Methods and compositions for producing cells of endodermal lineage and beta cells, and uses thereof

Abstract

To provide pharmaceutical compositions comprising a plurality of insulin-producing beta cells for treating diseases associated with dysfunctional endodermal cells.SOLUTION: Disclosed is a pharmaceutical composition comprising a plurality of insulin-producing beta cells, where insulin-producing beta cells are produced in a suspension by a method comprising the steps of: (c) contacting a plurality of human pluripotent stem cells with (i) a first composition comprising a TGFβ agonist and then with a second composition comprising a TGFβ agonist or an activin agonist for a period of time sufficient to form a plurality of embryonic endoderm cells; (d) contacting the plurality of embryonic endoderm cells with an FGFR2b agonist for a period of time sufficient to form a plurality of primitive intestinal tract cells.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications: This application claims priority from U.S. Provisional Application Serial No. 62 / 672,300, filed May 16, 2018; U.S. Provisional Application Serial No. 62 / 672,695, filed May 17, 2018; U.S. Provisional Application Serial No. 62 / 799,252, filed January 31, 2019; and U.S. Provisional Application Serial No. 62 / 789,724, filed January 8, 2019, which are hereby incorporated by reference in their entirety.

[0002] Statement Regarding Federally Sponsored Research or Development: This invention was made with government support under grant number DK114233 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Materials Incorporated by Reference: The Sequence Listing, which is part of this disclosure, includes a computer - readable form containing the nucleotide and / or amino acid sequences of the invention. The contents of the Sequence Listing are hereby incorporated by reference in their entirety.

Background Art

[0004] This disclosure generally relates to cell therapy and methods of generating beta - like cells.

Disclosure of the Invention

[0005] Among various aspects of this disclosure are provided methods and compositions for generating cells of the endodermal lineage and their use.

[0006] One aspect of the present disclosure provides a method for generating insulin-producing beta cells in suspension, the method comprising: providing stem cells; providing a serum-free medium; contacting the stem cells with a TGFβ / activin agonist or a glycogen synthase kinase 3 (GSK) inhibitor or a WNT agonist for a time sufficient to form definitive endoderm cells; contacting the definitive endoderm cells with an FGFR2b agonist for a time sufficient to form primitive gut tube cells; contacting the primitive gut tube cells with a RAR agonist and optionally a rho kinase inhibitor, a smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, or a BMP type 1 receptor inhibitor for a time sufficient to form early pancreatic progenitor cells; incubating the early pancreatic progenitor cells for at least about 3 days and optionally contacting the early pancreatic progenitor cells with a rho kinase inhibitor, a TGF-β / activin agonist, a smoothened antagonist, an FGFR2b agonist, or a RAR agonist for a time sufficient to form pancreatic progenitor cells; contacting the pancreatic progenitor cells with an Alk5 inhibitor, a gamma secretase inhibitor, SANT1, an Erbb1 (EGFR) or Erbb4 agonist, or a RAR agonist for a time sufficient to form endoderm cells; or changing the size of the cell clusters within about 24 hours and maturing the endoderm cells in a serum-free medium for a time sufficient to form beta cells.

[0007] In some embodiments, the TGFβ / activin agonist is activin A; the glycogen synthase kinase 3 (GSK) inhibitor or WNT agonist is CHIR; the FGFR2b agonist is KGF; the smoothened antagonist is SANT-1; the RAR agonist is retinoic acid (RA); the protein kinase C activator is PdBU; the BMP type 1 receptor inhibitor is LDN; the rho kinase inhibitor is Y27632; the Alk5 inhibitor is Alk5i; or the Erbb4 agonist is betacellulin.

[0008] In some embodiments, the serum-free medium comprises one or more selected from the group consisting of MCDB131, glucose, NaHCO3, BSA, ITS-X, Glutamax, vitamin C, penicillin-streptomycin, CMRL 10666, FBS, heparin, NEAA, trace element A, trace element B, or ZnSO4.

[0009] In some embodiments, the method comprises reducing the size of the endoderm clusters, and the change in the size of the cell clusters comprises dissociating the clusters and re-aggregating them before maturing into beta cells.

[0010] In some embodiments, the pancreatic progenitor cells are not incubated with any one or more of serum, T3, N-acetylcysteine, trolox, and R428.

[0011] In some embodiments, the time sufficient to form embryonic endoderm cells, primitive gut tube cells, early pancreatic progenitor cells, pancreatic progenitor cells, endoderm cells, or beta cells is between about 1 day and about 8 days.

[0012] In some embodiments, the method does not include the use of a TGFβR1 inhibitor (e.g., Alk5 inhibitor II) in the maturation of endoderm cells into beta cells.

[0013] In some embodiments, the absence of the TGFβR1 inhibitor enables TGFβ signaling and promotes the functional maturation of beta cells from endoderm cells.

[0014] In some embodiments, the absence of the TGFβR1 inhibitor enables an increase in insulin secretion from the cells in response to an increase in glucose levels or an increase in secretogogue levels.

[0015] In some embodiments, the method does not include T3, N-acetylcysteine, trolox, or R428 in the maturation of endoderm cells into beta cells.

[0016] In some embodiments, the beta cells are SC-beta cells that express at least one beta cell marker and undergo glucose-stimulated insulin secretion (GSIS) that includes first and second phase dynamic insulin secretion; the beta cells secrete insulin in substantially the same amounts as compared to cadaveric human islets; or the beta cells retain function for one day or more.

[0017] In some embodiments, the stem cells are HUES8 embryonic cells, SEVA 1016, or SEVA1019.

[0018] Another aspect of the disclosure provides a method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of insulin-producing beta cells, wherein the beta cells are generated according to the above.

[0019] Another aspect of the present disclosure provides a method of differentiating stem cells into endoderm lineage cells, the method comprising: providing stem cells; providing a serum-free medium; contacting the stem cells with a TGFβ / activin agonist and a glycogen synthase kinase 3 (GSK) inhibitor or a WNT agonist for a time sufficient to form definitive endoderm cells; contacting the definitive endoderm cells with an FGFR2b agonist for a time sufficient to form primitive gut tube cells; contacting the primitive gut tube cells with an RAR agonist, and optionally a smoothened antagonist / sonic hedgehog inhibitor, an FGF family member / FGFR2b agonist, a protein kinase 3 activator, a BMP inhibitor, or a rho kinase inhibitor, for a time sufficient to optionally form early pancreatic progenitor cells; incubating the early pancreatic progenitor cells for at least about 3 days, and optionally contacting the early pancreatic progenitor cells with a smoothened antagonist, an FGFR2b agonist, an RAR agonist, a rho kinase inhibitor, or a TGF-β / activin agonist for a time sufficient to form pancreatic progenitor cells; contacting the pancreatic progenitor cells with an Alk5 inhibitor / TGF-β receptor inhibitor, a thyroid hormone, and a gamma secretase inhibitor, and optionally a SANT1, Erbb1 (EGFR) or Erbb4 agonist / EGF family member, or an RAR agonist, for a time sufficient to form endoderm cells or endocrine cells; optionally contacting the endoderm cells or endocrine cells with an Alk5 inhibitor / TGF-β receptor inhibitor or a thyroid hormone for a time sufficient to form endoderm lineage cells (e.g., pancreatic cells, hepatocytes, or beta cells / SC-β cells); or plating the cells on a hard or soft substrate or introducing a cytoskeleton modulating agent into the cells at once and for a time sufficient to enhance the differentiation efficiency, wherein the cytoskeleton modulating agent comprises latrunculin A, latrunculin B, nocodazole, cytochalasin D, jasplakinolide, brevystatin, y-27632, y-15, gdc-0994, or an integrin modulating agent.

[0020] Another aspect of the present disclosure provides a method for differentiating stem cells into endoderm lineage cells, the method comprising incubating the stem cells in a medium comprising a TGFβ / activin agonist, activin A, a WNT agonist, and CHIR for about 24 hours, followed by incubating the cells in a medium without CHIR and with activin A for about 3 days to generate stage 1 definitive endoderm cells; incubating the stage 1 definitive endoderm cells in a medium comprising KGF, an FGFR2b agonist, for about 2 days to generate stage 2 cells for generating exocrine pancreatic cells; incubating the stage 2 cells in a medium comprising KGF, an FGFR2b agonist; LDN193189, a BMP inhibitor; TPPB; retinoic acid (RA), a RAR agonist; and SANT1, a smoothened antagonist, for 2 days to generate stage 3 cells; incubating the stage 3 cells in a medium comprising KGF, an FGFR2b agonist; LDN193189, a BMP inhibitor; TPPB; retinoic acid, a RAR agonist; and SANT1, a smoothened antagonist, for about 4 days to generate stage 4 cells, wherein latrocrine A is added during the first about 24 hours of the incubation or nocodazole is added throughout the about 4 days of the incubation; then incubating the stage 4 cells in a medium comprising bFGF for about 6 days, wherein nicotinamide is added during the last 2 days of the 6 days; incubating the stage 1 definitive endoderm cells in a medium comprising a WNT agonist, CHIR, and FGF4 for about 4 days to generate stage 2 cells for generating intestinal cells, wherein latrocrine A is added during the first about 24 hours of the incubation or nocodazole is added throughout the about 4 days of the incubation; incubating the stage 2 cells in a medium comprising R-spondin 1 and a BMP inhibitor; LDN193189 for about 7 days; or incubating the stage 1 definitive endoderm cells in a medium comprising KGF, an FGFR2b agonist, for about 2 days to generate stage 3 cells for generating hepatocytes;Incubate the stage 3 cells in a medium containing BMP4 for about 4 days to generate stage 4 cells, wherein either a RAR agonist, retinoic acid, and either rat laminin A or nocodazole are added during the first about 24 hours of incubation, and then the stage 4 cells are cultured in a medium containing OSM, HGF, and dexamethasone for about 5 days.;

[0021] In some embodiments, the method includes changing the size of the clusters before forming cells of the endodermal lineage.

[0022] In some embodiments, the TGFβ / activin agonist is activin A; the glycogen synthase kinase 3 (GSK) inhibitor or WNT agonist is CHIR; the FGFR2b agonist is KGF; the smoothened antagonist or sonic hedgehog inhibitor is SANT-1; the FGF family member / FGFR2b agonist is KGF; the RAR agonist is RA; the protein kinase 3 activator is PDBU; the BMP inhibitor is LDN; the rho kinase inhibitor is Y27632; the Alk5 inhibitor / TGF-β receptor inhibitor is Alk5i; the thyroid hormone is T3; the gamma secretase inhibitor is XXI; the Erbb1 (EGFR) or Erbb4 agonist / member of the EGF family is betacellulin; or the RAR agonist is RA.

[0023] In some embodiments, the serum-free medium comprises one or more selected from the group consisting of MCDB131, glucose, NaHCO3, BSA, ITS-X, Glutamax, vitamin C, penicillin-streptomycin, CMRL 10666, FBS, heparin, NEAA, trace element A, trace element B, or ZnSO4.

[0024] In some embodiments, a sufficient time to form embryonic endoderm cells, primitive gut tube cells, early pancreatic progenitor cells, pancreatic progenitor cells, endoderm cells, or beta cells is between about 1 day and about 15 days.

[0025] In some embodiments, plating initial pancreatic progenitor cells or activating YAP with s1p (sphingosine-1-phosphate) (e.g., during approximately stage 4) increases SC-β cell induction, prevents undesirably early endocrine commitment, or allows for correct timing of transcription factor expression.

[0026] In some embodiments, introducing ratranclin A, ratranclin B, or nocodazole into pancreatic progenitor cells (e.g., throughout stage 4, at stage 5 or on approximately day 7) results in enhanced endocrine induction of plated cells and enhanced glucose-stimulated insulin secretion of subsequently generated β cells.

[0027] In some embodiments, introducing ratranclin A or ratranclin B into pancreatic progenitor cells generates cells of the endoderm lineage such as hepatocytes, or ratranclin A or ratranclin B disrupts the cytoskeletal actin (e.g., introducing ratranclin A or ratranclin B before stage 5 results in hepatocytes, or introducing ratranclin A or ratranclin B throughout stage 5 increases the number of β cells).

[0028] In some embodiments, a YAP inhibitor (e.g., verteporfin) is introduced into pancreatic progenitor cells.

[0029] In some embodiments, introducing ratranclin A or ratranclin B into pancreatic progenitor cells increases glucose-mediated insulin secretion or insulin gene expression.

[0030] In some embodiments, the cells of the endoderm lineage are selected from beta cells, liver cells, or pancreatic cells.

[0031] In some embodiments, this method enhances the induction and function of beta cells.

[0032] In some embodiments, the method includes culturing in planar (adherent) culture.

[0033] In some embodiments, the method includes plating cells on a hard substrate, wherein the expression of NKX6.1 is increased on the hard substrate compared to the expression of NKX6.1 on a soft substrate or in suspension culture.

[0034] In some embodiments, the planar (adherent) cells are dispersed, re-aggregated, or combined with a surface that changes hydrophobicity with an external cue (e.g., temperature) to allow detachment of the cells while maintaining cell arrangement, extracellular matrix proteins, and insulin secretion.

[0035] In some embodiments, the beta cells are SC-β cells.

[0036] In some embodiments, the stem cells are selected from HUES8 and 1016SeVA.

[0037] Another aspect of the disclosure provides cells generated from any one of the above aspects or embodiments; or provides a screening method comprising introducing a compound or composition into the cells.

[0038] Another aspect of the disclosure provides a method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of endoderm lineage cells, wherein the cells are generated according to any one of the above aspects or embodiments.

[0039] In some embodiments, the subject has diabetes or the cells are transplanted into the subject.

[0040] Another aspect of the disclosure provides cells generated by the method of any one of the above aspects or embodiments.

[0041] Another aspect of the present disclosure provides a method of generating cells or cells generated by any one of the above aspects or embodiments, wherein the cells of the endodermal lineage, beta cells, or intermediate cells express CDX2, CHGA, FOXA2, SOX17, PDX1, NKX6-1, NGN3, NEUROG3, NEUROD1, NXK2-2, ISL1, KRT7, KRT19, PRSS1, PRSS2, or INS.

[0042] Other objects and features will be in part apparent and in part pointed out hereinafter.

Brief Description of the Drawings

[0043] Those skilled in the art will understand that the drawings described below are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0044]

Figure 1

[0045]

Figure 2

[0046]

Figure 3

[0047]

Figure 4

[0048]

Figure 5

[0049]

Figure 6

[0050]

Figure 7

[0051]

Figure 8

[0052]

Figure 9

[0053]

Figure 10

[0054]

Figure 11

[0055]

Figure 12

[0056]

Figure 13

[0057]

Figure 14

[0058]

Figure 15

[0059]

Figure 16

[0060]

Figure 17

[0061]

Figure 18

[0062]

Figure 19

[0063]

Figure 20

[0064]

Figure 21

[0065]

Figure 22

[0066]

Figure 23

Mode for Carrying Out the Invention

[0067] The present disclosure is based, at least in part, on the discovery that a modified process can produce cells that can appropriately respond to glucose at near islet-like levels and demonstrate both first and second phase responses. Described herein is a protocol for generating beta-like cells from human pluripotent stem cells with dynamic insulin secretion. Further, the present disclosure is based, at least in part, on the discovery that modulation of the actin cytoskeleton can enhance pancreatic differentiation of human pluripotent stem cells.

[0068] Generation of beta-like cells from human pluripotent stem cells with dynamic insulin secretion: The stem cell-derived beta (SC-β) cells generated by the methods described herein function better than the cells of the published literature (Pagliuca et al., Cell 2014) (undergo glucose-stimulated insulin secretion) and were found to express beta cell markers. This includes an increase in insulin secretion in static assays and first and second phase insulin responses in dynamic assays.

[0069] As described herein, stem cell-derived beta (SC-β) cells may be useful as a cell therapy for diabetes or for drug screening. The methods disclosed herein promote the differentiation of human pluripotent stem cells into insulin-producing beta cells. This method is modified from the previously described six-step differentiation protocol published by Pagliuca et al. (Cell 2014). This new method generated cells that could appropriately respond to glucose at near islet-like levels and showed both first and second phase responses.

[0070] To achieve the above modulation, the following were performed. (1) Shorten stage 3 to one day; (2) Enable TGFb signaling at stage 6 by removing Alk5 inhibitor II (which is included in the current literature); (3) Remove T3 from stage 6 (which is included in the current literature); (4) Perform stage 6 in serum-free basal medium (containing the formulation); and (5) At the start of stage 6, dissociate and re-aggregate the clusters.

[0071] Using the above modulation, enhanced stem cell-derived beta cells that better execute glucose-stimulated insulin secretion were generated. The current state of the art includes Alk5 inhibitor II and T3 in the final stage of culturing to mature stem cell-derived beta cells. In this field, functional stem cell-derived beta cells with both phase 1 and phase 2 insulin secretion could not be generated (see Rezania et al., Nature Biotechnology 2014 for the poor dynamic function of stem cell-derived beta cells in this field).

[0072] For example, Example 1 describes a method for generating stem cell-derived beta-like (SC-β) cells. Through a differentiation strategy focused on modulation of TGFβ signaling, control of cell cluster size, and use of enriched serum-free medium (ESFM), SC-β cells that express beta cell markers and undergo GSIS with both phase 1 and phase 2 dynamic insulin secretion were found to be generated.

[0073] Modulation of the actin cytoskeleton promotes pancreatic differentiation of human pluripotent stem cells: As described herein, this study identified the actin cytoskeleton as an important regulator of the growth and decline of human pancreatic cells. By controlling the state of the cytoskeleton by any of cell alignment (two-dimensional vs three-dimensional), substrate stiffness, or direct chemical treatment, it is shown herein that polymerized cytoskeleton prevents premature induction of NEUROG3 expression in pancreatic progenitor cells but inhibits subsequent differentiation into SC-β cells.

[0074] As shown herein, it has been discovered that modulation of the actin cytoskeleton and its downstream effector Yes-Associated Protein (YAP) at specific time points during differentiation can enhance the differentiation of human pluripotent stem cells into endoderm lineage cells, pancreatic progenitor cells, and insulin-producing beta cells. Using a six-stage differentiation protocol modified from Pagliuca et al. (Cell 2014), the following specific functions were observed: (1) Actin polymerization and YAP activity at stage 4 promote the generation of pancreatic progenitor cells (PDX1+ / NKX6-1+ / SOX9+); (2) Actin depolymerization and loss of YAP activity at stage 5, preferentially during the first 24 - 48 hours of stage 5, enhance the generation of endocrine cells, particularly beta cells that show enhanced glucose-stimulated insulin secretion.

[0075] To achieve the above modulation, the following can be done: (1) Promote actin polymerization by plating on a hard surface such as tissue culture plastic with a thin layer of ECM protein to promote attachment; (2) Promote actin depolymerization by plating on a soft surface such as a hydrogel or by treating the cells with latrunculin A and / or latrunculin B; (3) Promote YAP transcriptional activity using the same method as for promoting actin polymerization; and / or (4) Inhibit YAP transcriptional activity using the same method as for promoting actin depolymerization or by treating with verteporfin.

[0076] Using the above modulation, enhanced stem cell-derived beta cells were generated that perform glucose-stimulated insulin secretion better than previous methods and can be generated in adherent culture. Currently in this field, stem cell-derived beta cells can be generated, but they do not function as well as the approach disclosed herein. In this field, the actin cytoskeleton and YAP signaling are not utilized in the protocol. In this field, it is also not possible to generate functional stem cell-derived beta cells in cells during adherent culture. It has to be done either in suspension aggregates (control for many experiments in the attached dataset; first reported by Pagliuca et al., Cell 2014) or in aggregates on the air-liquid interface (first reported by Rezania et al., Nature Biotechnology 2014).

[0077] Described herein is the generation of stem cell-derived beta cells that function better (undergo glucose-stimulated insulin secretion) than the cells of the published literature (Pagliuca et al., Cell 2014) and express beta cell markers.

[0078] Also described herein is a method for generating stem cell-derived beta cells in a planar protocol that can undergo glucose-stimulated insulin secretion (GSIS).

[0079] Also described herein is the demonstration that the UpCell technology that does not require cell dispersion or that cells can be separated from the plate by dispersing and reaggregating the cells, maintaining the insulin secretion capacity and making transplantation more possible.

[0080] Also described herein is the generation of pancreatic progenitor cells with decreased endocrine expression (such as expression of NGN3, NEUROD1) and increased expression of pancreatic progenitor cells (such as expression of NKX6-1, SOX9).

[0081] Pancreatic progenitor cells and stem cell-derived beta cells may be useful as a cell therapy for diabetes. Stem cell-derived beta cells are also useful for drug screening. The adherent culture approach disclosed herein provides a convenient platform for drug screening studies.

[0082] The culture approach disclosed herein can also promote the improvement of the quality and reproducibility of differentiation and facilitate the automation of the differentiation process for commercialization.

[0083] As an example, as described in Example 2, the differentiation protocol by cytoskeletal modulation can generate several lines of cells (e.g., SC-β, beta-like cells). It has been found that the state of the actin cytoskeleton is important for the choice of the fate of endodermal cells. By utilizing the combination of cell-biomaterial interactions and small molecule regulators of the actin cytoskeleton (e.g., cytoskeletal modulating agents), the timing of endocrine transcription factor expression can be controlled to modulate the fate of differentiation and develop a two-dimensional protocol for differentiating cells. Importantly, this new planar protocol significantly enhances the function of SC-β cells differentiated from induced pluripotent stem cell (iPSC) lines and eliminates the need for three-dimensional cell arrays.

[0084] If the degree of actin polymerization at a specific time point of differentiation is different, the cells will be biased towards different endodermal lineages. Thus, a suboptimal cytoskeletal state results in a great inefficiency in cell specification.

[0085] Furthermore, the methods described herein can control actin polymerization to direct the differentiation of these other endodermal cell fates and modulate lineage specification.

[0086] Other lineages that can be generated according to the provided methods can be the liver, esophagus, exocrine, pancreas, intestine, or stomach.

[0087] The cytoskeleton modulating agent can be any agent that promotes or inhibits actin polymerization or microtubule polymerization. For example, the cytoskeleton modulating agent can be an actin depolymerizing or polymerizing agent, a microtubule modulating agent, or an integrin modulating agent (e.g., a compound such as an antibody and a small molecule). For example, the cytoskeleton modulating agent can be latrunculin A, latrunculin B, nocodazole, cytochalasin D, jasplakinolide, brevystatin, y-27632, y-15, gdc-0994, or an integrin modulating agent. The cytoskeleton modulating agent can be any cytoskeleton modulating agent known in the art (see, e.g., Ley et al., Nat Rev Drug Discov. 2016 Mar; 15(3): 173-183).

[0088] Changing the size of cell clusters: Changing the size of cell clusters can be carried out by any method known in the art. For example, changing the size of cells can include dissociating and re-aggregating cell clusters. As another example, cell clusters can be incubated in a cell dissociation reagent and sized by passing through a cell strainer (e.g., a 100 μm nylon cell strainer). As another example, TrypLE can be used to disperse single cells and re-aggregate them to change the size of the cells.

[0089] Formulations: The agents and compositions described herein can be formulated by any conventional method using one or more pharmaceutically acceptable carriers or excipients described, for example, in Remington's Pharmaceutical Sciences (ed. AR Gennaro), 21st Edition, ISBN:0781746736 (2005) (which is incorporated herein by reference in its entirety). Such formulations will contain, in an appropriate amount, a therapeutically effective amount of the cells (which can be in a purified form) described herein, together with an appropriate amount of carrier, to provide a form for proper administration to a subject.

[0090] The term "formulation" refers to the preparation of a drug in a form suitable for administration to a subject such as a human. Thus, a "formulation" may include pharmaceutically acceptable excipients (including diluents or carriers).

[0091] As used herein, the term "pharmaceutically acceptable" can describe a substance or component that does not cause an unacceptable loss of pharmacological activity or unacceptable adverse side effects. Examples of pharmaceutically acceptable components can be those having a monograph in the United States Pharmacopeia (USP29) and the National Formulary (NF24), United States Pharmacopeial Convention, Inc, Rockville, Maryland, 2005 ("USP / NF"), or a more recent edition, and components listed in the FDA's continuously updated Inactive Ingredient Search online database. Other useful components not described in USP / NF etc. can also be used.

[0092] As used herein, the term "pharmaceutically acceptable excipient" can include any solvent, dispersion medium, coating, antibacterial and antifungal agents, isotonic agents, or absorption delaying agents. The use of such media and agents for pharmaceutical active substances is well known in the art (generally, see Remington’s Pharmaceutical Sciences (ed. A.R. Gennaro), 21st edition, ISBN:078174676 (2005)). Its use in therapeutic compositions can be expected, except when conventional media or agents are incompatible with the active ingredient. Supplementary active ingredients can also be incorporated into the composition.

[0093] A "stable" formulation or composition can refer to a composition having sufficient stability to be stored for a commercially reasonable period, such as at least about 1 day, at least about 1 week, at least about 1 month, at least about 3 months, at least about 6 months, at least about 1 year, or at least about 2 years, at a convenient temperature such as from about 0°C to about 60°C.

[0094] The formulation needs to be compatible with the method of administration. The agents used in the present disclosure can be formulated by known methods for administration to a subject using several routes including, but not limited to, parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ophthalmic, buccal, and rectal. The individual agents can also be administered in combination with one or more additional agents or together with other biologically active or inactive agents. Such biologically active or inactive agents can be in fluid or mechanical communication with the agent or can adhere to the agent by ionic, covalent, van der Waals, hydrophobic, hydrophilic, or other physical forces.

[0095] Controlled release (or sustained release) formulations can be formulated to extend the activity of the agent and reduce the frequency of administration. Sustained release formulations can also be used to affect other properties such as the onset time of action or the blood level of the agent, and as a result, affect the occurrence of side effects. Controlled release formulations can be designed to first release an amount of the agent that produces the desired therapeutic effect and then gradually and continuously release other amounts of the agent to maintain the level of the therapeutic effect over a long period of time. To maintain the level of the agent in the body substantially constant, the agent can be released from the dosage form at a rate that replaces the amount of the agent that is metabolized or excreted from the body. The controlled release of the agent can be stimulated by various inducing factors such as changes in pH, changes in temperature, enzymes, water, or other physiological conditions or molecules.

[0096] The agents or compositions described herein can also be used in combination with other therapies, as further described below. Thus, in addition to the therapies described herein, other therapies known to be effective in the treatment of a disease, disorder, or condition can also be provided to a subject.

[0097] Therapy: Methods of using the generated cells for cell replacement therapy or stem cell transplantation are also provided. For example, the disclosed compositions and methods can be used to treat diabetes or other diseases associated with dysfunctional endodermal cells in a subject in need of administration of a therapeutically effective amount of endoderm lineage cells or beta cells to induce insulin secretion.

[0098] The methods described herein are generally performed on a subject in need thereof. A subject in need of the treatment methods described herein can be a subject having, diagnosed with, suspected of having, or at risk of developing diabetes or other diseases associated with dysfunctional endodermal cells. The determination of the need for treatment will typically be evaluated by a medical history and physical examination consistent with the disease or condition in question. Diagnosis of the various conditions treatable by the methods described herein is within the skill of the art. The subject can be an animal subject including mammals such as horses, cows, dogs, cats, sheep, pigs, mice, rats, monkeys, hamsters, guinea pigs, and chickens, as well as humans. For example, the subject can be a human subject.

[0099] Generally, a safe and effective amount of endoderm lineage cells (e.g., hepatocytes, insulin-expressing cells (e.g., β-cells, SC-β-cells), intestinal cells) will be an amount that causes the desired therapeutic effect in the subject while minimizing undesirable side effects.

[0100] In various embodiments, the effective amount of endoderm lineage or beta cells described herein can respond to glucose by insulin secretion. In various embodiments, the effective amount of cells described herein can treat, substantially inhibit, slow the progression of, or limit the onset of diabetes or other diseases associated with dysfunctional endodermal cells.

[0101] According to the methods described herein, administration can be by cell transplantation, cell implantation, parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ophthalmic, buccal, or rectal administration.

[0102] When used in the treatments described herein, a therapeutically effective amount of beta cells or endoderm lineage cells can be used in pure form or, if such forms exist, in pharmaceutically acceptable salt form, with or without pharmaceutically acceptable excipients. For example, the compounds of the present disclosure can be administered in an amount sufficient to induce insulin secretion with a reasonable benefit / risk ratio applicable to any medical treatment.

[0103] The amounts of the compositions described herein that can be combined with a pharmaceutically acceptable carrier to produce a single dosage form will vary depending on the host to be treated and the particular mode of administration. Since the required therapeutically effective amount can be achieved by administration of several individual doses, it will be understood by those skilled in the art that the unit content of the agent contained in each individual dose of the dosage form need not itself constitute a therapeutically effective amount.

[0104] The toxicity and therapeutic efficacy of the compositions described herein are determined by standard pharmaceutical procedures in cell cultures or experimental animals to determine the LD 50 (lethal dose for 50% of the population) and ED 50 (dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD 50 / ED 50 and a greater therapeutic index is generally understood to be optimal in the art.

[0105] The specific therapeutically effective dosage level for a particular subject will depend on various factors including the disorder being treated and the severity of the disorder; the activity of the specific compound used; the specific composition employed; the age, body weight, general health, sex, diet of the subject; the time of administration; the route of administration; the rate of excretion of the composition used; the duration of the treatment; drugs used in combination with or concurrently with the specific compound employed; and like factors well known in the medical arts. (See, e.g., Koda-Kimble et al. (2004) Applied Therapeutics; The Clinical Use of Drugs, Lippincott Williams & Wilkins, ISBN 0781748453; Winter (2003) Basic Clinical Pharmacokinetics, 4th Edition, Lippincott Williams & Wilkins, ISBN 0781741475; Sharqel (2004) Applied Biopharmaceutics & Pharmacokinetics, McGraw-Hill / Appleton & Lange, ISBN 0071375503). For example, it is within the skill of the art to start the dosage of the composition at a level lower than that required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose may be divided into multiple doses for purposes of administration. As a result, a single dose composition may contain such an amount or an approximate multiple thereof and may constitute the daily dosage. However, it will be understood that the total daily usage of the compounds and compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment.

[0106] In addition, each of the situations (states), diseases, disorders, and conditions described herein, as well as others, can benefit from the compositions and methods described herein. Generally, the treatment of a situation, disease, disorder, or condition includes preventing or delaying the appearance of clinical symptoms in a mammal that is suffering from or is at risk of having the situation, disease, disorder, or condition, but whose clinical or subclinical symptoms have not yet manifested. Treatment can also include suppressing the situation, disease, disorder, or condition, for example, preventing or reducing the onset of the disease or at least one of its clinical or subclinical symptoms. Further, treatment can include alleviating the disease, for example, causing at least one regression of the situation, disease, disorder, or condition, or its clinical or subclinical symptoms. The benefit to the subject being treated can be statistically significant or at least perceptible to the subject or the physician.

[0107] The administration of endoderm lineage cells or beta cells can be performed as a single event or over the course of treatment. For example, endoderm lineage cells or beta cells can be administered daily, weekly, biweekly, or monthly. In the case of treating an acute condition, the course of treatment is usually at least several days. For certain conditions, the treatment can be extended from several days to several weeks. For example, the treatment can span one week, two weeks, or three weeks. In the case of more chronic conditions, the treatment can span from several weeks to several months, or even more than one year.

[0108] Treatment according to the methods described herein can be carried out before, simultaneously with, or after conventional therapies for diabetes or other diseases associated with dysfunctional endoderm cells.

[0109] Administration: The agents and compositions described herein can be administered according to the methods described herein by a variety of means known in the art. The agents and compositions can be used therapeutically as either exogenous or endogenous materials. An exogenous agent is a drug that is produced or manufactured outside the body and administered to the body. An endogenous agent is a drug that is produced or manufactured in the body by some type of device (biological or otherwise) for delivery within the body or to other organs within the body.

[0110] As noted above, administration can be by implantation, transplantation, parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ophthalmic, buccal, or rectal administration.

[0111] The agents and compositions described herein can be administered by a variety of methods well known in the art. Administration can include, for example, direct injection (e.g., systemic or localized), transplantation, or implantation of generated cells, oral ingestion, cell-releasing biomaterials, polymeric matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, implantable matrix devices, mini-osmotic pumps, implantable pumps, injectable gels and hydrogels, liposomes, micelles (e.g., up to 30 μm), nanospheres (e.g., less than 1 μm), microspheres (e.g., 1 - 100 μm), reservoirs, combinations of any of the foregoing, or other suitable delivery vehicles to provide a desired release profile at various rates. Other methods of controlled release delivery of the agent or composition are known to those skilled in the art and are within the scope of the present disclosure.

[0112] The delivery system can include, for example, an infusion pump that can be used to administer cells in a manner similar to that used to deliver insulin or chemotherapy to a specific organ or tumor. Typically, using such a system, the cells can be administered in combination with a biodegradable, biocompatible polymer implant that contains or releases the cells over a controlled period at a selected site. Examples of polymeric materials include polyanhydrides, polyorthoesters, polyglycolic acid, polylactic acid, polyvinyl acetate, and their copolymers and combinations thereof. Further, the controlled release system can be placed near the therapeutic target and thus requires only a fraction of the systemic dose.

[0113] Drugs can be administered encapsulated in various carrier delivery systems. Examples of carrier delivery systems include microspheres, hydrogels, polymeric implants, smart polymeric carriers, and liposomes (see generally Uchegbu and Schatzlein, eds. (2006) Polymers in Drug Delivery, CRC, ISBN-10: 0849325331). Carrier-based systems for drug delivery of molecules or biomolecules can improve the transport of the therapeutic cells to their site of action; enable co-localized deposition with other drugs or excipients; improve the stability of the cells in vivo; extend the residence time of the cells at the site of action by reducing clearance; reduce the non-specific delivery of the cells to non-target tissues; alter the immunogenicity of the drug; reduce the frequency of administration; or improve the shelf life of the product.

[0114] Screening: Methods for screening are also provided. The screening method can include providing cells generated by any of the methods described herein, and introducing a compound or composition (e.g., a secretion promoter) into the cells. For example, the screening method can be used for drug screening or toxicity screening in any cells of the endodermal lineage or beta cells provided herein.

[0115] The subject methods are found to be useful in screening a variety of different candidate molecules (e.g., potentially therapeutically treatable candidate molecules). Candidate substances for screening by the methods described herein include, but are not limited to, tissue or cell fractions, nucleic acids, polypeptides, siRNA, antisense molecules, aptamers, ribozymes, triple helix compounds, antibodies, and small (e.g., less than about 2000 mw, or less than about 1000 mw, or less than about 800 mw) organic or inorganic molecules (including but not limited to salts or metals).

[0116] Candidate molecules include organic molecules, such as small organic compounds having a molecular weight greater than 50 daltons and less than about 2500 daltons. Candidate molecules can contain functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically contain at least an amine, carbonyl group, hydroxyl group or carboxyl group, and usually at least two functional chemical groups. Candidate molecules can include cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups.

[0117] Candidate molecules can be compounds within a compound library database. Those skilled in the art are generally familiar with a number of databases regarding commercially available compounds for screening (for example, see the ZINC database, UCSF, which has 2.7 million compounds across 12 different subsets of molecules; Irwin and Shoichet (2005) J Chem Inf Model 45, 177 - 182). Those skilled in the art are also familiar with commercial sources or various search engines for identifying desirable compounds and classes of compounds for further testing (for example, see the ZINC database; eMolecules.com; and the electronic libraries of commercial compounds provided by vendors such as ChemBridge, Princeton BioMolecular, Ambinter SARL, Enamine, ASDI, Life Chemicals).

[0118] Candidate molecules for screening by the methods described herein include both lead - like compounds and drug - like compounds. Lead - like compounds are generally understood to have a relatively small scaffold - like structure (for example, a molecular weight of about 150 to about 350 kD) with relatively few properties (for example, less than about 3 hydrogen donors and / or less than about 6 hydrogen acceptors; a hydrophobic property xlogP of about - 2 to about 4). (See, for example, Angewante (1999) Chemie Int. ed. Engl. 24, 3943 - 3948). In contrast, drug - like compounds are generally understood to have a relatively large scaffold (for example, a molecular weight of about 150 to about 500 kD) with relatively many properties (for example, less than about 10 hydrogen acceptors and / or less than about 8 rotatable bonds; a hydrophobic property xlogP of less than about 5). (See, for example, Lipinski (2000) J. Pharm. Tox. Methods 44, 235 - 249). The initial screening can be performed using lead - like compounds.

[0119] When designing leads from spatial orientation data, it can be helpful to understand that certain molecular structures are characterized as "drug-like". Such property evaluations can be based on an empirically recognized set of qualities derived by comparing similarities across the breadth of known drugs in a pharmacopoeia. A drug need not meet all or any of these properties, but if it is drug-like, the likelihood of clinical success for a drug candidate is much higher.

[0120] Some of these "drug-like" properties are summarized in Lipinski's four rules (since the fifth of them has become so prevalent, it is commonly known as the "Rule of Five"). These rules are generally related to oral absorption and are used to predict the bioavailability of compounds during lead optimization, but they serve as effective guidelines for constructing lead molecules during rational drug design efforts such as those achievable by using the methods of the present disclosure.

[0121] In the four "Rules of Five", a candidate drug-like compound is said to need to possess at least three of the following properties: (i) a weight of less than 500 Daltons; (ii) a logarithm of P of less than 5; (iii) no more than 5 hydrogen bond donors (represented as the sum of OH and NH groups); and (iv) no more than 10 hydrogen bond acceptors (the sum of N and O atoms). Also, drug-like molecules typically have a span (width) between about 8 Å and about 15 Å.

[0122] Kit: Kits are also provided. Such kits can include the agents or compositions described herein, and in certain embodiments, instructions for administration. Such kits can facilitate the performance of the methods described herein. When provided as a kit, the different components of the composition can be packaged in separate containers and mixed immediately prior to use. The components include, but are not limited to, the stem cells, media, and factors described herein. Such separate packaging of the components can be presented in a package, pack, or dispenser device that can include one or more unit dosage forms containing the composition, as needed. The pack can include, for example, a metal or plastic foil such as a blister pack. By packaging the components separately in this way, long-term storage can sometimes be carried out without loss of component activity.

[0123] The kit can also include reagents in separate containers, such as sterile water or saline that is added to separately packaged lyophilized active ingredients. For example, a sealed glass ampoule can contain the lyophilized component, and in a separate ampoule, sterile water, sterile saline, or a sterile diluent, each packaged under a neutral non-reactive gas such as nitrogen, can be included. The ampoule can be made of any suitable material, such as glass, an organic polymer, such as polycarbonate, polystyrene, ceramic, metal, or any other material commonly used to hold reagents. Other examples of suitable containers include bottles that can be made of a material similar to that of the ampoule, and packages that can have an interior lined with a foil such as aluminum or an alloy. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. The container can have a sterile access port, such as a bottle with a stopper that can be pierced by a hypodermic needle. Other containers can have two compartments separated by an easily removable membrane, which allows the components to mix when removed. The removable membrane can be glass, plastic, rubber, or the like.

[0124] In certain embodiments, the kit may be supplied with instructional materials. The instructions can be printed on paper or other substrates and / or provided as an electronically readable medium, such as a floppy disk, mini CD-ROM, CD-ROM, DVD-ROM, Zip disk, video tape, audio tape, and the like. The detailed procedures need not be physically associated with the kit. Instead, the user may be directed to an Internet website designated by the manufacturer or seller of the kit.

[0125] The compositions and methods described herein that utilize molecular biology protocols can follow various standard techniques known in the art (see, for example, Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10:0879697717; Ausubel et al., (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10:0471250929; Sambrook and Russel (2001) Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, ISBN-10:0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754; Studier (2005) Protein Expr Purif. 41(1), 207-234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10:3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10:0954523253).

[0126] The definitions and methods described herein are provided to better define the present disclosure and to guide those of ordinary skill in the art in practicing the present disclosure. Unless otherwise specified, terms should be understood according to their conventional usage by those of ordinary skill in the relevant art.

[0127] In some embodiments, the numbers expressing, for purposes of describing and claiming particular embodiments of the present disclosure, amounts of ingredients, properties such as molecular weights, reaction conditions, and the like are to be understood as being modified in some instances by the term "about." In some embodiments, the term "about" is used to indicate that a value includes the standard deviation of the mean of the device or method used to determine the value. In some embodiments, the numerical parameters set forth in the written description and the appended claims are approximations that may vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the present disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible to the extent practicable. The numerical values presented in some embodiments of the present disclosure may contain certain errors necessarily resulting from the standard deviation found in each respective test measurement. The recitation of numerical ranges herein is merely intended to serve as a simple way of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0128] In some embodiments, the terms "a," "an," "the," and similar references used in the context of describing particular embodiments (especially in the context of the following claims) can be construed to include both the singular and the plural unless specifically stated otherwise. In some embodiments, the term "or" as used herein, including in the claims, is used to mean "and / or" unless explicitly indicated otherwise to refer only to alternatives or if the alternatives are mutually exclusive.

[0129] The terms "comprise", "have", and "include" are open-ended conjunctive verbs. One or more forms or tenses of these verbs, such as "comprises", "comprising", "has", "having", "includes", and "including", are also open-ended. For example, a method that "comprises", "has", or "includes" one or more steps is not limited to possessing only those one or more steps, and may include other unrecited steps. Similarly, a composition or device that "comprises", "has", or "includes" one or more characteristics is not limited to possessing only those one or more characteristics, and may include other unrecited characteristics.

[0130] All of the methods described herein can be performed in any suitable order, unless otherwise indicated herein or otherwise clearly contradicted by the context. The use of any and all examples or exemplary language (e.g., "such as") provided with respect to specific embodiments herein is merely intended to better clarify the disclosure and is not intended to limit the scope of the disclosure otherwise claimed. No language in this specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.

[0131] The grouping of the selected elements or embodiments of the present disclosure disclosed herein should not be construed as limiting. Members of each group can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in or deleted from the group for reasons of convenience or patentability. When such inclusion or deletion occurs, the present specification is considered to include the modified group and thus meets the written description of all Markush groups used in the appended claims.

[0132] All publications, patents, patent applications, and other references cited in this application are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other reference were specifically and individually indicated to be incorporated by reference for all purposes. The citation of a reference herein should not be construed as an admission that it is prior art to the present disclosure.

[0133] Although the present disclosure has been described in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the scope of the present disclosure as defined in the appended claims. Furthermore, it should be understood that all examples in the present disclosure are provided as non-limiting examples.

[0134] Examples: The following non-limiting examples are provided to further illustrate the present disclosure. Those skilled in the art should understand that the techniques disclosed in the following examples represent approaches that the inventors have found to function well in the practice of the present disclosure and can thus be considered examples of modes for its practice. However, those skilled in the art should understand that, in light of the present disclosure, many changes can be made in the specific embodiments disclosed and still obtain similar results without departing from the spirit and scope of the present disclosure.

[0135] Example 1 Acquisition of Dynamic Function in Human Stem Cell-Derived Beta Cells: In the following examples, a new six-stage differentiation strategy for improving the functional maturation of stem cell-derived β (SC-β) cells that secrete large amounts of insulin, are glucose-responsive, and exhibit both first-phase and second-phase insulin release is described. The dynamic function in stem cell-derived beta cells is also described here.

[0136] Recent advances in human pluripotent stem cell (hPSC) differentiation protocols have generated insulin-producing cells that resemble pancreatic beta cells. These stem cell-derived β (SC-β) cells can undergo glucose-stimulated insulin secretion (GSIS), but insulin secretion per cell remains low compared to islets and lacks distinct first-phase and second-phase dynamic insulin release. Here, this study reports a differentiation strategy focused on generating SC-β cells that express beta cell markers and undergo GSIS with first-phase and second-phase dynamic insulin secretion using modulation of TGFβ signaling, control of cell cluster size, and enriched serum-free medium (ESFM). Transplanting these cells into mice significantly improves glucose tolerance. These results clarify that a specific time frame (or period) is required to inhibit and permit TGFβ signaling during SC-β cell differentiation to achieve dynamic function. The ability of these cells to undergo GSIS with dynamic insulin release makes them a promising cell source for diabetic cell therapy.

[0137] Preface: Diabetes is a global health problem affecting over 400 million people worldwide, with prevalence on the rise. Diabetes is mainly caused by the death or dysfunction of insulin-producing β-cells found within the pancreatic islets of Langerhans, leading to inappropriate insulin secretion and failure to maintain normal blood glucose levels in patients, and in severe cases, can cause ketoacidosis and death. Patients often rely on insulin injections, yet still suffer from long-term complications including retinopathy, neuropathy, nephropathy, and cardiovascular diseases. An alternative treatment is the replacement of endogenous β-cells by pancreatic islet transplantation. This treatment is clinically successful, but the limited availability of cadaveric donor islets greatly hinders its widespread application.

[0138] Differentiation of human pluripotent stem cells (hPSCs) into stem cell-derived β-cells (SC-β-cells) is a promising alternative cell source for diabetes cell replacement therapy and other applications such as disease modeling and studies of pancreatic development. Through modulation of pathways identified from embryogenesis, studies using hPSCs have elucidated the details of protocols for generating cells similar to early endoderm and pancreatic progenitor cells, and the latter (pancreatic progenitor cells) differentiate spontaneously into β-like cells several months after transplantation into rodents.

[0139] An approach for generating SC-β-cells in vitro has been reported that uses a type II Alk5 inhibitor compound (Alk5i) to inhibit TGFβ signaling at the final stage of differentiation. 30 For the first time with these approaches, SC-β-cells were generated that underwent glucose-stimulated insulin secretion (GSIS) in static incubation, expressed β-cell markers, and were able to control blood glucose levels in diabetic mice several weeks later. However, these cells were functionally inferior, including having low insulin secretion compared to human islets and little or no first and second phase insulin release in response to a high glucose challenge, indicating that these SC-β-cells were less mature than β-cells of the pancreatic islets. Several follow-up studies were conducted to introduce new differentiation factors or optimize the process, but were unable to equalize the function of SC-β-cells to that of human islets. 14,26,36,55 。

[0140] Here, this study describes a new six-stage differentiation strategy that, in combination with cell cluster size modification and ESFM culture, modulates Alk5i exposure to inhibit and permit TGFβ signaling at key stages to generate a nearly pure population of β-like cells, including endocrine cells, that secrete high levels of insulin and express β cell markers. These cells are glucose-responsive, exhibit first- and second-phase insulin release, and respond to multiple secretagogues. Transplanted cells significantly improve glucose tolerance in mice. This study shows that inhibiting TGFβ signaling at stage 6 significantly reduces the function of these differentiated cells, while treatment with Alk5i at stage 5 is required for a robust β-like cell phenotype.

[0141] Results: Differentiation into glucose-responsive SC-β cells in vitro: An improved differentiation protocol was developed using the HUES8 cell line. Y27632 was included at stages 3-4 and activin A at stage 4 to maintain cluster integrity and shorten stage 3 from 2 days to just 1 day to enhance progenitor cells. ESFM was developed for stage 6 as a replacement for the previously used serum-containing medium, resulting in a serum-free protocol. During protocol pilot studies, both cell cluster size modification and removal of Alk5i and T3 were observed to increase insulin secretion while maintaining the C-peptide+ population (see, for example, FIGS. 8A-8B).

[0142] Combining these changes led to the new six-stage differentiation protocol outlined in Figure 1A. Cells at stage 6 grew as clusters in suspension culture (see Figure 1B) with an average diameter of 172 ± 34 μm (mean ± standard deviation; n = 353 individual clusters), which was less than half the diameter of the clusters before size change (364 ± 55 μm; n = 155 clusters). Stage 6 clusters were stained red with the zinc chelate dye dithizone (DTZ) that stains β cells. Immunostaining of sectioned clusters revealed that most cells were C-peptide +, a protein produced by the INS gene in addition to the β cell markers PDX1+ and NKX6-1+ (see, for example, Figure 1C). A subset of cells stained positive for glucagon (GCG+) or were polyhormonal, staining positive for both C-peptide and GCG. These polyhormonal cells are known not to resemble adult β cells and do not function.

[0143] Both static GSIS assays (e.g., Figures 1D–1E; see Figure 8C) and dynamic GSIS assays (e.g., Figure 1F; see Figure 8D) were used to test the function of stage 6 cells generated with the new differentiation protocol. It was found that the cells not only secrete insulin but also increase insulin release when shifted from low to high glucose. In the static GSIS, although there was some variability, stage 6 cells increased insulin secretion by an average of 3.0 ± 0.1-fold when shifted from 2 to 20 mM glucose. This is in contrast to a previously published protocol (here the Pagliuca protocol 30Although improved compared to cells (1.4 ± 0.1) generated from (referred to as), on average, they are less than human islets (3.2 ± 0.1) (see, for example, Figure 1D). The stage 6 cells of this study did not increase insulin secretion in response to 5.6 mM glucose, but did increase secretion in response to high concentrations (11.1 and 20 mM), indicating that the cells are not stimulated by a low glucose threshold (see, for example, Figure 1E). Regarding insulin secretion per cell, the stage 6 cells secreted on average 5.3 ± 0.5 μIU / 10 3 cells, which was 9.2 ± 1.1 times that of cells generated by the Pagliuca protocol and 2.3 ± 0.3 times that of human islets (see, for example, Figure 1D).

[0144] In dynamic GSIS, the stage 6 cells showed rapid first-phase insulin release within 3 - 5 minutes from high glucose exposure, increasing insulin secretion 7.6 ± 1.3-fold to 159 ± 21 μIU / μg DNA, which was higher than that of cells generated by the Pagliuca protocol from stage 6 cells (1.7 ± 0.2-fold increase to 11 ± 1 μIU / μg DNA), but lower than that of human islets (15.0 ± 2.4-fold increase to 245 ± 26 μIU / μg DNA) (see, for example, Figure 1F). The second-phase insulin secretion was observed with continuous high glucose exposure, and the cells maintained insulin secretion 2.1 ± 0.3 higher than the initial low glucose, which was a higher increase than the Pagliuca protocol (0.9 ± 0.1), but lower than that of human islets (6.7 ± 0.8) (see, for example, Figure 1F). When the cells were returned to low glucose, insulin secretion from the stage 6 cells returned to the rate of decline. Enhancing insulin secretion and showing first-phase and second-phase insulin release in response to a high glucose challenge are important features of β-cell behavior. Overall, the stage 6 cells generated by this differentiation strategy produced cells with distinct first-phase and second-phase insulin secretion, which is Pagliuca 30It was not demonstrated in [the relevant experiment], and was not observed in stage 6 cells generated by the Pagliuca protocol. However, when compared to human islets containing β cells, these stage 6 cells had low insulin secretion per cell at high glucose, low average glucose stimulation, and slightly delayed first-phase insulin release.

[0145] To further characterize stage 6 cells generated by the new differentiation protocol, the cells were immunostained with a panel of pancreatic markers (see, for example, FIGS. 2A - 2C, 9). Most of the cells expressed chromogranin A (96 ± 1%), a pan - endocrine marker, and most cells expressed C - peptide (73 ± 3%) (see, for example, FIG. 2). These fractions were higher than those of stage 6 cells generated by the Pagliuca protocol (see, for example, FIG. 9) and those previously reported. 30 Many C - peptide + cells from both protocols expressed other markers seen in β cells, and expression of other pancreatic hormones was observed (see, for example, FIGS. 2, 9). Most of the C - peptide + cells expressed NKX6 - 1 (see, for example, FIG. 2) and were monohormonal, which was presumed to be the SC - β cell population. The proportion of C - peptide + cells that did not express another hormone increased compared to stage 6 cells generated by the Pagliuca protocol and those previously reported. 30 However, the proportion of these cells that expressed another hormone was equivalent (see, for example, FIGS. 2, 9). This data indicates that stage 6 cells generated by this new strategy are mainly pancreatic endocrine and mostly express C - peptide.

[0146] Stage 6 cells generated by the Pagliuca protocol, stage 6 cells generated by the protocol from this study, and human islets were compared, and the expression of several genes was measured (see, e.g., FIGS. 2D and 10). Many islet and β-cell genes, including INS, CHGA, NKX2-2, PDX1, NKX6-1, MAFB, GCK, and GLUT1, were increased compared to the Pagliuca protocol. Interestingly, the unpermitted β-cell genes LDHA and SLC16A1 had decreased expression in stage 6 cells compared to both the Pagliuca protocol and human islets (LDHA) and the Pagliuca protocol (SLC16A1). Stage 6 cells generated from the protocol of this study had increased expression of CHGA, NKX6-1, MAFB, GCK, and GLUT1 compared to human islets. However, INS, GCG, SST, particularly MAFA and UCN3, had decreased expression compared to stage 6 cells. However, several recent reports have provided evidence questioning the usefulness of MAFA and UCN3 in assessing the maturation of human SC-β cells. The expression of MAFA is low in human juvenile β cells. MAFB is expressed in humans but not in mouse β cells. The expression of UCN3 is much higher in mice than in human β cells and is also expressed in human α cells. This data indicates that stage 6 cells generated in this study have improved gene expression of many markers compared to the Pagliuca protocol, and while the expression of some β-cell markers is equivalent to or higher than that of human islets, other markers remain low.

[0147] Transplantation of SC-β cells into glucose-intolerant mice: To evaluate the functional potential of stage 6 cells in vivo, cells were first transplanted under the renal capsule of non-diabetic mice, and the ability of the grafts to respond to a glucose challenge was evaluated (see, e.g., FIG. 3A). Even after a long period (6 months) post-transplantation, the grafts responded to glucose injection by increasing human insulin 1.9 ± 0.5-fold. Excision and immunostaining of the transplanted kidneys revealed C-peptide+ cells that tended to cluster together, in addition to other pancreatic endocrine and exocrine markers (see, e.g., FIG. 3B; see FIG. 11A). To more rigorously evaluate stage 6 cells in vivo, another cohort of mice chemically induced to become diabetic with streptozotocin (STZ) was transplanted, and function was evaluated at early (10 and 16 days) and late (10 weeks) time points. Just 10 days after transplantation, STZ-treated mice administered stage 6 cells had significantly improved glucose tolerance compared to STZ-treated sham mice and had glucose clearance similar to that of mice without STZ treatment (see, e.g., FIGS. 3C-3D). Measurement of human insulin 16 days after transplantation revealed high insulin concentrations that increased 2.3 ± 0.6-fold to 16.6 ± 3.1 μIU / mL with glucose injection (see, e.g., FIG. 3E). These values are similar to those previously reported under similar conditions 30Greater than (1.4 ± 0.3 insulin increase and 3.8 ± 0.8 μIU / mL concentration). When the cohort was observed 10 weeks after transplantation, results similar to the 10- and 16-day data were revealed, and the transplanted mice had significantly improved glucose tolerance (see, e.g., FIGS. 3F-3G) and glucose-responsive insulin secretion (see, e.g., FIG. 3H). Mice not administered STZ showed glucose tolerance similar to that of mice administered therapeutic doses of human islets. Mice not administered stage 6 cells had undetectable human insulin, and mice administered STZ had a dramatic decrease in mouse C-peptide compared to non-STZ-treated mice (see, e.g., FIGS. 11B-11C). Grafts from these STZ-treated mice contained cells expressing β-cell markers in addition to other endocrine and exocrine markers (see, e.g., FIG. 11D). Overall, this data indicates that stage 6 cells generated with the new protocol function at both early and late time points in vivo and significantly improve glucose tolerance to levels equivalent to those of non-STZ-treated mice.

[0148] Characterization of the dynamic function of SC-β cells: The differentiation protocol generated cells capable of dynamic insulin secretion, and this phenotype was studied in more detail. When the cells reached stage 6, dynamic GSIS was performed on the cells (see, for example, Fig. 4A). The robust dynamic function was transient, and at later time points (days 9 - 26), a large amount of insulin was secreted with distinct phase 1 and phase 2 responses, but the day 5 cells secreted a small amount of insulin and showed weak phase 1 and phase 2. During this period, the proportion of C - peptide+ cells decreased slightly (see, for example, Fig. 12A). By day 35, insulin secretion at low glucose increased, and it was difficult to clearly identify phase 1 and phase 2. This data indicates that SC - β cells require 9 days at stage 6 to acquire dynamic function, this function persists for several weeks, but glucose responsiveness is lost after extended in vitro culture. Similarly, cadaveric human islets are known to have a limited functional lifespan in vitro, and the cause is not clear. This data further suggests an optimal time frame for these cells to be used in transplantation and drug screening studies. To further characterize dynamic insulin secretion, perfusion experiments were performed to assay whether SC - β cells could respond to continuous challenges with several known secretagogues (see, for example, Fig. 4B). After the first high - glucose challenge, SC - β cells could respond to a second high - glucose - only challenge, although not more strongly than the first challenge, and insulin secretion did not decrease when the first glucose challenge was extended to 1 hour in another experiment (see, for example, Fig. 4C). When other secretagogues were added during the second challenge, insulin secretion further increased (see, for example, Fig. 4B). The membrane depolarizing agent KCl and L - arginine showed the largest increase. Tolbutamide (which blocks potassium channels), 3 - isobutyl - 1 - methylxanthine (IBMX; which raises cytosolic cAMP), and exendin - 4 (an agonist of the GLP - 1 receptor) also increased insulin secretion more than high glucose alone. Not only did insulin secretion increase, but it also rose faster than in the case of high glucose alone.However, the response of stage 6 cells to KCl challenge was stronger than that of human islets (see, e.g., FIG. 12B), and observations made by others comparing β-like cells to human islets likely indicate a continuous immature or juvenile β-cell phenotype. Collectively, these data indicate that SC-β cells have diverse mechanisms of action and can respond to several secretagogues that may be applicable to drug screening.

[0149] Role of TGFβ signaling in the differentiation and maturation of SC-β cells: After evaluating SC-β cells generated with the new protocol, changes to the protocol were examined to gain insights into the differentiation and maturation of SC-β cells. Inclusion of Alk5i during stage 6 resulted in relatively weak but statistically significant GSIS in static assays, but omission of Alk5i, as with data from the Pagliuca protocol (see, e.g., FIG. 1D), significantly increased insulin secretion and glucose stimulation (see, e.g., FIGS. 5A and 13A). Insulin content also increased with removal of Alk5i during stage 6 (see, e.g., FIG. 5B), but the proinsulin / insulin ratio remained similar (see, e.g., FIG. 5C), suggesting that the increase in insulin content was not due to hormonal treatment. Furthermore, the percentage of cells expressing pancreatic endocrine markers including C-peptide remained similar between DMSO-treated and Alk5i-treated cells (see, e.g., FIGS. 5D–5E, 13B). Gene expression was overall similar regardless of Alk5i treatment, and changes in cluster size typically had a greater effect (see, e.g., FIG. 13C). Cells treated with Alk5i during stage 6 also dramatically decreased insulin secretion in dynamic GSIS assays and, similar to cells generated with the Pagliuca protocol (see, e.g., FIG. 1F), showed weak or no first and second phase responses (see, e.g., FIG. 5F). This data indicates that Alk5i treatment at stage 6 inhibits the functional maturation of SC-β cells.

[0150] In the study of Alk5i at stage 6, since inhibition of TGFBR1 is the standard function of Alk5i, it was suggested that TGFβ signaling needs to be permitted for the robust functional maturation of SC-β cells. To test this hypothesis, Western blot analysis was used to verify that TGFβ signaling occurs in stage 6 cells via SMAD phosphorylation (see, for example, Fig. 6A). Alk5i treatment decreased phosphorylated SMAD, confirming that TGFβ signaling was indeed occurring and was inhibited by Alk5i. SMAD phosphorylation was observed in stage 6 clusters regardless of size change, consistent with the observation that GSIS decreased regardless of size change upon Alk5i treatment (see, for example, Fig. 14). Next, two lentiviruses (TGFBR1#1 and #2) carrying shRNAs designed to knockdown TGFBR1 were generated. These viruses were able to decrease TGFBR1 transcripts (see, for example, Fig. 6B) and decrease SMAD phosphorylation (see, for example, Fig. 6A) compared to a control virus targeting GFP in stage 6 cells, although to a much lesser extent than Alk5i treatment (see, for example, Figs. 6C, 14). Similar to Alk5i treatment (see, for example, Figs. 5A, 5F), stage 6 cells transduced with shRNA against TGFBR1 had decreased insulin secretion, decreased positive glucose responsiveness in a static GSIS assay (see, for example, Fig. 6C), and blunted glucose responsiveness in a dynamic GSIS assay (see, for example, Fig. 6D). This data indicates that enabling TGFβ signaling at stage 6 is important for the functional maturation of SC-β cells, which is inhibited by treatment with Alk5i.

[0151] Finally, the role of Alk5i was examined at differentiation stage 5 to evaluate the effect of Alk5i on differentiation into pancreatic endocrine cells. These experiments were conducted in the presence or absence of Alk5i as outlined in Figure 1A. Omission of Alk5i did not change the proportion of cells that differentiated into endocrine cells (CHGA+), but did decrease the proportion of cells that differentiated into the C-peptide+ phenotype (see, for example, Figures 7A-7C). Similarly, the proportion of cells co-expressing C-peptide and NKX6-1 (an important transcription factor for identifying β cells) decreased upon omission of Alk5i. INS and GCG gene expression decreased upon omission of Alk5i, but surprisingly, SST expression increased slightly (see, for example, Figure 7D). Expression of some pancreatic endocrine markers either did not change or changed only slightly (see, for example, Figure 7F), but expression of NKX6-1 and PDX1 decreased in the absence of Alk5i (see, for example, Figure 7E). To further test the importance of Alk5i at stage 5, cells treated or not treated with Alk5i at stage 5 were cultured for an additional 7 days at stage 6 without changing the cluster size in the absence of Alk5i, and insulin secretion was significantly higher in cells treated with Alk5i at stage 5 (see, for example, Figure 7G). Collectively, these data indicate that Alk5i treatment at stage 5 has a positive effect on specification towards β-like cell fate, is not required for specification of endocrine cells, and is required for the resulting high insulin secretion of SC-β cells. Furthermore, these observations demonstrate the importance of stage-specific treatment with the TGFβ signaling inhibitor Alk5i for both the generation and functional maturation of SC-β cells.

[0152] Discussion: This study shows that enhanced functional maturation of SC-β cells is achieved with a new six-stage differentiation strategy. These cells secrete large amounts of insulin, are glucose-responsive, and exhibit both first- and second-phase insulin release. This differentiation procedure generates a nearly pure endocrine cell population without selection or sorting, and most cells express C-peptide and other β-cell markers. When transplanted into STZ-treated mice, glucose tolerance rapidly recovers and the function persists for several months. These SC-β cells respond to multiple secretagogues in a perfusion assay. Modulation of TGFβ signaling is essential for success, inhibition at stage 5 increases SC-β cell differentiation, while inhibition at stage 6 decreases function and insulin content. Permissive TGFβ signaling at stage 6 was required for robust dynamic function.

[0153] Previously reported protocols 30,32 The SC-β cells generated by the previously reported protocol do not produce robust first- and second-phase insulin release in response to glucose stimulation. Both protocols inhibit TGFβ signaling at the final stage of differentiation, and many subsequent reports also include inhibitors of TGFβ signaling without demonstrating appropriate dynamic function. However, the main observation of this study is that correct modulation of TGFβ signaling at key cell migration and maturation stages is important for successful differentiation into functional SC-β cells, and that permissive TGFβ signaling is required for improved functional maturation at stage 6.

[0154] The SC-β cells in this report were able to rapidly control glucose in STZ-treated mice within 10 days. Currently, an important limitation of diabetic cell replacement therapy is the need for a sustainable source of functional β cells, and improving the quality of the transplanted SC-β cells would help overcome this challenge. The process for generating SC-β cells demonstrated in this study is scalable, and the cells grow and differentiate as clusters in suspension culture. Using cell clusters in suspension culture enables large-scale animal transplantation studies and therapies (10 9It can flexibly accommodate many applications, such as the order of individual cells.

[0155] This strategy enhances the utility of in vitro-differentiated SC-β cells for drug screening because of the improved kinetics. Appropriate dynamic insulin release is an important feature of β-cell metabolism that is commonly lost in diabetes. This study established a renewable source of SC-β cells with dynamic insulin release that can be used to better study the mechanisms of β-cell dysfunction in diabetes and demonstrated their responses to several secretagogues.

[0156] The integration of numerous changes to the protocol generated SC-β cells that exhibited a dynamic glucose response. In addition to the modulation of TGFβ signaling, other notable changes included the removal of serum, the reduction of cluster size, and the absence of several additional factors (T3, N-acetylcysteine, trolox, and R428) used in other reports at the final stage. This study demonstrated the reproducibility of the protocol across multiple cell lines, although marker expression and function were maximal in the HUES8 cell line.

[0157] Methods: Culture of undifferentiated cells: mTeSR1 was used to culture undifferentiated hPSC lines in 30 mL spinner flasks on a rotator stir plate that rotated at 60 RPM in a humidified 5% CO2 37 °C incubator. Cells were passaged every 3 - 4 days by single-cell dispersion. The HUES8 hESC line, 1013-4FA (non-diabetic hiPSC line), 1016SeVA (non-diabetic hiPSC line), and 1019SeVF (type 1 diabetes hiPSC line) have been previously published 26,30Using a rotator stir plate (Chemglass) rotating at 60 RPM in a humidified 5% CO2 37°C incubator, undifferentiated cells were cultured in a 30 mL spinner flask (REPROCELL; ABBWVS03A) with mTeSR1 (StemCell Technologies; 05850). Cells were passaged every 3 - 4 days by single cell dispersion using Accutase (StemCell Technologies; 07920), viable cells were counted with Vi-Cell XR (Beckman Coulter), and seeded at 6x105 cells / mL in mTeSR1 + 10 μM Y27632 (Abcam; ab120129).

[0158] Differentiation of cell lines: To initiate differentiation, undifferentiated cells were made into single cell dispersion using Accutase and seeded at 6x10 5Seeded at cells / mL. Next, the cells were cultured in mTeSR1 for 72 hours and then cultured in the following differentiation medium. Stage 1 (3 days): S1 medium + 100 ng / ml Activin A (R&D Systems: 338-AC) + 3 μM Chir99021 (Stemgent; 04-0004-10) for 1 day. S1 medium + 100 ng / ml Activin A for 2 days. Stage 2 (3 days): S2 medium + 50 ng / ml KGF (Peprotech; AF-100-19). Stage 3 (1 day): S3 medium + 50 ng / ml KGF + 200 nM LDN193189 (Reprocell; 040074) + 500 nM PdBU (MilliporeSigma; 524390) + 2 μM Retinoic acid (MilliporeSigma; R2625) + 0.25 μM Sant1 (MilliporeSigma; S4572) + 10 μM Y27632. Stage 4 (5 days): S4 medium + 5 ng / mL Activin A + 50 ng / mL KGF + 0.1 μM Retinoic acid + 0.25 μM SANT1 + 10 μM Y27632. Stage 5 (7 days): S5 medium + 10 μM ALK5iII (Enzo Life Sciences; ALX-270-445-M005) + 20 ng / mL Betacellulin (R&D Systems; 261-CE-050) + 0.1 μM Retinoic acid + 0.25 μM SANT1 + 1 μM T3 (Biosciences; 64245) + 1 μM XXI (MilliporeSigma; 595790). Stage 6 (7 - 35 days): ESFM.

[0159] The composition of the differentiation medium used was as follows. S1 medium: 500 mL of MCDB131 (Cellgro; 15-100-CV) supplemented with 0.22 g of glucose (MilliporeSigma; G7528), 1.23 g of sodium bicarbonate (MilliporeSigma; S3817), 10 g of bovine serum albumin (BSA) (Proliant; 68700), 10 μL of ITS-X (Invitrogen; 51500056), 5 mL of GlutaMAX (Invitrogen; 35050079), 22 mg of vitamin C (MilliporeSigma; A4544), and 5 mL of penicillin / streptomycin (P / S) solution (Cellgro; 30-002-CI). S2 medium: 500 mL of MCDB131 supplemented with 0.22 g of glucose, 0.615 g of sodium bicarbonate, 10 g of BSA, 10 μL of ITS-X, 5 mL of GlutaMAX, 22 mg of vitamin C, and 5 mL of P / S. S3 medium: 500 mL of MCDB131 supplemented with 0.22 g of glucose, 0.615 g of sodium bicarbonate, 10 g of BSA, 2.5 mL of ITS-X, 5 mL of GlutaMAX, 22 mg of vitamin C, and 5 mL of P / S. S5 medium: 500 mL of MCDB131 supplemented with 1.8 g of glucose, 0.877 g of sodium bicarbonate, 10 g of BSA, 2.5 mL of ITS-X, 5 mL of GlutaMAX, 22 mg of vitamin C, 5 mL of P / S, and 5 mg of heparin (MilliporeSigma; A4544). ESFM: 500 mL of MCDB131 supplemented with 0.23 g of glucose, 10.5 g of BSA, 5.2 mL of GlutaMAX, 5.2 mL of P / S, 5 mg of heparin, 5.2 mL of MEM non-essential amino acids (Corning; 20-025-CI), 84 μg of ZnSO4 (MilliporeSigma; 10883), 523 μL of trace element A (Corning; 25-021-CI), and 523 μL of trace element B (Corning; 25-022-CI). The cells were sometimes cultured with 0.01% DMSO.Incubate with Gentle Cell Dissociation Reagent (StemCell Technologies; 07174) for 8 minutes, wash with ESFM, pass through a 100 μm nylon cell strainer (Corning; 431752), and then culture in ESFM in a well plate on an Orbi-Shaker (Benchmark) set at 100 RPM for 6 minutes to change the cell size on day 1 of stage 6. Unless otherwise specified, the assessment assays were performed between days 10 - 16 of stage 6. For comparison, human islets were obtained from ProdoLabs. A subset of stage 6 experiments was performed without changing the cluster size with Alk5i and T3, Alk5i, and / or CMRL 1066 Supplement (CMRLS) (Mediatech; 99 - 603 - CV) + 10% fetal bovine serum (FBS) (HyClone; 16777) + 1% P / S (not ESFM as indicated). To execute the Pagliuca protocol, Pagliuca, Millman, Guertler et al., 2014. 30 Followed the protocol outlined in 30 with a 30 mL spinner flask.

[0160] Optical microscopy: Using an inverted optical microscope (Leica DMi1), obtain optical microscope images of cell clusters that were either unstained or stained with 2.5 μg / mL DTZ (MilliporeSigma; 194832).

[0161] Immunostaining: To immunostain in vitro cell clusters or ex vivo grafts in mouse kidneys, samples were fixed overnight at 4°C with 4% paraformaldehyde (Electron Microscopy Science; 15714). After fixation, cell clusters were embedded in Histogel (Thermo Scientific; hg-4000-012). The embedded cell clusters and grafts were placed in 70% ethanol and subjected to paraffin embedding and sectioning. Paraffin was removed using Histoclear (Thermo Scientific; C78-2-G), samples were rehydrated, and antigens were retrieved using 0.05 M EDTA (Ambion; AM9261) in a pressure cooker (Proteogenix; 2100 Retriever). Samples were blocked, permeabilized for 30 minutes with a staining buffer (5% donkey serum in PBS (Jackson Immunoresearch; 017-000-121) and 0.1% Triton-X 100 (Acros Organics; 327371000)), stained overnight at 4°C with a primary antibody, stained for 2 hours at 4°C with a secondary antibody, and treated with mounting solution DAPI Fluoromount-G (SouthernBiotech; 0100-20). To immunostain plated cells, clusters were dispersed into single cells using TryplE Express (Fisher, 12604039), plated onto plates coated with Matrigel (Fisher, 356230), cultured in ESFM for 16 hours, and fixed with 4% paraformaldehyde for 30 minutes at room temperature. Fixed cells were blocked, permeabilized for 45 minutes at room temperature with a staining buffer, stained overnight at 4°C with a primary antibody, stained for 2 hours at room temperature with a secondary antibody, and stained with DAPI for 5 minutes. Imaging was performed using a Nikon A1Rsi confocal microscope or a Leica DMI4000 fluorescence microscope.

[0162] The primary antibody solution was prepared in staining buffer containing the following antibodies diluted 1:300 unless otherwise specified: rat anti-C-peptide (DSHB; GN-ID4-S), mouse anti-nkx6.1 (DSHB, F55A12-S), mouse anti-glucagon (ABCAM; ab82270), goat anti-pdx1 (R&D Systems; AF2419), rabbit anti-somatostatin (ABCAM; ab64053), mouse anti-pax6 (BD Biosciences; 561462), rabbit anti-chromogranin a (ab15160), goat anti-neurod1 (R&D Systems; AF2746), mouse anti-Islet1 (DSHB, 40.2d6-s), mouse anti-cytokeratin 19 diluted 1:100 (Dako; MO888), undiluted rabbit anti-glucagon (Cell Marque; 259A-18), sheep anti-trypsin diluted 1:100 (R&D Systems; AF3586). The secondary antibody solution was prepared in staining buffer containing the following antibodies diluted 1:300: anti-rat alexa fluor488 (Invitrogen; a21208), anti-mouse alexa fluor594 (Invitrogen; a21203), anti-rabbit alexa fluor594 (Invitrogen; a21207), anti-goat alexa fluor594 (Invitrogen; a11058).

[0163] Static GSIS: Collect approximately 20 - 30 stage 6 clusters or cadaveric human islets, wash twice with KRB buffer (128 mM NaCl, 5 mM KCl, 2.7 mM CaCl2, 1.2 mM MgSO4, 1 mM Na2HPO4, 1.2 mM KH2PO4, 5 mM NaHCO3, 10 mM HEPES (Gibco; 15630 - 080), and 0.1% BSA), resuspend in 2 mM glucose KRB, and place in the transwell of a 24 - well plate (Corning; 431752) to perform the assay. Incubate the clusters in 2 mM glucose KRB for 1 hour for equilibration. Next, drain the transwell, transfer to a new 2 mM glucose KRB well, and discard the old KRB solution. Incubate the clusters again in low glucose for 1 hour, then drain the transwell and transfer to new 2, 5.6, 11.1, or 20 mM glucose KRB wells while retaining the old 2 mM glucose KRB. Next, incubate the clusters in high glucose for 1 hour, then drain the transwell and retain the old glucose KRB. Perform Human Insulin Elisa (ALPCO; 80 - INSHU - E10.1) on the retained KRB to quantify insulin secretion. Disperse the cells into single cells by TrypLE treatment, count with Vi - Cell XR, and normalize insulin secretion using the viable cell number.

[0164] Dynamic glucose - stimulated insulin secretion: As previously reported 5, a perfusion system was assembled. In this system, a high-precision 8-channel dispenser pump (ISMATEC; ISM931C) combined with 0.015-inch inlet and outlet 2-stop tubes (ISMATEC; 070602-04i-ND) connected to a 275 μl cell chamber (BioRep; Peri-Chamber), and a dispensing nozzle (BioRep; PERI-NOZZLE) using a 0.04-inch connecting tube (BioRep; Peri-TUB-040) were used. Solutions, tubes, and cells were maintained at 37 °C in a water bath. Clusters and cadaveric human islets at stage 6 were washed twice with KRB and resuspended in 2 mM glucose KRB. Next, the cells were loaded into a Biorep perfusion chamber sandwiched between two layers of Bio-Gel P-4 polyacrylamide beads (Bio-Rad; 150-4124). The cells were perfused with 2 mM glucose KRB for 90 minutes before collecting samples for equilibration. For a single high glucose challenge, sample collection was started with cells exposed to 2 mM glucose KRB for 12 minutes, followed by exposure to 20 mM glucose KRB for 24 minutes, and then back to 2 mM glucose KRB for 12 minutes. For a challenge with multiple secretagogues, sample collection was started with cells exposed to 2 mM glucose KRB for 6 minutes, followed by 12 minutes of 20 mM glucose KRB, 6 minutes of 2 mM glucose KRB, 12 minutes of 20 mM glucose KRB plus treatment, and finally 6 minutes of 2 mM glucose KRB. Treatment with multiple secretagogues was as follows: 20 mM glucose only, 10 nM exendin-4 (MilliporeSigma; E7144), 100 μM IBMX (MilliporeSigma; I5879), 300 μM tolbutamide (MilliporeSigma; T0891), 20 mM L-arginine (MilliporeSigma; A5006), and 30 mM KCl (Thermo Fisher; BP366500). The effluent was collected at a flow rate of 100 μl / min at collection points of 2 - 4 minutes.After sample collection, clusters were collected and lysed in 10 mM Tris (MilliporeSigma; T6066), 1 mM EDTA, and 0.2% Triton-X 100 solution, and DNA was quantified using the Quant-iT Picogreen dsDNA assay kit (Invitrogen; P7589). Insulin secretion was quantified using the Human Insulin Elisa kit.

[0165] Flow cytometry: Clusters were dispersed into single cells with TrypLE, fixed with 4% paraformaldehyde at 4 °C for 30 minutes, blocked and permeabilized with staining buffer at 4 °C for 30 minutes, incubated overnight at 4 °C with the primary antibody in staining buffer, and incubated with the secondary antibody in staining buffer at 4 °C for 2 hours, resuspended in staining buffer, and then analyzed with LSRII (BD Biosciences) or X-20 (BD Biosciences). Dot plots and percentages were generated using FlowJo. Unless otherwise specified, all antibodies were used at a 1:300 dilution. The antibodies used were rat anti-C-peptide, mouse anti-nkx6.1 (1:100), mouse anti-glucagon, rabbit anti-somatostatin, rabbit anti-chromogranin A (1:1000), goat anti-pdx1, anti-rat alexa fluor 488, anti-mouse alexa fluor 647 (Invitrogen; a31571), anti-rabbit alexa fluor 647 (Invitrogen; a31573), anti-goat alexa fluor 647 (Invitrogen; a21447), anti-rabbit alexa fluor 488 (Invitrogen; a21206).

[0166] Real-time PCR: RNA was extracted using the RNeasy Mini Kit (Qiagen; 74016) with DNase treatment (Qiagen; 79254), and cDNA was synthesized using the High Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems; 4368814). Real-time PCR reactions were performed with the PowerUp SYBR Green Master Mix (Applied Biosystems; A25741) on StepOnePlus (Applied Biosystems) and analyzed using the ΔΔCt method. TBP was used as the normalization gene.

[0167]

Table 1

[0168] Transplantation study: All animal experiments were conducted in accordance with the rules of the University of Washington's International Animal Care and Use Committee. Mice were randomly assigned to either the transplantation group or the non-transplantation group, and the number of mice was selected to be sufficient to allow statistical significance based on previous studies. All procedures were performed by individuals who were not blinded. In this study, two mouse cohorts were used. The first group consisted of 50 - 56-day-old non-STZ-treated SCID / Beige male mice purchased from Charles River. The second group consisted of 6-week-old STZ-treated and control-treated NOD / SCID male mice purchased from Jackson Laboratories. As previously reported, the mice were anesthetized with isoflurane and approximately 5x10 6Stage 6 cells or saline (no transplant control) were injected. Mice were monitored up to 6 months after transplantation by performing a glucose tolerance test and in vivo GSIS. Mice were fasted for 16 hours and then injected with 2 g / kg of glucose. Blood was collected by tail bleed. Blood glucose levels were measured using a handheld glucometer (Contour Blood Glucose Monitoring System Model 9545C; Bayer). Human insulin was determined by collecting blood, separating serum in a microvette (Sarstedt; 16.443.100), and quantifying using a Human Ultrasensitive Insulin ELISA (ALPCO Diagnostics; 80-ENSHUU-E01.1). Serum mouse C-peptide concentration was determined by collecting blood from fed mice, separating serum in a microvette, and quantifying using a Mouse C-peptide ELISA (ALPCO Diagnostics; 80-CPTMS-E01).

[0169] Content of insulin and proinsulin: Stage 6 clusters were washed thoroughly with PBS, immersed in a solution of 1.5% HCl and 70% ethanol, held at -20 °C for 24 hours, recovered and vortexed vigorously, returned, maintained at -20 °C for an additional 24 hours, recovered and vortexed vigorously, and then centrifuged at 2100 RCF for 15 minutes. The supernatant was recovered and neutralized with an equal volume of 1 M TRIS (pH 7.5). The human insulin and proinsulin contents were quantified using a Human Insulin Elisa and a Proinsulin Elisa (Mercodia; 10-1118-01), respectively. Cells were normalized to the number of viable cells created using Vi-CellXR.

[0170] Western blot: After washing with PBS, the protein was added to Western blot lysis buffer consisting of 50 mM HEPES, 140 mM NaCl (MilliporeSigma; 7647-14-5), 1 mM EDTA (MilliporeSigma; 1233508), 1% Triton X-100, 0.1% Na-deoxycholate (MilliporeSigma: D6750), 0.1% SDS (ThermoScientific; 24730020), 1 mM Na3VO4 (MilliporeSigma; 450243), 10 mM NaF (MilliporeSigma; S7920), and 1% protease inhibitor cocktail (MilliporeSigma; p8340), incubated on a shaker at 4°C for 15 minutes, and then centrifuged at 10000 RCF for 10 minutes at 4°C to extract the protein from the cell clusters. The amount of protein was quantified using Pierce BCA Protein Assay (Thermo Scientific; 23228). Protein (30 μg) was loaded onto a 4-20% gradient polyacrylamide gel (Invitrogen; SP04200BOX), separated by electrophoresis, and transferred to a 0.45 μm nitrocellulose membrane (BioRad; 1620115). The nitrocellulose membrane was blocked with blotting grade blocker (BioRad; 170-6404), and incubated overnight at 4°C in the blocker with rabbit anti-phospho-SMAD2 / 3 1:1000 (Cell Signaling Technologies; 8828) antibody and rabbit anti-actin 1:1000 (Santa Cruz Biotechnology; SC1616) antibody. The membrane was washed and stained with rabbit secondary antibody 1:2500 (Jackson Immuno Research Laboratories; 211-032-171) in the blocker for 2 hours at 4°C, and developed using SuperSignal West Femto (Thermo Scientific; 34096). Images were taken with Odyssey FC (Li-COR).After imaging, the nitrocellulose membrane was stripped using Restore Western Blot Stripping Buffer (Thermo Scientific; 21059), incubated overnight at 4°C with rabbit anti-SMAD2 / 3 (Cell Signaling Technologies; 8685) antibody, washed and stained at 4°C for 2 hours with rabbit secondary antibody 1:2500 in the blocker, developed using SuperSignal West Femto, and imaged using Odyssey FC.

[0171] Lentivirus: The pLKO.1TRC plasmid containing the shRNA sequence contained the following sequences: shRNA GFP, GCGCGATCACATGGTCCTGCT (SEQ ID NO: 89); shRNA TGFBR1#1, GATCATGATTACTGTCGATAA (SEQ ID NO: 90); shRNA TGFBR1#2, GCAGGATTCTTTAGGCTTTAT (SEQ ID NO: 91). Lentiviral particles were generated and titrated using pMD-Lgp / RRE and pCMV-G, and the RSV-REV packaging plasmid containing the shRNA. The cells on day 1 of stage 6 were dispersed into single cells using TrypLE, and 3 million cells were seeded onto 4 mL of ESFM lentiviral particles at an MOI of 3 - 5 on a shaker. The transduced cells were washed with fresh ESFM 16 hours after transduction. RNA extraction and static GSIS were performed on day 13 of stage 6.

[0172] Statistical analysis: Statistical significance was calculated using GraphPad Prism with the indicated statistical tests. The slope and error of the slope were calculated using the LINEST function in Excel. As shown, unless otherwise specified or for box-and-whisker showing the minimum to maximum point range, the data are shown as mean ± SEM. n represents the total number of independent experiments.

[0173] References: 1. Amin, S., Cook, B., Zhou, T., Ghazizadeh, Z., Lis, R., Zhang, T., Khalaj, M., Crespo, M., Perera, M., Xiang, J.Z. et al. (2018). Discovery of a drug candidate for GLIS3-associated diabetes. Nat Commun 9, 2681. 2. Arda, H.E., Li, L., Tsai, J., Torre, E.A., Rosli, Y., Peiris, H., Spitale, R.C., Dai, C., Gu, X., Qu, K. et al. (2016). Age-Dependent Pancreatic Gene Regulation Reveals Mechanisms Governing Human beta Cell Function. Cell metabolism 23, 909-920. 3. Baron, M., Veres, A., Wolock, S.L., Faust, A.L., Gaujoux, R., Vetere, A., Ryu, J.H., Wagner, B.K., Shen-Orr, S.S., Klein, A.M. et al. (2016). A Single-Cell Transcriptomic Map of the Human and Mouse Pancreas Reveals Inter- and Intra-cell Population Structure. Cell Syst. 4. Bellin, M.D., Barton, F.B., Heitman, A., Harmon, J.V., Kandaswamy, R., Balamurugan, A.N., Sutherland, D.E., Alejandro, R., and Hering, B.J. (2012). Potent induction immunotherapy promotes long-term insulin independence after islet transplantation in type 1 diabetes. Am J Transplant 12, 1576-1583.

[0174] 5. Bentsi-Barnes, K., Doyle, M.E., Abad, D., Kandeel, F., and Al-Abdullah, I. (2011). Detailed protocol for evaluation of dynamic perifusion of human islets to assess beta-cell function. Islets 3, 284-290. 6. Blum, B., Roose, A.N., Barrandon, O., Maehr, R., Arvanites, A.C., Davidow, L.S., Davis, J.C., Peterson, Q.P., Rubin, L.L., and Melton, D.A. (2014). Reversal of beta cell de-differentiation by a small molecule inhibitor of the TGFbeta pathway. eLife 3, e02809. 7. Bonner-Weir, S., and Weir, G.C. (2005). New sources of pancreatic beta-cells. Nature biotechnology 23, 857-861. 8. Bruin, J.E., Asadi, A., Fox, J.K., Erener, S., Rezania, A., and Kieffer, T.J. (2015). Accelerated Maturation of Human Stem Cell-Derived Pancreatic Progenitor Cells into Insulin-Secreting Cells in Immunodeficient Rats Relative to Mice. Stem cell reports 5, 1081-1096. 9. Caumo, A., and Luzi, L. (2004). First-phase insulin secretion: does it exist in real life? Considerations on shape and function. Am J Physiol Endocrinol Metab 287, E371-385. 10. D'Amour, K., Bang, A., Eliazer, S., Kelly, O., Agulnick, A., Smart, N., Moorman, M., Kroon, E., Carpenter, M., and Baetge, E. (2006). Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nature biotechnology 24, 1392-1793. 11. D'Amour, K.A., Agulnick, A.D., Eliazer, S., Kelly, O.G., Kroon, E., and Baetge, E.E. (2005). Efficient differentiation of human embryonic stem cells to definitive endoderm. Nature biotechnology 23, 1534-1541.

[0175] 12. Del Prato, S., and Tiengo, A. (2001). The importance of first-phase insulin secretion: implications for the therapy of type 2 diabetes mellitus. Diabetes / metabolism research and reviews 17, 164-174. 13. Dhawan, S., Dirice, E., Kulkarni, R.N., and Bhushan, A. (2016). Inhibition of TGF-beta Signaling Promotes Human Pancreatic beta-Cell Replication. Diabetes 65, 1208-1218. 14. Ghazizadeh, Z., Kao, D.I., Amin, S., Cook, B., Rao, S., Zhou, T., Zhang, T., Xiang, Z., Kenyon, R., Kaymakcalan, O. et al. (2017). ROCKII inhibition promotes the maturation of human pancreatic beta-like cells. Nat Commun 8, 298. 15. Hering, B.J., Clarke, W.R., Bridges, N.D., Eggerman, T.L., Alejandro, R., Bellin, M.D., Chaloner, K., Czarniecki, C.W., Goldstein, J.S., Hunsicker, L.G. et al. (2016). Phase 3 Trial of Transplantation of Human Islets in Type 1 Diabetes Complicated by Severe Hypoglycemia. Diabetes Care 39, 1230-1240. 16. Hrvatin, S., O'Donnell, C.W., Deng, F., Millman, J.R., Pagliuca, F.W., DiIorio, P., Rezania, A., Gifford, D.K., and Melton, D.A. (2014). Differentiated human stem cells resemble fetal, not adult, beta cells. Proceedings of the National Academy of Sciences of the United States of America 111, 3038-3043. 17. Kayton, N.S., Poffenberger, G., Henske, J., Dai, C., Thompson, C., Aramandla, R., Shostak, A., Nicholson, W., Brissova, M., Bush, W.S. et al. (2015). Human islet preparations distributed for research exhibit a variety of insulin-secretory profiles. Am J Physiol Endocrinol Metab 308, E592-602. 18. Kroon, E., Martinson, L., Kadoya, K., Bang, A., Kelly, O., Eliazer, S., Young, H., Richardson, M., Smart, N., Cunningham, J. et al. (2008). Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nature biotechnology 26, 443-495.

[0176] 19. Kudva, Y.C., Ohmine, S., Greder, L.V., Dutton, J.R., Armstrong, A., De Lamo, J.G., Khan, Y.K., Thatava, T., Hasegawa, M., Fusaki, N. et al. (2012). Transgene-Free Disease-Specific Induced Pluripotent Stem Cells from Patients with Type 1 and Type 2 Diabetes. Stem Cell Transl Med 1, 451-461. 20. Lacy, P.E., and Kostianovsky, M. (1967). Method for the isolation of intact islets of Langerhans from the rat pancreas. Diabetes 16, 35-39. 21. Lin, H.M., Lee, J.H., Yadav, H., Kamaraju, A.K., Liu, E., Zhigang, D., Vieira, A., Kim, S.J., Collins, H., Matschinsky, F. et al. (2009). Transforming growth factor-beta / Smad3 signaling regulates insulin gene transcription and pancreatic islet beta-cell function. The Journal of biological chemistry 284, 12246-12257. 22. Lyon, J., Manning Fox, J.E., Spigelman, A.F., Kim, R., Smith, N., O'Gorman, D., Kin, T., Shapiro, A.M., Rajotte, R.V., and MacDonald, P.E. (2016). Research-Focused Isolation of Human Islets From Donors With and Without Diabetes at the Alberta Diabetes Institute IsletCore. Endocrinology 157, 560-569. 23. Maehr, R., Chen, S., Snitow, M., Ludwig, T., Yagasaki, L., Goland, R., Leibel, R.L., and Melton, D.A. (2009). Generation of pluripotent stem cells from patients with type 1 diabetes. Proceedings of the National Academy of Sciences of the United States of America 106, 15768-15773. 24. Mathers, C.D., and Loncar, D. (2006). Projections of global mortality and burden of disease from 2002 to 2030. PLoS Med 3, e442. 25. McCall, M., and Shapiro, A.M. (2012). Update on islet transplantation. Cold Spring Harb Perspect Med 2, a007823.

[0177] 26. Millman, J.R., and Pagliuca, F.W. (2017). Autologous Pluripotent Stem Cell-Derived beta-Like Cells for Diabetes Cellular Therapy. Diabetes 66, 1111-1120. 27. Millman, J.R., Xie, C., Van Dervort, A., Gurtler, M., Pagliuca, F.W., and Melton, D.A. (2016). Generation of stem cell-derived beta-cells from patients with type 1 diabetes. Nat Commun 7, 11463. 28. Nathan, D.M. (1993). Long-term complications of diabetes mellitus. N Engl J Med 328, 1676-1685. 29. Nostro, M.C., Sarangi, F., Yang, C., Holland, A., Elefanty, A.G., Stanley, E.G., Greiner, D.L., and Keller, G. (2015). Efficient Generation of NKX6-1(+) Pancreatic Progenitors from Multiple Human Pluripotent Stem Cell Lines. Stem cell reports 4, 591-604. 30. Pagliuca, F.W., Millman, J.R., Gurtler, M., Segel, M., Van Dervort, A., Ryu, J.H., Peterson, Q.P., Greiner, D., and Melton, D.A. (2014). Generation of functional human pancreatic beta cells in vitro. Cell 159, 428-439. 31. Petersen, M.B.K., Azad, A., Ingvorsen, C., Hess, K., Hansson, M., Grapin-Botton, A., and Honore, C. (2017). Single-Cell Gene Expression Analysis of a Human ESC Model of Pancreatic Endocrine Development Reveals Different Paths to beta-Cell Differentiation. Stem cell reports 9, 1246-1261. 32. Rezania, A., Bruin, J.E., Arora, P., Rubin, A., Batushansky, I., Asadi, A., O'Dwyer, S., Quiskamp, N., Mojibian, M., Albrecht, T. et al. (2014). Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nature biotechnology 32, 1121-1133. 33. Rezania, A., Bruin, J.E., Riedel, M.J., Mojibian, M., Asadi, A., Xu, J., Gauvin, R., Narayan, K., Karanu, F., O'Neil, J.J. et al. (2012). Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes 61, 2016-2029.

[0178] 34. Rezania, A., Bruin, J.E., Xu, J., Narayan, K., Fox, J.K., O'Neil, J.J., and Kieffer, T.J. (2013). Enrichment of human embryonic stem cell-derived NKX6.1-expressing pancreatic progenitor cells accelerates the maturation of insulin-secreting cells in vivo. Stem Cells 31, 2432-2442. 35. Rieck, S., Bankaitis, E.D., and Wright, C.V. (2012). Lineage determinants in early endocrine development. Seminars in cell & developmental biology 23, 673-684. 36. Russ, H.A., Parent, A.V., Ringler, J.J., Hennings, T.G., Nair, G.G., Shveygert, M., Guo, T., Puri, S., Haataja, L., Cirulli, V. et al. (2015). Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. The EMBO journal 34, 1759-1772. 37. Scharp, D.W., Lacy, P.E., Santiago, J.V., McCullough, C.S., Weide, L.G., Falqui, L., Marchetti, P., Gingerich, R.L., Jaffe, A.S., Cryer, P.E. et al. (1990). Insulin independence after islet transplantation into type I diabetic patient. Diabetes 39, 515-518. 38. Seino, S., Shibasaki, T., and Minami, K. (2011). Dynamics of insulin secretion and the clinical implications for obesity and diabetes. The Journal of clinical investigation 121, 2118-2125. 39. Shang, L., Hua, H., Foo, K., Martinez, H., Watanabe, K., Zimmer, M., Kahler, D.J., Freeby, M., Chung, W., LeDuc, C. et al. (2014). beta-cell dysfunction due to increased ER stress in a stem cell model of Wolfram syndrome. Diabetes 63, 923-933. 40. Shapiro, A.M., Lakey, J.R., Ryan, E.A., Korbutt, G.S., Toth, E., Warnock, G.L., Kneteman, N.M., and Rajotte, R.V. (2000). Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 343, 230-238.

[0179] 41. Shapiro, A.M., Ricordi, C., Hering, B.J., Auchincloss, H., Lindblad, R., Robertson, R.P., Secchi, A., Brendel, M.D., Berney, T., Brennan, D.C. et al. (2006). International trial of the Edmonton protocol for islet transplantation. N Engl J Med 355, 1318-1330. 42. Simsek, S., Zhou, T., Robinson, C.L., Tsai, S.Y., Crespo, M., Amin, S., Lin, X., Hon, J., Evans, T., and Chen, S. (2016). Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells. Stem Cells Transl Med 5, 572-579. 43. Song, J., and Millman, J.R. (2016). Economic 3D-printing approach for transplantation of human stem cell-derived beta-like cells. Biofabrication 9, 015002. 44. Stokes, A., and Preston, S.H. (2017). Deaths Attributable to Diabetes in the United States: Comparison of Data Sources and Estimation Approaches. PLoS One 12, e0170219. 45. Sui, L., Danzl, N., Campbell, S.R., Viola, R., Williams, D., Xing, Y., Wang, Y., Phillips, N., Poffenberger, G., Johannesson, B. et al. (2018). beta-Cell Replacement in Mice Using Human Type 1 Diabetes Nuclear Transfer Embryonic Stem Cells. Diabetes 67, 26-35. 46. Teo, A.K., Windmueller, R., Johansson, B.B., Dirice, E., Njolstad, P.R., Tjora, E., Raeder, H., and Kulkarni, R.N. (2013). Derivation of human induced pluripotent stem cells from patients with maturity onset diabetes of the young. The Journal of biological chemistry 288, 5353-5356. 47. Tomei, A.A., Villa, C., and Ricordi, C. (2015). Development of an encapsulated stem cell-based therapy for diabetes. Expert Opin Biol Ther 15, 1321-1336.

[0180] 48. Totsuka, Y., Tabuchi, M., Kojima, I., Eto, Y., Shibai, H., and Ogata, E. (1989). Stimulation of insulin secretion by transforming growth factor-beta. Biochem Biophys Res Commun 158, 1060-1065. 49. Tritschler, S., Theis, F.J., Lickert, H., and Bottcher, A. (2017). Systematic single-cell analysis provides new insights into heterogeneity and plasticity of the pancreas. Molecular metabolism 6, 974-990. 50. Vegas, A.J., Veiseh, O., Gurtler, M., Millman, J.R., Pagliuca, F.W., Bader, A.R., Doloff, J.C., Li, J., Chen, M., Olejnik, K. et al. (2016). Long-term glycemic control using polymer-encapsulated human stem cell-derived beta cells in immune-competent mice. Nat Med 22, 306-311. 51. Weir, G.C., Cavelti-Weder, C., and Bonner-Weir, S. (2011). Stem cell approaches for diabetes: towards beta cell replacement. Genome Med 3, 61. 52. Xin, Y., Kim, J., Okamoto, H., Ni, M., Wei, Y., Adler, C., Murphy, A.J., Yancopoulos, G.D., Lin, C., and Gromada, J. (2016). RNA Sequencing of Single Human Islet Cells Reveals Type 2 Diabetes Genes. Cell metabolism 24, 608-615. 53. Zeng, H., Guo, M., Zhou, T., Tan, L., Chong, C.N., Zhang, T., Dong, X., Xiang, J.Z., Yu, A.S., Yue, L. et al. (2016). An Isogenic Human ESC Platform for Functional Evaluation of Genome-wide-Association-Study-Identified Diabetes Genes and Drug Discovery. Cell stem cell 19, 326-340. 54. Zhang, C.Y., Baffy, G., Perret, P., Krauss, S., Peroni, O., Grujic, D., Hagen, T., Vidal-Puig, A.J., Boss, O., Kim, Y.B. et al. (2001). Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 105, 745-755. 55. Zhu, S., Russ, H.A., Wang, X., Zhang, M., Ma, T., Xu, T., Tang, S., Hebrok, M., and Ding, S. (2016). Human pancreatic beta-like cells converted from fibroblasts. Nat Commun 7, 10080.

[0181] Example 2 Cytoskeletal regulation of human pancreatic cell growth and decline: In the following examples, the modulation of the cytoskeleton to promote pancreatic differentiation will be described. The method of cytoskeletal modulation can be used to generate cells of several lineages, not just pancreatic cells. Further, this example describes a method for generating insulin-producing beta-like cells from human pluripotent stem cells (hPSCs) for disease modeling for type 1 diabetes (T1D) cell replacement therapy and drug screening.

[0182] Recent progress has been made in the differentiation of human pluripotent stem cells (hPSCs) into insulin-producing β cells, with cell replacement therapy for insulin-dependent diabetes as the ultimate goal. These approaches utilize the addition of soluble factors to activate developmental signaling pathways and drive pancreatic specification. Interestingly, all currently successful protocols require three-dimensional cell aggregation, but the reason for this requirement is unclear. This study establishes a link between the microenvironment and the state of the actin cytoskeleton with the expression of key pancreatic transcription factors driving pancreatic lineage specification. The results obtained indicate that temporal control of the actin cytoskeleton strongly influences the choice of cell fate towards the endodermal lineage. Using a combination of cell-biomaterial interactions and the actin depolymerizing agent latrunculin A, a new two-dimensional differentiation protocol was developed to generate highly reproducible stem cell-derived β (SC-β) cells in several hPSC lines capable of robust dynamic glucose-stimulated insulin secretion. Furthermore, this study shows that these SC-β cells can rapidly reverse severe pre-existing diabetes in mice.

[0183] Introduction: Recent development of protocols for the generation of SC-β cells has provided hope for cell-based therapies for the treatment of diabetes. These differentiation strategies rely on the precise activation and inhibition of specific developmental pathways by soluble growth factors and small molecules to achieve the fate of functional SC-β cells. Interestingly, all successful SC-β cell protocols currently require the use of three-dimensional cell arrangements as suspension clusters or aggregates on the air-liquid interface to differentiate pancreatic progenitor cells into SC-β cells. The reason for this requirement was unclear, especially in understanding the influence of the insoluble microenvironment on the choice of pancreatic fate.

[0184] Current methods for generating SC-β cells differentiate hPSCs through intermediate definitive endoderm and pancreatic progenitor cell stages. Given the appropriate signals, these progenitor cells can generate non-pancreatic lineages such as intestinal and hepatocyte (liver cells). Within the pancreatic lineage, non-β cell multi-hormonal cells are generated when endocrine genes such as NEUROG3 are induced early prior to the induction of NKX6-1+ pancreatic progenitor cells. Complete differentiation to SC-β cell fate has only been achieved in three-dimensional cell arrays, although induction of this NKX6-1+ phenotype has been demonstrated in both two-dimensional and three-dimensional cell cultures.

[0185] Cells can sense their surrounding microenvironment through transmembrane proteins called integrins, and different combinations of α and β integrin subunits determine the extracellular matrix (ECM) proteins to which specific cells can attach. Integrins bound to ECM proteins form clusters, recruit other adhesion proteins that function as anchors for the assembly of the actin cytoskeleton, and provide a means for cells to generate mechanical forces. These forces not only enable cells to move and change shape, but can also be converted into intracellular biochemical signaling. Specific material properties of the ECM substrate can dramatically affect this response by varying the degree of actin polymerization. For example, matrix stiffness, shape, and adhesion density have all been shown to direct the differentiation of stem cells. However, this concept of manipulating the cytoskeleton has not been widely applied to the differentiation of definitive endoderm lineages.

[0186] Here, this study identifies that the state of the actin cytoskeleton is important for the choice of endoderm cell fate. In the context of SC-β cells, the cytoskeletal state greatly influences the endocrine induction mediated by NEUROG3 and subsequent specification of SC-β cells. By utilizing the combination of cell-biomaterial interactions and small molecule regulators of the actin cytoskeleton, a two-dimensional protocol was developed to control the timing of expression of endocrine transcription factors, modulate the fate of differentiation, and generate SC-β cells. Importantly, this new planar protocol significantly enhances the function of SC-β cells differentiated from induced pluripotent stem cell (iPSC) lines and eliminates the need for three-dimensional cell arrays. Different degrees of actin polymerization at specific time points of differentiation cause cells to bias towards different endoderm lineages, and thus, a suboptimal cytoskeletal state results in significant inefficiency in the specification of SC-β cells. Furthermore, this study demonstrates that this concept of controlling actin polymerization can be applied to the directed differentiation of these other endoderm cell fates to modulate lineage specification.

[0187] Results: The actin cytoskeleton controls the maintenance of progenitor cells expressing PDX1: To better understand the role of the microenvironment in SC-β cell differentiation, stage 3 PDX1+ pancreatic progenitor cells were generated using a suspension-based differentiation protocol, a single cell dispersion was made from these clusters, and the cells were seeded onto tissue culture polystyrene (TCP) plates coated with a variety of ECM proteins (see, e.g., FIGS. 15a-15b, 21a). This stage of the protocol is designed to generate NKX6-1+ pancreatic progenitor cells, but stage 5 then initiates endocrine induction of these progenitor cells by inducing NEUROG3. The most prominent observation from these experiments was that plating cells on most ECM proteins during stage 4 prevented premature expression of NEUROG3 compared to normal suspension clusters, but expression increased significantly when cells were re-aggregated into clusters after single cell dispersion (see, e.g., FIGS. 15c, 21b). The downstream targets of NEUROG3, NKX2.2 and NEUROD1, followed the same decreasing trend, but SOX9 expression increased (see, e.g., FIGS. 15c, 21b). Interestingly, the ECM protein that induced the highest NEUROG3 expression was laminin 211, which corresponded to insufficient cell adhesion (see, e.g., FIG. 21b). Colorimetric antibody-based integrin adhesion assays at the start and end of stage 4 confirmed high expression of integrin subunits that bind to collagen I and IV (α1, α2, β1), fibronectin (αV, β1, α5β1), vitronectin (αV, β1, αVβ5) and some, but not all, laminin isoforms (α3, β1) (see, e.g., FIG. 21c). Thus, strong adhesion to the culture surface, rather than the composition of specific ECM protein coatings, prevented premature endocrine induction at stage 4.

[0188] One of the major differences between culturing floating cells as clusters compared to plating cells on TCP plates is that there is a large difference in the substrate stiffness experienced by each cell. To test the effect of substrate stiffness on endocrine induction, pancreatic progenitor cells expressing PDX1 were plated on type I collagen gels of various heights attached to TCP plates, as decreasing the height of the gel increases the effective stiffness experienced by the cells. Increasing the height of the gel increased NEUROG3, NKX2.2, and NEUROD1 and decreased SOX9 in line with endocrine induction (see, for example, FIG. 15d). The expression of NKX6-1 followed a trend opposite to that of NEUROG3, indicating that prematurely induced NEUROG3 expression by a soft substrate is detrimental to the induction of NKX6-1 in pancreatic progenitor cells.

[0189] To further investigate how cell adhesion affects endocrine induction, a compound screen was performed using factors that affect various aspects of cell adhesion. This screen revealed that latrunculin A, which binds to and sequesters monomeric actin of the cytoskeleton, significantly increased the expression of NEUROG3 and its downstream targets NKX2.2 and NEUROD1 (see, for example, FIGS. 15e–15f). This increase was greater than that induced by the γ-secretase inhibitor XXI (which inhibits NOTCH signaling and has been used for the generation of endocrine cells). The NEUROG3 expression in response to latrunculin A treatment was highly dose-dependent for both HUES8 (see, for example, FIG. 15g) and two iPSC lines (see, for example, FIG. 22a). Latrunculin B, a less potent form of the compound, also increased NEUROG3 expression in a dose-dependent manner but required approximately 10-fold higher concentrations to achieve a similar effect (see, for example, FIG. 22b). The expression of NKX6-1 followed a trend opposite to that of NEUROG3 (see, for example, FIGS. 15f–15g), again indicating the need to prevent prematurely induced NEUROG3 expression for NKX6-1 to turn on during stage 4.

[0190] Treatment of plated stage 4 cells with 1 μM rat neurogenin A for 24 hours resulted in nearly complete depolymerization of F-actin (see, e.g., FIG. 15h) and a corresponding increase in the G / F-actin ratio (see, e.g., FIG. 15i), which corresponded to high NEUROG3 expression. Furthermore, the G / F-actin ratios for all conditions were consistent with the trends observed in NEUROG3 expression (see, e.g., FIG. 15c), with plated cells being at the lowest level, followed by normal suspension culture, reaggregated clusters, and finally plated cells treated with rat neurogenin A. In contrast, addition of the actin polymerization agent jasplakinolide to pancreatic progenitor cells during reaggregation after dispersion attenuated premature NEUROG3 expression (see, e.g., FIG. 22c). Collectively, these data indicate that the polymerization state of the actin cytoskeleton is critically important for the expression of the key pancreatic transcription factors NEUROG3 and NKX6-1.

[0191] The cytoskeletal state guides the pancreatic progenitor cell program: To further investigate how the state of the cytoskeleton affects the pancreatic progenitor program, single-cell RNA sequencing was performed throughout stage 4 on plated pancreatic progenitor cells treated with the cytoskeleton modulation compounds latrunculin A or nocodazole. Latrunculin A depolymerizes F-actin in these plated progenitor cells, while treatment with nocodazole depolymerizes microtubules and causes overcontraction of F-actin. By the end of stage 4, four populations were identified by unsupervised clustering (see, for example, FIGS. 16a-16b, 22d). Two populations of pancreatic progenitor cells were identified by the expression of SOX9 and PDX1, but were distinguished based on differences in NKX6-1 expression. In contrast, cells undergoing premature endocrine induction showed high expression of markers such as CHGA, NEUROG3, NKX2-2, NEUROD1, and ISL1. Importantly, however, they lacked NKX6-1 expression. Exocrine progenitor cells were characterized by high expression of the duct markers KRT7 and KRT19 and the acinar marker PRSS1 (trypsin).

[0192] The state of the cytoskeleton during stage 4 had a dramatic impact on the distribution of cells into these four groups (see, e.g., Fig. 16c). The largest cell population (39.0%) of the plated controls was pancreatic progenitor cells 2 cells expressing NKX6-1, which are the required progenitor cell population at this stage of the protocol. Of these plated cells, only a small fraction (4.9%) expressed endocrine genes. Conversely, ratranclin A treatment decreased the NKX6-1+ population (2.5%) while dramatically increasing endocrine induction (44.7%). These results correspond to prior qRT-PCR data indicating that plating of pancreatic progenitor cells prevents the onset of NEUROG3 while promoting the expression of NKX6-1, while ratranclin A is a potent endocrine inducer. In contrast, treatment with nocodazole promoted exocrine-like progenitor cells (67.0%). These data suggest that an optimal cytoskeletal state is required for the expression of NKX6-1 at stage 4. Specifically, depolymerized cytoskeleton at stage 4 causes endocrine induction prior to NKX6-1 turning on, while overly activated cytoskeleton also prevents NXK6-1 expression and instead promotes the fate of exocrine progenitor cells. Collectively, these data indicate that the polymerization state of the actin cytoskeleton in pancreatic progenitor cells is a highly important regulator of pancreatic cell fate.

[0193] Differentiation into SC-β cells is temporally controlled by the actin cytoskeleton: The expression of pancreatic transcription factors, particularly the timing of NKX6-1 and NEUROG3, is important for proper SC-β cell differentiation. Specifically, when NEUROG3 is expressed before NKX6-1, non-functional multi-hormonal cells or glucagon-positive cells are generated, whereas the expression of NEUROG3 after NKX6-1 induction leads to the rise and fall of SC-β cells. Since the state of the cytoskeleton was important for the expression of these genes, pancreatic progenitor cells were plated on TCP coated with type I collagen, and then rat ranklin A was added at various stages of the SC-β cell differentiation protocol. When rat ranklin A was not added, the plated pancreatic progenitor cells had a low differentiation efficiency (see, for example, FIG. 17a), and the resulting cells secreted little insulin (see, for example, FIG. 17b). The addition of 0.5 μM rat ranklin A either through stage 4 (pancreatic progenitor cells) or stage 6 (SC-β cell maturation) increased both general endocrine induction (CHGA+) and β cell specification (NKX6-1+ / c-peptide+). However, rat ranklin A added during stage 5, which was designed to induce endocrine, resulted in the greatest increase in endocrine induction, SC-β cell specification, and glucose-stimulated insulin secretion (GSIS) (see, for example, FIGS. 17a-b). These data indicate that the attachment of pancreatic progenitor cells to TCP inhibits SC-β cell differentiation, which is overcome by the stage-dependent depolymerization of the actin cytoskeleton by rat ranklin A.

[0194] To optimize the benefits of rat latrocrine A for SC-β cell induction, various durations and concentrations were tested during stage 5 (see, for example, FIG. 17c). Both duration and concentration affected GSIS, and treatment with 1 μM during the first 24 hours of stage 5 yielded the greatest benefit at the shortest and lowest dose. This 24-hour treatment appeared to be sufficient to rescue SC-β cell specification, but long-term culture with rat latrocrine A at stage 5 hampered this effect. Subsequent characterization showed that this 24-hour 1 μM rat latrocrine A treatment increased total insulin content (see, for example, FIG. 17d), improved the proinsulin / insulin ratio (see, for example, FIG. 17e), and increased the expression of endocrine genes (see, for example, FIG. 17f). The expression of markers associated with other endodermal lineages decreased (see, for example, FIG. 17f), as did the area of off-target cell types stained with other non-pancreatic markers such as AFP, which could be visually distinguished by differences in cell morphology (see, for example, FIG. 17g). The plated SC-β cells generated with rat latrocrine A treatment were functional on TCP at stage 6 (see, for example, FIG. 17c), but could also aggregate into clusters within a 6-well plate on an orbital shaker (see, for example, FIG. 17h). The resulting clusters could be evaluated by a dynamic GSIS assay in a perfusion system and showed insulin secretion in both the first and second phases (see, for example, FIG. 17i).

[0195] In summary, these data indicate that the state of the cytoskeleton is important for maintaining pancreatic progenitor cells and, in particular, for specifying the fate of pancreatic cells into SC-β cells. Specifically, proper cytoskeletal polymerization is important for the pancreatic progenitor cell program during stage 4, but actin depolymerization is required during endocrine induction at stage 5 for differentiation into SC-β cells. The high rigidity of TCP induces actin polymerization that prevents premature expression of NEUROG3 and promotes NKX6-1 expression at stage 4, but it also inhibits NEUROG3 expression during stage 5 and subsequently suppresses the specification of SC-β cells. Treatment with latrunculin A depolymerizes the cytoskeleton at stage 5, enabling the reliable generation of functional SC-β cells on TCP without the need for three-dimensional cell arrays.

[0196] Latrunculin A treatment enables a planar protocol for generating SC-β cells: Previous ECM and cytoskeleton experiments first differentiated cells using a suspension-based differentiation protocol during the first three stages to generate pancreatic progenitor cells, and subsequently adhered them onto TCP to continue differentiation and experiments (see, for example, Fig. 15a). Using the new understanding of the role of the cytoskeleton in pancreatic differentiation, this study developed a novel fully planar SC-β cell differentiation protocol that meets the current requirements in the field of three-dimensional cell arrangement (see, for example, Fig. 18a). Similar to previous experiments, adding latrunculin A during stage 4 dramatically increased the early expression of NEUROG3 and its downstream targets while simultaneously decreasing NKX6-1 expression (see, for example, Fig. 23a), thereby confirming that pancreatic progenitor cells generated by both protocols have a similar response to latrunculin A. When latrunculin A was not used in planar culture, few SC-β cells were formed (see, for example, Fig. 18b), consistent with the requirements of three-dimensional culture in previous reports. However, adding 1 μM latrunculin A during the first 24 hours of stage 5 during planar differentiation greatly increased endocrine induction and the specification of SC-β cells while decreasing off-target lineages (see, for example, Fig. 18b, Figs. 22b–22d).

[0197] To further characterize this new planar differentiation protocol, three hPSC lines from previous studies (HUES8, 1013-4FA, and 1016SeVA) were differentiated with this planar protocol. After 1 week at stage 6, the cells could be aggregated into clusters on an orbital shaker for use in the same in vitro and in vivo investigation methods as suspension-based differentiation. This gave aggregated clusters with up to approximately 40% SC-β cells (NKX6-1+ / c-peptide+) and low percentages of polypolymon cells (C-peptide+ / GCG+ or C-peptide+ / SST+) (see, for example, FIG. 18c). The expression of many β-cell and pancreatic islet genes was similar to that in human pancreatic islets, but the expression of MAFA and UCN3 remained low (see, for example, FIG. 18d), similar to the reports by the suspension protocol. Most cells within these clusters were immunostained with c-peptide and were co-positive with several important β-cell markers (see, for example, FIGS. 18e, 23e-23f). All three lines had similar insulin content (see, for example, FIG. 18f), proinsulin / insulin ratio (see, for example, FIG. 18g), static GSIS (see, for example, FIG. 18h), and dynamic GSIS (see, for example, FIG. 18i). A significantly weaker dynamic function by SC-β cells generated from 1013-4FA and 1016SeVA has been previously reported compared to HUES8 using the suspension-based protocol 5 . However, differentiation by this new planar protocol greatly enhanced the first and second phase dynamic insulin release of these iPSC lines, and the dynamic function of all three lines now approaches that of human pancreatic islets (see, for example, FIGS. 18i-18j). Thus, this planar protocol enables greater translational potential of SC-β cells generated from different genetic backgrounds.

[0198] To evaluate the in vivo function of these cells, stage 6 clusters generated from HUES8 by the planar protocol were transplanted under the kidney capsule of streptozotocin (STZ)-induced diabetic mice (see, e.g., Fig. 23g). Fasting glucose levels began to approach those of untreated controls within 2 weeks of transplantation and then remained below 200 mg / dL (see, e.g., Fig. 19a). Glucose tolerance tests performed 3 and 10 weeks after transplantation demonstrated that STZ-treated mice that received SC-β cell transplantation had glucose tolerance similar to that of untreated control mice (see, e.g., Fig. 19a). Furthermore, high levels of human insulin were detected in the sera of transplanted mice and were regulated by glucose levels (see, e.g., Figs. 19b, 23h). Between 12 weeks after transplantation, nephrectomy was performed in four transplanted mice to remove the human grafts, resulting in a rapid loss of glycemic control and confirming that restoration of glucose homeostasis occurred from the transplanted cells (see, e.g., Fig. 19a). Immunostaining of the excised kidneys revealed large areas of C-peptide+ cells and no overgrowth was observed (see, e.g., Fig. 19d). Collectively, these data demonstrate that this novel planar differentiation protocol generates functional SC-β cells capable of rapidly restoring existing diabetes in mice.

[0199] Cytoskeletal modulation affects the choice of endodermal fate: To further investigate the effect of the cytoskeleton on the selection of endodermal cell fate, bulk RNA sequencing was performed at stage 6 of the SC-β cell protocol in cells plated during stage 4 and treated with rat prolactin A during the pancreatic progenitor stage (stage 4) or endocrine induction (stage 5). These cells were also compared to untreated plated differentiation and suspension differentiation. Heatmaps of the 1000 most differentially expressed genes show that the timing of rat prolactin A treatment had a drastic effect on the resulting cell expression profiles (see, for example, FIG. 20a). Specifically, optimal stage 5 rat prolactin A treatment shifted the gene expression profile of plated cells towards that of suspension-based SC-β cell differentiation and increased β cell and islet gene expression. Interestingly, many other differentially expressed genes were associated with the non-endocrine lineage (see, for example, FIGS. 20b-20d), stage 4 rat prolactin A treatment increased intestinal and gastric gene expression, and the plated control increased the expression of genes associated with the liver and esophagus. Thus, having an intact or depolymerized cytoskeleton at specific time points alters endodermal lineage specification, and the timing of cytoskeletal modulation is decisive for endodermal cell fate.

[0200] Collectively, these data indicate that the state of the cytoskeleton is not only important for β-cell specification but also widely important for endodermal cell fate determination. Since cytoskeletal modulation affected fate selection into several endodermal lineages in the SC-β cell protocol, the incorporation of latrunculin A and other established differentiation protocols, such as nocodazole, into the exocrine pancreas, intestine, and liver generation was tested. In exocrine differentiation, nocodazole significantly increased trypsin gene expression (PRSS1, PRSS2) and immunostaining but inhibited endocrine induction (see, for example, FIG. 20e), consistent with our initial single-cell RNA sequencing results showing that nocodazole promotes the exocrine precursor program. In contrast, nocodazole in intestinal differentiation significantly increased CDX2 gene expression and immunostaining (see, for example, FIG. 20f). In contrast, latrunculin A treatment significantly increased marker intestinal stem cells and Paneth cells, which are known to be important for LGR5+ intestinal stem cell viability. In liver differentiation, interestingly, both nocodazole and latrunculin A increased hepatocyte gene expression (see, for example, FIG. 20g). However, immunostaining for albumin was more abundant with nocodazole treatment, while AFP was more dominant with latrunculin A treatment, suggesting differences in the liver phenotype. Overall, these data provide proof of principle that the cytoskeleton is an important component in endodermal cell fate determination during directed differentiation. As demonstrated in this study for SC-β cell differentiation, while these protocols may surely benefit from further optimization, these data show that the use of specific cytoskeletal modulation compounds can help increase the differentiation efficiency of other endodermal differentiation protocols when used at appropriate times and dosages. Furthermore, due to the possible influence of the substrate on the dynamics of the cytoskeleton, this data further suggests that the culture format is most likely important for the success of these directed differentiations.

[0201] Discussion: In this study, we identified the actin cytoskeleton as a decisive regulator of human pancreatic cell fate. By directly controlling the state of the cytoskeleton through cell arrangement (two-dimensional vs. three-dimensional), substrate stiffness, or chemical treatment, we showed that polymerized cytoskeleton blocks early induction of NEUROG3 expression in pancreatic progenitor cells but also inhibits subsequent differentiation into SC-β cells. Timely cytoskeleton depolymerization by latrunculin A overcomes this inhibition and enables robust generation of SC-β cells. We translated these findings to develop a new planar differentiation protocol that can generate highly functional SC-β cells that rapidly restore existing diabetes through dynamic insulin secretion in phases 1 and 2 after transplantation into mice. Single-cell and bulk RNA sequencing revealed that multiple endodermal lineages, not only SC-β cells, are affected by the state of the cytoskeleton, and these methods enabled enhanced differentiation into exocrine, intestinal, and liver cell fates by cytoskeleton modulation.

[0202] There are several distinct advantages to the planar protocol for generating SC-β cells, including better control over important transcription factors such as NEUROG3 and improved cell line reproducibility due to a more controlled, homogeneous microenvironment on tissue culture plates compared to large clusters of cells. However, perhaps the most important benefit of this new protocol is the large improvement in the dynamic function of SC-β cells from two iPSC lines. It has previously been reported that SC-β cells generated in these two lines using a suspension-based protocol have considerably weaker dynamic function. The convertibility of differentiation strategies is a long-standing challenge faced by the field and is particularly problematic when studying patient-derived iPSCs, which often have a weak in vitro and in vivo SC-β cell phenotype. Additionally, it has been observed that certain iPSC lines can often be difficult to adapt to suspension culture. The use of this planar approach with human patient iPSCs better facilitates rigorous studies of diabetes for drug screening and autologous cell replacement therapy.

[0203] This study also resolves a long-standing mystery in the field of why three-dimensional cell arrangement is required for the generation of SC-β cells. This study emphasizes the importance of cell culture formats in stem cell differentiation research and provides other practical benefits in the field of SC-β cells, namely, the elimination of complex, cumbersome, and expensive three-dimensional cell culture requirements. Modulation of the cytoskeleton through planar culture and subsequent treatment with latrunculin A can also better promote the correct timing of NKX6-1 and NEUROG3 expression, which promotes functional single-hormone SC-β cells. The seemingly short temporal requirement for cytoskeleton depolymerization at the onset of endocrine induction may be due to a positive feedback loop that maintains NEUROG3 expression when turned on. These findings also appear to be consistent with in vivo actin dynamics in which the cytoskeleton is reorganized among cells of the developing pancreatic duct to induce delamination and subsequent islet formation.

[0204] Another important observation from this study is that the cytoskeletal state not only regulates SC-β cell differentiation but also broadly affects endodermal lineage specification. Depending on the timing of latrunculin A treatment during SC-β cell differentiation, exocrine, liver, esophageal, gastric, and intestinal gene signatures were detected at stage 6. These findings were applied by adding cytoskeletal modulation compounds during directed differentiation protocols for some of these other lineages, often improving the differentiation outcome. Thus, the influence of the cytoskeletal state depends on the desired endodermal lineage as well as the type and timing of cytoskeletal modulation within these directed differentiation protocols. These modulations within these other protocols can be further optimized, but this study overall emphasizes that cytoskeletal dynamics are decisive for endodermal cell fate and that cytoskeletal signaling acts synergistically with soluble biochemical factors to regulate cell fate determination. As a result, combinations of cell-biomaterial interactions and cytoskeletal modulation compounds can be harnessed to improve the differentiation outcome towards endodermal lineages.

[0205] Methods: Stem cell culture: Three stem cell lines previously used in an SC-β cell differentiation protocol, including the HUES8 hESC line and two non-diabetic human iPSC lines (1013-4FA and 1016SeVA), were utilized in this study. Experiments were performed using the HUES8 line unless otherwise noted. Undifferentiated cells were grown in mTeSR1 (StemCell Technologies, 05850) in a humidified incubator at 37 °C with 5% CO2. For suspension culture, cells were passaged every three days with Accutase (StemCell Technologies, 07920) and seeded at 0.6 × 10 6 cells / mL into 30 mL spinner flasks (REPROCELL, ABBWVS03A) at 60 RPM on a magnetic stirring plate (Chemglass). For planar culture, cells were passaged every four days with TrypLE (Life Technologies, 12-604-039) and seeded onto 6-well plates (Corning, 356230) coated with Matrigel at 3,000,000 - 5,000,000 cells / well, with the density depending on the cell line. All cells were seeded into mTeSR1 supplemented with 10 μM Y-27632.

[0206] SC-β cell differentiation: Suspension protocol: 72 hours after subculture, cells in a 30 mL spinner flask were differentiated using the following formulations in a 6-stage protocol. Stage 1 (3 days): S1 medium + 100 ng / ml Activin A (R&D Systems, 338-AC) + 3 μM CHIR99021 (Stemgent, 04-0004-10). S1 medium + 100 ng / ml Activin A for the next 2 days. Stage 2 (3 days): S2 medium + 50 ng / ml KGF (Peprotech, AF-100-19). Stage 3 (1 day): S3 medium + 50 ng / ml KGF + 200 nM LDN193189 (Reprocell, 040074) + 500 nM PdBU (MilliporeSigma, 524390) + 2 μM retinoic acid (MilliporeSigma, R2625) + 0.25 μM SANT1 (MilliporeSigma, S4572) + 10 μM Y27632. Stage 4 (5 days): S3 medium + 5 ng / mL Activin A + 50 ng / mL KGF + 0.1 μM retinoic acid + 0.25 μM SANT1 + 10 μM Y27632. Stage 5 (7 days): S5 medium + 10 μM ALK5i II (Enzo Life Sciences, ALX-270-445-M005) + 20 ng / mL betacellulin (R&D Systems, 261-CE-050) + 0.1 μM retinoic acid + 0.25 μM SANT1 + 1 μM T3 (Biosciences, 64245) + 1 μM XXI (MilliporeSigma, 595790). Stage 6 (7 - 25 days): Enriched serum-free medium (ESFM). On day 1 of stage 6, the cluster size was changed by single-cell dispersion with TrypLE and re-aggregation in a 6-well plate on an orbital shaker (Benchmark Scientific, OrbiShaker) at 100 RPM in ESFM.

[0207] The basal differentiation medium formulations used in each stage were as follows. S1 medium: 500 mL of MCDB 131 (Cellgro, 15-100-CV) supplemented with 0.22 g of glucose (MilliporeSigma, G7528), 1.23 g of sodium bicarbonate (MilliporeSigma, S3817), 10 g of bovine serum albumin (BSA) (Proliant, 68700), 10 μL of ITS-X (Invitrogen, 51500056), 5 mL of GlutaMAX (Invitrogen, 35050079), 22 mg of vitamin C (MilliporeSigma, A4544), and 5 mL of penicillin / streptomycin (P / S) solution (Cellgro, 30-002-CI). S2 medium: 500 mL of MCDB 131 supplemented with 0.22 g of glucose, 0.615 g of sodium bicarbonate, 10 g of BSA, 10 μL of ITS-X, 5 mL of GlutaMAX, 22 mg of vitamin C, and 5 mL of P / S. S3 medium: 500 mL of MCDB 131 supplemented with 0.22 g of glucose, 0.615 g of sodium bicarbonate, 10 g of BSA, 2.5 mL of ITS-X, 5 mL of GlutaMAX, 22 mg of vitamin C, and 5 mL of P / S. S5 medium: 500 mL of MCDB 131 supplemented with 1.8 g of glucose, 0.877 g of sodium bicarbonate, 10 g of BSA, 2.5 mL of ITS-X, 5 mL of GlutaMAX, 22 mg of vitamin C, 5 mL of P / S, and 5 mg of heparin (MilliporeSigma, A4544). ESFM: 500 mL of MCDB 131 supplemented with 0.23 g of glucose, 10.5 g of BSA, 5.2 mL of GlutaMAX, 5.2 mL of P / S, 5 mg of heparin, 5.2 mL of MEM non-essential amino acids (Corning, 20-025-CI), 84 μg of ZnSO4 (MilliporeSigma, 10883), 523 μL of trace element A (Corning, 25-021-CI), and 523 μL of trace element B (Corning, 25-022-CI).

[0208] For experiments investigating the effect of plating pancreatic progenitor cells, cells were differentiated with a suspension protocol for Stages 1 - 3. At the end of Stage 3, clusters were dispersed into single cells with TrypLE and plated at 0.625×10 6 cells / cm 2 onto tissue culture plates coated with various ECM proteins. The differentiation medium for the remainder of this hybrid protocol was the same as the suspension protocol except that Y - 27632 and activin A were omitted on Days 2 - 5 of Stage 4. In each experiment, the additional compounds were added as indicated: 1 μM ratocrin A (Cayman Chemical, 10010630), 1 μM ratocrin B (Cayman Chemical, 10010631), 1 μM cytochalasin D (MilliporeSigma, C2618), 1 μM jasplakinolide (Cayman Chemical, 11705), 10 μM brevistatin (MilliporeSigma, 203389), 1 μM nocodazole (Cayman Chemical, 13857), 1 μM Y - 15 (Cayman Chemical, 14485), 10 μM Y - 27632 and 10 μM GDC - 0994 (Selleckchem, S7554). Various ECM coatings including collagen I (Corning, 354249), collagen IV (Corning, 354245), fibronectin (Gibco, 33016 - 015), vitronectin (Gibco, A14700), Matrigel (Corning, 356230), gelatin (Fisher, G7 - 500) and laminin 111, 121, 211, 221, 411, 421, 511 and 521 (Biolamina, LNKT - 0201) were first tested with this plating method. All subsequent experiments with this hybrid protocol were performed with collagen I.

[0209] Planar protocol: 24 hours after passage, 0.313 - 0.521×10 6 cells / cm 2The cells seeded were differentiated with daily medium exchanges using a new 6-stage protocol with the following formulations. Stage 1 (4 days): BE1 medium + 100 ng / mL activin A + 3 μM CHIR99021 for the first 24 hours, and BE1 containing only 100 ng / mL activin A for the following 3 days. Stage 2 (2 days): BE2 medium + 50 ng / mL KGF. Stage 3 (2 days): BE3 + 50 ng / mL KGF, 200 nM LDN193189, 500 nM TPPB (Tocris, 53431), 2 μM retinoic acid and 0.25 μM SANT1. Stage 4 (4 days): BE3 + 50 ng / mL KGF, 200 nM LDN193189, 500 nM TPPB, 0.1 μM retinoic acid and 0.25 μM SANT1. Stage 5 (7 days): S5 medium + 10 μM ALK5i II + 20 ng / mL betacellulin + 0.1 μM retinoic acid + 0.25 μM SANT1 + 1 μM T3 + 1 μM XXI. 1 μM rat follistatin A was added to this medium only for the first 24 hours. Stage 6 (7 - 25 days): The cultures were maintained on plates with ESFM for the first 7 days. To transfer to suspension culture, the cells were dispersed into single cells with TrypLE and placed at a concentration of 4,000,000 - 5,000,000 cells / well into 6 mL of ESFM in a 6-well plate on an orbital shaker at 100 RPM. The investigation was performed 5 - 8 days after cluster aggregation.

[0210] The basal differentiation medium formulations different from the suspension protocol were as follows. BE1 medium: 500 mL of MCDB 131 supplemented with 0.8 g glucose, 0.587 g sodium bicarbonate, 0.5 g BSA and 5 mL GlutaMAX. BE2 medium: 500 mL of MCDB 131 supplemented with 0.4 g glucose, 0.587 g sodium bicarbonate, 0.5 g BSA, 5 mL GlutaMAX and 22 mg vitamin C. BE3 medium: 500 mL of MCDB 131 supplemented with 0.22 g glucose, 0.877 g sodium bicarbonate, 10 g BSA, 2.5 mL of ITS-X, 5 mL GlutaMAX and 22 mg vitamin C.

[0211] Microscopy and Immunocytochemistry: Bright-field images were taken with a Leica DMi1 inverted optical microscope, and fluorescence images were captured with a Nikon A1Rsi confocal microscope. For immunostaining, cells were fixed with 4% paraformaldehyde (PFA) for 30 minutes at room temperature. Next, they were blocked and permeabilized with an immunocytochemistry (ICC) solution consisting of 0.1% Triton X (Acros Organics, 327371000) and 5% donkey serum (Jackson Immunoresearch, 017000-121) in PBS (Corning, 21-040-CV) for 45 minutes at room temperature. Next, samples were incubated with primary antibody diluted in the ICC solution overnight at 4°C, washed with ICC, incubated with secondary antibody diluted in ICC for 2 hours at room temperature, and stained with DAPI for 15 minutes at room temperature. For histological section preparation, whole SC-β cell clusters generated in mouse kidneys containing the planar protocol and transplanted cells were fixed with 4% PFA overnight at 4°C. Additionally, in vitro clusters were embedded in Histogel (Thermo Scientific, hg-4000-012). These samples were then paraffin-embedded and sectioned by the Division of Comparative Medicine (DCM) Research Animal Diagnostic Laboratory Core at Washington University in St. Louis. Paraffin was removed from the section samples with Histoclear (Thermo Scientific, C78-2-G), and antigen retrieval was performed with 0.05 M EDTA (Ambion, AM9261) in a pressure cooker (Proteogenix, 2100 Retriever). Slides were blocked, permeabilized with the ICC solution for 45 minutes, incubated with primary antibody in the ICC solution overnight at 4°C, and incubated with secondary antibody for 2 hours at room temperature. Next, the slides were sealed with DAPI Fluoromount-G (SouthernBiotech, 0100-20).

[0212] Unless otherwise specified, the primary antibodies were diluted 1:300 in ICC solution: rat anti-C-peptide (DSHB, GN-ID4-S), mouse anti-NKX6-1 (DSHB, F55A12-S) at 1:100, goat anti-PDX1 (R&D Systems, AF2419), sheep anti-NEUROG3 (R&D Systems, AF2746), TRITC-conjugated phalloidin (MilliporeSigma, FAK100) at 1:200, rabbit anti-somatostatin (ABCAM, ab64053), mouse anti-glucagon (ABCAM, ab82270), mouse anti-NKX2-2 (DSHB, 74.5A5-S), goat anti-NEUROD1 (R&D Systems, AF2746), mouse anti-ISL1 (DSHB, 40.2d6-s), rabbit anti-CHGA (ABCAM, ab15160), sheep anti-PRSS1 / 2 / 3 (R&D Systems, AF3586) at 1:100, mouse anti-KRT19 (Dako, MO888) at 1:100, goat anti-KLF5 (R&D Systems, AF3758), rabbit anti-CDX2 (Abcam, ab76541), mouse anti-AFP (Abcam, ab3980), rabbit anti-albumin (Abcam, ab207327).

[0213] The secondary antibodies were diluted 1:300 in ICC solution. All secondary antibodies were raised in donkey: anti-goat alexa fluor 594 (Invitrogen, A11058), anti-goat alexa fluor 647 (Invitrogen, A31571, anti-mouse alexa fluor 488 (Invitrogen, A21202), anti-mouse alexa fluor 594 (Invitrogen, A21203), anti-mouse alexa fluor 647 (Invitrogen, A31571), anti-rabbit alexa fluor 488 (Invitrogen, A21206), anti-rabbit alexa fluor 594 (Invitrogen, A21207), anti-rabbit alexa fluor 647 (Invitrogen, A31573), anti-rat alexa fluor 488 (Invitrogen, A21208), anti-sheep alexa fluor 594 (Invitrogen, A11016).

[0214] qRT-PCR: RNA was directly extracted from all clusters or cells on the plate using the RNeasy Mini Kit (Qiagen, 74016). The samples were treated with a DNase kit (Qiagen, 79254) during extraction. The High Capacity cDNA Reverse Transcriptase kit (Applied Biosystems, 4368814) was used to synthesize cDNA in a thermocycler (Applied Biosystems, A37028). PowerUp SYBR Green Master Mix (Applied Biosystems, A25741) was used on a StepOnePlus (Applied Biosystems), and the real-time PCR results were analyzed using the ΔΔCt method. Both TBP and GUSB were used as housekeeping genes. The primer sequences were as follows.

[0215]

Table 2-1

Table 2-2

[0216] Collagen gel: According to the manufacturer's instructions, 10×PBS, sterile deionized water, and 1M NaOH were used to prepare a type I collagen (Corning, 354249) gel at a concentration of 5 mg / mL. Various amounts of this collagen solution were pipetted into the center of the wells of a 24-well plate and centrifuged briefly to obtain a uniform coating. The height of the collagen gel was calculated based on the volume of the collagen gel solution, the radius of the 24-well plate, and the formula for the height of a cylinder.

[0217] G / F actin ratio: The G / F actin ratio was determined by Western blot according to the instructions of the G-Actin / F-Actin In Vivo Assay Kit (Cytoskeleton, BK037). The Western blot was visualized using a SuperSignal West Pico PLUS Chemiluminescent substrate (ThermoScientific, 34577) and an Odyssey FC (LI-COR) imaging device.

[0218] Integrin assay: To quantify which integrins were expressed on the surface of pancreatic progenitor cells, cells generated in suspension culture were dispersed by TrypLE at the end of stage 3 or stage 4 and plated onto wells coated with monoclonal antibodies for different α and β integrin subunits using an Alpha / Beta Integrin-Mediated Cell Adhesion Array Combo kit (MilliporeSigma, ECM532). Integrin expression was quantified according to the manufacturer's instructions.

[0219] Single-cell RNA sequencing: Cells generated by the suspension protocol at the end of stage 3 were dispersed into single cells with TrypLE from the clusters and plated at 0.625×10 6 cells / cm 2They were seeded. Throughout stage 4, 0.5 μM latrunculin A or 5 μM nocodazole was added. At the end of stage 4, the cells were made into single-cell dispersions, suspended in DMEM, and submitted to the Washington University Genome Technology Access Center. Library preparation was performed using the Chromium Single Cell 3’ Library and Gel Bead Kit v2 (10x Genomics, 120237). Briefly, single cells were isolated into emulsions using a microfluidic platform, and the emulsion of each single cell was barcoded with a unique set of oligonucleotides. The GemCode platform was used to perform reverse transcription in each single-cell emulsion amplified to construct the library. The library was sequenced with paired-end read data of 26x98 primerbp using Illumina HiSeq2500.

[0220] To perform single-cell RNA analysis, Seurat v2.0 was used. FilterCells was used to filter out doublet cells and cells with high mitochondrial gene expression (>9000 total genes and >5% mitochondrial genes in the untreated control, >6000 genes and >6% mitochondrial genes in latrunculin A, >12000 genes and >4% mitochondrial genes in nocodazole). Each dataset was normalized using global-scaling normalization. FindVariableGenes was used to identify and remove outlier genes using the scaled z-score dispersion. The datasets were then combined, and canonical correlation analysis (CCA) was performed with RunMultiCCA. AlignSubspace was used to align the CCA subspaces and generate a new dimensionality reduction for the integrated analysis. Unsupervised TSNE plots were generated using RunTSNE, and the resulting clusters were clarified and labeled using FindMarkers. VlnPlot (violin plot) and FeaturePlot (tsne plot) were used to visualize the differences in gene expression across each cluster and condition.

[0221] Flow cytometry: Cells were dissociated into single cells with TrypLE and fixed with 4% PFA for 30 minutes. Next, the cells were washed with PBS, incubated with ICC solution at room temperature for 45 minutes, incubated with the primary antibody at 4°C overnight, and incubated with the secondary antibody at room temperature for 2 hours. Next, the cells were washed twice with ICC solution, filtered, and then run on an LSRII flow cytometer (BD Biosciences). Analysis was completed with FlowJo.

[0222] Glucose stimulated insulin secretion: Static GSIS: To investigate the function of cells generated by the hybrid protocol, static GSIS was performed on cells still attached to 96- or 24-well tissue culture plates. To investigate the function of clusters generated by the planar protocol, approximately 30 clusters were collected and placed in tissue culture transwell inserts (MilliporeSigma, PIXP01250) of 24-well plates. All were first washed twice with KRB buffer (128 mM NaCl, 5 mM KCl, 2.7 mM CaCl2, 1.2 mM MgSO4, 1 mM Na2HPO4, 1.2 mM KH2PO4, 5 mM NaHCO3, 10 mM HEPES (Gibco, 15630-080) and 0.1% BSA). Cells were first incubated in 2 mM glucose KRB solution at 37°C for 1 hour, then this solution was discarded and replaced with fresh 2 mM glucose KRB. After an additional 1 hour, the supernatant was collected. 20 mM glucose KRB was added for the next 1 hour, and then the supernatant was collected again. Between each solution exchange, the cells were washed with fresh KRB. Next, the cells were dissociated into single cells with TrypLE and counted with Vi-Cell XR (Beckman Coulter). Supernatants from low and high glucose challenges were quantified by human insulin ELISA (ALPCO, 80-INSHU-E10.1), and cell number was used to normalize insulin secretion.

[0223] Dynamic GSIS: As reported by the inventors 5The dynamic function of SC-β cells was investigated in a washout setup. 0.015-inch inlet and outlet tubing (ISMATEC, 070602-04i-ND) was connected to a 275 μl cell chamber (BioRep, Peri-Chamber) and a dispensing nozzle (BioRep, PERI-NOZZLE) with 0.04” connecting tubing (BioRep, Peri-TUB-040). Approximately 30 SC-β cell clusters were washed twice with KRB buffer and placed in the chamber, sandwiched between two layers of hydrated biogel P-4 polyacrylamide beads (Bio-Rad, 150-4124). These chambers were connected to a high-precision 8-channel dispenser pump (ISMATEC, ISM931C) and submerged in a 37 °C water bath for the remainder of the assay. For the first 90 minutes, a 2 mM glucose KRB solution was perfused through the chamber at a flow rate of 100 μL / min. After this equilibration period, effluent water was collected at 2-minute intervals and the glucose solution was switched as follows: 12 minutes with 2 mM glucose KRB, 24 minutes with 20 mM glucose KRB, and 16 minutes with 2 mM glucose KRB. Next, the SC-β cell clusters were lysed with a solution of 10 mM Tris (MilliporeSigma, T6066), 1 mM EDTA (Ambion, AM9261), and 0.2% Triton-X (Acros Organics, 327371000). DNA was quantified using the Quant-iT PicoGreen dsDNA assay kit (Invitrogen, P7589) and used to normalize the insulin values quantified by human insulin ELISA.

[0224] Insulin and proinsulin content: All SC-β cell clusters or cells attached to the culture plates were washed twice thoroughly with PBS. Half of the clusters or an equivalent well of the plated cells were submerged in TrypLE for the cell count on the Vi-Cell XR. For the remaining half of the samples, a solution of 1.5% HCl and 70% ethanol was added directly to the clusters in Eppendorf tubes or to the plated cells. After 15 minutes, the plated cells were vigorously pipetted and transferred to Eppendorf tubes. The Eppendorf tubes from the clusters and plated cells were kept at -20 °C for 72 hours and agitated vigorously every 24 hours. Next, the samples were centrifuged at 2100 RCF for 15 minutes. The supernatant of each sample was collected, neutralized with an equal volume of 1 M Tris (pH 7.5), and quantified using a proinsulin ELISA (Mercodia, 10-1118-01) and a human insulin ELISA kit. Proinsulin and insulin secretion were normalized to the viable cell number.

[0225] Transplantation studies: In vivo studies were performed in accordance with the rules of the Washington University International Care and Use Committee. Seven-week-old male immunodeficient mice (NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ) were purchased from Jackson Laboratories. Diabetes was induced in randomly selected mice by administering 45 mg / kg of STZ (R&D Systems, 1621500) in PBS intraperitoneally for 5 consecutive days. The mice became diabetic approximately 1 week after STZ treatment. Two weeks later, transplantation surgery was performed by injecting approximately 5 million SC-β cells generated with the planar protocol under the kidney capsule of the diabetic mice anesthetized with isoflurane. After the transplantation surgery, all mice were monitored weekly. Removal of the kidneys containing SC-β cells from randomly selected transplanted mice was performed during the 12th week after transplantation.

[0226] Fasting blood glucose measurement, glucose tolerance test, and in vivo GSIS were performed for in vivo investigation. For all studies, mice were fasted for 4 - 6 hours. For fasting measurements, blood glucose levels were obtained from tail bleeding using a handheld glucometer (Bayer, 9545C). For the glucose tolerance test, 2 g / kg glucose in 0.9% saline (Moltox, 51 - 405022.052) was injected, and blood glucose was measured every 30 minutes for 150 minutes. For in vivo GSIS, approximately 30 μL of blood through tail bleeding was collected using a microvette (Sarstedt, 16.443.100) before and 60 minutes after glucose injection. Blood samples were centrifuged at 2500 rpm for 15 minutes at 4°C, and serum was collected for quantification using a human Ultrasensitive insulin ELISA kit (ALPCO Diagnostics, 80 - ENSHUU - E01.1) and a mouse C - peptide ELISA kit (ALPCO Diagnostics, 80 - CPTMS - E01).

[0227] Bulk RNA sequencing: At the end of stage 3, cells generated with the suspension protocol were single - cell dispersed from the clusters with TrypLE and seeded at 0.625×10 6 cells / cm 2 in 24 - well plates coated with collagen 1. 0.5 μM latrocrine A was added throughout stage 4, or 1 μM latrocrine A was added for the first 24 hours of stage 5. Two weeks later at stage 6, RNA was extracted using the RNeasy Mini kit (Qiagen, 74016), and DNase treatment (Qiagen, 79254) was included during extraction. Samples were sent to the Washington University's Genome Technology Access Center in St. Louis for library preparation and sequencing. Samples were prepared by RNA depletion using Ribo - Zero according to the manufacturer's protocol of the library kit, indexed, pooled, and sequenced on an Illumina HiSeq.

[0228] Differential gene expression analysis was performed using EdgeR. DGEList was used to create a count object, and the trimmed mean of M-values (TMM) method was used with calcNormFactors to normalize the data. Pairwise comparisons were performed using exactTest, and topTags was used to obtain differentially expressed genes and their respective log fold changes (logFC) and adjusted p-values (FDR). These values were used to generate volcano plots using ggplot2. Hierarchical clustering and heatmaps were performed and generated using heatmap.2 (gplots) using the expression levels calculated by logCPM. Gene set analysis was performed using gene set enrichment analysis (GSEA). Lineage-specific gene sets including exocrine (GO:0035272, M13401), pancreatic beta cells (Hallmark, M5957), and intestinal epithelium (GO:0060576, M12973) were obtained from the Molecular Signatures Database (MdigDB). Gene sets for the liver, esophagus, and stomach were customized using the Human Protein Atlas and the literature.

[0229] Differentiation into other endodermal lineages: For differentiation into other endodermal lineages, HUES8 stem cells were cultured and passaged normally. After seeding at 0.521×10 6 cells / cm 2 in a 24-well plate and 24 hours later, differentiation was initiated. Protocols for exocrine pancreas, intestine, and liver were applied from the literature. As shown in each protocol, rat insulin A or nocodazole was added. All three differentiation protocols used the same stage 1 to induce endoderm. Stage 1 (4 days): BE1 medium + 100 ng / mL activin A + 3 μM CHIR99021 for the first 24 hours, followed by BE1 containing only 100 ng / mL activin A for the next 3 days.

[0230] Exocrine pancreas: Stage 2 (2 days): BE2 medium + 50 ng / mL KGF. Stage 3 (2 days): BE3 + 50 ng / mL KGF, 200 nM LDN193189, 500 nM TPPB, 2 μM retinoic acid and 0.25 μM SANT1. Stage 4 (4 days): BE3 + 50 ng / mL KGF, 200 nM LDN193189, 500 nM TPPB, 0.1 μM retinoic acid and 0.25 μM SANT1. 1 μM ratocrin A was added for the first 24 hours of this stage, or 1 μM nocodazole was added throughout stage 4. Stage 5 (6 days): S5 medium + 10 ng / mL bFGF. 10 mM nicotinamide (MilliporeSigma, 72340) was added for the last 2 days.

[0231] Intestinal differentiation: Stage 2 (4 days): BE2 medium + 3 μM CHIR99021 + 500 ng / mL FGF4 (R&D Systems, 235-F4). 1 μM ratocrin A was added for the first 24 hours of this stage, or 1 μM nocodazole was added throughout stage 2. Stage 3 (7 days): BE3 medium + 500 ng / mL R-spondin1 (R&D Systems, 4645-RS) + 100 ng / mL EGF (R&D Systems, 236-EG) + 200 nM LDN193189.

[0232] Liver differentiation: Stage 2 (2 days): BE2 medium + 50 ng / mL KGF. Stage 3 (4 days): BE3 medium + 10 ng / mL bFGF + 30 ng / mL BMP4 (R&D Systems, 314-BP). Either 2 μM retinoic acid and 1 μM ratocrin A or 1 μM nocodazole was added only for the first 24 hours. Stage 4 (5 days): BE3 medium + 20 ng / mL OSM (R&D Systems, 295-OM) + 20 ng / mL HGF (R&D Systems, 294-HG) + 100 nM dexamethasone (MilliporeSigma, D4902).

[0233] Statistical analysis Data analysis was performed using GraphPad Prism, version 7. The data analyzed were evaluated by two-sided t-test or ANOVA, followed by Dunnett's multiple comparison test or Tukey's HSD test. The following notation was used to indicate p-values: ns = not significant, *= p < 0.05, **= p < 0.01, ***= p < 0.001. Error bars for all data represent SEM. The sample size (n) indicates the total number of biological replicates.

[0234] List of references: 1. Millman, J. R. & Pagliuca, F. W. Autologous pluripotent stem cell-derived β-like cells for diabetes cellular therapy. Diabetes 66, 1111-1120 (2017). 2. Tomei, A. A., Villa, C. & Ricordi, C. Development of an encapsulated stem cell-based therapy for diabetes. Expert Opin. Biol. Ther. 15, 1321-1336 (2015). 3. Jennings, R. E., Berry, A. A., Strutt, J. P., Gerrard, D. T. & Hanley, N. A. Human pancreas development. Development 142, 3126-3137 (2015). 4. Pagliuca, F. W. et al., Generation of functional human pancreatic β cells in vitro. Cell 159, 428-439 (2014). 5. Velazco-Cruz, L. et al., Acquisition of Dynamic Function in Human Stem Cell-Derived β Cells. Stem Cell Reports 12, 351-365 (2019). 6. Rezania, A. et al., Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nat. Biotechnol. 32, 1121-1133 (2014). 7. Russ, H. A. et al., Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. EMBO J. 34, 1759-1772 (2015). 8. Nair, G. G. et al., Recapitulating endocrine cell clustering in culture promotes maturation of human stem-cell-derived β cells. Nat. Cell Biol. 21, 263-274 (2019).

[0235] 9. Sui, L. et al., β-Cell replacement in mice using human type 1 diabetes nuclear transfer embryonic stem cells. Diabetes 67, 26-35 (2018). 10. Ghazizadeh, Z. et al., ROCKII inhibition promotes the maturation of human pancreatic beta-like cells. Nat. Commun. 8, (2017). 11. D’Amour, K. A. et al., Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat. Biotechnol. 23, 1534-1541 (2005). 12. Amour, K. A. D. et al., Production of pancreatic hormone - expressing endocrine cells from human embryonic stem cells. 24, 1392 - 1401 (2006). 13. Kroon, E. et al., Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nat. Biotechnol. 26, 443 - 452 (2008). 14. Nostro, M. C. et al., Efficient generation of NKX6-1+ pancreatic progenitors from multiple human pluripotent stem cell lines. Stem Cell Reports 4, 591 - 604 (2015). 15. Rezania, A. et al., Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes 61, 2016 - 2029 (2012). 16. Spence, J. R. et al., Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nature 470, 105 - 110 (2011). 17. Cheng, X. et al., Self-renewing endodermal progenitor lines generated from human pluripotent stem cells. Cell Stem Cell 10, 371 - 384 (2012). 18. Gu, G., Dubauskaite, J. & Melton, D. A. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129, 2447-57 (2002). 19. Johansson, K. A. et al., Temporal Control of Neurogenin3 Activity in Pancreas Progenitors Reveals Competence Windows for the Generation of Different Endocrine Cell Types. Dev. Cell 12, 457-465 (2007). 20. Nelson, S. B., Schaffer, A. E. & Sander, M. The transcription factors Nkx6.1 and Nkx6.2 possess equivalent activities in promoting beta-cell fate specification in Pdx1+ pancreatic progenitor cells. Development 134, 2491-2500 (2007).

[0236] 21. Schulz, T. C. et al., A scalable system for production of functional pancreatic progenitors from human embryonic stem cells. PLoS One 7, (2012). 22. Barczyk, M., Carracedo, S. & Gullberg, D. Integrins. Cell Tissue Res. 339, 269-280 (2010). 23. Vicente-Manzanares, M., Ma, X., Adelstein, R. S. & Horwitz, A. R. Non-muscle myosin II takes centre stage in cell adhesion and migration. Nat. Rev. Mol. Cell Biol. 10, 778-90 (2009). 24. Engler, A. J., Sen, S., Sweeney, H. L. & Discher, D. E. Matrix elasticity directs stem cell lineage specification. Cell 126, 677-89 (2006). 25. Hogrebe, N. J. & Gooch, K. J. Direct influence of culture dimensionality on hMSC differentiation at various matrix stiffnesses using a fibrous self-assembling peptide hydrogel. J. Biomed. Mater. Res. Part A 104, 2356-68 (2016). 26. Kilian, K. a, Bugarija, B., Lahn, B. T. & Mrksich, M. Geometric cues for directing the differentiation of mesenchymal stem cells. Proc. Natl. Acad. Sci. U. S. A. 107, 4872-7 (2010). 27. McBeath, R., Pirone, D. M., Nelson, C. M., Bhadriraju, K. & Chen, C. S. Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev. Cell 6, 483-95 (2004). 28. Ahn, E. H. et al., Spatial control of adult stem cell fate using nanotopographic cues. Biomaterials 35, 2401-10 (2014). 29. Frith, J. E., Mills, R. J. & Cooper-White, J. J. Lateral spacing of adhesion peptides influences human mesenchymal stem cell behaviour. J. Cell Sci. 125, 317-27 (2012).

[0237] 30. Hogrebe, N. J. et al., Independent control of matrix adhesiveness and stiffness within a 3D self-assembling peptide hydrogel. Acta Biomater. 70, 110-119 (2018). 31. Leong, W. S. et al., Thickness sensing of hMSCs on collagen gel directs stem cell fate. Biochem. Biophys. Res. Commun. 401, 287-92 (2010). 32. Brenner, S. L. & Korn, D. inhibition of actin polymerization by latrunculin A. FEBS Lett. 2, 316-318 (1987). 33. Peng, G. E., Wilson, S. R. & Weiner, O. D. A pharmacological cocktail for arresting actin dynamics in living cells. Mol. Biol. Cell 22, 3986-3994 (2011). 34. GEF-H1 Couples Nocodazole-induced Microtubule Disassembly to Cell Contractility via RhoA. Mol. Biol. Cell 19, 2147-2153 (2008). 35. Hohwieler, M. et al., Human pluripotent stem cell-derived acinar / ductal organoids generate human pancreas upon orthotopic transplantation and allow disease modelling. Gut 66, 473-486 (2017). 36. McCracken, K. W., Howell, J. C., Wells, J. M. & Spence, J. R. Generating human intestinal tissue from pluripotent stem cells in vitro. Nat. Protoc. 6, 1920-1928 (2011). 37. Ang, L. T. et al., A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells Resource A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells. Cell Rep. 22, 2190-2205 (2018). 38. Yin, X. et al., Niche-independent high-purity cultures of Lgr5 + intestinal stem cells and their progeny. Nat. Methods 11, 106-112 (2014). 39. Wang, X. et al., Point mutations in the PDX1 transactivation domain impair human β-cell development and function. Mol. Metab. 1-18 (2019). doi:10.1016 / J.MOLMET.2019.03.006 40. Balboa, D. et al., Insulin mutations impair beta-cell development in a patient-derived iPSC model of neonatal diabetes. Elife 7, 1-35 (2018).

[0238] 41. Ma, S. et al., β Cell Replacement after Gene Editing of a Neonatal Diabetes-Causing Mutation at the Insulin Locus. Stem Cell Reports 11, 1407-1415 (2018). 42. Maxwell, K. et al., Rapid reversal of pre-existing diabetes in mice with transplantation of CRISPR / Cas9-corrected human stem cell-derived diabetic patient β cells. Submitted (2019). 43. Seymour, P. A. Sox9: A master regulator of the pancreatic program. Rev. Diabet. Stud. 11, 51-83 (2014). 44. Kesavan, G. et al., Cdc42 / N-WASP signaling links actin dynamics to pancreatic cell delamination and differentiation. J. Cell Sci. 127, e1-e1 (2014). 45. Butler, A., Hoffman, P., Smibert, P., Papalexi, E. & Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol. 36, 411-420 (2018). 46. McCarthy, D. J., Chen, Y. & Smyth, G. K. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 40, 4288-4297 (2012). 47. Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140 (2009). 48. Subramanian, A. et al., Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102, 15545-50 (2005). 49. Mootha, V. K. et al., PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. 34, 1-7 (2003). 50. Liberzon, A. et al., Molecular signatures database (MSigDB) 3.0. Bioinformatics 27, 1739-1740 (2011).

[0239] 51. Liberzon, A. et al., The Molecular Signatures Database Hallmark Gene Set Collection. Cell Syst. 1, 417-425 (2015). 52. Uhlen, M. et al., Tissue-based map of the human proteome. Science. 347, 1-9 (2015). 53. Takebe, T. et al., Vascularized and functional human liver from an iPSC-derived organ bud transplant. Nature 499, 481-484 (2013). 54. Finkbeiner, S. R. et al., Transcriptome-wide Analysis Reveals Hallmarks of Human Intestine Development and Maturation In Vitro and In Vivo. Stem Cell Reports 4, 1140-1155 (2015). 55. McCracken, K. W. et al., Modelling human development and disease in pluripotent stem-cell-derived gastric organoids. Nature 516, 400-404 (2014). 56. Rosekrans, S. L., Baan, B., Muncan, V. & van den Brink, G. R. Esophageal development and epithelial homeostasis. Am. J. Physiol. Liver Physiol. 309, G216-G228 (2015). 57. Trisno, S. L. et al., Esophageal Organoids from Human Pluripotent Stem Cells Delineate Sox2 Functions during Esophageal Specification. Cell Stem Cell 23, 501-515.e7 (2018). 58. Willet, S. G. & Mills, J. C. Stomach Organ and Cell Lineage Differentiation: From Embryogenesis to Adult Homeostasis. Cmgh 2, 546-559 (2016).

Claims

1. 1. A method for generating insulin-producing beta cells in suspension, comprising: providing stem cells; Providing a serum-free medium; and contacting the stem cells with a TGFβ / activin agonist or a glycogen synthase kinase 3 (GSK) inhibitor or a WNT agonist for a time sufficient to form definitive endoderm cells; contacting the definitive endoderm cells with an FGFR2b agonist for a period of time sufficient to form primitive gut cells; contacting primitive intestinal cells with a RAR agonist, and optionally a rho kinase inhibitor, a smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, or a BMP type 1 receptor inhibitor, for a time sufficient to form early pancreatic progenitor cells; incubating the early pancreatic progenitor cells for at least about 3 days, optionally contacting the early pancreatic progenitor cells with a rho kinase inhibitor, a TGF-β / activin agonist, a smoothened antagonist, an FGFR2b agonist, or a RAR agonist for a time sufficient to form pancreatic progenitor cells; or contacting the pancreatic progenitor cells with an Alk5 inhibitor, a gamma secretase inhibitor, a SANT1, an Erbb1 (EGFR) or Erbb4 agonist, or a RAR agonist for a period of time sufficient to form endoderm cells; and Maturating the endoderm cells in serum-free medium for a time sufficient to reduce the size of the cell clusters, including allowing the cell clusters to change size (optionally by incubation for up to about 24 hours), and to form beta cells. The method includes:

2. The TGFβ / activin agonist is activin A; The glycogen synthase kinase 3 (GSK) inhibitor or WNT agonist is CHIR; The FGFR2b agonist is KGF; the smoothened antagonist is SANT-1; The RAR agonist is retinoic acid (RA); The protein kinase C activator is PdBU; The BMP type 1 receptor inhibitor is LDN; The rho kinase inhibitor is Y27632; The Alk5 inhibitor is an Alk5i; or The method of claim 1, wherein the Erbb4 agonist is betacellulin.

3. Serum-free medium was prepared using MCDB131, glucose, NaHCO 3 , BSA, ITS-X, Glutamax, Vitamin C, Penicillin-Streptomycin, CMRL 10666, FBS, Heparin, NEAA, Trace Element A, Trace Element B, or ZnSO 4 3. The method of claim 1, further comprising one or more selected from the group consisting of:

4. 2. The method of claim 1, comprising reducing endoderm cluster size, wherein altering the size of the cell clusters comprises disassembling the clusters and allowing them to re-aggregate prior to maturation into beta cells.

5. 2. The method of claim 1, wherein the pancreatic progenitor cells are not incubated with any one or more of serum, T3, N-acetylcysteine, Trolox, and R428.

6. 2. The method of claim 1, wherein the time sufficient to form definitive endoderm cells, primitive gut cells, early pancreatic progenitor cells, pancreatic progenitor cells, endoderm cells is between about 1 day and about 8 days, or the time sufficient to form beta cells is between about 1 day and about 9 days.

7. 2. The method of claim 1, which does not include the use of a TGFβR1 inhibitor (optionally Alk5 inhibitor II) or a thyroid hormone (optionally T3) in the maturation of endoderm cells into beta cells.

8. The method of claim 7, wherein the absence of a TGFβR1 inhibitor allows TGFβ signaling, promotes functional maturation of beta cells from endoderm cells, or allows increased insulin secretion from cells in response to increased glucose levels or increased secretagogue levels.

9. 8. The method of claim 7, wherein the maturation of endoderm cells into beta cells does not include T3, N-acetylcysteine, trolox, or R428.

10. the beta cells are SC-β cells that express at least one β cell marker, at least one pancreatic islet cell marker, and undergo glucose-stimulated insulin secretion (GSIS) including first and second phase dynamic insulin secretion; the beta cells secrete insulin in substantially similar amounts as compared to cadaveric human islets; or The method of claim 1 , wherein the beta cells retain function for one or more days.

11. 2. The method of claim 1, wherein the stem cell is an induced pluripotent stem cell (iPSC) (such as a patient-derived iPSC), a HUES8 embryonic cell, 1013-4FA, SEVA 1016, or SEVA1019.

12. 13. A method of treating a subject in need thereof comprising administering a therapeutically effective amount of insulin-producing beta cells to the subject, whereby the beta cells are generated according to claim 1.

13. 1. A method for differentiating stem cells into cells of an endodermal lineage, comprising: providing stem cells; providing a serum-free medium; contacting the stem cells with a TGFβ / activin agonist and a glycogen synthase kinase 3 (GSK) inhibitor or a WNT agonist for a time sufficient to form definitive endoderm cells; contacting the definitive endoderm cells with an FGFR2b agonist for a period of time sufficient to form primitive gut cells; contacting the primitive intestinal cells with a RAR agonist, and optionally a smoothened antagonist / sonic hedgehog inhibitor, an FGF family member / FGFR2b agonist, a protein kinase 3 activator, a BMP inhibitor, or a rho kinase inhibitor, as appropriate, for a time sufficient to form early pancreatic progenitor cells; incubating the early pancreatic progenitor cells for at least about 3 days, optionally contacting the early pancreatic progenitor cells with a smoothened antagonist, an FGFR2b agonist, an RAR agonist, a rho kinase inhibitor, or a TGF-β / activin agonist for a time sufficient to form pancreatic progenitor cells; contacting the pancreatic progenitor cells with an Alk5 inhibitor / TGF-β receptor inhibitor, thyroid hormone, and a gamma secretase inhibitor, and optionally a SANT1, Erbb1 (EGFR) or Erbb4 agonist / EGF family member, or a RAR agonist, for a time sufficient to form endodermal or endocrine cells; contacting endoderm or endocrine cells, as appropriate, with an Alk5 inhibitor / TGF-β receptor inhibitor or thyroid hormone for a time sufficient to form cells of an endodermal lineage (e.g., pancreatic cells, hepatic cells, or beta cells / SC-β cells); and To modulate the cytoskeleton, the cells are plated on a stiff substrate (such as tissue culture plastic with a thin layer of ECM proteins to promote attachment) or a soft substrate or are introduced with a cytoskeletal modulating agent, at one time and for a time sufficient to enhance differentiation efficiency, the cytoskeletal modulating agent comprising latrunculin A, latrunculin B, nocodazole, cytochalasin D, jasplakinolide, blebbistatin, y-27632, y-15, gdc-0994, or an integrin modulating agent. The method includes:

14. 1. A method for differentiating stem cells into cells of an endodermal lineage, comprising: incubating the stem cells in a medium containing a TGFβ / activin agonist, activin A, a WNT agonist, and CHIR for about 24 hours, and then incubating the cells in a medium containing activin A but not CHIR for about 3 days to generate stage 1 definitive endoderm cells; and To generate exocrine pancreatic cells, the stage 1 definitive endoderm cells are incubated for about 2 days in a medium containing KGF, an FGFR2b agonist, to generate stage 2 cells; the stage 2 cells are incubated for 2 days in a medium containing KGF, an FGFR2b agonist; a BMP inhibitor, LDN193189; TPPB; retinoic acid (RA), an RAR agonist; and SANT1, a smoothened antagonist, to generate stage 3 cells; KGF, an FGFR2b agonist; a BMP inhibitor, LDN 193189; TPPB; the stage 3 cells are incubated for about 4 days in medium containing the RAR agonist retinoic acid; and the smoothened antagonist SANT1 to generate stage 4 cells, whereby latrunculin A is added for about the first 24 hours of incubation or nocodazole is added throughout about the 4 days of incubation; and the stage 4 cells are then incubated for about 6 days in medium containing bFGF, whereby nicotinamide is added for the last 2 days of the 6 days; To generate intestinal cells, incubating the stage 1 and definitive endoderm cells in a medium containing a WNT agonist, CHIR, and FGF4 for about 4 days to generate stage 2 cells, wherein latrunculin A is added for about the first 24 hours of incubation or nocodazole is added throughout about the entire 4 days of incubation; incubating the stage 2 cells in a medium containing R-spondin 1 and a BMP inhibitor; LDN193189 for about 7 days; or To generate hepatocytes, the stage 1 definitive endoderm cells are incubated in medium containing KGF, an FGFR2b agonist, for about 2 days to generate stage 3 cells; the stage 3 cells are incubated in medium containing BMP4 for about 4 days to generate stage 4 cells, where an RAR agonist, retinoic acid, and either latrunculin A or nocodazole are added for about the first 24-48 hours of incubation, and then the stage 4 cells are cultured in medium containing OSM, HGF, and dexamethasone for about 5 days. The method includes:

15. 15. The method of claim 13 or 14, comprising altering the size of the clusters prior to forming cells of the endodermal lineage.

16. The TGFβ / activin agonist is activin A; The glycogen synthase kinase 3 (GSK) inhibitor or WNT agonist is CHIR; The FGFR2b agonist is KGF; the smoothened antagonist or sonic hedgehog inhibitor is SANT-1; The FGF family member / FGFR2b agonist is KGF; the RAR agonist is RA; the protein kinase 3 activator is PDBU; The BMP inhibitor is LDN; The rho kinase inhibitor is Y27632; The Alk5 inhibitor / TGF-β receptor inhibitor is an Alk5i; The thyroid hormone is T3; The gamma secretase inhibitor is XXI; the Erbb1 (EGFR) or Erbb4 agonist / EGF family member is betacellulin; or RAR agonist is RA The method of claim 13.

17. 15. The method of any one of claims 13 or 14, wherein the medium is a serum-free medium containing one or more selected from the group consisting of MCDB131, glucose, NaHCO3, BSA, ITS-X, Glutamax, Vitamin C, Penicillin-Streptomycin, CMRL 10666, FBS, Heparin, NEAA, Trace Element A, Trace Element B, or ZnSO4.

18. 14. The method of claim 13, wherein the time sufficient to form definitive endoderm cells, primitive gut cells, early pancreatic progenitor cells, pancreatic progenitor cells, endoderm cells, or beta cells is between about 1 day and about 15 days.

19. 14. The method of claim 13, wherein early pancreatic progenitor cells are plated or YAP is activated with s1p (sphingosine-1-phosphate) to increase SC-β cell induction, prevent undesirable premature endocrine commitment, or allow for correct timing of transcription factor expression.

20. 14. The method of claim 13, wherein latrunculin A, latrunculin B, or nocodazole is introduced into the pancreatic progenitor cells, resulting in enhanced endocrine induction of the plated cells and enhanced glucose-stimulated insulin secretion of the subsequently generated beta cells.

21. The method of claim 13, wherein latrunculin A or latrunculin B is introduced into pancreatic progenitor cells to generate cells of an endodermal lineage such as hepatocytes, or latrunculin A or latrunculin B disrupts the actin cytoskeleton (e.g., introduction of latrunculin A or latrunculin B before stage 5 results in hepatocytes, or introduction of latrunculin A or latrunculin B through stage 5 increases the number of beta cells).

22. The method of claim 13, wherein a YAP inhibitor (e.g., verteporfin) is introduced into pancreatic progenitor cells.

23. The method of claim 13, wherein latrunculin A or latrunculin B is introduced into pancreatic progenitor cells to increase glucose-mediated insulin secretion or insulin gene expression.

24. 14. The method of claim 13, wherein the cell of the endodermal lineage is selected from a beta cell, a liver cell, or a pancreatic cell.

25. The method of claim 13, which enhances beta cell induction and function.

26. The method of claim 13, comprising culturing in plate (adherent) culture.

27. The method of claim 13, comprising plating cells on a stiff substrate, wherein expression of NKX6.1 is increased on the stiff substrate compared to expression of NKX6.1 on a soft substrate or in suspension culture.

28. The method of claim 13, wherein planar (adherent) cells are dispersed and reaggregated or combined with a surface that changes hydrophobicity with an external cue (e.g., temperature) to allow cell detachment and preserve cell positioning, extracellular matrix proteins, and insulin secretion.

29. The method of claim 13, wherein the beta cells are SC-β cells.

30. 14. The method of claim 13, wherein the stem cells are selected from induced pluripotent stem cells (iPSCs) (such as patient-derived iPSCs), HUES8, 1013-4FA, 1013-4FA, 1016SeVA, and 1019SeVA.

31. providing a cell produced according to any one of claims 1, 13, or 14; and Introducing the compound or composition into the cell A screening method comprising:

32. 17. A method of treating a subject in need thereof comprising administering to the subject a therapeutically effective amount of cells of an endodermal lineage, wherein the cells are generated according to any one of claims 1, 13, or 14.

33. 33. The method of claim 32, wherein the subject has diabetes or the cells are transplanted into the subject, and the transplanted cells improve glucose tolerance in the subject and have a sustained function for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months after transplantation.

34. 15. A cell produced by the method of any one of claims 1, 13, or 14.

35. 35. The cell of claim 34 or a cell produced by the method of any one of claims 1, 13, or 14, wherein the cell of the endodermal lineage, the beta cell, or the intermediate cell of the endodermal lineage expresses CDX2, CHGA, FOXA2, SOX17, PDX1, NKX6-1, NGN3, NEUROG3, NEUROD1, NXK2-2, ISL1, KRT7, KRT19, PRSS1, PRSS2, or INS.

Images