Composition containing enzymatically treated rice bran product

Abstract

To provide means for promoting expression of FGF-21.SOLUTION: Provided is a composition for promoting expression and / or secretion of FGF-21 that contains an enzymatically treated rice bran product.SELECTED DRAWING: None

Description

Technical Field

[0001] The present disclosure relates to a composition containing an enzymatically treated rice bran product, etc. Specifically, it relates to a composition for promoting the expression and / or secretion of FGF-21, etc., containing an enzymatically treated rice bran product.

Background Art

[0002] It is known that enzymatically treated rice bran products have various effects such as an ACE inhibitory effect (Patent Document 1), a vascular endothelial function improving effect (Patent Document 2), a thrombus prevention effect (Patent Document 3), a brain function improving effect (Patent Document 4), an anti-obesity effect (Patent Document 5), etc.

[0003] On the other hand, myokines are a general term for hormones and peptides secreted from skeletal muscle (muscle), and are endocrine substances that act on the muscle itself or on multiple organs via the bloodstream, and are known to be secreted by exercise. FGF-21, known as one of the myokines, is a type of fibroblast growth factor having a pharmacological action of improving abnormal glycolipid metabolism, and is mainly produced in the liver, but it has also been found to be produced and secreted from fat and muscle. Currently, clinical trials are being conducted to use FGF-21 as a drug for improving metabolic diseases, and in recent years, it has been reported to be important for maintaining the function of skeletal muscle as well.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Non-Patent Documents

[0005]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0006] It is an object to provide a means for promoting the expression or secretion of FGF-21.

Means for Solving the Problems

[0007] The present inventors have found that the enzymatically treated product of rice bran has an action of promoting the expression or secretion of FGF-21, and have further made improvements.

[0008] The present disclosure includes, for example, the subject matter described in the following items. Item 1. A composition for promoting FGF-21 expression and / or secretion, comprising an enzymatically treated product of rice bran. Item 2. A composition for use in at least one selected from the group consisting of maintenance of muscle function, improvement of muscle function, maintenance of muscle mass, and increase in muscle mass, comprising an enzymatically treated product of rice bran. Item 3. A composition for use in at least one selected from the group consisting of anti-obesity and improvement of brain function, comprising an enzymatically treated product of rice bran. Item 4. The composition according to item 3, wherein the brain function improvement is at least one selected from the group consisting of maintenance of brain function, maintenance of cognitive function, maintenance of attention function, maintenance of memory, maintenance of spatial recognition ability, maintenance of attention, maintenance of work efficiency, and improvement of judgment. Item 5. The composition according to any one of items 1 to 4, wherein the enzyme-treated rice bran product is a thermolysin-treated rice bran product.

Effects of the Invention

[0009] A composition for promoting FGF-21 expression and / or secretion is provided.

Brief Description of the Drawings

[0010]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Modes for Carrying Out the Invention

[0011] Hereinafter, each embodiment included in the present disclosure will be described in more detail. The composition for promoting FGF-21 expression and / or secretion included in the present disclosure contains an enzyme-treated rice bran product. In this specification, the composition may be referred to as "the composition for promoting FGF-21 expression and / or secretion of the present disclosure".

[0012] The rice bran is not particularly limited, but defatted rice bran is preferred. For example, it may be defatted rice bran obtained by pressing (pressed defatted rice bran). More specifically, it may also be pressed defatted rice bran obtained by heating the rice bran (raw rice bran) obtained after milling to inactivate lipase and then performing a pressing process. In addition, examples of the defatted rice bran include defatted rice bran having a lipid content of 5 to 20% by mass. Defatted rice bran having a lipid content within this range is preferably obtained by pressing defatting (particularly, pressing defatting after lipase inactivation treatment).

[0013] The lipase inactivation treatment is performed for the purpose of preventing oxidative deterioration of rice bran (raw rice bran) containing about 18 to 20% by mass of lipids. Usually, it is performed by heating and roasting the raw rice bran at about 70 to 130°C. The pressing process is carried out by a known pressing method, for example, pressing the rice bran that has been heat-roasted and reached about 100 to 115°C with a low-temperature continuous press (for example, the Miracle Chamber sold by Technosigma). The pressing can be carried out until the lipid content in the defatted rice bran after pressing reaches about 5 to 20% by mass. Also, a drying process may be performed for the purpose of reducing the moisture content of the rice bran before the lipase inactivation treatment or the defatted rice bran after oil extraction. Furthermore, in particular, the defatted rice bran obtained by the pressing process can be further pulverized and classified by a known method to be in a powder form. At this time, the average particle diameter of the powder may be 5 to 200 μm, may be 10 to 150 μm, or may be 40 to 100 μm. Note that the lipid content in the defatted rice bran may be 5 to 20% by mass as described above, or may be 7 to 15% by mass. In addition, it is also possible to purchase and use commercially available defatted rice bran as described above. Examples of such commercially available defatted rice bran include Nukup (manufactured by Tokyo Bref Co., Ltd.), High Bref (manufactured by Sanbran Co., Ltd.), and the like.

[0014] As the enzyme used for preparing the enzyme-treated rice bran product, there is no particular limitation as long as it is a protease (including peptidase) capable of decomposing proteins and polypeptides contained in rice bran, and known enzymes can be used. Examples of such enzymes include trypsin (EC3.4.21.4), papain (EC3.4.22.2), thermolysin (EC3.4.24.27), chymotrypsin (EC3.4.21.1, EC3.4.21.2), etc. The descriptions in parentheses are enzyme numbers (Enzyme Commission numbers). Among them, thermolysin is preferred.

[0015] As the enzyme used for the enzyme treatment of rice bran, for example, commercially available products can be purchased and used. For example, thermolysin can be purchased from Peptide Institute, Inc., Daiwa Kasei Co., Ltd., Nacalai Tesque, Inc., Amano Enzyme, Wako Pure Chemical Industries, Ltd., etc.

[0016] The enzyme treatment conditions for obtaining the enzyme-treated rice bran product are not particularly limited as long as the conditions can obtain the activity of the enzyme used, and can be appropriately determined. For example, when using thermolysin as the enzyme, after mixing rice bran and thermolysin in water, the treatment can be carried out by reacting at 30°C to 70°C with gentle stirring for about 1 to 30 hours. The reaction temperature and reaction time vary depending on the structure and function of the manufacturing equipment used and the purity of the enzyme used. For example, the optimum temperature of thermolysin is around about 65°C, but industrially, it is preferable to determine the reaction temperature in the range of 35 to 60°C (more preferably 50 to 60°C). In addition, after the treatment, the enzyme may be inactivated for the purpose of stabilizing the quality. The inactivation treatment of the enzyme can be carried out, for example, by heating (the conditions vary depending on the enzyme used, for example, when using an enzyme preparation containing about 3% thermolysin, a treatment at 70 to 100°C for about 1 to 20 minutes can be adopted). Furthermore, after the treatment, filtration, centrifugation, etc. can be carried out to recover the filtrate, etc., or the obtained filtrate, etc. can be purified by concentration, drying, column treatment, etc.

[0017] As described above, the rice bran enzyme-treated product is obtained by subjecting rice bran to enzyme treatment, and the rice bran enzyme-treated product contains enzyme degradation products of proteins and polypeptides contained in rice bran.

[0018] The composition for promoting FGF-21 expression and / or secretion of the present disclosure may be the above-described rice bran enzyme-treated product itself, or may contain other components in addition to the rice bran enzyme-treated product. Examples of the other components include carriers that are pharmaceutically or food hygienically acceptable.

[0019] In the composition for promoting FGF-21 expression and / or secretion of the present disclosure, the content of the rice bran enzyme-treated product is not particularly limited, and may be, for example, about 1 to 100% by mass, about 5 to 90% by mass, or about 10 to 80% by mass.

[0020] The composition for promoting FGF-21 expression and / or secretion of the present disclosure can be used as an oral composition. As the oral composition, for example, it can be used as a food composition, a pharmaceutical composition (including quasi-drugs), etc.

[0021] The form of the composition for promoting FGF-21 expression and / or secretion of the present disclosure is not particularly limited. When used as an oral composition, for example, it can be in the form of hard capsules, soft capsules, supplements, chewable tablets, beverages, powdered beverages, granules, films, etc. When used as food or drink, for example, tea-based beverages, sports beverages, beauty beverages, fruit juice beverages, carbonated beverages, alcoholic beverages, soft drinks, jelly beverages, concentrated beverages diluted with water, hot water, carbonated water, etc., powders, granules, tablets and other dry solids to be dissolved or suspended in water or hot water for drinking, tablet confections, jellies, snacks, baked confections, fried confections, cakes, chocolates, gums, candies, gummies and other confections, soups, noodles, rice, cereals and other food forms. Among these, when used in normal life, forms such as supplement type, chewable tablets, one-shot drink type, etc. are preferred, and when taken for the purpose of enhancing exercise effects, the form of beverages such as sports beverages is most preferred. Furthermore, these oral compositions can be provided to consumers as container-packed foods. The container is not particularly limited as long as it can be sealed.

[0022] The composition for promoting FGF-21 expression and / or secretion of the present disclosure can be ingested in one or multiple times (preferably 2 to 3 times). Also, the ingestion target is preferably a human, but non-human mammals other than humans (for example, rats, mice, rabbits, cows, pigs, dogs, cats, sheep, monkeys, etc.) may also be acceptable.

[0023] The composition for promoting FGF-21 expression and / or secretion of the present disclosure has an effect of promoting the expression of FGF-21. The promotion of FGF-21 expression may be the promotion of the expression of the FGF-21 gene or the promotion of the expression of the FGF-21 protein.

[0024] As shown in the examples described below, the rice bran enzyme-treated product has an effect of promoting the expression and / or secretion of FGF-21 in muscle cells. Since FGF-21 has been reported to promote muscle differentiation and be important for maintaining the function of skeletal muscle (Non-Patent Document 1), the composition for promoting FGF-21 expression and / or secretion of the present disclosure can be preferably used as a composition for maintaining muscle function, a composition for improving muscle function, a composition for maintaining muscle mass, or a composition for increasing muscle mass. The present disclosure also includes a composition for maintaining muscle function, a composition for improving muscle function, a composition for maintaining muscle mass, and a composition for increasing muscle mass, which contain the rice bran enzyme-treated product. These compositions may be collectively referred to as "the composition for maintaining muscle function etc. of the present disclosure".

[0025] Examples of the subjects for ingesting the composition for maintaining muscle function etc. of the present disclosure include, for example, humans with low muscle mass, humans who have developed or are suspected of developing locomotive syndrome, humans who are not able to ingest appropriate nutrients, humans with disrupted eating habits, humans with insufficient exercise, humans who are unable to exercise, humans who have developed metabolic diseases such as diabetes or obesity or belong to the pre-group thereof, humans who have accumulated or are likely to accumulate ectopic fat (fat accumulated in places other than adipose tissue. For example, fat accumulation in muscle), etc.

[0026] Since FGF-21 has been reported to induce weight loss by actions such as improving insulin sensitivity, improving glucose metabolism, improving lipid metabolism, increasing energy consumption, or suppressing appetite via the central nervous system (Non-Patent Documents 2 and 3), the composition for promoting FGF-21 expression and / or secretion of the present disclosure can be preferably used as an anti-obesity composition. The present disclosure also includes an anti-obesity composition containing the rice bran enzyme-treated product. This composition may be referred to as "the anti-obesity composition of the present disclosure". The anti-obesity composition of the present disclosure is expected to exhibit an anti-obesity effect based on promoting the expression and / or secretion of FGF-21 in muscle.

[0027] In obesity and type 2 diabetes, a state of FGF-21 resistance exists, and it is considered that the anti-obesity effect of FGF-21 is reduced. Although the blood FGF-21 concentration has increased compensatorily, it is thought that the above-mentioned anti-obesity effect of FGF-21 is not exerted. Therefore, subjects for ingesting the anti-obesity composition of the present disclosure include, for example, humans who are not sensitive to FGF-21, such as humans who have developed metabolic diseases such as lifestyle-related diseases like obesity and diabetes or who belong to the pre-group thereof, elderly humans, etc. In addition, humans with disrupted lifestyles, disrupted eating habits, humans with insufficient exercise, humans who cannot exercise, humans in whom ectopic fat has accumulated or is likely to accumulate, etc. can be mentioned.

[0028] Since FGF-21 has been reported to have a neuroprotective effect, a nerve elongation effect, suppression of inflammation and oxidative stress in the center, or an effect of suppressing the accumulation of Aβ in the brain by in vitro tests using cells or in vivo tests using rodents (Non-Patent Documents 4 and 5), the composition for promoting FGF-21 expression and / or of the present disclosure can be preferably used as a composition for improving brain function. Examples of improving brain function include, for example, maintaining brain function, maintaining cognitive function, maintaining attention function, maintaining memory, maintaining spatial recognition ability, maintaining attention, maintaining work efficiency, or improving judgment. The present disclosure also includes a composition for improving brain function containing a rice bran enzyme-treated product. This composition may be referred to as "the composition for improving brain function of the present disclosure". The composition for improving brain function of the present disclosure is expected to exhibit an effect of improving brain function based on promoting the expression and / or secretion of FGF-21 in muscle.

[0029] Subjects for ingesting the composition for improving brain function of the present disclosure include, for example, humans who have developed metabolic diseases such as lifestyle-related diseases like obesity and diabetes or who belong to the pre-group thereof, elderly humans, etc. In addition, humans with disrupted lifestyles, disrupted eating habits, humans with insufficient exercise, humans who cannot exercise, humans in whom ectopic fat has accumulated or is likely to accumulate, etc. can be mentioned.

[0030] Note that, as used herein, the term “comprising” includes “consisting essentially of” and “consisting of.” Further, the present disclosure encompasses any combination of the constituent elements described herein.

[0031] In addition, the various characteristics (properties, structures, functions, etc.) described for each embodiment of the present disclosure above may be combined in any manner when specifying the subject matter encompassed by the present disclosure. That is, the present disclosure encompasses all subject matters consisting of any combination of the combinable characteristics described herein.

Example

[0032] The content of the present disclosure will be specifically described using the following experimental examples. However, the present disclosure is not limited thereto in any way. In the following, unless otherwise specified, the experiments are carried out under atmospheric pressure and normal temperature conditions. Also, unless otherwise specified, “%” means “mass %”.

[0033] Method for enzymatic treatment of rice bran Purified water was added to defatted rice bran, and further 0.5% of Sumizyme PC10F (manufactured by Amano Enzyme Inc., containing 3% thermolysin) was added to the defatted rice bran to prepare a defatted rice bran suspension. The suspension was incubated at 55 °C for 15 hours while gently stirring, and then the enzyme was inactivated (80 - 83 °C, 5 minutes). After enzyme inactivation, centrifugation was performed at 20 °C (16,000 g, 5 minutes), and the supernatant was collected. The supernatant was filtered through a No. 2 filter (Advantec), and the filtrate was freeze-dried to prepare an enzymatically treated rice bran product. For the untreated rice bran enzyme product, it was prepared in the same manner without adding the above Sumizyme PC10F.

[0034] Method for preparing a sample of enzymatically treated rice bran for cell test The rice bran enzyme-treated or untreated product prepared above was dissolved using a differentiation medium and stirred at 37°C (1,000 rpm, 5 minutes). A ThermoMixer C (Eppendorf) was used for the stirring treatment. The rice bran enzyme-treated solution after the stirring treatment was sterilized using a 0.22-μm syringe filter (Millex, Sigma-Aldrich), and this was used as the rice bran enzyme-treated or untreated product for cell tests.

[0035] 1. Gene expression evaluation of Fgf-21 - Concentration-dependent experiment of rice bran enzyme-treated product (added after differentiation) Myoblast cell line (C2C12, ATCC) derived from mouse skeletal muscle was 4.0×10 4Seeded into a 12-well plate at a density of cells / 1mL / well and cultured for 3 days in a growth medium (DMEM medium (Dulbecco's Modified Eagle Medium, Sigma-Aldrich) containing 10% FBS (Fetal Bovine Serum, Biowest) and 1% Antibiotics (Gibco)). After reaching confluence, the medium was changed to a differentiation medium (DMEM medium containing 2% HS (Horse Serum, Sigma-Aldrich) and 1% Antibiotics) and cultured for an additional 4 days. Thereafter, rice bran enzyme-treated products (25, 50, 100 μg / mL) dissolved in the differentiation medium were added and treated for 24 h. The control was the differentiation medium only. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). cDNA was synthesized using the PrimeScript RT reagent Kit (Takara Bio). Quantitative gene expression was performed using QuantStudio (trademark) 5 Real-Time PCR (Thermo Fisher Scientific) with specific primers for each (Fgf-21; forward CGACTGCTGCTGGCTGTCTTC (SEQ ID NO: 1), reverse GGCTTCAGTGTCTTGGTCGTCATC (SEQ ID NO: 2), Rps18 (Ribosomal protein S18); forward GCTTAATTTGACTCAACACGGGA (SEQ ID NO: 3), reverse AGCTATCAATCTGTCAATCCTGTA (SEQ ID NO: 4)), and the intercalator method using TB Green Fast qPCR Mix (Takara Bio). The expression level of the Fgf-21 gene was corrected by the expression level of Rps18, and the relative value was determined when the expression in the differentiation medium only was set to 1.

[0036] As shown in Figure 1, it was confirmed that the rice bran enzyme-treated product showed a concentration-dependent effect of promoting the expression of the Fgf-21 gene.

[0037] 2. Evaluation of Fgf-21 gene expression - Experiment with or without enzymatic treatment of rice bran (added after differentiation) Mouse skeletal muscle-derived myoblast cell line (C2C12, ATCC) at 4.0×10 4Seeded into a 12-well plate at a density of cells / 1mL / well and cultured for 3 days in a growth medium (DMEM medium (Dulbecco's Modified Eagle Medium, Sigma-Aldrich) containing 10% FBS (Fetal Bovine Serum, Biowest) and 1% Antibiotics (Gibco)). After reaching confluence, the medium was changed to a differentiation medium (DMEM medium containing 2% HS (Horse Serum, Sigma-Aldrich) and 1% Antibiotics), and the cells were cultured for an additional 4 days. Then, rice bran enzyme-treated or untreated substances (100 μg / mL each) dissolved in the differentiation medium were added and treated for 24 h. The control was the differentiation medium only, and 10 μM of Baicalein (Tokyo Chemical Industry) was used as the positive control. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). Single-stranded cDNA was synthesized using the PrimeScript RT reagent Kit (Takara Bio). Quantitative gene expression was performed by the intercalator method using QuantStudio (trademark) 5 Real-Time PCR (Thermo Fisher Scientific), specific primers for each (SEQ ID NOs: 1-4), and TB Green Fast qPCR Mix (Takara Bio). The expression level of each gene was corrected by the expression level of Ribosomal protein S18 (RPS18), and the relative value was determined with the expression in the differentiation medium only set to 1.

[0038] As shown in Figure 2, it was confirmed that the untreated rice bran enzyme did not show an effect of promoting the expression of the Fgf-21 gene.

[0039] 3. Evaluation of Fgf-21 gene expression - Time-dependent experiment of rice bran enzyme-treated product (added simultaneously with differentiation) Myoblast cell line (C2C12, ATCC) derived from mouse skeletal muscle was 2.0×10 4Cells were seeded in a 12-well plate at a density of cells / 1mL / well and cultured for 4 days in a growth medium (DMEM medium (Dulbecco's Modified Eagle Medium, Sigma-Aldrich) containing 10% FBS (Fetal Bovine Serum, Biowest) and 1% Antibiotics (Gibco)). After reaching confluence, the medium was changed to a differentiation medium (DMEM medium containing 2% HS and 1% Ab), and a rice bran enzyme-treated product (100 μg / mL) dissolved in the differentiation medium was added and treated for 24 - 48 h. The control was the differentiation medium only. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). Single-stranded cDNA was synthesized using the PrimeScript RT reagent Kit (Takara Bio). Quantitative gene expression was performed using the QuantStudio (trademark) 5 Real-Time PCR (Thermo Fisher Scientific) by the intercalator method using specific primers (SEQ ID NOs: 1 - 4) for each and the TB Green Fast qPCR Mix (Takara Bio). The expression level of each gene was corrected by the expression level of Ribosomal protein S18 (RPS18), and the relative value was determined when the expression in the differentiation medium only was set to 1.

[0040] As shown in Fig. 3, it was confirmed that the rice bran enzyme-treated product exhibited an effect of promoting the expression of the Fgf-21 gene even when added simultaneously with the initiation of differentiation induction of the myoblast cell line.

[0041] 4. Evaluation of intracellular FGF-21 (Western Blotting) (added after differentiation) Myoblast cell line (C2C12, ATCC) derived from mouse skeletal muscle was 1.0×10 5Cells were seeded in 6-well plates at a density of cells / 2mL / well and cultured for 3 days in growth medium (DMEM medium (Dulbecco's Modified Eagle Medium, Sigma-Aldrich) containing 10% FBS (Fetal Bovine Serum, Biowest) and 1% Antibiotics (Gibco)). After reaching confluence, the medium was changed to differentiation medium (DMEM medium containing 2% HS (Horse Serum, Sigma-Aldrich) and 1% Antibiotics), and the cells were cultured for an additional 4 days. Thereafter, the rice bran enzyme-treated product (100 μg / mL) dissolved in the differentiation medium was added and treated for 24 h. The control was the differentiation medium only, and 10 μM Baicalein (Tokyo Chemical Industry) was used as the positive control. After the 24-hour addition treatment, the cells were washed twice with cold PBS(-), and the cells were collected with M-PER buffer (Thermo Scientific) supplemented with protease inhibitor (Thermo Scientific) and phosphatase inhibitor (Thermo Scientific) on ice. Centrifugation was performed at 4°C (15,000 g, 20 min), and the supernatant was collected. The total protein concentration of the obtained protein extract was measured by BCA assay (Thermo Scientific). After adjusting the protein concentrations to be constant, Laemmli Sample Buffer (BIO-RAD) was added, and the proteins were denatured by boiling. Thereafter, protein electrophoresis was performed by SDS-PAGE, and the separated proteins were transferred to a PVDF membrane. The membrane onto which the proteins were transferred was blocked with PBS containing 5% skim milk and 0.05% Tween-20, and then reacted with the primary antibody and secondary antibody according to the conventional method. Subsequently, the membrane was chemiluminesced using SuperSignal West Dura Chemiluminescent Substrate as the substrate, and the luminescence intensity was detected by the Amersham Imager 680 RGB (Cytiva) system. Quantification of the band intensity was performed using Image J.

[0042] As shown in Figure 4, it was confirmed that the rice bran enzyme-treated product increased the FGF-21 protein in muscle cells.

[0043] 5. Evaluation of extracellular FGF-21 (ELISA) (added after differentiation) Mouse skeletal muscle-derived myoblast cell line (C2C12, ATCC) was seeded in a 12-well plate at a density of 4.0×10 4 cells / 1mL / well and cultured in growth medium (DMEM medium (Dulbecco's Modified Eagle Medium, Sigma-Aldrich) containing 10% FBS (Fetal Bovine Serum, Biowest) and 1% Antibiotics (Gibco)) for 3 days. After reaching confluence, the medium was changed to differentiation medium (DMEM medium containing 2% HS (Horse Serum, Sigma-Aldrich) and 1% Antibiotics), and the cells were cultured for an additional 4 days. Then, the rice bran enzyme-treated product (100 μg / mL) dissolved in the differentiation medium was added and treated for 24 h. The control was the differentiation medium only. After 24 h of treatment, the culture supernatant was collected, centrifuged at 4°C (1,000 g, 5 min), and the supernatant was taken. For this supernatant, FGF-21 in the culture supernatant was quantified using the Mouse / Rat FGF-21 Quantikine ELISA Kit (R&D Systems). Multiskan SkyHigh TC (Thermo Scientific) was used for quantification.

[0044] As shown in Fig. 5, it was confirmed that the rice bran enzyme-treated product increased the FGF-21 protein secreted into the muscle cell culture supernatant.

Claims

**Claim 1** A composition for promoting FGF-21 expression and / or secretion, comprising a rice bran enzyme-treated product. **Claim 2** A composition for use in at least one selected from the group consisting of maintaining muscle function, improving muscle function, maintaining muscle mass, and increasing muscle mass, comprising a rice bran enzyme-treated product. **Claim 3** A composition for use in at least one selected from the group consisting of anti-obesity and improving brain function, comprising a rice bran enzyme-treated product. **Claim 4** The composition according to claim 3, wherein the improvement of brain function is at least one selected from the group consisting of maintaining brain function, maintaining cognitive function, maintaining attention function, maintaining memory, maintaining spatial recognition ability, maintaining attention, maintaining work efficiency, and improving judgment. **Claim 5** The composition according to any one of claims 1 to 4, wherein the rice bran enzyme-treated product is a thermolysin-treated product of rice bran.

Images