Methods and kits for depletion and enrichment of nucleic acid sequences

Abstract

To provide: kits and methods for enriching target nucleic acid sequences, such as nucleic acid molecules including a target nucleic acid sequence; and kits and methods for depleting target nucleic acid sequences, such as nucleic acid molecules including a target nucleic acid sequence.SOLUTION: In an embodiment, the methods for enriching target nucleic acid sequences include selectively degrading single-stranded sample nucleic acid molecules, such as those that do not include the target nucleic acid sequences. In an embodiment, the methods for depleting target nucleic acid sequences include selectively degrading double-stranded sample nucleic acid molecules, such as those including the target nucleic acid sequences.SELECTED DRAWING: Figure 1-1

Description

Detailed Description of the Invention

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Patent No. 62 / 750,169, filed Oct. 24, 2018, which is hereby incorporated by reference in its entirety.

[0002] Regarding the Sequence Listing The sequence listing related to this application is provided in text format rather than in printed - on - paper format, and is hereby incorporated by reference in this specification. The file name of this text file containing the sequence listing is 70380_Seq_final_2019 - 10 - 24.txt. This text file is 14 KB in size, was created on Oct. 24, 2019, and is submitted via EFS - Web together with the filing of this specification.

[0003] Background It is difficult to determine the sequence and concentration of nucleic acid molecules having a specific target sequence in complex biological samples such as tissues, cells, cell lysates, and sera. Similarly, it is equally difficult to determine the sequence and concentration of nucleic acids from a set of barcoded molecules such as single - cell RNA sequencing libraries.

[0004] Conventionally, to sequence nucleic acids in such complex samples and sequencing libraries, sequencing methods such as Sanger sequencing or next - generation sequencing (NGS) methods have been used. In such methods, many extra sequences are generated in addition to the sequences based on the target sequence of interest. And when using the NGS method, a relatively large number of sequence reads are used to achieve the desired depth of sequencing.

[0005] In complex samples, it is considered that by selectively enriching the target nucleic acid sequence or depleting non - target nucleic acid sequences, the elucidation of sequencing data is simplified and the number of reads required to achieve a specific depth of sequencing can be reduced.

[0006] Accordingly, at present in the art, in preparations for sequencing, etc., it is necessary to selectively remove some or all of the non-target nucleic acid molecules, or to selectively increase the proportion of the target nucleic acid molecule in a complex mixture. The present disclosure aims to meet such a need and further provides related advantages.

[0007] Summary For this purpose, in certain aspects, the present disclosure provides methods and kits for enriching target nucleic acid molecules. Correspondingly, in other aspects, the present disclosure provides methods and kits for depleting non-target nucleic acid molecules.

[0008] In one aspect, the present disclosure provides a method for enriching a target nucleic acid sequence. In one embodiment, the method comprises introducing into a sample solution containing a plurality of sample nucleic acid molecules each containing a universal adapter nucleic acid sequence, a capture primer nucleic acid molecule complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules; performing enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and providing an enriched sample solution having a higher proportion of sample nucleic acid molecules containing the target nucleic acid sequence than the sample solution by performing enzymatic digestion of single-stranded sample nucleic acid molecules. The method further comprises providing an enriched sample solution having a higher proportion of sample nucleic acid molecules containing the target nucleic acid sequence than the sample solution by performing enzymatic digestion of single-stranded sample nucleic acid molecules.

[0009] In another aspect, the present disclosure provides a method for depleting a target nucleic acid sequence. In one embodiment, the method includes introducing into a sample solution containing a plurality of sample nucleic acid molecules each containing a universal adapter nucleic acid sequence containing ribonucleotides, a capture primer nucleic acid molecule that is complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules; performing enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and providing a depleted sample solution in which the proportion of sample nucleic acid molecules containing the target nucleic acid sequence is lower than that of the sample solution, by performing enzymatic cleavage of the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules.

[0010] In one aspect, the present disclosure provides a kit for enriching a target nucleic acid sequence. In one embodiment, the kit includes a capture primer nucleic acid molecule that is complementary or partially complementary to the target sequence, and a degrading enzyme configured to degrade single-stranded nucleic acid molecules.

[0011] In another aspect, the present disclosure provides a kit for depleting a target nucleic acid sequence. In one embodiment, the kit includes a capture primer nucleic acid molecule that is complementary or partially complementary to the target sequence, and a degrading enzyme configured to degrade double-stranded nucleic acid molecules.

[0012] This summary is provided to present a series of concepts in a concise form and these concepts will be further described in the detailed description below. This summary is not intended to identify key features of the claimed subject matter nor is it intended to be used as an aid in determining the scope of the claimed subject matter. (Description of Drawings) Many of the above-described aspects and attendant advantages of the present invention will become more readily appreciated as the same becomes better understood by reference to the following detailed description and the accompanying drawings.

Brief Description of Drawings

[0013]

Figure 1-1

Figure 1-2

Figure 1-3

Figure 1-4

Figure 1-5

Figure 2-1

Figure 2-2

Figure 2-3

Figure 2-4

Figure 2-5

Figure 3-1

Figure 3-2

Figure 3-3

Figure 3-4

Figure 3-5

Figure 4-1

Figure 4-2

Figure 4-3

Figure 5-1

Figure 5-2

Figure 6-1

Figure 6-2

Figure 7-1

Figure 7-2

Figure 7-3

Figure 8

[0014] Detailed description The present disclosure provides kits and methods for enriching a target nucleic acid sequence (such as a nucleic acid molecule comprising the target nucleic acid sequence), as well as kits and methods for depleting a target nucleic acid sequence (such as a nucleic acid molecule comprising the target nucleic acid sequence).

[0015] As used herein, the terms "nucleic acid" and "polynucleotide" refer to biopolymers made up of monomeric units called "nucleotides". Typically, each nucleotide is composed of a pentose sugar, a phosphate group, and a nitrogenous base (also referred to as a "nucleobase"). The structure of this sugar component typically determines the type of nucleic acid polymer. Nucleotide monomers are linked to form a linear sequence of the nucleic acid polymer. Nucleic acids encompassed by the present disclosure include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), cDNA, or peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), and other synthetic nucleic acids well known in the art, or other synthetic polymers having nucleotide side chains, or any combination thereof. Nucleic acid molecules can be single-stranded or double-stranded (including those in which complementary single-stranded polynucleotide chains hybridize by base pairing of individual nucleobases). Typically, cDNA, RNA, GNA, TNA, or LNA are single-stranded. DNA can be double-stranded (dsDNA) or single-stranded (ssDNA).

[0016] The nucleotide subunits of nucleic acids may be natural, artificial, or modified. As described above, nucleotides typically contain a nucleobase, a sugar, and at least one phosphate group. Nucleobases are typically heterocyclic. Suitable nucleobases include canonical purines and pyrimidines, more specifically adenine (A), guanine (G), thymine (T) (or, in RNA, typically uracil (U) instead of thymine (T)), and cytosine (C). The sugar is typically a pentose sugar. Suitable sugars include, but are not limited to, ribose and deoxyribose. Nucleotides are typically ribonucleotides or deoxyribonucleotides. Nucleotides typically contain a monophosphate, diphosphate, or triphosphate. These are generally referred to herein as nucleotides or nucleotide residues and refer to the subunits. Unless otherwise specified, terms such as nucleotides and nucleotide residues are not intended to imply any particular structure or feature. Also, as described above, the nucleic acids according to the present disclosure may also include synthetic variants of DNA or RNA. "Synthetic variants" include nucleic acids incorporating well-known analogs of natural nucleotides and / or nucleobases that can hybridize to nucleic acids in a manner similar to natural nucleotides. Examples of synthetic variants include peptide nucleic acid (PNA), phosphorothioate DNA, and locked nucleic acid. Modified or synthetic nucleobases and analogs include 5-Br-UTP, 5-Br-dUTP, 5-F-UTP, 5-F-dUTP, 5-propynyl dCTP, 5-propynyl-dUTP, diaminopurine, S2T, 5-fluorouracil It may include, but is not limited to, ribose, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl ester of uracil-5-oxyacetic acid, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine, etc. Those having ordinary knowledge in the art can easily determine which base pairs are regarded as base pair matches or base pair mismatches for each modified nucleobase.

[0017] Method In one aspect, the present disclosure provides a method for enriching and / or depleting a target nucleic acid sequence, such as a target nucleic acid sequence present on a sample nucleic acid in a complex sample solution containing sample nucleic acid molecules that do not contain the target nucleic acid sequence.

[0018] Enrichment method In one embodiment, the present disclosure provides a method for enriching a target nucleic acid sequence. In one embodiment, the method for enriching a target nucleic acid sequence comprises: (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to the target nucleic acid sequence of one or more sample nucleic acid molecules into a sample solution containing a plurality of sample nucleic acid molecules each containing a universal adapter nucleic acid sequence; (b) performing enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) performing enzymatic degradation of single-stranded sample nucleic acid molecules to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules containing the target nucleic acid sequence than the sample solution.

[0019] A method for enriching a target nucleic acid sequence according to an embodiment of the present disclosure will be described below. In this regard, FIGS. 1A to 1J schematically illustrating the method for enriching a target nucleic acid sequence according to an embodiment of the present disclosure are noted.

[0020] FIG. 1A schematically illustrates a sample solution containing nucleic acid molecules to be enriched and nucleic acid molecules to be depleted. As shown, the sample solution includes an initial pool of nucleic acid molecules including double-stranded nucleic acid molecules to be enriched and double-stranded nucleic acid molecules to be depleted. When the sample nucleic acid molecules are shown as double-stranded, in one embodiment, the sample nucleic acid molecules include single-stranded sample nucleic acid molecules, or a combination of single-stranded sample nucleic acid molecules and double-stranded sample nucleic acid molecules. The double-stranded nucleic acid molecules to be enriched are illustrated as including universal adapter nucleic acid sequences a, a * , b, and b * and target nucleic acid sequences c and c * . The double-stranded nucleic acid molecules to be depleted are illustrated as including universal adapter nucleic acid sequences a, a * , b, and b * and nucleic acid sequences d and d * different from the target nucleic acid sequences c and c * . The universal adapter nucleic acid sequences a, a in both the sample nucleic acid molecules to be enriched and the sample nucleic acid molecules to be depleted* a, b, and b * a, are shown in the figures as including a common feature that is schematically shown as an ellipse in the figures. As further described herein with respect to Figure 1F, such a common feature is suitable for enzymatic degradation under certain conditions, such as when the universal adapter nucleic acid sequence is single-stranded.

[0021] The method according to the present disclosure is suitable for enriching a plurality of sample solutions containing nucleic acid molecules. In one embodiment, the sample solution is selected from the group consisting of a WGS library, a WES library, an ATAC-seq library, a ChIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, a single-cell RNA-seq library, a DNA data storage library, or any other arbitrary library having universal adapters at both ends. The mixture of DNA molecules may or may not be amplified in advance, and may be generated by an enzyme or chemically synthesized. The universal adapter (domain a and domain b * ) may contain DNA nucleotides and / or RNA nucleotides. As further described herein, at least one of the ribonucleotides may be guanine. In one embodiment, the universal adapter nucleic acid sequence is present on all or substantially all of the nucleic acid molecules in the library.

[0022] In one embodiment, the sample solution comprises double-stranded or single-stranded sample nucleic acid molecules containing 3' modifications configured to prevent or limit self-annealing and extension, from, for example, WGS libraries, WES libraries, ATAC-seq libraries, CHIP-seq libraries, WTS libraries, Bisulfite-seq libraries, and RNA-seq libraries. In one embodiment, such 3' modifications include dideoxynucleotides (ddNTPs), inverted 3'dT, or nucleotide sequences that reduce binding energy (such as adenine, thymine, or uracil). In one embodiment, the starting sample solution comprises double-stranded sample nucleic acid molecules, such as WGS libraries, WES libraries, ATAC-seq libraries, CHIP-seq libraries, WTS libraries, Bisulfite-seq libraries, and RNA-seq libraries, prepared by using PCR primers containing a poly-T overhang or a poly-A overhang at the 5' end.

[0023] In one embodiment, the universal adapter nucleic acid sequence is added by, for example, PCR, translocation, reverse transcription, ligation, chemical synthesis, or other well-known methods for adding an adapter to a DNA sequence, as further described herein with respect to the kits according to the present disclosure.

[0024] In one embodiment, the universal adapter nucleic acid sequence includes a nucleic acid sequence adjacent to the 3' or 5' end, which is configured to avoid self-priming by not binding to itself, as in the case of a hairpin configuration. In one embodiment, the universal adapter nucleic acid molecule includes a poly-T sequence, a poly-A sequence, or a combination thereof. See, for example, FIGS. 6 and 7.

[0025] In one embodiment, the nucleotides in the sample solution include ribonucleotides or deoxynucleotides. In one embodiment, such nucleotides include nucleotides selected from the group consisting of locked nucleic acids, peptide nucleic acids, 2'-O-methyl RNAs, 2'-O-methoxyethyl RNAs, and phosphorothioate-modified nucleic acids. Thus, in one embodiment, the degrading enzymes further described herein, such as RNase T1, are replaced by degrading enzymes that can selectively cleave modified ribonucleotides or deoxynucleotides.

[0026] As described above, in one embodiment, the method includes introducing into the sample solution one or more capture primer nucleic acid molecules that are complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules. FIG. 1B schematically illustrates the sample solution of FIG. 1A further including the capture primer nucleic acid molecule c'.

[0027] As described above, the capture primer nucleic acid molecule is complementary or partially complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule includes a plurality of bases that are not complementary to the target nucleic acid sequence within a range such as 1 to 5. In one embodiment, the capture primer nucleic acid molecule has a complementarity of 90% or more with the target nucleic acid sequence. However, such partially complementary capture primer nucleic acid molecules are configured to bind to the target nucleic acid sequence depending on the annealing temperature and / or other reaction conditions described herein.

[0028] In one embodiment, the method includes maintaining the temperature of the sample solution above the melting temperature of a plurality of sample nucleic acid molecules. FIG. 1C schematically illustrates the sample solution of FIG. 1B after melting the nucleic acid molecules to be enriched and the nucleic acid molecules to be depleted, according to an embodiment of the present disclosure. In one embodiment, the melting temperature is 95° C. or higher. As long as it is the melting temperature of a plurality of sample nucleic acid molecules, the temperature of the sample solution is sufficient to completely or partially break the Watson-Crick bonds between the sample nucleic acid molecules and increase the number of single-stranded or partially single-stranded sample nucleic acid molecules in the sample solution. As shown, such melting results in the target nucleic acid sequences c and c * as well as nucleic acid sequences d and d * being exposed and able to bind to other nucleic acid sequences such as the capture primer nucleic acid molecule c'.

[0029] In one embodiment, the method includes maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence. Such an annealing temperature is generally suitable for annealing at least a portion of the capture primer nucleic acid molecule to the target nucleic acid sequence. In one embodiment, the annealing temperature ranges from about 50° C. to about 72° C. FIG. 1D schematically illustrates the sample solution of FIG. 1C after annealing the capture primer nucleic acid molecule c' to the target sequence c * of the nucleic acid molecule to be enriched. In the illustrated embodiment, one of the capture primer nucleic acid molecules c' is bound to the target nucleic acid sequence c * of the sample nucleic acid molecule to be enriched.

[0030] In one embodiment, the capture primer nucleic acid molecule is configured to be mainly single-stranded at the annealing temperature. In this regard, the capture primer nucleic acid molecule is mostly single-stranded at the annealing temperature and is thus configured to bind to the target nucleic acid sequence in most cases. In one embodiment, the capture primer nucleic acid molecule is configured to be mainly at least partially double-stranded at the annealing temperature. In this regard, the cases where the capture primer nucleic acid molecule is in a configuration suitable for binding to the target nucleic acid sequence are fewer than in most cases at the annealing temperature. Therefore, the binding of such a double-stranded capture primer nucleic acid molecule to the target nucleic acid sequence is generally more selective than in the case of a single-stranded capture primer nucleic acid molecule.

[0031] In one embodiment, the capture primer nucleic acid molecule further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule. Such a double-stranded capture primer nucleic acid molecule is generally double-stranded at the annealing temperature and is thus configured to bind to the target nucleic acid sequence relatively less. In this regard, such a double-stranded capture primer nucleic acid molecule is configured to bind more selectively to the target nucleic acid sequence.

[0032] In one embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules among a plurality of sample nucleic acid molecules, and the second target nucleic acid sequence is different from the above-mentioned target nucleic acid sequence. In this regard, by maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, the capture primer nucleic acid molecule can bind to various target nucleic acid sequences. As further described herein with respect to FIGS. 1E and 1F, sample nucleic acid molecules containing various target sequences that are complementary or partially complementary to the capture primer nucleic acid molecule can undergo enzymatic extension and be protected from degradation.

[0033] In one embodiment, the capture primer nucleic acid molecule contains phosphorothioate bonds. In one embodiment, the phosphorothioate bond is located between the base at the 3'-end of the capture primer nucleic acid molecule and the base immediately adjacent to the base at the 3'-end. Such phosphorothioate bonds are configured to withstand 3'-exonuclease activity, such as that in proofreading polymerases.

[0034] As described above, the sample nucleic acid molecule contains a universal adapter nucleic acid sequence. In one embodiment, the universal adapter nucleic acid sequences of a plurality of sample nucleic acid molecules contain adapter tag nucleic acid sequences. In one embodiment, the adapter tag nucleic acid sequence defines a unique nucleic acid sequence. Such a unique sequence can be used to determine the origin of the sample nucleic acid molecule (e.g., the original cell, tissue, or suspension, etc.) when such a unique nucleic acid sequence has a different sequence from another adapter tag nucleic acid sequence used for tagging sample nucleic acid molecules in other samples such as other cells, tissues, or cell suspensions.

[0035] Such adapter tag nucleic acid sequences are suitable for counting a plurality of nucleic acid molecules in a sample, such as by sequencing the sample solution. In one embodiment, each adapter tag nucleic acid molecule contains a plurality of degenerate bases suitable for counting the sample nucleic acid molecules amplified after a nucleic acid amplification reaction.

[0036] In one embodiment, by maintaining the sample solution at the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence, at least some of the capture primer nucleic acid molecules can bind to the second target nucleic acid sequence. Thus, in one embodiment, the annealing temperature of the capture primer nucleic acid molecule and the second target nucleic acid sequence is relatively close to the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence. Therefore, in one embodiment, the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature within the range of about 1°C to about 5°C from the above annealing temperature.

[0037] In one embodiment, the sample solution is maintained at a temperature near the annealing temperature, but not necessarily exactly at the annealing temperature in some cases. In this regard, the binding specificity of the capture primer nucleic acid molecule is not uniform, and thus the capture primer nucleic acid molecule can bind to a plurality of target nucleic acid sequences having relatively similar sequences, and as a result, a plurality of different sample nucleic acid molecules can be enriched. Therefore, in one embodiment, the step of maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, or at a temperature lower than this, includes the step of maintaining the sample solution at a temperature within the range of about 1°C to about 5°C from the annealing temperature of the capture primer nucleic acid molecule.

[0038] As described above, in one embodiment, the method according to the present disclosure performs enzymatic extension of a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of one or more sample nucleic acid molecules. The step of performing enzymatic extension of the capture primer nucleic acid molecule includes the step of introducing into the sample solution an extension enzyme configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence. FIG. 1E schematically illustrates the sample solution of FIG. 1D after performing enzymatic extension of the capture primer nucleic acid molecule c' annealed to the target sequence c. As shown, the nucleic acid sequence annealed to the target nucleic acid sequence c * is shown to be extended and also bind to the universal adapter nucleic acid sequence b. As further described herein, by binding to the universal adapter nucleic acid sequence, the extended capture primer nucleic acid molecule inhibits enzymatic degradation of the double-stranded sample nucleic acid molecule. * to * bind.

[0039] The extension enzyme can include any enzyme configured to perform enzymatic extension of a capture primer nucleic acid molecule annealed to another nucleic acid molecule. In one embodiment, the extension enzyme is selected from the group consisting of polymerase, reverse transcriptase, and combinations thereof.

[0040] In one embodiment, the step of enzymatically extending the capture primer nucleic acid molecule includes maintaining the sample solution near the extension temperature of an extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence by the extension enzyme. Such an extension temperature may be the same as or different from the annealing temperature. In one embodiment, the extension temperature ranges from about 68°C to about 72°C.

[0041] The method according to the present disclosure includes a step of enzymatically degrading a specific nucleic acid molecule in a sample solution to provide an enriched sample solution in which the proportion of sample nucleic acid molecules containing the target nucleic acid sequence is higher than that of the sample solution. In one embodiment, such enzymatic degradation includes a step of enzymatically degrading single-stranded sample nucleic acid molecules. As described above with respect to FIGS. 1D and 1E, sample nucleic acid molecules containing nucleic acid sequences complementary or partially complementary to the capture primer nucleic acid molecule may generally be double-stranded. In this regard, by enzymatically degrading single-stranded nucleic acid molecules, for example, in combination with other steps such as amplifying the sample nucleic acid molecules as they are, the sample solution is enriched with nucleic acid molecules containing the target nucleic acid sequence.

[0042] In one embodiment, the step of enzymatically degrading single-stranded sample nucleic acid molecules includes introducing into the sample solution a degrading enzyme configured to degrade single-stranded nucleic acid molecules containing a universal adapter nucleic acid sequence. In one embodiment, the degrading enzyme is introduced into the sample solution after the step of enzymatically extending the capture primer nucleic acid molecule. In one embodiment, the degrading enzyme is introduced into the sample solution before the step of enzymatically extending the capture primer nucleic acid molecule. In such an embodiment, the degrading enzyme may not be active, for example, at the extension temperature, and thus does not degrade or substantially degrade single-stranded nucleic acid molecules at the extension temperature. Rather, in one embodiment, the degrading enzyme is active at a temperature lower than the extension temperature.

[0043] In one embodiment, the step of enzymatically degrading a single-stranded sample nucleic acid molecule includes the step of maintaining the temperature of the sample solution at the degradation temperature of the degrading enzyme. In one embodiment, the degradation temperature is lower than the annealing temperature. In one embodiment, the degradation temperature is lower than the extension temperature. In one embodiment, the degradation temperature is about 60° C. or lower.

[0044] In one embodiment, the degradation temperature is the active temperature of the degrading enzyme. Thus, by maintaining the sample solution at or near the degradation temperature, the degrading enzyme becomes active, for example, active in the degradation of single-stranded nucleic acid molecules. In one embodiment, the degrading enzyme is inactive at a temperature selected from the extension temperature, melting temperature, annealing temperature, and combinations thereof. In this regard, the degrading enzyme does not or substantially does not enzymatically degrade single-stranded nucleic acid molecules in the sample solution, such as before the enzymatic extension of the annealing capture primer nucleic acid molecule annealed to the target nucleic acid sequence. molecule.

[0045] In one embodiment, the degrading enzyme becomes active at the degradation temperature after becoming inactive at a temperature higher than the degradation temperature (such as the extension temperature). In this regard, in one embodiment, the degrading enzyme is configured to preferentially or selectively degrade a sample nucleic acid molecule such as a single-stranded sample nucleic acid molecule after becoming inactive at a temperature higher than the degradation temperature. Without being bound by theory, the degrading enzyme is considered to be inactive at a temperature higher than the active temperature, for example, when the degrading enzyme takes an inactive conformation, and it is considered that the degradation is further activated when the temperature of the sample solution is maintained within the active range and the degrading enzyme takes an active conformation.

[0046] In one embodiment, the step of enzymatically degrading a single-stranded sample nucleic acid molecule includes the step of degrading a portion of the universal adapter nucleic acid sequence on the single-stranded sample nucleic acid molecule. FIG. 1F schematically illustrates the sample solution of FIG. 1E after the enzymatic degradation of the single-stranded sample nucleic acid molecule according to an embodiment of the present disclosure. In the illustrated embodiment, the degrading enzyme has degraded a portion of the single-stranded nucleic acid molecule including the universal adapter sequence b that originally included the target portion (shown here as an oval) of the universal adapter nucleic acid sequence. * This is different from the double-stranded sample nucleic acid, which includes the target nucleic acid sequence c * and is undergoing enzymatic extension by an extending enzyme. In this regard, the double-stranded sample nucleic acid is illustrated as having the original universal adapter nucleic acid sequence b * as such.

[0047] In one embodiment, the universal adapter nucleic acid sequence is completely single-stranded. In this regard, the universal adapter nucleic acid sequence is not base-paired with other nucleic acid sequences, such as on another nucleic acid molecule. In one embodiment, only a portion of the universal adapter nucleic acid sequence is single-stranded. In one embodiment, the universal adapter nucleic acid sequence is single-stranded at one or more nucleotides and is configured to be enzymatically degraded by a degrading enzyme when single-stranded.

[0048] The enzymatic degradation of the single-stranded sample nucleic acid molecule can include multiple forms of degradation configured, for example, to render the degraded sample nucleic acid, such as that including the universal adapter nucleic acid molecule, unsuitable for nucleic acid amplification reactions. In one embodiment, the step of enzymatically degrading a single-stranded sample nucleic acid molecule includes the step of cleaving the backbone of the universal adapter nucleic acid molecule of the single-stranded sample nucleic acid molecule. In one embodiment, the step of enzymatically degrading a single-stranded sample nucleic acid molecule includes the step of digesting a portion of the universal adapter nucleic acid molecule of the single-stranded sample nucleic acid molecule.

[0049] As described above, in one embodiment, the degrading enzyme is configured to enzymatically degrade single-stranded nucleic acid molecules such as single-stranded sample nucleic acid molecules. In one embodiment, the degrading enzyme is ribonuclease. In one embodiment, the degrading enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of Rnase T1, Rnase A, and combinations thereof.

[0050] In one embodiment, the degrading enzyme is Rnase T1. In one embodiment, the degrading enzyme relates to SEQ ID NO: 14. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 14 greater than 90%, greater than 95%, or greater than 99%. In one embodiment, the universal adapter nucleic acid sequence contains riboguanine. In one embodiment, the universal adapter nucleic acid sequence contains a plurality of riboguanines. Since Rnase T1 selectively degrades single-stranded riboguanine, when the universal adapter nucleic acid sequence contains one or more riboguanines and the sample solution is maintained at the active temperature of Rnase T1, the Rnase T1 degrading enzyme is configured to degrade the universal adapter nucleic acid sequence. In one embodiment, the degrading enzyme is Rnase T1. In one embodiment, the degrading enzyme relates to SEQ ID NO: 14. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 14 greater than 90%, greater than 95%, or greater than 99%. In one embodiment, the universal adapter nucleic acid sequence contains riboguanine. In one embodiment, the universal adapter nucleic acid sequence contains a plurality of riboguanines. Since Rnase T1 selectively degrades single-stranded riboguanine, when the universal adapter nucleic acid sequence contains one or more riboguanines and the sample solution is maintained at the active temperature of Rnase T1, the Rnase T1 degrading enzyme is configured to degrade the universal adapter nucleic acid sequence.

[0051] In one embodiment, the degrading enzyme is Rnase A. In one embodiment, the degrading enzyme relates to SEQ ID NO: 15. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 15 greater than 90%, greater than 95%, or greater than 99%. In one embodiment, the universal adapter nucleic acid sequence contains bases selected from the group consisting of ribocytosine, ribouracil, and combinations thereof. In one embodiment, the universal adapter nucleic acid sequence contains multiple ribocytosines, multiple ribouracils, and combinations thereof. Since Rnase A selectively degrades single-stranded ribocytosine and ribouracil (e.g., at salt concentrations higher than 300 mM), when the universal adapter nucleic acid sequence contains one or more ribocytosines and / or ribouracils, the Rnase A degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at the active temperature of Rnase A.

[0052] In one embodiment, the method according to the present disclosure includes repeating the enzymatic extension of the capture primer nucleic acid molecule and the enzymatic degradation of the single-stranded sample nucleic acid molecule. By repeating the enzymatic extension and the enzymatic degradation, the extension enzyme, the capture primer nucleic acid molecule, and the degrading enzyme can be used one or more times further to selectively degrade the sample nucleic acid molecules that do not contain the target nucleic acid sequence. As described above, in one embodiment, such degradation includes degrading the universal adapter nucleic acid sequence, which can later be used in a nucleic acid amplification reaction. As further described herein with respect to FIGS. 1I and 1J, sequences containing the universal adapter nucleic acid sequence as it is are preferentially enriched.

[0053] In one embodiment, the method further includes maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecules, such as after performing enzymatic extension of the capture primer nucleic acid molecule and performing enzymatic degradation of the single-stranded sample nucleic acid molecule. In this regard, the sample solution containing the sample nucleic acid molecule having the universal adapter nucleic acid sequence that has undergone or remains enzymatic degradation is single-stranded, and thus is further configured to be enzymatically extended and degraded. FIG. 1G schematically illustrates the melting of the nucleic acid molecules in the sample solution of FIG. 1F according to an embodiment of the present disclosure.

[0054] In one embodiment, the method according to the present disclosure includes a step of purifying a plurality of sample nucleic acid molecules in an enriched sample solution. FIG. 1H schematically illustrates the sample solution of FIG. 1G after removing the capture primer nucleic acid molecule according to an embodiment of the present disclosure. Such purification may include purification using, for example, SPRI beads. In one embodiment, the step of purifying a plurality of sample nucleic acid molecules in an enriched sample solution includes removing reagents selected from capture primer nucleic acid molecules, enzymes, and combinations thereof from the enriched sample solution. Such purification of the sample solution can simplify the sequencing data based on the sample solution by reducing the number of nucleic acid molecules present in the sample solution, and as a result, reducing the amount of sequencing data based on the sample solution, particularly the amount of sequencing data not related to the target nucleic acid sequence.

[0055] In one embodiment, the method according to the present disclosure includes a step of amplifying the sample nucleic acid molecule after enzymatic degradation of the single-stranded nucleic acid molecule. Accordingly, in one embodiment, the method includes introducing a plurality of amplification primer nucleic acid molecules into the enriched sample solution. In one embodiment, the amplification primer nucleic acid molecule of the plurality of amplification primer nucleic acid molecules is complementary to the universal adapter nucleic acid sequence. FIG. 1I shows the polymerase chain reaction (PCR) primer a * and Schematically illustrate the sample solution of FIG. 1H further containing a and b. As shown, the PCR primers are the universal adapter sequences a of the sample nucleic acid molecules in the sample solution according to the embodiments of the present disclosure * and are complementary to b.

[0056] In one embodiment, the method includes providing an amplified enriched sample solution by performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in an enriched sample solution having a plurality of amplified primer nucleic acid molecules. FIG. 1J schematically illustrates the sample solution of FIG. 1I after PCR amplification of the sample nucleic acid molecules of the sample solution according to the embodiments of the present disclosure. As shown, the sample solution has a higher proportion of sample nucleic acid molecules containing the target sequences c and c * than in the case of the nucleic acid sequences d and d * .

[0057] As described above and as shown in FIG. 1J, since at least some of the universal adapter nucleic acid sequences of the sample nucleic acid molecules are degraded, these degraded sample nucleic acid molecules do not participate in the nucleic acid amplification reaction, and thus, the amplified enriched sample solution is considered to have a low proportion of such sample nucleic acid molecules. In this regard, in one embodiment, the step of performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the enriched sample solution does not amplify, or substantially does not amplify, the sample nucleic acid molecules degraded by the degrading enzyme.

[0058] In one embodiment, the method includes preparing an enriched sample solution for use in sequencing, such as a next-generation sample preparation, by performing one or more enzymatic reactions on the amplified enriched sample solution. Thus, in one embodiment, the method according to the present disclosure includes performing a reaction selected from a nucleic acid fragmentation reaction, enzyme-mediated end repair, A tailing, adapter ligation, polymerase chain reaction, and combinations thereof on the amplified enriched sample solution.

[0059] In one embodiment, the method according to the present disclosure includes a step of sequencing nucleic acid molecules in an enriched sample solution. In one embodiment, the step of sequencing nucleic acid molecules in an enriched sample solution includes a step of generating sample nucleic acid information based on a plurality of sample nucleic acid molecules in the enriched sample solution. As described above, in certain embodiments, the universal adapter nucleic acid molecule includes an adapter tag nucleic acid molecule. In one embodiment, the step of sequencing nucleic acid molecules in an enriched sample solution includes a step of generating adapter tag nucleic acid sequence information based on the adapter tag nucleic acid sequence.

[0060] Deficiency method In one embodiment, the present disclosure provides a method for depleting a target nucleic acid sequence. In one embodiment, the method includes: (a) introducing a capture primer nucleic acid molecule that is complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules into a sample solution containing a plurality of sample nucleic acid molecules each containing a universal adapter nucleic acid sequence containing ribonucleotides; (b) enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) providing a depleted sample solution in which the proportion of sample nucleic acid molecules containing the target nucleic acid sequence is lower than that in the sample solution by enzymatically cleaving the double-stranded ribonucleic acid molecules of the sample nucleic acid molecules.

[0061] Hereinafter, a method for depleting a target nucleic acid sequence according to an embodiment of the present disclosure will be described. In this regard, FIGS. 2A to 2J schematically illustrating the method for depleting a target nucleic acid sequence according to an embodiment of the present disclosure are noted.

[0062] FIG. 2A schematically illustrates a sample solution containing nucleic acid molecules to be enriched and nucleic acid molecules to be depleted. As shown, the sample solution includes an initial pool of nucleic acid molecules containing double-stranded nucleic acid molecules to be enriched and double-stranded nucleic acid molecules to be depleted. The double-stranded sample nucleic acid molecules to be enriched include universal adapter nucleic acid sequences a, a demonstrates.* a, b, and b * and target nucleic acid sequences c and c * as shown to include. The double-stranded nucleic acid molecule to be depleted is the universal adapter nucleic acid sequences a, a * b, and b * and nucleic acid sequences c and c * and different target nucleic acid sequences d and d * as shown to include. The universal adapter nucleic acid sequences a, a * b, and b * in both the nucleic acid molecule to be enriched and the nucleic acid molecule to be depleted are shown to include a common feature schematically shown as an ellipse in the figure. As further described herein with respect to Figure 2F, such a common feature is suitable for enzymatic degradation under certain conditions, such as when the universal adapter nucleic acid sequence is double-stranded.

[0063] The method according to the present disclosure is suitable for enriching a plurality of sample solutions containing nucleic acid molecules. In one embodiment, the sample solution is selected from the group consisting of a WGS library, a WES library, an ATAC-seq library, a ChIP-seq library, a WTS library, a Bisulfite-seq library, an RNA-seq library, a single-cell RNA-seq library, a DNA data storage library, or any other library having universal adapters at both ends. The mixture of DNA molecules may or may not be pre-amplified, and may be generated by an enzyme or chemically synthesized. The universal adapter (domain a and domain b * ) may contain DNA nucleotides and / or RNA nucleotides. As further described herein, at least one of the ribonucleotides may be guanine. In one embodiment, the universal adapter nucleic acid sequence is present on all or substantially all of the nucleic acid molecules in the library.

[0064] In one embodiment, the sample solution comprises double-stranded or single-stranded sample nucleic acid molecules containing 3' modifications configured to prevent or limit self-annealing and extension, from, for example, WGS libraries, WES libraries, ATAC-seq libraries, CHIP-seq libraries, WTS libraries, Bisulfite-seq libraries, and RNA-seq libraries. In one embodiment, such 3' modifications include dideoxynucleotides (ddNTPs), inverted 3'dT, or nucleotide sequences that reduce binding energy (such as adenine, thymine, or uracil). In one embodiment, the starting sample solution contains double-stranded sample nucleic acid molecules, such as WGS libraries, WES libraries, ATAC-seq libraries, CHIP-seq libraries, WTS libraries, Bisulfite-seq libraries, and RNA-seq libraries, produced by using PCR primers containing a poly-T overhang or a poly-A overhang at the 5' end.

[0065] In one embodiment, the universal adapter nucleic acid sequence is added by, for example, PCR, translocation, reverse transcription, ligation, chemical synthesis, or other well-known methods for adding an adapter to a DNA sequence, as further described herein with respect to the kits according to the present disclosure.

[0066] In one embodiment, the universal adapter nucleic acid sequence includes a nucleic acid sequence adjacent to the 3' or 5' end, which is configured to not bind to itself, such as in the case of a hairpin configuration, and thus avoid self-priming. In one embodiment, the universal adapter nucleic acid molecule includes a poly-T sequence, a poly-A sequence, or a combination thereof. See, for example, FIGS. 6 and 7.

[0067] In one embodiment, the nucleotides in the sample solution are ribonucleotides or deo It contains xynucleotides. In one embodiment, such nucleotides include nucleotides selected from the group consisting of locked nucleic acids, peptide nucleic acids, 2'-O-methyl RNA, 2'-O-methoxyethyl RNA, and phosphorothioate-modified nucleic acids. Thus, in one embodiment, a degrading enzyme such as RNase HII is replaced by a degrading enzyme configured to selectively cleave modified ribonucleotides or deoxynucleotides having a double-stranded conformation. In one embodiment, the sample nucleic acid molecule contains methylated DNA, and the degrading enzyme contains a restriction enzyme that specifically cleaves methylated (or hemimethylated) double-stranded DNA.

[0068] As described above, in one embodiment, the method includes introducing into the sample solution one or more capture primer nucleic acid molecules that are complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules. FIG. 2B shows the capture primer nucleic acid molecule d' according to an embodiment of the present disclosure. 1 and d' 2* further illustrates schematically the sample solution of FIG. 2A. As shown, the capture primer nucleic acid molecules d' 1 and d' 2* are not the sample nucleic acid molecules to be enriched, but are complementary or partially complementary to the target nucleic acid sequences d * and d on the sample nucleic acid molecules to be depleted.

[0069] In one embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to the universal adapter nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule contains a plurality of bases that are not complementary to the universal adapter nucleic acid sequence within a range such as 1 to 5. In one embodiment, the capture primer nucleic acid molecule has a complementarity of 90% or more with the universal adapter sequence. However, such a partially complementary capture primer nucleic acid molecule is configured to bind to the target nucleic acid sequence depending on the annealing temperature and / or other reaction conditions described herein.

[0070] In one embodiment, the method includes maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules. FIG. 2C schematically illustrates the sample solution of FIG. 2B after melting the enriched sample nucleic acid molecules and the depleted sample nucleic acid molecules according to an embodiment of the present disclosure. In one embodiment, the melting temperature is 95° C. or higher. If it is the melting temperature of the plurality of sample nucleic acid molecules, the temperature of the sample solution is sufficient to completely or partially break the Watson-Crick bonds between the sample nucleic acid molecules and increase the number of single-stranded or partially single-stranded sample nucleic acid molecules in the sample solution. As shown, such melting exposes the target nucleic acid sequences d and d * as well as the nucleic acid sequences c and c * so that they can bind to other nucleic acid sequences such as the capture primer nucleic acid molecules d' 1 and d' 2* and the like.

[0071] In one embodiment, the method includes maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence, or at a lower temperature than this. Such an annealing temperature is generally suitable for annealing at least a portion of the capture primer nucleic acid molecule to the target nucleic acid sequence. In one embodiment, the annealing temperature ranges from about 50 °C to about 72 °C. Figure 2D shows the target sequence d of the sample nucleic acid molecule to be depleted according to an embodiment of the present disclosure * and d, and the capture primer nucleic acid molecules d' 1 and d' 2* schematically illustrate the sample solution of Figure 2C after annealing. In the illustrated embodiment, the capture primer nucleic acid molecules d' 1 and d' 2* are bound to the target nucleic acid sequences d * and d of the sample nucleic acid molecule to be depleted.

[0072] In one embodiment, the capture primer nucleic acid molecule is configured to be mainly single-stranded at the annealing temperature. In this regard, the capture primer nucleic acid molecule is mostly single-stranded at the annealing temperature and is thus mostly configured to bind to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is configured to be mainly at least partially double-stranded at the annealing temperature. In this regard, the cases where the capture primer nucleic acid molecule is in a configuration suitable for binding to the target nucleic acid sequence are fewer than in most cases at the annealing temperature. Therefore, the binding of such a double-stranded capture primer nucleic acid molecule to the target nucleic acid sequence is generally more selective than in the case of a single-stranded capture primer nucleic acid molecule.

[0073] In one embodiment, the capture primer nucleic acid molecule further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule. Such double-stranded capture primer nucleic acid molecules are generally double-stranded at the annealing temperature and are thus relatively less likely to be configured to bind to a target nucleic acid sequence. In this regard, such double-stranded capture primer nucleic acid molecules are configured to bind more selectively to the target nucleic acid sequence.

[0074] In one embodiment, the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules among a plurality of sample nucleic acid molecules, and the second target nucleic acid sequence is different from the target nucleic acid sequence. In this regard, by maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, the capture primer nucleic acid molecule can bind to various target nucleic acid sequences. As further described herein with respect to FIGS. 2E and 2F, sample nucleic acid molecules containing various target sequences that are complementary or partially complementary to the capture primer nucleic acid molecule can undergo enzymatic extension and can be labeled for degradation.

[0075] In one embodiment, the capture primer nucleic acid molecule contains phosphorothioate linkages. In one embodiment, the phosphorothioate linkage is located between the base at the 3' end of the capture primer nucleic acid molecule and the base immediately adjacent to the base at the 3' end. Such phosphorothioate linkages are configured to withstand 3' exonuclease activity, such as that in proofreading polymerases.

[0076] As described above, the sample nucleic acid molecule contains a universal adapter nucleic acid sequence. In one embodiment, the universal adapter nucleic acid sequences of a plurality of sample nucleic acid molecules contain an adapter tag nucleic acid sequence. In one embodiment, the adapter tag nucleic acid sequence defines a unique nucleic acid sequence. Such a unique sequence can be used to determine the origin of the sample nucleic acid molecule (e.g., the originating cell, tissue, or suspension, etc.) when such a unique nucleic acid sequence has a different sequence from another adapter tag nucleic acid sequence used for tagging sample nucleic acid molecules in other samples such as other cells, tissues, or cell suspensions.

[0077] Such an adapter tag nucleic acid sequence is suitable for counting a plurality of nucleic acid molecules in a sample by, for example, sequencing a sample solution. In one embodiment, each adapter tag nucleic acid molecule contains a plurality of degenerate bases suitable for counting the sample nucleic acid molecules amplified after a nucleic acid amplification reaction.

[0078] In one embodiment, by maintaining the sample solution at the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence, at least some of the capture primer nucleic acid molecules can bind to the second target nucleic acid sequence such that the annealing temperature of the capture primer nucleic acid molecule and the second target nucleic acid sequence is relatively close to the annealing temperature of the capture primer nucleic acid molecule and the target nucleic acid sequence. Thus, in one embodiment, the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature within the range of about 1°C to about 5°C from the above annealing temperature.

[0079] In one embodiment, the sample solution is maintained at a temperature near the annealing temperature but not necessarily exactly at the annealing temperature in some cases. In this regard, the capture primer The binding specificity of nucleic acid molecules is not uniform. Therefore, a capture primer nucleic acid molecule can bind to a plurality of target nucleic acid sequences having, for example, relatively similar sequences, and as a result, a plurality of different sample nucleic acid molecules can be depleted. Thus, in one embodiment, the step of maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule, or at a lower temperature, includes maintaining the sample solution at a temperature within the range of about 1°C to about 5°C from the annealing temperature of the capture primer nucleic acid molecule.

[0080] As described above, in one embodiment, the method includes the step of enzymatically extending a capture primer nucleic acid molecule annealed to a target nucleic acid sequence of one or more sample nucleic acid molecules. FIG. 2E shows, according to an embodiment of the present disclosure, the target sequence d * and the capture primer nucleic acid molecule d' 1 and d' 2* that are annealed to d. FIG. 2D schematically illustrates the sample solution after the enzymatic extension of 1 and d' 2* is shown. As shown, the capture primer nucleic acid molecules d' 1 and d' 2* are annealed to the target sequences d * and d on the sample nucleic acid molecules to be depleted. Also, as shown, the nucleic acid sequences annealed to the target nucleic acid sequences d and d * are shown to be extended and also bind to the universal adapter nucleic acid sequences a and b * . As further described herein, by binding to the universal adapter nucleic acid sequences a and b * , the extended capture primer nucleic acid molecules activate the enzymatic degradation of the double-stranded sample nucleic acid molecules.

[0081] The extension enzyme can include any enzyme configured to perform the enzymatic extension of a capture primer nucleic acid molecule annealed to another nucleic acid molecule. In one embodiment, the extension enzyme is selected from the group consisting of polymerase, reverse transcriptase, and combinations thereof.

[0082] In one embodiment, the step of enzymatically extending the capture primer nucleic acid molecule includes maintaining the sample solution near the extension temperature of an extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence by the extension enzyme. Such an extension temperature may be the same as or different from the annealing temperature. In one embodiment, the annealing temperature ranges from about 50°C to about 72°C.

[0083] As described above, the method according to this embodiment includes a step of enzymatically cleaving the double-stranded ribonucleic acid molecule of the sample nucleic acid molecule. FIG. 2F schematically illustrates the sample solution of FIG. 2E after enzymatic degradation of the double-stranded nucleic acid molecule according to an embodiment of the present disclosure. In the illustrated embodiment, the universal adapter nucleic acid sequences a and b * bound to the capture primer nucleic acid molecule that has undergone enzymatic extension are degraded. In this regard, it is illustrated as if the ellipse of the capture primer nucleic acid molecule is degraded. As further described herein with respect to FIG. 2F, such degradation may include cleavage or degradation of the backbone of the universal adapter nucleic acid sequence of the double-stranded sample nucleic acid molecule.

[0084] In the illustrated embodiment, the degrading enzyme is the universal adapter sequences a and b including the target portion (here shown as an ellipse) of the universal adapter nucleic acid sequence * such that a portion of the double-stranded nucleic acid molecule containing them is shown to be enzymatically degraded. The sample nucleic acid molecule containing the target nucleic acid sequences d and d * has the universal adapter sequences a and b * enzymatically degraded. This is different from the single-stranded sample nucleic acid, which contains the nucleic acid sequences c and c * and has the universal adapter sequence as it is. In this regard, the single-stranded sample nucleic acid is illustrated as having the universal adapter nucleic acid sequence as it is.

[0085] The enzymatic degradation of double-stranded sample nucleic acid molecules can include multiple forms of degradation configured to render the degraded sample nucleic acids, such as those containing universal adapter nucleic acid molecules, unsuitable for nucleic acid amplification reactions. In one embodiment, the enzymatic step of degrading double-stranded sample nucleic acid molecules includes the step of cleaving the backbone of the universal adapter nucleic acid molecule of the double-stranded sample nucleic acid molecule. In one embodiment, the step of enzymatically cleaving a double-stranded sample nucleic acid molecule includes the step of degrading a portion of the universal adapter nucleic acid sequence on the double-stranded sample nucleic acid molecule. In one embodiment, the step of enzymatically cleaving a double-stranded sample nucleic acid molecule includes the step of cleaving the backbone of the universal adapter nucleic acid sequence of the double-stranded sample nucleic acid molecule. In one embodiment, the step of enzymatically cleaving a double-stranded sample nucleic acid molecule includes the step of digesting a portion of the universal adapter nucleic acid sequence of the double-stranded sample nucleic acid molecule.

[0086] In one embodiment, the step of enzymatically degrading double-stranded sample nucleic acid molecules includes the step of maintaining the temperature of the sample solution at the degradation temperature of the degrading enzyme. In one embodiment, the degradation temperature is lower than the annealing temperature. In one embodiment, the degradation temperature is lower than the extension temperature. In one embodiment, the degradation temperature is about 60 °C or lower.

[0087] In one embodiment, the degradation temperature is the active temperature of the degrading enzyme. Thus, by maintaining the sample solution at or near the degradation temperature, the degrading enzyme becomes active, for example, active in the degradation of double-stranded nucleic acid molecules. In one embodiment, the degrading enzyme is inactive at a temperature selected from the extension temperature, melting temperature, annealing temperature, and combinations thereof. In this regard, the degrading enzyme does not, or substantially does not, enzymatically degrade double-stranded nucleic acid molecules in the sample solution, such as prior to the enzymatic extension of an annealing capture primer nucleic acid molecule annealed to a target nucleic acid sequence.

[0088] In one embodiment, the degrading enzyme becomes inactive at a temperature higher than the degradation temperature (such as the extension temperature) and then becomes active at the degradation temperature. In this regard, in one embodiment, the degrading enzyme is configured to preferentially or selectively degrade a sample nucleic acid molecule such as a double-stranded sample nucleic acid molecule after becoming inactive at a temperature higher than the degradation temperature. Without being bound by theory, it is considered that the degrading enzyme is inactive at a temperature higher than the active temperature, for example, when the degrading enzyme takes an inactive conformation, and it is considered that the degradation is further activated when the temperature of the sample solution is maintained within the active range and the degrading enzyme takes an active conformation.

[0089] As described above, in one embodiment, the degrading enzyme is configured to perform enzymatic degradation of a double-stranded nucleic acid molecule such as a double-stranded sample nucleic acid molecule. In one embodiment, the degrading enzyme is not a restriction endonuclease. In one embodiment, the degrading enzyme is a ribonuclease. In one embodiment, the degrading enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of Rnase HII, RNase H, Rnase III, and combinations thereof.

[0090] In one embodiment, the degrading enzyme is Rnase HII. In one embodiment, the degrading enzyme relates to SEQ ID NO: 16. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 16 greater than 90%, greater than 95%, or greater than 99%.

[0091] In one embodiment, the degrading enzyme is RNase H. In one embodiment, the degrading enzyme relates to SEQ ID NO: 17. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 17 greater than 90%, greater than 95%, or greater than 99%.

[0092] In one embodiment, the degrading enzyme is Rnase III. In one embodiment, the degrading enzyme is the one according to SEQ ID NO: 18. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 18 greater than 90%, greater than 95%, or greater than 99%.

[0093] In one embodiment, the method according to the present disclosure includes repeating the enzymatic extension of the capture primer nucleic acid molecule and the enzymatic degradation of the double-stranded sample nucleic acid molecule. By repeating the enzymatic extension and the enzymatic degradation, an extension enzyme, a capture primer nucleic acid molecule, and a degrading enzyme can be used one or more times further to selectively degrade a sample nucleic acid molecule containing a target nucleic acid sequence such as target sequences d and d * As described above, in one embodiment, such degradation includes degrading the universal adapter nucleic acid sequence, which can later be used in a nucleic acid amplification reaction. As further described herein with respect to FIGS. 2I and 2J, nucleic acid sequences containing the universal adapter nucleic acid sequence as it is are preferentially enriched. Thus, by performing enzymatic degradation of further sample nucleic acid sequences having a target nucleic acid sequence, sample nucleic acid molecules having no target nucleic acid sequence are configured not to participate in such selective or preferential enrichment.

[0094] In one embodiment, the method further includes a step of maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule, such as after performing the enzymatic extension of the capture primer nucleic acid molecule and then performing the enzymatic degradation of the double-stranded sample nucleic acid molecule. In this regard, the sample solution containing the sample nucleic acid molecule that has undergone enzymatic degradation or has the universal adapter nucleic acid sequence as it is is single-stranded and is thus configured to bind to the capture primer nucleic acid molecule later. FIG. 2G schematically illustrates the melting of the nucleic acid molecules in the sample solution of FIG. 2F according to an embodiment of the present disclosure.

[0095] In one embodiment, the method according to the present disclosure includes a step of purifying a plurality of sample nucleic acid molecules in a depleted sample solution. FIG. 2H shows a capture primer nucleic acid molecule d' according to an embodiment of the present disclosure. 1 and d' 2* FIG. 2G schematically illustrates the sample solution after removing. Such purification may include purification using, for example, SPRI beads. In one embodiment, the step of purifying a plurality of sample nucleic acid molecules in a depleted sample solution includes a step of removing reagents selected from capture primer nucleic acid molecules, enzymes, and combinations thereof from the depleted sample solution. Such purification of the sample solution reduces the number of nucleic acid molecules present in the sample solution and reduces the amount of sequencing data based on the sample solution, particularly reducing the amount of sequencing data not related to the target nucleic acid sequence, thereby simplifying the sequencing data based on the sample solution.

[0096] In one embodiment, the method according to the present disclosure includes a step of amplifying sample nucleic acid molecules after enzymatic degradation of double-stranded nucleic acid molecules. Thus, in one embodiment, the method includes a step of introducing a plurality of amplification primer nucleic acid molecules into a depleted sample solution. In one embodiment, the amplification primer nucleic acid molecules of the plurality of amplification primer nucleic acid molecules are complementary to a universal adapter nucleic acid sequence. FIG. 2I schematically illustrates the sample solution of FIG. 2H further including polymerase chain reaction (PCR) primers a and b * As shown, the PCR primers are complementary to the universal adapter sequences a * and b of the nucleic acid molecules in the sample solution according to an embodiment of the present disclosure.

[0097] In one embodiment, the method includes a step of providing an amplified depleted sample solution by performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in a depleted sample solution having a plurality of amplification primer nucleic acid molecules. FIG. 2J schematically illustrates the sample solution of FIG. 2I after PCR amplification of the nucleic acid molecules of the sample solution according to an embodiment of the present disclosure. As shown, the sample solution includes nucleic acid sequences c and c *The proportion of sample nucleic acid molecules containing is higher than that of the sample nucleic acid molecules containing the target nucleic acid sequences d and d * is higher than that of the sample nucleic acid molecules containing.

[0098] As described above and as shown in Figure 2J, at least some of the universal adapter nucleic acid sequences of the sample nucleic acid molecules are degraded. Therefore, these degraded sample nucleic acid molecules do not participate in the nucleic acid amplification reaction. Thus, it is considered that the amplification-deficient sample solution has a low proportion of such sample nucleic acid molecules. In this regard, in one embodiment, the step of performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the deficient sample solution does not amplify, or substantially does not amplify, the sample nucleic acid molecules degraded by the degrading enzyme. Therefore, the amplification-deficient sample solution has a higher proportion of nucleic acid molecules containing sequence c or c * than d or d * containing.

[0099] In one embodiment, the method includes the step of preparing a deficient sample solution for sequencing, such as a next-generation sample preparation, by performing one or more enzymatic reactions on the amplification-deficient sample solution. Thus, in one embodiment, the method according to the present disclosure includes the step of performing a reaction selected from a nucleic acid fragmentation reaction, enzymatic end repair, A-tailing, adapter ligation, polymerase chain reaction, and combinations thereof on the amplification-deficient sample solution.

[0100] In one embodiment, the method according to the present disclosure includes a step of sequencing nucleic acid molecules in a depleted sample solution. In one embodiment, the step of sequencing nucleic acid molecules in a depleted sample solution includes a step of generating sample nucleic acid information based on a plurality of sample nucleic acid molecules in the depleted sample solution. As described above, in certain embodiments, the universal adapter nucleic acid molecule includes an adapter tag nucleic acid molecule. In one embodiment, the step of sequencing nucleic acid molecules in a depleted sample solution includes a step of generating adapter tag nucleic sequence information based on the adapter tag nucleic acid sequence.

[0101] In one embodiment, the capture primer nucleic acid molecule is a blocking capture primer nucleic acid molecule. In this regard, FIGS. 3A-3J illustrating the method according to embodiments of the present disclosure are noted. FIGS. 3A-3D are similar to FIGS. 1A-1D described elsewhere herein, except that the capture primer nucleic acid molecule includes a capture primer nucleic acid molecule d' that is a blocking capture primer nucleic acid molecule. In this regard, in one embodiment, the blocking capture primer nucleic acid molecule d' is configured to block enzymatic extension by an extension enzyme at the 3' end of the blocking capture primer nucleic acid molecule d'. As shown, the sample solution further includes a non-blocking capture primer nucleic acid molecule a.

[0102] In one embodiment, the blocking capture primer nucleic acid molecule includes a reverse nucleic acid. In one embodiment, the blocking capture primer nucleic acid molecule includes one or more adenine or thymine overhangs at the 3' end.

[0103] As shown in FIG. 3E, in the enzymatic extension in which the blocking capture primer nucleic acid molecule is annealed to the target nucleic acid sequence d * the extension enzyme cannot extend beyond the blocking capture primer nucleic acid molecule, but on other sample nucleic acid molecules, the extension enzyme can extend over the entire molecule (such as an enriched sample nucleic acid molecule) that does not include the target nucleic acid sequence d * .

[0104] As shown in FIG. 3F, the degrading enzyme enzymatically degrades the single-stranded universal adapter molecule of the sample nucleic acid to be depleted. In this regard, subsequently the sample solution is thawed (FIG. 3G), purified (FIG. 3H), amplified (FIGS. 3I and 3J), and depleted of molecules containing the target nucleic acid sequence d * and the sample solution is illustrated as having a higher proportion of sample nucleic acid molecules having sequences c and c * than in the case of the target nucleic acid sequences d and d * . Thus, the sample solution lacks sample nucleic acid molecules having the target nucleic acid sequence.

[0105] The blocking capture primer nucleic acid molecule is illustrated to deplete the sample nucleic acid molecule in combination with a degrading enzyme configured to degrade single-stranded nucleic acid molecules, but according to an embodiment of the present disclosure the blocking capture primer nucleic acid molecule can be used in combination with a degrading enzyme configured to degrade double-stranded sample nucleic acid molecules to enrich sample nucleic acid molecules having a target nucleic acid sequence complementary to the blocking capture primer nucleic acid molecule.

[0106] Kit In another aspect, the present disclosure provides a kit comprising reagents for enriching and / or depleting target nucleic acid sequences, such as target nucleic acid sequences present in a complex sample solution containing nucleic acid molecules that do not contain the target nucleic acid sequence.

[0107] Enrichment kit In one embodiment, the present disclosure provides a kit for enriching sample nucleic acid molecules containing a target nucleic acid sequence. In one embodiment, the kit includes a capture primer nucleic acid molecule complementary or partially complementary to the target sequence and a degrading enzyme configured to degrade single-stranded nucleic acid molecules.

[0108] As described above, the kit includes a capture primer nucleic acid molecule. In one embodiment, the capture primer nucleic acid molecule is fully complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to one or more target nucleic acid molecules. As further described herein, the capture primer nucleic acid molecule can be at least partially complementary to a plurality of target nucleic acid sequences, and thus, depending on the reaction conditions used, the kit according to the present disclosure is configured to enrich sample nucleic acid molecules having a plurality of different target nucleic acid sequences.

[0109] As further described herein with respect to FIG. 1D, the capture primer nucleic acid molecule can be single-stranded, at least partially double-stranded, or double-stranded, such as at the annealing temperature between the capture primer nucleic acid molecule and its target nucleic acid sequence.

[0110] In one embodiment, the capture primer nucleic acid molecule includes phosphorothioate bonds. In one embodiment, the phosphorothioate bond is located between the base at the 3'-end of the capture primer nucleic acid molecule and the base immediately adjacent to the base at the 3'-end. Such phosphorothioate bonds are configured to withstand 3'-exonuclease activity, such as those in proofreading polymerases.

[0111] In one embodiment, the kit further includes a plurality of universal adapter nucleic acid molecules configured to bind to sample nucleic acid molecules. As further described herein with respect to the methods according to the present disclosure, the universal adapter nucleic acid molecules are suitable for use in nucleic acid amplification reactions.

[0112] In one embodiment, the universal adapter nucleic acid molecule includes riboguanine, such as when the degrading enzyme is Rnase T1. In one embodiment, the universal adapter nucleic acid molecule includes ribocytosine, ribouracil, or a combination thereof, such as when the degrading enzyme is Rnase A.

[0113] In one embodiment, the universal adapter nucleic acid molecule includes a nucleic acid sequence adjacent to the 3'-end or 5'-end, which is configured not to bind to itself, such as in the case of a hairpin configuration, and thus to avoid self-priming. In one embodiment, the universal adapter nucleic acid molecule includes a poly-T sequence, a poly-A sequence, or a combination thereof.

[0114] In one embodiment, the kit further includes a reagent for binding the universal adapter nucleic acid molecule to the sample nucleic acid molecule. In one embodiment, the kit includes a transposase in which an oligonucleotide containing the universal adapter nucleic acid molecule is incorporated; a restriction endonuclease, an oligonucleotide or oligonucleotide complex containing the universal adapter nucleic acid molecule, an oligonucleotide or oligonucleotide complex containing a T7 promoter, an antibody or antibody fragment against a transcription factor, and combinations thereof.

[0115] The kit according to this embodiment includes a degrading enzyme. In one embodiment, the degrading enzyme is configured to degrade single-stranded nucleic acid molecules. In one embodiment, the degrading enzyme is configured to degrade single-stranded nucleic acid molecules containing the universal adapter nucleic acid molecule. In one embodiment, the degrading enzyme is ribonuclease. In one embodiment, the degrading enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of Rnase T1, Rnase A, and combinations thereof.

[0116] In one embodiment, the degrading enzyme is Rnase T1. In one embodiment, the degrading enzyme is related to SEQ ID NO: 14. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 14 greater than 90%, greater than 95%, or greater than 99%. In one embodiment, the universal adapter nucleic acid sequence contains riboguanine. In one embodiment, the universal adapter nucleic acid sequence contains a plurality of riboguanines. Since Rnase T1 selectively degrades single-stranded riboguanine, when the universal adapter nucleic acid sequence contains one or more riboguanines, the Rnase T1 degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at the active temperature of Rnase T1.

[0117] In one embodiment, the degrading enzyme is Rnase A. In one embodiment, the degrading enzyme is related to SEQ ID NO: 15. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 15 greater than 90%, greater than 95%, or greater than 99%. In one embodiment, the universal adapter nucleic acid sequence contains a base selected from the group consisting of ribocytosine, ribouracil, and combinations thereof. In one embodiment, the universal adapter nucleic acid sequence contains a plurality of ribocytosines, a plurality of ribouracils, and combinations thereof. Since Rnase A selectively degrades single-stranded ribocytosine and ribouracil (for example, at a salt concentration higher than 300 mM), when the universal adapter nucleic acid sequence contains one or more ribocytosines and / or ribouracils, the Rnase A degrading enzyme is configured to degrade the universal adapter nucleic acid sequence, such as when the sample solution is maintained at the active temperature of Rnase A.

[0118] In one embodiment, the degrading enzyme is inactive in degrading single-stranded nucleic acid molecules above the active temperature range, and becomes active in degrading single-stranded nucleic acid molecules within the active temperature range after becoming inactive. As further described herein, in one embodiment, the degrading enzyme is inactive at high temperatures such as the enzymatic extension temperature, but becomes active when the temperature of the sample solution drops after rising.

[0119] In one embodiment, the kit further includes an extension enzyme configured to extend a capture primer nucleic acid molecule annealed to a target nucleic acid sequence. In one embodiment, the extension enzyme is selected from the group consisting of polymerase, reverse transcriptase, and combinations thereof.

[0120] In one embodiment, the kit further includes instructions for enriching a target nucleic acid sequence, such as in a sample containing a sample nucleic acid molecule. In one embodiment, the kit includes instructions for enriching a sample nucleic acid molecule containing a target nucleic acid sequence. In one embodiment, the instructions include: (a) introducing a capture primer nucleic acid molecule complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules into a sample solution containing a plurality of sample nucleic acid molecules each containing a universal adapter nucleic acid sequence; (b) enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) providing an enriched sample solution in which the proportion of the sample nucleic acid molecule containing the target nucleic acid sequence is higher than that of the sample solution by enzymatically degrading the single-stranded sample nucleic acid molecule. In one embodiment, the instructions further include repeating steps (b) and (c) one or more times for the enriched sample solution. In one embodiment, the instructions further include maintaining the temperature of the sample solution above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

[0121] In one embodiment, regarding the step of enzymatically extending a capture primer nucleic acid molecule, the specification includes a step of maintaining the temperature of the sample solution at or above the melting temperature of a plurality of sample nucleic acid molecules, a step of introducing into the sample solution an extension enzyme configured to extend a capture primer nucleic acid molecule annealed to a target nucleic acid sequence, a step of maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence, or at a temperature lower than this, and a step of maintaining the sample solution near the extension temperature of the extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence by the extension enzyme.

[0122] In one embodiment, regarding the step of enzymatically degrading a single-stranded sample nucleic acid molecule, the specification includes a step of introducing into the sample solution a degrading enzyme configured to degrade a single-stranded nucleic acid molecule containing a universal adapter nucleic acid sequence, and a step of maintaining the temperature of the sample solution at the degradation temperature of the degrading enzyme.

[0123] In one embodiment, the specification further includes a description of the step of binding a universal adapter molecule to a sample nucleic acid molecule in a sample solution.

[0124] Deficiency kit In one embodiment, the present disclosure provides a kit for depleting a sample nucleic acid molecule containing a target nucleic acid sequence. In one embodiment, the kit includes a capture primer nucleic acid molecule complementary or partially complementary to the target sequence, and a degrading enzyme configured to degrade a double-stranded nucleic acid molecule.

[0125] As described above, the kit includes a capture primer nucleic acid molecule. In one embodiment, the capture primer nucleic acid molecule is fully complementary to the target nucleic acid sequence. In one embodiment, the capture primer nucleic acid molecule is partially complementary to one or more target nucleic acid molecules. As further described herein, the capture primer nucleic acid molecule can be at least partially complementary to a plurality of target nucleic acid sequences, and thus, the kit according to the present disclosure is configured to enrich sample nucleic acid molecules having a plurality of different target nucleic acid sequences, depending on the reaction conditions used.

[0126] As further described herein with respect to FIG. 2D, the capture primer nucleic acid molecule can be single-stranded, at least partially double-stranded, or double-stranded, such as at the annealing temperature between the capture primer nucleic acid molecule and its target nucleic acid sequence.

[0127] In one embodiment, the capture primer nucleic acid molecule includes phosphorothioate bonds. In one embodiment, the phosphorothioate bond is located between the 3'-terminal base of the capture primer nucleic acid molecule and the base immediately adjacent to the 3'-terminal base. Such phosphorothioate bonds are configured to withstand 3'-exonuclease activity, such as that in proofreading polymerases. In one embodiment, the kit further includes a plurality of universal adapter nucleic acid molecules configured to bind to sample nucleic acid molecules. As further described herein with respect to the methods according to the present disclosure, the universal adapter nucleic acid molecules are suitable for use in nucleic acid amplification reactions.

[0128]

[0129] ​In one embodiment, the universal adapter nucleic acid molecule contains a nucleic acid sequence adjacent to the 3'-end or 5'-end, which is configured not to bind to itself, such as in the case of a hairpin arrangement, and thus to avoid self-priming. In one embodiment, the universal adapter nucleic acid molecule contains a poly-T sequence, a poly-A sequence, or a combination thereof.

[0130] In one embodiment, the kit further includes a reagent for binding the universal adapter nucleic acid molecule to the sample nucleic acid molecule. In one embodiment, the kit includes a transposase incorporated with an oligonucleotide containing the universal adapter nucleic acid molecule; a restriction endonuclease, an oligonucleotide or oligonucleotide complex containing the universal adapter nucleic acid molecule, an oligonucleotide or oligonucleotide complex containing a T7 promoter, an antibody or antibody fragment against a transcription factor, and combinations thereof selected from the group consisting of these.

[0131] The kit according to this embodiment includes a degrading enzyme. In one embodiment, the degrading enzyme is configured to cleave a double-stranded nucleic acid molecule containing the universal adapter nucleic acid molecule. In one embodiment, the degrading enzyme is configured to degrade a double-stranded nucleic acid molecule containing the universal adapter nucleic acid molecule. In one embodiment, the degrading enzyme is a ribonuclease. In one embodiment, the degrading enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the degrading enzyme is not a restriction endonuclease. In one embodiment, the degrading enzyme is a ribonuclease. In one embodiment, the degrading enzyme is an endonuclease. In one embodiment, the endonuclease is an endoribonuclease. In one embodiment, the endoribonuclease is selected from the group consisting of Rnase HII, RNase H, Rnase III, and combinations thereof.

[0132] In one embodiment, the degrading enzyme is Rnase HII. In one embodiment, the degrading enzyme relates to SEQ ID NO: 16. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 16 that is greater than 90%, greater than 95%, or greater than 99%.

[0133] In one embodiment, the degrading enzyme is Rnase H. In one embodiment, the degrading enzyme relates to SEQ ID NO: 17. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 17 that is greater than 90%, greater than 95%, or greater than 99%.

[0134] In one embodiment, the degrading enzyme is Rnase III. In one embodiment, the degrading enzyme relates to SEQ ID NO: 18. In one embodiment, the degrading enzyme has a sequence homology with SEQ ID NO: 18 that is greater than 90%, greater than 95%, or greater than 99%.

[0135] In one embodiment, the kit further includes an extending enzyme configured to extend a capture primer nucleic acid molecule annealed to a target nucleic acid sequence. In one embodiment, the extending enzyme is selected from the group consisting of polymerase, reverse transcriptase, and combinations thereof. of.

[0136] In one embodiment, the kit further includes instructions for depleting target nucleic acid sequences, such as in a sample containing sample nucleic acid molecules. In one embodiment, the instructions include instructions for performing the depletion method according to the present disclosure. In one embodiment, the instructions include: (a) introducing a capture primer nucleic acid molecule that is complementary or partially complementary to the target nucleic acid sequence of one or more of the plurality of sample nucleic acid molecules into a sample solution containing a plurality of sample nucleic acid molecules each containing a universal adapter nucleic acid sequence containing ribonucleotides; (b) performing enzymatic extension of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) providing a depleted sample solution in which the proportion of sample nucleic acid molecules containing the target nucleic acid sequence is lower than that of the sample solution by performing enzymatic cleavage of the double-stranded ribonucleic acid molecule of the sample nucleic acid molecule. In one embodiment, the instructions further include repeating steps (b) and (c) one or more times on the enriched sample solution. In one embodiment, the instructions further include maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

[0137] In one embodiment, for the step of performing enzymatic extension of the capture primer nucleic acid molecule, the instructions include maintaining the temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules, introducing an extension enzyme configured to extend the capture primer nucleic acid molecule annealed to the target nucleic acid sequence into the sample solution, maintaining the sample solution at or near the annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence, or at a temperature lower than this, and maintaining the sample solution near the extension temperature of the extension enzyme suitable for enzymatically extending the capture primer nucleic acid molecule annealed to the target nucleic acid sequence by the extension enzyme.

[0138] In one embodiment, regarding the step of enzymatically cleaving a double-stranded sample nucleic acid molecule, the specification includes a step of introducing into the sample solution a degrading enzyme configured to cleave a double-stranded nucleic acid molecule containing a universal adapter nucleic acid sequence, and a step of maintaining the temperature of the sample solution at the degradation temperature of the degrading enzyme.

[0139] In one embodiment, the specification further includes a step of introducing a plurality of amplification primer nucleic acid molecules into a sample solution lacking the same, wherein the amplification primer nucleic acid molecules of the plurality of amplification primer nucleic acid molecules are complementary to the universal adapter nucleic acid sequence, and a step of performing a nucleic acid amplification reaction on a plurality of sample nucleic acid molecules in the sample solution lacking the same having the plurality of amplification primer nucleic acid molecules.

[0140] In one embodiment, the specification further includes an instruction regarding the step of binding a universal adapter molecule to a sample nucleic acid molecule in the sample solution.

Example

[0141] Example Example 1: Results of an example of an enrichment scheme using a selection probe: Two different amplicons of different lengths and having a universal adapter were prepared by amplifying the sequence from a plasmid (AmpR is 421 bp, Hygro is 774 bp). The AmpR amplicon was prepared using primers BC_0328 and BC_0330 (Figure 6). The Hygro amplicon was prepared using primers BC_0332 and BC_0334 (Figure 4).

[0142] These two amplicons were added in equal amounts (0.2 ng each) to a 20 μL reaction.

[0143] The following mixture was used to enrich the AmpR amplicon, where BC_306_amp_capture is an oligonucleotide that is complementary to the AmpR amplicon and not complementary to the Hygro amplicon.

[0144]

Table 1

[0145] The following mixture was used to enrich the Hygro amplicon, where BC_301_hygro_capture is an oligonucleotide that is complementary to the Hygro amplicon and not complementary to the AmpR amplicon.

[0146]

Table 2

[0147] The sample was then subjected to the following cycle of conditions: Thermal cycle the sample, 1 or 3 cycles with the following protocol: 1. 95°C, 30 seconds 2. 58°C, 20 seconds 3. 68°C, 20 seconds 4. 37°C or 42°C or 50°C, 15 minutes The sample was then quickly placed on ice.

[0148] Then, 2 μL of each reaction was added to a 25 μL qPCR reaction with universal primers. When the reaction started to plateau, these were transferred from qPCR to a 1.25% agarose gel and run. The results are shown in Figure 8. In the above row, from left to right: 1. 100 base pair ladder (New England Biolabs) 2. Amp capture, 1 cycle, step 4 at 37°C 3. Amp capture, 1 cycle, step 4 at 42°C 4. Amp capture, 1 cycle, step 4 at 50°C 5. Hygro capture, 1 cycle, step 4 at 37°C 6. Hygro capture, 1 cycle, step 4 at 42°C 7. Hygro capture, 1 cycle, step 4 is at 50 °C 8. Control: DNA only The following, from left to right: 9. 100 base pair ladder (New England Biolabs) 10. Amp capture, 3 cycles, step 4 is at 37 °C 11. Amp capture, 3 cycles, step 4 is at 42 °C 12. Amp capture, 3 cycles, step 4 is at 50 °C 13. Hygro capture, 3 cycles, step 4 is at 37 °C 14. Hygro capture, 3 cycles, step 4 is at 42 °C 15. Hygro capture, 3 cycles, step 4 is at 50 °C 16. Control: DNA only

[0149] Oligonucleotide sequences: See Figure 5: AmpR_amplicon-sequence.pdf See Figure 4: Hygro_amplicon-sequence.pdf BC_0108_TSO_PCR AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO: 12) BC_0062_Primer_Bind CAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 13) BC_0328_amp_fwd_3ribo AAGCAGTGGTATCAACrGCArGAGTrGAATGGGTACCAAACGACGAGCGTGACA (SEQ ID NO: 1) BC_0330_amp_rev_3ribo GTGACTGGAGTTCAGACrGTGTrGCTCTTCCrGATCTCCAATGCTTAATCAGTGAGGCACC (SEQ ID NO: 2) BC_0306_Amp_capture ACGGGGAGTCAGGCAACTATGGATGA (SEQ ID NO: 19) BC_0359_amp_ribo_dT_fwd TTTTTTTTTTAAGCAGTGGTATCAACrGCArGAGTrGAATGGGTACCAAACGACGAGCGTGACA (SEQ ID NO: 20) BC_0360_amp_ribo_dT_rev TTTTTTTTTTCAGACrGTGTrGCTCTTCCrGATCTCCAATGCTTAATCAGTGAGGCACC (SEQ ID NO: 21) BC_0332_hygro_fwd_3ribo AAGCAGTGGTATCAACrGCArGAGTrGAATGGGCCCGCTGTTCTGCAGCC (SEQ ID NO: 3) BC_0334_hygro_rev_3ribo GTGACTGGAGTTCAGACrGTGTrGCTCTTCCrGATCTATTCCTTTGCCCTCGGACG (SEQ ID NO: 4) BC_0301_hygro_capture AGAAGTACTCGCCGATAGTGGAAACCGA (SEQ ID NO: 22)

[0150] The results of the gel images in Figure 8 show the enrichment of the desired target molecules under various conditions. Lanes 2-4 and 10-12 show the enrichment of AmpR molecules. Lanes 5-7 and 13-15 show the enrichment of Hygro molecules. The enrichment occurs at a wide range of temperatures (37°C to 50°C) during the degradation process. The gel also shows that enrichment equal to or greater than that of one cycle can be achieved when multiple cycles consisting of nucleic acid melting, capture primer annealing, capture primer extension, and single-stranded riboguanine degradation are performed (compare lanes 10-12 with lanes 4-6 and lanes 13-15 with lanes 5-7).

[0151] Example 2: In this example, for a single-cell RNA sequencing library (derived from expanded primary T cells), specific sequences matching a part of the following genes were enriched: ACTB (ATGGCCCAGTCCTCTCCCAA, SEQ ID NO: 5), GAPDH (AGGAGTAAGACCCCTGGACCAC, SEQ ID NO: 6), TRAC (AGAACCCTGACCCTGCCG, SEQ ID NO: 7), TRBC1 (CTGAAAAACGTGTTCCCACCCGAG, SEQ ID NO: 8), and TRBC2 (ACCTGAACAAGGTGTTCCCACC, SEQ ID NO: 9).

[0152] TRAC corresponds to the constant region of the T cell receptor alpha chain, and TRBC1 and TRCB2 correspond to two possible constant regions present in the T cell receptor beta chain. Since the alpha and beta chains of the T cell receptor are generated by VJ and VDJ recombination, the sequence variations that can occur for each are very high. However, by enriching nucleic acid sequences containing a part of the TRAC sequence, it is possible to enrich all or almost all nucleic acid sequences encoding the T cell receptor alpha chain. Similarly, by enriching nucleic acid sequences containing a part of either TRBC1 or TRBC2, it is possible to enrich all or almost all nucleic acid sequences encoding the T cell receptor beta chain.

[0153] A single-cell RNA sequencing library of amplified cDNA was prepared by the published SPLiT-seq method. For 1 ng of amplified cDNA, PCR was performed for 11 cycles using primers BC_385 and BC_386 for re-amplification, and riboguanosine was introduced at each 5' end of the double-stranded DNA molecule. The resulting PCR product was purified using SPRI beads (Kapa Pure Beads) with a bead-to-PCR product ratio of 2:1 according to the manufacturer's instructions. The concentration of the resulting purified PCR product was measured using the Qubit dsDNA HS Assay Kit.

[0154] Twelve different enrichment variations were compared. Three different polymerase mixtures were tested, two different polymerase extension times were tested, and two different Rnase T1 concentrations were tested (the combination variations are 3×2×2 = 12). Variation 1 (Hot start Taq, 1× Standard Taq In Buffer, polymerase extension for 30 seconds, Rnase T1 at 100 u) Variation 2 (Hot start Taq, 1× Standard Taq Buffer, polymerase extension for 120 seconds, Rnase T1 at 100 u) Variation 3 (Hot start Taq, 1× Standard Taq Buffer, polymerase extension for 30 seconds, Rnase T1 at 20 u) Variation 4 (Hot start Taq, 1× Standard Taq Buffer, polymerase extension for 120 seconds, Rnase T1 at 20 u) Variation 5 (OneTaq Hot start, 1× OneTaq Standard Reaction Buffer, polymerase extension for 30 seconds, Rnase T1 at 100 u) Variation 6 (OneTaq Hot start, 1× OneTaq Standard Reaction Buffer, polymerase extension for 120 seconds, Rnase T1 at 100 u) Variation 7 (OneTaq Hot start, 1× OneTaq Standard Reaction Buffer, polymerase extension for 30 seconds, Rnase T1 at 20 u) Variation 8 (OneTaq Hot start, 1× OneTaq Standard Reaction Buffer, polymerase extension for 120 seconds, Rnase T1 at 20 u) Variation 9 (Deep Vent Exo-, 1× ThermoPol Reaction Buffer, polymerase extension for 30 seconds, Rnase T1 at 100 u) Variation 10 (Deep Vent Exo-, in 1× ThermoPol Reaction Buffer, polymerase extension for 120 seconds, Rnase T1 at 100 u) Variation 11 (Deep Vent Exo-, in 1× ThermoPol Reaction Buffer, polymerase extension for 30 seconds, Rnase T1 at 20 u) Variation 12 (Deep Vent Exo-, in 1× ThermoPol Reaction Buffer, polymerase extension for 120 seconds, Rnase T1 at 20 u)

[0155] Each reaction was prepared using the following: (2 μL 10× Standard Taq Buffer / 4 μL OneTaq Standard Reaction Buffer / 2 μL ThermoPol Reaction Buffer), 1.6 μL 2.5 mM dNTP, (0.1 μL HotStart Taq Polymerase / 0.1 μL OneTaq® Hot Start DNA Polymerase / 0.1 μL Deep Vent® (exo-) DNA Polymerase), 1 μL of pooled capture primers (total 10 μM, 2 μM each), (11.3 / 13.3 μL of water), amplified cDNA 1 μL (from PCR using BC_385 and BC_386), and Rnase T1 1 μL (diluted to 100 u / μL or 20 u / μL). Primers BC_0344_ACTB_probe (SEQ ID NO: 5), BC_0343_GAPDH_probe (SEQ ID NO: 6), BC_0391_TRAC_probe (SEQ ID NO: 7), BC_0392_TRBC1_probe (SEQ ID NO: 8), BC_0393_TRBC2_probe (SEQ ID NO: 9) were used as pooled capture primers.

[0156] Variations 1, 3, 5, 7 were subjected to the following cycles: a. 30 seconds at 95°C, b. 30 seconds at 95°C, c. 20 seconds at 53°C, d. 30 seconds at 68°C, e. 15 minutes at 37°C, f. Repeat steps b - e for an additional 2 cycles (3 cycles including the first cycle). including the first cycle). Variations 2, 4, 6, and 8 were subjected to the following cycle: a. 30 seconds at 95°C, b. 30 seconds at 95°C, c. 20 seconds at 53°C, d. 2 minutes at 68°C, e. 15 minutes at 37°C, f. Repeat steps b - e for an additional 2 cycles (3 cycles including the first cycle). Variations 9 and 11 were subjected to the following cycle: a. 30 seconds at 95°C, b. 30 seconds at 95°C, c. 20 seconds at 55°C, d. 30 seconds at 72°C, e. 15 minutes at 37°C, f. Repeat steps b - e for an additional 2 cycles (3 cycles including the first cycle). Variations 10 and 12 were subjected to the following cycle: a. 30 seconds at 95°C, b. 30 seconds at 95°C, c. 20 seconds at 55°C, d. 2 minutes at 72°C, e. 15 minutes at 37°C, f. Repeat steps b - e for an additional 2 cycles (3 cycles including the first cycle).

[0157] Then, all 12 reactions were purified using single sided SPRI cleanup (Kapa Pure Beads) according to the manufacturer's instructions (doubling the ratio of beads to PCR product). Each of the 12 purified reactions was then amplified by PCR using primers BC_0062 (SEQ ID NO: 12) and BC_0108 TSO_PCR (SEQ ID NO: 12). Subsequently, the amplified PCR products were fragmented, end - repaired (including A - tailing), adapter - ligated, and PCR using primers was performed to add Illumina adapters (P7 and P5) with indexes, preparing them for use in next - generation sequencing on an Illumina sequencer.

[0158] The original amplified cDNA library (which has not undergone any enrichment) was also prepared for next-generation sequencing using the same method (fragmentation, end repair (including A-tailing), adapter ligation, and PCR using primers to add Illumina adapters (P7 and P5) with indexes).

[0159] All 13 libraries (12 enrichment variations and the original non-enriched library) were sequenced together on an Illumina NextSeq. The resulting libraries were sorted according to the indexes added in the final PCR.

[0160] Next, the fold-change enrichment of each of the 12 enrichment variations relative to the non-enriched library was calculated for each of the 5 sequences to be enriched: ACTB (ATGGCCCAGTCCTCTCCCAA, SEQ ID NO: 5), GAPDH (AGGAGTAAGACCCCTGGACCAC, SEQ ID NO: 6), TRAC (AGAACCCTGACCCTGCCG, SEQ ID NO: 7), TRBC1 (CTGAAAAACGTGTTCCCACCCGAG, SEQ ID NO: 8), and TRBC2 (ACCTGAACAAGGTGTTCCCACC, SEQ ID NO: 9).

[0161]

Table 3

[0162] The results in Table 3 show the enrichment of the desired target molecules under various conditions. For each of the 5 target sequences, the nucleic acids containing a given sequence are enriched under different experimental conditions. By adjusting the concentration of Rnase T1, the type of polymerase, and the polymerase extension time, different target sequence fold-change enrichments can be achieved.

[0163] So far, exemplary embodiments have been illustrated and described, but it is understood that these embodiments can be variously modified without departing from the spirit and scope of the present invention.

[0164] Embodiments of the present invention that claim exclusive characteristics or rights are defined as follows.

Claims

1. 1. A method for enriching a target nucleic acid sequence, comprising: (a) introducing into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adaptor nucleic acid sequence, a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules; (b) performing an enzymatic extension of the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; (c) enzymatically degrading single-stranded sample nucleic acid molecules to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules that contain said target nucleic acid sequence than said sample solution.

2. The step of enzymatically extending the capture primer nucleic acid molecule comprises: maintaining a temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules; introducing into the sample solution an extension enzyme configured to extend the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence; maintaining the sample solution at a temperature near or below an annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence; and maintaining the sample solution near an extension temperature of the extension enzyme suitable for enzymatic extension by the extension enzyme of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence.

3. 3. The method of claim 2, wherein the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

4. The step of enzymatically degrading single-stranded sample nucleic acid molecules comprises: introducing into the sample solution a degradative enzyme configured to degrade single-stranded nucleic acid molecules comprising the universal adaptor nucleic acid sequence; The method according to any one of claims 1 to 3, further comprising a step of maintaining the temperature of the sample solution at the decomposition temperature of the decomposition enzyme.

5. The method of claim 4 , wherein the degradative enzyme is introduced into the sample solution after the step of performing enzymatic extension of the capture primer nucleic acid molecule.

6. The method of claim 4 , wherein the degradative enzyme is introduced into the sample solution prior to the step of enzymatic extension of the capture primer nucleic acid molecule.

7. The method of any one of claims 4 to 6, wherein the decomposition temperature is lower than the annealing temperature.

8. The method of any one of claims 4 to 7, wherein the decomposition temperature is lower than the extension temperature.

9. The method according to any one of claims 4 to 8, wherein the decomposition temperature is an activity temperature of the decomposition enzyme.

10. The method according to any one of claims 4 to 9, wherein the decomposition enzyme is a ribonuclease.

11. The method according to any one of claims 4 to 10, wherein the decomposition enzyme is an endonuclease. Law.

12. The method of claim 11 , wherein the endonuclease is an endoribonuclease.

13. The method of claim 12, wherein the endoribonuclease is selected from the group consisting of Rnase T1, Rnase A, and combinations thereof.

14. The method according to any one of claims 4 to 13, wherein the degradative enzyme is Rnase T1 and the universal adaptor nucleic acid sequence comprises riboguanine.

15. The method of any one of claims 4 to 13, wherein the degradative enzyme is Rnase A and the universal adaptor nucleic acid sequence comprises a base selected from the group consisting of ribocytosine, ribouracil, and combinations thereof.

16. The method according to any one of claims 4 to 15, wherein the degradative enzyme is inactive at the extension temperature.

17. The method according to any one of claims 4 to 16, wherein the decomposition enzyme becomes active at the decomposition temperature after being inactive at a temperature higher than the decomposition temperature.

18. The method of any one of claims 1 to 17, wherein the step of enzymatically degrading the single-stranded sample nucleic acid molecule comprises degrading a portion of the universal adapter nucleic acid sequence on the single-stranded sample nucleic acid molecule.

19. The method according to any one of claims 1 to 18, wherein the step of enzymatically degrading the single-stranded sample nucleic acid molecule comprises cleaving the backbone of the universal adaptor nucleic acid molecule of the single-stranded sample nucleic acid molecule.

20. The method of any one of claims 1 to 18, wherein the step of enzymatically degrading the single-stranded sample nucleic acid molecule comprises digesting a portion of the universal adaptor nucleic acid molecule of the single-stranded sample nucleic acid molecule.

21. 21. The method of any one of claims 1 to 20, wherein the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules of the plurality of sample nucleic acid molecules, and the second target nucleic acid sequence is different from the target nucleic acid sequence.

22. 22. The method of any one of claims 2 to 21, wherein maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecule comprises maintaining the sample solution at a temperature within about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecule.

23. 23. The method of any one of claims 2 to 22, wherein the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature within about 1°C to about 5°C of the annealing temperature.

24. The method of any one of claims 2 to 23, further comprising repeating steps (b) and (c) one or more times on said enriched sample solution.

25. The temperature of the sample solution is adjusted to the temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

25. The method of claim 24, further comprising maintaining the molecule at or above its melting temperature.

26. introducing a plurality of amplification primer nucleic acid molecules into the enriched sample solution, wherein an amplification primer nucleic acid molecule of the plurality of amplification primer nucleic acid molecules is complementary to the universal adapter nucleic acid sequence; The method of any one of claims 1 to 25, further comprising the step of performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the enriched sample solution with the plurality of amplification primer nucleic acid molecules to provide an amplified enriched sample solution.

27. 27. The method of claim 26, wherein the step of performing the nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the enriched sample solution does not amplify, or does not substantially amplify, sample nucleic acid molecules that have been degraded by the degradative enzyme.

28. 28. The method of claim 26 or 27, further comprising the step of performing a reaction selected from a nucleic acid fragmentation reaction, an enzymatic end repair, A-tailing, adaptor ligation, a polymerase chain reaction, and combinations thereof on the amplification-enriched sample solution.

29. The method of any one of claims 1 to 28, further comprising the step of purifying said plurality of sample nucleic acid molecules in said enriched sample solution.

30. 30. The method of claim 29, wherein purifying the plurality of sample nucleic acid molecules in the enriched sample solution comprises removing a reagent selected from capture primer nucleic acid molecules, enzymes, and combinations thereof from the enriched sample solution.

31. The method of any one of claims 1 to 30, further comprising the step of sequencing nucleic acid molecules in the enriched sample solution.

32. The method of any one of claims 1 to 31, wherein the universal adaptor nucleic acid sequences of the plurality of sample nucleic acid molecules comprise an adaptor tag nucleic acid sequence.

33. 33. The method of claim 32, wherein the adapter tag nucleic acid sequence defines a unique nucleic acid sequence.

34. 34. The method of any one of claims 31 to 33, wherein sequencing the nucleic acid molecules in the enriched sample solution comprises generating sample nucleic acid information based on the plurality of sample nucleic acid molecules in the enriched sample solution.

35. 35. The method of claim 34, wherein sequencing the nucleic acid molecules in the enriched sample solution comprises generating adaptor tag nucleic acid sequence information based on the adaptor tag nucleic acid sequence.

36. The method of any one of claims 1 to 35, wherein the capture primer nucleic acid molecule comprises a phosphorothioate linkage.

37. 37. The method of claim 36, wherein the phosphorothioate bond is positioned between the base at the 3' end of the capture primer nucleic acid molecule and the base immediately adjacent to the base at the 3' end.

38. The method of any one of claims 1 to 37, wherein the capture primer nucleic acid molecule is configured to be predominantly single-stranded at the annealing temperature.

39. The capture primer nucleic acid molecule is at least partially predominantly dimerized at the annealing temperature. The method according to any one of claims 1 to 37, which is configured to be single stranded.

40. 38. The method of any one of claims 1 to 37, wherein the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence, and the capture primer nucleic acid molecule comprises, within the range of 1 to 5, a number of bases that are not complementary to the universal adaptor nucleic acid sequence.

41. 38. The method of any one of claims 1 to 37, wherein the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence, and the capture primer nucleic acid molecule has 90% or more complementarity to the universal adapter sequence.

42. 38. The method of any one of claims 1 to 37, wherein the capture primer nucleic acid further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule.

43. a capture primer nucleic acid molecule that is complementary or partially complementary to a target sequence; and a degradative enzyme configured to degrade a single-stranded nucleic acid molecule.

44. 44. The kit of claim 43, wherein the degradative enzyme is a ribonuclease.

45. 44. The kit of claim 43, wherein the degradative enzyme is an endonuclease.

46. 46. ​​The kit of claim 45, wherein the endonuclease is an endoribonuclease.

47. 47. The kit of claim 46, wherein the endoribonuclease is selected from the group consisting of Rnase T1, Rnase A, and combinations thereof.

48. The kit according to any one of claims 43 to 47, wherein the degrading enzyme is Rnase T1.

49. The kit according to any one of claims 43 to 48, wherein the degradative enzyme is configured to degrade single-stranded nucleic acid molecules containing riboguanine.

50. The kit according to any one of claims 43 to 46, wherein the degrading enzyme is Rnase A.

51. 51. The kit of claim 50, wherein the degradative enzyme is configured to degrade single-stranded nucleic acid molecules comprising a nucleobase selected from the group consisting of ribocytosine, ribouracil, and combinations thereof.

52. The decomposition enzyme is Above its active temperature range, it is inactive in degrading single-stranded nucleic acid molecules; 52. The kit of any one of claims 43 to 51, which after being inactivated becomes active in degrading single-stranded nucleic acid molecules within said active temperature range.

53. 53. The kit of any one of claims 43 to 52, further comprising a plurality of universal adaptor nucleic acid molecules configured to bind to sample nucleic acid molecules.

54. A transposase incorporating an oligonucleotide containing a universal adaptor nucleic acid molecule; a restriction endonuclease, an oligonucleotide containing a universal adaptor nucleic acid molecule; The kit of any one of claims 43 to 53, further comprising a reagent selected from the group consisting of a nucleotide or oligonucleotide complex, an oligonucleotide or oligonucleotide complex comprising a T7 promoter, an antibody or antibody fragment against a transcription factor, and combinations thereof.

55. 55. The kit of claim 53 or 54, wherein the degradative enzyme is configured to degrade single-stranded nucleic acid molecules that comprise the universal adaptor nucleic acid molecule.

56. and further comprising instructions for enriching a target nucleic acid sequence, the instructions comprising: (a) introducing into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adaptor nucleic acid sequence, a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules; (b) performing an enzymatic extension of the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; and (c) performing enzymatic degradation of single-stranded sample nucleic acid molecules to provide an enriched sample solution having a higher proportion of sample nucleic acid molecules comprising said target nucleic acid sequence than said sample solution.

57. For enzymatically extending the capture primer nucleic acid molecule, the instructions include: maintaining a temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules; introducing into the sample solution an extension enzyme configured to extend the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence; maintaining the sample solution at a temperature near or below an annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence; and maintaining the sample solution near an extension temperature of the extension enzyme suitable for enzymatic extension by the extension enzyme of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence.

58. For the step of enzymatically digesting single-stranded sample nucleic acid molecules, the instructions include: introducing into the sample solution a degradative enzyme configured to degrade single-stranded nucleic acid molecules comprising the universal adaptor nucleic acid sequence; and maintaining the temperature of the sample solution at the decomposition temperature of the decomposition enzyme.

59. 59. The kit of any one of claims 56 to 58, wherein the instructions further comprise repeating steps (b) and (c) one or more times on the enriched sample solution.

60. 60. The kit of claim 59, wherein the instructions further comprise maintaining a temperature of the sample solution at or above a melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

61. The instructions are: introducing a plurality of amplification primer nucleic acid molecules into the enriched sample solution, wherein an amplification primer nucleic acid molecule of the plurality of amplification primer nucleic acid molecules is complementary to the universal adapter nucleic acid sequence; 61. The kit of any one of claims 56 to 60, further comprising the step of performing a nucleic acid amplification reaction on said plurality of sample nucleic acid molecules in said enriched sample solution having said plurality of amplification primer nucleic acid molecules.

62. The instructions are:

62. The kit of any one of claims 56 to 61, further comprising instructions for attaching a universal adaptor molecule to a sample nucleic acid molecule in a sample solution.

63. 63. The kit of any one of claims 43 to 62, further comprising an extending enzyme configured to extend the capture primer nucleic acid molecule that is annealed to a target nucleic acid sequence.

64. 64. The kit of claim 63, wherein the extension enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

65. 1. A method for depleting a target nucleic acid sequence, comprising: (a) introducing into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adaptor nucleic acid sequence comprising a ribonucleotide, a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules; (b) performing an enzymatic extension of the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; (c) performing enzymatic cleavage of double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules containing the target nucleic acid sequence than the sample solution.

66. The step of enzymatically extending the capture primer nucleic acid molecule comprises: maintaining a temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules; introducing into the sample solution an extension enzyme configured to extend the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence; maintaining the sample solution at a temperature near or below an annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence; and maintaining the sample solution near an extension temperature of the extending enzyme suitable for enzymatic extension by the extending enzyme of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence.

67. 67. The method of claim 66, wherein the extending enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

68. The step of enzymatically cleaving the double-stranded sample nucleic acid molecules comprises: introducing into the sample solution a degradative enzyme configured to degrade double-stranded ribonucleic acid molecules comprising the universal adaptor nucleic acid sequence; and maintaining the temperature of the sample solution at the decomposition temperature of the decomposition enzyme.

69. 69. The method of claim 68, wherein the degradative enzyme is introduced into the sample solution after the step of performing enzymatic extension of the capture primer nucleic acid molecule.

70. 69. The method of claim 68, wherein the degradative enzyme is introduced into the sample solution prior to the step of performing enzymatic extension of the capture primer nucleic acid molecule.

71. 69. The method of claim 68, wherein the decomposition temperature is less than the annealing temperature.

72. 69. The method of claim 68, wherein the decomposition temperature is lower than the extension temperature.

73. 69. The method of claim 68, wherein the decomposition temperature is the activity temperature of the decomposition enzyme.

74. The method according to any one of claims 68 to 73, wherein the degradative enzyme is a ribonuclease.

75. The method according to any one of claims 68 to 73, wherein the degradative enzyme is an endonuclease.

76. 76. The method of claim 75, wherein the endonuclease is an endoribonuclease.

77. 77. The method of claim 76, wherein the endoribonuclease is selected from the group consisting of RNase HII, RNase H, RNase III, and combinations thereof.

78. The method according to any one of claims 68 to 76, wherein the degradative enzyme is Rnase HII.

79. 79. The method of any one of claims 65 to 78, wherein the capture primer nucleic acid molecule is a blocked capture primer nucleic acid molecule, the blocked capture primer nucleic acid molecule configured to block enzymatic extension at a 3' end of the blocked capture primer nucleic acid molecule by an extending enzyme.

80. 80. The method of any one of claims 68 to 79, wherein the step of performing enzymatic cleavage of the double-stranded sample nucleic acid molecule comprises degrading a portion of the universal adaptor nucleic acid sequence on the double-stranded sample nucleic acid molecule.

81. 81. The method of claim 80, wherein the step of performing enzymatic cleavage of the double-stranded sample nucleic acid molecule comprises cleaving the backbone of the universal adaptor nucleic acid sequence of the double-stranded sample nucleic acid molecule.

82. 81. The method of claim 80, wherein performing enzymatic cleavage of the double-stranded sample nucleic acid molecule comprises digesting a portion of the universal adaptor nucleic acid sequence of the double-stranded sample nucleic acid molecule.

83. 83. The method of any one of claims 65 to 82, wherein the capture primer nucleic acid molecule is complementary or partially complementary to a second target nucleic acid sequence of one or more second sample nucleic acid molecules of the plurality of sample nucleic acid molecules, and the second target nucleic acid sequence is different from the target nucleic acid sequence.

84. 84. The method of any one of claims 66 to 83, wherein maintaining the sample solution at a temperature near or below the annealing temperature of the capture primer nucleic acid molecule comprises maintaining the sample solution at a temperature within about 1°C to about 5°C of the annealing temperature of the capture primer nucleic acid molecule.

85. 85. The method of claim 83 or 84, wherein the capture primer nucleic acid molecule and the second target nucleic acid sequence have a second annealing temperature within about 1° C. to about 5° C. of the annealing temperature.

86. 86. The method of any one of claims 65 to 85, further comprising repeating steps (b) and (c) one or more times on said depleted sample solution.

87. 87. The method of claim 86, further comprising maintaining a temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

88. introducing a plurality of amplification primer nucleic acid molecules into the depleted sample solution, wherein an amplification primer nucleic acid molecule of the plurality of amplification primer nucleic acid molecules is complementary to the universal adapter nucleic acid sequence; The method of any one of claims 65 to 87, further comprising the step of providing an amplification depleted sample solution by performing a nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the depleted sample solution having the plurality of amplification primer nucleic acid molecules.

89. 89. The method of claim 88, wherein the step of performing the nucleic acid amplification reaction on the plurality of sample nucleic acid molecules in the depleted sample solution does not amplify, or does not substantially amplify, sample nucleic acid molecules that have been degraded by the degradative enzyme.

90. 90. The method of any one of claims 65 to 89, further comprising the step of subjecting the amplification deficient sample solution to a reaction selected from a nucleic acid fragmentation reaction, an enzymatic end repair, A-tailing, adaptor ligation, a polymerase chain reaction, and combinations thereof.

91. 91. The method of any one of claims 65 to 90, further comprising the step of purifying said plurality of sample nucleic acid molecules in said depleted sample solution.

92. 92. The method of claim 91, wherein purifying the plurality of sample nucleic acid molecules in the depleted sample solution comprises removing a reagent selected from a capture primer nucleic acid molecule, an enzyme, and combinations thereof from the depleted sample solution.

93. 93. The method of any one of claims 65 to 92, further comprising the step of sequencing nucleic acid molecules in the depleted sample solution.

94. 94. The method of any one of claims 65 to 93, wherein the universal adaptor nucleic acid sequences of the plurality of sample nucleic acid molecules comprise an adaptor tag nucleic acid sequence.

95. 95. The method of claim 94, wherein the adapter tag nucleic acid sequence defines a unique nucleic acid sequence.

96. 96. The method of any one of claims 93 to 95, wherein the step of sequencing the nucleic acid molecules in the depleted sample solution comprises generating sample nucleic acid information based on the plurality of sample nucleic acid molecules in the depleted sample solution.

97. 97. The method of claim 96, wherein sequencing the nucleic acid molecules in the depleted sample solution comprises generating adaptor tag nucleic acid sequence information based on the adaptor tag nucleic acid sequence.

98. 98. The method of any one of claims 65 to 97, wherein the capture primer nucleic acid molecule comprises a phosphorothioate linkage.

99. 99. The method of claim 98, wherein the phosphorothioate bond is located between the base at the 3' end of the capture primer nucleic acid molecule and the base immediately adjacent to the base at the 3' end.

100. 100. The method of any one of claims 65 to 99, wherein the capture primer nucleic acid molecule is configured to be predominantly single-stranded at the annealing temperature.

101. 100. The method of any one of claims 65 to 99, wherein the capture primer nucleic acid molecule is configured to be predominantly at least partially double-stranded at the annealing temperature.

102. 102. The method of any one of claims 65-101, wherein the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence, and the capture primer nucleic acid molecule comprises, within 1 to 5, a number of bases that are not complementary to the universal adaptor nucleic acid sequence.

103. 103. The method of any one of claims 65 to 102, wherein the capture primer nucleic acid molecule is partially complementary to the target nucleic acid sequence, and the capture primer nucleic acid molecule has 90% or more complementarity to the universal adapter molecule.

104. 104. The method of any one of claims 65 to 103, wherein the capture primer nucleic acid molecule further comprises a second capture primer nucleic acid molecule that is complementary or partially complementary to the first capture primer nucleic acid molecule.

105. a capture primer nucleic acid molecule that is complementary or partially complementary to a target sequence; and a degradative enzyme configured to degrade a double-stranded nucleic acid molecule.

106. The kit of claim 105, wherein the degradative enzyme is a ribonuclease.

107. The kit of claim 105, wherein the degradative enzyme is an endonuclease.

108. The kit of claim 107, wherein the endonuclease is an endoribonuclease.

109. 109. The kit of claim 108, wherein the endoribonuclease is selected from the group consisting of RNase HII, RNase H, RNase III, and combinations thereof.

110. The kit according to any one of claims 105 to 109, wherein the degrading enzyme is RNase HII.

111. 111. The kit of any one of claims 105 to 110, wherein the capture primer nucleic acid molecule is a blocked capture primer nucleic acid molecule, the blocked capture primer nucleic acid molecule configured to block enzymatic extension by an extending enzyme at a 3' end of the blocked capture primer nucleic acid molecule.

112. The decomposition enzyme is Above its active temperature range, it is inactive in degrading double-stranded nucleic acid molecules; The kit according to any one of claims 105 to 111, which after being inactivated, becomes active in decomposing double-stranded nucleic acid molecules within said active temperature range.

113. 113. The kit of any one of claims 105 to 112, further comprising a plurality of universal adaptor nucleic acid molecules configured to bind to sample nucleic acid molecules.

114. A transfection vector incorporating an oligonucleotide containing a universal adaptor nucleic acid molecule. The kit of any one of claims 105 to 113, further comprising a reagent selected from the group consisting of a sposase; a restriction endonuclease, an oligonucleotide or oligonucleotide complex comprising a universal adaptor nucleic acid molecule, an oligonucleotide or oligonucleotide complex comprising a T7 promoter, an antibody or antibody fragment against a transcription factor, and combinations thereof.

115. The kit of claim 114, wherein the degradative enzyme is configured to cleave a double-stranded nucleic acid molecule that comprises the universal adaptor nucleic acid molecule.

116. and further comprising instructions for depleting the target nucleic acid sequence, the instructions comprising: (a) introducing into a sample solution comprising a plurality of sample nucleic acid molecules, each of the sample nucleic acid molecules comprising a universal adaptor nucleic acid sequence comprising a ribonucleotide, a capture primer nucleic acid molecule that is complementary or partially complementary to a target nucleic acid sequence of one or more sample nucleic acid molecules of the plurality of sample nucleic acid molecules; (b) performing an enzymatic extension of the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence of the one or more sample nucleic acid molecules; (c) performing enzymatic cleavage of double-stranded ribonucleic acid molecules of the sample nucleic acid molecules to provide a depleted sample solution having a lower proportion of sample nucleic acid molecules containing the target nucleic acid sequence than the sample solution.

117. For enzymatically extending the capture primer nucleic acid molecule, the instructions include: maintaining a temperature of the sample solution at or above the melting temperature of the plurality of sample nucleic acid molecules; introducing into the sample solution an extension enzyme configured to extend the capture primer nucleic acid molecule that is annealed to the target nucleic acid sequence; maintaining the sample solution at a temperature near or below an annealing temperature of the capture primer nucleic acid molecule suitable for annealing the capture primer nucleic acid molecule to the target nucleic acid sequence; and maintaining the sample solution near an extension temperature of the extension enzyme suitable for enzymatic extension by the extension enzyme of the capture primer nucleic acid molecule annealed to the target nucleic acid sequence.

118. For the step of enzymatic cleavage of double-stranded sample nucleic acid molecules, the instructions include: introducing into the sample solution a degradative enzyme configured to cleave double-stranded nucleic acid molecules comprising the universal adaptor nucleic acid sequence; and maintaining the temperature of the sample solution at the decomposition temperature of the decomposition enzyme.

119. 119. The kit of any one of claims 116 to 118, wherein the instructions further comprise repeating steps (b) and (c) one or more times on the depleted sample solution.

120. 120. The kit of claim 119, wherein the instructions further comprise maintaining a temperature of the sample solution at or above a melting temperature of the plurality of sample nucleic acid molecules and the capture primer nucleic acid molecule.

121. The instructions are: introducing a plurality of amplification primer nucleic acid molecules into the depleted sample solution, wherein an amplification primer nucleic acid molecule of the plurality of amplification primer nucleic acid molecules is complementary to the universal adapter nucleic acid sequence; and performing a nucleic acid amplification reaction on said plurality of sample nucleic acid molecules in said depleted sample solution having said plurality of amplification primer nucleic acid molecules.

122. The kit of any one of claims 116 to 121, wherein the instructions further comprise instructions for attaching a universal adaptor molecule to a sample nucleic acid molecule in a sample solution.

123. 123. The kit of any one of claims 105 to 122, further comprising an extending enzyme configured to extend the capture primer nucleic acid molecule that is annealed to a target nucleic acid sequence.

124. The kit of any one of claims 105 to 123, wherein the extension enzyme is selected from the group consisting of a polymerase, a reverse transcriptase, and combinations thereof.

Images