Expression regulator for PTX3, prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune disease, or sclerema, or methods for improving the same
By utilizing microparticles containing specific microRNAs to target PTX3 expression, the agent addresses the challenge of managing autoimmune diseases like rheumatoid arthritis and vasculitis, offering an effective therapeutic solution.
Patent Information
- Application Number
- JP2023211599
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-26
AI Technical Summary
Current technologies lack effective methods to control the expression of PTX3 using microRNA derived from microparticles, which is crucial for managing rheumatoid arthritis, vasculitis, and skin sclerosis associated with autoimmune diseases.
The development of an agent containing microparticles that incorporate specific microRNAs, such as hsa-miR-224-5p, hsa-miR-374c-5p, and hsa-miR-655-3p, which target genes related to PTX3 expression, allowing for the regulation of PTX3 protein and gene expression.
This approach effectively controls PTX3 expression, thereby improving conditions associated with rheumatoid arthritis, vasculitis, and skin sclerosis, providing a novel therapeutic or prophylactic agent for these autoimmune diseases.
Smart Images

Figure 2025095535000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an expression regulator of PTX3; a prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases; and a method for improving rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases.
Background Art
[0002] Pentraxin 3 (PTX3) is also called TSG-14 (TNF-inducible gene 14 protein). PTX3 is a member of the pentraxin superfamily consisting of evolutionarily conserved proteins characterized by a pentraxin domain, which is a structural motif. PTX3 is produced by various cell types such as endothelial cells, smooth muscle cells, adipocytes, fibroblasts, mononuclear phagocytes, and dendritic cells. The expression of PTX3 is induced by primary inflammatory signals such as IL-1, TNF (Tumor necrosis factor), and microorganisms. PTX3 is an acute-phase glycoprotein and plays a role in innate immune resistance to pathogens, inflammation, tissue remodeling and repair, female fertility, and cancer regulation. In addition, pentraxin 3 is a biomarker for cardiovascular diseases, and an increase in plasma pentraxin 3 concentration is observed in patients with cardiovascular diseases.
[0003] In recent years, PTX3 has been known to be related to rheumatoid arthritis (Non-Patent Document 1). Non-Patent Document 1 describes that PTX3 increases in the synovial fluid of joints in rheumatoid arthritis and that the progression of rheumatoid arthritis can be suppressed by suppressing PTX3.
[0004] In addition, PTX3 is known to block vasculitis associated with autoimmune diseases (Non-Patent Document 2).
[0005] On the other hand, although research on microRNA (miRNA) is progressing, the functions and target genes of miRNA involved in PTX3 are not well understood.
Prior Art Documents
[0006] [Non-Patent Literature 1] Int. J. Med. Sci.,(2021) 18(8):1886-1898 [Non-Patent Literature 2] Front. Immunol., (2019) 10, 1135 [Summary of the Invention] [Problems to be Solved by the Invention]
[0007] There was no description of miRNA in Non-Patent Literatures 1 and 2.
[0008] The problem to be solved by the present invention is to provide a novel PTX3 expression control agent capable of controlling the expression of PTX3 using miRNA derived from microparticles. [Means for Solving the Problems]
[0009] The present inventors have found that microparticles containing specific microRNA can control (such as suppress or inhibit) the expression of PTX3 protein and / or PTX3 gene (Ptx3).
[0010] Specifically, the present invention and preferred configurations thereof are as follows.
[0011] [1] An agent for controlling the expression of PTX3, wherein the expression control agent contains microparticles, the microparticles contain miRNA having a gene related to the expression of PTX3 as a target gene, an agent for controlling the expression of PTX3. [2] The agent for controlling the expression of PTX3 according to [1], wherein the microparticles are exosomes. [3] The PTX3 according to [1], comprising at least one of hsa-miR-224-5p, has-miR-374c-5p, and hsa-miR-655-3p as a miRNA targeting a gene related to the expression of PTX3. [1] An expression regulator of PTX3 according to [1], wherein the miRNA targeting a gene related to the expression of PTX3 comprises at least hsa-miR-224-5p. [5] An expression regulator of PTX3 according to [1], wherein the miRNA targeting a gene related to the expression of PTX3 comprises hsa-miR-224-5p and hsa-miR-655-3p. [6] An expression regulator of PTX3 according to [1], wherein the microparticle contains a miRNA targeting a gene related to the expression of PTX3 at a concentration higher than that in the culture supernatant of dental pulp-derived stem cells. [7] The microparticle is a microparticle purified and isolated from the culture supernatant of dental pulp-derived stem cells, An expression regulator of PTX3 according to [1], wherein the microparticle does not contain components excluding exosomes from the culture supernatant of dental pulp-derived stem cells. [8] A prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, comprising the expression regulator of PTX3 according to [1] as an active ingredient. [9] A prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis according to [8], which is a prophylactic or therapeutic agent for skin sclerosis and is a skin application agent.
[10] An improvement method for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, comprising administering an effective amount of the expression regulator of PTX3 according to [1], or an effective amount of the prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis according to [8] to a subject suffering from rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis.
Effects of the Invention
[0012] According to the present invention, a novel PTX3 expression regulator capable of controlling the expression of PTX3 using miRNA derived from microparticles can be provided.
Brief Description of the Drawings
[0013]
Figure 1
Figure 2
Modes for Carrying Out the Invention
[0014] Hereinafter, the present invention will be described in detail. The description of the constituent elements described below may be based on representative embodiments or specific examples, but the present invention is not limited to such embodiments. In this specification, the numerical range represented by "~" means a range including the numerical values described before and after "~" as the lower limit value and the upper limit value.
[0015] [Expression Regulator of PTX3] In the expression regulator of PTX3 of the present invention, the expression regulator contains microparticles, and the microparticles contain miRNAs targeting genes related to the expression of PTX3. The expression regulator of PTX3 of the present invention can control the expression of PTX3 using miRNAs derived from microparticles. As a result, it is preferable that the expression regulator of PTX3 of the present invention can improve rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases, and more preferably can prevent or treat them. Hereinafter, preferred embodiments of the expression regulator of PTX3 of the present invention will be described.
[0016] [Rheumatoid Arthritis, Vasculitis Associated with Autoimmune Diseases] First, the case where the expression regulator of PTX3 of the present invention is used to improve rheumatoid arthritis and vasculitis associated with autoimmune diseases will be described. In the present invention, vasculitis refers to a general term for diseases in which inflammation is observed in the blood vessels themselves, and as a result, diseases that cause organ damage due to bleeding, blood flow disorders, and infarction. Vasculitis is also referred to as a vasculitis syndrome or systemic vasculitis.
[0017] (Classification according to CHCC2012) Vasculitis may be classified according to the vessel diameter of the blood vessels in which the main inflammation occurs. In the classification according to vessel diameter, it is generally classified according to the following CHCC (Chapel Hill Consensus Conference) 2012. The PTX3 expression regulator of the present invention is used for the improvement of rheumatoid arthritis included in "VI. Vasculitis associated with systemic diseases" among these vasculitides and vasculitis associated with various autoimmune diseases. Vasculitis associated with various autoimmune diseases includes Takayasu arteritis included in "I. Large vessel vasculitis", microscopic polyangiitis (MPA) which is vasculitis associated with autoimmune diseases included in "III. Small vessel vasculitis", and immune complex small vessel vasculitis (such as cryoglobulinemic vasculitis), Behçet's disease included in "IV. Vasculitis affecting various blood vessels", and is used for the improvement of vasculitis associated with autoimmune diseases (other than rheumatoid arthritis) included in "VI. Vasculitis associated with systemic diseases".
[0018] I. Large vessel vasculitis (I-1) Takayasu arteritis: Granulomatous vasculitis is common, and the aorta and its main branches are invaded. The main symptoms are systemic inflammation, pain due to vasculitis, and vascular stenosis, occlusion, and dilation. Even after the inflammation subsides, various organ disorders and aneurysms due to blood flow disorders become problems. The pathogenesis is presumed to be that environmental factors such as infection trigger, against the background of genetic factors, the destruction of elastic arteries mainly the aorta by autoimmune mechanisms. The pathological feature of Takayasu arteritis is an erosion image of the medial elastic fibers starting from the adventitial side. Infiltrating cells include CD4-positive T cells, CD8-positive T cells, macrophages, NK cells, γδT cells, etc. Some macrophages are observed as multinucleated giant cells that phagocytose fragmented elastic fibers. These cells are thought to damage the vascular wall with cytokine abnormalities. As therapeutic agents, steroids, immunosuppressants, biological agents (such as tocilizumab, TNF inhibitors), antiplatelet drugs, etc. are used.
[0019] (I-2) Giant cell vasculitis: Granulomatous vasculitis is common, and the aorta and its main branches are invaded. The branches of the carotid artery, vertebral artery, and temporal artery are often invaded.
[0020] II. Medium-sized vasculitis (with many inflammatory aneurysms and stenoses) (II-1) Polyarteritis nodosa (PAN): A necrotizing medium and small vessel vasculitis that does not cause glomerulonephritis, arteriolitis, capillary vasculitis, or venulitis. It is not associated with antineutrophil cytoplasmic antibody (ANCA). (II-2) Kawasaki disease: A vasculitis associated with mucocutaneous lymph node syndrome. It mainly invades small and medium-sized vessels. The coronary artery is frequently invaded. The aorta and large blood vessels may also be invaded.
[0021] III. Small vessel vasculitis (III-1) ANCA-associated vasculitis: Includes microscopic polyangiitis (MPA), granulomatosis with polyangiitis (GPA) (formerly Wegener granulomatosis), and eosinophilic granulomatosis with polyangiitis (EGPA) (formerly Churg-Strauss syndrome). Microscopic polyangiitis (MPA) is a necrotizing vasculitis mainly involving small blood vessels, with little deposition of immune complexes. The main symptoms include rapidly progressive glomerulonephritis, pulmonary hemorrhage, or interstitial pneumonia, and organ symptoms outside the kidneys and lungs (purpura, subcutaneous hemorrhage, gastrointestinal hemorrhage, multiple mononeuritis, fever, weight loss, easy fatigue). As for the pathogenesis, it is speculated that both genetic factors and environmental factors interact with each other, leading to the production of the autoantibody ANCA, which causes vascular endothelial damage, involving an autoimmune mechanism. In the pathological state of vascular endothelial cell damage caused by MPA, the involvement of inflammatory cytokines such as TNF-α, ANCA, MPO, and neutrophil activation is considered. ANCA produced by the autoimmune mechanism, together with inflammatory cytokines, excessively activates neutrophils and is speculated to release neutrophil extracellular traps, a fine fiber network (chromatin fiber) containing proteolytic enzymes in neutrophils, which damages the vascular endothelium. The main treatment guidelines are glucocorticoids (GC) and immunosuppressive drugs (including rituximab).
[0022] (III-2) Immune complex-mediated small-vessel vasculitis: including anti-glomerular basement membrane antibody disease (anti-GBM disease), cryoglobulinemic vasculitis, IgA vasculitis (formerly Henoch-Schönlein purpura), and hypocomplementemic urticarial vasculitis (anti-C1q vasculitis). A group of patients showing an immune complex-mediated vasculitis syndrome containing cryoglobulinemic vasculitis (CG) is called cryoglobulinemic vasculitis. CGemia is frequently recognized in autoimmune diseases.
[0023] IV. Vasculitis Affecting Various Blood Vessels (IV-1) Behçet's disease: Vasculitis that occurs in patients with Behçet's disease (characterized by recurrent oral ulcers and genital ulcers, complicated by inflammatory lesions of the skin, eyes, joints, gastrointestinal tract, and central nervous system), which can affect arteries or veins. Small-vessel vasculitis, thrombotic vasculitis, thrombosis, arteritis, and aneurysms can occur. The pathological conditions are contributed by both autoimmune and autoinflammatory mechanisms.
[0024] (IV-2) Cogan syndrome: It is a vasculitis that occurs in patients with Cogan syndrome (characterized by inflammatory eye lesions such as interstitial keratitis, uveitis, and episcleritis, and inner ear diseases such as sensorineural hearing loss and vestibular dysfunction). Arteritis (small, medium, and large blood vessels), aortitis, aortic aneurysm, aortic valvulitis, and mitral valvulitis occur.
[0025] V. Vasculitis affecting a single organ Including cutaneous leukocytoclastic vasculitis, cutaneous arteritis, cutaneous small vessel vasculitis, central nervous system localized vasculitis, isolated aortitis, testicular arteritis, etc.
[0026] VI. Vasculitis associated with systemic diseases Including lupus vasculitis, rheumatoid vasculitis, sarcoid vasculitis, etc. It includes vasculitis associated with autoimmune diseases (autoimmune diseases with vasculitis). (VI-1) Rheumatoid vasculitis (RA) includes rheumatoid vasculitis (RV) of small and medium blood vessels. The pathogenesis of rheumatoid vasculitis is unknown, but the involvement of autoantibodies targeting blood vessels, the induction of inflammation by immune complex deposition, and the activation of cellular immunity locally are considered as mechanisms. There is deposition of immunoglobulins, C3, and C4 at the site of inflammation of vasculitis. In RV, high levels of rheumatoid factor in serum, positive immune complexes, and low complement levels are observed, suggesting that there are stronger immunological abnormalities than in RA. Treatment guidelines include steroids, steroid pulse therapy, methotrexate (MTX), azathioprine (AZA), cyclophosphamide (CY), TNF inhibitors, tocilizumab (TCZ), rituximab (RTX), and abatacept.
[0027] (VI-2) Vasculitis associated with autoimmune diseases includes Burger's disease, etc. Burger's disease is a segmental lesion of the extremities arteriovenous vessels that is frequently seen in men in their 20s to 40s. As the pathogenesis, in addition to smoking, infection, nutritional disorders, and autoimmunity are mentioned.
[0028] VII. Vasculitis with known causes Hepatitis C virus (HCV)-associated cryoglobulinemic vasculitis; hepatitis B virus (HBV)-associated vasculitis; syphilis-associated aortitis; drug-related immune complex vasculitis; drug-related ANCA-associated vasculitis; cancer-related vasculitis; hydralazine-related microscopic polyangiitis, etc.
[0029] <Skin sclerosis> Next, the case of using the PTX3 expression regulator of the present invention for improving skin sclerosis will be described. Skin sclerosis refers to the occurrence of skin fibrosis, the occurrence of dermal sclerosis, and other scleroderma. Note that other scleroderma includes systemic scleroderma and localized scleroderma. Skin fibrosis refers to a phenomenon in which substances called extracellular matrix such as collagen fibers (collagen) increase in the skin and internal organs, resulting in the hardening of the skin and internal organs. Dermal sclerosis refers to the general hardening of the dermis. For example, dermal sclerosis progresses with aging. Dermal sclerosis due to aging occurs due to atrophy of the superficial blood vessels. Dermal sclerosis associated with aging induces age-related changes in epidermal stem cells such as hemidesmosome fragility, abnormal spindle axis, and premature differentiation. On the other hand, when superficial blood vessels are artificially induced, the dermis of aging skin becomes soft, and the firmness of tissues dependent on blood vessels can be improved. In addition, age-related changes in epidermal stem cells can also be improved. Systemic scleroderma is caused by complex causes such as immune abnormalities (autoimmune diseases), fibrosis, and vascular abnormalities. In systemic scleroderma, skin sclerosis starts from the fingers and progresses continuously proximally (toward the trunk) from the back of the hand to the forearm. Localized scleroderma is a disease in which clearly demarcated sclerosis appears in the skin of a limited area, which is completely different from systemic scleroderma. Localized scleroderma is an autoimmune disease caused by an autoimmune response to somatic mosaicism. The PTX3 expression regulator of the present invention is preferably used for improving at least the sclerosis of the dermis among these skin scleroses. PTX3 has an action of suppressing angiogenesis and is a factor whose expression increases with aging. By controlling the expression of PTX3, atrophy and regression of superficial blood vessels associated with aging are alleviated, the dermis can be softened, and skin sclerosis can be improved. Furthermore, since the PTX3 expression regulator of the present invention can improve autoimmune diseases, it can also improve systemic scleroderma and localized scleroderma.
[0030] <Micro-particles> The PTX3 expression regulator of the present invention contains micro-particles. In the present invention, the micro-particles contain miRNA having a gene related to the expression of PTX3 as a target gene. The micro-particles are derived from dental pulp-derived stem cells or the like, for example, by secretion, budding, or dispersion from mesenchymal stem cells such as dental pulp-derived stem cells, and leach, release, or drop into the cell culture medium. The micro-particles are preferably contained in the culture supernatant of dental pulp-derived stem cells or the like, and more preferably are micro-particles derived from the culture supernatant of dental pulp-derived stem cells. However, the micro-particles derived from the culture supernatant of dental pulp-derived stem cells do not necessarily have to be obtained from the culture supernatant of dental pulp-derived stem cells. For example, even if the micro-particles inside dental pulp-derived stem cells are isolated by any method, as long as they are the same as the micro-particles that can be isolated from the culture supernatant of dental pulp-derived stem cells, they can be said to be micro-particles derived from the culture supernatant of dental pulp-derived stem cells. The micro-particles derived from the culture supernatant of dental pulp-derived stem cells or the like may be used in a state contained in the culture supernatant, or may be used in a state purified from the culture supernatant. It is preferable that the micro-particles are micro-particles purified from the culture supernatant. The origin of the micro-particles can be determined by a known method. For example, the micro-particles can be determined as to whether they are derived from any stem cells such as dental pulp-derived stem cells, adipose-derived stem cells, bone marrow-derived stem cells, or umbilical cord-derived stem cells by the method described in J Stem Cell Res Ther (2018) 8:2. Specifically, based on the miRNA pattern of the micro-particles, the origin of each micro-particle can be determined.
[0031] (miRNA) In the present invention, the microparticle contains miRNA having a gene related to the expression of PTX3 as a target gene. In the present invention, miRNA (MicroRNAs) is, for example, an RNA molecule of 21 to 25 bases (nucleotides). miRNA can regulate gene expression by degrading the target gene mRNA or suppressing it at the decoding stage. In the present invention, miRNA may be, for example, single-stranded (monomer) or double-stranded (dimer). Also, in the present invention, the mature miRNA cleaved by ribonucleases such as Dicer is preferred for miRNA.
[0032] Note that the sequences of miRNAs described in this specification, such as hsa-miR-224-5p, are registered in a known database (for example, miRBase database) in association with accession numbers, and those skilled in the art can uniquely determine the sequences. For example, the accession number of hsa-miR-224-5p is MIMAT0000281, and the sequence is registered in the miRBase database. Hereinafter, the accession numbers of each miRNA are omitted. However, the miRNA in this specification includes variants that differ by about 1 to 5 bases from mature miRNAs such as hsa-miR-224-5p. Also, each miRNA in this specification is a polynucleotide consisting of a nucleotide sequence having identity with the nucleotide sequence of each miRNA (for example, hsa-miR-224-5p), or a polynucleotide consisting of their complementary nucleotide sequences, and includes a polynucleotide having the function of the miRNA in the present invention. "Identity" refers to the degree of identity when the sequences to be compared are appropriately aligned, and means the occurrence rate (%) of exact matches of amino acids between the sequences. Alignment can be performed by using any algorithm such as BLAST. The identity is, for example, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or about 99%. The polynucleotide consisting of a nucleotide sequence having identity may have, for example, point mutations, deletions and / or additions in the nucleotide sequence of the miRNA. The number of bases such as the point mutations is, for example, 1 to 5, 1 to 3, 1 to 2, or 1. Also, the polynucleotide consisting of a complementary nucleotide sequence is, for example, a polynucleotide that hybridizes under stringent conditions with the polynucleotide consisting of the nucleotide sequence of the miRNA, and includes a polynucleotide having the function of the miRNA in the present invention. The stringent conditions are not particularly limited, but for example, the conditions described in
[0028] of JP-A-2017-184642 can be mentioned, and the content of this publication is incorporated herein by reference.
[0033] In the present invention, it is preferable that the microparticles contain miRNA having, as a target gene, a gene related to the expression of PTX3 at a concentration higher than that in the culture supernatant of dental pulp-derived stem cells. Hereinafter, preferred embodiments of the miRNA contained in the microparticles will be described.
[0034] (1) miRNA having, as a target gene, a gene related to the expression of PTX3 Non-Patent Document 1 (Int. J. Med. Sci., (2021) 18(8):1886-1898) describes that PTX3 increases in the synovial fluid of joints in rheumatoid arthritis and that the progression of rheumatoid arthritis can be suppressed by suppressing PTX3.
[0035] In addition, PTX3 can block vasculitis associated with autoimmune diseases (Non-Patent Document 2: Front. Immunol., (2019) 10, 1135). PTX3 is an acute inflammatory protein, expressed in vascular endothelial cells, macrophages, fibroblasts, smooth muscle cells, etc., and its expression is enhanced in an inflammation-stimulus-dependent manner. Therefore, PTX3 serves as a marker for ischemic heart diseases such as myocardial infarction and arteriosclerosis. Therefore, miRNAs targeting genes related to the expression of PTX3 (such as hsa-miR-224-5p, has-miR-374c-5p, and hsa-miR-655-3p which are known) may be effective as preventive or therapeutic drugs for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis.
[0036] Note that the decreased expression of miR-224 promotes the formation of vulnerable atherosclerotic plaques and vascular remodeling in acute coronary syndrome (ACS) through the activation of the TGF-β / Smad pathway (J. Cell. Physiol. (2018) 234, 2537-2551). When investigating the roles of lncRNA AK087124 and miR-224-5p in the pathological state of arteriosclerosis, compared with normal mice, AK087124 is upregulated and miR-224-5p is downregulated in the plasma and plaques of atherosclerotic mice. miR-224-5p suppresses PTEN and inhibits apoptosis and inflammatory responses (Archives of Biochemistry and Biophysics, (2021) 705, 15 :108916).
[0037] In the present invention, when the microparticle contains an miRNA targeting a gene related to the expression of PTX3 (preferably, the PTX3 gene), it preferably functions as an expression regulator of the gene related to the expression of PTX3. The microparticle is preferably an inhibitor of PTX3 expression. In this case, in the present invention, it is preferable that the microparticle contains at least one of hsa-miR-224-5p, has-miR-374c-5p, and hsa-miR-655-3p, more preferably contains at least hsa-miR-224-5p, particularly preferably contains hsa-miR-224-5p and hsa-miR-655-3p, and even more particularly preferably contains all of hsa-miR-224-5p, has-miR-374c-5p, and hsa-miR-655-3p.
[0038] Preferably, the microparticle contains at least one of the miRNAs targeting the gene related to the expression of PTX3, with a Log2Ratio of the read count obtained by the analysis using IMOTA being 2.0 or more, more preferably 4.0 or more, and particularly preferably 6.0 or more. Preferably, the microparticle contains both hsa-miR-224-5p and hsa-miR-655-3p with a Log2Ratio of the read count obtained by the analysis using IMOTA being 4.0 or more, and more preferably contains hsa-miR-224-5p with a Log2Ratio of 6.0 or more.
[0039] Preferably, the expression level of hsa-miR-224-5p in the microparticle is 1.1 times or more, more preferably 1.5 times or more, and particularly preferably 2 times or more, compared to exosomes obtained from the culture supernatant of adipose-derived stem cells or exosomes obtained from the culture supernatant of umbilical cord-derived stem cells.
[0040] When the microparticle is an inhibitor of PTX3 expression, it is preferable that the expression of the PTX3 gene in any cell can be suppressed to 0.8 times or less of the normal level (in the case of untreated cells), more preferably 0.7 times or less, and particularly preferably 0.6 times or less.
[0041] (Types of miRNA) Here, the microparticles derived from the culture supernatant of dental pulp-derived stem cells contain approximately 2,600 types of small RNAs. Among these, approximately 1,800 types are miRNAs. Among these miRNAs, the miRNAs with high content are 180 to 200 types. The miRNAs with high content in the microparticles derived from dental pulp-derived stem cells are characterized by the fact that many of them are microRNAs related to the treatment of neurological diseases and vasculitis, which have not been previously known and are newly discovered findings of the present inventor. This feature is significantly different from the types of miRNAs with high content in the microparticles of other mesenchymal stem cells. For example, the miRNAs with high content in the microparticles of adipose-derived stem cells and umbilical cord-derived stem cells hardly contain microRNAs related to the treatment of neurological diseases and vasculitis.
[0042] The microparticles preferably contain two or more types of microRNAs (hereinafter also referred to as vasculitis-related microRNAs) that can control the expression of proteins and / or genes related to vasculitis, more preferably contain 10 or more types, even more preferably contain 30 or more types, particularly preferably contain 50 or more types, and even more particularly preferably contain 100 or more types.
[0043] (Types of microparticles) The microparticles are preferably at least one type selected from the group consisting of exosomes, microvesicles, membrane particles, membrane vesicles, ectosomes, and exovesicles, or microvesicles, and more preferably exosomes. The diameter of the microparticles is preferably 10 to 1,000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm. In addition, it is desirable that molecules called tetraspanins such as CD9, CD63, and CD81 are present on the surface of the microparticles. These may be CD9 alone, CD63 alone, CD81 alone, or any combination of two or three of them. Hereinafter, although there may be an explanation of a preferred embodiment when exosomes are used as the microparticles, the microparticles used in the present invention are not limited to exosomes.
[0044] Exosomes are preferably extracellular vesicles released from cells during the fusion of multivesicular bodies with the plasma membrane. The surface of the exosomes preferably contains lipids and proteins derived from the cell membrane of dental pulp-derived stem cells. Inside the exosomes, it is preferable to contain intracellular substances of dental pulp-derived stem cells such as nucleic acids (microRNA, messenger RNA, DNA, etc.) and proteins. Exosomes are known to be used for cell-to-cell communication by transporting genetic information from one cell to another. Exosomes can be easily traced and targeted to specific regions.
[0045] (Content of microparticles) The content of the microparticles in the microparticle composition is not particularly limited. The microparticle composition preferably contains 0.5×10 8 or more, more preferably 1.0×10 8 or more, particularly preferably 2.0×10 8 or more, even more particularly preferably 2.5×10 8 or more, and even more particularly preferably 1.0×10 9 or more. In addition, the content concentration of the microparticles in the microparticle composition is not particularly limited. The microparticle composition preferably contains 1.0×10 8 or more per mL, more preferably 2.0×10 8 or more per mL, particularly preferably 4.0×10 8 or more per mL,8 It is more particularly preferred to contain at least, and even more particularly preferably at least 2.0×10 9 per mL. A preferred embodiment of the expression control agent of the present invention can maintain a high amount of miRNA targeting a gene related to PTX3 expression by containing microparticles in such a large amount or high concentration.
[0046] <Other components> In addition to the microparticles, the microparticle composition may contain other components as long as the effects of the present invention are not impaired, depending on the type and purpose of the animal to which it is administered. Examples of other components include nutritional components, antibiotics, cytokines, protective agents, carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, soothing agents, stabilizers, preservatives, antiseptics, and the like. Examples of nutritional components include fatty acids, vitamins, and the like. Examples of antibiotics include penicillin, streptomycin, gentamicin, and the like. Examples of carriers include materials known as pharmaceutically acceptable carriers. The microparticle composition may be the culture supernatant of dental pulp-derived stem cells itself or the microparticles themselves, or may be a pharmaceutical composition further containing a pharmaceutically acceptable carrier, excipient, or the like. The purpose of the pharmaceutical composition is to facilitate the administration of the microparticles to the administration target.
[0047] The pharmaceutically acceptable carrier is preferably a carrier (including diluents) that does not cause significant irritation to the administration target and does not inhibit the biological activity and properties of the administered compound. Examples of carriers are propylene glycol; (physiological) saline; emulsions; buffers; media such as DMEM or RPMI; cryopreservation media containing components that remove free radicals.
[0048] The microparticle composition may contain an active ingredient of a conventionally known therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis. Those skilled in the art can make appropriate changes according to the use, administration target, and the like.
[0049] On the other hand, it is preferable that the microparticle composition does not contain a predetermined substance. For example, it is preferable that the microparticle composition does not contain dental pulp-derived stem cells. In addition, it is preferable that the microparticle composition does not contain MCP-1. However, it may contain cytokines other than MCP-1. Examples of other cytokines include those described in
[0014] to
[0020] of JP 2018-023343 A. In addition, it is preferable that the microparticle composition does not contain Siglec-9. However, it may contain other sialic acid-binding immunoglobulin-like lectins other than Siglec-9. Note that it is preferable that the microparticle composition does not substantially contain serum (such as fetal bovine serum, human serum, and sheep serum). In addition, it is preferable that the microparticle composition does not substantially contain conventional serum substitutes such as Knockout serum replacement (KSR). It is preferable that the content (solid content) of each of the other components described above in the microparticle composition is 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.
[0050] <Method for producing microparticles> The method for producing microparticles is not particularly limited. A culture supernatant such as that of dental pulp-derived stem cells may be prepared, and subsequently, microparticles may be purified from the culture supernatant of dental pulp-derived stem cells to prepare the PTX3 expression regulator of the present invention. Alternatively, microparticles may be purified from the culture supernatant of commercially purchased dental pulp-derived stem cells to prepare the PTX3 expression regulator of the present invention. Furthermore, a composition containing the culture supernatant of dental pulp-derived stem cells that has been discarded may be received (or the composition may be appropriately purified), and microparticles may be purified therefrom to prepare the PTX3 expression regulator of the present invention.
[0051] (Method for preparing culture supernatant of dental pulp-derived stem cells, etc.) The culture supernatant of dental pulp-derived stem cells, etc. is not particularly limited. The culture supernatant of dental pulp-derived stem cells and the like preferably contains substantially no serum. For example, the culture supernatant of dental pulp-derived stem cells and the like preferably has a serum content of 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.
[0052] Dental pulp-derived stem cells may be of human origin or of non-human animal origin. Examples of non-human animals include the same animals (species) as the animals (species) to which the PTX3 expression control agent of the present invention described below is administered, and mammals are preferred.
[0053] There are no particular restrictions on the dental pulp-derived stem cells used in the culture supernatant. Stem cells from exfoliated deciduous teeth, other deciduous tooth pulp stem cells obtained by other methods, and dental pulp stem cells (DPSC) can be used. In addition to human deciduous tooth pulp stem cells and human permanent tooth pulp stem cells, dental pulp-derived stem cells of non-human animal origin such as porcine deciduous tooth pulp stem cells can be used. In addition to exosomes, dental pulp-derived stem cells can produce various cytokines such as vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), transforming growth factor-beta (TGF-β)-1 and -3, TGF-α, KGF, HBEGF, SPARC, and other growth factors and chemokines. They can also produce many other bioactive substances. In the present invention, it is particularly preferred that the dental pulp-derived stem cells used in the culture supernatant of dental pulp-derived stem cells are dental pulp-derived stem cells containing many proteins, and it is preferred to use deciduous tooth pulp stem cells. That is, in the present invention, it is preferred to use the culture supernatant of deciduous tooth pulp stem cells.
[0054] The dental pulp-derived stem cells used in the present invention may be natural or genetically modified as long as the purpose of the treatment can be achieved. In particular, in the present invention, immortalized stem cells derived from dental pulp can be used. By using immortalized stem cells capable of substantially infinite proliferation, the amount and composition of biofactors contained in the culture supernatant of the stem cells can be stabilized over a long period of time. There are no particular limitations on the immortalized stem cells derived from dental pulp. The immortalized stem cells are preferably non-cancerous immortalized stem cells. The immortalized stem cells derived from dental pulp can be prepared by adding the following low molecular weight compounds (inhibitors) to dental pulp-derived stem cells alone or in combination and culturing them. The TGFβ receptor inhibitor is not particularly limited as long as it has an action of inhibiting the function of the transforming growth factor (TGF) β receptor. For example, 2-(5-benzo[1,3]dioxol-4-yl-2-tert-butyl-1H-imidazol-4-yl)-6-methylpyridine, 3-(6-methylpyridin-2-yl)-4-(4-quinolyl)-1-phenylthiocarbamoyl-1H-pyrazole (A-83-01), 2-[(5-chloro-2-fluorophenyl)pteridin-4-yl]pyridin-4-ylamine (SD-208), 3-[(pyridin-2-yl)-4-(4-quinonyl)]-1H-pyrazole, 2-(3-(6-methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine (above, Merck), SB431542 (Sigma-Aldrich), etc. are included. Preferably, A-83-01 is included. The ROCK inhibitor is not particularly limited as long as it has an action of inhibiting the function of Rho-associated kinase. Examples of the ROCK inhibitor include GSK269962A (Axonmedchem), Fasudil hydrochloride (Tocris Bioscience), Y-27632, H-1152 (above, Fujifilm Wako Pure Chemical Corporation), etc. Preferably, Y-27632 is included. The GSK3 inhibitor is not particularly limited as long as it inhibits GSK-3 (Glycogen synthase kinase 3). Examples include A 1070722, BIO, BIO-acetoxime (above, TOCRIS), etc. The MEK inhibitor is not particularly limited as long as it has the action of inhibiting the function of MEK (MAP kinase-ERK kinase). For example, AZD6244, CI-1040 (PD184352), PD0325901, RDEA119 (BAY86-9766), SL327, U0126-EtOH (above, from Selleck), PD98059, U0124, U0125 (above, from Cosmo Bio Co., Ltd.), etc. can be mentioned.
[0055] When the PTX3 expression regulator of the present invention is used in regenerative medicine, in accordance with the requirements of the Act on Securing Safety in Regenerative Medicine, etc., a composition containing the culture supernatant of dental pulp-derived stem cells or their immortalized stem cells, and microparticles derived therefrom, shall be in a form that does not contain other somatic stem cells other than dental pulp-derived stem cells, etc. The microparticle composition may contain mesenchymal stem cells or other somatic stem cells other than dental pulp-derived stem cells, etc., but preferably does not contain them. Examples of other somatic stem cells other than mesenchymal stem cells include stem cells derived from the dermal system, digestive system, bone marrow system, nervous system, etc., but are not limited thereto. Examples of dermal somatic stem cells include epithelial stem cells, hair follicle stem cells, etc. Examples of digestive somatic stem cells include pancreatic (general) stem cells, liver stem cells, etc. Examples of bone marrow somatic stem cells (other than mesenchymal stem cells) include hematopoietic stem cells, etc. Examples of nervous somatic stem cells include neural stem cells, retinal stem cells, etc. The microparticle composition may contain stem cells other than somatic stem cells, but preferably does not contain them. Stem cells other than somatic stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), and embryonic carcinoma cells (EC cells).
[0056] The method for preparing the culture supernatant of dental pulp-derived stem cells or their immortalized stem cells is not particularly limited, and conventional methods can be used. The culture supernatant of dental pulp-derived stem cells and the like is a culture solution obtained by culturing dental pulp-derived stem cells. For example, by separating and removing cell components after culturing dental pulp-derived stem cells, a culture supernatant usable in the present invention can be obtained. A culture supernatant subjected to various treatments (for example, centrifugation, concentration, solvent replacement, dialysis, freezing, drying, freeze-drying, dilution, desalting, storage, etc.) may be used as appropriate.
[0057] Dental pulp-derived stem cells for obtaining the culture supernatant of dental pulp-derived stem cells can be selected by a conventional method, and can be selected based on the size and morphology of the cells or as adherent cells. From dental pulp cells collected from exfoliated primary teeth or permanent teeth, they can be selected as adherent cells or their subcultured cells. As the culture supernatant of dental pulp-derived stem cells, a culture supernatant obtained by culturing the selected stem cells can be used.
[0058] Note that the "culture supernatant of dental pulp-derived stem cells and the like" is preferably a culture solution that does not contain the cells themselves obtained by culturing dental pulp-derived stem cells and the like. In one aspect of the culture supernatant of dental pulp-derived stem cells used in the present invention, it is preferably free of cells (regardless of the type of cells) as a whole. Due to this feature, the composition of this aspect is clearly distinguished from various compositions containing dental pulp-derived stem cells themselves, not to mention dental pulp-derived stem cells. A typical example of this aspect is a composition composed only of the culture supernatant of dental pulp-derived stem cells without containing dental pulp-derived stem cells. The culture supernatant of dental pulp-derived stem cells used in the present invention may contain the culture supernatants of both primary tooth dental pulp-derived stem cells and adult dental pulp-derived stem cells. The culture supernatant of dental pulp-derived stem cells used in the present invention preferably contains the culture supernatant of primary tooth dental pulp-derived stem cells as an active ingredient, more preferably contains 50% by mass or more, and preferably contains 90% by mass or more. It is more particularly preferred that the culture supernatant of dental pulp-derived stem cells used in the present invention is a composition composed only of the culture supernatant of primary tooth dental pulp-derived stem cells.
[0059] For the culture medium of dental pulp-derived stem cells to obtain the culture supernatant, a basal medium, or a basal medium supplemented with serum or the like can be used. As the basal medium, in addition to Dulbecco's modified Eagle's medium (DMEM), Iscove's modified Dulbecco's medium (IMDM) (such as from GIBCO), Ham's F12 medium (HamF12) (such as from SIGMA, GIBCO), RPMI1640 medium, etc. can be used. Examples of components that can be added to the medium include serum (such as fetal bovine serum, human serum, sheep serum), serum replacement (such as Knockout serum replacement (KSR)), bovine serum albumin (BSA), antibiotics, various vitamins, and various minerals. However, in order to prepare a "culture supernatant of dental pulp-derived stem cells" without serum, it is advisable to use a serum-free medium throughout the process or for the last or the last few passages of subculture. For example, by culturing dental pulp-derived stem cells in a serum-free medium (serum-free medium), a culture supernatant of dental pulp-derived stem cells without serum can be prepared. Even if one or more passages of subculture are performed and the last or the last few passages of subculture are cultured in a serum-free medium, a culture supernatant of dental pulp-derived stem cells or the like without serum can be obtained. On the other hand, a culture supernatant of dental pulp-derived stem cells without serum can also be obtained by removing serum from the collected culture supernatant using dialysis or solvent replacement by column.
[0060] For the culture of dental pulp-derived stem cells to obtain the culture supernatant, the commonly used conditions can be directly applied. Regarding the method for preparing the culture supernatant of dental pulp-derived stem cells, it may be the same as the cell culture method described below, except that the isolation and selection steps of the stem cells are appropriately adjusted according to the type of stem cells. Those skilled in the art can appropriately perform the isolation and selection of dental pulp-derived stem cells according to the type of dental pulp-derived stem cells. In addition, for the culture of dental pulp-derived stem cells, special conditions may be applied to produce a large amount of microparticles such as exosomes. Examples of special conditions include low-temperature conditions, low-oxygen conditions, microgravity conditions, and conditions of co-culture with some stimulant.
[0061] The culture supernatant of dental pulp-derived stem cells used for preparing microparticles such as exosomes in the present invention may contain other components in addition to the culture supernatant of dental pulp-derived stem cells, but it is preferably substantially free of other components. However, various additives used for preparing exosomes may be added to the culture supernatant of dental pulp-derived stem cells and then stored.
[0062] (Preparation of Microparticles) Microparticles can be prepared by purifying microparticles from the culture supernatant of dental pulp-derived stem cells or the like.
[0063] Purification of the microparticles is preferably separation of a fraction containing the microparticles from the culture supernatant of dental pulp-derived stem cells, and more preferably isolation of the microparticles. The microparticles can be isolated by separating them from non-associated components based on the characteristics of the microparticles. For example, the microparticles can be isolated based on molecular weight, size, morphology, composition, or biological activity. In the present invention, the microparticles can be purified by collecting a specific fraction (for example, precipitate) containing a large amount of microparticles obtained by centrifuging the culture supernatant of dental pulp-derived stem cells. Unnecessary components (insoluble components) of fractions other than the predetermined fraction may be removed. Removal of the solvent, dispersion medium, and unnecessary components from the microparticle composition does not have to be complete removal. Exemplary centrifugation conditions are 100 to 20,000 g for 1 to 30 minutes. In the present invention, the microparticles can be purified by filtering the culture supernatant of dental pulp-derived stem cells or its centrifuged product. Unnecessary components can be removed by the filtration treatment. Also, by using a filtration membrane with an appropriate pore size, removal of unnecessary components and sterilization treatment can be performed simultaneously. The material, pore size, etc. of the filtration membrane used for the filtration treatment are not particularly limited. Filtration can be performed with a filtration membrane having an appropriate molecular weight or size cut-off by a known method. The pore size of the filtration membrane is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm from the viewpoint of easily collecting exosomes. In the present invention, the culture supernatant of dental pulp-derived stem cells, or its centrifuged product, or its filtered product can be separated using further separation means such as ram chromatography. For example, high performance liquid chromatography (HPLC) using various columns can be used. As the column, a size exclusion column or a binding column can be used. In each fraction at each processing stage, one or more characteristics or biological activities of the microparticles can be used to track the microparticles (or their activities). For example, light scattering, refractive index, dynamic light scattering, or a UV-visible light detector can be used to track the microparticles. Alternatively, specific enzyme activities, etc. can be used to track the activities in each fraction. As a method for purifying microparticles, the method described in
[0034] to
[0064] of Japanese Patent Application Laid-Open No. 2019-524824 may be used, and the content of this publication is incorporated herein by reference.
[0064] The final form of the microparticle composition is not particularly limited. For example, the microparticle composition may be in a form in which the microparticles are filled in a container together with a solvent or a dispersion medium; a form in which the microparticles are gelled together with a gel and filled in a container; a form in which the microparticles are frozen and / or dried to be solidified and formulated or filled in a container, etc. Examples of the container include tubes, centrifuge tubes, bags, etc. suitable for cryopreservation. The freezing temperature can be, for example, -20°C to -196°C.
[0065] The PTX3 expression regulator of the present invention has advantages such as being easy to mass-produce, being able to utilize the culture solution of stem cells that were conventionally discarded as industrial waste, etc., compared with a composition that can be used as a therapeutic or preventive agent for conventional rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases. In particular, when the culture supernatant of dental pulp-derived stem cells is the culture supernatant of human dental pulp-derived stem cells, when applying the PTX3 expression regulator of the present invention to humans, it has high safety from the perspective of immunology and also has the advantage of fewer ethical problems. When the culture supernatant of dental pulp-derived stem cells is the culture supernatant of dental pulp-derived stem cells from a patient with vasculitis, the safety of the PTX3 expression regulator of the present invention will be enhanced and the ethical problems will also be reduced when applied to that patient. When the PTX3 expression regulator of the present invention is derived from the culture supernatant of dental pulp-derived stem cells, it is also used for the purpose of regenerative medicine. In particular, a composition containing microparticles derived from the culture supernatant of dental pulp-derived stem cells and the like is preferably used for the purpose of regenerative medicine. Here, in regenerative medicine based on stem cell transplantation, it is known that stem cells are not the main actors in regeneration, but the humoral components produced by stem cells repair organs together with their own stem cells. Difficult problems such as canceration, standardization, administration method, storage stability, and culture method associated with conventional stem cell transplantation are solved, and regenerative medicine becomes possible with a composition using the culture supernatant of dental pulp-derived stem cells or microparticles derived therefrom. Compared with stem cell transplantation, when using the PTX3 expression regulator of the present invention, since cells are not transplanted, it is less likely to cause tumorigenesis and is safer. In addition, the PTX3 expression regulator of the present invention has the advantage that a product with a certain standardized quality can be used. Since mass production and an efficient administration method can be selected, it can be used at low cost.
[0066] [Preventive or therapeutic agent for rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases] The preventive or therapeutic agent for rheumatoid arthritis, vasculitis or skin sclerosis associated with autoimmune diseases of the present invention contains the PTX3 expression regulator of the present invention. As used herein, "prevention" means preventing the onset of a disease (vasculitis in this specification). Also, as used herein, "treatment" means alleviating, suppressing, or preventing the progression of symptoms in a developed disease, and improving the symptoms.
[0067] [Method for improving rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis] The method for improving rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention includes administering an effective amount of an expression regulator of PTX3 of the present invention or an effective amount of a prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention to a subject having developed vasculitis.
[0068] The step of administering an expression regulator of PTX3 of the present invention or the like to a subject having developed rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis is not particularly limited. Examples of the administration method include oral administration, spraying or suction into the nasal cavity or airway, intravenous drip, topical administration, nasal drops, application to the skin, etc., and it is preferable that the invasion is small. As the method of topical administration, injection is preferable. Also, electroporation, which temporarily creates fine holes in the cell membrane by applying a voltage (electrical pulse) to the skin surface and allows the active ingredient to penetrate to the dermis layer that cannot be reached by normal care, is also preferable. When administering topically, intravenous administration, intraarterial administration, portal vein administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, etc. can be mentioned, and intraarterial administration, intravenous administration, subcutaneous administration, or intraperitoneal administration is more preferable. When administering an expression regulator of PTX3 of the present invention to a subject having developed skin sclerosis, application to the skin is more preferable. For example, it is preferable to mix an expression regulator of PTX3 of the present invention into skin application agents such as lotion, essence, emulsion, cream, ointment, pack, etc. and apply these to the skin. When the prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis of the present invention is a prophylactic or therapeutic agent for skin sclerosis, it is preferably a skin application agent. In addition, by using various formulation techniques, the in vivo distribution of microparticles can be altered. Numerous methods for altering the in vivo distribution are known to those skilled in the art. Examples of such methods include, for example, the protection of exosomes in vesicles composed of substances such as proteins, lipids (e.g., liposomes), carbohydrates, or synthetic polymers. The PTX3 expression regulator of the present invention administered to a subject who has developed rheumatoid arthritis, vasculitis associated with an autoimmune disease, or skin sclerosis may circulate in the subject's body and reach a predetermined tissue. There are no particular restrictions on the number of administrations and the administration interval. The number of administrations can be once or more per week, preferably 5 or more times, more preferably 6 or more times, and particularly preferably 7 or more times. The administration interval is preferably from 1 hour to 1 week, more preferably from half a day to 1 week, and particularly preferably once a day (once a day). However, it can be appropriately adjusted according to the species of the administration subject and the symptoms of the administration subject. The PTX3 expression regulator of the present invention is preferably used for administering to a subject who has developed vasculitis once or more per week over the therapeutic effective period. When the administration subject is a human, it is preferable to have a larger number of administrations per week, preferably 5 or more times per week over the therapeutic effective period, and preferably administer daily. 2.0×10 9 When using the culture supernatant of dental pulp-derived stem cells at a concentration of cells / ml, in a mouse model, it is preferably 0.1 to 5 ml per mouse (about 25 g), more preferably 0.3 to 3 ml, and even more preferably 0.5 to 1 ml. 0.1×10 8 When using microparticles at a concentration of particles / μg, in a mouse model, it is preferably 1 to 50 μg per mouse (about 25 g), more preferably 3 to 30 μg, and even more preferably 5 to 25 μg. The preferable range of the dosage per body weight for other animals can be calculated using a proportional relationship from the dosage per body weight (about 25 g) for the model mouse. However, it can be appropriately adjusted according to the symptoms of the administration subject.
[0069] There are no particular restrictions on the animal (species) to which the PTX3 expression regulator of the present invention is administered. The animal to which the PTX3 expression regulator of the present invention is administered is preferably a mammal, a bird (such as a chicken, a quail, or a duck), or a fish (such as a salmon, a trout, a tuna, or a bonito). As the mammal, it may be a human or a non-human mammal, but a human is particularly preferred. As the non-human mammal, it is more preferably a cow, a pig, a horse, a goat, a sheep, a monkey, a dog, a cat, a mouse, a rat, a guinea pig, or a hamster.
[0070] The PTX3 expression regulator of the present invention may be used in combination with a conventionally known therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis. Specifically, for example, it may be used in combination with a conventionally known steroid, immunosuppressant, biological preparation (such as tocilizumab, TNF inhibitor, etc.), antiplatelet agent, antihistamine / antiallergic agent, NSAIDs (non-steroidal anti-inflammatory drugs), etc.
Example
[0071] The features of the present invention will be further specifically described below by way of examples, comparative examples, or reference examples. The materials, amounts used, ratios, treatment details, treatment procedures, etc. shown in the following examples can be appropriately changed without departing from the spirit of the present invention. Therefore, the scope of the present invention should not be construed as being limited by the specific examples shown below.
[0072] [Example 1] [Preparation of culture supernatant of dental pulp-derived stem cells] Using DMEM medium instead of DMEM / HamF12 mixed medium, and otherwise according to the method described in Example 6 of Patent No. 6296622, the culture supernatant of human deciduous dental pulp stem cells was prepared, and the culture supernatant was collected. In the primary culture, fetal bovine serum (FBS) was added for culturing, and in the subculture, the supernatant of the subculture solution cultured using the primary culture solution was collected so that it did not contain FBS, and the culture supernatant of deciduous dental pulp stem cells was prepared. Note that DMEM is Dulbecco's modified Eagle's medium, and F12 is Ham's F12 medium.
[0073] <Preparation of Exosomes> Exosomes derived from dental pulp stem cells were purified from the culture supernatant of the obtained dental pulp-derived stem cells by the following method. The culture supernatant (100 mL) of deciduous dental pulp stem cells was filtered through a filter with a pore size of 0.22 micrometers, and then the solution was centrifuged at 100,000×g at 4°C for 60 minutes. The supernatant was decanted, and the exosome-concentrated pellet was resuspended in phosphate-buffered saline (PBS). The resuspended sample was centrifuged at 100,000×g for 60 minutes. The pellet was recovered again as a concentrated sample from the bottom of the centrifuge tube (approximately 100 μl). The protein concentration was determined by a Micro BSA Protein Assay Kit (Pierce, Rockford, IL). The composition (concentrated solution) containing exosomes was stored at -80°C. A composition containing exosomes purified from the culture supernatant of dental pulp-derived stem cells was used as the expression regulator (microparticle composition sample) of Example 1.
[0074] The average particle size and concentration of the microparticles contained in the expression regulator of Example 1 were evaluated using a nanoparticle analysis system NanoSight (Nanosight) (manufactured by Nippon Cantum Design Co., Ltd.). The average particle size of the microparticles contained in the expression regulator of Example 1 was 50 to 150 nm. The expression regulator of Example 1 was a high-concentration exosome solution of 1.0×10 9 or more per ml, specifically a high-concentration exosome solution of 2.0×10 9 per ml. In addition, the components of the obtained expression regulator of Example 1 were analyzed by a known method. As a result, it was found that the expression regulator of Example 1 did not contain dental pulp-derived stem cells, did not contain MCP-1, and did not contain Siglec-9. Therefore, it was found that the active ingredients of the expression regulator of Example 1 were different from MCP-1 and Siglec-9, which are the active ingredients of the culture supernatant of mesenchymal stem cells, and their analogs.
[0075] [Comparative Example 1] [Preparation of culture supernatant of umbilical cord-derived stem cells] A culture supernatant of umbilical cord-derived stem cells was prepared in the same manner as in Example 1, except that human umbilical cord-derived stem cells were used instead of deciduous dental pulp stem cells, and a composition containing exosomes purified from umbilical cord-derived stem cells (the microparticle composition of Comparative Example 1) was prepared.
[0076] [Test Example 1]: MicroRNA expressed in exosomes The small RNAs contained in the microparticle composition of Example 1 were analyzed by next-generation sequencing (NGS). By NGS analysis, 1787 miRNAs were identified in the microparticle composition of Example 1 (exosomes of dental pulp-derived stem cells). The obtained results are shown in Table 1 below.
[0077] [Table 1]
[0078] [Test Example 2]: Search for microRNA related to diseases MicroRNAs related to diseases were searched. Extraction of miRNAs related to diseases was performed using IMOTA (Interactive Multi-Omics-Tissue Atlas). IMOTA is an interactive multi-omics atlas that can examine the interactions and expression levels of miRNAs, mRNAs, and proteins in each tissue and cell (Nucleic Acids Research, Volume 46, Issue D1, 4 January 2018, Pages D770-D775, "IMOTA: an interactive multi-omics tissue atlas for the analysis of human miRNA-target interactions"). Here, it was explored whether it contains microRNAs that regulate proteins and / or genes related to rheumatoid arthritis, vasculitis associated with autoimmune diseases or skin sclerosis, or whether it contains microRNAs that regulate proteins and / or genes targeted by therapeutic drugs. In this Test Example 2, microRNAs targeting genes related to the expression of PTX3 were searched.
[0079] [Test Example 2]: Search for MicroRNAs Related to Diseases MicroRNAs related to diseases were explored. Extraction of miRNAs related to diseases was performed using IMOTA (Interactive Multi-Omics-Tissue Atlas). IMOTA is an interactive multi-omics atlas that can examine the interactions and expression levels of miRNAs, mRNAs, and proteins in each tissue and cell (Nucleic Acids Research, Volume 46, Issue D1, 4 January 2018, Pages D770-D775, "IMOTA: an interactive multi-omics tissue atlas for the analysis of human miRNA-target interactions"). Here, it was explored whether microRNAs that regulate proteins and / or genes related to rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis are included, or whether microRNAs that regulate proteins and / or genes targeted by therapeutic drugs are included. In this Test Example 2, as a protein related to rheumatoid arthritis, vasculitis associated with autoimmune diseases, or skin sclerosis, miRNAs targeting the gene related to the expression of PTX3 were explored.
[0080] The miRNAs expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells targeting the gene related to the expression of PTX3 were the following PTX3-suppression-related miRNA group (three types). hsa-miR-224-5p, has-miR-374c-5p, and hsa-miR-655-3p. Therefore, it was found that the expression regulator of the present invention can be used as an expression regulator of PTX3.
[0081] The results of comparing the expression levels of miRNAs expressed in exosomes of dental pulp-derived stem cells are shown in the heat map of Fig. 1. The concentration of the heat map is shown as the log ratio of the read count value.
[0082] As shown in Figure 1, it was found that the expression control agent of the present invention contains miRNA related to PTX3 at a high concentration. Therefore, the expression control agent of the present invention can control the expression of PTX3 and / or the PTX3 gene (Ptx3).
[0083] [Test Example 3]: Confirmation of Suppression of PTX3 Expression Using a vasculitis model of human umbilical vein endothelial cells (HUVEC), the suppression of PTX3 expression was confirmed by the following method. After seeding HUVEC cells, they were cultured at 37°C under 5% CO₂ for 18 hours. Then, the HUVEC cells were sealed in a BBL GasPakTM anaerobic system (Becton Dickinson Microbiology Systems, Cockeysville, MD, USA) and cultured under low oxygen for 24 hours. As a result, the oxygen concentration in the culture environment of HUVEC cells became 2%. Twenty-four hours later, the expression control agent of Example 1 (exosomes purified from dental pulp-derived stem cells) or the microparticle composition prepared in Comparative Example 1 (exosomes purified from umbilical cord-derived stem cells) was administered at 10,000 exosomes per HUVEC cell. Forty-eight hours later, the expression level of the PTX3 gene was quantified by qPCR using the following primer set. PTX3: Pentraxin 3 (PTX3) Human qPCR Primer Pair (NM_002852) CGAAATAGACAATGGACTCCATCC / CTCATCTGCGAGTTCTCCAGCA
[0084] [Reference Example 1]: Untreated with Low Oxygen The treatment of culturing HUVEC cells under low oxygen for 24 hours was replaced with culturing at 37°C under 5% CO₂ for 24 hours. The expression level of the PTX3 gene was quantified by qPCR in the same manner as in Example 1 except that the microparticle composition was not added.
[0085] [Reference Example 2]: Without Microparticles after Low Oxygen Culture The PTX3 gene expression level was quantified by qPCR in the same manner as in Example 1, except that the microparticle composition was not added.
[0086] Figure 2 is a graph of the PTX3 gene expression levels quantified in each example. From Figure 2, it was found that the PTX3 expression inhibitor of the present invention can significantly suppress the PTX3 gene expression level.
[0087] [Test Example 4]: Administration to patients with rheumatoid arthritis, vasculitis associated with autoimmune diseases, and rheumatoid vasculitis (RA) To one patient with rheumatoid arthritis, vasculitis associated with autoimmune diseases, and rheumatoid vasculitis (RA) who was positive for rheumatoid factor (RF) and positive for anti-CCP antibody, the culture supernatant of dental pulp-derived stem cells obtained in Example 1 or the microparticle composition (purified exosome composition) obtained in Example 1 was administered according to the treatment schedule shown in Table 2 below. Rheumatoid factor is an autoantibody (immunoglobulin) against IgG-Fc, and in this test example, IgM-type RF, which is common as an index of the pathological condition of rheumatoid arthritis, was used. Anti-CCP antibody is an antibody against cyclic citrullinated peptide (CCP), and is a central immunoglobulin in the pathological condition of rheumatoid arthritis.
[0088] (Evaluation) For the patient, measurement of rheumatoid factor, measurement of anti-CCP antibody, and VAS evaluation were performed according to the treatment schedule shown in Table 2 below. The date is in the order of MM / DD / YYYY. Visual Analogue Scale (VAS) evaluation is a method for evaluating pain by a visual scale in which a scale of a 10-cm long black line (the left end is "no pain" = 0, and the right end is "the maximum pain imaginable" = 10) is shown to the patient, and the result of the patient indicating the current degree of pain is evaluated from 0 to 10. The results obtained are shown in Table 2 below. In Table 2 below, the unit of the dosage of the exosome composition is "100 million (1.0×10 8"(pieces)". 1 ml of the culture supernatant of the dental pulp-derived stem cells used contains exosomes in an amount corresponding to 20 μg of the exosome composition. From Table 2 below, it was found that administration of the microparticle composition (exosome composition) purified and isolated from the culture supernatant of dental pulp-derived stem cells can more significantly improve the levels of rheumatoid factor, anti-CCP antibody, and VAS than administration of the culture supernatant of dental pulp-derived stem cells. That is, it was suggested that the expression regulator of the present invention can significantly improve vasculitis associated with rheumatoid arthritis and autoimmune diseases when used as a microparticle composition (exosome composition) purified and isolated from the culture supernatant of stem cells.
[0089]
Table 2
Claims
1. An agent for controlling the expression of PTX3, wherein the expression control agent contains microparticles, the microparticles contain miRNA having a gene related to the expression of PTX3 as a target gene, An agent for controlling the expression of PTX3.
2. The agent for controlling the expression of PTX3 according to Claim 1, wherein the microparticles are exosomes.
3. The PTX3 according to Claim 1, which contains at least one of hsa-miR-224-5p, has-miR-374c-5p and hsa-miR-655-3p as miRNA having a gene related to the expression of PTX3 as a target gene.
4. The agent for controlling the expression of PTX3 according to Claim 1, wherein the miRNA having a gene related to the expression of PTX3 as a target gene contains at least hsa-miR-224-5p.
5. The agent for controlling the expression of PTX3 according to Claim 1, wherein the miRNA having a gene related to the expression of PTX3 as a target gene contains hsa-miR-224-5p and hsa-miR-655-3p.
6. The agent for controlling the expression of PTX3 according to Claim 1, wherein the microparticles contain miRNA having a gene related to the expression of PTX3 as a target gene at a concentration higher than that of the culture supernatant of dental pulp-derived stem cells.
7. The microparticles are microparticles purified and isolated from the culture supernatant of dental pulp-derived stem cells, The agent for controlling the expression of PTX3 according to Claim 1, wherein the microparticles do not contain components excluding the exosomes from the culture supernatant of the dental pulp-derived stem cells.
8. A prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases or skin sclerosis, which contains the agent for controlling the expression of PTX3 according to Claim 1 as an active ingredient.
9. The prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases or skin sclerosis according to Claim 8, which is a prophylactic or therapeutic agent for skin sclerosis and is a skin application agent.
10. A method for improving rheumatoid arthritis, vasculitis associated with autoimmune diseases or skin sclerosis, which includes administering an effective amount of the agent for controlling the expression of PTX3 according to Claim 1, or an effective amount of the prophylactic or therapeutic agent for rheumatoid arthritis, vasculitis associated with autoimmune diseases or skin sclerosis according to Claim 8, to a subject having developed rheumatoid arthritis, vasculitis associated with autoimmune diseases or skin sclerosis.