Polyhydroxyalkanoic acid, recombinant hydrogen-oxidizing bacteria, and method for producing polyhydroxyalkanoic acid

Abstract

To provide a method for producing PHA containing a monomer component having a methyl group at the α-position in the presence of an inexpensive carbon source.SOLUTION: Provided are a polyhydroxyalkanoic acid (PHA) having a weight-average molecular weight (Mw) of 1 million or more, containing a monomer component having a methyl group at the α-position, the monomer component being 3-hydroxy-2-methylpropionic acid (3H2MP); a gene-deficient hydrogen oxidizing bacterium lacking the 3-hydroxyisobutyrate dehydrogenase (hbdH) gene and capable of producing PHA containing a monomer component having a methyl group at the α-position; and a method for producing PHA containing a monomer component having a methyl group at the α-position, comprising: (i) producing an hbdH gene-deficient hydrogen oxidizing bacterium having a PHA polymerase; (ii) culturing the hbdH gene-deficient hydrogen oxidizing bacterium in the presence of a carbon source; and (iii) collecting αPHA containing a monomer component having a methyl group at the α-position from the culture.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a high molecular weight polyhydroxyalkanoic acid (PHA) containing a specific monomer component having a methyl group at the α-position, a hydrogen-oxidizing bacterium lacking a specific gene and having the ability to produce a copolymerized PHA, and a method for producing a PHA containing a monomer component having a methyl group at the α-position.

Background Art

[0002] Polyhydroxyalkanoic acid (PHA), which is a polymer of 3-hydroxyalkanoic acid, is a biodegradable polyester accumulated by microorganisms in cells. In recent years, it has attracted attention not only as a biodegradable plastic material but also as a plastic material derived from biomass.

[0003] A homopolymer composed of (R)-3-hydroxybutyric acid (3HB), which is the most common PHA (hereinafter, appropriately referred to as "P(3HB)"), is crystalline. While it can shorten the processing time, it is hard and brittle and lacks practicality. In addition, problems such as the polymer being degraded into low molecular weight substances during melting occur during molding processing, and it is not suitable for industrial production. As one means of improving these physical properties, copolymers of 3HB and other monomers (hereinafter, the copolymers of PHA are appropriately referred to as "copolymerized PHA") have been variously developed.

[0004] On the other hand, PHA containing a monomer component having no methyl group at the α-position, such as valeric acid or butyric acid, has low heat resistance (decomposition temperature), whereas PHA containing a monomer component having a methyl group at the α-position, such as 3-hydroxy-2-methylbutyric acid (3H2MB) or 3-hydroxy-2-methylpropionic acid (3H2MP), has excellent heat resistance, a high crystallization rate, and can be used as a high-performance biodegradable plastic. For example, the present inventors have reported the synthesis of a copolymerized PHA containing a high fraction of 3H2MB in the presence of a carbon source and a precursor of 3H2MB (tiglic acid) (Patent Document 1). In addition, many reports have been made on the synthesis of PHA containing a monomer component having a methyl group at the α-position (Non-Patent Documents 1 to 5).

[0005] However, in order to introduce the monomer component, it was necessary to use expensive precursors such as tiglic acid (Patent Document 1, Non-Patent Documents 1 to 5). In addition, there was a problem that the cell yield and PHA production amount decreased due to the cytotoxicity of the added precursor (Non-Patent Document 2).

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

Non-Patent Documents

[0007]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0008] Therefore, a method for producing PHA containing a monomer component having a methyl group at the α-position in the presence of an inexpensive carbon source without using a precursor has been desired.

Means for Solving the Problems

[0009] As a result of intensive studies in view of such a situation, among the enzymes that catalyze the reaction from 3-hydroxy-2-methylpropionyl-CoA to 3-hydroxyvaleryl-CoA (3HV-CoA) in the PHA biosynthetic pathway, the inventors prepared a recombinant hydrogen-oxidizing bacterium in which the gene encoding 3-hydroxyisobutyrate dehydrogenase (HbdH) was deleted from the genome of a hydrogen-oxidizing bacterium. By using the recombinant hydrogen-oxidizing bacterium, it was found that PHA containing a monomer component having a methyl group at the α-position as one of the second components can be efficiently obtained without using a precursor of the monomer component having a methyl group at the α-position, and the present invention was completed. It was also found that deletion of the gene encoding HbdH gives high molecular weight PHA.

[0010] That is, the present invention provides the following. (1) A polyhydroxyalkanoate (PHA) containing a monomer component having a methyl group at the α-position and having a weight average molecular weight (Mw) of 1,000,000 or more, wherein the monomer component having a methyl group at the α-position is 3-hydroxy-2-methylpropionic acid (3H2MP). (2) A gene-deficient hydrogen-oxidizing bacterium having the ability to produce copolymer polyhydroxyalkanoate (PHA) with the 3-hydroxyisobutyrate dehydrogenase (hbdH) gene deleted, wherein the copolymer PHA contains a monomer component having a methyl group at the α-position. (3) A method for producing polyhydroxyalkanoate (PHA) containing a monomer component having a methyl group at the α-position, (i) A step of preparing a 3-hydroxyisobutyrate dehydrogenase (hbdH) gene-deficient hydrogen-oxidizing bacterium having a PHA polymerase; (ii) A step of culturing the gene-deficient hydrogen-oxidizing bacterium in the presence of a carbon source, and (iii) A step of collecting PHA containing a monomer component having a methyl group at the α-position from the culture The production method comprising. (4) The production method according to (3), wherein the step (i) includes a step of introducing a gene encoding a broad-substrate-specific PHA polymerase into the gene-deficient hydrogen-oxidizing bacterium. (5) The production method according to (3) or (4), wherein the carbon source is sugar and / or carbon dioxide. (6) The production method according to (5), wherein the carbon dioxide is a mixed gas containing carbon dioxide at 1 to 20% (v / v). (7) The production method according to (5) or (6), wherein the sugar is fructose. (8) The production method according to any one of (3) to (7), wherein in the step (ii), a precursor of a monomer component having a methyl group at the α-position is further added. (9) The production method according to (8), wherein the precursor is methacrylic acid and / or a branched amino acid. (10) The production method according to (9), wherein the branched amino acid is valine or isoleucine. (11) The production method according to any one of (3) to (10), wherein the monomer component having a methyl group at the α-position is 3-hydroxy-2-methylpropionic acid (3H2MP). (12) The production method according to any one of (3) to (10), wherein the monomer component having a methyl group at the α-position is 3-hydroxy-2-methylbutyric acid (3H2MB). (13) The production method according to (12), wherein isoleucine is added in addition to fructose as a carbon source. (14) The production method according to any one of (3) to (13), wherein the PHA containing a monomer component having a methyl group at the α-position substantially does not contain 3-hydroxyvaleric acid (3HV) as a monomer component. (15) The production method according to any one of (3) to (14), wherein the step (i) further includes a step of introducing a 2-ketoacid decarboxylase (kivd) gene and a phenylacetaldehyde dehydrogenase (padA) gene. (16) The production method according to any one of (3) to (15), wherein the step (i) further includes a step of introducing a 3-ketothiolase (bktB) gene. (17) The production method according to any one of (3) to (16), wherein the hydrogen-oxidizing bacterium is Ralstonia eutropha. (18) The production method according to any one of (4) to (17), wherein the PHA polymerase gene encodes a PHA polymerase variant in which asparagine at position 149 and aspartic acid at position 171 of the PHA polymerase derived from Aeromonas caviae are substituted with serine and glycine, respectively. [Advantages of the Invention]

[0011] By the production method of the present invention, a high-molecular-weight copolymer PHA containing a monomer component having a methyl group at the α-position can be synthesized in the presence of an inexpensive carbon source without using a precursor of the monomer component having a methyl group at the α-position. [Brief Description of the Drawings]

[0012]

Figure 1

Figure 2

Figure 3

Mode for Carrying Out the Invention

[0013] Hereinafter, the present invention will be described in detail according to specific embodiments. However, the present invention is by no means limited to the following embodiments, and can be implemented with appropriate modifications.

[0014] The first embodiment of the present invention is a method for producing PHA containing a monomer component having a methyl group at the α-position, and includes the following steps: (i) A step of preparing a 3-hydroxyisobutyrate dehydrogenase (hbdH) gene-deficient hydrogen-oxidizing bacterium having a PHA polymerase; (ii) A step of culturing the gene-deficient hydrogen-oxidizing bacterium in the presence of a carbon source, and (iii) A step of collecting PHA containing a monomer component having a methyl group at the α-position from the culture.

[0015] In the present invention, the "monomer component having a methyl group at the α-position" is, for example, 3H2MB and / or 3H2MP. The "PHA containing a monomer component having a methyl group at the α-position" is, for example, PHA containing 3H2MB or 3H2MP as a monomer component, and examples thereof include P(3HB-co-3H2MP-co-3H4MV), P(3HB-co-3H2MP-co-3H4MV-co-3H2MB), and P(3HB-co-3H2MB). In the following formula, * means a bonding point.

[0016]

Chemical formula

[0017] HbdH is generally an oxidoreductase that catalyzes the reaction from 3-hydroxyisobutyric acid to 2-methyl-3-oxopropanoic acid. Also, HbdH is known as an enzyme that catalyzes the reaction from 3-hydroxyisobutyric acid to methylmalonic semialdehyde in the Cupriavidus necator H16 strain, and it has been reported that 3-hydroxypropionic acid cannot be synthesized when the hbdH gene is deleted (Christian Arenas-Lopez et al., Biotechnol Biofuels (2019), 12:150, https: / / doi.org / 10.1186 / s13068-019-1489-5). When expressed as "HbdH", it means 3-hydroxyisobutyrate dehydrogenase, and when expressed as "hbdH", it means the gene encoding the enzyme.

[0018] "Hydrogen-oxidizing bacteria" (also referred to as "hydrogen bacteria") refers to bacteria that oxidize free hydrogen and perform carbon assimilation using the energy generated by this reaction. Examples of hydrogen-oxidizing bacteria include bacteria of the genus Ralstonia such as Ralstonia eutropha, bacteria of the genus Alcaligenes such as Alcaligenes latus, and bacteria of the genus Hydrogenovibrio such as Hydrogenovibrio marinus. Among these, Ralstonia eutropha is preferred in terms of its ability to grow under conditions where gaseous carbon dioxide or carbonate is the sole carbon source, the fact that its whole genome information has been analyzed, and the fact that a gene recombination method has been established (Cramm, R. et al., J. Mol. Microbiol. Biotechnol., 16, 38-52 (2009)). Examples include Ralstonia eutropha H16 strain (ATCC17699) and Ralstonia eutropha PHB - 4 strain (DSM541).

[0019] In the present invention, "deficiency of the hbdH gene" means that the hbdH gene possessed by wild-type hydrogen-oxidizing bacteria contains deletion, substitution, addition, or insertion of one or more bases, resulting in a state of completely lacking 3-hydroxyisobutyrate dehydrogenase activity or a state of lacking normal 3-hydroxyisobutyrate dehydrogenase activity. The state of "lacking normal 3-hydroxyisobutyrate dehydrogenase activity" refers to, for example, a state in which the activity is decreased compared to normal 3-hydroxyisobutyrate dehydrogenase activity, such as a state having an activity of less than 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5% of the normal protein activity.

[0020] As methods for disrupting the activity of the hbdH gene, there may be mentioned gene disruption by genetic recombination methods, induction of functional deficiency by mutagenesis methods, and the like. For example, from the viewpoints of good operability and high efficiency of causing deficiency in the activity of the hbdH gene, the in-frame deletion method is used to ligate the genes upstream and downstream of the nucleotide sequence of the hbdH gene after removing them, or to ligate them after removing a part of the nucleotide sequence encoding the hbdH gene, and the obtained gene fragment is introduced into the cells of wild-type hydrogen-oxidizing bacteria, and a method of replacing the chromosome of the hydrogen-oxidizing bacteria with the gene fragment by homologous recombination may be mentioned, and the like. The in-frame deletion method, the method of introducing a foreign gene into the cells of hydrogen-oxidizing bacteria, the method of homologous recombination, and the like can be carried out according to known methods.

[0021] Specifically, as a method for causing deficiency in the hbdH gene in the present invention, it includes (a) a step of amplifying the DNA of the upstream region and the downstream region of the target gene to be deficient by PCR, (b) a step of ligating the obtained DNA fragment of the upstream region and the DNA fragment of the downstream region to obtain a ligated DNA fragment of the upstream region and the downstream region and circularizing it, and (c) a step of introducing the obtained circularized DNA into a wild strain of hydrogen-oxidizing bacteria, transforming it, and performing homologous recombination with the DNA of the bacteria.

[0022] In step (b), the ligation of the DNA fragment of the upstream region and the DNA fragment of the downstream region means arranging and binding the DNA fragment of the upstream region adjacent in series on the 5' side and the DNA fragment of the downstream region on the 3' side. The ligated DNA fragment may contain a marker gene.

[0023] The ligated DNA fragment can be circularized, for example, by self-ligation. As a method for introducing the circularized DNA into hydrogen-oxidizing bacteria, general methods known to those skilled in the art can be used. For example, there may be mentioned the calcium phosphate method, the calcium chloride / rubidium chloride method, the electroporation method, the conjugation transfer method, and the like.

[0024] In step (c), the introduction of the wild strain into the hydrogen-oxidizing bacterium can be carried out by methods such as the conjugation transfer method, the protoplast-PEG method, the electroporation method, the particle gun method, the Agrobacterium method, the microinjection method, etc.

[0025] As a method for confirming that the target gene has been introduced into the hydrogen-oxidizing bacterium, known methods can be used. For example, the PCR method, the Southern hybridization method, etc. can be used to confirm that the target locus has been replaced by the marker.

[0026] As a method for screening gene-deficient strains, methods such as extracting genomic DNA from the selected candidate strains and confirming by sequence analysis can be mentioned. As other methods, the colony PCR method, the colony hybridization method, etc. can be used.

[0027] In the present invention, the "PHA polymerase" in "having a PHA polymerase" may be the PHA polymerase originally possessed by the hydrogen-oxidizing bacterium or one provided from the outside. Some hydrogen-oxidizing bacteria originally have the ability to produce PHA, but this is mainly the ability to produce a homopolymer of HB (P(HB)), and they can hardly synthesize a copolymerized PHA further containing HA units other than HB. Therefore, the main PHA polymerase originally possessed by the hydrogen-oxidizing bacterium is an enzyme that produces P(HB). Therefore, even for a hydrogen-oxidizing bacterium that originally has a PHA polymerase, it is preferable to provide a PHA polymerase from the outside. Such a PHA polymerase from the outside is referred to as a "PHA polymerase with broad substrate specificity" or simply "PHA polymerase". That is, the "broad-substrate-specific PHA polymerase" refers to an enzyme whose polymerization activity for synthesizing PHA is not limited to only (R)-HB-CoA. By introducing a gene encoding a broad-substrate-specific PHA polymerase (hereinafter, appropriately referred to as "PHA polymerase gene" or "phaC") into a host microorganism, a copolymerized PHA further containing a hydroxyalkanoic acid (HA) unit other than HB can be synthesized, and the composition of the copolymerized PHA can be controlled. Therefore, in step (i) of the production method of the present invention, it is preferable to further introduce a PHA polymerase gene into the hydrogen-oxidizing bacterium.

[0028] In the hbdH gene-deficient hydrogen-oxidizing bacterium obtained in step (i) of the production method of the present invention, in order to enhance the introduction fraction of the monomer component having a methyl group at the α-position in the copolymerized PHA, it is preferable to introduce the kivd gene and the padA gene, and it is more preferable to introduce the bktB gene in addition to the kivd gene and the padA gene. Hereinafter, these three genes are each appropriately referred to as "monomer supply enhancing genes". It is known that Ralstonia eutropha H16, which is one of the hydrogen-oxidizing bacteria, has the bktB gene downstream of its phbCAB operon (Madison, L.L., et al., (1999) Microbiol. Mol. Biol. Rev., 63, 21-53). "Enhancement" means that the introduction fraction of the monomer component having a methyl group at the α-position in the copolymerized PHA produced by the hydrogen-oxidizing bacterium into which two or three monomer supply enhancing genes have been introduced is "higher" than the introduction fraction of the monomer component having a methyl group at the α-position in the copolymerized PHA produced by the hydrogen-oxidizing bacterium into which the monomer supply enhancing gene has not been introduced. Although it depends on the type of the monomer component having a methyl group at the α-position, for example, it is judged as "higher" when the introduction fraction of the monomer component becomes twice or more. Note that PHA is appropriately referred to as copolymerized PHA.

[0029] Kivd and PadA are enzymes that catalyze the pathway of converting 2-ketoisovaleric acid to isobutyryl-CoA. Specifically, Kivd has the function of converting 2-ketoisovaleric acid to isobutyl aldehyde, and PadA has the function of converting isobutyl aldehyde to isobutyric acid. Isobutyric acid is converted to isobutyryl-CoA by the CoA transferase possessed by hydrogen-oxidizing bacteria. BktB is an enzyme that catalyzes the condensation reaction of isobutyryl-CoA and acetyl-CoA and catalyzes the pathway of converting it to 3-oxo-4-methylvaleric acid-CoA. Furthermore, it is an enzyme that catalyzes the condensation reaction of propionyl-CoA and acetyl-CoA and catalyzes the pathway of converting it to 3-oxovaleric acid-CoA. When biosynthesizing, for example, the copolymer P(3HB-co-3H2MB) from isoleucine, BktB catalyzes the dimerization of isobutyryl CoA and acetyl CoA and the pathway of changing to 3-oxo-4-methylvaleric acid-CoA, and catalyzes the dimerization of propionyl CoA and acetyl CoA and the pathway of converting it to 3-oxovaleric acid-CoA. Note that when denoted as "kivd", "padA", or "bktB", it means a gene, and when denoted as "Kivd", "PadA", or "BktB", it means the enzyme encoded by the corresponding gene.

[0030] Kivd is not particularly limited as long as it has the function of converting 2-ketoisovaleric acid to isobutyl aldehyde. The origin of the kivd is not particularly limited, but those derived from prokaryotes are preferred. As an example, 2-ketoacid decarboxylase (GenBank: ADA65057.1) derived from Lactococcus lactis subsp. lactis KF147 can be mentioned. PadA is not particularly limited as long as it has the function of converting isobutyraldehyde into isobutyric acid. Examples include phenylacetaldehyde dehydrogenase (Gene ID: 945933) derived from Escherichia coli str. K-12. Other organisms include those derived from Shigella dysenteriae (WP_000138640.1), Enterobacter cloacae complex (WP_028017554.1), Pluralibacter gergoviae (WP_048284376.1), Buttiauxella agrestis (WP_034495388.1), Klebsiella quasipneumoniae (CEL82223.1), and the like. BktB is not particularly limited as long as it has the function of converting isobutyryl-CoA into 3-oxo-4-methylvalerate-CoA and propionyl-CoA into 3-oxovalerate-CoA. An example is 3-ketothiolase derived from Ralstonia eutropha H16.

[0031] Kivd, PadA, and BktB may be variants thereof. Such variants consist of an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence of each wild-type enzyme, and have the corresponding activity. Specifically, the variant of Kivd has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity or homology to the amino acid sequence of wild-type Kivd, and has 2-ketoacid decarboxylase activity. Variants of PadA have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity or homology to the amino acid sequence of wild-type PadA and have phenylacetaldehyde dehydrogenase activity. Variants of BktB have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity or homology to the amino acid sequence of wild-type BktB and have 3-ketothiolase activity.

[0032] The "identity" of two amino acid sequences refers to the ratio of the same amino acid residues appearing at each corresponding position when the two amino acid sequences are aligned, and the "homology" of two amino acid sequences refers to the ratio of similar amino acid residues appearing at each corresponding position when the two amino acid sequences are aligned. The two amino acid sequences to be compared are appropriately aligned, the same residues existing in each sequence are determined, the number of matching sites is determined, and then the number of matching sites is divided by the total number of residues in the sequence region to be compared, and the resulting value is multiplied by 100. For example, it can be determined using programs such as the BLAST (Basic Local Alignment Search Tool) program (Altschul et al., J. Mol. Biol., (1990), 215(3):403-10).

[0033] Each of the genes kivd, padA, and bktB encodes Kivd, PadA, and BktB, respectively. The DNA encoding each enzyme can be easily obtained by well-known methods such as PCR using genomic DNA or cDNA derived from each microorganism as a template. Each of the genes kivd, padA, and bktB may be a variant thereof. Such a variant consists of a nucleotide sequence in which one or more nucleotides are deleted, substituted, or added in the nucleotide sequence of the wild-type gene.

[0034] Specifically, a variant of the kivd gene has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity or homology to the nucleotide sequence of the gene. A variant of the padA gene has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity or homology to the nucleotide sequence of the gene. A variant of the bktB gene has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity or homology to the nucleotide sequence of the gene.

[0035] The "identity" of two nucleotide sequences refers to the ratio of the same nucleotides appearing at each corresponding position when the two nucleotide sequences are aligned, and the "homology" of two nucleotide sequences refers to the similarity or correlation between the two nucleotide sequences. For example, it can be determined using a BLAST (Basic Local Alignment Search Tool) program (Altschul et al., J. Mol. Biol., (1990), 215(3):403-10), etc.

[0036] The PHA polymerase gene of the present invention may be introduced into the same plasmid vector as the plasmid vector into which the above monomer supply enhancing gene has been introduced, or into a separate plasmid vector. When not using a plasmid vector, the PHA polymerase gene may be introduced onto DNA such as a chromosome, plasmid, or megaplasmid possessed by the hydrogen-oxidizing bacterium that is the host, using known gene recombination techniques. As the former method, specifically, the PHA polymerase gene of the present invention, a known monomer supply gene, and a monomer supply enhancing gene are inserted into a broad-host-range vector for expressing the target gene in hydrogen-oxidizing bacteria to obtain a plasmid, and the plasmid vector is introduced into hydrogen-oxidizing bacteria. Note that the hydrogen-oxidizing bacterium into which the above monomer supply enhancing gene has been introduced may be referred to as "recombinant hydrogen-oxidizing bacterium", "recombinant bacterium", or "recombinant".

[0037] As the broad-host-range vector for expressing the target gene in the host, a known vector having a promoter, ribosome binding site, gene cloning site, terminator, etc. can be used.

[0038] Examples of known monomer supply genes include the β-ketothiolase gene (phbA, phaA) derived from Ralstonia eutropha, the acetoacetyl-CoA reductase gene (phbB, phaB) (Peoples, O. P. and Sinskey, A. J., J. Biol. Chem. 264:15293-15297 (1989)), the R-hydratase gene (phaJ) derived from Aeromonas caviae (Fukui, T. and Doi, Y., J. Bacteriol. 179:4821-4830 (1997)), the propionate CoA transferase gene (pct) derived from Ralstonia eutropha Re)(H16_A2718), acyl-CoA dehydrogenase (acaD) derived from Ralstonia eutropha (H16_B1192), 3-hydroxybutyryl-CoA dehydratase (crt) derived from Ralstonia eutropha (H16_B1189), enoyl-CoA hydratase derived from Ralstonia eutropha (H16_A3307), and the like.

[0039] Examples of the PHA polymerase gene include those derived from microorganisms selected from Pseudomonas sp. strain 61-3, Pseudomonas stutzeri, Pseudomonas sp. A33, Allochromatium vinosum, Bacillus megaterium, Bacillus cereus, Bacillus sp. INT005, Lamprocystis roseopersicina, Nocardia corallina, Rhodobactor shaeroides, Ralstonia eutropha, Rhodococcus sp. NCIMB 40126, Thiocapsa pfennigii, Aeromonas caviae, and Aeromonas hydrophila. In addition, examples of the PHA polymerase gene also include those derived from microorganisms selected from Ferrimonas marina, Plesiomonas shigelloides, Shewanella pealeana, and Vibrio metschnikovii (PCT / JP2023 / 037027).

[0040] In addition, as the PHA polymerase gene, a gene encoding a mutant of the above-mentioned PHA polymerase may also be used. Such a mutant consists of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the wild-type PHA polymerase, and is a protein having PHA polymerization activity. By using such a mutant, the production amount of the PHA polymer increases. For example, as the PHA polymerase mutant used in the present invention, mutants including substitution of the 149th asparagine from the N-terminus of the PHA polymerase derived from a microorganism with serine, and / or substitution of the 171st aspartic acid of PhaC with glycine can be mentioned (Tsuge T, et al., FEMS Microbial Lett 277(2007)217-222).

[0041] Furthermore, a gene encoding a protein called phasin (hereinafter, appropriately referred to as "PhaP") is introduced upstream of the PHA polymerase gene (see, for example, JP-A-2013-42697). PhaP is known to co-localize with PHA granules inside bacteria and is considered to be involved in the formation and stabilization of PHA granules. The microorganism from which PhaP is derived is, for example, a microorganism belonging to the genus Aeromonas, and specifically, Aeromonas caviae can be mentioned.

[0042] As PhaP, mutants having an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid region from the N-terminus to the 20th amino acid are also preferably used. For example, a mutant in which the 4th aspartic acid from the N-terminus of PhaP is substituted with asparagine can be mentioned (see, for example, JP-A-2013-42697). The mutant of PhaP also improves the productivity of PHA in the same manner.

[0043] Mutants including all of the above-mentioned substitution of the 149th amino acid of PhaC, substitution of the 171st amino acid of the enzyme, and substitution of the 4th amino acid of phasin are also preferred. Hereinafter, a mutant in which the 4th aspartic acid of PhaP is substituted with asparagine is referred to as "PhaP AcThe double mutant in which the 149th asparagine of PhaC is replaced by serine and the 171st aspartic acid of PhaC is replaced by glycine is designated as "PhaC Ac NSDG". PhaP Ac The production method of D4N is disclosed, for example, in JP-A-2013-42697, and the production method of PhC Ac The production method of NSDG is described in detail, for example, in Tsuge T, et al., FEMS Microbial Lett 277(2007)217-222.

[0044] As the carbon source, for example, saccharides, carbon dioxide, carboxylic acids, oils and fats, etc. can be used. Among them, sugar is preferable because the growth inhibitory effect on the cells is weak. Also, carbon dioxide is preferable because of its low environmental impact. Examples of saccharides include glucose, fructose, galactose, xylose, arabinose, sucrose, maltose, starch, starch hydrolysate, etc. Examples of carboxylic acids include acetic acid, lactic acid, etc. Among them, fructose is preferable because specific hydrogen-oxidizing bacteria selectively assimilate fructose. As the oils and fats, vegetable oils are preferable, for example, soybean oil, corn oil, cottonseed oil, peanut oil, coconut oil, palm oil, palm kernel oil, or their fractionated oils, for example, palm W olein oil (low-boiling fraction obtained by solvent-free fractionation of palm oil twice), palm kernel olein (low-boiling fraction obtained by solvent-free fractionation of palm kernel oil once), or synthetic oils obtained by chemically or biochemically treating these oils and fats and their fractions, or mixed oils thereof.

[0045] In the production method of the present invention, although the use of a precursor is not basically required, in order to promote the biosynthesis of the copolymerized PHA, in step (ii), it is preferable to further add a precursor of a monomer component having a methyl group at the α-position. Examples of the precursor include relatively inexpensive methacrylic acid. Methacrylic acid is converted to 3H2MP via methacrylyl-CoA. Also, as the precursor, relatively inexpensive branched amino acids such as valine and isoleucine can also be preferably used. When the recombinant hydrogen-oxidizing bacterium obtained in step (i) of the production method of the present invention is a valine overproducing strain or an isoleucine overproducing strain, generally, it is not necessary to add branched amino acids to the medium. However, when the recombinant hydrogen-oxidizing bacterium is not a valine overproducing strain or an isoleucine overproducing strain, it is preferable to further add valine and isoleucine to the medium in addition to the carbon source.

[0046] In the method of the present invention, the recombinant hydrogen-oxidizing bacterium (Ralstonia eutropha 1F2) specifically used to synthesize PHA containing 3H2MP is a valine overproducing strain. In this case, the addition of valine is unnecessary (Figure 1). On the other hand, in the method of the present invention, since the recombinant hydrogen-oxidizing bacterium (Ralstonia eutropha 1F2) specifically used to synthesize PHA containing 3H2MB is not an isoleucine overproducing strain, it is preferable to add isoleucine to the medium (Figure 2). Thereby, an excessive amount of isoleucine can be accumulated in the cells. The addition amount of isoleucine relative to the addition amount of sugar is not particularly limited. However, if the addition amount of isoleucine is greatly excessive relative to the addition amount of sugar, the biosynthesis from sugar to pyruvic acid will be inhibited, which is not preferable. The addition amount of isoleucine relative to the addition amount of sugar is preferably about 0.1 to about 10 (w / w%), more preferably about 0.2 to about 5 (w / w%), and still more preferably about 0.5 to about 2 (w / w%).

[0047] When using carbon dioxide, enriched air with carbon dioxide can be exemplified. In the present invention, since hydrogen-oxidizing bacteria are used as host microorganisms, a mixed gas containing hydrogen (H2), oxygen (O2), and carbon dioxide (CO2) can be used. Furthermore, the mixed gas may contain other components such as ammonia, nitrogen, hydrocarbons, carbon monoxide, formaldehyde, water vapor, etc. The proportion of carbon dioxide in the mixed gas is, for example, 1 to 20% (v / v), preferably 1 to 15% (v / v), more preferably 3 to 15% (v / v). When synthesizing PHA containing 3H2MB in the presence of carbon dioxide, as described above, it is preferable to further add isoleucine to the medium. The addition amount of isoleucine with respect to carbon dioxide is preferably about 0.1 to about 10 (g / L), more preferably about 0.1 to about 5 (g / L), still more preferably about 0.1 to about 1 (g / L).

[0048] The culture temperature is a temperature at which the bacteria can grow, preferably 15 to 40 °C, particularly preferably 20 to 40 °C, still more preferably 28 to 34 °C. The culture time is not particularly limited, but in batch culture, for example, 1 to 7 days is preferable, and continuous culture is also possible. The culture medium is not particularly limited as long as it can be utilized by the host of the present invention. A medium containing a nitrogen source, inorganic salts, other organic nutrient sources, etc. in addition to a carbon source can be used. Examples of the nitrogen source include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate, diammonium hydrogen phosphate, etc., peptone, meat extract, yeast extract, etc. Examples of the inorganic salts include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium hydrogen phosphate, magnesium sulfate, sodium chloride, etc. Examples of other organic nutrient sources include amino acids such as glycine, alanine, serine, threonine, proline, etc.; vitamins such as vitamin B1, vitamin B12, biotin, nicotinamide, pantothenic acid, vitamin C, etc.

[0049] The recovery of the PHA of the present invention from the bacterial cells can be carried out, for example, by the following method. After completion of the culture, the bacterial cells are separated from the culture broth using a centrifuge or the like, and the bacterial cells are washed with distilled water, methanol or the like and then dried. Then, from the dried bacterial cells, the copolymer is extracted using an organic solvent such as chloroform. Next, the bacterial cell components are removed from the organic solvent solution containing the copolymer by filtration or the like, and a poor solvent such as methanol or hexane is added to the filtrate to precipitate the copolymer. The supernatant can be removed from the precipitated copolymer by filtration or centrifugation and dried to recover the copolymer. As another means, the recovery of the copolymer PHA from the bacterial cells can also be carried out by the following method. The bacterial cells containing the copolymer PHA are dispersed in an aqueous solvent containing a surfactant or the like, and the bacterial cells are disrupted using an ultrasonic disrupter or a high-pressure homogenizer. Then, the insoluble components are recovered by filtration or centrifugation. The recovered insoluble components are washed with an appropriate solvent such as water and dried to recover the copolymer PHA. The analysis of the obtained copolymer can be carried out, for example, by gas chromatography, nuclear magnetic resonance method or the like.

[0050] In the copolymer PHA of the present invention, the introduction fraction of the monomer component having a methyl group at the α-position in the copolymer PHA is at least 1.5 times higher than the introduction fraction of the monomer component in the copolymer PHA produced by a hydrogen-oxidizing bacterium having no three monomer supply-enhancing genes, and in some cases, several times to about 10 times higher depending on the type of the monomer component. Therefore, high flexibility can be expected. This indicates that a copolymer PHA having high flexibility can be biosynthesized in the presence of an inexpensive carbon source even in the absence of a precursor. Flexible physical properties are a great advantage during processing as a plastic material. Therefore, the copolymer PHA of the present invention can be used for applications such as films, sheets, containers, bottles, packaging materials and the like.

[0051] The second embodiment of the present invention relates to a copolymer PHA containing a 3H2MP monomer component having a weight average molecular weight (Mw) of 1 million or more. Specifically, the Mw of the copolymerized PHA ranges from about 1 million to about 3.5 million, and the polydispersity (Mw / Mn) of PHA is 1.5 to 4.0. The polydispersity of a polymer is an important factor in determining the suitability of the polymer for specific applications such as biodegradable plastic materials. From the perspective of strength, polymers with generally high molecular weight and low PDI are desirable. Depending on the type of PHA polymerase introduced into the recombinant hydrogen-oxidizing bacteria, it is also possible to produce copolymerized PHA having a molecular weight exceeding 3.5 million.

[0052] A third embodiment of the present invention relates to a gene-deficient hydrogen-oxidizing bacterium having the ability to produce copolymerized PHA, in which the hbdH gene is deleted, and the copolymerized PHA contains a monomer component having a methyl group at the α-position. In the present invention, "having the ability to produce copolymerized PHA" means that the recombinant hydrogen-oxidizing bacterium only needs to have the ability to produce copolymerized PHA containing a monomer component having a methyl group at the α-position, and the ability to produce copolymerized PHA may be inherent in the hydrogen-oxidizing bacterium itself or may be imparted to the hydrogen-oxidizing bacterium. Even if the hydrogen-oxidizing bacterium itself has the ability to produce the copolymerized PHA, when the biosynthetic ability of the copolymer is low or the control ability of the composition of the copolymer is low, the ability to produce the copolymerized PHA may be imparted from the outside. Specific examples of the hydrogen-oxidizing bacterium having the ability to produce copolymerized PHA include those belonging to the genus Ralstonia, the genus Cupriavidus, etc. In the gene-deficient hydrogen-oxidizing bacterium of the present invention, the introduction fraction of the monomer component having a methyl group at the α-position in the copolymerized PHA is at least 1.5 times higher than the introduction fraction of the monomer component in the copolymerized PHA produced by a hydrogen-oxidizing bacterium having no three monomer supply enhancing genes, and depending on the type of the monomer component, it is enhanced by several times to about 10 times. Moreover, when the gene-deficient hydrogen-oxidizing bacterium of the present invention is used, a high molecular weight copolymerized PHA can be obtained. Specifically, the Mw of the copolymerized PHA ranges from about 1 million to about 3.5 million.

[0053] Note that the definition of the "monomer component having a methyl group at the α-position" is as described in the first embodiment of the present invention. Also, the kivd gene, padA gene, bktB gene, and the method for producing a gene-deficient hydrogen-oxidizing bacterium are as described in the first embodiment.

[0054] Next, the present invention will be described in detail with reference to examples, but the present invention is not limited to these examples at all.

Examples

[0055] Example 1 Construction of plasmid (1) Construction of plasmid pk18-d-hbdH In order to delete the hbdH gene (H16_B1190) on the genome of hydrogen-oxidizing bacterium R. eutropha H16, plasmid pk18-d-hbdH was constructed. First, genomic DNA of R. eutropha H16 was extracted using Wizard Genomic DNA Purification Kit (manufactured by Promega). Using the extracted genomic DNA as a template, PCR amplification was performed using forward primer A, reverse primer B, forward primer C, and reverse primer D to obtain DNA fragments of 1 kb upstream and downstream of the hbdH gene. Next, using the obtained DNA fragments as a template, overlap PCR was performed using forward primer A and reverse primer D. The obtained 2-kb DNA fragment (SEQ ID NO: 5) was digested with restriction enzymes SphI and EcoRI and inserted into the SphI and EcoRI sites of pK18mobsacB (DOI: 10.1016 / 0378-1119(94)90324-7) to construct plasmid pk18-d-hbdH.

[0056] Forward primer A: 5’-TTCgaattcCCTTGGGGCCGGCGCCGCGCAGCAC-3’ (SEQ ID NO: 1) Reverse primer B: 5’-AGGAGACCCCATGATCGAGTTCGCCCTGCACGGCCACGTCG-3’ (SEQ ID NO: 2) Forward primer C: 5’-ACTCGATCATGGGGTCTCCTTCCGTGTCGTTCTTGAATGC-3’ (SEQ ID NO: 3) Reverse primer D: 5’-GACgcatgcGACCCGCTGTCCACCGTGGAGCTGG-3’ (SEQ ID NO: 4)

[0057] Base sequence of the 2 kb DNA fragment obtained by overlap PCR (SEQ ID NO: 5)

[0058] (2) Plasmid MCS-3_P tac Construction of -bktb-kivd-padA First, for the kivd gene, the kivd gene derived from Lactobacillus lactis KF147 (GenBank: ADA65057.1) was used, and for the padA gene, the padA gene derived from Escherichia coli K-12 strain (Gene ID: 945933) was used. In both cases, the codons were optimized for E. coli and chemically synthesized products were obtained from Eurofins Genomics Co., Ltd. The nucleotide sequences are shown.

[0059] Nucleotide sequence of the kivd gene (SEQ ID NO: 6)

[0060] Base sequence of padA gene (SEQ ID NO: 7)

[0061] The bktB gene was obtained from Ralstonia eutropha H16 (Kyoto Encyclopedia of Genes and Genomes: KEGG) (https: / / www.genome.jp / kegg / catalog / org_list.html).

[0062] The nucleotide sequence of the bktB gene (SEQ ID NO: 8)

[0063] Next, using the kivd and padA genes as DNA templates, PCR amplification was performed using Primer 1 to 4 (in order, forward primer 1, reverse primer 2, forward primer 3, reverse primer 4). Forward primer 1: 5’-TCTGAGGTTAGCCTTGGTACCgaaggagatataca-3’ (SEQ ID NO: 9) Reverse primer 2: 5’-tgtatatctccttcctcgagtcaggatttgttct-3’ (SEQ ID NO: 10) Forward primer 3: 5’-agaacaaatcctgactcgaggaaggagatataca-3’ (SEQ ID NO: 11) Reverse primer 4: 5’-AAAGGGAACAAAAGCTGGGTACCtcaatagcgtac-3’ (SEQ ID NO: 12)

[0064] Next, using the obtained PCR product as a DNA template, overlap PCR was performed using forward primer 1 and reverse primer 4 to obtain a kivd-padA DNA fragment (3.2 kb). Subsequently, the kivd-padA DNA fragment was digested with the restriction enzyme KpnI, and PBBR1”C1 Ps AB Re _P tac The plasmid pBBR1”C1 inserted into the KpnI site of bktB (Miyahara Y, Yamamoto M, Thorbecke R, Mizuno S, Tsuge T (2020), Biotechnol. Lett., 42, 1655-1662) Ps AB Re _P tac bktB-kivd-padA (14.5 kb) (Figure 2) was constructed.

[0065] Then, pBBR1”C1 Ps AB Re _P tacbktB-kivd-padA was used as a DNA template, and PCR amplification was performed using Primers 5 to 8 (forward primer 5, reverse primer 6, forward primer 7, reverse primer 8 in order). Forward primer 5: 5’-aaagggaacaaaagctgggtacctcaatagcgtac-3’ (SEQ ID NO: 13) Reverse primer 6: 5’-ttcgagcgtatctgaggttagccttgaaggagata-3’ (SEQ ID NO: 14) Forward primer 7: 5’-atgtatatctccttcaaggctaacctcagatacgc-3’ (SEQ ID NO: 15) Reverse primer 8: 5’-ggccgctctagaactagtggatcccccgggctg-3’ (SEQ ID NO: 16)

[0066] As a result, gene fragments of the tac promoter (P tac ), bktB, kivd, and padA were obtained. Next, the broad-host-range vector pBBR1MCS-3 (Kovach ME, Elzer PH, Hill DS et al., Gene 1995; 166: 175-6. DOI: 10.1016 / 0378-1119(95)00584-1) (5.2 kbp) was digested with the restriction enzymes KpnI and SpeI. Using the Takara In-Fusion (registered trademark) HD Cloning Kit (manufactured by Takara Bio Inc.), the gene fragments of P tac , bktB, kivd, and padA were inserted into pBBR1MCS-3. As a result, plasmid MCS-3_P tac -bktb-kivd-padA (9.8 kbp) (Figure 3) was obtained.

[0067] (3) Construction of plasmid MCS-3_P tac -bktb The plasmid MCS-3_P tac-bktb-kivd-padA was digested with the restriction enzyme KpnI, blunt-ended using T4 DNA polymerase, and then self-ligated to obtain plasmid MCS-3_P tac -bktb was obtained.

[0068] (4) Plasmid pJRD215_P Ac Construction of NSDG pBBREE”P Ac The NSDG vector (7.5 kb) (Watanabe Y, Ichinomiya Y, Shimada D, Saika A, Abe H, Taguchi S, Tsuge T, J. Biosci. Bioeng., 2012, 113:286-292, DOI: 10.1016 / j.jbiosc.2011.10.015) and the pJRD215 vector (Davison J, Heusterspreute M, Chevalier N, Ha-Thi V, Brunel F, Gene, 1987, 51, 275-280) were digested with the restriction enzymes EcoRI and BamHI, and the pha promoter of Aeromonas caviae FA440 strain and the phaCNSDG gene of Aeromonas caviae FA440 strain were inserted into the EcoRI and BamHI sites of the pJRD215 vector. Thereby, pJRD215_P Ac NSDG (12.1 kbp) was obtained. Note that phaCNSDG is a double mutant of the PHA polymerase in which the 149th asparagine of PhaC is substituted with serine and the 171st aspartic acid of PhaC is substituted with glycine, and its production method is described in detail in, for example, Tsuge T, et al., FEMS Microbial Lett 277(2007)217-222.

[0069] Example 2 Construction of hbdH gene-deficient strain To disrupt the hbdH gene of Ralstonia eutropha 1F2 (Journal of Biotechnology, vol. 197, No. 8, 2015; doi:10.1128 / JB.02474-14), homologous recombination was performed using the plasmid pk18-d-hbdH obtained in Example 1(1). First, the plasmid pk18-d-hbdH was introduced into Escherichia coli S17-1 strain by electroporation to transform the Escherichia coli S17-1 strain. This transformant was inoculated into an LB medium (5.0 g / L yeast extract, 10 g / L bacto-tryptone, 10 g / L NaCl) containing 50 μg / mL kanamycin and cultured with shaking overnight at 37°C. On the other hand, the Ralstonia eutropha 1F2 strain was inoculated into an NR medium (2.0 g / L yeast extract, 10 g / L bacto-tryptone, 10 g / L skipjack extract) and cultured with shaking overnight at 30°C. Next, 2 mL of the culture solution was collected from each of the above culture solutions and centrifuged at 10,000×g for 2 minutes to prepare cell pellets. The cell pellets were washed three times with 1 mL of NR medium to remove the antibiotics contained in the medium. The washed cell pellets were suspended in 50 μL of NR medium to prepare a cell suspension in which the two types of cells were mixed. 100 μL of the cell suspension was dropped onto an NR agar medium and incubated at 30°C for 24 hours to perform conjugation transfer. Subsequently, the cells after culture were suspended in physiological saline and inoculated into a Simmons citrate agar medium (2 g / L trisodium citrate dihydrate, 5.0 g / L NaCl, 1.0 g / L KH2PO4, 1.0 g / L NH4H2PO4, 0.2 g / L MgSO4·7H2O) containing 200 μg / mL kanamycin and 10 μg / mL gentamicin, and cultured at 30°C for 2 days. The formed colonies were inoculated into an NR medium (2 mL) containing 200 μg / mL kanamycin and cultured overnight at 30°C. The culture solution was suspended in physiological saline to prepare a dilution solution, which was inoculated into an MSY medium (a medium obtained by adding 1.0 g / L yeast extract to an MS medium) containing 150 g / L sucrose and cultured at 30°C for 2 days.

[0070] The formed colonies were collected, and colony PCR was performed using the following primers to confirm the construction of the Ralstonia eutropha hbdH gene-deficient strain (1F2ΔhbdH strain). Forward primer: 5’-TCGACACCTACACGCTGCAGCAGC-3’ (SEQ ID NO: 17) Reverse primer: 5’-TCCATCAGCGCCACCAGCGGCTTGG-3’ (SEQ ID NO: 18)

[0071] Example 3 Production of PHA Using Fructose as a Carbon Source (1) Preparation of Recombinant Using Plasmid The PHA polymerization plasmid pJRD215_P Ac -NSDG, and pBBR1MCS-3 constructed in Example 1(4) were introduced into the 1F2ΔhbdH strain prepared in Example 2 using the electroporation method (applied voltage 1.5 kV) to transform the 1F2ΔhbdH strain to obtain recombinant a with pJRD215_P Ac -NSDG, and MCS-3_P tac -bktB prepared in Example 1(3) were introduced into the 1F2ΔhbdH strain prepared in Example 2 using the electroporation method to transform the 1F2ΔhbdH strain to obtain recombinant b with pJRD215_P Ac -NSDG, and MCS-3_P tac -bktB-kivd-padA prepared in Example 1(2) were introduced into the 1F2ΔhbdH strain prepared in Example 2 using the electroporation method to transform the 1F2ΔhbdH strain to obtain recombinant c, respectively. Also, the PHA polymerization plasmid pJRD215_P Ac -NSDG was introduced into the 1F2ΔhbdH strain prepared in Example 2 using the electroporation method under the same conditions to transform the 1F2ΔhbdH strain to obtain recombinant f. Furthermore, as a comparative experiment, pJRD215_P Ac -NSDG and pBBR1MCS-3 were introduced into the Ralstonia eutropha 1F2 strain to transform the 1F2 strain to obtain recombinant d, and pJRD215_P Ac -NSDG and MCS-3_P tac -bktB were introduced into the 1F2 strain to transform the 1F2 strain to obtain recombinant e, respectively.

[0072] (2) Synthesis and analysis of PHA (1) Each of the recombinants a to e prepared in (1) was inoculated into 2 mL of NR medium (2.0 g / L yeast extract, 10 g / L bactotryptone, 10 g / L skipjack extract), and cultured with shaking overnight at 30 °C to obtain a preculture solution. Next, 1 mL of the preculture solution was inoculated into 100 mL of MS medium (9.0 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 0.5 g / L NH4Cl, 0.2 g / L MgSO4·7H2O, 1 mL trace elements solution) containing 10 g / L fructose, and cultured with shaking at 30 °C for 72 hours. The "trace elements solution" contains 0.218 g / L CoCl2·6H2O, 20.5 g / L FeCl3·6H2O, 7.8 g / L CaCl2, 0.118 g / L NiCl2·6H2O, 0.105 g / L CrCl3·6H2O, and 0.156 g / L CuSO4·5H2O in 0.1 N HCl. In all cultures, 100 μg / mL kanamycin and 10 μg / mL tetracycline were added for culturing to maintain the plasmid intracellularly.

[0073] After the culture was completed, the culture solution was transferred to a centrifuge tube and centrifuged at 5000×g for 10 minutes to collect the cells. Next, the cell pellet was suspended in 50 mL of pure water and centrifuged again. This operation was performed twice to remove the remaining medium components and metabolites contained in the culture supernatant. The obtained cell pellet was dried using a freeze dryer to obtain a dried cell powder. The obtained dried cells were suspended in 15 mL of a 4% aqueous sodium dodecyl sulfate solution and subjected to ultrasonic disruption at 12 W for 10 minutes to extract the PHA accumulated intracellularly. The synthesized PHA was 1 subjected to 1H NMR (BioSpin Avance III 400A (Bruker) and BioSpin Avance III HD 500) analysis to determine the monomer composition. The results are shown in Table 1.

[0074] Example 4 Production of PHA Using Carbon Dioxide as a Carbon Source Each of the recombinants a and b prepared in Example 3(1) was inoculated into 2 mL of NR medium and cultured with shaking overnight at 30 °C to obtain a preculture solution. Next, 1 mL of the preculture solution was inoculated into a 250 mL jar fermenter (ABLE Corporation) containing 100 mL of MS medium, and a mixed gas (H2:O2:CO2:N2 = 3.8:7.3:13.0:75.9 (v / v%)) was supplied at a flow rate of 5 mL / min, and the culture was carried out at a stirring speed of 1200 rpm and a culture temperature of 30 °C for 162 hours. To prevent foaming of the culture solution, 0.01 wt% of Antifoam 204 (manufactured by Sigma) was added to the medium. In all cultures, 100 μg / mL of kanamycin and 10 μg / mL of tetracycline were added to maintain the plasmid intracellularly and the cultures were carried out.

[0075] In the same manner as in Example 3, collection of bacteria and preparation of dried bacterial cells were carried out. The monomer composition of PHA was determined by gas chromatography (GC) using a Shimadzu GC-2014s apparatus (Shimadzu, Kyoto, Japan) equipped with a flame ionization detector. The preparation of the GC sample was carried out as follows. 20 mg of dried bacterial cells were weighed into a screw-cap test tube, 2 mL of sulfuric acid methanol (sulfuric acid 15 v / v%) and 2 mL of chloroform were added, and a methyl esterification reaction was carried out at 100 °C for 140 minutes. After completion of the reaction, 1 mL of ultrapure water was added and stirred vigorously, and the chloroform layer was recovered. To the recovered solution, an equal volume of chloroform solution containing 0.1 (w / v%) methyl-n-octane as an internal standard was added to prepare a final sample for GC analysis. The sample was injected through a GC capillary column InertCap 1 (30 m × 0.25 mm, GL Science). The column temperature was first held at 90 °C for 2 minutes, then raised to 110 °C at a rate of 5 °C / min, and then further raised to 280 °C at a rate of 20 °C / min. The monomer composition was calculated from the obtained signal peak areas. The results are shown in Table 1.

[0076]

Table 1

[0077] From Table 1, it was found that the hbdH gene-deficient strain gave a copolymerized PHA containing 3H2MP in the presence of fructose. Also, it was revealed that the introduction of the bktB, kivd, and padA genes enhanced the introduction fraction of 3H2MP. Furthermore, it was found that even when carbon dioxide was used as the carbon source, a copolymerized PHA containing 3H2MP was obtained.

[0078] The PHA obtained in the experiment of Entry B described in Table 1 was methyl-esterified to prepare a GC sample. The prepared sample was analyzed with a gas chromatograph mass spectrometer (GC-MS) equipped with a chiral column under the following conditions to evaluate the chirality of the monomer component 3H2MP that constitutes the PHA (Figure 3). · Equipment Gas chromatograph: GC-2010 (Shimadzu Corporation) Gas chromatograph mass spectrometer: GCMC-QC2010 (Shimadzu Corporation) Chiral column: Beta DEX (trademark) 120 (Sigma-Aldrich) Detector: Mass spectrometer (MS) Ionization source: Electron impact ionization method (EI) Analysis software: GC MS Solution (Shimadzu Corporation) · Measurement conditions Perfluorotributylamine was used for mass number calibration of MS. Helium was used as the carrier gas, and the inlet pressure was 120 kPa. After injecting 1 μL of the sample, the column temperature was held at 85°C for 15 minutes, and then it was heated to 280°C at a rate of 5°C / min. When the column temperature reached 280°C, it was held for 5 minutes. Temperature conditions for the analysis lines of each device GC: Sample vaporization temperature 280°C; Injection mode Split, GC-MS: Ion source temperature 230°C; Interface temperature 250°C.

[0079] As shown in Figure 3, it was found that the chirality of the monomer component 3H2MP in the PHA obtained by the production method of the present invention is 2S. The production method of the present invention capable of selectively producing the 2S form indicates that it is effective for the production of a copolymerized PHA containing 3H2MP having high crystallinity.

[0080] Example 5 Production of PHA Using Fructose and Isoleucine as Carbon Sources Using the recombinant f prepared in Example 3(1) and using fructose and isoleucine as carbon sources, and culturing was carried out in the same manner as in Example 3 except that the antibiotic used to maintain the plasmid intracellularly was only 100 μg / mL of kanamycin. 10 g / L of fructose and 10 g / L of isoleucine were added to the MS medium, and shaking culture was carried out at 30 °C for 72 hours. The synthesized PHA was 1 subjected to 1H NMR (BioSpin Avance III 400A (Bruker) and BioSpin Avance III HD 500) analysis to determine the monomer composition. The results are shown in Table 2.

[0081] [Table 2]

[0082] From Table 2, it became clear that the hbdH gene-deficient strain gives a copolymerized PHA containing 3H2MP and / or 3H2MB, particularly a copolymerized PHA in which the introduction fraction of 3H2MB is enhanced.

[0083] Example 6 Preparation of 1F2ΔphaC1::phaCNSDG Strain by Gene Introduction into the Genome (1) Construction of Plasmid pk18-phaCNSDG In order to insert the phaCNSDG gene represented by SEQ ID NO: 19 into the 1F2ΔphaC1 strain (PHA polymerization ability-deficient strain), the plasmid pk18-phaCNSDG was constructed. The plasmid pJRD215_P prepared in (3) of Example 1 AcUsing NSDG as a template, PCR amplification was performed using Primer 1 and Primer 2 (SEQ ID NOs: 20 and 21 in order), and a phaCNSDG gene fragment (1.8 kb) was amplified. Next, using the genomic DNA of Ralstonia eutropha H16 as a template, DNA fragments of approximately 0.8 - 1 kb upstream and downstream of the phaC1 gene on the genome were obtained using Primers 3 - 6 (SEQ ID NOs: 22, 23, 24, 25 in order). Next, overlap PCR was performed using the obtained DNA fragments as templates. As a result, a fragment (3.6 kb) (SEQ ID NO: 26) was obtained by connecting the gene fragments upstream and downstream of the phaC1 gene of Ralstonia eutropha H16 and the phaCNSDG gene fragment. The obtained DNA fragment was inserted into the SphI and EcoRI sites of pK18mobsacB (DOI: 10.1016 / 0378-1119(94)90324-7) to construct plasmid pk18-phaCNSDG.

[0084] The nucleotide sequence of the phaCNSDG gene (SEQ ID NO: 19)

[0085] Forward primer 1: 5’-AGAGACAATCAAATCATGAGCCAACCATCTTATGG-3’ (SEQ ID NO: 20) Reverse primer 2: 5’-GCACTCATGCAAGCGTCATGCGGCGTCCTCCTCTG-3’ (SEQ ID NO: 21) Forward primer 3: 5’-aaaGAATTCCGGGCAAGTACCTTGCCGACAT-3’ (SEQ ID NO: 22) Reverse primer 4: 5’-GTTGGCTCATGATTTGATTGTCTCTCTGCCGTCAC-3’ (SEQ ID NO: 23) Forward primer 5: 5’-CGCCGCATGACGCTTGCATGAGTGCCGGCGTGCGT-3’ (SEQ ID NO: 24) Reverse primer 6: 5’-aaaGCATGCACTCGGCGCGCGACAGGGCGCGCTTG-3’ (SEQ ID NO: 25)

[0086] Base sequence of the 3.6 kb DNA fragment obtained by overlap PCR (SEQ ID NO: 26)

[0087] (2) Construction of the 1F2ΔphaC1::phaCNSDG strain To replace the phaC1 gene of Ralstonia eutropha H16 strain with the phaCNSDG gene represented by SEQ ID NO: 19, homologous recombination was performed using plasmid pk18-phaCNSDG. First, plasmid pk18-phaCNSDG was introduced into Escherichia coli S17-1 strain by heat shock method to transform Escherichia coli S17-1 strain. This transformant was inoculated into LB medium (5.0 g / L yeast extract, 10 g / L bactotryptone, 10 g / L NaCl) containing 50 μg / mL kanamycin and cultured with shaking overnight at 37°C. On the other hand, Ralstonia eutropha H16 strain was inoculated into NR medium (2.0 g / L yeast extract, 10 g / L bactotryptone, 10 g / L skipjack extract) and cultured with shaking overnight at 30°C. Next, 2 mL of the culture solution of the transformant of Escherichia coli S17-1 strain and the culture solution of Ralstonia eutropha H16 strain were each collected, centrifuged at 10000×g for 2 minutes to prepare cell pellets. The cell pellets were washed 3 times with 1 mL of NR medium to remove the antibiotics contained in the medium. The washed cell pellets were suspended in 50 μL of NR medium to prepare a cell suspension mixture of the two types of cells. 100 μL of the cell suspension was dropped onto NR agar medium and incubated at 30°C for 24 hours to perform conjugation transfer.

[0088] Subsequently, the cultured cells were suspended in physiological saline and inoculated onto Simmons citrate agar medium (2 g / L trisodium citrate dihydrate, 5.0 g / L NaCl, 1.0 g / L KH2PO4, 1.0 g / L NH4H2PO4, 0.2 g / L MgSO4·7H2O) containing 200 μg / mL kanamycin and 10 μg / mL gentamicin, and cultured at 30 °C for 2 days. The formed colonies were inoculated into 2 mL of NR medium (2.0 g / L yeast extract, 10 g / L bactotryptone, 10 g / L dried bonito extract) containing 200 μg / mL kanamycin and cultured overnight at 30 °C. The culture solution was suspended in physiological saline to prepare a dilution solution, which was inoculated onto MSY medium (MS medium (refer to Miyahara Y, Wang Chih-Ting, Ishii-Hyakutake M, Tsuge T, Bioengineering 2022, 9(10), 586. DOI: https: / / doi.org / 10.3390 / bioengineering9100586) with 1.0 g / L yeast extract added) containing 150 g / L sucrose, and cultured at 30 °C for 2 days. The formed colonies were collected, and colony PCR was performed using primer 3 (SEQ ID NO: 22) and primer 6 (SEQ ID NO: 25) to confirm the construction of the 1F2ΔphaC1::phaCNSDG strain.

[0089] Example 7 1F2ΔphaC::phaCNSDG by Gene Transfer into the Genome _ Preparation of ΔhbdH Strain An 1F2ΔphaC::phaCNSDG ΔhbdH strain was prepared in the same manner as in Example 6(2), except that the hbdH gene-deficient strain prepared in Example 2 was used. _ The ΔhbdH strain was prepared.

[0090] Example 8 Production of PHA Using Fructose, or Fructose and Methacrylic Acid as Carbon Sources Each recombinant prepared in Examples 6 and 7 was inoculated into 2 mL of NR medium (2.0 g / L yeast extract, 10 g / L bactotryptone, 10 g / L dried bonito extract) and cultured with shaking overnight at 30 °C to obtain a preculture solution. Next, 1 mL of the preculture was inoculated into 100 mL of MS medium (9.0 g / L Na2HPO4·12H2O, 1.5 g / L KH2PO4, 0.5 g / L NH4Cl, 0.2 g / L MgSO4·7H2O, 1 mL trace elements solution) containing 10 g / L of fructose, or 10 g / L of fructose and 1 g / L of sodium methacrylate in terms of methacrylic acid, and cultured with shaking at 30 °C for 72 hours. The trace elements solution contains 0.218 g / L CoCl2·6H2O, 20.5 g / L FeCl3·6H2O, 7.8 g / L CaCl2, 0.118 g / L NiCl2·6H2O, 0.105 g / L CrCl3·6H2O, and 0.156 g / L CuSO4·5H2O in 0.1 N HCl.

[0091] After the culture was completed, the culture solution was transferred to a centrifuge tube and centrifuged at 9000×g for 10 minutes to collect the cells. Next, the cell pellet was suspended in 40 mL of pure water and centrifuged again. This operation was performed twice to remove the remaining medium components and metabolites contained in the culture supernatant. The obtained cell pellet was dried using a freeze dryer to obtain dry cell powder.

[0092] The PHA content and PHA monomer composition were measured by gas chromatography (GC) using a Shimadzu GC-2014s apparatus (Shimadzu, Kyoto, Japan) equipped with a flame ionization detector. The preparation of the GC sample was carried out as follows. 20 mg of dry cells were weighed into a screw-cap test tube, 2 mL of methanol sulfate (15 vol% sulfuric acid) and 2 mL of chloroform were added, and a methyl esterification reaction was carried out at 100 °C for 140 minutes. After the reaction was completed, 1 mL of ultrapure water was added and stirred vigorously, and the chloroform layer was recovered. An equal volume of chloroform solution containing 0.1% (w / v) methyl-n-octane as an internal standard was added to the recovered solution to prepare a final sample for GC analysis. The sample was injected through a GC capillary column InertCap 1 (30 m × 0.25 mm, GL Science). The column temperature was first held at 90 °C for 2 minutes, then raised to 110 °C at a rate of 5 °C / min, and then further raised to 280 °C at a rate of 20 °C / min. The total PHA content and 3HA monomer composition were calculated from the obtained signal peak areas. The results are shown in Table 3.

[0093]

Table 3

[0094] Example 9 Preparation of Recombinant and Production of PHA The recombinants of Entries 5 to 12 in Table 4 were prepared as follows, and the recombinants were cultured in the same manner as in Example 3 to produce PHA. [1] Recombinant of Entry 5 (without monomer supply enhancement gene) Recombinant d prepared in Example 3(1). [2] Recombinant of Entry 6 (monomer supply enhancement gene bktb) Recombinant e prepared in Example 3(1). [3] Recombinant of Entry 7 (monomer supply enhancement genes bktb, kivd, padA) To Ralstonia eutropha 1F2 strain, plasmid pJRD215_P prepared in Example 1(4) was used in the same manner as in Example 3(1). Ac_NSDG and plasmid MCS-3_P prepared in Example 1(2) tac _bktB_kivd_padA was introduced to prepare a recombinant. [4] Recombinant of Entry8 (monomer supply enhancing genes bktB, kivd, padA, pct Re ) (4-1) Construction of plasmid MCS-3_P tac -bktb-kivd-padA-pct Re Construction Plasmid MCS-3_P prepared in Example 1(2) tac -bktB-kivd-padA was used as a template, and inverse PCR was performed using Primer 1 and Primer 2 (SEQ ID NOs: 27 and 28 in sequence) to obtain a 9.8 kb linear DNA. Furthermore, genomic DNA of Ralstonia eutropha H16 strain was used as a template, and PCR was performed using Primer 3 and Primer 4 (SEQ ID NOs: 29 and 30 in sequence) to obtain a pct Re gene fragment (1.6 kb). From the obtained 9.8 kb and 1.6 kb DNA fragments, plasmid MCS-3_P tac -bktb-kivd-padA-pct Re (11.4 kbp) was obtained.

[0095] Forward Primer 1: 5’- AACGTTTTCCTCTCTCTTAAATCAATAGCGTACGC -3’ (SEQ ID NO: 27) Reverse Primer 2: 5’- gcacctgtaacagcttttgttccctttagt -3’ (SEQ ID NO: 28) Forward Primer 3: 5’- acaaaagctgttacaggtgcaggggcccgg -3’ (SEQ ID NO: 29) Reverse Primer 4: 5’- TTTAAGAGAGAGGAAAACGTTatgaaggtgatcac -3’ (SEQ ID NO: 30)

[0096] (4-2) Preparation of recombinant Ralstonia eutropha 1F2 strain was transformed with plasmid pJRD215_P prepared in Example 1(4) in the same manner as in Example 3(1). Ac _NSDG and plasmid MCS-3_P prepared in (4-1). tac -bktb-kivd-padA-pct Re (11.4 kbp) was introduced to prepare a recombinant.

[0097] [5] Recombinant of Entry 9 (monomer supply enhancement genes bktB, kivd, padA, acaD, crt). (5-1) Plasmid MCS-3_P tac Construction of -bktb-kivd-padA-acaD-crt Using the genomic DNA of Ralstonia eutropha H16 strain as a template, the acaD gene (1.1 kb) was PCR amplified using primer 5 and primer 6 (SEQ ID NOs: 31 and 32 in order), and the crt gene (0.8 kb) was PCR amplified using primer 7 and primer 8 (SEQ ID NOs: 33 and 34 in order). The obtained PCR products were inserted into the NdeI, BamHI, and SpeI sites of the pBBREE”P Ac NSDG vector (7.5 kb) (Watanabe Y, Ichinomiya Y, Shimada D, Saika A, Abe H, Taguchi S, Tsuge T, J. Biosci. Bioeng., 2012, 113:286-292, DOI: 10.1016 / j.jbiosc.2011.10.015) to construct plasmid pBBREE”acaD-crt (7.7 kb). Using pBBREE”acaD-crt as a template, a PCR reaction was performed using primer 9 and primer 10 (SEQ ID NOs: 35 and 36 in order) to obtain the acaD-crt gene containing the pha promoter sequence of Aeromonas caviae. Then, MCS-3_P prepared in Example 1(2). tac-bktb-kivd-padA was digested with SpeI, and the vector and insert DNA were blunted using T4 DNA polymerase. A ligation reaction was performed using the resulting DNA fragments to construct plasmid MCS-3_P tac -bktb-kivd-padA-acaD-crt was constructed.

[0098] Forward primer 5: 5’- AAACATATGCACAGCGACTACACCGAAGAGCAAA -3’ (SEQ ID NO: 31) Reverse primer 6: 5’- AAAGGATCCCTACAGGCTGCGCGCGATCAGCA -3’ (SEQ ID NO: 32) Forward primer 7: 5’- aaaGGATCCGTCCGCCGCCGACAAGGAGG -3’ (SEQ ID NO: 33) Reverse primer 8: 5’- AAAACTAGTCTAGGCGTTGCGCCATTGCGGCGTTC -3’ (SEQ ID NO: 34) Forward primer 9: 5’- AAAGGATCCCGATCTGGACCGGGG-3’ (SEQ ID NO: 35) Reverse primer 10: 5’- aaaACTAGTCTAGGCGTTGCGCCATTGC-3’ (SEQ ID NO: 36)

[0099] (5-2) Preparation of recombinants Into Ralstonia eutropha 1F2 strain, in the same manner as in Example 3(1), plasmid pJRD215_P Ac _NSDG, and plasmid MCS-3_P tac -bktb-kivd-padA-acaD-crt prepared in [5-1] were introduced to prepare recombinants.

[0100] [6] Recombinant of Entry 10 (without monomer supply enhancement gene) Recombinant a prepared in Example 3(1)

[0101] [7] Recombinant of Entry 11 (monomer supply enhancement gene bktb) Recombinant b prepared in Example 3(1).

[0102] [8] Recombinant of Entry 12 (monomer supply enhancement genes bktB, kivd, padA, acaD, crt) A recombinant was prepared in the same manner as in [5] above, except that the 1F2 strain was changed to the 1F2ΔhbdH strain.

[0103] Example 10 Examination of the molecular weight of PHA The molecular weights of the copolymerized PHAs prepared in Example 9 were measured by gel permeation chromatography (GPC) using a Shimadzu Nexera GPC system equipped with an RI-504 refractive index detector (Shodex) and two KF-406-LHQ joint columns (40 °C, Shodex) (Table 4). Chloroform was used as the mobile phase solvent at a flow rate of 0.3 mL / min. The sample concentration and injection volume were set to 1 mg / mL and 10 μL, respectively. A polystyrene standard with low polydispersity was also analyzed as a reference standard for constructing the calibration curve (Table 4). Note that a recombinant obtained by introducing a PHA polymerase gene into the Ralstonia eutropha 1F2 strain using a plasmid is designated as "1F2 / pJRD215_P Ac NSDG" (Entry 5 - 9), and a recombinant obtained by introducing a PHA polymerase gene into the Ralstonia eutropha 1F2ΔhbdH strain using a plasmid is designated as "1F2ΔhbdH / pJRD215_P Ac NSDG" (Entry 10 - 12).

[0104]

Table 4

[0105] It can be seen from Table 4 that the high molecular weight of PHA was achieved by using the hbdH gene-deficient strain.

Industrial Applicability

[0106] The production method of the present invention includes a monomer component having a methyl group at the α-position and enables the production of high molecular weight PHA. Such PHA can be used for the industrial production of high-performance biodegradable plastics.

Claims

1. A polyhydroxyalkanoic acid (PHA) containing a monomer component having a methyl group at the α-position and having a weight-average molecular weight (Mw) of 1,000,000 or more, wherein the monomer component having a methyl group at the α-position is 3-hydroxy-2-methylpropionic acid (3H2MP).

2. A gene-deficient hydrogen-oxidizing bacterium having the ability to produce copolymer polyhydroxyalkanoic acid (PHA) with a deleted 3-hydroxyisobutyric acid dehydrogenase (hbdH) gene, wherein the copolymer PHA contains a monomer component having a methyl group at the α-position.

3. A method for producing a polyhydroxyalkanoic acid (PHA) containing a monomer component having a methyl group at the α-position, comprising: (i) a step of preparing a 3-hydroxyisobutyric acid dehydrogenase (hbdH) gene-deficient hydrogen-oxidizing bacterium having a PHA polymerase; (ii) a step of culturing the gene-deficient hydrogen-oxidizing bacterium in the presence of a carbon source; and (iii) a step of collecting PHA containing a monomer component having a methyl group at the α-position from the culture. The production method comprising the above steps.

4. The production method according to claim 3, wherein the step (i) includes a step of introducing a gene encoding a PHA polymerase with broad substrate specificity into the gene-deficient hydrogen-oxidizing bacterium.

5. The production method according to claim 3, wherein the carbon source is sugar and / or carbon dioxide.

6. The production method according to claim 5, wherein the carbon dioxide is a mixed gas containing 1 to 20% (v / v) of carbon dioxide.

7. The production method according to claim 5, wherein the sugar is fructose.

8. The production method according to claim 3, wherein in the step (ii), a precursor of a monomer component having a methyl group at the α-position is further added.

9. The production method according to claim 8, wherein the precursor is methacrylic acid and / or a branched amino acid.

10. The production method according to claim 9, wherein the branched amino acid is valine or isoleucine.

11. The production method according to claim 3, wherein the monomer component having a methyl group at the α-position is 3-hydroxy-2-methylpropionic acid (3H2MP).

12. The production method according to claim 3, wherein the monomer component having a methyl group at the α-position is 3-hydroxy-2-methylbutyric acid (3H2MB).

13. The production method according to claim 12, wherein isoleucine is added in addition to fructose as a carbon source.

14. The production method according to claim 3, wherein the PHA containing a monomer component having a methyl group at the α-position substantially does not contain 3-hydroxyvaleric acid (3HV) as a monomer component.

15. The production method according to claim 3, wherein the step (i) further includes a step of introducing a 2-ketocarboxylic acid decarboxylase (kivd) gene and a phenylacetaldehyde dehydrogenase (padA) gene.

16. The production method according to any one of claims 3 to 15, wherein the step (i) further includes a step of introducing a 3-ketothiolase (bktB) gene.

17. The production method according to claim 3, wherein the hydrogen-oxidizing bacterium is Ralstonia eutropha.

18. The production method according to claim 4, wherein the PHA polymerase gene encodes a PHA polymerase variant in which asparagine at position 149 of the PHA polymerase derived from Aeromonas caviae is substituted with serine and aspartic acid at position 171 is substituted with glycine.

Images