Crystalline forms of c21h22ci2n4o2

A crystalline form of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide with improved stability and solubility is developed, addressing the challenges of formulation and delivery in pharmaceutical compositions.

JP2025089464AInactive Publication Date: 2025-06-12BIOMED VALLEY DISCOVERIES INC +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025050047
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2015-01-30
Filing Date
2025-03-25
Publication Date
2025-06-12
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

There is a need for a crystalline form of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide that exhibits improved stability and solubility characteristics for effective formulation and delivery in pharmaceutical compositions.

Method used

A crystalline form of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide is developed, characterized by specific XRPD patterns, which enhances its stability and solubility.

Benefits of technology

The crystalline form achieves significantly improved stability and solubility, enabling more effective formulation and delivery of the active pharmaceutical ingredient, thereby enhancing its therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025089464000001_ABST
    Figure 2025089464000001_ABST
Patent Text Reader

Abstract

To provide crystalline forms of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide, which is useful as an inhibitor of ERK protein kinase.SOLUTION: The present invention provides a crystalline form of a compound of Formula (I). There are also provided pharmaceutical compositions comprising the provided crystalline forms, and methods of using the provided crystalline forms and pharmaceutical compositions for treating cancer. The present invention relates to crystalline forms of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide, which is useful as an inhibitor of ERK protein kinase.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This patent application claims the benefit of U.S. Provisional Patent Application No. 62 / 110,449, filed on January 30, 2015, which is hereby incorporated by reference in its entirety.

[0002] Field of the Invention The present invention relates to a crystalline form of 4-(5 - chloro - 2 - isopropylaminopyridin - 4 - yl)-1H - pyrrole - 2 - carboxylic acid [1-(3 - chlorophenyl)-2 - hydroxyethyl]amide, which is useful as an inhibitor of ERK protein kinase.

Background Art

[0003] The mitogen - activated protein kinase (MAPK) pathway mediates signals that control diverse cellular processes including growth, differentiation, migration, proliferation, and apoptosis. The signaling pathway by extracellular signal - regulated kinase (ERK), one of the MAPK pathways, is often found to be up - regulated in tumors. Thus, the members of the pathway represent attractive blockade targets in the development of cancer therapies (Kohno and Pouyssegur, 2006). For example, U.S. Patent No. 7,354,939B2 discloses, inter alia, compounds that are effective as inhibitors of ERK protein kinase. One of these compounds, 4-(5 - chloro - 2 - isopropylaminopyridin - 4 - yl)-1H - pyrrole - 2 - carboxylic acid [1-(3 - chlorophenyl)-2 - hydroxyethyl]amide, is a compound according to formula (I):

Chemical Formula

[0004] Pharmaceutical compositions are often formulated with crystalline solids of the active pharmaceutical ingredient (API). The specific crystalline form of the API can have a significant impact on properties such as stability and solubility / bioavailability. The characteristics of instability and solubility can limit the ability to formulate the composition with an appropriate shelf life, or the ability to effectively deliver a desired amount of drug over a given time frame (Peterson et al., 2006). There is a need for a crystalline form of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide that exhibits improved properties for the formulation of pharmaceutical compositions. This application is directed to meeting this need and other needs.

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Summary of the Invention

Means for Solving the Problems

[0006] It has been discovered that a crystalline form of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide can be prepared that exhibits improved properties, such as surprisingly improved stability and solubility characteristics.

[0007] Thus, the present invention provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0008] The present invention also provides the crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0009] The present invention provides a compound having a powder X-ray diffraction (XRPD) pattern comprising characteristic peaks at about 2θ of 19.5°, of the formula:

Chemical formula

[0010] The present invention provides a compound having an XRPD pattern comprising characteristic peaks at about 2θ of 9.1 and 19.5°, of the formula:

Chemical formula

[0011] The present invention provides a compound having an XRPD pattern comprising characteristic peaks at about 2θ of 9.1, 15.4, 19.5, and 21.4°, of the formula:

Chemical formula

[0012] The present invention provides a compound having one or more XRPD 2θ reflections (°) selected from the group consisting of about 9.1, 12.5, 15.2, 15.4, 19.2, 19.5, 20.3, 20.5, 21.4, 21.7, 21.9, 23.1, 23.3, 23.6, and 24.3, of the formula:

Chemical formula

[0013] The present invention provides a compound having an XRPD pattern substantially as shown in Figure 1, of the formula:

Chemical formula

[0014] The present invention also provides a pharmaceutical composition comprising any of the crystalline compounds of the present invention.

[0015] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of any of the crystalline compounds of the present invention.

[0016] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of any of the pharmaceutical compositions of the present invention.

[0017] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride.

[0018] The present invention provides a compound having a powder X-ray diffraction (XRPD) pattern comprising characteristic peaks at about 6.7° 2θ, of the formula:

Chemical formula

[0019] The present invention provides a compound having an XRPD pattern comprising characteristic peaks at about 6.7 and 11.0° 2θ, of the formula:

Chemical formula

[0020] The present invention provides a compound having an XRPD pattern comprising characteristic peaks at about 6.7, 11.0, 17.6, and 19.9° 2θ, of the formula:

Chemical formula

[0021] The present invention also provides a crystalline hydrochloride salt of a compound having one or more XRPD 2θ reflections (°) selected from the group consisting of about 6.1, 6.7, 11.0, 12.1, 13.7, 15.2, 16.5, 17.6, 17.9, 18.4, 18.7, 19.6, 19.9, and 20.4, of the formula:

Chemical formula

[0022] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern substantially as shown in FIG. 4, of the formula:

Chemical formula

[0023] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl hydrate.

[0024] The present invention also provides a crystalline hydrochloride salt of a compound having a powder X-ray diffraction (XRPD) pattern comprising a characteristic peak at 2θ of about 10.5°, of the formula:

Chemical formula

[0025] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at 2θ of about 6.2 and 10.5°, of the formula:

Chemical formula

[0026] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at 2θ of about 6.2, 10.5, 22.4, and 28.5°, of the formula: [Chemical formula] also provides a crystalline hydrochloride salt of the compound of

[0027] The present invention relates to a compound having one or more XRPD 2θ reflections (°) selected from the group consisting of about 5.8, 5.9, 6.2, 10.5, 11.8, 12.4, 15.9, 17.6, 17.8, 20.0, 20.4, 21.1, 21.4, 21.9, 22.4, 2 3.1, 24.0, 24.2, 24.9, and 25.3, of the formula: [Chemical formula] also provides a crystalline hydrochloride salt of the compound of

[0028] The present invention provides a crystalline hydrochloride salt of a compound having an XRPD pattern substantially as shown in FIG. 7, of the formula: [Chemical formula] also provides a crystalline hydrochloride salt of the compound of

[0029] The present invention provides a crystalline hydrochloride salt of a compound having a powder X-ray diffraction (XRPD) pattern comprising a characteristic peak at about 2θ of 10.7°, of the formula: [Chemical formula] also provides a crystalline hydrochloride salt of the compound of

[0030] The present invention provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at about 2θ of 10.7 and 18.1°, of the formula: [Chemical formula] also provides a crystalline hydrochloride salt of the compound of

[0031] The present invention provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at about 2θ of 6.0, 10.7, 12.7, and 18.1°, of the formula: [Chemical formula] also provides a crystalline hydrochloride salt of the compound.

[0032] The present invention provides a crystalline hydrochloride salt of a compound having one or more XRPD 2θ reflections (°) selected from the group consisting of about 6.0, 6.3, 10.7, 12.0, 12.7, 15.6, 16.2, 16.3, 16.7, 17.9, 18.1, and 21.4, of the formula:

Chemical formula

[0033] The present invention provides a crystalline hydrochloride salt of a compound having an XRPD pattern substantially as shown in Figure 10, of the formula:

Chemical formula

[0034] The following drawings form a part of this specification and are incorporated herein to further illustrate certain embodiments of the present invention. The present invention can be better understood by reference to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein.

Brief Description of the Drawings

[0035]

Figure 1

[0036]

Figure 2

[0037]

Figure 3

[0038]

Figure 4

[0039]

Figure 5

[0040]

Figure 6

[0041]

Figure 7

[0042]

Figure 8

[0043]

Figure 9

[0044]

Figure 10

[0045]

Figure 11

[0046]

Figure 12

[0047]

Figure 13

[0048]

Figure 14

Mode for Carrying Out the Invention

[0049] The present invention provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0050] The present invention also provides crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0051] The present invention also provides a crystalline free base of a compound of the formula:

Chemical formula

[0052] The present invention also provides a crystalline free base of a compound of the formula:

Chemical formula

[0053] The present invention also provides a crystalline free base of a compound of the formula:

Chemical formula

[0054] The present invention also provides a crystalline free base of a compound of the formula: having one or more XRPD 2θ reflections (°) selected from the group consisting of about 9.1, 12.5, 15.2, 15.4, 19.2, 19.5, 20.3, 20.5, 21.4, 21.7, 21.9, 23.1, 23.3, 23.6 and 24.3:

Chemical formula

[0055] The present invention also provides a crystalline free base of a compound of the formula: having an XRPD pattern substantially as shown in FIG. 1:

Chemical formula

[0056] The present invention also provides crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride having a Fourier transform infrared spectroscopy (FT-IR) spectrum comprising one or more peaks at about 1603, 1533, 1487, 1080, 857 and 681 cm -1

[0057] The present invention also provides crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride having an FT-IR spectrum substantially as shown in FIG. 2.

[0058] The present invention also provides: (i) an XRPD pattern comprising one or more peaks at 2θ of about 9.1, 15.4, 19.5 and 21.4°; and (ii) about 1603, 1533, 1487, 1080, 857 and 681 cm -1 ​​​Provided is crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride having an FT-IR spectrum comprising one or more peaks.

[0059] The present invention also provides crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride having a DSC thermogram with an endotherm having an onset temperature of about 184 °C. amide monohydrochloride.

[0060] The present invention also provides crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride having a DSC thermogram substantially as shown in Figure 3.

[0061] The present invention also provides a pharmaceutical composition comprising the crystalline compound of the present invention.

[0062] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the crystalline compound of the present invention.

[0063] In some embodiments, the subject is a mammal.

[0064] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0065] In some embodiments, the mammal is a human.

[0066] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0067] The present invention also provides a method of treating cancer in a subject in need of cancer treatment, the method comprising administering to the subject an effective amount of the pharmaceutical composition of the present invention.

[0068] In some embodiments, the subject is a mammal.

[0069] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0070] In some embodiments, the mammal is a human.

[0071] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0072] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride.

[0073] The present invention also provides a crystalline hydrochloride salt of a compound having a powder X-ray diffraction (XRPD) pattern comprising characteristic peaks at about 6.7° 2θ, of the formula:

Chemical formula

[0074] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at about 6.7 and 11.0° 2θ, of the formula:

Chemical formula

[0075] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at about 6.7, 11.0, 17.6 and 19.9° 2θ, of the formula:

Chemical formula

[0076] The present invention also provides a crystalline hydrochloride salt of a compound having one or more XRPD 2θ reflections (°) selected from the group consisting of about 6.1, 6.7, 11.0, 12.1, 13.7, 15.2, 16.5, 17.6, 17.9, 18.4, 18.7, 19.6, 19.9 and 20.4, of the formula: [Chemical formula] To provide a crystalline hydrochloride salt of the compound.

[0077] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern substantially as shown in FIG. 4, of the formula: [Chemical formula] To provide a crystalline hydrochloride salt of the compound.

[0078] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride in Form C having a Fourier transform infrared spectroscopy (FT-IR) spectrum comprising one or more peaks at about 1610, 1523, 1219, 1141, 1076 and 845 cm -1 .

[0079] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride in Form C having an FT-IR spectrum substantially as shown in FIG. 5.

[0080] The present invention also provides (i) an XRPD pattern comprising one or more peaks at 2θ of about 6.7, 11.0, 17.6 and 19.9°; and (ii) about 1610, 1523, 1219, 1141, 1076 and 845 cm -1Provided is crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride in Form C having an FT-IR spectrum comprising one or more peaks.

[0081] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride in Form C having a DSC thermogram with an endotherm having an onset temperature of about 239 °C. amide monohydrochloride.

[0082] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide monohydrochloride in Form C having a DSC thermogram substantially as shown in FIG. 6.

[0083] The present invention also provides a pharmaceutical composition comprising the crystalline compound of the present invention.

[0084] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the crystalline compound of the present invention.

[0085] In some embodiments, the subject is a mammal.

[0086] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0087] In some embodiments, the mammal is a human.

[0088] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0089] The present invention also provides a method of treating cancer in a subject in need of cancer treatment, the method comprising administering to the subject an effective amount of the pharmaceutical composition of the present invention.

[0090] In some embodiments, the subject is a mammal.

[0091] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0092] In some embodiments, the mammal is a human.

[0093] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0094] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl hydrate.

[0095] The present invention also provides a crystalline hydrochloride salt of a compound having a powder X-ray diffraction (XRPD) pattern comprising characteristic peaks at about 10.5° 2θ, of the formula:

Chemical formula

[0096] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at about 6.2 and 10.5° 2θ, of the formula:

Chemical formula

[0097] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern comprising characteristic peaks at about 6.2, 10.5, 22.4, and 28.5° 2θ, of the formula:

Chemical formula

[0098] The present invention also provides a crystalline hydrochloride salt of a compound having one or more XRPD 2θ reflections (°) selected from the group consisting of about 5.8, 5.9, 6.2, 10.5, 11.8, 12.4, 15.9, 17.6, 17.8, 20.0, 20.4, 21.1, 21.4, 21.9, 22.4, 23.1, 24.0, 24.2, 24.9 and 25.3, of the formula:

Chemical formula

[0099] The present invention also provides a crystalline hydrochloride salt of a compound having an XRPD pattern substantially as shown in FIG. 7, of the formula:

Chemical formula

[0100] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl hydrate of Form A having a Fourier transform infrared spectroscopy (FT-IR) spectrum containing one or more peaks at about 1573, 1237, 1163, 946 and 790 cm -1 .

[0101] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl hydrate of Form A having an FT-IR spectrum substantially as shown in FIG. 8.

[0102] The present invention also provides a crystalline form A 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl hydrate having an XRPD pattern comprising one or more peaks at 2θ of about 6.2, 10.5, 22.4 and 28.5°; and (ii) an FT-IR spectrum comprising one or more peaks at about 1573, 1237, 1163, 946 and 790 cm -1

[0103] The present invention also provides a crystalline form A 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HC l hydrate having a DSC thermogram substantially as shown in FIG. 9.

[0104] The present invention also provides a pharmaceutical composition comprising the crystalline compound of the present invention.

[0105] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the crystalline compound of the present invention.

[0106] In some embodiments, the subject is a mammal.

[0107] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals and domestic animals.

[0108] In some embodiments, the mammal is a human.

[0109] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0110] ​The present invention also provides a method of treating cancer in a subject in need of cancer treatment, the method comprising administering to the subject an effective amount of the pharmaceutical composition of the present invention.

[0111] In some embodiments, the subject is a mammal.

[0112] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0113] In some embodiments, the mammal is a human.

[0114] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0115] The present invention also provides a crystalline hydrochloride salt of a compound of the formula:

Chemical formula

[0116] The present invention also provides a crystalline hydrochloride salt of a compound of the formula:

Chemical formula

[0117] The present invention also provides a crystalline hydrochloride salt of a compound of the formula:

Chemical formula

[0118] The present invention also provides a crystalline hydrochloride salt of a compound of the formula: having one or more XRPD 2θ reflections (°) selected from the group consisting of about 6.0, 6.3, 10.7, 12.0, 12.7, 15.6, 16.2, 16.3, 16.7, 17.9, 18.1 and 21.4: [Chemical formula]

[0119] The present invention also provides a crystalline hydrochloride salt of a compound of the formula: having an XRPD pattern substantially as shown in FIG. 10: [Chemical formula]

[0120] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl in Form D having a Fourier transform infrared spectroscopy (FT-IR) spectrum comprising one or more peaks at about 1537, 1471, 1239, 1163, 1067 and 946 cm -1

[0121] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl in Form D having an FT-IR spectrum substantially as shown in FIG. 11.

[0122] The present invention also provides (i) an XRPD pattern comprising one or more peaks at 2θ of about 6.0, 12.7 and 18.1°; and (ii) about 1537, 1471, 1239, 1163, 1067 and 946 cm -1 ​​​Provided is crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl in Form D having an FT-IR spectrum comprising one or more peaks.

[0123] The present invention also provides crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide HCl in Form D having a DSC thermogram substantially as shown in FIG. 12.

[0124] The present invention also provides a pharmaceutical composition comprising the crystalline compound of the present invention.

[0125] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the crystalline compound of the present invention.

[0126] In some embodiments, the subject is a mammal.

[0127] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0128] In some embodiments, the mammal is a human.

[0129] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent thereby further comprising.

[0130] The present invention also provides a method of treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the pharmaceutical composition of the present invention.

[0131] In some embodiments, the subject is a mammal.

[0132] In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0133] In some embodiments, the mammal is a human.

[0134] In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent.

[0135] The term "solid form" is often used to refer to a class or type of solid-state materials. One kind of solid form is a "polymorph", which refers to two or more compounds having the same chemical formula but different solid-state structures. Salts can be polymorphs. When polymorphs are elements, these are referred to as allotropes. Carbon has well-known allotropes such as graphite, diamond, and buckminsterfullerene. Polymorphs of molecular compounds such as pharmaceutical active ingredients ("APIs") are often prepared and studied to identify compounds that meet academic or commercial needs, including but not limited to improved solubility, dissolution rate, hygroscopicity, and stability.

[0136] Other solid forms include solvates and hydrates of compounds containing salts. A solvate is a compound in which solvent molecules are present within the crystal structure in combination with another compound such as an API. When the solvent is water, the solvate is called a hydrate. Solvates and hydrates may be in a fixed ratio or a variable ratio. Monohydrate is a term used when there is, for example, one water molecule in a unit cell in a fixed ratio to the API.

[0137] To identify the presence of a particular solid form, it is typical for those skilled in the art to use analytical techniques suitable for collecting data on the form for analysis. For example, chemical identification of solid forms often involves 13 C-NMR spectroscopy or 1It can be determined by solution state methods such as H-NMR spectroscopy, and such techniques can also be valuable in determining the stoichiometry and presence of "guests" such as water or solvents, respectively, in hydrates or solvates. These spectroscopic methods can also be used, for example, to distinguish solid forms without water or solvent in the unit cell (often referred to as "anhydrides") from hydrates or solvates.

[0138] Since solution state analysis methods do not provide information about the solid state of the substance, for example, solid state methods can be used to distinguish between solid forms such as anhydrides. Examples of solid state methods that can be used to analyze and characterize solid forms, including anhydrides and hydrates, are single crystal X-ray diffraction, powder X-ray diffraction ("XRPD"), solid 13 C-NMR, infrared ("IR") spectroscopy including Fourier transform infrared (FT-IR) spectroscopy, Raman spectroscopy, and thermal techniques such as differential scanning calorimetry (DSC), melting point method, and hot stage microscopy.

[0139] Polymorphs are a subset of crystal forms that share the same chemical structure but differ in the way the molecules are packed within the solid. When attempting to distinguish polymorphs based on analytical data, search for data that characterize the forms. For example, if two polymorphs of a compound (e.g., Form I and Form II) exist, at angles where such peaks are not seen in the pattern of Form II When finding the peaks of the pattern of Form I, the form can be characterized using powder X-ray diffraction peaks. In such cases, this single peak for Form I may further serve to distinguish Form I from Form II and to characterize Form I. If additional forms exist, the same analysis is also performed for the other polymorphs. Thus, to characterize Form I relative to the other polymorphs, the peaks of Form I are searched at angles at which such peaks are not seen in the powder X-ray diffraction patterns of the other polymorphs. A set of peaks or indeed a single peak that distinguishes Form I from other known polymorphs is the set of peaks that can be used to characterize Form I. For example, when characterizing a polymorph that has two peaks, these two peaks can be used to identify the presence of this polymorph and thus to characterize the polymorph. Those skilled in the art will recognize that there are often multiple ways, including multiple ways of using the same analytical method, to characterize a polymorph. For example, three powder X-ray diffraction peaks may be found to characterize a polymorph. Additional peaks may be used, but are not necessary, to characterize the polymorph up to and including the full diffraction pattern. It is also possible to characterize the crystal form using all the peaks within the full diffractogram, but instead, as disclosed herein, depending on the situation, it may be typical to use a subset of this data to characterize such a crystal form.

[0140] For example, as used herein, a "characteristic peak" is a subset of the observed peaks that is used to distinguish one crystal polymorph from another. Characteristic peaks are determined by evaluating whether any of the observed peaks (if present) are within ±0.2° of 2θ for one crystal polymorph of a compound relative to all other known crystal polymorphs of that compound.

[0141] When analyzing data to distinguish anhydrates from hydrates, for example, one can rely on the fact that the two solid forms have different chemical structures (one has water in the unit cell and the other does not). Thus, one can distinguish the forms of the compound using only this feature, and it may not be necessary to identify the peaks of the anhydrate (e.g., those not present in the hydrate, or vice versa).

[0142] Powder X-ray diffraction patterns are part of the most commonly used solid-state analytical methods used to characterize solid forms. A powder X-ray diffraction pattern is an x-y graph with the diffraction angle 2θ (°) on the x-axis and intensity on the y-axis. The peaks in this plot can be used to characterize the crystalline solid form. Since peak intensity is particularly sensitive to the orientation of the sample, the data are often represented by the peak positions on the x-axis rather than the peak intensities on the y-axis (see Pharmaceutical Analysis, Lee and Web, pages 255-257 (2003)). Thus, it is typical for those skilled in the art not to use intensity to characterize solid forms.

[0143] As with any data measurement, there is variability in powder X-ray diffraction data. In addition to variability in peak intensity, there is also variability in the peak positions on the x-axis. However, this variability can typically be taken into account when reporting peak positions for characterization purposes. Such variability in peak positions along the x-axis can arise from several sources. One can be sample preparation. Samples of the same crystalline material prepared under different conditions may yield slightly different diffractograms. Factors such as particle size, moisture content, solvent content, and orientation can all affect the way the sample diffracts X-rays. Another source of variability can be instrument parameters. Different X-ray instruments operate using different parameters, and these can yield slightly different diffraction patterns from the same crystalline solid form. Similarly, different software packages process X-ray data in different ways, which also results in variability. Those skilled in the pharmaceutical art are aware of these and other sources of variability.

[0144] Due to such sources of variation, it is common to describe X-ray diffraction peaks using the word "about" in front of the peak value in degrees (2θ) (which is sometimes referred to herein as "2θ reflection (°)"), such that, depending on the circumstances, data is presented within 0.1 or 0.2° (2θ) of the stated peak value. The powder X-ray diffraction data corresponding to the solid forms of the present invention was collected on equipment that is routinely calibrated and operated by researchers skilled in the art. In the present invention, XRPD values are preferably obtained using Cu Kα X-ray radiation according to the method described in Example 1. Accordingly, the variation associated with these data is expected to be closer to ±0.1° 2θ than ±0.2° 2θ, and in fact, for the equipment used herein, it is likely to be less than 0.1. However, considering that equipment used elsewhere by those skilled in the art may not be maintained as such, for example, all powder X-ray diffraction peaks described herein are reported with a variation of about ±0.2° 2θ, and it is intended that all disclosures herein are reported with such variation at all times, and herein, even when the output of the analysis may suggest a higher degree of accuracy at its nominal value, it is reported to one significant digit after the decimal point.

[0145] Single crystal X-ray diffraction provides three-dimensional structural information about the positions of atoms and bonds within a crystal. However, it is not always possible or appropriate to obtain such a structure from a crystal, for example, due to insufficient crystal size or difficulty in preparing a crystal of sufficient quality for single crystal X-ray diffraction.

[0146] Powder X-ray diffraction data can also be used, depending on the situation, to determine the crystallographic unit cell of the crystal structure. The method for doing this is called "indexing". Indexing is the process of determining the size and shape of the crystallographic unit cell that corresponds to the peak positions in an appropriate powder X-ray diffraction pattern. Indexing yields solutions for three unit cell lengths (a, b, c), three unit cell angles (α, β, γ), and three Miller index labels (h, k, l) for each peak. The lengths are typically reported in angstrom units, and the angles are typically reported in degrees. The Miller index labels are dimensionless integers. The success of indexing indicates that the sample is composed of one crystal phase and thus is not a mixture of crystal phases.

[0147] IR spectroscopy, particularly FT-IR, is another technique that can be used to characterize solid forms either in combination with powder X-ray diffraction or separately from it. In an IR spectrum, the absorbed light is plotted on the x-axis of the graph in "wave number" (cm -1 ) units, and the intensity is taken on the y-axis. Variations in the positions of IR peaks also exist and can be due to sample conditions as well as data collection and processing. Since the typical variations in the IR spectra reported herein are on the order of ±2.0 cm -1 , the use of the word "about" when referring to IR peaks is meant to include this variation, and all IR peaks disclosed herein are intended to be reported with such variation.

[0148] Thermal methods are another typical technique for characterizing solid forms. Different polymorphs of the same compound often melt at different temperatures. Thus, the melting points of polymorphs, as measured by methods such as capillary melting point method, DSC, and hot stage microscopy, either alone or in combination with techniques such as powder X-ray diffraction, IR spectroscopy including FT-IR, or both, can be used to characterize the polymorph or other solid form.

[0149] As with any analytical method, the determination of melting point is also subject to variation. In addition to instrument variation, common sources of variation are due to the unique properties of the sample being measured for melting point, such as the presence of other solid forms or other impurities in the sample.

[0150] As used herein, the terms “treating,” “treatment of,” “treatment,” and grammatical variations thereof, mean subjecting an individual subject to a protocol, regimen, process, or treatment desired to obtain a physiological response or physiological outcome in that subject, e.g., in a patient. In particular, the methods and compositions of the present invention can be used to slow the onset of disease symptoms, delay the onset of a disease or condition, or stop the progression of disease onset. However, since any subject being treated may not respond to a particular treatment protocol, treatment regimen, treatment process, or treatment therapy, treating does not require that a desired physiological response or physiological outcome be achieved in each subject, in any subject, or in a population of subjects, e.g., a patient population. Thus, a given subject or population of subjects, e.g., a patient population, may not respond to treatment or may have an inadequate response to treatment.

[0151] As used herein, the terms “ameliorating,” “amelioration of,” and grammatical variations thereof, mean reducing the severity of symptoms of a disease in a subject.

[0152] As used herein, “subject” means a mammal, preferably a human. In addition to humans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.

[0153] Cancer includes both solid tumors and blood cancers. Non-limiting examples of solid tumors include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of tumors, extracranial germ cell tumors, eye cancer, gallbladder cancer, gastric cancer, germ cell tumors, gestational trophoblastic tumors, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, large bowel cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndromes, myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasms, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell cancer, renal pelvis and urothelial transitional cell cancer, salivary gland cancer, Sézary syndrome, skin cancer (such as cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumors, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms tumor.

[0154] Examples of blood cancers include leukemias such as adult / pediatric acute lymphoblastic leukemia, adult / pediatric acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and hairy cell leukemia, lymphomas such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult / pediatric Hodgkin lymphoma, mycosis fungoides, adult / pediatric non-Hodgkin lymphoma, primary central nervous system lymphoma, Sézary syndrome, cutaneous T-cell lymphoma, and Waldenström macroglobulinemia, as well as other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma / plasma cell neoplasms, myelodysplastic syndromes, and myelodysplastic / myeloproliferative neoplasms, but are not limited thereto. A preferred set of cancers treatable in accordance with the present invention includes neuroblastoma, leukemia, lymphoma, liver cancer, lung cancer, skin cancer, testicular cancer, and thyroid cancer. Preferably, the cancer is melanoma.

[0155] The method of the present invention may further optionally comprise administering to the subject at least one additional therapeutic agent effective to treat cancer and ameliorate its effects. The additional therapeutic agent may be selected from the group consisting of an antibody or fragment thereof, a chemotherapeutic agent, an immunotherapeutic agent, a radionuclide, a photoactive therapeutic agent, a radiosensitizer, and combinations thereof.

[0156] The crystalline, free base, and salt forms of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide (hereinafter referred to in the present specification as "the solid forms of the present invention"), and the anti-cancer agents used in co-treatment therapy may be administered to the subject simultaneously or at different times so as to be considered the most appropriate. When the solid forms of the present invention and other anti-cancer agents are administered at different times, for example, by sequential administration, the solid forms of the present invention can be administered to the subject before the other anti-cancer agents. Alternatively, the other anti-cancer agent can be administered to the subject before 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide.

[0157] As used herein, "antibody" includes not only naturally occurring immunoglobulins but also non-naturally occurring immunoglobulins, such as, for example, single-chain antibodies, chimeric antibodies (e.g., humanized mouse antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Fragments of an antibody include fragments that bind to an antigen (e.g., Fab’, F(ab’) 2 , Fab, Fv, and rIgG). For example also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd ed., W.H. See also Freeman & Co., New York (1998). The term "antibody" also includes bivalent or bispecific molecules, diabodies, triabodies, and tetra-bodies. The term "antibody" further includes both polyclonal and monoclonal antibodies.

[0158] Examples of therapeutic antibodies that can be used in the present invention include rituximab (Rituxan), cetuximab (Erbitux), bevacizumab (Avastin), and ibritumomab (Zevalin).

[0159] As used herein, "chemotherapeutic agent" means any therapeutic agent that uses a cytotoxic agent and / or a cell growth inhibitor against cancer cells, or cells associated with or supporting cancer cells, and is compatible with the solid form of the present invention and the treatment of the present invention. In a preferred embodiment, the chemotherapeutic agent is an agent selected from the group consisting of antimetabolites, microtubule inhibitors, DNA damaging agents, antibiotics, antiangiogenic agents, vascular disrupting agents, molecular targeting agents, and combinations thereof.

[0160] As used herein, "antimetabolite" means a substance that reduces or inhibits the use of a chemical substance by cells that are part of normal metabolism. Non-limiting examples of antimetabolites or their analogs according to the present invention include antifolates, purine inhibitors, pyrimidine inhibitors, and combinations thereof.

[0161] As used herein, "antifolate" means a substance that alters, reduces, or inhibits the use of folic acid (vitamin B9) by cells. Non-limiting examples of antifolates include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), pralatrexate (Spectrum Pharmaceuticals), aminopterin (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

[0162] As used herein, "purine" refers to a compound containing a fused six-membered nitrogen-containing ring and a five-membered nitrogen-containing ring. Non-limiting examples of purines important in cell metabolism include adenine , guanine, hypoxanthine, and xanthine. A "purine inhibitor" is a substance that alters, reduces, or suppresses the production or use of purines by cells. Non-limiting examples of purine inhibitors include methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), cladribine (Genzyme Corp.), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), fostadesine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), aminopterin (Sigma Aldrich), azathioprine (GlaxoSmithKline), pharmaceutically acceptable salts thereof, and combinations thereof.

[0163] As used herein, "pyrimidine" refers to a compound containing a six-membered nitrogen-containing ring. Non-limiting examples of pyrimidines important for cell metabolism include uracil, thymine, cytosine, and orotic acid. A "pyrimidine inhibitor" is a substance that alters, reduces, or inhibits the production or use of pyrimidines by cells. Non-limiting examples of pyrimidine inhibitors include 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), gemcitabine (Eli Lilly), cytarabine (Bedford Laboratories), decitabine (Astellas Pharma Inc.), floxuridine (Bedford Laboratories), 5-azacytidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), siarabin (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), carmofur (Santa Cruz Biotechnology, Inc.), 6-azauracil (MP Biomedicals, LLC), their pharmaceutically acceptable salts, and combinations thereof.

[0164] In a preferred embodiment of the present invention, the antimetabolite is selected from the group consisting of 5-fluorouracil (Tocris Bioscience), tegafur (LGM Pharma), capecitabine (Xeloda) (Roche), cladribine (LGM Pharma), methotrexate (DuraMed Pharmaceuticals, Inc.), pemetrexed (Eli Lilly), hydroxyurea (Bristol-Myers Squibb), 2-mercaptopurine (Sigma-Aldrich), 6-mercaptopurine (Sigma-Aldrich), fludarabine (Ben Venue Laboratories), gemcitabine (Eli Lilly), clofarabine (Genzyme Corp.), cytarabine (Bedford Laboratories), decitabine (Astellas Pharma Inc.), floxuridine (Bedford Laboratories), nelarabine (GlaxoSmithKline), pralatrexate (Spectrum Pharmaceuticals), 6-thioguanine (Gate Pharmaceuticals), 5-azacitidine (Pharmion Pharmaceuticals), doxifluridine (Cayman Chemicals), holoxydine (BioCryst Pharmaceuticals), pentostatin (Bedford Laboratories), sapacitabine (Cyclacel Pharmaceuticals, Inc.), siarabin (Access Pharmaceuticals), troxacitabine (SGX Pharmaceuticals), raltitrexed (AstraZeneca), aminopterin (Sigma Aldrich), carmofur (Santa Cruz Biotechnology, Inc.), azathioprine (GlaxoSmithKline), 6-azauracil (MP Biomedicals, LLC), pharmaceutically acceptable salts thereof, and combinations thereof.

[0165] ​As used herein, a "microtubule inhibitor" is a substance that disrupts the function of microtubules, such as polymerization or depolymerization of individual microtubule units. In one aspect of the invention, the microtubule inhibitor can be selected from the group consisting of microtubule destabilizing agents, microtubule stabilizing agents, and combinations thereof. The microtubule inhibitor of the present invention can also be selected from the group consisting of taxanes, vinca alkaloids, epothilones, and combinations thereof.Non-limiting examples of microtubule inhibitors according to the present invention include BT-062 (Biotest), HMN-214 (D. Western Therapeutics), eribulin mesylate (Eisai Co., Ltd.), vindesine (Eli Lilly), EC-1069 (Endocyte), EC-1456 (Endocyte), EC-531 (Endocyte), vintafolide (Endocyte), 2-methoxyestradiol (EntreMed), GTx-230 (GTx), trastuzumab emtansine (Hoffmann-La Roche), chlorambucil (Immune Pharmaceuticals), D1302A-mitansinoid conjugate (ImmunoGen), IMGN-529 (ImmunoGen), lorvotuzumab mertansine (ImmunoGen), SAR-3419 (ImmunoGen), SAR-566658 (ImmunoGen), IMP-03138 (Impact Therapeutics), the combination of topotecan / vincristine (LipoCure), BPH-8 (Molecular Discovery Systems), fosbretabulin trometamol (OXiGENE), estramustine phosphate sodium (Pfizer), vincristine (Pierre Fabre), vinflunine (Pierre Fabre), vinorelbine (Pierre Fabre), RX-21101 (Rexahn), cabazitaxel (Sanofi), STA-9584 (Synta Pharmaceuticals), vinblastine, epothilone A, patupilone (Novartis), ixabepilone (Bristol-Myers Squibb), epothilone D (Kosan Biosciences), paclitaxel (Bristol-Myers Squibb), docetaxel (Sanofi-Aventis), HAI abraxane, DJ-927 (Daiichi Sankyo Co., Ltd.), discodermolide (CAS No. 127943-53-7), erythroviolide (CAS No. 174545-76-7), pharmaceutically acceptable salts thereof, and combinations thereof.

[0166] Examples of DNA damaging agents of the present invention include, but are not limited to, alkylating agents, platinum-based drugs, intercalating agents, and DNA replication inhibitors.

[0167] As used herein, an "alkylating agent" is a substance that adds one or more alkyl groups (CnHm, where n and m are integers) to nucleic acids. In the present invention, the alkylating agent is selected from the group consisting of nitrogen mustards, nitrosoureas, alkyl sulfonates, triazines, ethyleneimines, and combinations thereof. Non-limiting examples of nitrogen mustards include mechlorethamine (Lundbeck), chlorambucil (GlaxoSmithKline), cyclophosphamide (Mead Johnson Co.), bendamustine (Astellas), ifosfamide (Baxter International), melphalan (Ligand), melphalan flufenamide (Oncopeptides), and pharmaceutically acceptable salts thereof. Non-limiting examples of nitrosoureas include streptozocin (Teva), carmustine (Astellas Pharma Inc.), lomustine (Sanofi), and pharmaceutically acceptable salts thereof. Non-limiting examples of alkyl sulfonates include busulfan (Jazz Pharmaceuticals) and and pharmaceutically acceptable salts thereof. Non-limiting examples of triazines include dacarbazine (Bayer), temozolomide (Cancer Research Technology), and pharmaceutically acceptable salts thereof. Non-limiting examples of ethyleneimines include thiotepa (Bedford Laboratories), altretamine (MGI Pharma), and pharmaceutically acceptable salts thereof. Other alkylating agents include ProLindac (Access), Ac-225 BC-8 (Actinium Pharmaceuticals), ALF-2111 (Alfact Innovation), trofosfamide (Baxter International), MDX-1203 (Bristol-Myers Squibb), thioureidobutyronitrile (CellCeutix), mitobronitol (Chinoin), mitolactol (Chinoin), nimustine (Daiichi Sankyo Company, Limited), glufosfamide (Eleison Pharmaceuticals), combination of HuMax-TAC and PBD ADC (Genmab), BP-C1 (Meabco), treosulfan (Medac), nilutamide (Metronomx), ifosfamide tosylate (Tanabe Mitsubishi Pharma Corporation), ranimustine (Tanabe Mitsubishi Pharma Corporation), ND-01 (NanoCarrier), HH-1 (Nordic Nanovector), combination of 22P1G cells and ifosfamide (Nuvilex), estramustine phosphate (Pfizer), prednimustine (Pfizer), lurbinectedin (PharmaMar), trabectedin (PharmaMar), altretamide (Sanofi), SGN-CD33A (Seattle Genetics), hotemustin (Servier), nedaplatin (Shionogi & Co., Ltd.), heptaplatin (Sk Holdings), apaziquone (Spectrum Pharmaceuticals), SG-2000 (Spirogen), TLK-58747 (Telik), laromustine (Vion Pharmaceuticals), procarbazine (Alkem Laboratories Ltd.), and pharmaceutically acceptable salts thereof.

[0168] As used herein, "platinum-based agent" refers to an anti-cancer substance containing the metal platinum and analogs of such substances. Platinum can be in any oxidation state. Platinum-based agents of the present invention include 1,2-diaminocyclohexane (DACH) derivatives, phenanthroimidazole Pt(II) complexes, platinum(IV) compounds, dinuclear and trinuclear platinum compounds, demethylcantharidin-incorporated platinum complexes, platinum conjugate compounds, cisplatin nanoparticles and polymeric micelles, sterically hindered platinum complexes, oxaliplatin (Debiopharm), satraplatin (Johnson Matthey), BBR3464 (Novuspharma S.p.A.), ZD0473 (Astra Zeneca), cisplatin (Nippon Kayaku Co., Ltd.), JM-11 (Johnson Matthey), PAD (cis-dichlorobis(cyclopentylamine)platinum(II)), MBA ((trans-1,2-diaminocyclohexane)bis(bromoacetato)platinum(II)), PHM ((1,2-cyclohexanediamine)malonato platinum(II)), SHP ((1,2-cyclohexanediamine)sulfato platinum(II)), neo-PHM ((trans-R,R-1,2-cyclohexanediamine)malonato platinum(II)), neo-SHP ((trans-R,R-1,2-cyclohexanediamine)sulfato platinum(II)), JM-82 (Johnson Matthey), PYP ((1,2-cyclohexanediamine)bis(pyruvato)platinum(II)), PHIC ((1,2-cyclohexanediamine)isocitrato platinum(II)), TRK-710 ((trans-R,R-1,2-cyclohexanediamine)[3-acetyl-5-methyl-2,4(3H,5H)-furandionato]platinum(II)), BOP ((1,2-cyclooctanediamine)bis(bromoacetato)platinum(II)), JM-40 (Johnson Matthey), enroplatin (UnionPharma), zinoplatin (LGM Pharma), CI-973 (Parke-Davis), lobaplatin (Zentaris AG / Hainan Tianwang International Pharmaceutical), cycloplatin (LG M Pharma), WA2114R (Miboplatin / Robaplatin) (Chembest Research Laboratories, Ltd.), Heptaplatin (SKI2053R) (SK Chemicals), TNO-6 (Spiroplatin) (Haihang Industry Co., Ltd.), Ormaplatin (Tetraplatin) (LGM Pharma), JM-9 (Iproplatin) (Johnson Matthey), BBR3610 (Novuspharma S.p.A.), BBR3005 (Novuspharma S.p.A.), BBR3571 (Novuspharma S.p.A.), BBR3537 (Novuspharma S.p.A.), Alloplatin (L-NDDP) (BOC Sciences), Pt-ACRAMTU ({[Pt(en)Cl(ACRAMTU-S)](NO3)2 (en = ethane-1,2-diamine, ACRAMTU = 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea)}), Cisplatin-loaded liposomes (LiPlasomes), SPI-077 (Alza), Lipoplatin (Regulon), Lipoxal (Regulon), Carboplatin (Johnson Matthey), Nedaplatin (Shionogi & Co., Ltd.), Milliplatine hydrate (Dainippon Sumitomo Pharma Co., Ltd.), Ormaplatin (LGM Pharma), Enroplatin (Lederle Laboratories), CI973 (Parke-Davis), PEGylated cisplatin, PEGylated carboplatin, PEGylated oxaliplatin, Transplatin (trans-diaminedichloroplatinum(II); mixed Z: trans-[PtCl2{Z-HN=C(OMe)Me}(NH3)]), CD-37 (Estradiol-platinum(II) hybrid molecule), Picoplatin (Poniard Pharmaceuticals), [Chemical formula] , AH44 (Komeda et al., 2006; Harris et al., 2005; Qu et al., 2004), triplatin NC (Harris et al., 2005; Qu et al., 2004), ProLindac (Access), pharmaceutically acceptable salts thereof, and combinations thereof, including but not limited to these.

[0169] As used herein, “intercalating agent” includes, but is not limited to, doxorubicin (adriamycin), daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0170] Non-limiting examples of DNA replication inhibitors include, but are not limited to, topoisomerase inhibitors. As used herein, “topoisomerase inhibitor” is a substance that reduces the expression or activity of topoisomerase. Topoisomerase inhibitors according to the present invention can inhibit topoisomerase I, topoisomerase II, or both topoisomerase I and topoisomerase II. Non-limiting examples of topoisomerase I inhibitors according to the present invention include irinotecan (Alchemia), APH-0804 (Aphios), camptothecin (Aphios), cositecan (BioNumerik), topotecan (GlaxoSmithKline), velotecan hydrochloride (Chon Kun Dang), filtecanpegol (Enzon), HN-30181A (Hanmi), hRS7-SN-38 (Immunomedics), labelizumab-SN-38 (Immunomedics), etirinotecanpegol (Nektar Therapeutics), NK-012 (Nippon Kayaku Co., Ltd.), SER-203 (Serina Therapeutics), simitecan hydrochloride prodrug (Shanghai HaiHe Pharmace uticals), Gemtecan (Sigma-Tau), Namitecan (Sigma-Tau), SN-38 (Supratek Pharma), TLC-388 hydrochloride (Taiwan Liposome Company), Lamellarin D (PharmaMar), pharmaceutically acceptable salts thereof, and combinations thereof. Non-limiting examples of type II topoisomerase inhibitors according to the present invention are Adva-27a (Advanomics), Zoptarelin doxorubicin (Aeterna Zentaris), Barasertib (Anthra Pharmaceuticals), Lazoxane (AstraZeneca), Doxorubicin (Avena Therapeutics), Amsacrine (Bristol-Myers Squibb), Etoposide phosphate (Bristol-Myers Squibb), Etoposide (Novartis), Dexrazoxane (Cancer Research Technology), the combination of Cytarabine / Daunorubicin (Celator Pharmaceuticals), CAP7.1 (CellAct Pharma), Aldoxorubicin (CytRx), Amrubicin hydrochloride (Dainippon Sumitomo Pharma Co., Ltd.), Bosaroxin (Dainippon Sumitomo Pharma Co., Ltd.), Daunorubicin (Gilead Sciences), the combination of Miratuzumab / Doxorubicin (Immunomedics), Aclarubicin (Kyowa Hakko Kirin Co., Ltd.), Mitoxantrone (Meda), Pirarubicin (Meiji Seika Pharma Co., Ltd.), Epirubicin (Pfizer), Teniposide (Novartis), F-14512 (Pierre Fabre), Elliptinium acetate (Sanofi), Zorubicin (Sanofi), Dexrazoxane (TopoTarget), Sobuzoxane (Zenyaku Kogyo Co., Ltd.), Idarubicin (Pfizer), HU-331 (Cayman Chemical), Aurintricarboxylic acid (Sigma Aldrich), pharmaceutically acceptable salts thereof, and combinations thereof.

[0171] Examples of chemotherapeutic antibiotics according to the present invention include, but are not limited to, actinomycin, anthracycline, valrubicin, epirubicin, bleomycin, pirarubicin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0172] As used herein, "anti-angiogenic agent" means any compound that prevents or delays the formation of new blood vessels from existing blood vessels. In the present invention, examples of anti-angiogenic agents include, but are not limited to, pegaptanib, ranibizumab, bevacizumab (Avastin), carboxyamidotriazole, TNP-470, CM101, IFN-α, IL-12, platelet factor 4, suramin, SU5416, thrombospondin, VEGFR antagonists, angiogenesis inhibitory steroids and heparin, cartilage-derived angiogenesis inhibitory factor, matrix metalloproteinase inhibitors, angiostatin, endostatin, 2-methoxyestradiol, tecogalan, prolactin, αvβ3 inhibitors, linomide, VEGF-Trap, aminosteroids, cortisone, tyrosine kinase inhibitors, anti-angiogenic siRNAs, inhibitors of the complement system, vascular disrupting agents, and combinations thereof. Preferably, the anti-angiogenic agent is bevacizumab.

[0173] Examples of the VEGFR antagonists of the present invention include, but are not limited to, pazopanib, regorafenib, lenvatinib, sorafenib, sunitinib, axitinib, vandetanib, cabozantinib, batatinib, semaxanib, ZD6474, SU6668, AG-013736, AZD2171, AEE788, MF1 / MC-18F1, DC101 / IMC-1C11, ramucirumab, and motesanib. Also included as VEGFR antagonists may be VEGF inhibitors such as bevacizumab, aflibercept, 2C3, r84, VEGF-Trap, and ranibizumab.

[0174] The angiogenesis-inhibiting steroids of the present invention include any steroids that inhibit, reduce, prevent angiogenesis or neovascularization, or cause regression of pathological angiogenesis. The present invention In addition to those disclosed in European Application No. EP1236471A2, as angiogenesis-inhibiting steroids of the present invention, 20-substituted steroids disclosed in U.S. Patent No. 4,599,331, 21-hydroxy steroids disclosed in U.S. Patent No. 4,771,042, C11-functionalized steroids disclosed in International Application No. WO1987 / 02672, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione 21-acetate, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione, 6α-fluoro-17α,21-dihydroxy-16β-methylpregna-4,9(11)-diene-3,20-dione 21-phosphonooxy, and pharmaceutically acceptable salts thereof, hydrocortisone, tetrahydrocortisol, 17α-hydroxyprogesterone, 11α-epihydrocortisol, cortisone, corticosterone, desoxycorticosterone, dexamethasone, cortisone 21-acetate, hydrocortisone 21-phosphate, 17α-hydroxy-6α-methylpregna-4-ene-3,20-dione 17-acetate, 6α-fluoro-17α,21-dihydroxy-16α-methylpregna-4,9(11)-diene-3,20-dione, and Δ9(11)-ethynoate (all disclosed in International Application No. WO1990 / 015816A1) are mentioned.

[0175] Examples of the cartilage-derived angiogenesis inhibitors include, but are not limited to, the peptides troponin and chondromodulin I.

[0176] Examples of the matrix metalloproteinase inhibitor of the present invention include, but are not limited to, succinyl hydroxamates such as marimastat and SC903, sulfonamide hydroxamates such as CGS27023A, phosphine amide hydroxamates, carboxylate inhibitors such as BAY12-9566, thiol inhibitors such as Compound B, aminomethylbenzimidazole analogs, peptides such as legacepin, and tetracyclines such as minocycline.

[0177] Examples of the αvβ3 inhibitor include, but are not limited to, IS20I, P11 peptide, EMD85189 and 66203, RGD peptides, RGD mimetics such as S 36578-2, exostatin, antibodies or antibody fragments against αvβ3 integrin such as Vitaxin targeting the extracellular domain of the dimer, cilengitide, and peptide mimetics such as S247.

[0178] Examples of the anti-angiogenic siRNA include, but are not limited to, siRNAs targeting mRNAs upregulated during angiogenesis, optionally PEGylated siRNAs targeting VEGF or VEGFR mRNAs, and siRNAs targeting the mRNAs of UPR (unfolded protein response)-IRE1α, XBP-1 and ATF6. In addition, siRNAs with a length of at least 21 nucleotides have been shown to inhibit neovascularization regardless of the target sequence (Kleinman et al., 2008) and may be included in the anti-angiogenic siRNAs of the present invention.

[0179] As inhibitors of the complement system, modified natural complement components such as soluble type 1 complement receptor, soluble type 1 complement receptor lacking long homology repeat A, soluble type 1 complement receptor-sialyl Lewis x, type 2 complement receptor, soluble decay-accelerating factor, soluble membrane cofactor protein, soluble CD59, decay-accelerating factor-CD59 hybrid, membrane cofactor protein-decay-accelerating factor hybrid, C1 inhibitor, and C1q receptor, complement inhibitory antibodies such as anti-C5 monoclonal antibody and anti-C5 single-chain Fv, synthetic inhibitors of complement activation such as antagonist peptides and analogs targeting the C5a receptor, and naturally occurring compounds that block complement activation such as heparin and related glycosaminoglycan compounds are included, but are not limited to these. Makrides (Makrides, 1998) has disclosed additional inhibitors of the complement system. These are not limited thereto.

[0180] As used herein, the term "vascular disrupting agent" means any compound that targets an existing vascular system, such as the tumor vascular system, damages or destroys said vascular system, and / or causes tumor central necrosis. In the present invention, examples of vascular disrupting agents include ABT-751 (Abbott), AVE8062 (Aventis), BCN105 (Bionomics), BMXAA (Antisoma), CA-4-P (OxiGene), CA-1-P (OxiGene), CYT997 (Cytopia), MPC-6827 (Myriad Pharmaceuticals), MN-029 (MediciNova), NPI-2358 (Nereus), Oxi4503 (Oxigene), TZT-1027 (Daiichi Pharmaceutical Co., Ltd.), ZD6126 (AstraZeneca and Angiogene), their pharmaceutically acceptable salts, and combinations thereof, but are not limited to these.

[0181] As used herein, a "molecular targeting agent" is a substance that, when administered to a subject, interferes with the function of a single molecule or group of molecules, preferably a single molecule or group of molecules involved in tumor growth and progression. Non-limiting examples of the molecular targeting agents of the present invention include signal transduction inhibitors, modulators of gene expression and other cellular functions, immune system modulators, antibody-drug conjugates (ADCs), and combinations thereof.

[0182] As used herein, a "signal transduction inhibitor" is a substance that disrupts cell-to-cell communication, such as when an extracellular signal transduction molecule activates a cell surface receptor. Non-limiting examples of the signal transduction inhibitors of the present invention include anaplastic lymphoma kinase (ALK) inhibitors, B-Raf inhibitors, epidermal growth factor inhibitors (EGFRi), ERK inhibitors, Janus kinase inhibitors, MEK inhibitors, mammalian target of rapamycin (mTor) inhibitors, phosphoinositide 3-kinase inhibitors (PI3Ki), and Ras inhibitors.

[0183] As used herein, an "anaplastic lymphoma kinase (ALK) inhibitor" is a substance that (i) directly interacts with ALK, for example, by binding to ALK, and (ii) reduces the expression or activity of ALK. Non-limiting examples of anaplastic lymphoma kinase (ALK) inhibitors of the present invention include crizotinib (Pfizer, New York, NY), CH5424802 (Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), GSK1838705 (GlaxoSmithKline, United Kingdom), Chugai 13d (Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), CEP28122 (Teva Pharmaceutical Industries, Ltd., Israel), AP26113 (Ariad Pharmaceuticals, Cambridge, MA), Cephalon 30 (Teva Pharmaceutical Industries, Ltd., Israel), X-396 (Xcovery, Inc., West Palm Beach, FL), Amgen 36 (Amgen Pharmaceuticals, Thousand Oaks, CA), ASP3026 (Astellas Pharma US, Inc., Northbrook, Illinois), and Amgen 49 (Amgen Pharmaceuticals, Thousand Oaks, CA), including pharmaceutically acceptable salts thereof and combinations thereof.

[0184] As used herein, a "B-Raf inhibitor" of the present invention is a substance that (i) directly interacts with B-Raf, for example, by binding to B-Raf, and (ii) reduces the expression or activity of B-Raf. B-Raf inhibitors can be classified into two types according to their respective binding modes. As used herein, a "type 1" B-Raf inhibitor is an inhibitor that targets the ATP-binding site of the kinase in its active conformation. A "type 2" B-Raf inhibitor is an inhibitor that preferentially binds to the inactive conformation of the kinase. Non-limiting examples of type 1 B-Raf inhibitors of the present invention include

Chemical formula

Chem.

[0185] Non-limiting examples of the type 2 B-Raf inhibitors of the present invention are

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

[0186] Other B-Raf inhibitors include, but are not limited to, AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 253 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research)), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GW5074 (Sigma Aldrich), ISIS 5132 (Novartis), LErafAON (NeoPharm, Inc.), LBT613 (Novartis), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), TAK 632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), XL-281 (Exelixis), pharmaceutically acceptable salts thereof, and combinations thereof.

[0187] As used herein, an "EGFR inhibitor" is a substance that (i) directly interacts with EGFR by binding thereto, and (ii) reduces the expression or activity of EGFR. Non-limiting examples of EGFR inhibitors according to the present invention include (+)-aeroplysinin-1 (CAS No. 28656-91-9), 3-(4-isopropylbenzylidene)-indolin-2-one, ABT-806 (Life Science Pharmaceuticals), AC-480 (Bristol-Myers Squibb), afatinib (Boehringer Ingelheim), AG 1478 (CAS No. 153436-53-4), AG 494 (CAS No. 133550-35- 3), AG 555 (CAS No. 133550-34-2), AG 556 (CAS No. 133550-41-1), AG 825 (CAS No. 149092-50-2), AG-490 (CAS No. 134036-52-5), Antroquinonol (Golden Biotechnology), AP-26113 (Ariad), ARRY334543 (CAS No. 845272-21-1), AST 1306 (CAS No. 897383-62-9), AVL-301 (Celgene), AZD8931 (CAS No. 848942-61-0), BIBU 1361 (CAS No. 793726-84-8), BIBX 1382 (CAS No. 196612-93-8), BMS-690514 (Bristol-Myers Squibb), BPIQ-I (CAS No. 174709-30-9), Canertinib (Pfizer), Cetuximab (Actavis), Sipatinib (Jiangsu Hengrui Medicine), CL-387,785 (Santa Cruz Biotech), Compound 56 (CAS No. 171745-13-4), CTX-023 (CytomX Therapeutics), CUDC-101 (Curis), Dacomitinib (Pfizer), DAPH (CAS No. 145915-58-8), Daphnetin (Santa Cruz Biotech), Doberitinib Lactate (Novartis), EGFR Inhibitor (CAS No. 879127-07-8), Epitinib (Hutchison China MediTech), Erbstatin Analogue (CAS No. 63177-57-1), Erlotinib (Astellas), Gefitinib (AstraZeneca), GT-MAB 5.2-GEX (Glycotope), GW 583340 (CAS No. 388082-81-3), GW2974 (CAS No. 202272-68-2), HDS 029 (CAS No. 881001-19-0), hypericin (Santa Cruz Biotech), icotinib hydrochloride (Betapharma), JNJ-26483327 (Johnson & Johnson), JNJ-28871063 (Johnson & Johnson), KD-020 (Kadmon Pharmaceuticals), lapatinib ditosylate (GlaxoSmithKline), lavendustin A (Sigma), lavendustin C (Sigma), LY-3016859 (Eli Lilly), MEHD-7945A (Hoffmann-La Roche), MM-151 (Merrimack), MT-062 (Medisyn Technologies), necitumumab (Eli Lilly), neratinib (Pfizer), nimotuzumab (Center of Molecular Immunology), NT-004 (NewGen Therapeutics), panitumumab (Amgen), PD 153035 (CAS No. 153436-54-5), PD 161570 (CAS No. 192705-80-9), PD. 168393, PD 174265 (CAS No. 216163-53-0), Pyrotinib (Sihuan Pharmaceutical), Pogiotinib (Hanmi), PP 3 (CAS No. 5334-30-5), PR-610 (Proacta), Pyrotinib (Jiangsu Hengrui Medicine), RG-13022 (CAS No. 136831-48-6), Lindpeptin (Celldex Therapeutics), RPI-1 (CAS No. 269730-03-2), S-222611 (Shionogi & Co., Ltd.), TAK 285 (CAS No. 871026-44-7), TAS-2913 (Taiyo Yakuhin Kogyo Co., Ltd.), Seribantumab (Hutchison China MediTech), Tyrphostin 47 (RG-50864, AG-213) (CAS No. 118409-60-2), Tyrphostin 51 (CAS No. 122520-90-5), Tyrphostin AG 1478 (CAS No. 175178-82-2), Tyrphostin AG 183 (CAS No. 126433-07-6), Tyrphostin AG 528 (CAS No. 133550-49-9), Tyrphostin AG 99 (CAS No. 118409-59-9), Tyrphostin B42 (Santa Cruz Biotech), Tyrphostin B44 (Santa Cruz Biotech), Tyrphostin RG 14620 (CAS No. 136831-49-7), Vandetanib (AstraZeneca), Baricitinib (Array BioPharma), Batatinib (Novartis), WZ 3146 (CAS No. 1214265-56-1), WZ 4002 (CAS No. 1213269-23-8), WZ8040 (CAS No. 1214265-57-2), XL-647 (Exelixis), Z-650 (HEC Pharm), ZM 323881 (CAS No. 324077-30-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the EGFR inhibitor is selected from the group consisting of panitumumab, erlotinib, pharmaceutically acceptable salts thereof, and combinations thereof.

[0188] As described above, the solid form of the present invention is an ERK inhibitor. As used herein, an "ERK inhibitor" is a substance that (i) directly interacts with ERK, including ERK1 and ERK2, for example, by binding to ERK, and (ii) reduces the expression or activity of the ERK protein kinase. Thus, inhibitors that act upstream of ERK, such as MEK inhibitors and RAF inhibitors, are not ERK inhibitors according to the present invention. The solid form of the present invention can be administered as combination therapy in combination with other ERK inhibitors, such as AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.

[0189] As used herein, a "Janus kinase inhibitor" is a substance that (i) directly interacts with a Janus kinase, for example, by binding to the Janus kinase, and (ii) reduces the expression or activity of the Janus kinase. Examples of Janus kinases of the present invention include Tyk2, Jak1, Jak2, and Jak3. Non-limiting examples of Janus kinase inhibitors of the present invention include ruxolitinib (Incyte Corporation, Wilmington, DE), baricitinib (Incyte Corporation, Wilmington, DE), tofacitinib (Pfizer, New York, NY), VX-509 (Vertex Pharmaceuticals, Inc., Boston, MA), GLPG0634 (Galapagos NV, Belgium), CEP-33779 (Teva Pharmaceuticals, Israel), pharmaceutically acceptable salts thereof, and combinations thereof.

[0190] As used herein, a "MEK inhibitor" is a substance that (i) directly interacts with MEK by binding thereto, and (ii) reduces the expression or activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEK inhibitors according to the present invention. MEK inhibitors can be classified into two types depending on whether the inhibitor competes with ATP for binding to MEK. As used herein, a "type 1" MEK inhibitor is an inhibitor that competes with ATP for binding to MEK. A "type 2" MEK inhibitor is an inhibitor that does not compete with ATP for binding to MEK. Non-limiting examples of type 1 MEK inhibitors according to the present invention include ventamapimod (Merck KGaA), L783277 (Merck), RO092210 (Roche), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 1 MEK inhibitor is RO092210 (Roche) or a pharmaceutically acceptable salt thereof. Non-limiting examples of type 2 MEK inhibitors according to the present invention include anthrax toxin, the lethal factor portion of anthrax toxin, ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one), PD 184352 (CI-1040), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), refametinib (AstraZeneca) , including selumetinib (AZD6244) (AstraZeneca), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), RDEA119 (Ardea Biosciences / Bayer), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the type 2 MEK inhibitor is trametinib or a pharmaceutically acceptable salt thereof. Other MEK inhibitors include, but are not limited to, anthroquinonol (Golden Biotechnology), AS-1940477 (Astellas), AS-703988 (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973, RG422, RO4987655, RO5126766, SL327, WX-554 (Wilex), YopJ polypeptide, pharmaceutically acceptable salts thereof, and combinations thereof.

[0191] As used herein, an "mTOR inhibitor" is a substance that (i) directly interacts with mTOR by binding thereto, for example, and (ii) reduces the expression or activity of mTOR. Non-limiting examples of mTOR inhibitors according to the present invention include zotarolimus (AbbVie), everolimus (Biosensors), temsirolimus (Pfizer), sirolimus (Pfizer), sirolimus NanoCrystal (Elan Pharmaceutical Technologies), sirolimus TransDerm (TransDerm), sirolimus-PNP (Samyang), everolimus (Novartis), biolimus A9 (Biosensors), ridaforolimus (Ariad), rapamycin, TCD-10023 (Terumo), DE-109 (MacuSight), MS-R001 (MacuSight), MS-R002 (MacuSight), MS-R003 (MacuSight), Perceiva (MacuSight), XL-765 (Exelixis), quinacrine (Cleveland BioLabs), PKI-587 (Pfizer), PF-04691502 (Pfizer), GDC-0980 (Genentech and Piramed), dactolisib (Novartis), CC-223 (Celgene), PWT-33597 (Pathway Therapeutics), P-7170 (Piramal Life Sciences), LY-3023414 (Eli Lilly), INK-128 (Takeda Pharmaceutical Company Limited), GDC-0084 (Genentech), DS-7423 (Daiichi Sankyo Company, Limited), DS-3078 (Daiichi Sankyo Company, Limited), CC-115 (Celgene), CBLC-137 (Cleveland BioLabs), AZD-2014 (AstraZeneca), X-480 (Xcovery), X-414 (Xcovery), EC-0371 (Endocyte), VS-5584 (Verastem), PQR-401 (Piqur), PQR-316 (Piqur), PQR-311 (Piqur), PQR-309 (Piqur), PF-06465603 (Pfizer), NV-128 (Novogen), nPT-MTOR (BioticaTechnology), BC-210 (Biotica Technology), WAY-600 (Biotica Technology), WYE-354 (Biotica Technology), WYE-687 (Biotica Technology), LOR-220 (Lorus Therapeutics), HMPL-518 (Hutchison China MediTech), GNE-317 (Genentech), EC-0565 (Endocyte), CC-214 (Celgene), and ABTL-0812 (Ability Pharmaceuticals).

[0192] As used herein, a "PI3K inhibitor" is a substance that reduces the expression or activity of phosphatidylinositol 3-kinase (PI3K) or downstream proteins such as Akt. When activated, PI3K phosphorylates the 3'-OH group of the inositol ring in inositol phospholipids to generate phosphatidylinositol-3,4,5-trisphosphate (PI-3,4,5-P(3)), a second messenger. Akt interacts with the phospholipid, causing Akt to translocate to the inner membrane where it is phosphorylated and activated. Activated Akt modulates the functions of numerous substrates involved in the regulation of cell survival, cell cycle progression, and cell growth.

[0193] Non-limiting examples of PI3K inhibitors according to the present invention include A-674563 (CAS number: 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxalin-6-ylmethylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS number: 857531-00-1), the benzimidazole series of Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS number: 32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS number: 612847-09-3, CAS number: 681281-88-9, CAS number: 75747-14-7, CAS number: 925681-41-0, CAS number: 98510-80-6, CCT128930 (CAS number: 885499-61-6), CH5132799 (CAS number: 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS number: 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS number: 937174-76-0), H-89 (CAS number: 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.) KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS No.: 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No.: 1032350-13-2), ML-9 (CAS No.: 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS No.: 1191951-57-1), PI3 kinase delta inhibitors from Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors from Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors from Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor 2 from Incozen (Incozen Therapeutics), PI3 kinase inhibitors from Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors from Roche (Roche Holdings Inc.), PI3 kinase inhibitors from Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitors from Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors from Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors from Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors from Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), Pathway Therapeutic. PI3-delta inhibitors of s-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitors of Cellzome (Cellzome AG), PI3-delta / gamma inhibitors of Cellzome (Cellzome AG), PI3-delta / gamma inhibitors of Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitors of Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitors of Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitors of Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitors of Evotec (Evotec), PI3-gamma inhibitors of Cellzome (Cellzome AG), PI3-gamma inhibitors of Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitors of Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitors of Intellikine-1 (Intellikine Inc.), Pictilisib (GDC-0941) (Roche Holdings Inc.), PIK-90 (CAS No.: 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), Tristiribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the inhibitor of the PI3K / Akt pathway is Pictilisib (GDC-0941) or a pharmaceutically acceptable salt thereof.

[0194] As used herein, "RAS inhibitor" refers to a substance that (i) directly interacts with RAS by binding thereto, and (ii) reduces the expression or activity of RAS. Non-limiting examples of RAS inhibitors according to the present invention include farnesyltransferase inhibitors (e.g., tipifarnib and lonafarnib, etc.), small molecules containing a farnesyl group (e.g., salsalate and TLN-4601, etc.), DCAI as described by Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602 as described by Shima (Shima et al., 2013), and HBS3 (Patgiri et al., 2011), and AIK-4 (Allinky), their pharmaceutically acceptable salts, and combinations thereof.

[0195] As used herein, "gene expression" is the process by which information from DNA is used in the formation of polypeptides. "Modulators of gene expression and other cellular functions" are substances that affect gene expression and other functions of cells. Non-limiting examples of such modulators include hormones, histone deacetylase inhibitors (HDACi), and cyclin-dependent kinase inhibitors (CDKi), and poly(ADP-ribose) polymerase (PARP) inhibitors.

[0196] In the present invention, a "hormone" is a substance released by cells in one part of the body and that affects cells in another part of the body. Non-limiting examples of hormones according to the present invention include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Müllerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atrial peptide, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin , somatomedin, leptin, lipotropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol, but are not limited thereto.

[0197] Some compounds interfere with the activity of a particular hormone or stop the production of a particular hormone. Non-limiting examples of hormone-interfering compounds according to the present invention include tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the scope of the meaning of hormones in the present invention.

[0198] As used herein, "HDAC inhibitor" refers to a substance that (i) directly interacts with HDAC by binding thereto, for example, and (ii) reduces the expression or activity of HDAC. Non-limiting examples of HDAC inhibitors according to the present invention include 4SC-201 (4SC AG), 4SC-202 (Takeda Pharmaceutical Company Limited), abexinostat (Celera), AN-1 (Titan Pharmaceuticals, Inc.), apicidin (Merck & Co., Inc.), AR-42 (Arno Therapeutics), ARQ-700RP (ArQule), Avugane (TopoTarget AS), azelaic-1-hydroxamate-9-anilide (AAHA), belinostat (TopoTarget), butyrate (Enzo Life Sciences, Inc.), CG-1255 (Errant Gene Therapeutics, LLC), CG-1521 (Errant Gene Therapeutics, LLC), CG-200745 (CrystalGenomics, Inc.), kidamide (Shenzhen Chipscreen Biosciences), CHR-3996 (Chroma Therapeutics), CRA-024781 (Pharmacyclics), CS-3158 (Shenzhen Chipscreen Biosciences), CU-903 (Curis), DAC-60 (Genextra), Entinostat (Bayer), Hyaluronic acid butyrate (HA-But), IKH-02 (IkerChem), IKH-35 (IkerChem), ITF-2357 (Italfarmaco), ITF-A (Italfarmaco), JNJ-16241199 (Johnson & Johnson), KA-001 (Karus Therapeutics), KAR-3000 (Karus Therapeutics), KD-5150 (Kalypsys), KD-5170 (Kalypsys), KLYP-278 (Kalypsys), KLYP-298 (Kalypsys), KLYP-319 (Kalypsys), KLYP-722 (Kalypsys), m-Carboxycinnamic acid bis-hydroxamide (CBHA), MG-2856 (MethylGene), MG-3290 (MethylGene), MG-4230 (MethylGene), MG-4915 (MethylGene), MG-5026 (MethylGene), MGCD-0103 (MethylGene Inc.), Mocetinostat (MethylGene), MS-27-275 (Schering AG), NBM-HD-1 (NatureWise), NVP-LAQ824 (Novartis), OCID-4681-S-01 (Orchid Pharmaceuticals), Oxamflatin ((2E)-5-[3-[(phenylsulfonyl)amino]phenyl]-penta-2-en-4-ynohydroxamic acid), Panobinostat (Novartis), PCI-34051 (Pharmacyclics), Phenylbutyrate (Enzo Life Sciences, Inc.), Pivaloyloxymethyl Butyrate (AN-9, Titan Pharmaceuticals, Inc.), pivabnex (Titan Pharmaceuticals, Inc.), plasinostat (SBIO), PX-117794 (TopoTarget AS), PXD-118490 (LEO-80140) (TopoTarget AS), piroximide (succinoyl-3-aminopyridine amide hydroxamic acid), resminostat (Takeda Pharmaceutical Company Limited), RG-2833 (RepliGen), licolinostat (Acetylon), romidepsin (Astellas), SB-1304 (S * BIO), SB-1354 (S * BIO), SB-623 (Merrion Research I Limited), SB-624 (Merrion Research I Limited), SB-639 (Merrion Research I Limited), SB-939 (S * BIO), scriptide (N-hydroxy-1,3-dioxo-1H-benz[de]isoquinoline-2(3H)-hexan amide), SK-7041 (In2Gen / SK Chemical Co.), SK-7068 (In2Gen / SK Chemical Co.), suberoylanilide hydroxamic acid (SAHA), sulfonamide hydroxamic acid, tributyrin (Sigma Aldrich), trichostatin A (TSA) (Sigma Aldrich), valproic acid (VPA) (Sigma Aldrich), vorinostat (Zolinza), WF-27082B (Fujisawa Pharmaceutical Co., Ltd.), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the HDAC inhibitor is romidepsin, its pharmaceutically acceptable salts, and combinations thereof.

[0199] As used herein, "CDK" refers to a family of protein kinases that regulate the cell cycle. Known CDKs include cdk1, cdk2, ckd3, ckd4, cdk5, cdk6, cdk7, cdk8, cdk9, cdk10, and cdk11. A "CDK inhibitor" is a substance that (i) directly interacts with a CDK, for example, by binding to the CDK, and (ii) decreases the expression or activity of the CDK. Non-limiting examples of CDK inhibitors according to the present invention include 2-hydroxybohémine, 3-ATA, 5-iodo-indirubin-3'-monoxime, 9-cyanopaurone, alloisoleucine A, alsterpaullone 2-cyanoethyl, alvocidib (Sanofi), AM-5992 (Amgen), aminopurvalanol A, alshriafravin A, AT-7519 (Astex Pharmaceuticals), AZD 5438 (CAS number: 602306-29-6), BMS-265246 (CAS number: 582315-72-8), BS-181 (CAS number: 1092443-52-1), butyrolactone I (CAS number: 87414-49-1), Cdk / Crk inhibitor (CAS number: 784211-09-2), Cdk1 / 5 inhibitor (CAS number: 40254-90-8), Cdk2 inhibitor II (CAS number: 222035-13-4), Cdk2 inhibitor IV, NU6140 (CAS number: 444723-13-1), Cdk4 inhibitor (CAS number: 546102-60-7), Cdk4 inhibitor III (CAS number: 265312-55-8), Cdk4 / 6 inhibitor IV (CAS number: 359886-84-3), Cdk9 inhibitor II (CAS number: 140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinaciclib (Ligand), (R)-DRF053 dihydrochloride (CAS number: 1056016-06-8), fascaplysin, flavopiridol, hygrolidin, indirubin, LEE-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano Medical Sciences), MM-D37K (Maxwell Biotech), N9-isopropyl-olomoucine, NSC 625987 (CAS number: 141992-47-4), NU2058 (CAS number: 161058-83-9), NU6102 (CAS number: 444722-95-6), olomoucine, ON-108600 (Onconova), ON-123300 (Onconova), oxyindole I, P-1446-05 (Piramal), P-276-00 (Piramal), palbo Cyclicrib (Pfizer), PHA-767491 (CAS number: 845714-00-3), PHA-793887 (CAS number: 718630-59-2), PHA-848125 (CAS number: 802539-81-7), purvalanol A, purvalanol B, R547 (CAS number: 741713-40-6), RO-3306 (CAS number: 872573-93-8), roscovitine, SB-1317 (SBIO), SCH 900776 (CAS number: 891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS number: 345627-80-7), SU9516 (CAS number: 377090-84-1), WHI-P180 (CAS number: 211555-08-7), pharmaceutically acceptable salts thereof, and combinations thereof. Preferably, the CDK inhibitor is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.

[0200] As used herein, "poly(ADP-ribose) polymerase (PARP) inhibitor" refers to a substance that reduces the expression or activity of poly(ADP-ribose) polymerase (PARP) or downstream proteins. Non-limiting examples of the poly(ADP-ribose) polymerase (PARP) inhibitors of the present invention include PF01367338 (Pfizer, New York, NY), olaparib (AstraZeneca, United Kingdom), iniparib (Sanofi-Aventis, Paris, France), veliparib (Abbott Laboratories, Abbott Park, IL), MK 4827 (Merck, White House Station, NJ), CEP 9722 (Teva Pharmaceuticals, Israel), LT-673 (Biomarin, San Rafael, CA), and BSI 401 (Sanofi-Aventis, Paris, France), their pharmaceutically acceptable salts, and combinations thereof.

[0201] As used herein, "immunotherapeutic agent" means any anti-cancer agent that uses a substance that modifies the immune response by enhancing or reducing the ability of the immune system to produce antibodies or sensitized cells that recognize and react with an antigen that is compatible with the solid form of the present invention and that induces its production. Immunotherapeutic agents can be recombinant, synthetic, or natural preparations, and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunotherapeutic agents are naturally present in the body, and some of these are available in pharmacological preparations. Examples of immunotherapeutic agents include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferon, imiquimod and cell membrane fractions derived from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).

[0202] In a preferred embodiment, the immunotherapeutic agent is an immune checkpoint inhibitor. As used herein, the term "immune checkpoint inhibitor" means a substance that blocks the activity of molecules involved in the attenuation of the immune response. Such molecules include, for example, cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed cell death protein 1 (PD-1). Examples of the immune checkpoint inhibitors of the present invention include, but are not limited to, ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer), MDX-1106 (Medarex, Inc.), MK3475 (Merck), CT-011 (CureTech, Ltd.), AMP-224 (AmpImmune), MDX-1105 (Medarex, Inc.), IMP321 (Immutep S.A.), and MGA271 (Macrogenics).

[0203] In the present invention, the term "radionuclide" refers to a radioactive substance that is administered to a patient, for example, intravenously or orally administered to the patient, and then penetrates into a target organ or target tissue through the normal metabolism of the patient, where it delivers local radiation over a short period of time of time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.

[0204] In the present invention, the term "photoactive therapeutic agent" means a compound and composition that become active when exposed to light. Certain examples of photoactive therapeutic agents are disclosed, for example, in U.S. Patent Application No. 2011 / 0152230A1, "Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy".

[0205] In the present invention, the term "radiosensitizer" means a compound that increases the sensitivity of tumor cells to radiotherapy. Examples of radiosensitizers include misonidazole, metronidazole, tirapazamine, and sodium trans-crocetinate.

[0206] In the present invention, the "effective amount" or "therapeutically effective amount" of one or more solid forms of the present invention or other anti-cancer agents of the present invention, including a pharmaceutical composition containing one or more solid forms of the present invention or other anti-cancer agents of the present invention, is an amount of such solid form or composition that, when administered to a subject, is sufficient to produce a beneficial or desired result as described herein. Effective dosage forms, modes of administration, and dosages can be determined empirically, and making such determinations is within the scope of the skill in the art. By those skilled in the art, it is understood that the dosage will vary with the route of administration, rate of excretion, duration of treatment, identity of any other drugs being administered, the subject, e.g., the age, size, and species of a human patient, and similar factors well known in the medical and veterinary arts. Generally, an appropriate dosage of one or more solid forms of the present invention or a pharmaceutical composition according to the present invention is an amount that is the lowest dosage effective to produce the desired effect. The effective dosage of the solid form or pharmaceutical composition of the present invention can be administered as two, three, four, five, six, or more fractional dosages, administered individually at appropriate intervals throughout the day.

[0207] Suitable and non-limiting examples of the solid forms of the present invention, or the dosage of another anti-cancer agent, disclosed herein include from about 1 mg / kg to about 100 mg / kg per day, from about 1 mg / kg to about 1200 mg / kg per day, from 75 mg / kg per day to about 300 mg / kg per day, etc., from about 1 mg / kg to about 2400 mg / kg per day. Other representative dosages of such agents include about 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, 400 mg / kg, 500 mg / kg, 600 mg / kg, 700 mg / kg, 800 mg / kg, 900 mg / kg, 1000 mg / kg, 1100 mg / kg, 1200 mg / kg, 1300 mg / kg, 1400 mg / kg, 1500 mg / kg, 1600 mg / kg, 1700 mg / kg, 1800 mg / kg, 1900 mg / kg, 2000 mg / kg, 2100 mg / kg, 2200 mg / kg, and 2300 mg / kg per day. The effective dosages of the solid forms of the present invention, or other anti-cancer agents, disclosed herein can be administered as two, three, four, five, six, or more sub-dosages, individually administered at appropriate intervals throughout the day as sub-dosages.

[0208] The solid forms of the present invention, or other anti-cancer agents, or pharmaceutical compositions containing them, can be administered in any desired effective manner, for oral administration, or as eye drops for topical administration to the ointment or eye, or for parenteral administration or other administration, intraperitoneal administration, subcutaneous It can be administered by any suitable method, such as oral administration, topical administration, intradermal administration, inhalation administration, intrapulmonary administration, rectal administration, vaginal administration, sublingual administration, intramuscular administration, intravenous administration, intraarterial administration, intrathecal administration, or intralymphatic administration, etc. Furthermore, the solid form of the present invention, or other anticancer agents, or pharmaceutical compositions containing these can be administered together with other treatments. The solid form of the present invention, or other anticancer agents, or the pharmaceutical composition of the present invention can, if desired, also be encapsulated and protected in other forms against gastric secretions or other secretions.

[0209] The pharmaceutical composition of the present invention may contain one or more active ingredients, for example, one or more solid forms of the present invention optionally combined with other anticancer agents, anticancer agents, mixed with one or more pharmaceutically acceptable diluents or carriers, and optionally, one or more other compounds, drugs, ingredients, and / or materials. Regardless of the selected route of administration, the agent / compound of the present invention is formulated into a pharmaceutically acceptable dosage form by conventional methods known to those skilled in the art. See, for example, Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, PA.).

[0210] In the art, pharmaceutically acceptable diluents or carriers are well known (see, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, PA.) and The National Formulary (American Pharmaceutical Association, Washington, D.C.)), sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate, and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline solution, sodium chloride injection solution, Ringer's injection solution, dextrose injection solution, dextrose and sodium chloride injection solution, lactated Ringer's injection solution), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and triglycerides), biodegradable polymers (e.g., polylactide - polyglycolide, poly(orthoesters), and poly(acids (anhydrides))), elastomeric matrices, liposomes, microspheres, oils (e.g., corn oil, germ oil, olive oil, castor oil, sesame oil, cottonseed oil, and peanut oil), cocoa butter, waxes (e.g., suppository wax), paraffin, silicone, talc, silicylate, etc. are included. Each pharmaceutically acceptable diluent or carrier used in the pharmaceutical compositions of the present invention must be "acceptable" in the sense that it is compatible with the other ingredients of the formulation and not injurious to the subject. In the art, diluents or carriers suitable for the selected dosage form and intended route of administration are well known, and acceptable diluents or carriers for the selected dosage form and method of administration can be determined using ordinary skill in the art.

[0211] The pharmaceutical composition of the present invention may optionally contain additional components and / or materials commonly used in pharmaceutical compositions. These components and materials are well known in the art and include (1) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders such as carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose, and acacia; (3) humectants such as glycerol; (4) disintegrants such as agar, calcium carbonate, potato starch or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, croscarmellose sodium, and sodium carbonate; (5) dissolution retardants such as paraffin; (6) absorption promoters such as quaternary ammonium compounds; (7) cetyl alcohol and glyceryl monostearate Humectants such as rolls; (8) Absorbents such as kaolin clay and bentonite clay; (9) Lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, and sodium lauryl sulfate; (10) Suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, and tragacanth; (11) Buffering agents; (12) Excipients such as lactose, milk sugar, polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicate, and polyamide powder; (13) Inert diluents such as water or other solvents; (14) Preservatives; (15) Surfactants; (16) Dispersing agents; (17) Release control agents or absorption delaying agents such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and wax; (18) Opacifying agents; (19) Adjuvants; (20) Humectants; (21) Emulsifying and suspending agents; (22) Solubilizing and emulsifying agents such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 - butylene glycol, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan; (23) Propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons such as butane and propane; (24) Antioxidants; (25) Agents such as sugar and sodium chloride that make the formulation isotonic with the blood of the intended recipient; (26) Thickening agents; (27) Coating materials such as lecithin; and (28) Containing sweeteners, flavoring agents, coloring agents, fragrances, and preservative agents.Each such component or material must be "acceptable" in the sense that it is compatible with the other components of the formulation and not injurious to the subject. In the art, components and materials suitable for the selected dosage form and intended route of administration are well known, and acceptable components and materials for the selected dosage form and method of administration can be determined using ordinary skill in the art.

[0212] The pharmaceutical compositions of the present invention suitable for oral administration can be in the form of capsules, cachets, pills, tablets, powders, granules, solutions or suspensions of aqueous or non-aqueous liquids, water-in-oil or oil-in-water liquid emulsions, elixirs or syrups, troches, boluses, lozenges, or pastes. These formulations can be prepared by methods known in the art, for example, via conventional pan coating processes, mixing processes, granulation processes, or lyophilization processes.

[0213] Solid dosage forms for oral administration (such as capsules, tablets, pills, dragees, powders, granules, etc.) can be prepared, for example, by mixing the active ingredient(s) with one or more pharmaceutically acceptable diluents or carriers, and optionally, one or more fillers, extenders, binders, humectants, disintegrants, dissolution retardants, absorption promoters, wetting agents, absorbents, lubricants, and / or colorants. Appropriate excipients can be used to also employ similar types of solid compositions as fillers in soft-filled gelatin capsules and hard-filled gelatin capsules. Tablets can be made, optionally, with one or more auxiliary components, by compression or molding. Compressed tablets can be prepared using appropriate binders, lubricants, inert diluents, preservatives, disintegrants, surfactants, or dispersants. Molded tablets can be made by molding with an appropriate machine. Tablets, as well as other solid dosage forms such as dragees, capsules, pills, and granules, can also be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical art. They can also have a delayed release of the active ingredient therein Alternatively, they can be formulated to effect controlled release. They can be sterilized, for example, by filtration through a bacteria-retaining filter. These compositions can also optionally contain an opacifying agent and can be compositions that release the active ingredient only in or preferentially in certain parts of the digestive tract, optionally in a delayed manner. The active ingredient can also be in microencapsulated form.

[0214] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. The liquid dosage forms can contain a suitable inert diluent commonly used in the art. In addition to the inert diluent, oral compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents, coloring agents, perfuming agents, and preservatives. Suppositories can contain suspending agents.

[0215] The pharmaceutical compositions of the present invention for rectal or vaginal administration can be provided as suppositories, prepared by mixing one or more active ingredients with one or more suitable non-irritating diluents or carriers that are solid at room temperature but liquid at body temperature and thus melt in the rectal or vaginal cavity to release the active compound. The pharmaceutical compositions of the present invention suitable for vaginal administration also include pessary formulations, tampon formulations, cream formulations, gel formulations, paste formulations, foam formulations, or spray formulations containing such pharmaceutically acceptable diluents or carriers known in the art to be suitable.

[0216] Dosage forms for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, eye drops, and inhalants. The active drug(s) / compound(s) including the solid forms of the present invention can be mixed with a suitable pharmaceutically acceptable diluent or carrier under sterile conditions. Ointments, pastes, creams, and gels can contain excipients. Powders and sprays can contain excipients and propellants.

[0217] The pharmaceutical composition of the present invention suitable for parenteral administration is one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted into sterile injectable solutions or sterile injectable dispersions immediately before use, and may contain one or more agents / compounds in combination with a sterile powder that may contain suitable antioxidants, buffers, solutes that make the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Appropriate fluidity can be maintained, for example, by the use of coating materials, in the case of dispersions, by maintaining the required particle size, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants such as wetting agents, emulsifying agents, and dispersing agents. It may also be desirable to include isotonic agents. In addition, sustained absorption of injectable pharmaceutical forms can also be brought about by the incorporation of agents that delay absorption.

[0218] In some cases, it is desirable to slow the absorption of a drug (e.g., a pharmaceutical formulation) from a subcutaneous or intramuscular injection in order to extend its action. This can be achieved by using a liquid suspension of a crystalline or amorphous material that is poorly soluble in water.

[0219] Subsequently, the absorption rate of the active agent / drug containing the solid form of the present invention depends on its dissolution rate, which may further depend on the crystal size and crystal form. Alternatively, delayed absorption of a parenterally administered agent / drug can be achieved by dissolving or suspending the active agent / drug in an oil vehicle. Injectable depot forms can be prepared by forming a microencapsule matrix of the active ingredient in a biodegradable polymer. Depending on the ratio of the active ingredient to the polymer and the nature of the particular polymer employed, the release rate of the active ingredient can be controlled. Injectable depot formulations can also be prepared by encapsulating the drug within liposomes or microemulsions that are compatible with body tissues. The injectable material can be sterilized, for example, by filtration through a bacteria-retaining filter.

[0220] The formulations can be present in sealed containers, such as ampoules and vials, for unit-dose or multi-dose use, and can be stored in a lyophilized state that requires only the addition of a sterile liquid diluent or liquid carrier, such as water for injection, immediately prior to use. Ready-to-use injectable solutions and ready-to-use injectable suspensions can be prepared from sterile powders, granules, and tablets of the types described above.

[0221] The following examples are presented for the purpose of further illustrating the compounds, compositions, and methods of the present invention. These examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

Example

[0222] (Example 1) Experimental method Powder X-ray diffraction (XRPD) XRPD patterns in transmission mode were collected using an incident beam of Cu radiation generated using a microfocus X-ray source. An elliptical grazing multilayer mirror was used to focus the Cu Kα X-ray radiation passing through the specimen towards the detector. Prior to analysis, a silicon specimen (NIST SRM Analysis was performed on [Si 111] 640d to verify that the position of the observed Si 111 peak corresponded to the position certified by NIST. The sample specimen was sandwiched between thin films of 3 μm thickness and analyzed in a transmission configuration. A beam stop, short anti-scatter extension, and anti-scatter knife edge were used to minimize the background caused by air. Solar slits for the incident and diffracted beams were used to minimize broadening due to axial divergence. The diffraction pattern was collected using a scanning position-sensitive detector placed 240 mm from the specimen. Preferred orientation and static particle effects were not evaluated.

[0223] The XRPD pattern in reflection mode was collected using an incident beam of Cu Kα radiation generated using a microfocus source and a nickel filter. The diffractometer was configured using a symmetric Bragg-Brentano type arrangement. Prior to analysis, analysis was performed on a silicon specimen ([Si 111] 640d) to verify that the position of the observed Si 111 peak corresponded to the position certified by NIST. The sample specimen was prepared as a thin circular layer at the center of a silicon-made zero-background substrate. An anti-scatter slit (SS) was used to minimize the background caused by air. Solar slits for the incident and diffracted beams were used to minimize broadening due to axial divergence. The diffraction pattern was collected using a scanning position-sensitive detector placed 240 mm from the specimen. Preferred orientation and static particle effects were not evaluated.

[0224] In most situations, peaks within a range of 2θ of up to approximately 30° were selected. The position of the peak along the x-axis (°2θ) was rounded to one significant digit after the decimal point. The variation in peak position was given up to within ±0.2° of 2θ based on the recommendations outlined in the USP's consideration of variations in powder X-ray diffraction. The exactness and precision associated with any particular measurement were not determined. Additionally, third-party measurements on independently prepared samples on different instruments can result in variations exceeding ±0.2° of 2θ. According to the USP guidelines, variable hydrates and solvates may show peak variations exceeding 0.2° of 2θ, and thus, peak variations of 0.2° of 2θ are not applicable to these materials. For the list of d-spacing (d-space), the wavelength used to calculate d-spacing (d-spacin g) was the wavelength by Cu-Kα1, 1.5405929 Å. The variation associated with the estimated value of d-spacing was calculated from the USP recommendations at each d-spacing and presented in each data table.

[0225] Fourier transform infrared (FT-IR) spectroscopy The FT-IR spectra were obtained using a Fourier transform infrared spectrophotometer equipped with a mid / far-IR source, a range-extended potassium bromide (KBr) beam splitter, and a deuterated triglycine sulfate (DTGS) detector. Wavelength verification was performed using NIST SRM 1921b (polystyrene). An attenuated total reflection (ATR) accessory with a germanium (Ge) crystal was used to obtain the data. 256 scans were collected at a spectral resolution of 2 cm -1 and overlaid. The background data set was obtained using an impurity-free Ge crystal. By taking the ratio of these two data sets with respect to each other, the log 1 / R (R = reflectance) spectrum was obtained. Peak selection was performed using an absolute threshold near the baseline and a sensitivity of 75.

[0226] Differential scanning calorimetry (DSC) DSC analysis was performed using a differential scanning calorimeter. Temperature calibration was performed using NIST-traceable indium metal. The sample was placed in an aluminum DSC pan, covered with a lid, and the weight was accurately recorded. A weighed aluminum T0HSMP pan configured as the sample pan was placed on the reference side of the cell. Unless otherwise specified, the reported temperature was rounded to the nearest degree.

[0227] Raman spectroscopy Raman spectroscopy was performed using a dispersive RamanRXN3 (Kaiser Optical Systems Inc., Ann Arbor, MI) for in situ reaction monitoring. The RamanRXN3 system uses an excitation wavelength of 785 nm from an external resonator-stabilized diode laser. All spectra were obtained using a 1 / 4-inch water-immersion optical probe with a laser output of approximately 103 mW at the tip of the probe. Spectra were collected using an exposure time of 5 - 15 seconds, and 5 spectra were integrated. Wavelength calibration and laser wavelength calibration were performed using an internal neon standard and a diamond Raman shift standard, respectively. Intensity calibration was performed using a Kaiser Raman calibration accessory (Kaiser Optical Systems Inc., Ann Arbor, MI).

[0228] (Example 2) Preparation of the crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide The free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was prepared according to the following synthetic scheme.

Chemical formula

[0229] In Step 1, a 200 L glass-lined reactor free of impurities was evacuated to a pressure of -0.08 MPa or less three times, and then filled with nitrogen up to normal pressure. Absolute ethanol (49.90 kg) was charged into the 200 L glass-lined reactor. Subsequently, ASYM-111606 (Asymchem) (12.70 kg) and isopropylamine (29.00 kg) were added to the mixture. The mixture was heated to 65 - 75 °C to reflux it. The mixture was reacted at 65 - 75 °C. After 20 hours, the reaction product was sampled and analyzed by HPLC every 4 - 6 hours until the content of ASYM-111606 became ≤1%. The mixture was cooled to 40 - 45 °C and concentrated under reduced pressure (≤ -0.08 MPa) at 45 °C or lower until 13 - 26 L remained. The organic phase was washed with a sodium chloride solution, stirred for 20 - 30 minutes, allowed to stand for 20 - 30 minutes, and then separated. The organic phase was concentrated under reduced pressure (≤ -0.06 MPa) at 30 °C or lower until 13 - 20 L remained. Petroleum ether (8.55 kg) was added to the concentrated mixture. The mixture was transferred to a 20 L rotary evaporator and concentrated under reduced pressure (≤ -0.06 MPa) at 30 °C or lower until 13 - 20 L remained. Subsequently, petroleum ether (8.55 kg) was added to the concentrated mixture. The mixture was cooled to 0 - 5 °C and stirred for crystallization. After 1 hour, the mixture was sampled and the wt% was analyzed every 1 - 2 hours until the wt% of the mother liquor became ≤11% or the change in wt% between consecutive samples became ≤1%. The mixture was filtered through a 10 L filter flask. The filter cake was sampled and analyzed for purity by HPLC. 10.50 kg of the product was recovered as a yellowish-brown solid with a purity of 99.39%.

[0230] In Step 2, a 300 L glass-lined reactor free of impurities was evacuated to a pressure of -0.08 MPa or less three times, and then filled with nitrogen to normal pressure. Glycol dimethyl ether (73.10 kg) was charged into a 300 L glass-lined reactor at 20 - 30 °C. Subsequently, ASYM-112060 (Asymchem) (10.46 kg) and ASYM-111938 (Asymchem) (12.34 kg, 11.64 kg after correction) were added to the mixture under protection with nitrogen. The temperature was maintained at 20 - 30 °C, and purified water (10.50 kg) and anhydrous sodium carbonate (5.67 kg) were added to the mixture. Palladium acetate (0.239 kg) and tricyclohexylphosphonium tetrafluoroborate (0.522 kg) were added to the mixture under protection with nitrogen. After the addition, the mixture was evacuated to a pressure of -0.06 MPa or less and then filled with nitrogen to normal pressure. This was repeated 10 times until the residual oxygen was ≤ 300 ppm. The mixture was heated to 75 - 85 °C to reflux. The mixture was reacted at 75 - 85 °C. After 4 hours, the mixture was sampled and analyzed by HPLC every 2 - 3 hours for the content of ASYM-112060. When the content of ASYM-112060 reached 6.18%, additional ASYM-111938 (0.72 kg) was added, and the reaction was continued until the content of ASYM-112060 was ≤ 3%. The mixture was cooled to 25 - 35 °C and filtered through a 30 L stainless steel vacuum filter. The filter cake was immersed and washed twice with THF (14.10 kg). The filtrate and the washing liquid were combined and concentrated under reduced pressure (-0.08 MPa or less) at 50 °C or less until 10 - 15 L remained. The mixture was cooled to 15 - 25 °C. Methanol (11.05 kg) was added to the concentrated mixture. Then, the mixture was stirred for crystallization. After 2 hours, the mixture was sampled and analyzed by HPLC every 2 - 4 hours until the wt% of the mother liquor was ≤ 2%. The mixture was filtered through a 30 L stainless steel vacuum filter. The filter cake was immersed and washed twice with methanol (8.30 kg). The filter cake was transferred to a 50 L plastic drum.Next, ethyl acetate (7.10 kg) and petroleum ether (46.30 kg) were added to the drum. The mixture was stirred for 1.5 - 2 hours and then filtered through a Nutsche filter. The filter cake was immersed and washed with petroleum ether (20.50 kg). The filter cake was dried in the Nutsche filter under nitrogen at 30 - 40 °C. After 8 hours, the solid was sampled and Karl Fischer (KF) analysis was performed at intervals of 4 - 8 hours to monitor the drying process. Drying was completed when the KF result reached ≤ 1.0% water. During drying, the solid was turned over and mixed every 4 - 6 hours. 12.15 kg of the product was recovered as a yellowish-brown solid with a purity of 98.32%.

[0231] In Step 3, the impurity-free dry 300 L glass-lined reactor was evacuated to ≤ -0.08 MPa three times and then filled with nitrogen to normal pressure. THF (62.58 kg) was charged into the 300 L glass-lined reactor at 15 - 30 °C. Then the stirrer was started. ASYM-112393 (12.00 kg, 11.70 kg after correction) was added to the mixture. The mixture was stirred until the solid was completely dissolved. The temperature was maintained at 15 - 30 °C, and a lithium hydroxide solution prepared with lithium hydroxide monohydrate (5.50 kg) in purified water (70.28 kg) was added to the mixture. Then diethylamine (3.86 kg) was added. The mixture was heated to 60 - 70 °C to reflux. The mixture was reacted at 60 - 70 °C. After 30 hours, the reaction product was sampled and analyzed by HPLC every 4 - 6 hours until the content of the intermediate at relative retention time (RRT) = 1.39 - 1.44 was < 1% and the content of ASYM-112393 was < 1%. The HPLC conditions for this analysis are shown in Table 1.

Table 1

[0232] The mixture was cooled to 25 - 35°C, and MTBE (25.97 kg) was added to the mixture. The mixture was stirred for 20 - 30 minutes and filtered through an in-line fluid filter. The filtrate was transferred to a 300 L glass-lined reactor, allowed to stand for 20 - 30 minutes, and then separated. The pH of the resulting aqueous phase was adjusted to 1 - 2 with a 6N hydrochloric acid solution prepared from concentrated hydrochloric acid (14.86 kg) in purified water (10.88 kg) at a rate of 5 - 8 kg / hour at 15 - 25°C. The pH of the mixture was readjusted to 6.4 - 6.7 with a saturated sodium carbonate solution prepared from sodium carbonate (5.03 kg) in purified water (23.56 kg) at a rate of 3 - 5 kg / hour at 15 - 25°C. Subsequently, the pH of the mixture was adjusted to 6.2 - 6.4 with a hydrochloric acid solution prepared from concentrated hydrochloric acid (1.09 kg) in purified water (0.80 kg). The mixture was filtered through a Nutsche filter. The filter cake was transferred to a 300 L glass-lined reactor, and purified water (117.00 kg) was added. The mixture was stirred, sampled, and analyzed by HPLC until the p-toluenesulfonic acid residue in the filter cake was ≤ 0.5%. Subsequently, the mixture was filtered. The filter cake was dried in a tray dryer under nitrogen at 55 - 65°C until KF ≤ 10%. The solid and MTBE (8.81 kg) were charged into a 50 L stainless steel drum. The mixture was stirred for 1 - 2 hours. The mixture was filtered through a 30 L stainless steel vacuum filter. The filter cake was dried in a Nutsche filter at 50 - 60°C. After 8 hours, the solid was sampled and analyzed by KF every 4 - 8 hours until KF ≤ 5%. During drying, the solid was turned over and mixed every 4 - 6 hours. 6.3 kg of the product was recovered as an off-white solid with a purity of 98.07%.

[0233] In Step 4, a 50 L flask free of dry impurities was purged with nitrogen for 20 minutes. DMF (30.20 kg) was charged into the 50 L flask reactor. Then, the stirrer was started. The temperature was maintained at 15 - 25°C, and ASYM-112394 (3.22 kg, 2.76 kg after correction) was added to the mixture. The mixture was stirred until the solid was completely dissolved. The mixture was cooled to -10 to -20°C, and 1-hydroxybenzotriazole hydrate (2.10 kg) was added to the mixture at -10 to -20°C. Then, EDCI (2.41 kg) was added to the mixture in 5 portions at intervals of about 5 - 10 minutes. The mixture Cooled to -20~-30°C, and ASYM-111888 (Asymchem) (1.96 kg) was added to the mixture at -20~-30°C. Then, DIEA (1.77 kg) was added to the mixture at a rate of 3~4 kg / hour. The mixture was heated to 15~25°C at a rate of 5~10°C / hour. The mixture was reacted at 15~25°C. After 6~8 hours, the mixture was sampled and analyzed by HPLC every 2~4 hours until the content of ASYM-112394 was ≤2%. The mixture was cooled to 0~10°C, and the reaction mixture was quenched at 0~10°C with a solution prepared from ethyl acetate (28.80 kg) in purified water (12.80 kg). The mixture was extracted three times with ethyl acetate (28.80 kg). For each extraction, the mixture was stirred for 20~30 minutes, allowed to stand for 20~30 minutes, and then separated. The organic phases were combined and washed twice with purified water (12.80 kg). For each time, the mixture was stirred for 20~30 minutes, allowed to stand for 20~30 minutes, and then separated. Then, the obtained organic phase was filtered through an in-line fluid filter. The filtrate was transferred to a 300 L glass-lined reactor. The mixture was washed twice with a 5% acetic acid solution prepared from acetic acid (2.24 kg) in purified water (42.50 kg). The solution was added at a rate of 10~20 kg / hour. The organic phase was washed twice with a sodium carbonate solution prepared from sodium carbonate (9.41 kg) in purified water (48.00 kg). The organic phase was washed twice with a sodium chloride solution prepared from sodium chloride (16.00 kg) in purified water (44.80 kg). The organic phase was transferred to a 300 L glass-lined reactor. Anhydrous sodium sulfate (9.70 kg) was added to the mixture, and the mixture was stirred at 15~30°C for 2~4 hours. The mixture was filtered through a Nutsche filter pre-loaded with about 1 cm thick silica gel (7.50 kg). The filter cake was immersed and washed with ethyl acetate (14.40 kg) and then filtered. The filtrates were combined, and the combined filtrate was added to a 72 L flask through an in-line fluid filter. The mixture was concentrated under reduced pressure (P≤-0.08 MPa) at T≤40°C until 3~4 L remained. Then, MTBE (4.78 kg) was added to the mixture.The mixture was cooled to 0 - 10 °C with stirring for crystallization. After 1 hour, the mixture was sampled and the wt% was analyzed every 1 - 2 hours until the wt% of the mother liquor was ≤ 5% or the change in wt% between consecutive samples was ≤ 1%. The mixture was filtered in a vacuum filter flask and the filter cake was dried in a tray dryer under nitrogen at 30 - 40 °C until KF ≤ 0.5%. 3.55 kg of the product was recovered as an off - white solid with a purity of 100%.

[0234] The free base of the resulting 4 - (5 - chloro - 2 - isopropylaminopyridin - 4 - yl) - 1H - pyrrole - 2 - carboxylic acid [1 - (3 - chlorophenyl) - 2 - hydroxyethyl] amide was analyzed by XRPD (Figure 1). The peaks shown in Figure 1 are listed in Table 2 and the prominent peaks are listed in Table 3. Table 2: XRPD peaks observed for the free base of 4 - (5 - chloro - 2 - isopropylaminopyridin - 4 - yl) - 1H - pyrrole - 2 - carboxylic acid [1 - (3 - chlorophenyl) - 2 - hydroxyethyl] amide

Table 2 - 1

Table 2 - 2

Table 3

[0235] FT - IR was performed on a sample of the free base of 4 - (5 - chloro - 2 - isopropylaminopyridin - 4 - yl) - 1H - pyrrole - 2 - carboxylic acid [1 - (3 - chlorophenyl) - 2 - hydroxyethyl] amide as described in Example 1 (Figure 2). The observed peaks from Figure 2 are listed in Table 4. Table 4: FT-IR Peaks Observed for the Free Base of 4-(5-Chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic Acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide

Table 4-1

Table 4-2

[0236] DSC was performed on a sample of the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide as described in Example 1 (Figure 3), and an endotherm with an onset temperature of approximately 184 °C was shown.

[0237] (Example 3A) Preparation of Form C of 4-(5-Chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic Acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide

Chemical formula

[0238] The mixture was then filtered and washed successively with a pre-prepared solution of absolute ethanol (14.8 kg), methanol (0.8 kg), and isopropanol (0.8 kg), and then with MTBE (21 kg in two portions). Since the polymorph can be unstable in the wet filter cake in the presence of the reagent alcohol, it is preferred to avoid delay in washing the filter cake, and an improvement in stability was observed after washing with MTBE. The wet filter cake was then dried at 40 - 50 °C in a heated filter funnel or tray dryer until dry. Typical yields were about 85 - 90%.

[0239] (Example 3B) Alternative preparation of form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Chemical formula] Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was also prepared from the free base of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide as follows. A 72 L flask free of dry impurities was purged with nitrogen for 20 minutes. Absolute ethanol (21.35 kg), methanol (1.17 kg), and isopropanol (1.19 kg) were charged into the 72 L flask at 15 - 25 °C, and the mixture was stirred for 20 - 30 minutes. ASYM-111935 (3.01 kg) was added to the mixture, and the mixture was heated to 70 - 75 °C at a rate of 15 - 25 °C / hour and stirred until the solid was completely dissolved.

[0240] The alcohol / HCl solution was prepared as follows. Absolute ethanol (1.500 kg), methanol (0.088 kg), and isopropanol (0.087 kg) were charged into a 5 L flask at 15 - 25 °C, and the mixture was stirred for 20 - 30 minutes. Hydrogen chloride gas bubbles were blown through an immersion tube into the mixture at 10 - 25 °C with stirring. After 2 hours, the mixture was sampled and analyzed every 2 - 4 hours until the wt% of hydrogen chloride was ≥ 35%.

[0241] The prepared alcohol / HCl solution (0.519 kg) was added dropwise to the mixture at 70 - 75 °C at a rate of 0.5 - 1.0 kg / hour. Seed crystals (0.009 kg) were added to the mixture, and the prepared alcohol / HCl solution (0.173 kg) was added to the mixture at 70 - 75 °C at a rate of 0.5 - 1.0 kg / hour. After the addition, the mixture was stirred at 70 - 75 °C for 1 - 2 hours. The mixture was cooled to 15 - 25 °C at a rate of 5 - 15 °C / hour and stirred for 4 - 6 hours. The mixture was heated to 70 - 75 °C at a rate of 15 - 25 °C / hour and stirred at 70 - 75 °C for 8 - 10 hours. The mixture was cooled to 15 - 25 °C at a rate of 5 - 15 °C / hour and stirred for 4 - 6 hours. The mixture was filtered with a vacuum filter flask. The filter cake was immersed in a solution prepared from absolute ethanol (4.25 kg), methanol (0.24 kg), and isopropanol (0.24 kg), rinsed, and then filtered. The filter cake was dried in a drying chamber under nitrogen at 40 - 50 °C until the ethanol residue was <0.5%, the methanol residue was <0.3%, and the isopropanol residue was <0.3%. 2.89 kg of the product was recovered as a white solid with a purity of 99.97%.

[0242] Form C of the resulting 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was analyzed by XRPD (Figure 4). The peaks shown in Figure 4 are listed in Table 5 and the prominent peaks are listed in Table 6. Table 5: XRPD Peaks Observed for Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide

Table 5-1

Table 5-2

[0243] FT-IR was performed on a sample of Form C as described in Example 1 (Figure 5). The observed peaks from Figure 5 are listed in Table 7. Table 7: Observed FT-IR Peaks for Form C of 4-(5-Chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 7-1] [Table 7-2]

[0244] DSC was performed on a sample of Form C as described in Example 1 (Figure 6), and a prominent endotherm with an onset temperature of approximately 239 °C was shown.

[0245] (Example 4) Preparation of Form A of 4-(5-Chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was dissolved in methanol at 60 °C, resulting in a clear solution. The sample was slowly cooled from 60 °C to ambient temperature and subsequently evaporated rapidly. Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was formed as a white solid / needle crystals.

[0246] Alternatively, form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was dissolved in ethanol at 60 °C, resulting in a clear solution. The sample was slowly cooled from 60 °C to ambient temperature and subsequently evaporated rapidly. Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was formed as a white solid / needle crystals.

[0247] Alternatively, form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was prepared as a slurry in ethanol, resulting in a white suspension. The ethanol slurry was maintained at ambient temperature for 7 days. Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was formed as white microplates.

[0248] The resulting form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was analyzed by XRPD (Figure 7). The peaks shown in Figure 7 are listed in Table 8, and the prominent peaks are listed in Table 9. Table 8: XRPD Peaks Observed for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 8-1] [Table 8-2] Table 9: Prominent XRPD Peaks for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 9-1] [Table 9-2]

[0249] FT-IR was performed on a sample of Form A as described in Example 1 (Figure 8). The observed peaks from Figure 8 are listed in Table 10. Table 10: Observed FT-IR Peaks for Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide [Table 10-1] [Table 10-2]

[0250] ​When DSC was performed on the sample of Form A as described in Example 1 (Figure 9), four endothermic events were observed: melting of water at 0 °C, followed by two broad events with peak maxima at temperatures of about 61 °C and 136 °C, respectively, with weight losses of 3.0% and 1.9%, and finally an endotherm with an onset temperature of about 201 °C.

[0251] (Example 5) For Form D of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide Preparation A container containing Form A of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide was purged with dry nitrogen and the relative humidity was monitored. After about 73 minutes, the relative humidity decreased from 36.9% to 1.0%. The resulting material was analyzed and determined to be a new form, which was named Form D.

[0252] In related experiments, it was observed that samples of Form D of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide became Form A when sorbing water. This led to the conclusion that Forms A and D are reversibly interconvertible as a function of relative humidity.

[0253] Samples of Form D of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide were analyzed by XRPD (Figure 10). The peaks shown in Figure 10 are listed in Table 11, and the prominent peaks are listed in Table 12. Table 11: XRPD Peaks Observed for Form D of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide

Table 11-1

Table 11-2

Table 11-3

Table 12-1

Table 12-2

[0254] FT-IR was performed on a sample of Form D as described in Example 1 (Figure 11). The observed peaks from Figure 11 are listed in Table 13. Table 13: Observed FT-IR Peaks for Form D of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide

Table 13-1

Table 13-2

[0255] When DSC was performed on the sample of Form D as described in Example 1 (Figure 12), endotherms with peak maxima at approximately 156 °C and 204 °C were shown respectively. This DSC is consistent with the DSC of Form A, except that the first two endotherms associated with melting and water loss are not present in the DSC trace for Form D. Therefore, this DSC is consistent with the conclusion that Form D is the anhydrous form of Form A.

[0256] (Example 6) Comparison of Forms A and C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide by Raman spectroscopy Samples of each of Form A and Form C of 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide were prepared at 60 mg / ml in a mixture of ethanol:methanol:isopropanol (90:5:5) at 24 °C. Raman spectroscopy was performed on each sample and on the solvent alone as described in Example 1.

[0257] Wavelength 1000 - 1600 cm -1 The results for the scan over are shown in Figure 13. For Form A, a distinct characteristic peak at approximately 1165 cm -1 was observed.

[0258] Wavelength 950 - 1030 cm -1 The results for the scan over are shown in Figure 14. For Form A, a characteristic peak at approximately 983 cm -1 was observed, and for Form C, a characteristic peak at approximately 987 cm -1 was observed.

[0259] Exemplary embodiments of the present invention have been described herein, but the present invention is not limited to the described embodiments, and those skilled in the art should understand that various other changes or modifications can be made without departing from the scope or spirit of the present invention. References

Number

[0260] The following items are provided. (Item 1) Crystalline 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide. (Item 2) Crystalline free base 4-(5-chloro-2-isopropylaminopyridin-4-yl)-1H-pyrrole-2-carboxylic acid [1-(3-chlorophenyl)-2-hydroxyethyl]amide. (Item 3) Having a powder X-ray diffraction (XRPD) pattern containing characteristic peaks at 2θ of about 19.5°, of the formula:

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Claims

[Claim 1] A disease treated by a crystalline compound.

Citation Information

Patent Citations

  • Pyrrole inhibitors of ERK protein kinase, synthesis thereof and intermediates thereto

    US7354939B2