNA and the second gRNA each target an intron of the human dystrophin gene such that exons 45-55 are deleted. The gRNA may bind to, and may target, a polynucleotide sequence corresponding to SEQ ID NO: 2, or a fragment thereof, or its complement. The gRNA may be encoded by a polynucleotide sequence comprising SEQ ID NO: 2, or a fragment thereof, or its complement. The target sequence of the gRNA may include the polynucleotide of SEQ ID NO: 2, or a fragment thereof, such as a 5'-truncation thereof, or its complement. The truncation may be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides shorter than SEQ ID NO: 2. In some embodiments, the gRNA may bind to, and may target, the polynucleotide of SEQ ID NO: 2. In some embodiments, the gRNA may bind to, and may target, a 5'-truncation of the polynucleotide of SEQ ID NO: 2. The gRNA may bind to, and may target, a polynucleotide sequence corresponding to SEQ ID NO: 3, or a fragment thereof, or its complement. The gRNA may be encoded by a polynucleotide sequence comprising SEQ ID NO: 3, or a fragment thereof, or its complement. The target sequence of the gRNA may include the polynucleotide of SEQ ID NO: 3, or a fragment thereof, such as a 5'-truncation thereof, or its complement. The truncation may be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides shorter than SEQ ID NO: 3. In some embodiments, the gRNA may bind to, and may target, the polynucleotide of SEQ ID NO: 3. In some embodiments, the gRNA may bind to, and may target, a 5'-truncation of the polynucleotide of SEQ ID NO: 3.In some embodiments, the gRNA that comprises SEQ ID NO:2, or binds to, targets, or is encoded by a polynucleotide sequence corresponding to SEQ ID NO:2 or a truncation thereof, pairs with the gRNA that comprises SEQ ID NO:3, or binds to, targets, or is encoded by a polynucleotide sequence corresponding to SEQ ID NO:3 or a truncation thereof.

[0054] Single or multiplex gRNAs can be designed to restore the dystrophin reading frame by targeting mutation hotspots in exons 45-55 of dystrophin. After treatment with the vectors of the present disclosure, dystrophin expression can be restored in Duchenne patient muscle cells in vitro. Human dystrophin was detected in vivo after transplantation of genetically corrected patient cells into immunodeficient mice. Significantly, the unique multiplex gene editing ability of the CRISPR / Cas9-based gene editing system enables efficient generation of large deletions in this mutation hotspot region that can correct up to 62% of patient mutations by a general or patient-specific gene editing approach. In some embodiments, candidate gRNAs are evaluated and selected based on off-target activity, on-target activity, and distance from the exon as measured by the investigator.

[0055] (3) gRNA Scaffold The CRISPR / Cas9-based gene editing system includes at least one gRNA scaffold. The gRNA scaffold facilitates the binding of the gRNA and Cas9 to endonuclease activity. The gRNA scaffold is a polynucleotide sequence following the gRNA target sequence. The gRNA target sequence and the gRNA scaffold together form one polynucleotide. In some embodiments, the gRNA scaffold includes the polynucleotide sequence of SEQ ID NO: 4 or its complement. In some embodiments, the gRNA scaffold is encoded by the polynucleotide sequence of SEQ ID NO: 4 or its complement. In some embodiments, the gRNA includes a polynucleotide targeting the sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or a shortening thereof, and a polynucleotide corresponding to or encoding the gRNA scaffold of SEQ ID NO: 4.

[0056] 3. DNA Target Composition A DNA target composition containing such a gene construct is further disclosed herein. The DNA target composition includes at least one gRNA molecule (e.g., two gRNA molecules) targeting the dystrophin gene (e.g., the human dystrophin gene) as described above. The at least one gRNA molecule is capable of binding to and recognizing a target region. The target region can be selected immediately upstream of an out-of-frame stop codon such that an insertion or deletion during the repair process restores the dystrophin reading frame by a frameshift. The target region can also be a splice acceptor site or a splice donor site, such that an insertion or deletion during the repair process disrupts splicing and restores the dystrophin reading frame by splice site disruption and exon exclusion. The target region can also be a heterologous stop codon such that an insertion or deletion during the repair process restores the dystrophin reading frame by removing or disrupting the stop codon.

[0057] In certain embodiments, the DNA target composition of the present disclosure comprises a first gRNA and a second gRNA. The first gRNA molecule and the second gRNA molecule may each bind to or target a polynucleotide of SEQ ID NO: 2 and SEQ ID NO: 3, or a shortening thereof, or a complement thereof. The first gRNA molecule and the second gRNA molecule may each comprise a polynucleotide corresponding to SEQ ID NO: 2 and SEQ ID NO: 3, or a shortening thereof, or a complement thereof. The deletion efficiency of the vectors of the present disclosure may be related to the size of the deletion, i.e., the size of the segment deleted by the vector. In certain embodiments, the length or size of the specific deletion is determined by the distance between PAM sequences within the target gene (e.g., the dystrophin gene). In certain embodiments, the specific deletion of a segment of the dystrophin gene defined with respect to its length and the sequences it contains (e.g., exon 51) is the result of cleavage made adjacent to specific PAM sequences in the target gene (e.g., the dystrophin gene).

[0058] In certain embodiments, the size of the deletion is from about 50 to about 2,000 base pairs (bp), such as from about 50 to about 1999 bp, from about 50 to about 1900 bp, from about 50 to about 1800 bp, from about 50 to about 1700 bp, from about 50 to about 1650 bp, from about 50 to about 1600 bp, from about 50 to about 1500 bp, from about 50 to about 1400 bp, from about 50 to about 1300 bp, from about 50 to about 1200 bp, from about 50 to about 1150 bp, from about 50 to about 1100 bp, from about 50 to about 1000 bp, from about 50 to about 900 bp, from about 50 to about 850 bp, from about 50 to about 800 bp, from about 50 to about 750 bp, from about 50 to about 700 bp, from about 50 to about 600 bp, from about 50 to about 500 bp, from about 50 to about 400 bp, from about 50 to about 350 bp, from about 50 to about 300 bp, from about 50 to about 250 bp, from about 50 to about 200 bp, from about 50 to about 150 bp, from about 50 to about 100 bp, from about 100 to about 1999 bp, from about 100 to about 1900 bp, from about 100 to about 1800 bp, from about 100 to about 1700 bp, from about 100 to about 1650 bp, from about 100 to about 1600 bp, from about 100 to about 1500 bp, from about 100 to about 1400 bp, from about 100 to about 1300 bp, from about 100 to about 1200 bp, from about 100 to about 1150 bp, from about 100 to about 1100 bp, from about 100 to about 1000 bp, from about 100 to about 900 bp, from about 100 to about 850 bp, from about 100 to about 800 bp, from about 100 to about 750 bp, from about 100 to about 700 bp, from about 100 to about 600 bp, from about 100 to about 1000 bp, from about 100 to about 400 bp, from about 100 to about 350 bp, from about 100 to about 300 bp, from about 100 to about 250 bp, from about 100 to about 200 bp, from about 100 to about 150 bp, from about 200 to about 1999 bp, from about 200 to about 1900 bp, from about 200 to about 1800 bp, from about 200 to about 1700 bp, from about 200 to about 1650 bp, from about 200 to about 1600 bp, from about 200 to about 1500 bp, from about 200 to about 1400 bp, from about 200 to about 1300 bp, from about 200 to about 1200 bp, from about 200 to about 1150 bp, from about 200 to about 1100 bp, from about 200 to about 1000 bp, from about 200 to about 900 bp, from about 200 to about 850 bp, from about 200 to about 800 bp, from about 200 to about 750 bp, from about 200 to about 700 bp, from about 200 to about 600 bp, from about 200 to about 2000 bp, from about 200 to about 400 bp, from about 200 to about 350 bp, from about 200 to about 300 bp, from about 200 to about 250 bp, from about 300 to about 1999 bp,It is about 300 to about 1900 bp, about 300 to about 1800 bp, about 300 to about 1700 bp, about 300 to about 1650 bp, about 300 to about 1600 bp, about 300 to about 1500 bp, about 300 to about 1400 bp, about 300 to about 1300 bp, about 300 to about 1200 bp, about 300 to about 1150 bp, about 300 to about 1100 bp, about 300 to about 1000 bp, about 300 to about 900 bp, about 300 to about 850 bp, about 300 to about 800 bp, about 300 to about 750 bp, about 300 to about 700 bp, about 300 to about 600 bp, about 300 to about 3000 bp, about 300 to about 400 bp, or about 300 to about 350 bp. In certain embodiments, the size of the deletion can be about 118 base pairs, about 233 base pairs, about 326 base pairs, about 766 base pairs, about 805 base pairs or about 1611 base pairs.,

[0059] 4. Compositions for Genome Editing in Muscle For example, gene constructs or compositions thereof for genome editing of a target gene in a subject, such as a target gene in the skeletal muscle and / or cardiac muscle of the subject, are disclosed herein. The gene construct may be a vector. The vector may be a modified AAV vector. The composition may include a polynucleotide sequence encoding a CRISPR / Cas9-based gene editing system. The composition may deliver an active CRISPR / Cas9-based gene editing system to skeletal muscle or cardiac muscle. The gene constructs of the present disclosure can be used to correct or reduce the effect of mutations in the dystrophin gene involved in genetic diseases and / or other skeletal muscle or cardiac muscle conditions such as DMD. The composition may further include donor DNA or a transgene. These compositions may be used for genome editing, genome manipulation, and for correcting or reducing the effect of mutations in genes involved in genetic diseases and / or other skeletal muscle and / or cardiac muscle conditions.,

[0060] a. CRISPR / Cas9-Based Gene Editing System for Targeting Dystrophin A CRISPR / Cas9-based gene editing system that is specific in addition to the dystrophin gene is disclosed herein. The CRISPR / Cas9-based gene editing system may include Cas9 and at least one gRNA for targeting the dystrophin gene. The CRISPR / Cas9-based gene editing system may bind to and recognize a target region. The target region may be selected immediately upstream of an out-of-frame stop codon such that an insertion or deletion during the repair process restores the dystrophin reading frame by frameshift. The target region may be a splice acceptor site or a splice donor site, such that an insertion or deletion during the repair process disrupts splicing and restores the dystrophin reading frame by splice site disruption and exon exclusion. The target region may be a heterologous stop codon such that an insertion or deletion during the repair process restores the dystrophin reading frame by removing or disrupting the stop codon. The target region may include an intron of the dystrophin gene. The target region may include an exon of the dystrophin gene.

[0061] b. Adeno-associated virus vector The composition may include a viral delivery system. In certain embodiments, the vector is an adeno-associated virus (AAV) vector. AAV vectors are small viruses belonging to the Dependovirus genus of the Parvoviridae family that infect humans and several other primate species. AAV vectors may be used to deliver a CRISPR / Cas9-based gene editing system using various construct configurations. For example, AAV vectors may deliver Cas9 and gRNA expression cassettes on separate vectors or the same vector. In another case, when a small Cas9 protein derived from a species such as Staphylococcus aureus or Neisseria meningitidis is used, both Cas9 and up to two gRNA expression cassettes may be combined in a single AAV vector within the 4.7 kb packaging limit.

[0062] In certain embodiments, the AAV vector is a modified AAV vector. The modified AAV vector may have enhanced myocardial tissue affinity and skeletal muscle tissue affinity. The modified AAV vector may be capable of delivering and expressing a CRISPR / Cas9-based gene editing system in mammalian cells. For example, the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646). The modified AAV vector may deliver a nuclease to skeletal muscle and myocardium in vivo. The modified AAV vector may be based on one or more of several capsid types including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. The modified AAV vector may be based on an AAV2 pseudotype having alternative muscle affinity AAV capsids such as AAV2 / 1 vector, AAV2 / 6 vector, AAV2 / 7 vector, AAV2 / 8 vector, AAV2 / 9 vector, AAV2.5 vector, and AAV / SASTG vector that efficiently transduce skeletal muscle or myocardium by systemic delivery and local delivery (Seto et al., Current Gene Therapy (2012) 12:139-151). The modified AAV vector may be AAV2i8G9 (Shen et al., J. Biol. Chem. (2013) 288:28814-28823). The AAV vector may be AAVrh74.

[0063] 5. Method a. Method for Genome Editing in Muscle Methods of genome editing in a subject are disclosed herein. The genome editing may be in the subject's skeletal muscle and / or cardiac muscle. The methods may include administering to the subject's skeletal muscle and / or cardiac muscle a system or composition for genome editing as described above. The genome editing may include correcting a mutant gene or inserting a transgene. Correcting a mutant gene may include deleting, rearranging, or substituting the mutant gene. Correcting a mutant gene may include nuclease-mediated NHEJ or nuclease-mediated HDR.

[0064] b. A method of correcting a mutant gene and treating a subject Methods for correcting mutant genes (e.g., mutant dystrophin genes, e.g., mutant human dystrophin genes) in cells and treating subjects suffering from genetic diseases such as DMD are disclosed herein. The methods can include administering to the cells or subject the systems or gene constructs (e.g., vectors) of the present disclosure described above or compositions containing the same. The methods can include administering to the skeletal muscle and / or myocardium of the subject the systems or gene constructs (e.g., vectors) of the present disclosure for genome editing in skeletal muscle and / or myocardium described above or compositions containing the same. By use of the systems or gene constructs (e.g., vectors) of the present disclosure or compositions containing the same for delivering a CRISPR / Cas9-based gene editing system to skeletal muscle or myocardium, expression of a fully functional protein or a partially functional protein by a repair template DNA or donor DNA capable of replacing an entire gene or region containing the mutation may be restored. The CRISPR / Cas9-based gene editing system may be used to introduce a site-specific double-strand break at a target genomic locus. The site-specific double-strand break occurs when cleavage of the target DNA is enabled by binding of the CRISPR / Cas9-based gene editing system to the target DNA sequence. This DNA cleavage may stimulate the natural DNA repair mechanism, thereby resulting in one of two possible repair pathways, namely, the homology-directed repair (HDR) pathway or the non-homologous end joining (NHEJ) pathway.

[0065] Provided herein is a CRISPR / Cas9-based gene editing system without a repair template that can efficiently correct a reading frame and restore the expression of a functional protein involved in a genetic disease. The disclosed CRISPR / Cas9-based gene editing system may employ a homology-directed repair-based correction method or a nuclease-mediated non-homologous end joining (NHEJ)-based correction method that enables efficient correction in a growth-limited primary cell line that may not be suitable for homologous recombination or selection-based gene correction. This strategy integrates a rapid and robust construct of an active CRISPR / Cas9-based gene editing system by an efficient gene editing method for the treatment of genetic diseases caused by mutations in non-essential coding regions that cause frameshifts, premature stop codons, ectopic splice donor sites, or ectopic splice acceptor sites.

[0066] i) Nuclease-mediated non-homologous end joining Restoration of protein expression from an endogenous mutant gene may be by NHEJ-mediated DNA repair without a template. In contrast to transient methods targeting target gene RNA, correction of the target gene reading frame in the genome by a transiently expressed CRISPR / Cas9-based gene editing system may result in permanently restored target gene expression by all of the modified cells and their progeny. In certain embodiments, NHEJ refers to NHEJ induced by a Cas9 molecule in certain embodiments, nuclease-mediated NHEJ that cleaves double-stranded DNA. The method includes administering to a subject's skeletal muscle or myocardium for genome editing in the skeletal muscle or myocardium the gene construct (e.g., vector) of the present disclosure or a composition comprising the same.

[0067] Nuclease-mediated NHEJ gene correction can correct mutant target genes and offers several potential advantages over the HDR pathway. For example, NHEJ does not require a donor template that can cause non-specific insertion mutations. In contrast to HDR, NHEJ works efficiently in all phases of the cell cycle and can thus be effectively utilized in both cycling cells, such as muscle fibers, and post-mitotic cells. This provides robust and permanent gene restoration as an alternative to oligonucleotide-based exon skipping of stop codons or pharmacological forced readthrough, and potentially requires only a single drug treatment. NHEJ-based gene correction using CRISPR / Cas9-based gene editing systems as well as other engineered nucleases, including meganucleases and zinc finger nucleases, may be combined with other existing ex vivo and in vivo platforms for cell-based and gene-based therapies in addition to the plasmid electroporation technique described herein. For example, delivery of a CRISPR / Cas9-based gene editing system by mRNA-based gene transfer or as a purified cell-permeable protein can enable a DNA-free genome editing approach that avoids any possibility of insertion mutations.

[0068] ii) Homology-directed repair Restoration of protein expression from an endogenous mutant gene may involve homology-directed repair. The methods described above further include administering a donor template to the cell. The donor template may include a nucleotide sequence encoding a fully functional or partially functional protein. For example, the donor template may include a miniaturized dystrophin construct, termed minidystrophin ("minidys"), which is a fully functional dystrophin construct for restoring the mutant dystrophin gene or a fragment of the dystrophin gene that results in restoration of the mutant dystrophin gene after homology-directed repair.

[0069] iii) A method of correcting a mutant gene and treating a subject using CRISPR / Cas9 The present disclosure is also directed to genome editing by a CRISPR / Cas9-based gene editing system for restoring the expression of a fully functional protein or a partially functional protein by a repair template or donor DNA capable of replacing an entire gene or region containing a mutation. The CRISPR / Cas9-based gene editing system may be used to introduce a site-specific double-strand break at a target genomic locus. A site-specific double-strand break occurs when the CRISPR / Cas9-based gene editing system binds to a target DNA sequence using a gRNA, enabling cleavage of the target DNA. The CRISPR / Cas9-based gene editing system has the advantage of high levels of genome editing with a high percentage of successful and efficient gene modification. This DNA cleavage may stimulate the natural DNA repair mechanism, thereby resulting in one of two possible repair pathways, namely, the homology-directed repair (HDR) pathway or the non-homologous end joining (NHEJ) pathway.

[0070] The present disclosure is directed to genome editing by a CRISPR / Cas9-based gene editing system that is capable of efficiently correcting a reading frame and restoring the expression of a functional protein involved in a genetic disease in the absence of a repair template. The disclosed CRISPR / Cas9-based gene editing systems and methods may involve using a homology-directed repair approach or a nuclease-mediated non-homologous end joining (NHEJ)-based correction approach that enables efficient correction in growth-limited primary cell lines that may not be suitable for homologous recombination or selection-based gene correction. This strategy incorporates a rapid and robust construct of an active CRISPR / Cas9-based gene editing system by an efficient gene editing method for the treatment of genetic diseases caused by mutations in non-essential coding regions that cause frameshifts, premature stop codons, ectopic splice donor sites, or ectopic splice acceptor sites.

[0071] The present disclosure provides a method for correcting mutant genes in cells and treating a subject suffering from a genetic disease such as DMD. The method may include administering to the cell or subject a CRISPR / Cas9-based gene editing system as described above, a polynucleotide or vector encoding the CRISPR / Cas9-based gene editing system, or a composition of the CRISPR / Cas9-based gene editing system. The method may include administering a CRISPR / Cas9-based gene editing system, for example, a Cas9 protein or Cas9 fusion protein comprising a second domain having nuclease activity, a nucleotide sequence encoding the Cas9 protein or Cas9 fusion protein, and / or administering at least one gRNA, wherein the gRNA targets different DNA sequences. The target DNA sequences may be overlapping. The number of gRNAs administered to the cell may be at least one gRNA, at least two different gRNAs, at least three different gRNAs, at least four different gRNAs, at least five different gRNAs, at least six different gRNAs, at least seven different gRNAs, at least eight different gRNAs, at least nine different gRNAs, at least ten different gRNAs, at least fifteen different gRNAs, at least twenty different gRNAs, at least thirty different gRNAs or at least fifty different gRNAs as described above. The method may include homology-directed repair or non-homologous end joining.

[0072] c. Method of treating a disease The present disclosure is directed to methods of treating a subject as needed. The methods include administering to a tissue of the subject a system or gene construct (e.g., a vector) of the present disclosure as described above or a composition comprising the same. In certain embodiments, the methods may include administering to the skeletal muscle or cardiac muscle of the subject a system or gene construct (e.g., a vector) of the present disclosure as described above or a composition comprising the same. In certain embodiments, the methods may include administering to a vein of the subject a system or gene construct (e.g., a vector) of the present disclosure as described above or a composition comprising the same. In certain embodiments, the subject is afflicted with a skeletal muscle condition or a cardiac muscle condition that causes degeneration or weakness or a genetic disease. For example, the subject may be afflicted with Duchenne muscular dystrophy as described above.

[0073] i) Duchenne muscular dystrophy The methods described above may be used to correct the dystrophin gene and restore full or partially functional protein expression of the mutant dystrophin gene. In some aspects and embodiments, the present disclosure provides methods for reducing the effects (e.g., clinical symptoms / clinical metrics) of DMD in a patient. In some aspects and embodiments, the present disclosure provides methods for treating DMD in a patient. In some aspects and embodiments, the present disclosure provides methods for preventing DMD in a patient. In some aspects and embodiments, the present disclosure provides methods for preventing further progression of DMD in a patient.

[0074] 6. Constructs and plasmids The composition described above may include one or more gene constructs encoding the CRISPR / Cas9-based gene editing system disclosed herein. A gene construct such as a plasmid may include a nucleic acid encoding at least one of a Cas9 protein and / or a Cas9 fusion protein and / or a gRNA, etc., of the CRISPR / Cas9-based gene editing system. The composition described above may include a gene construct encoding the modified AAV vector disclosed herein and a nucleic acid sequence encoding the CRISPR / Cas9-based gene editing system. A gene construct such as a plasmid may include a nucleic acid encoding the CRISPR / Cas9-based gene editing system. The composition described above may include a gene construct encoding the modified lentiviral vector disclosed herein.

[0075] A gene construct such as a recombinant plasmid or a recombinant viral particle may include a nucleic acid encoding a Cas9 fusion protein and at least one gRNA. In some embodiments, the gene construct may include a nucleic acid encoding a Cas9 fusion protein and at least two different gRNAs. In some embodiments, the gene construct may include a nucleic acid encoding a Cas9 fusion protein and more than two different gRNAs. In some embodiments, the gene construct may include a promoter operably linked to a nucleotide sequence encoding at least one gRNA molecule and / or a Cas9 molecule. In some embodiments, the promoter is operably linked to a nucleotide sequence encoding a first gRNA molecule, a second gRNA molecule, and / or a Cas9 molecule. The gene construct may exist intracellularly as a functional extrachromosomal molecule. The gene construct may be a linear minichromosome including a centromere, a telomere, or a plasmid or a cosmid.

[0076] The gene construct may be part of the genome of a recombinant viral vector, including recombinant lentivirus, recombinant adenovirus, and recombinant adeno-associated virus. The gene construct may be part of the genetic material in an attenuated, live microorganism or a recombinant microbial vector that lives within a cell. The gene construct may include regulatory elements for the gene expression of the coding sequence of the nucleic acid. The regulatory element may be a promoter, enhancer, start codon, stop codon, or polyadenylation signal.

[0077] In certain embodiments, the gene construct is a vector. The vector can be an adeno-associated virus (AAV) vector encoding at least one Cas9 molecule and at least one gRNA molecule, and the vector can express at least one Cas9 molecule and at least one gRNA molecule in mammalian cells. The vector can be a plasmid. The vector can be used for gene therapy in vivo. The vector may be recombinant. The vector may include a heterologous nucleic acid encoding a fusion protein such as a Cas9 fusion protein or a CRISPR / Cas9-based gene editing system. The vector may be a plasmid. The vector is useful for transfecting cells with a nucleic acid encoding a Cas9 fusion protein or a CRISPR / Cas9-based gene editing system, under conditions where the transformed host cells are cultured and maintained such that expression of the Cas9 fusion protein or the CRISPR / Cas9-based gene editing system occurs. The coding sequence may be optimized for expression stability and high levels. In some examples, the codons are selected to reduce the formation of secondary structures of RNA, such as those formed by intramolecular binding.

[0078] The vector may contain a heterologous nucleic acid encoding a CRISPR / Cas9-based gene editing system, and may further include a start codon that may be upstream of the CRISPR / Cas9-based gene editing system coding sequence and a stop codon that may be downstream of the CRISPR / Cas9-based gene editing system coding sequence. The start codon and the stop codon may be in-frame with the CRISPR / Cas9-based gene editing system coding sequence. The vector may include a promoter operably linked to the CRISPR / Cas9-based gene editing system coding sequence. The promoter operably linked to the CRISPR / Cas9-based gene editing system coding sequence may be a promoter derived from Simian virus 40 (SV40), Mouse mammary tumor virus (MMTV) promoter, Human immunodeficiency virus (HIV) promoter, such as Bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, Moloney virus promoter, Avian leukosis virus (ALV) promoter, Cytomegalovirus (CMV) promoter, such as CMV immediate early promoter, Epstein-Barr virus (EBV) promoter, U6 promoter, such as Human U6 promoter, or Rous sarcoma virus (RSV) promoter. The promoter may be a promoter derived from a human gene such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine or human metallothionein. The promoter may be a tissue-specific promoter such as a natural or synthetic muscle-specific promoter or skin-specific promoter. Examples of such promoters are described in U.S. Patent Application Publication No. 20040175727 and U.S. Patent Application Publication No. 20040192593, the contents of which are incorporated herein by reference in their entirety.Examples of muscle-specific promoters include the Spc5-12 promoter (described in US Patent Application Publication No. 20040192593, which is incorporated herein by reference in its entirety, Hakim et al., Mol. Ther. Methods Clin. Dev. (2014) 1:14002, and Lai et al., Hum Mol Genet. (2014) 23(12):3189-3199), the MHCK7 promoter (described in Salva et al., Mol. Ther. (2007) 15:320-329), the CK8 promoter (described in Park et al., PLoS ONE (2015) 10(4):e0124914), and the CK8e promoter (described in Muir et al., Mol. Ther. Methods Clin. Dev. (2014) 1:14025). In some embodiments, the expression of the gRNA and / or Cas9 protein is driven by a tRNA.

[0079] Each of the polynucleotide sequences encoding the gRNA molecule and / or Cas9 molecule may each be operably linked to a promoter. The promoter operably linked to the gRNA molecule and / or Cas9 molecule may be the same promoter. The promoter operably linked to the gRNA molecule and / or Cas9 molecule may be different promoters. The promoter may be a constitutive promoter, an inducible promoter, a repressive promoter, or a regulatable promoter. The promoter may be a tissue-specific promoter. The tissue-specific promoter may be a muscle-specific promoter. Examples of muscle-specific promoters include the MHCK7 promoter, the CK8 promoter, and the Spc512 promoter. The promoter may be, for example, the CK8 promoter, the Spc512 promoter, or the MHCK7 promoter. The vector may contain a polyadenylation signal that may be downstream of the CRISPR / Cas9-based gene editing system. The polyadenylation signal may be an SV40 polyadenylation signal, an LTR polyadenylation signal, a bovine growth hormone (bGH) polyadenylation signal, a human growth hormone (hGH) polyadenylation signal, or a human β-globin polyadenylation signal. The SV40 polyadenylation signal may be a polyadenylation signal derived from the pCEP4 vector (Invitrogen, San Diego, California, USA).

[0080] The vector may contain an enhancer upstream of the CRISPR / Cas9-based gene editing system, i.e., a Cas9 protein coding sequence or a Cas9 fusion protein coding sequence or sgRNA, or a CRISPR / Cas9-based gene editing system. The enhancer may be necessary for DNA expression. The enhancer may be derived from human actin, human myosin, human hemoglobin, human muscle creatine, or a viral enhancer, such as CMV, HA, RSV, or EBV. Polynucleotide functional enhancers are described in U.S. Patent No. 5,593,972, U.S. Patent No. 5,962,428, and WO94 / 016737, the contents of each of which are incorporated by reference in their entirety. The vector may contain a mammalian origin of replication to maintain the vector episomally and generate multiple copies of the vector in the cell. The vector may contain regulatory sequences that may be well-suited for gene expression in mammalian cells or human cells to which the vector is administered. The vector may contain a reporter gene such as green fluorescent protein ("GFP") and / or a selectable marker such as hygromycin ("Hygro").

[0081] The vector may be an expression vector or expression system for producing a protein by conventional techniques and readily available starting materials, including Sambrook et al., Molecular Cloning and Laboratory Manual, Second Edition, Cold Spring Harbor (1989), which is incorporated by reference in its entirety. In some embodiments, the vector may include a nucleic acid sequence encoding a CRISPR / Cas9-based gene editing system that includes a nucleic acid sequence encoding a Cas9 protein or Cas9 fusion protein and a nucleic acid sequence encoding at least one gRNA. 7. Pharmaceutical Composition The subject matter of the present disclosure provides a composition comprising the above-described gene construct. The pharmaceutical compositions described in detail herein can be formulated according to the mode of administration used. When the pharmaceutical composition is an injectable pharmaceutical composition, they are sterile, free of pyrogenic substances, and free of particulate matter. Isotonic formulations are preferably used. Generally, additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol, and lactose. In some cases, isotonic solutions such as phosphate buffered saline are preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstrictor is added to the formulation.

[0082] The composition may further comprise a pharmaceutically acceptable excipient. A pharmaceutically acceptable excipient may be a molecule that functions as a vehicle, adjuvant, carrier, or diluent. Pharmaceutically acceptable excipients may include surfactants such as immunostimulating complexes (ISCOMs), Freund's incomplete adjuvant, LPS analogs containing monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or transfection promoters including nanoparticles, or other known transfection promoters.

[0083] The transfection promoter is a polyanion, polycation, or lipid containing poly-L-glutamate (LGS). The transfection promoter is poly-L-glutamate, and more preferably, the poly-L-glutamate is present in a composition for genome editing in skeletal muscle or cardiac muscle at a concentration of less than 6 mg / mL. The transfection promoter may include surfactants such as immunostimulating complexes (ISCOMs), Freund's incomplete adjuvant, LPS analogs containing monophosphoryl lipid A, muramyl peptides, quinone analogs, and vesicles such as squalene and squalene may be included, and hyaluronic acid may be used by being administered together with the gene construct. In some embodiments, the DNA vector encoding the composition may include a transfection promoter such as a lipid, liposomes including lecithin liposomes or other liposomes known in the art as a DNA-liposome mixture (see, for example, International Patent Publication No. WO9324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection promoters. Preferably, the transfection promoter is a polyanion, polycation, or lipid containing poly-L-glutamate (LGS).

[0084] 8. Delivery Method Methods for delivering a gene construct (e.g., a vector) or a composition thereof of the present disclosure to a cell are provided herein. Delivery of the composition may be transfection or electroporation of the composition as a nucleic acid molecule that is expressed in the cell and delivered to the cell surface. Electroporation of the nucleic acid molecule may be performed using a BioRad Gene Pulser Xcell device or an Amaxa Nucleofector IIb device. Several different buffers may be used, including BioRad electroporation solution, Sigma phosphate buffered saline product #D8537 (PBS), Invitrogen OptiMEM I (OM), or Amaxa Nucleofector solution V (N.V.). Transfection may include a transfection reagent such as Lipofectamine 2000.

[0085] Upon delivery of the gene construct or composition of the present disclosure to a tissue and upon delivery of the vector into a mammalian cell, the transfected cells express a gRNA molecule and a Cas9 molecule. The gene construct or composition may be administered to a mammal to alter gene expression or to reengineer or alter the genome. For example, the gene construct or composition may be administered to a mammal to correct the dystrophin gene in the mammal. The mammal may be a human, non-human primate, cow, pig, sheep, goat, antelope, bison, guinea pig, bovine, deer, hamster, elephant, llama, alpaca, mouse, rat, or chicken, and preferably may be a human, cow, pig, or chicken. Gene constructs (e.g., vectors) encoding gRNA molecules and Cas9 molecules can be delivered to mammals by electroporation vectors, liposome-mediated vectors, nanoparticle-facilitated vectors and / or recombinant vectors in vivo, and also by DNA injection (also referred to as DNA vaccination) when not. Recombinant vectors can be delivered by any viral mode. The viral mode can be recombinant lentivirus, recombinant adenovirus and / or recombinant adeno-associated virus.

[0086] The gene constructs (e.g., vectors) of the present disclosure or compositions containing the same can be introduced into cells to genetically correct the dystrophin gene (e.g., the human dystrophin gene). In certain embodiments, the gene constructs (e.g., vectors) of the present disclosure or compositions containing the same are introduced into myoblasts derived from DMD patients. In certain embodiments, the gene construct (e.g., vector) or composition containing the same is introduced into fibroblasts derived from DMD patients, and the genetically corrected fibroblasts are used to confirm whether the corrected dystrophin protein is functional and / or to induce differentiation into myoblasts that can be implanted into a subject, such as damaged muscle of the subject, for treating the subject. The modified cells can also be stem cells such as induced pluripotent stem cells, bone marrow-derived precursors, skeletal muscle precursors, human skeletal myoblasts derived from DMD patients, CD133+ cells, mesodermal angioblasts, and MyoD-transduced cells or Pax7-transduced cells, or other myogenic precursor cells. For example, the CRISPR / Cas9-based gene editing system may cause neural differentiation or myogenic differentiation of induced pluripotent stem cells.

[0087] 9. Route of Administration The gene constructs (e.g., vectors) or compositions thereof of the present disclosure may be administered to a subject by different routes, including oral, parenteral, sublingual, transdermal, rectal, transmucosal, topical, inhalation, intraoral administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and intraarticular, or combinations thereof. In certain embodiments, the gene constructs (e.g., vectors) or compositions of the present disclosure are administered to a subject (e.g., a subject suffering from DMD) intramuscularly, intravenously, or combinations thereof. For veterinary use, the gene constructs (e.g., vectors) or compositions of the present disclosure may be administered as appropriately acceptable formulations according to normal veterinary practice. A veterinarian may readily determine the most appropriate dosage regimen and route of administration for a particular animal. The compositions may be administered by conventional syringes, needleless injection devices, "particle bombardment gene guns", or other physical methods, such as electroporation ("EP"), "hydrodynamic methods" or ultrasound.

[0088] The gene constructs (e.g., vectors) or compositions of the present disclosure may be delivered to mammals by several techniques, including electroporation vectors, liposome-mediated vectors, nanoparticle-facilitated vectors, recombinant vectors, e.g., recombinant lentiviruses, recombinant adenoviruses and recombinant adeno-associated viruses when present, and DNA injection (also referred to as DNA vaccination) when absent, in vivo. The compositions may be injected into skeletal muscle or cardiac muscle. For example, the compositions may be injected into the tibialis anterior muscle or the tail. In some embodiments, the gene constructs (e.g., vectors) or compositions thereof of the present disclosure are administered by 1) tail vein injection (systemic) into adult mice, 2) intramuscular injection, e.g., local injection into muscle such as TA or gastrocnemius muscle in adult mice, 3) intraperitoneal injection into P2 mice, or 4) facial vein injection (systemic) into P2 mice.

[0089] 10. Cell type Any of these delivery methods and / or routes of administration may be utilized in a variety of cell types. Examples of cell types include immortalized myoblasts, such as wild-type lines and those derived from DMD patients, such as the Δ48-50 DMD cell line, DMD6594 (del48-50) cell line, DMD8036 (del48-50) cell line, C25C14 cell line, and DMD-7796 cell line, primal DMD dermal fibroblasts, induced pluripotent stem cells, bone marrow-derived precursors, skeletal muscle precursors, human skeletal myoblasts derived from DMD patients, CD133+ cells, mesodermal angioblasts, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor cells, hematopoietic stem cells, smooth muscle cells, and MyoD-transduced cells or Pax7-transduced cells, or other myogenic precursor cells, but are not limited thereto. Immortalization of human myoblasts can be used for the derivation of clonal genetically corrected myoblasts. It is possible to modify cells ex vivo to isolate and expand a clonal population of immortalized DMD myoblasts that contain a genetically corrected dystrophin gene and do not contain other nuclease-introduced mutations in the protein-coding regions of the genome. In another case, transient in vivo delivery of a CRISPR / Cas9-based system by non-viral gene transfer or non-integrating viral gene transfer, or by direct delivery of a purified protein and gRNA containing a cell-permeable motif, may enable highly specific correction in situ with minimal or no risk of foreign DNA integration.

[0090] 11. Kit Kits that may be used to correct a mutant dystrophin gene are provided herein. The kit includes at least a gRNA for correcting the mutant dystrophin gene and instructions for using a CRISPR / Cas9-based gene editing system. Kits that may be used for genome editing of the dystrophin gene in skeletal muscle or cardiac muscle are also provided herein. The kit may include a gene construct (e.g., a vector) or a composition containing the same for genome editing in skeletal muscle or cardiac muscle as described above, and instructions for using the composition. The instructions included in the kit may be affixed to the packaging material or included as an accompanying document. The instructions are typically written or printed materials, but they are not limited to such. Any medium capable of storing such instructions and communicating them to the end user is contemplated by the present disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges, chips), optical media (e.g., CD-ROM), etc. As used herein, the term "instructions" may include the address of an Internet site that provides the instructions.

[0091] A gene construct (e.g., a vector) or a composition containing the same for correcting mutant dystrophin or for genome editing of the dystrophin gene in skeletal muscle or cardiac muscle may include a modified AAV vector containing the gRNA molecule and Cas9 molecule described above that specifically binds to and cleaves a region of the dystrophin gene. The CRISPR / Cas9-based gene editing system described above may specifically bind to a specific region in the mutant dystrophin gene and may be included in the kit for targeting. The kit may further include the donor DNA, different gRNAs, or transgenes described above.

Examples

[0092] 12. Examples Other suitable modifications and adaptations of the methods of the present disclosure described herein are readily applicable and evaluable, and may be made using suitable equivalents without departing from the scope of the present disclosure or the aspects and embodiments disclosed herein, which will be readily apparent to those skilled in the art. The present disclosure, although described in detail herein, is merely intended to illustrate some aspects and embodiments of the present disclosure and should not be considered as limiting the scope of the present disclosure. It will be more clearly understood by referring to the following examples. All journal references, U.S. patents and publications referred to herein are hereby incorporated by reference in their entirety. The present disclosure will be described in detail by way of the following non-limiting examples, which illustrate a plurality of embodiments and aspects.

[0093] (Example 1) Dual vector system Conventional CRISPR / Cas9 systems for the treatment of DMD typically involve more than two vectors (FIGS. 6 and 7). For example, one vector may encode the Cas9 protein, and a second vector may encode two gRNAs. As another example, one vector may encode the Cas9 protein and a first gRNA, and a second vector may encode the Cas9 protein and a second gRNA. A schematic diagram of an experiment to excise exons 45-55 of dystrophin in mice using multiple vectors is shown in FIG. 3, and the results are shown in FIGS. 4, 5, and 10. Newborn mice were treated with a dual vector system by systemic / intracranial venous injection. Tissues were harvested 8 weeks after treatment. As shown in FIG. 4, deletion of the mutant hot spot exons 45-55 was confirmed by PCR and sequencing. Further results are shown in FIG. 10, indicating that AAV-CRISPR targeting the control locus (upper panel in FIG. 10) or AAV-CRISPR targeting exons 45-55 (lower panel in FIG. 10) showed widespread dystrophin expression in the myocardium after deletion of exons 45-55, which was not observed in mock vector-treated mice.

[0094] (Example 2) Verification of treatment methods for the dual vector system Using immortalized myoblasts isolated from DMD patients, further verification of the CRISPR-based method for restoring the functional dystrophin gene with the dual vector of Example 1 was performed. The immortalized myoblasts contained deletions in exons 48-50 that resulted in out-of-frame mutations (Figure 9A). The same AAV plasmids used in the HEK293 in vitro experiments in Example 1 were transfected into patient myoblasts. Deletion PCR of genomic DNA and cDNA showed that exons 45-55 were effectively deleted, which was confirmed by Sanger sequencing (Figure 9B). Western blot of cell lysates showed that untreated myoblasts did not produce dystrophin protein, while transfected myoblasts expressed a smaller dystrophin protein compared to the positive control, consistent with the hotspot deletion (Figure 9C). These results further provided in vitro verification that the dual vector construct can be used to edit human mutations and restore dystrophin expression.

[0095] (Example 3) Components for the all-in-one vector A one-vector CRISPR / Cas9 system was developed for the treatment of DMD (Figures 6 and 7). The advantages of the one-vector system include having all the necessary editing components in a single vector, the ability to increase the effective dose, rationalization of other vector production (single therapeutic agent), use / incorporation of muscle-specific promoters (e.g., CK8, Spc512, MHCK7), and the ability to target combinations of exons and large deletions (e.g., by varying the guide sequence). A schematic diagram of the developed all-in-one vector is shown in Figure 8. The sequences included in part or all of the all-in-one vectors described herein are shown in Table 1. Figures 12, 13, and 14 show the results of testing these constructs in mdx mice. The all-in-one vectors are described in more detail in Examples 4 - 7.

[0096]

Table 1-1

Table 1-2

Table 1-3

[0097] (Example 4) All-in-one vector 1 (versions 1 and 2) Two versions of vector 1 were generated. Vector 1 contained exon 45 - 55 targeting gRNA with all promoters (U6, H1, and SaCas9-driven) in the forward direction and a mini polyadenylation signal for SaCas9. Version 1 of vector 1 contained the EFS constitutive promoter. The sequence for version 1 of vector 1 is SEQ ID NO: 14. Version 2 of vector 1 contained the CK8 constitutive promoter. The sequence for version 2 of vector 1 is SEQ ID NO: 15.

[0098] (Example 5) All-in-One Vector 2 (Versions 1 - 4) Four versions of Vector 2 were generated. Vector 2 contained exon 45 - 55 target gRNA with a U6 promoter in the reverse direction outward from the SaCas9 driving promoter and a mini polyadenylation signal for SaCas9. Version 1 of Vector 2 contained an EFS constitutive promoter. The sequence for Version 1 of Vector 2 is as shown in SEQ ID NO: 16. Version 2 of Vector 2 contained a CK8 constitutive promoter. The sequence for Version 2 of Vector 2 is as shown in SEQ ID NO: 17. Version 3 of Vector 2 contained a Spc512 promoter. The sequence for Version 3 of Vector 2 is as shown in SEQ ID NO: 18. Version 4 of Vector 2 contained an MHCK7 promoter. The sequence for Version 4 of Vector 2 is as shown in SEQ ID NO: 19.

[0099] (Example 6) All-in-One Vector 3 (Versions 1 - 4) Four versions of Vector 3 were generated. Vector 3 contained exon 45 - 55 target gRNA with a U6 promoter in the reverse direction outward from the SaCas9 driving promoter and a mini polyadenylation signal for SaCas9. Version 1 of Vector 3 contained an EFS constitutive promoter. The sequence for Version 1 of Vector 3 is as shown in SEQ ID NO: 20. Version 2 of Vector 3 contained a CK8 promoter. The sequence for Version 2 of Vector 3 is as shown in SEQ ID NO: 21. Version 3 of Vector 3 contained a Spc512 promoter. The sequence for Version 3 of Vector 3 is as shown in SEQ ID NO: 22. Version 4 of Vector 3 contained an MHCK7 promoter. The sequence for Version 4 of Vector 3 is as shown in SEQ ID NO: 23.

[0100] (Example 7) All-in-one vector 5 (versions 1-4) After screening a panel of all-in-one vector designs to determine the effects of guide placement, regulatory elements, and the Pol-III promoter, a new set of all-in-one vectors was generated with constitutive and muscle-specific promoters (Figure 11). Versions of vector 5 of the all-in-one vectors included the SV40 intron (see SEQ ID NO: 24) and different element arrangements. Version 1 of vector 5 included a constitutive promoter. The sequence for version 1 of vector 5 is as shown in SEQ ID NO: 41. Version 2 of vector 5 included the CK8 promoter. The sequence for version 2 of vector 5 is as shown in SEQ ID NO: 42. Version 3 of vector 5 included the Spc-512 promoter. The sequence for version 3 of vector 5 is as shown in SEQ ID NO: 29. Version 4 of vector 5 included the MHCK7 promoter. The sequence for version 4 of vector 5 is as shown in SEQ ID NO: 30.

[0101] From the foregoing description of the specific embodiments, the general nature of the invention will be fully shown, whereby others may, without departing from the general concept of the disclosure, readily modify and / or adapt such specific embodiments for various applications by applying knowledge within the skill of the art without undue experimentation. Therefore, such adaptations and modifications are intended to be within the meaning and scope of the equivalents of the disclosed embodiments based on the teachings and guidance presented herein. It should be understood that the syntax or terminology herein is for the purpose of description and not of limitation, and thus the terminology or syntax of this specification should be interpreted by those skilled in the art in light of the teachings and guidance. The breadth and scope of the present disclosure should not be limited by any of the above exemplary aspects, but should be defined only in accordance with the following claims and their equivalents. All publications, patents, patent applications, and / or other documents cited in this application are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent, patent application, and / or other document were individually indicated to be incorporated by reference for all purposes. For reasons of completeness, various aspects of the present disclosure are presented in the following numbered sections.

[0102] Item 1. A CRISPR-Cas system comprising one or more vectors encoding a composition comprising: (a) a first guide RNA (gRNA) molecule targeting intron 44 of dystrophin; (b) a second gRNA molecule targeting intron 55 of dystrophin; (c) Cas9 protein; and (d) one or more Cas9 gRNA scaffolds. Item 2. The system according to Item 1, comprising a single vector. Item 3. The system according to Item 1, comprising two or more vectors, wherein the two or more vectors comprise a first vector and a second vector. Item 4. The system according to Item 3, wherein (a) the first vector encodes the first gRNA molecule and the second gRNA molecule; and (b) the second vector encodes the Cas9 protein. Item 5. The system according to Item 3, wherein (a) the first vector encodes the first gRNA molecule; and (b) the second vector encodes the second gRNA molecule. Item 6. The system according to Item 5, wherein the first vector further encodes the Cas9 protein. Item 7. The system according to Item 5 or 6, wherein the second vector further encodes the Cas9 protein.

[0103] Item 8. The system according to any one of Items 1 to 7, wherein the expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter. Item 9. The system according to item 8, wherein the muscle-specific promoter comprises an MHCK7 promoter, a CK8 promoter, or a Spc512 promoter. Item 10. The system according to item 2, wherein a single vector encodes a first gRNA molecule, a second gRNA molecule, and a Cas9 protein. Item 11. The system according to any one of items 1 to 10, wherein the vector comprises at least one bidirectional promoter. Item 12. The system according to item 11, wherein the bidirectional promoter comprises a first promoter that drives the expression of the first gRNA molecule and / or the second gRNA molecule, and a second promoter that drives the expression of the Cas9 protein. Item 13. The system according to any one of items 1 to 12, wherein the first gRNA targets the polynucleotide of SEQ ID NO: 2 or a 5'-truncated product thereof.

[0104] Item 14. The system according to any one of items 1 to 13, wherein the second gRNA targets the polynucleotide of SEQ ID NO: 3 or a 5'-truncated product thereof. Item 15. The system according to any one of items 1 to 14, wherein the Cas9 protein is an SpCas9 protein, an SaCas9 protein, or an St1Cas9 protein. Item 16. The system according to any one of items 1 to 15, wherein the Cas9 gRNA scaffold is an SaCas9 gRNA scaffold. Item 17. The system according to item 16, wherein the SaCas9 gRNA scaffold comprises the polynucleotide of SEQ ID NO: 4 or is encoded by the polynucleotide of SEQ ID NO: 4. Item 18. The system according to any one of items 1 to 17, wherein the Cas9 protein is an SaCas9 protein encoded by the polynucleotide of SEQ ID NO: 11. Item 19. The system according to any one of items 1 to 18, wherein the vector comprises at least one polynucleotide selected from SEQ ID NOs: 1 to 13 and 24. Item 20. The system according to any one of items 1 to 19, wherein the vector comprises the polynucleotide sequence of SEQ ID NO: 24. Item 21. The system according to any one of Items 1 to 20, wherein the vector comprises a polynucleotide sequence selected from SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 29, and SEQ ID NO: 30.

[0105] Item 22. The system according to any one of Items 1 to 21, wherein the vector is a viral vector. Item 23. The system according to any one of Items 1 to 22, wherein the vector is an adeno-associated virus (AAV) vector. Item 24. The system according to Item 23, wherein the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13, or AAVrh.74. Item 25. The system according to any one of Items 1 to 24, wherein the vector comprises a ubiquitous promoter or a tissue-specific promoter operably linked to a polynucleotide sequence encoding a first gRNA molecule, a second gRNA molecule, and / or a Cas9 protein. Item 26. The system according to Item 25, wherein the tissue-specific promoter is a muscle-specific promoter. Item 27. A cell comprising the system according to any one of Items 1 to 26. Item 28. A kit comprising the system according to any one of Items 1 to 26. Item 29. A method for correcting a mutant dystrophin gene in a cell, the method comprising administering the system according to any one of Items 1 to 26 to the cell. Item 30. A method for genome editing of a mutant dystrophin gene in a subject, the method comprising administering the system according to any one of Items 1 to 26 or the cell according to Item 27 to the subject. Item 31. A method for treating a subject having a mutant dystrophin gene, the method comprising administering the system according to any one of Items 1 to 26 or the cell according to Item 27 to the subject. Item 32. The method according to item 30 or 31, wherein the system or cell is administered to the subject intramuscularly, intravenously, or in a combination thereof.

[0106] Sequence SEQ ID NO: 1, AAV ITR cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 1)

[0107] SEQ ID NO: 2, DNA target sequence of gRNA targeting the human dystrophin intron 44 region, JCR143 acatttcctctctatacaaatg (SEQ ID NO: 2) SEQ ID NO: 3, DNA target sequence of gRNA targeting the human dystrophin intron 55 region, JCR120 atatagtaatgaaattattggcac (SEQ ID NO: 3) SEQ ID NO: 4, Scaffold of SaCas9 guide RNA, scaffold of gRNA tctcgccaacaagttgacgagataaacacggcattttgccttgttttagtagattctgtttccagagtactaaaac (SEQ ID NO: 4) SEQ ID NO: 5, U6 promoter ggtgtttcgtcctttccacaagatatataaagccaagaaatcgaaatactttcaagttacggtaagcatatgatagtccattttaaaacataattttaaaactgcaaactacccaagaaattattactttctacgtcacgtattttgtactaatatctttgtgtttacagtcaaattaattccaattatctctctaacagccttgtatcgtatatgcaaatatgaaggaatcatgggaaataggccctc (SEQ ID NO: 5)

[0108] SEQ ID NO: 6, H1 promoter gaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccac (SEQ ID NO: 6) SEQ ID NO: 7, EFS promoter tcgagtggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtgtcgtgaccgcgg (SEQ ID NO: 7)

[0109] SEQ ID NO: 8, CK8 promoter ctagactagcatgctgcccatgtaaggaggcaaggcctggggacacccgagatgcctggttataattaacccagacatgtggctgcccccccccccccaacacctgctgcctctaaaaataaccctgcatgccatgttcccggcgaagggccagctgtcccccgccagctagactcagcacttagtttaggaaccagtgagcaagtcagcccttggggcagcccatacaaggccatggggctgggcaagctgcacgcctgggtccggggtgggcacggtgcccgggcaacgagctgaaagctcatctgctctcaggggcccctccctggggacagcccctcctggctagtcacaccctgtaggctcctctatataacccaggggcacaggggctgccctcattctaccaccacctccacagcacagacagacactcaggagccagccag(SEQ ID NO: 8)

[0110] SEQ ID NO: 9, Spc512 promoter gagctccaccgcggtggcggccgtccgccttcggcaccatcctcacgacacccaaatatggcgacgggtgaggaatggtggggagttatttttagagcggtgaggaaggtgggcaggcagcaggtgttggcgctctaaaaataactcccgggagttatttttagagcggaggaatggtggacacccaaatatggcgacggttcctcacccgtcgccatatttgggtgtccgccctcggccggggccgcattcctgggggccgggcggtgctcccgcccgcctcgataaaaggctccggggccggcggcggcccacgagctacccggaggagcgggaggcgccaagctctagaactagtggatcccccgggctgcaggaattcgatat(SEQ ID NO: 9)

[0111] SEQ ID NO: 10, MHCK7 promoter gtttaaacaagcttgcatgtctaagctagacccttcagattaaaaataactgaggtaagggcctgggtaggggaggtggtgtgagacgctcctgtctctcctctatctgcccatcggccctttggggaggaggaatgtgcccaaggactaaaaaaaggccatggagccagaggggcgagggcaacagacctttcatgggcaaaccttggggccctgctgtctagcatgccccactacgggtctaggctgcccatgtaaggaggcaaggcctggggacacccgagatgcctggttataattaacccagacatgtggctgcccccccccccccaacacctgctgcctctaaaaataaccctgtccctggtggatcccctgcatgcgaagatcttcgaacaaggctgtgggggactgagggcaggctgtaacaggcttgggggccagggcttatacgtgcctgggactcccaaagtattactgttccatgttcccggcgaagggccagctgtcccccgccagctagactcagcacttagtttaggaaccagtgagcaagtcagcccttggggcagcccatacaaggccatggggctgggcaagctgcacgcctgggtccggggtgggcacggtgcccgggcaacgagctgaaagctcatctgctctcaggggcccctccctggggacagcccctcctggctagtcacaccctgtaggctcctctatataacccaggggcacaggggctgccctcattctaccaccacctccacagcacagacagacactcaggagccagccagcggcgcgccc(SEQ ID NO: 10)

[0112] SEQ ID NO: 11, a polynucleotide encoding SaCas9

[0113] Array number 12, Mini polyadenylation signal tagcaataaaggatcgtttattttcattggaagcgtgtgttggttttttgatcaggcgcg (Array number 12) Array number 13, bGH polyadenylation signal ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga (Array number 13)

[0114] Array number 14, Version 1 of Vector 1

[0115] Array number 15, version 2 of vector 1

[0116] Array number 16, version 1 of vector 2

[0117] Array number 17, version 2 of vector 2

[0118] SEQ ID NO:18, Vector 2 version 3

[0119] SEQ ID NO: 19, Vector 2 version 4

[0120] SEQ ID NO: 20, Vector 3 version 1

[0121] SEQ ID NO:21, version 2 of vector 3

[0122] SEQ ID NO:22, version 3 of vector 3

[0123] SEQ ID NO:23, version 4 of vector 3

[0124] SEQ ID NO:24, a polynucleotide encoding an SV40 intron tctagaggatccggtactcgaggaactgaaaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacggaagtgttac

[0125] SEQ ID NO:25 NNGRR (R=A or G; N can be any nucleotide residue, e.g., A, G, C, or T) SEQ ID NO:26 NNGRRN (R=A or G, N can be any nucleotide residue, e.g., A, G, C, or T) SEQ ID NO:27 NNGRRT (R=A or G, N can be any nucleotide residue, e.g., A, G, C, or T)

[0126] SEQ ID NO:28 NNGRRV (R=A or G, N can be any nucleotide residue, e.g., A, G, C, or T)

[0127] SEQ ID NO:29, version 3 of vector 5

[0128] SEQ ID NO:30, version 4 of vector 5

[0129] 配列番号31、黄色ブドウ球菌(S.aureas)Cas9をコードするコドン最適化ポリヌクレオチド atgaaaagga actacattct ggggctggac atcgggatta caagcgtggg gtatgggatt attgactatg aaacaaggga cgtgatcgac gcaggcgtca gactgttcaa ggaggccaac gtggaaaaca atgagggacg gagaagcaag aggggagcca ggcgcctgaa acgacggaga aggcacagaa tccagagggt gaagaaactg ctgttcgatt acaacctgct gaccgaccat tctgagctga gtggaattaa tccttatgaa gccagggtga aaggcctgag tcagaagctg tcagaggaag agttttccgc agctctgctg cacctggcta agcgccgagg agtgcataac gtcaatgagg tggaagagga caccggcaac gagctgtcta caaaggaaca gatctcacgc aatagcaaag ctctggaaga gaagtatgtc gcagagctgc agctggaacg gctgaagaaa gatggcgagg tgagagggtc aattaatagg ttcaagacaa gcgactacgt caaagaagcc aagcagctgc tgaaagtgca gaaggcttac caccagctgg atcagagctt catcgatact tatatcgacc tgctggagac tcggagaacc tactatgagg gaccaggaga agggagcccc ttcggatgga aagacatcaa ggaatggtac gagatgctga tgggacattg cacctatttt ccagaagagc tgagaagcgt bagtacgct taaacgcag atctgtacaa cgccctgaat gacctgaaca acctggtcat caccagggat gaagagaga aactggata ctatgagaag ttccagatca tcgaaaacgt gtttaagcag aagaaaaagc ctacactgaa acagattgct areagatcc tggtcaacga agaggacatc aagggctacc gggtgacaag cactggaaaa ccagagttca ccaatctgaa agtgtatcac gatattaagg acatcacagc acggaaagaa atcattgaga acgccgaact gctggatcag attgctaaga tcctgactat ctaccagagc tccgaggaca tccaggaaga gctgactac ctgaacagcg agctgaccca ggaagagatc gaacagatta gtaatctgaa ggggtacacc ggaacacaca acctgtccct gaaagctatc aatctgattc tggatgagct gtggcataca aacgacaatc agattgcaat ctttaaccgg ctgaagctgg tcccaaaaaa ggtggacctg agtcagcaga aagagatccc aaccacactg gtggacgatt tcattctgtc acccgtggtc aagcggagct tcatccagag catcaaagtg atcaacgcca tcatcaagaa gtacggcctg cccaatgata tcattatcga gctggctagg gagaagaaca gcaaggacgc acagaagatg atcaatgaga tgcagaaacg aaccggcag accaatgaac gcattgaaga gattatccga actaccggga aagagaacgc aaagtacctg attgaaaaaa tcaagctgca cgatatgcag gagggaaagt gtctgtattc tctggaggcc tccccctgg aggacctgct gaacaatcca ttcaactacg aggtcgatca tattatcccc agaagcgtgt ccttcgacaa ttcctttaac aacaaggtgc tggtcaagca ggaagagaac tctaaaaagg gcaataggac tcctttccag tacctgtcta gttcagattc caagatctct tacgaaacct ttaaaaagca cattctgaat ctggccaaag gaaagggccg catcagcaag accaaaaagg agtacctgct ggaagagcgg gacatcaaca gattctccgt ccagaaggat tttattaacc ggaatctggt ggacacaaga tacgctactc gcggcctgat gaatctgctg cgatcctatt tccgggtgaa caatctggat gtgaaagtca agtccatcaa cggcgggttc acatctttc tgaggcgcaa atggaagttt aaaaaggagc gcaacaaagg gtacaagcac catgccgaag atgctctgat tatcgcaaat gccgacttca tctttaagga gtggaaaaag ctggacaaag ccaagaaagt gatggagaac cagatgttcg aagagaagca ggccgaatct atgcccgaaa tcgagacaga acaggagtac aaggagattt tcatcactcc tcaccagatc aagcatatca aggatttcaa ggactacaag tactctcacc gggtggataa aaagcccaac agagagctga tcaatgacac cctgtatagt acaagaaaag acgataaggg gaataccctg attgtgaaca atctgaacgg actgtacgac aaagataatg aaagctggaa aaagctgatc aacaaaagtc ccgagaagct gctgatgtac caccatgatc ctcagacata tcagaaactg aagctgatta tggagcagta cggcgacgag aagaacccac tgtataagta ctatgaag actgggaact acctgaccaa gtatagcaaa areataatg gccccgtgat caagaagatc aagtactatg ggaacaagct gaatgcccat ctggacatca cagacgatta ccctaacagt cgcaacaagg tggtcaagct gtcactgaag ccatacagat tcgatgtcta tctggacaac ggcgtgtata aatttgtgac tgtcaagaat ctggatgtca tcaaaaagga gaactactat gaagatgaata gcaagtgcta cgaagaggct aaaaagctga aaaagattag caaccaggca gagttcatcg cctcctttta caaacgac ctgattaaga tcaatggga actgtatagg gtcatcgggg tgaacaatga tctgctgaac cgcattgaag tgaatatgat tgacatcact taccgagagt atctggaaaa catgaatgat aagcgccccc ctcgaattat caaaacaatt gcctctaaga ctcagagtat caaaaagtac tcaaccgaca ttctgggaaa cctgtatgag gtgaagagca aaaagcaccc tcagattatc aaaaagggc [SEQ ID NO: 31]

[0130] SEQ ID NO: 32, Codon-optimized polynucleotide encoding Staphylococcus aureus Cas9 atgaagcgga actacatcct gggcctggac atcggcatca ccagcgtggg ctacggcatc atcgactacg agacacggga cgtgatcgat gccggcgtgc ggctgttcaa agaggccaac gtggaaaaca acgagggcag gcggagcaag agaggcgcca gaaggctgaa gcggcggagg cggcatagaa tccagagagt gaagaagctg ctgttcgact acaacctgct gaccgaccac agcgagctga gcggcatcaa cccctacgag gccagagtga agggcctgag ccagaagctg agcgaggaag agttctctgc cgccctgctg cacctggcca agagaagagg cgtgcacaac gtgaacgagg tggaagagga caccggcaac gagctgtcca ccaaagagca gatcagccgg aacagcaagg ccctggaaga gaaatacgtg gccgaactgc agctggaacg gctgaagaaa gacggcgaag tgcggggcag catcaacaga ttcaagacca gcgactacgt gaaagaagcc aaacagctgc tgaaggtgca gaaggcctac caccagctgg accagagctt catcgacacc tacatcgacc tgctggaaac ccggcggacc tactatgagg gacctggcga gggcagcccc ttcggctgga aggacatcaa agaatggtac gagatgctga tgggccactg cacctacttc cccgaggaac tgcggagcgt gaagtacgcc tacaacgccg acctgtacaa cgccctgaac gacctgaaca atctcgtgat caccagggac gagaacgaga agctggaata ttacgagaag ttccagatca tcgagaacgt gttcaagcag aagaagaagc ccaccctgaa gcagatcgcc aaagaaatcc tcgtgaacga agaggatatt aagggctaca gagtgaccag caccggcaag cccgagttca ccaacctgaa ggtgtaccac gacatcaagg acattaccgc ccggaaagag attattgaga acgccgagct gctggatcag attgccaaga tcctgaccat ctaccagagc agcgaggaca tccaggaaga actgaccaat ctgaactccg agctgaccca ggaagagatc gagcagatct ctaatctgaa gggctatacc ggcacccaca acctgagcct gaaggccatc aacctgatcc tggacgagct gtggcacacc aacgacaacc agatcgctat cttcaaccgg ctgaagctgg tgcccaagaa ggtggacctg tcccagcaga aagagatccc caccaccctg gtggacgact tcatcctgag ccccgtcgtg aagagaagct tcatccagag catcaaagtg atcaacgcca tcatcaagaa gtacggcctg cccaacgaca tcattatcga gctggcccgc gagaagaact ccaaggacgc ccagaaaatg atcaacgaga tgcagaagcg gaaccggcag accaacgagc ggatcgagga aatcatccgg accaccggca aagagaacgc caagtacctg atcgagaaga tcaagctgca cgacatgcag gaaggcaagt gcctgtacag cctggaagcc atccctctgg aagatctgct gaacaacccc ttcaactatg aggtggacca catcatcccc agaagcgtgt ccttcgacaa cagcttcaac aacaaggtgc tcgtgaagca ggaagaaaac agcaagaagg gcaaccggac cccattccag tacctgagca gcagcgacag caagatcagc tacgaaacct tcaagaagca catcctgaat ctggccaagg gcaagggcag aatcagcaag accaagaaag agtatctgct ggaagaacgg gacatcaaca ggttctccgt gcagaaagac ttcatcaacc ggaacctggt ggataccaga tacgccacca gaggcctgat gaacctgctg cggagctact tcagagtgaa caacctggac gtgaaagtga agtccatcaa tggcggcttc accagctttc tgcggcggaa gtggaagttt aagaaagagc ggaacaaggg gtacaagcac cacgccgagg acgccctgat cattgccaac gccgatttca tcttcaaaga gtggaagaaa ctggacaagg ccaaaaaagt gatggaaaac cagatgttcg aggaaaagca ggccgagagc atgcccgaga tcgaaaccga gcaggagtac aaagagatct tcatcacccc ccaccagatc aagcacatta aggacttcaa ggactacaag tacagccacc gggtggacaa gaagcctaat agagagctga ttaacgacac cctgtactcc acccggaagg acgacaaggg caacaccctg atcgtgaaca atctgaacgg cctgtacgac aaggacaatg acaagctgaa aaagctgatc aacaagagcc ccgaaaagct gctgatgtac caccacgacc cccagaccta ccagaaactg aagctgatta tggaacagta cggcgacgag aagaatcccc tgtacaagta ctacgaggaa accgggaact acctgaccaa gtactccaaa aaggacaacg gccccgtgat caagaagatt aagtattacg gcaacaaact gaacgcccat ctggacatca ccgacgacta ccccaacagc agaaacaagg tcgtgaagct gtccctgaag ccctacagat tcgacgtgta cctggacaat ggcgtgtaca agttcgtgac cgtgaagaat ctggatgtga tcaaaaaaga aaactactac gaagtgaata gcaagtgcta tgaggaagct aagaagctga agaagatcag caaccaggcc gagtttatcg cctccttcta caacaacgat ctgatcaaga tcaacggcga gctgtataga gtgatcggcg tgaacaacga cctgctgaac cggatcgaag tgaacatgat cgacatcacc taccgcgagt acctggaaaa catgaacgac aagaggcccc ccaggatcat taagacaatc gcctccaaga cccagagcat taagaagtac agcacagaca ttctgggcaa cctgtatgaa gtgaaatcta agaagcaccc tcagatcatc aaaaagggc[SEQ ID NO: 32]

[0131] SEQ ID NO: 33, Codon-optimized polynucleotide encoding Staphylococcus aureus Cas9 atgaagcgca actacatcct cggactggac atcggcatta cctccgtggg atacggcatc atcgattacg aaactaggga tgtgatcgac gctggagtca ggctgttcaa agaggcgaac gtggagaaca acgaggggcg gcgctcaaag aggggggccc gccggctgaa gcgccgccgc agacatagaa tccagcgcgt gaagaagctg ctgttcgact acaaccttct gaccgaccac tccgaacttt ccggcatcaa cccatatgag gctagagtga agggattgtc ccaaaagctg tccgaggaag agttctccgc cgcgttgctc cacctcgcca agcgcagggg agtgcacaat gtgaacgaag tggaagaaga taccggaaac gagctgtcca ccaaggagca gatcagccgg aactccaagg ccctggaaga gaaatacgtg gcggaactgc aactggagcg gctgaagaaa gacggagaag tgcgcggctc gatcaaccgc ttcaagacct cggactacgt gaaggaggcc aagcagctcc tgaaagtgca aaaggcctat caccaacttg accagtcctt tatcgatacc tacatcgatc tgctcgagac tcggcggact tactacgagg gtccagggga gggctcccca tttggttgga aggatattaa ggagtggtac gaaatgctga tgggacactg cacatacttc cctgaggagc tgcggagcgt gaaatacgca tacaacgcag acctgtacaa cgcgctgaac gacctgaaca atctcgtgat cacccgggac gagaacgaaa agctcgagta ttacgaaaag ttccagatta ttgagaacgt gttcaaacag aagaagaagc cgacactgaa gcagattgcc aaggaaatcc tcgtgaacga agaggacatc aagggctatc gagtgacctc aacgggaaag ccggagttca ccaatctgaa ggtctaccac gacatcaaag acattaccgc ccggaaggag atcattgaga acgcggagct gttggaccag attgcgaaga ttctgaccat ctaccaatcc tccgaggata ttcaggaaga actcaccaac ctcaacagcg aactgaccca ggaggagata gagcaaatct ccaacctgaa gggctacacc ggaactcata acctgagcct gaaggccatc aacttgatcc tggacgagct gtggcacacc aacgataacc agatcgctat tttcaatcgg ctgaagctgg tccccaagaa agtggacctc tcacaacaaa aggagatccc tactaccctt gtggacgatt tcattctgtc ccccgtggtc aagagaagct tcatacagtc aatcaaagtg atcaatgcca ttatcaagaa atacggtctg cccaacgaca ttatcattga gctcgcccgc gagaagaact cgaaggacgc ccagaagatg attaacgaaa tgcagaagag gaaccgacag actaacgaac ggatcgaaga aatcatccgg accaccggga aggaaaacgc gaagtacctg atcgaaaaga tcaagctcca tgacatgcag gaaggaaagt gtctgtactc gctggaggcc attccgctgg aggacttgct gaacaaccct tttaactacg aagtggatca tatcattccg aggagcgtgt cattcgacaa ttccttcaac aacaaggtcc tcgtgaagca ggaggaaaac tcgaagaagg gaaaccgcac gccgttccag tacctgagca gcagcgactc caagatttcc tacgaaacct tcaagaagca catcctcaac ctggcaaagg ggaagggtcg catctccaag accaagaagg aatatctgct ggaagaaaga gacatcaaca gattctccgt gcaaaaggac ttcatcaacc gcaacctcgt ggatactaga tacgctactc ggggtctgat gaacctcctg agaagctact ttagagtgaa caatctggac gtgaaggtca agtcgattaa cggaggtttc acctccttcc tgcggcgcaa gtggaagttc aagaaggaac ggaacaaggg ctacaagcac cacgccgagg acgccctgat cattgccaac gccgacttca tcttcaaaga atggaagaaa cttgacaagg ctaagaaggt catggaaaac cagatgttcg aagaaaagca ggccgagtct atgcctgaaa tcgagactga acaggagtac aaggaaatct ttattacgcc acaccagatc aaacacatca aggatttcaa ggattacaag tactcacatc gcgtggacaa aaagccgaac agggaactga tcaacgacac cctctactcc acccggaagg atgacaaagg gaataccctc atcgtcaaca accttaacgg cctgtacgac aaggacaacg ataagctgaa gaagctcatt aacaagtcgc ccgaaaagtt gctgatgtac caccacgacc ctcagactta ccagaagctc aagctgatca tggagcagta tggggacgag aaaaacccgt tgtacaagta ctacgaagaa actgggaatt atctgactaa gtactccaag aaagataacg gccccgtgat taagaagatt aagtactacg gcaacaagct gaacgcccat ctggacatca ccgatgacta ccctaattcc cgcaacaagg tcgtcaagct gagcctcaag ccctaccggt ttgatgtgta ccttgacaat ggagtgtaca agttcgtgac tgtgaagaac cttgacgtga tcaagaagga gaactactac gaagtcaact ccaagtgcta cgaggaagca aagaagttga agaagatctc gaaccaggcc gagttcattg cctccttcta taacaacgac ctgattaaga tcaacggcga actgtaccgc gtcattggcg tgaacaacga tctcctgaac cgcatcgaag tgaacatgat cgacatcact taccgggaat acctggagaa tatgaacgac aagcgcccgc cccggatcat taagactatc gcctcaaaga cccagtcgat caagaagtac agcaccgaca tcctgggcaa cctgtacgag gtcaaatcga agaagcaccc ccagatcatc aagaaggga[SEQ ID NO: 33]

[0132] SEQ ID NO: 34, Codon-optimized polynucleotide encoding Staphylococcus aureus Cas9

[0133] Codon-optimized polynucleotide encoding Staphylococcus aureus Cas9, SEQ ID NO: 35 accggtgcca ccatgtaccc atacgatgtt ccagattacg cttcgccgaa gaaaaagcgc aaggtcgaag cgtccatgaa aaggaactac attctggggc tggacatcgg gattacaagc gtggggtatg ggattattga ctatgaaaca agggacgtga tcgacgcagg cgtcagactg ttcaaggagg ccaacgtgga aaacaatgag ggacggagaa gcaagagggg agccaggcgc ctgaaacgac ggagaaggca cagaatccag agggtgaaga aactgctgtt cgattacaac ctgctgaccg accattctga gctgagtgga attaatcctt atgaagccag ggtgaaaggc ctgagtcaga agctgtcaga ggaagagttt tccgcagctc tgctgcacct ggctaagcgc cgaggagtgc ataacgtcaa tgaggtggaa gaggacaccg gcaacgagct gtctacaaag gaacagatct cacgcaatag caaagctctg gaagagaagt atgtcgcaga gctgcagctg gaacggctga agaaagatgg cgaggtgaga gggtcaatta ataggttcaa gacaagcgac tacgtcaaag aagccaagca gctgctgaaa gtgcagaagg cttaccacca gctggatcag agcttcatcg atacttatat cgacctgctg gagactcgga gaacctacta tgagggacca ggagaaggga gccccttcgg atggaaagac atcaaggaat ggtacgagat gctgatggga cattgcacct attttccaga agagctgaga agcgtcaagt acgcttataa cgcagatct tacaacgccc tgaatgacct gaacaacctg gtcatcacca gggatgaaaa cgagaaactg gaatactatg agaagttcca gatcatcgaa aacgtgttta agcagaagaa aaagcctaca ctgaaacaga ttgctaagga gatcctggtc aacgaagagg acatcaaggg ctaccgggtg acaagcactg gaaaaccaga gttcaccaat ctgaaagtgt atcacgatat taaggacatc acagcacgga aagaaatcat tgagaacgcc gaactgctgg atcagattgc taagatcctg actatctacc agagctccga ggacatccag gaagagctga ctaacctgaa cagcgagctg acccaggaag agatcgaaca gattagtaat ctgaaggggt acaccggaac acacaacctg tccctgaaag ctatcaatct gattctggat gagctgtggc atacaaacga caatcagatt gcaatcttta accggctgaa gctggtccca aaaaaggtgg acctgagtca gcagaaagag atcccaacca cactggtgga cgatttcatt ctgtcacccg tggtcaagcg gagcttcatc cagagcatca aagtgatcaa cgccatcatc aagaagtacg gcctgcccaa tgatatcatt atcgagctgg ctagggagaa gaacagcaag gacgcacaga agatgatcaa tgagatgcag aaacgaaacc ggcagaccaa tgaacgcatt gaagagatta tccgaactac cgggaaagag aacgcaaagt acctgattga aaaaatcaag ctgcacgata tgcaggaggg aaagtgtctg tattctctgg aggccatccc cctggaggac ctgctgaaca atccattcaa ctacgaggtc gatcatatta tccccagaag cgtgtccttc gacaattcct ttaacaacaa ggtgctggtc aagcaggaag agaactctaa aaagggcaat aggactcctt tccagtacct gtctagttca gattccaaga tctcttacga aacctttaaa aagcacattc tgaatctggc caaaggaaag ggccgcatca gcaagaccaa aaaggagtac ctgctggaag agcgggacat caacagattc tccgtccaga aggattttat taaccggaat ctggtggaca caagatacgc tactcgcggc ctgatgaatc tgctgcgatc ctatttccgg gtgaacaatc tggatgtgaa agtcaagtcc atcaacggcg ggttcacatc ttttctgagg cgcaaatgga agtttaaaaa ggagcgcaac aaagggtaca agcaccatgc cgaagatgct ctgattatcg caaatgccga cttcatcttt aaggagtgga aaaagctgga caaagccaag aaagtgatgg agaaccagat gttcgaagag aagcaggccg aatctatgcc cgaaatcgag acagaacagg agtacaagga gattttcatc actcctcacc agatcaagca tatcaaggat ttcaaggact acaagtactc tcaccgggtg gataaaaagc ccaacagaga gctgatcaat gacaccctgt atagtacaag aaaagacgat aaggggaata ccctgattgt gaacaatctg aacggactgt acgacaaaga taatgacaag ctgaaaaagc tgatcaacaa aagtcccgag aagctgctga tgtaccacca tgatcctcag acatatcaga aactgaagct gattatggag cagtacggcg acgagaagaa cccactgtat aagtactatg aagagactgg gaactacctg accaagtata gcaaaaagga taatggcccc gtgatcaaga agatcaagta ctatgggaac aagctgaatg cccatctgga catcacagac gattacccta acagtcgcaa caaggtggtc aagctgtcac tgaagccata cagattcgat gtctatctgg acaacggcgt gtataaattt gtgactgtca agaatctgga tgtcatcaaa aaggagaact actatgaagt gaatagcaag tgctacgaag aggctaaaaa gctgaaaaag attagcaacc aggcagagtt catcgcctcc ttttacaaca acgacctgat taagatcaat ggcgaactgt atagggtcat cggggtgaac aatgatctgc tgaaccgcat tgaagtgaat atgattgaca tcacttaccg agagtatctg gaaaacatga atgataagcg cccccctcga attatcaaaa caattgcctc taagactcag agtatcaaaa agtactcaac cgacattctg ggaaacctgt atgaggtgaa gagcaaaaag caccctcaga ttatcaaaaa gggctaagaa ttc[SEQ ID NO: 35]

[0134] SEQ ID NO: 36, Codon-optimized polynucleotide encoding Staphylococcus aureus Cas9

[0135] SEQ ID NO: 37, polynucleotide sequence of Staphylococcus aureus Cas9

[0136] Accession number 38, pDO242 (SaCas9 used in all JCR89 / 91 projects and JCR157 / 160 projects for in vitro work; SaCas9 is in uppercase)

[0137] SEQ ID NO: 39, Amino Acid Sequence of Staphylococcus aureus Cas9 Molecule

[0138] Sequence number 40, amino acid sequence of Staphylococcus aureus Cas9

[0139] Array number 41, version 1 of vector 5

[0140] Array number 42, version 2 of vector 5

Claims

1. (a) a first guide RNA (gRNA) molecule targeting intron 44 of dystrophin; (b) a second gRNA molecule targeting intron 55 of dystrophin; (c) a Cas9 protein, and (d) one or more Cas9 gRNA scaffolds. A CRISPR-Cas system comprising one or more vectors encoding a composition comprising:

2. The system of claim 1 , which comprises a single vector.

3. The system of claim 1 , comprising two or more vectors, the two or more vectors comprising a first vector and a second vector.

4. (a) a first vector encoding a first gRNA molecule and a second gRNA molecule; (b) the second vector encodes a Cas9 protein; The system of claim 3.

5. (a) a first vector encoding a first gRNA molecule; (b) a second vector encoding a second gRNA molecule; The system of claim 3.

6. The system of claim 5 , wherein the first vector further encodes a Cas9 protein.

7. The system of claim 5 or 6, wherein the second vector further encodes a Cas9 protein.

8. The system of any one of claims 1 to 7, wherein expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter.

9. The system of claim 8 , wherein the muscle-specific promoter comprises an MHCK7 promoter, a CK8 promoter, or an Spc512 promoter.

10. The system of claim 2, wherein a single vector encodes the first gRNA molecule, the second gRNA molecule and the Cas9 protein.

11. The system according to any one of claims 1 to 10, wherein the vector comprises at least one bidirectional promoter.

12. The bidirectional promoter a first promoter driving expression of the first gRNA molecule and / or the second gRNA molecule; A second promoter that drives expression of the Cas9 protein. The system of claim 11 comprising:

13. The system according to any one of claims 1 to 12, wherein the first gRNA targets the polynucleotide of SEQ ID NO: 2 or a 5' truncation thereof.

14. The system according to any one of claims 1 to 13, wherein the second gRNA targets the polynucleotide of SEQ ID NO: 3 or a 5' truncation thereof.

15. The system according to any one of claims 1 to 14, wherein the Cas9 protein is a SpCas9 protein, a SaCas9 protein or a St1Cas9 protein.

16. The system of any one of claims 1 to 15, wherein the Cas9 gRNA scaffold is a SaCas9 gRNA scaffold.

17. The system of claim 16, wherein the SaCas9 gRNA scaffold comprises or is encoded by the polynucleotide of SEQ ID NO:

4.

18. The system according to any one of claims 1 to 17, wherein the Cas9 protein is a SaCas9 protein encoded by the polynucleotide of SEQ ID NO:

11.

19. The system according to any one of claims 1 to 18, wherein the vector comprises at least one polynucleotide selected from SEQ ID NOs: 1 to 13 and 24.

20. The system according to any one of claims 1 to 19, wherein the vector comprises the polynucleotide sequence of SEQ ID NO:

24.

21. 21. The system according to any one of claims 1 to 20, wherein the vector comprises a polynucleotide sequence selected from SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:29 and SEQ ID NO:

30.

22. The system according to any one of claims 1 to 21, wherein the vector is a viral vector.

23. The system according to any one of claims 1 to 22, wherein the vector is an adeno-associated virus (AAV) vector.

24. 24. The system of claim 23, wherein the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-10, AAV-11, AAV-12, AAV-13 or AAVrh.

74.

25. 25. The system of any one of claims 1 to 24, wherein the vector comprises a ubiquitous or tissue-specific promoter operably linked to a polynucleotide sequence encoding the first gRNA molecule, the second gRNA molecule and / or the Cas9 protein.

26. 26. The system of claim 25, wherein the tissue-specific promoter is a muscle-specific promoter.

27. A cell comprising the system according to any one of claims 1 to 26.

28. A kit comprising a system according to any one of claims 1 to 26.

29. A method for correcting a mutated dystrophin gene in a cell, comprising administering to the cell a system according to any one of claims 1 to 26.

30. A method for genome editing of a mutated dystrophin gene in a subject, the method comprising administering to the subject a system according to any one of claims 1 to 26 or a cell according to claim 27.

31. A method of treating a subject having a mutated dystrophin gene, comprising administering to the subject a system according to any one of claims 1 to 26 or a cell according to claim 27.

32. 32. The method of claim 30 or 31, wherein the system or cells are administered to the subject intramuscularly, intravenously, or a combination thereof.

Images