Ca2-il15 fusion protein for tunable regulation

The DRD from human carbonic anhydrase 2 modulates IL-15 stability in immune cells, addressing the challenges of continuous IL-15 administration by enabling reversible control, thus enhancing the safety and efficacy of immunotherapies.

JP2025100715APending Publication Date: 2025-07-03OBSIDIAN THERAPEUTICS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025065728
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-09-10
Filing Date
2025-04-11
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing immunotherapy strategies face challenges in safely and effectively controlling cytokine function and expression, particularly with continuous administration of IL-15, which can lead to dysregulated proliferation or toxicity in T cells and NK cells, limiting the efficacy and safety of therapies like CAR-T and NK cell-based treatments.

Method used

A drug-responsive domain (DRD) derived from human carbonic anhydrase 2 (CA2) is used to modulate the stability of IL-15, allowing for reversible control of IL-15 expression and function through small molecule ligands, enabling transient and intermittent exposure to IL-15 in immune cells, thereby enhancing their persistence and efficacy without dysregulation.

Benefits of technology

The DRD system provides adjustable control over IL-15 expression, improving the safety and effectiveness of immunotherapies by extending the persistence and functionality of engineered immune cells, such as T cells and NK cells, while minimizing toxicity and dysregulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025100715000016
    Figure 2025100715000016
  • Figure 2025100715000017
    Figure 2025100715000017
  • Figure 2025100715000018
    Figure 2025100715000018
Patent Text Reader

Abstract

To provide a CA2-IL15 fusion protein for tunable regulation.SOLUTION: The present disclosure provides drug responsive domains derived from human carbonic anhydrase 2 that can modulate protein stability for human interleukin 15 (IL15) payloads, as well as compositions and methods of use thereof. The present disclosure provides novel protein domains derived from human carbonic anhydrase 2 (CA2) displaying small molecule-dependent stability. Such protein domains are called drug responsive domains (DRDs).SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to related applications This application claims the benefit of priority of U.S. Provisional Application No. 62 / 898,520, filed on September 10, 2019. The entire content of the said application is incorporated herein by reference in its entirety.

[0002] Reference to Sequence Listing This application includes a Sequence Listing that was electronically submitted in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy created on September 10, 2020, is named 68052_473951_SL.txt and is 178,693 bytes in size.

[0003] The present disclosure relates to a drug - responsive domain (DRD) derived from human carbonic anhydrase 2 (CA2) that can modulate protein stability against at least one payload including human interleukin 15 (IL15), compositions, and methods of use thereof. In the present disclosure, provided are a CA2 bio - circuit system, a CA2 effector module, a polypeptide of a stimulus - responsive element (SRE) for use in enhancing responses from immune cells, polynucleotides encoding them, vectors and cells comprising the polypeptide and / or polynucleotide.

Background Art

[0004] By using the DRD technology described herein together with methods of controlling cytokine function and / or expression, existing immunotherapy strategies are significantly improved, including gene transfer and adoptive Field of protein therapy that can be safely and effectively incorporated into T cell transfer (ACT) therapy can be expanded, including uses that have hitherto been considered unsuitable for therapeutic use also included. Improvements in natural killer cells (NK cells), tumor infiltrating lymphocytes (TIL), and T cell-based immunotherapies are necessary to enhance and improve the functionality of the therapy , which, for example, improves the persistence and / or viability of engineered immune cells for use upon administration to a subject in various immunotherapies. CA2 DRD that binds to human IL15, modified cells, compositions, and methods that include such DRD are provided that meet such needs . SUMMARY OF THE INVENTION

[0005] The present disclosure provides a novel protein domain derived from human carbonic anhydrase 2 (CA2) that exhibits small molecule-dependent stability . Such a protein domain is referred to as a drug-responsive domain (DRD ). In the absence of its binding (i.e., stabilizing) ligand, the DRD is destabilized and degradation of a payload (e.g., a protein of interest (POI) of the subject) operably bound to the DRD occurs . On the other hand, in the presence of its binding ligand, the DRD and its operably bound payload are stabilized. The stability of the DRD and its operably bound payload is determined by the dose of the binding ligand .

[0006] In some embodiments, the present disclosure provides a stimulus-responsive element (SRE) that can include, in whole or in part, a drug-responsive domain (DRD D) derived from human carbonic anhydrase 2 (CA2, having the amino acid sequence of SEQ ID NO: 1). In one embodiment, the DRD is It may be derived from the full-length CA2 polypeptide (SEQ ID NO: 1). In some embodiments the DRD may be derived from a part or region of human carbonic anhydrase. A part or region of CA2 may be selected from amino acids 2 to 260 of CA2 (SEQ ID NO: 2).

[0007] In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more mutations relative to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more amino acid substitutions relative to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more mutations in a part of CA2. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more mutations in CA2 or a part thereof, and may further contain additional amino acids. In some embodiments, the S .

[0008] In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more mutations in a part of CA2. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more mutations in CA2 or a part thereof, and may further contain additional amino acids. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more mutations in CA2 or a part thereof, and may further contain additional amino acids. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more amino acid substitutions in a part of CA2. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more amino acid substitutions in CA2 or a part thereof, and may further contain additional amino acids. In some embodiments, the SRE may contain a DRD that contains one, two, three, four or more amino acid substitutions in CA2 or a part thereof, and may further contain additional amino acids. In this specification, there is also provided an isolated polypeptide variant that contains at least one mutation relative to SEQ ID NO: 1. Non-limiting examples of CA2 mutations relative to SEQ ID NO: 1 are

[0009] and also provided. Examples include M1del and L156H. In another aspect, the DRD is a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO: 4, and the CA2 mutation comprises Mdel1 (M1del) and L15 6H relative to SEQ ID NO: 1. In another aspect, the DRD is a polypeptide comprising the amino acid deletion M1 del and the amino acid substitution L156H relative to SEQ ID NO: 1, and may further contain additional amino acids. In another aspect, the DRD is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 4. del and the amino acid substitution L156H relative to SEQ ID NO: 1, and may further contain additional amino acids. In another aspect, the DRD is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 4. del and the amino acid substitution L156H relative to SEQ ID NO: 1, and may further contain additional amino acids. In another aspect, the DRD is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 4. lypeptide. lypeptide.

[0010] Also provided herein is a bio-circuit system comprising at least one effector module. The effector module of the bio-circuit may include a stimulus-responsive element (SRE), and the SRE may include a DRD derived from human carbonic anhydrase 2 (CA2; SEQ ID NO: 1) or a variant thereof, which includes one, two, three, four or more mutations of CA2 relative to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the effector module of the bio-circuit includes an SRE that includes a DRD having one, two, three, four or more amino acid substitutions in CA2 relative to SEQ ID NO: 1 or SEQ ID NO: 2. The bio-circuit may include at least one payload that can be attached to, added to, or associated with the SRE. The payload may include (i) human IL15, including but not limited to, the amino acid sequence of SEQ ID NO: 8. lypeptide. lypeptide. lypeptide. lypeptide. The effector module of the bio-circuit may include an SRE that includes a DRD having one, two, three, four or more amino acid substitutions in CA2 relative to SEQ ID NO: 1 or SEQ ID NO: 2. The bio-circuit may include at least one payload that can be attached to, added to, or associated with the SRE. The payload may include (i) human IL15, including but not limited to, the amino acid sequence of SEQ ID NO: 8. The effector module of the bio-circuit may include an SRE that includes a DRD having one, two, three, four or more amino acid substitutions in CA2 relative to SEQ ID NO: 1 or SEQ ID NO: 2. The bio-circuit may include at least one payload that can be attached to, added to, or associated with the SRE. The payload may include (i) human IL15, including but not limited to, the amino acid sequence of SEQ ID NO: 8. The effector module of the bio-circuit may include an SRE that includes a DRD having one, two, three, four or more amino acid substitutions in CA2 relative to SEQ ID NO: 1 or SEQ ID NO: 2. The bio-circuit may include at least one payload that can be attached to, added to, or associated with the SRE. The payload may include (i) human IL15, including but not limited to, the amino acid sequence of SEQ ID NO: 8. The effector module of the bio-circuit may include an SRE that includes a DRD having one, two, three, four or more amino acid substitutions in CA2 relative to SEQ ID NO: 1 or SEQ ID NO: 2. The bio-circuit may include at least one payload that can be attached to, added to, or associated with the SRE. The payload may include (i) human IL15, including but not limited to, the amino acid sequence of SEQ ID NO: 8. lypeptide.

[0011] The SRE of the bio-circuit system includes, but is not limited to, Mdel1 and L156H, etc. not, one, two, three, or more of CA2 (SEQ ID NO: 1 or SEQ ID NO: 2) may include mutations. The SRE of the bio-circuit system may be, but is not limited to, L156H one, two, three, or more amino acid substitutions in CA2 (SEQ ID NO: 1 or SEQ ID NO: 2).

[0012] In some embodiments, the SRE in the CA2 bio-circuit system may be CA2 having mutations M1del and L156H, and the numbering is related to the amino acid sequence of SEQ ID NO: 1 (SEQ ID NO: 4). In some embodiments, the SRE is a polypeptide comprising, or consisting of, the amino acid sequence of SEQ ID NO: 4. In some embodiments, the SRE is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 4.

[0013] The bio-circuit systems described herein may include an SRE that responds to one or more stimulants.

[0014] In some embodiments, the stimulant may be a small molecule, and the small molecule may be acetazolamide (ACZ).

[0015] In another aspect, the present disclosure provides an effector module comprising at least one payload. In some embodiments, the effector module includes an SRE comprising a CA2 DRD operably linked to an IL15 payload. In some embodiments, the IL15 payload includes the amino acid sequence of SEQ ID NO: 8. In some embodiments, the IL15 payload includes the nucleotide sequence of SEQ ID NO: 9. ​​​​​​May be partially encoded by the nucleic acid sequence. In some embodiments, the IL15 pe Peyrold is the membrane-bound form of IL15. In some embodiments, the IL15 pe Peyrold is a membrane-bound form of IL15 that includes a functional IL15 component or domain, a transmembrane domain, and an intracellular tail In some embodiments, the IL15 pay Peyrold is a membrane-bound form of IL15 that includes a functional IL15 component or domain, a transmembrane domain, an intracellular tail, and a leader sequence. In some embodiments, The present disclosure provides an SRE comprising a CA2 DRD operably linked to a membrane-bound IL15 polypeptide In some embodiments, the present disclosure provides an SRE comprising a CA2 DRD operably linked to a membrane-bound IL15 polypeptide, wherein the membrane-bound IL15 po lypeptide comprises, from N-terminus to C-terminus, a leader sequence, an IL15 polypeptide comprising the amino acid sequence of SEQ ID NO: 8, a peptide linker, a transmembrane domain, and an intracellular tail Included. In another aspect, the present disclosure provides a method of creating a modified or genetically engineered cell comprising introducing a polynucleotide encoding an effector module into the cell ..

[0016] In some embodiments, the modified or engineered cell is an immune cell. In some embodiments the immune cell is a T cell, a natural killer (NK) cell, or a tumor infiltrating lymphocyte (TIL). In some embodiments, the polynucleotide encodes a CA2 DRD operably linked to an IL15 payload. In some embodiments the polynucleotide encodes a CA2 DRD operably linked to a membrane-bound IL15 payload In some embodiments, the polynucleotide encodes a CA2 DRD operably linked to a membrane-bound IL15 payload In some embodiments, the polynucleotide encodes a CA2 DRD operably linked to an IL15 payload. In some embodiments the polynucleotide is operably linked to a membrane-bound IL15 payload encodes the CA2 DRD that is present. In some embodiments, the polynucleotide is introduced into cells by a non-viral vector delivery method. In some embodiments the polynucleotide is introduced into cells by viral transduction. In some embodiments the polynucleotide is introduced into cells by lentiviral transduction. In some embodiments the polynucleotide is introduced into cells by lentiviral transduction into T cells, NK cells, or TILs. In some embodiments, the present disclosure provides a method of creating modified or genetically engineered T cells, NK cells, or TILs, comprising introducing into T cells, NK cells, or TILs a polynucleotide encoding a CA2 DRD operably linked to a membrane-bound IL15 payload by a viral vector such as a lentiviral vector.

[0017] In another aspect, the present disclosure provides a method of treatment comprising: (a) administering to a subject having a disease or disorder a modified cell comprising a recombinant construct comprising an SRE that binds to a payload of the present disclosure, or a composition comprising a plurality of such modified cells; and (b) administering to the subject a stimulant to which the SRE responds in a therapeutically effective amount. In some embodiments of this aspect, the disease or disorder is cancer, neoplasm, or tumor. In some embodiments, the SRE is CA2 DRD. In some embodiments, the payload is IL15 or membrane-bound IL 15. In some embodiments, the modified cell is operably linked to an IL15 payload comprises a CA2 SRE that may be linked. In some embodiments, the modified cell comprises a CA2 SRE operably linked to a membrane-bound IL15 payload. In some embodiments, the stimulant is acetazolamide, celecoxib, baldecozib, rofecoxib, metazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the modified cell comprises a CA2 operably linked to a membrane-bound IL15 payload, and the stimulant is acetazolamide. In some related aspects, the modified cell is an engineered or modified immune cell, e.g., the CA2-IL15 biocircuit and system may be used with immune cells including T cells such as CD8+ T cells and CD4+ T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), lymphokine-activated killer (LAK) cells, memory T cells, regulatory T cells (Tregs), helper T cells, cytokine-induced killer (CIK) cells, and any combination thereof. In other embodiments, the immune-stimulatory cells for ACT may be generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). In some embodiments, autologous or allogeneic immune cells are used for ACT. In some embodiments, the immune cells are T cells, TILs, or NK cells. In some embodiments, the immune cells are NK cells derived from iPSCs, cord blood, or peripheral blood mononuclear cells, and the modified immune cells are administered to a subject at the same or substantially the same dose as a reference cell composition lacking the SRE bound to the payload in a subject show more or longer proliferation and / or persistence than in

[0018] In another aspect, the disclosure provides a method of treating a subject having a malignancy, comprising: (a) administering to the subject a composition comprising a modified T cell, a modified NK cell, or a modified TIL, or a plurality of such modified cells, comprising a recombinant construct comprising an SRE bound to a payload of the disclosure; and (b) administering to the subject a therapeutically effective amount of an agonist to which the SRE responds. In some embodiments, the tumor expresses a tumor- associated antigen. In some embodiments, the modified T cell or modified NK cell further comprises a chimeric antigen receptor (CAR) or a T cell receptor (TCR) comprising an antigen-binding domain specific for a tumor-associated antigen. In some embodiments, the modified T cell or modified NK cell comprises a CAR comprising an antigen-binding domain specific for a tumor-associated antigen. In some embodiments, the modified T cell, modified NK cell, or modified TIL comprises an SRE that is CA2 D. In some embodiments, the modified T cell, modified NK Tazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, danciamide, or dichlorphenamide. In some embodiments, the modified cell comprises a CA2 SRE operably linked to a membrane-bound IL15 payload, and the stimulant is acetazolamide.

[0019] In another aspect, the disclosure provides a polynucleotide encoding a bio-circuit system, a vector, and a pharmaceutical composition comprising the bio-circuit system and a pharmaceutically acceptable additive.

[0020] In another aspect, the disclosure provides a recombinant protein encoded by a polynucleotide of the disclosure. In some embodiments, the recombinant protein comprises an effector module comprising a CA2 DRD operably linked to an IL15 payload. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The foregoing and other objects, features, and advantages will become apparent from the following description of certain embodiments of the disclosure as illustrated in the accompanying drawings. The drawings are not necessarily to scale, and emphasis is instead placed upon illustrating the principles of various embodiments of the disclosure. A representative procedure for in vitro characterization and / or validation of ACZ-controlled membrane-bound IL15 (mbIL15) expression in T cells is shown.

Figure 1

Figure 2

Figure 3A

Figure 3B

Figure 3C

Figure 4A

Figure 4B

Figure 5A

Figure 5B

Figure 5C

Figure 6

Figure 7

Figure 8A

Figure 8B

Figure 9

[0022] The details of one or more embodiments of the disclosure are set forth in the accompanying description below. Any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure. Other features, objectives and methods of the present disclosure include, but are not limited to, the following: The advantages and advantages of the present invention will become apparent from the present description. Unless otherwise defined, all terms used herein include the plural form. The technical and scientific terms are understood to be understood by those of ordinary skill in the art to which this disclosure belongs. In the event of a conflict, this description shall take precedence.

[0023] Cancer immunotherapy aims to induce or restore immune system responsiveness against cancer. Significant advances in immunotherapy research have led to the broad classification of immunotherapy into active and passive immunotherapy. A variety of strategies have been developed that can be classified. In general, these strategies involve either directly killing cancer cells or It can be used to kill or counter an immunosuppressive tumor microenvironment. Active immunotherapy aims to induce an endogenous and persistent tumor antigen-specific immune response. The response can be further enhanced by non-specific stimulation of immune response modifiers such as cytokines. In contrast, passive immunotherapy involves approaches in which immune effector molecules such as tumor antigen-specific cytotoxic T cells or antibodies are administered to the host. This approach is short-lived and requires multiple treatments. For efficient T cell activation, three signals are required, namely T cell receptor (TCR) signal transmission (Signal 1), activation by co-stimulatory molecules (Signal 2), and immune-stimulatory cytokines

[0024] (Signal 3). To date, the majority of CAR-based immunotherapies that have been designed and discussed have Signal 1 and Signal 2. However, the Signal 3 typically provided by homeostatic cytokines is not present in conventional CAR T cells and is not abundant in the tumor microenvironment either. Therefore, it is necessary to engineer T cells (e.g., including CAR T cells) that can provide additional cytokine signaling to meet the need for Signal 3 for optimal T cell activation. The major cytokines involved in T cell activation that include Signal 3 cytokines belong to the γ c class, such as IL-2, IL-7, IL-15, IL-21, and IL-9. These cytokines ultimately regulate T cell survival and proliferation, which play important roles in T cell persistence and efficacy. These cytokines are currently used in the ex vivo expansion of CAR T cells prior to combination or monotherapy.

[0025] ​

[0026] However, there may be a risk in supporting the extended lifespan of T cells by continuous exposure to IL15. This is because chronic high exposure to IL-15 may cause abnormal T cell proliferation or toxicity. In humans, dysregulated production of IL15, high serum levels, or abnormal IL15 signaling is associated with autoimmune diseases and may be involved in the development of large granular lymphocyte leukemia and cutaneous T cell lymphoma.

[0027] Natural killer (NK) cells are members of the natural lymphoid cell family and are characterized in humans by the expression of the phenotypic marker CD56 (neural cell adhesion molecule) in the absence of CD3 (T cell coreceptor). NK cells are powerful effector cells of the innate immune system that mediate cytotoxic attacks without the need for prior antigen priming and form the first line of defense against diseases including cancer malignancies and viral infections.

[0028] Several preclinical and clinical trials have demonstrated that adoptive transfer of NK cells is a promising treatment for cancers such as acute myeloid leukemia (Ruggeri et al., Science; 2002, 295:2097-2100; and Geller et al., Immunotherapy, 2011, 3:1445-1459). Adoptive transfer of NK cells expressing CARs such as DAP12-based activating CAR has been shown to promote tumor cell eradication (Topfer et al., J Immunol. 2015; 194:3201- Promotion of cell lysis and interferon-γ (IFN-γ) production in myeloma has also been shown (Chu et al., Leukemia, 2014, 28(4):917-927).

[0029] NK cell activation is characterized by a series of receptors with activating and inhibitory functions . Important activating receptors in NK cells include CD94 / NKG2C and NKG2 D (C-type lectin-like receptor), as well as natural cytotoxic receptors (NCR) NKp30, N Kp44, and NKp46, which recognize ligands on tumor cells or virus-infected cells. NK cell inhibition is basically mediated by the α1 helix of HLA molecules and the interaction between polymorphic inhibitory killer cell immunoglobulin-like receptors (KIR) and their allogeneic human leukocyte antigen (HLA) ligands. The balance between signals generated from activating and inhibitory receptors mainly determines immediate cytotoxic activation.

[0030] NK cells may be isolated from peripheral blood mononuclear cells (PBMC) and cord blood, or may be derived from human embryonic stem (ES) cells and induced pluripotent stem cells (iPSC). NK cells can be further developed for adoptive immunotherapy. Strategies and protocols useful for the proliferation of NK cells may include interleukin 2 (IL2) stimulation and the use of autologous feeder cells, or the use of genetically engineered allogeneic feeder cells. In some embodiments, NK cells can be selectively developed by combining with stimulatory ligands including IL1 5, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA- 1, and BCM1 / SLAMF2 (for example, U.S. Patent Publication No. US20150190471).

[0031] NK cell-based immunotherapy is rapidly developing due to the ability of NK cells to directly lyse tumor targets, the emergence of antibodies and molecules that mediate NK cell-driven type of antibody-dependent cell-mediated cytotoxicity (ADCC), and the ability of NK cells to induce inflammatory responses. NK cells are used in clinical trials alone or in combination with hematopoietic stem cell transplantation using autologous and allogeneic NK cell infusion strategies. In addition, there are signs of other modalities of NK cell therapy, such as the use of NK cell line products and chimeric antigen receptor (CAR)-transduced NK cells. Others have shown that the in vivo persistence and proliferation of NK cells correlate with antitumor activity in patients with advanced AML. Among the strategies being preclinically evaluated to address this issue, the use of cytokines that induce NK cell persistence and proliferation appears to be the mainstream in current clinical trials. IL15 has a known physiological role in the development and homeostasis of NK cells without stimulating regulatory T cells, but experimental findings have shown that continuous treatment with IL-15 results in changes in functional NK cells consistent with exhaustion. For example, in NK cells continuously treated with IL15, during 9 days of experimental continuous treatment with IL15, they initially showed better proliferation and expansion but were more susceptible to the effects of cell death, as experimentally shown in at least one study. In addition, cell cycle gene expression data showed that in NK cells continuously administered IL15, the expression of cell cycle checkpoint genes and arrest genes was abundant, and on day 9 of culture, these cells were shown to transition to a state of arrest due to cell stress. ​

[0032] Tumor-infiltrating lymphocytes (TILs) consist of all lymphocyte cell populations that have invaded tumor tissue. . The cellular components of tumors include TILs, NK cells, macrophages, dendritic cells, and myeloid lineage cells, suggesting a productive immune response. However, most of the immune cells present in the tumor microenvironment are in a form where many of the immune cell populations are converted to an expression type that further impairs the immune system response, so their normal function is impaired in some way. Tumors recruit regulatory T lymphocytes (Tregs), tumor-associated macrophages (TAMs), myeloid-derived suppressor cells (MDSCs), and cancer-associated fibroblasts (CAFs) and can help them escape immune recognition. Tregs and MDSCs both exhibit immunosuppressive functions and limit the response by TILs and other cells. Depletion of CD4+ Tregs improves the clinical response of patients undergoing immune reconstitution during TIL therapy who are treated with autologous TILs. In mouse models, even a small number of Tregs can suppress adoptive cell therapy mediated by effective CD8+ T cells.

[0033] TILs are found in many solid tumors, including breast cancer and melanoma, and emerge as important biomarkers in predicting the efficacy and outcome of treatment. In breast cancer, TILs are mainly composed of cytotoxic (CD8+) and helper (CD4+) T cells , with a low proportion of B cells and NK cells. Breast cancer patients with progressive tumors with a high CD8+ T cell infiltration or a high density of TILs have more beneficial outcomes. In melanoma, TIL therapy is improved by including a lymphodepleting pretreatment therapy prior to cell injection. Investigations in human and mouse models of melanoma have shown that lymph Lymphodepletion suppresses T cell proliferation in melanoma patients and is suggested to deplete negative regulatory cells, including regulatory T cells (Tregs) and peripherally myeloid-derived suppressor cells, which are useful for the proliferation of adoptively transferred T lymphocytes.

[0034] Adoptive cell therapy (ACT) using tumor-infiltrating lymphocytes (TILs) is an individualized cancer treatment based on the injection of autologous CD4+ and CD8+ T lymphocytes that have proliferated from tumors in the presence of interleukin-2 (IL-2) alone or in combination with IL-7, IL-15, and / or IL-21. TILs are polyclonal populations rich in lymphocytes that recognize tumor-specific antigens and include not only individual tumor neoantigens but also shared tumor-associated antigens. In a study at the National Cancer Institute (NCI) started in 1980, tumor regression was demonstrated in selected patients who received adoptive transfer of lymphokine-activated killer cells in combination with recombinant IL-2. Subsequent methods for large-scale expansion of human TILs, simplification and shortening of the TIL production process, as well as improvement of patient preconditioning and treatment protocols have resulted in increased patient response rates. However, the overall response rate of TIL therapy is still very slow and improvement is needed.

[0035] The present disclosure provides a system, composition, immunotherapeutic agent, and method for avoiding problems associated with continuously administered or expressed IL15 by providing a regulatable control of IL15 gene expression and function for cancer immunotherapy. The present invention relates to a biocircuit system, effector module, stimulus-responsive element (SRE), and IL15 payload, ​​​​​​​​​​​​​​Also provided are polynucleotides encoding any of the foregoing. In one aspect, the systems, compositions, immunotherapeutics, and other components of the present invention can be controlled by separately added stimulators that provide sufficient adaptability to control cancer immunotherapy. The adjustable nature of the systems and compositions of the present invention has the potential to improve the efficacy and duration of effectiveness of immunotherapy. The ability to reversibly increase, decrease, or silence the biological activity of adoptively transferred cells using the compositions of the present invention maximizes the potential of cell therapies that cannot use the "kill switch" that would otherwise terminate the therapy. Without being bound by any particular theory, the long-term engraftment of T cells

[0036] can be achieved through transient intermittent exposure to IL15 in NK cells, TIL, and T cell populations used in various therapies, including cancer immunotherapy, without dysregulated proliferation or activation and without phenotypic, functional, or chromosomal abnormalities. The present invention provides a method for fine-tuning immunotherapy after administration to a patient. This subsequently improves the safety and effectiveness of immunotherapy and increases the population of subjects who benefit from immunotherapy. The effector modules described and disclosed in this disclosure bind independently of and in conjunction with one or more stimulus response elements (SREs) that are operably bound to IL15 and, together with them, form effector modules that include mbIL15. The bio-circuits, SREs, and DRDs disclosed in this disclosure can be used with immune cells, and adoptively transferred NK cells and T cells, including TIL, have extended persistence, thereby providing permanent immune surveillance and treatment. Without being bound by any particular theory, the long-term engraftment of T cells can be achieved through transient intermittent exposure to IL15 in NK cells, TIL, and T cell populations used in various therapies, including cancer immunotherapy, without dysregulated proliferation or activation and without phenotypic, functional, or chromosomal abnormalities. can be achieved through transient intermittent exposure to IL15 in NK cells, TIL, and T cell populations used in various therapies, including cancer immunotherapy, without dysregulated proliferation or activation and without phenotypic, functional, or chromosomal abnormalities. is believed to be achievable.

[0037] The present invention provides a method for fine-tuning immunotherapy after administration to a patient. This subsequently improves the safety and effectiveness of immunotherapy and increases the population of subjects who benefit from immunotherapy. The effector modules described and disclosed in this disclosure are bound independently of and in conjunction with one or more stimulus response elements (SREs) that are operably bound to IL15 and, together with them, form effector modules that include mbIL15. The effector modules described and disclosed in this disclosure are bound independently of and in conjunction with one or more stimulus response elements (SREs) that are operably bound to IL15 and, together with them, form effector modules that include mbIL15. The effector modules described and disclosed in this disclosure are bound independently of and in conjunction with one or more stimulus response elements (SREs) that are operably bound to IL15 and, together with them, form effector modules that include mbIL15. The bio-circuits, SREs, and DRDs disclosed in this disclosure can be used with immune cells, and adoptively transferred NK cells and T cells, including TIL, have extended persistence, thereby providing permanent immune surveillance and treatment. bio-circuits, SREs, and DRDs disclosed in this disclosure can be used with immune cells, and adoptively transferred NK cells and T cells, including TIL, have extended persistence, thereby providing permanent immune surveillance and treatment. The adjustable nature of the systems and compositions of the present invention has the potential to improve the efficacy and duration of effectiveness of immunotherapy. The ability to reversibly increase, decrease, or silence the biological activity of adoptively transferred cells using the compositions of the present invention Desired signal transduction may be provided that enables the provision of possibilities.

[0038] As used herein, "biocircuit" or "biocircuit system" refers to within a biological system that includes an agonist and at least one effector module that responds to the agonist, or is defined as a circuit useful in a biological system, and the response to the agonist results in at least one signal or outcome within, between, as an indicator of, or in a biological system. The biological system is ordinarily understood to be any cell, tissue, organ, organ system, or living organism, regardless of whether it is an animal, plant, fungus, bacterium, or virus. A biocircuit may also be understood to be an artificial circuit that produces a signal or outcome in a cell-free environment, such as by using an agonist or effector module taught by the present disclosure in a diagnostic, reporter system, device, assay, or kit.

[0039] The biocircuits of the present disclosure include at least one effector module. As used herein, "effector module" refers to a single- or multi-component construct or complex that includes at least (a) one or more stimulus response elements (SREs) and (b) one or more payloads (e.g., a protein of interest (POI)). In some embodiments, the effector module includes one SRE and one payload.

[0040] The effector module includes one or more payloads, one or more SREs, one or more cleavage sites, one or more signal sequences, and one or more It may be designed to include one or more additional features including the presence or absence of a linker.

[0041] In one embodiment, the effector module includes at least one immunotherapy agent, e.g., for example, including IL15.

[0042] The effector module includes their SRE and payloads and may be nucleic acid-based, protein-based, or a combination thereof. They may be in the form of DNA, RNA, mRNA, protein, fusion protein, or any combination of the foregoing. In one embodiment, the effector module is a fusion protein. In one embodiment, the effector module is encoded by a nucleic acid such as DNA. embodiment, the effector module is encoded by a nucleic acid such as DNA. .

[0043] The effector module includes their SRE and payloads and may individually, collectively, or independently include peptides, polypeptides, or proteins. At the protein level, such payloads may be any natural or artificial peptide or polypeptide or fragment thereof. The natural peptide or polypeptide components of the payload may be from any known protein of any species.

[0044] The effector module may be designed to operate in one, two, three, four, or more module loops. When two or more effector modules are utilized in a biocircuit, it is known as the effector module system of that biocircuit.

[0045] ​​​​​​​​As used herein, a "stimulus-responsive element" (SRE) is a component of an effector module that links, attaches, binds, or associates with one or more payloads and, in some cases, causes responsiveness of the effector module to one or more stimulants. As used herein, the "responsive" nature of an SRE to a stimulant may be characterized by covalent or non-covalent interactions, direct or indirect binding, or a structural or chemical reaction to the stimulant. Further, the reaction of any SRE to a stimulant may be a matter of degree or type. The reaction may be a partial reaction. The reaction may be a reversible reaction. The reaction may ultimately result in a control signal or output. Such an output signal may be from the relative nature to the stimulant, e.g., a 1% - 10 0% modifying effect or a factored increase or decrease such as 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more. In some embodiments, the SRE is a polypeptide that is operably linked to a polypeptide payload. In some embodiments, the SRE is a polypeptide that is fused to a polypeptide payload. In some embodiments, the present disclosure provides methods of modulating protein expression, function, or levels. In some aspects, modulating protein expression, function, or levels means at least about 30%, 40%, 50%, 60%, 70%, 80%, 85% 90%, 95%, and 100%, or at least 20 - 30%, 20 - 40%, 2 0 - 50%, 20 - 60%, 20 - 70%, 20 - 80%, 20 - 90%, 20 - 95%

[0046] ​​​​​​​​​​, 20 to 100%, 30 to 40%, 30 to 50%, 30 to 60%, 30 to 70%, 30 to 80%, 30 to 90%, 30 to 95%, 30 to 100%, 40 to 50%, 40 to 60%, 40 to 70%, 40 to 80%, 40 to 90%, 40 to 95%, 40 to 100%, 50 to 6 0%, 50 to 70%, 50 to 80%, 50 to 90%, 50 to 95%, 50 to 100%, 6 0 to 70%, 60 to 80%, 60 to 90%, 60 to 95%, 60 to 100%, 70 to 80 %, 70 to 90%, 70 to 95%, 70 to 100%, 80 to 90%, 80 to 95%, 80 to 100%, 90 to 95%, 90 to 100%, or 95 to 100%, etc., referring to at least about a 20% regulation of expression, function, or level.

[0047] A drug-responsive domain (DRD) is a small protein domain that can be added to a target protein of interest. In some embodiments, the DRD is operably linked to the target protein of interest. The DRD destabilizes the attached target protein in the absence of a DRD-binding ligand. However, when a specific small molecule ligand binds to the intended DRD as a ligand-binding partner, the destabilization is overridden and protein function is restored. The conditional nature of DRD stability allows for a rapid and non-disruptive switch from a stable protein to an unstable degradation substrate. Furthermore, its dependence on the concentration of that ligand further provides tunable control of the degradation rate. The term drug-responsive domain (DRD) is interchangeable with the term destabilizing domain (DD). In one embodiment, the SRE is a drug-responsive domain (DRD). In some

[0048] embodiments, In embodiments, the CA2 agent-responsive domains described herein are, in this specification, in connection with any of the IL15 payloads taught herein, may be used as an SRE in the bio-circuit systems of the present disclosure.

[0049] Regions or portions or domains of the wild-type protein (e.g., CA2) may be used as an SRE / DRD, in whole or in part. In one embodiment, the SRE is derived from the parental protein CA2 or a mutant CA2 protein. In various embodiments the DRD contains one, two, three, or four or more mutations compared to the parental CA2 protein, e.g., of human CA2, the amino acid sequence: MSHHWGYGKH NGPEHWHK DF PIAKGERQSP VDIDTHTAKY DPSLKPLSVS YDQA TSLRIL NNGHAFNVEF DDSQDKAVLK GGPLDGTYRL IQFHFHWGSL DGQGSEHTVD KKKYAAELHL VHWNTKY GDF GKAVQQPDGL AVLGIFLKVG SAKPGLQKVV DVL DSIKTKG KSADFTNFDP RGLLPESLDY WTYPGSLTTP PLLECVTWIV LKEPISVSSE QVLKFRKLNF NGEGEP SEQ ID NO: 1 having EELM VDNWRPAQPL KNRQIKASFK, or the amino acid sequence: SHHWGYGKH NGPEHWHKDF PIAKGERQSP V DIDTHTAKY DPSLKPLSVS YDQATSLRIL NNGHAFNV EF DDSQDKAVLK GGPLDGTYRL IQFHFHWGSL DGQG SEHTVD KKKYAAELHL VHWNTKYGDF GKAVQQPDGL AVLGIFLKVG SAKPGLQKVV DVLDSIKTKG KSADFTN FDP RGLLPESLDY WTYPGSLTTP PLLECVTWIV LKE PISVSSE QVLKFRKLNF NGEGEPEELM VDNWRPAQPL It is SEQ ID NO:2 having KNRQIKASFK.

[0050] Human CA2 having the amino acid sequence of SEQ ID NO:1 has the nucleic acid sequence of SEQ ID NO:3: atgtcccatcactgggggtacggcaaacacaacggacctg agcactggcataaggacttccccattgccaagggagagcg ccagtcccctgttgacatcgacactcatacagccaagtat gacccttccctgaagcccctgtctgtttcctatgatcaag caacttccctgaggatcctcaacaatggtcatgctttcaa cgtggagtttgatgactctcaggacaaagcagtgctcaag ggaggacccctggatggcacttacagattgattcagtttc actttcactggggttcacttgatggacaaggttcagagca tactgtggataaaaagaaatatgctgcagaacttcacttg gttcactggaacaccaaatatggggattttgggaaagctg tgcagcaacctgatggactggccgttctaggtattttttt gaaggttggcagcgctaaaccgggccttcagaaagttgtt gatgtgctggattccattaaaacaaagggcaagagtgctg acttcactaacttcgatcctcgtggcctccttcctgaatc cctggattactggacctacccaggctcactgaccacccct cctcttctggaatgtgtgacctggattgtgctcaaggaac ccatcagcgtcagcagcgagcaggtgttgaaattccgtaa acttaacttcaatggggagggtgaacccgaagaactgatg gtggacaactggcgcccagctcagccactgaagaacaggc Encoded by a polynucleotide having aaatcaaagcttccttcaaa Thereof.

[0051] As used herein, the phrase "derived from" means that when it relates to an effector module, SRE, or payload, the effector module, SRE, or payload is at least in part of origin from the described parental molecule or sequence. For example, when designing an SRE, such an SRE may be derived from an epitope or region of a naturally occurring protein, but is then modified by any of the methods taught herein to optimize SRE function. Meaning that the payload has an origin from the described parental molecule or sequence. For example, when designing an SRE, such an SRE may be derived from an epitope or region of a naturally occurring protein, but is then modified by any of the methods taught herein to optimize SRE function. Or region, but is then modified by any of the methods taught herein to optimize SRE function. In some embodiments, the DRD of the present disclosure may be derived from CA2 (SEQ ID NO: 1; Uniprot ID: P00918

[0052] Which may be stabilized by a ligand such as a small molecule inhibitor of CA2. As used herein, the term "CA2 WT" refers to the human wild-type CA2 protein sequence as defined as SEQ ID NO: 1 by GenBank Access NO.P00918. ) and may be stabilized by a ligand such as a small molecule inhibitor of CA2. In some embodiments, the DRD may be SEQ ID NO: In some embodiments, the DRD may be SEQ ID NO: : It may be derived from CA2 of SEQ ID NO: 2.

[0053] In some embodiments, the DRD may be derived from CA2 having amino acids 2-260 of the parental CA2 sequence. This is referred to herein as the M1del mutation. M1 The del mutation may also be referred to herein as an amino acid deletion. In some embodiments the human DRD constructs disclosed herein may not contain the N-terminal methionine corresponding to the N-terminal methionine of SEQ ID NO: 1. Regardless of the presence or absence of the N-terminal methionine in the disclosed CA2 DRD, the present disclosure identifies the position of the CA2 DRD in relation to the wild-type human CA2 (Uniprot ID: P00918) of SEQ ID NO: 1, and the reference position 1 is the N-terminal methionine of SEQ ID NO: 1. For example, a hypothetical CA2 DRD containing the G12A mutation refers herein to a CA2 DRD construct, and regardless of whether the CA2 DRD construct itself contains the N-terminal methionine corresponding to the N-terminal methionine of SEQ ID NO: 1, glycine (G) is mutated to alanine (A) at a position in the CA2 DRD construct corresponding to the 12th amino acid of SEQ ID NO: 1. In this example of a hypothetical CA2 DRD containing the G12A mutation, the change from glycine (G) to alanine (A) is also referred to as an amino acid substitution. In some embodiments, the DRD may be derived from human CA2 having amino acids 2-260 of the wild-type human CA2 sequence of SEQ ID NO: 1. This may be referred to as the M1del mutation and has the amino acid sequence of SEQ ID NO: 2. In some embodiments, the DRD disclosed herein has an amino acid sequence as shown in SEQ ID NO: 4.

[0054] In some embodiments, the DRD may be derived from human CA2 having amino acids 2-260 of the wild-type human CA2 sequence of SEQ ID NO: 1. This may be referred to as the M1del mutation and may have the amino acid sequence of SEQ ID NO: 2. In some embodiments, the DRD disclosed herein has an amino acid sequence as shown in SEQ ID NO: 4. ​

[0055] Table 1 provides CA2 DRD. The positions of the mutant amino acids described in Table 1 are related to the full-length CA2 of SEQ ID NO: 1. **[Table 1]**

[0056] In some embodiments, an exemplary DRD from CA2 that controls an operably linked IL15 payload comprises or consists of the amino acid sequence of SEQ ID NO: 4 or is encoded by the nucleotide sequence of SEQ ID NO: 5.

[0057] In some embodiments, a CA2 DRD useful for the regulated and adjustable expression of IL15 as described herein comprises one or more mutations associated with Uniprot ID: P00918 (SEQ ID NO: 1) and may include, but is not limited to, those associated with the amino acid sequence of SEQ ID NO: 1 (M1del, L156H). In some embodiments, a CA2 DRD useful for the regulated and adjustable expression of IL15 as described herein may include one mutation associated with (SEQ ID NO: 2) (L156H). In some embodiments, a CA2 DRD useful for the regulated and adjustable expression of IL15 as described herein may include one amino acid substitution associated with (SEQ ID NO: 2) (L156H). In some embodiments, the CA2 DRD comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the CA2 DRD consists of the amino acid sequence of SEQ ID NO: 4.

[0058] The SREs described herein are limited to those for CA2 WT of SEQ ID NO:1. 1 or 2 chromosome markers, such as, but not limited to, M1del, and L156H In some embodiments, the CA2 DRD may include a CA2 DRD that includes one or more mutations. DRD comprises a L156H mutation and one or more additional mutations relative to SEQ ID NO:1. In some embodiments, the CA2 DRD further comprises the mutation and M1del and L156H mutations, and further comprising one or more additional mutations. In some embodiments, the CA2 DRD is M1de relative to SEQ ID NO:1. 1 amino acid deletion and L156H amino acid substitution, It further includes acid substitutions.

[0059] As used herein, a biological circuit system comprising at least one effector module is provided. The effector module of the biological circuit is CA2 (SEQ ID NO: 1 or In one embodiment, the nucleic acid sequence may include a stimulus response element (SRE) derived from SEQ ID NO:2. The RE comprises or consists of the amino acid sequence of SEQ ID NO:4. The biological circuit comprises at least one SRE that can be attached, attached, or associated with the SRE. The payload may comprise a human payload comprising the amino acid sequence of SEQ ID NO:8. The payload may comprise IL15, and the payload may comprise a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO:9. It may be coded by:

[0060] [Table 2]

[0061] In some embodiments, the present disclosure provides a method of modulating a protein, expression, function, or level by measuring a stabilization rate and a destabilization rate. As used herein, the stabilization rate, when used herein, is defined as the ratio of the expression, function, or level of a protein of interest in response to a stimulant to the expression, function, or level of the protein of interest in the absence of a stimulant specific for the SRE. As used herein, the destabilization rate is defined as the ratio of the expression, function, or level of a protein of interest in the absence of a stimulant specific for an effector module to the expression, function, or level of the protein of interest in the absence of a stimulant specific for the SRE, where the effector module is structurally expressed. As used herein, "structurally" refers to the expression, function, or level of a protein of interest that is not bound to the SRE and is thus expressed both in the presence and absence of a stimulant. As used herein, "payload" or "target payload" or "payload of interest (POI)" is defined as any protein whose function changes. The payload may include any protein or fragment thereof. In some embodiments, the payload of the present disclosure includes IL15. It is technically understood that the nomenclature of a gene and / or protein with respect to the same gene or protein may or may not include punctuation such as the dash symbol "-" or symbols such as Greek letters. Whether or not these are included in or excluded from the present specification, it is not intended that their meaning be changed, as will be understood by those skilled in the art. For example, I

[0062]

[0063]

[0063] L15, IL 15, and IL-15 refer to the same interleukin. In some embodiments, the payload of the present disclosure may be an IL15 interleukin cytokine that stimulates an immune response.

[0064] The payload of the present disclosure may include an amino acid sequence similar to the amino acid sequence of human IL15, for example, UniProtKB-P40933 (IL15_HUMAN). In one embodiment, the IL15 payload includes the amino acid sequence

[0065] (SEQ ID NO: 8) provided in Table 2. In some embodiments, the payload of the present disclosure may be utilized to improve the proliferation, survival, persistence, and efficacy of immune cells such as CD8+ TEM, natural killer (NK) cells, and tumor infiltrating lymphocytes

[0066] (TIL), as well as CAR T cells used in immunotherapy. In one aspect, the present disclosure provides bio-circuits and compositions that minimize the toxicity associated with cytokine therapy. In some embodiments, the effector module may be a CA2 DRD-IL1 5 fusion polypeptide. In some embodiments, the IL15-containing The MSCV promoter, synthetic RPBSA promoter, or ubiquitin may be placed under the transcriptional control of the chitin promoter.

[0067] A unique feature of IL15-mediated activation is that IL15 binds to the membrane-bound IL15 beta / gamma receptor and activates the alpha subunit of the IL15 receptor (IL15Ra) that exists as a complex with it, either in the same cell or in different cells. This is the mechanism of presentation. In various embodiments, the payload of the present disclosure is membrane-bound IL15, and the amino acid sequence of the membrane-bound IL15 includes the amino acid sequence of SEQ ID NO: 8.

[0068] The payload of the present disclosure may include a nucleic acid sequence as disclosed herein, but the payload may include additional or fewer nucleotides than those described. Such a nucleic acid sequence may have more or fewer nucleotides than about 1, more or fewer nucleotides than about 2, more or fewer nucleotides than about 3, more or fewer nucleotides than about 4, more or fewer nucleotides than about 5, more or fewer nucleotides than about 6, more or fewer nucleotides than about 7, more or fewer nucleotides than about 8, more or fewer nucleotides than about 9, more or fewer nucleotides than about 10, or more than 10 nucleotides.

[0069] Effector modules, their SREs, and the bio-circuit components containing the payload may be nucleic acid-based. The term "nucleic acid" in a broad sense refers to a polymer of nucleotides. ​​​​​​​The primer includes any compound and / or substance, such as a binding nucleotide. This These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the present disclosure include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid ( LNA, LNA having a β-D-ribo configuration, α-LNA (diastereomer of LNA) having an α-L-ribo configuration, 2′-amino-LNA having a 2′-amino functional group, and 2′-amino-α-LNA having a 2′-amino functional group), or a hybrid thereof is included, but not limited thereto.

[0070] In some embodiments, the nucleic acid molecule is DNA. In some embodiments, the nucleic acid molecule is messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and can be translated to produce the polypeptide of interest encoded in vitro, in vivo, in situ, or ex vivo. The polynucleotides of the present disclosure can be mRNA or any nucleic acid molecule, optionally chemically modified.

[0071] In some embodiments, the polynucleotides of the present disclosure may cover a 5'UTR sequence that plays a role in translation initiation. The 5'UTR sequence may include features such as the Kozak sequence, which is widely known to be involved in the process by which ribosomes initiate translation of a gene. , The Kozak sequence has a consensus XCCR(A / G)CCAUG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), and X is any nucleotide. In one embodiment, the Kozak sequence is ACCGCC. By manipulating the features typically found in genes highly expressed in target cells or tissues, the stability of the polynucleotides and protein production of the present disclosure can be enhanced. eotide. In one embodiment, the polynucleotide of the present disclosure may encode a variant polypeptide having a certain identity with a reference polypeptide sequence. As used herein, "reference polypeptide sequence" refers to the starting polypeptide sequence. The reference sequence may be a wild-type sequence or any sequence referred to in the design of another sequence. As is well known in the art, the term "identity" refers to the relationship between two or more sequences as determined by comparing the sequences. Technically, identity also means the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more residues (amino acids or nucleic acids). Identity is measured as the percentage of exact matches between two or more sequences by gap alignment (if any) handled by a specific mathematical model or computer program (i.e., "algorithm"). The identity of related sequences can be readily calculated by known methods. Such methods include Computational Molecular Biol ogy, Lesk, A.M. ed., Oxford University Press, N In one embodiment, the polynucleotide of the present disclosure may encode a variant polypeptide having a certain identity with a reference polypeptide sequence. As used herein, "reference polypeptide sequence" refers to the starting polypeptide sequence. The reference sequence may be a wild-type sequence or any sequence referred to in the design of another sequence.

[0072] As is well known in the art, the term "identity" refers to the relationship between two or more sequences as determined by comparing the sequences. Technically, identity also means the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more residues (amino acids or nucleic acids). Identity is measured as the percentage of exact matches between two or more sequences by gap alignment (if any) handled by a specific mathematical model or computer program (i.e., "algorithm"). The identity of related sequences can be readily calculated by known methods. Such methods include Computational Molecular Biol ogy, Lesk, A.M. ed., Oxford University Press, N eotide. In one embodiment, the polynucleotide of the present disclosure may encode a variant polypeptide having a certain identity with a reference polypeptide sequence. As used herein, "reference polypeptide sequence" refers to the starting polypeptide sequence. The reference sequence may be a wild-type sequence or any sequence referred to in the design of another sequence. As is well known in the art, the term "identity" refers to the relationship between two or more sequences as determined by comparing the sequences. Technically, identity also means the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more residues (amino acids or nucleic acids). Identity is measured as the percentage of exact matches between two or more sequences by gap alignment (if any) handled by a specific mathematical model or computer program (i.e., "algorithm"). The identity of related sequences can be readily calculated by known methods. Such methods include Computational Molecular Biol

[0073] ogy, Lesk, A.M. ed., Oxford University Press, N As is well known in the art, the term "identity" refers to the relationship between two or more sequences as determined by comparing the sequences. Technically, identity also means the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more residues (amino acids or nucleic acids). Identity is measured as the percentage of exact matches between two or more sequences by gap alignment (if any) handled by a specific mathematical model or computer program (i.e., "algorithm"). The identity of related sequences can be readily calculated by known methods. Such methods include Computational Molecular Biol ogy, Lesk, A.M. ed., Oxford University Press, N eotide. In one embodiment, the polynucleotide of the present disclosure may encode a variant polypeptide having a certain identity with a reference polypeptide sequence. As used herein, "reference polypeptide sequence" refers to the starting polypeptide sequence. The reference sequence may be a wild-type sequence or any sequence referred to in the design of another sequence. As is well known in the art, the term "identity" refers to the relationship between two or more sequences as determined by comparing the sequences. Technically, identity also means the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more residues (amino acids or nucleic acids). Identity is measured as the percentage of exact matches between two or more sequences by gap alignment (if any) handled by a specific mathematical model or computer program (i.e., "algorithm"). The identity of related sequences can be readily calculated by known methods. Such methods include Computational Molecular Biol ogy, Lesk, A.M. ed., Oxford University Press, N eotide. In one embodiment, the polynucleotide of the present disclosure may encode a variant polypeptide having a certain identity with a reference polypeptide sequence. As used herein, "reference polypeptide sequence" refers to the starting polypeptide sequence. The reference sequence may be a wild-type sequence or any sequence referred to in the design of another sequence. ogy, Lesk, A.M. ed., Oxford University Press, N eotide. In one embodiment, the polynucleotide of the present disclosure may encode a variant polypeptide having a certain identity with a reference polypeptide sequence. As used herein, "reference polypeptide sequence" refers to the starting polypeptide sequence. The reference sequence may be a wild-type sequence or any sequence referred to in the design of another sequence. ew York, 1988; Biocomputing: Informatics a nd Genome Projects, edited by Smith, D.W., Academic Press, New York, 1993; Computer Analysis o f Sequence Data, Part 1, edited by Griffin, A.M., and G riffin, H.G., Humana Press, New Jersey, 199 4; Sequence Analysis in Molecular Biolog y, by von Heinje, G., Academic Press, 1987; Seq uence Analysis Primer, edited by Gribskov, M. and Deve reux, J., M. Stockton Press, New York, 1991 ; and those described in Carillo et al., SIAM J. Applied Math. 48, 107 3 (1988)) are included, but not limited to these.

[0074] In some embodiments, the variant sequence may have the same or similar activity as the reference sequence. Alternatively, the variant may have a changed activity (e.g., increased or decreased) relative to the reference sequence. Generally, a var iant of a particular polynucleotide or polypeptide of the present disclosure is, as determined by the sequence alignment programs and parameters described herein and known to those of skill in the art, at least about 40%, 45%, 50%, 55%, 60%, 65%, 7 0%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 9 6%, 97%, 98%, or 99% identical to that particular reference polynucleotide or poly 6%, 97%, 98%, 99% but less than 100% sequence identity, such that For such alignments, tools include the BLAST suite (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.). Nucleic Acids Res. 25:3389-3402.) are included. .

[0075] The effector modules of the present disclosure may further include a signal sequence that controls the distribution of a payload of interest, a cleavage mechanism and / or processing mechanism that facilitates cleavage of the payload from the effector module construct, a targeting signal and / or trafficking signal that can control the cellular localization of the effector module, tags, and / or one or more linker sequences that link different components of the effector module.

[0076] In addition to the SRE and payload regions, the effector modules of the present disclosure may further include one or more additional features such as one or more signal sequences.

[0077] Signal sequences (also referred to as signal peptides, targeting signals, targeting peptides, localization sequences, trafficking peptides, leader sequences, or leader peptides) are proteins ( ​​​For example, the effector modules of the present disclosure) are directed to their designated cellular sites and / or are directed to extracellular sites. Protein signal sequences play a central role in the targeting and translocation of nearly all secreted proteins and many integral membrane proteins.

[0078] Signal sequences are short (5-30 amino acids in length) peptides that are present at the N-terminus of the majority of novel synthetic proteins that are directed to specific sites. Signal sequences are recognized by the signal recognition particle (SRP) and can be cleaved using type I and type II signal peptidases. Signal sequences derived from human proteins are incorporated as regulatory modules of the effector module and can direct the effector module to specific cells and / or extracellular sites.

[0079] In some embodiments, the signal sequence may, but does not necessarily, be located at the N-terminus or C-terminus of the effector module and may, but does not necessarily, be cleaved from the desired effector module to produce a "mature" payload.

[0080] In some embodiments, the signal sequence used herein may exclude the methionine at position 1 of the amino acid sequence of the signal sequence. This may be referred to as the M1del mutation.

[0081] In addition to naturally occurring signal sequences, such as those consisting of secreted proteins, signal sequences may be variants modified from known signal sequences of proteins.

[0082] In some cases, a signal sequence that directs the payload of interest to the surface membrane of the target cell is used may also be. Expression of the payload on the surface of the target cell may help to limit the diffusion of the payload into the non-target in vivo environment thereby potentially improving the safety profile of the payload. Additionally, membrane presentation of the payload may enable payload stabilization and recycling for a longer half-life, as well as physiological and qualitative signal transduction. The membrane sequence may be the endogenous signal sequence of the N-terminal component of the payload of interest. Optionally, it may be desirable to exchange this sequence with a different signal sequence in some cases. The signal sequence may be selected based on their compatibility with the secretory pathway of the cell type of interest such that the payload is present on the surface of T cells. In some embodiments the signal sequence may be an IgE signal sequence, a CD8a signal sequence (also called CD8a leader), or an IL15Ra signal sequence (also called IL15Ra leader) , or an M1del CD8a signal sequence (also called M1del CD8 leader sequence) . In some embodiments, the effector module may include a cleavage mechanism and / or a processing mechanism. In some embodiments, the effector module of the present disclosure may include at least one protein cleavage signal / site. The protein cleavage signal / site may be located at the N-terminus, C-terminus, intermediate between the N-terminus and C-terminus, between the N-terminus and the midpoint, between the midpoint and the C-terminus, and combinations thereof, but not limited thereto, at any space between the N- terminus and C-terminus.

[0083] In some embodiments, the effector module includes a linker.

[0084] ​

[0085] In some embodiments, the effector module of the present disclosure may further include a linker sequence. The linker region mainly functions as a spacer between two or more polypeptides within the effector module. A "linker" or "spacer", as used herein, refers to a molecule or group of molecules that connects two parts of a molecule, such as two molecules, or two domains of a recombinant protein.

[0086] In some embodiments, a "linker" (L) or "linker domain" or "linker region" or "linker module" or "peptide linker", as used herein, refers to an oligopeptide or polypeptide region of about 1 to 100 amino acids in length that covalently links either domain / region of the effector module (also referred to as a peptide linker).

[0087] In some embodiments, an artificially designed peptide linker may consist of a polymer of flexible residues such as glycine (G) and serine (S) so that adjacent protein domains can move freely relative to each other. When it is desirable to ensure that two adjacent domains do not interfere with each other, a longer linker may be used. The selection of a particular linker sequence may be of concern if it affects the biological activity, stability, folding, targeting, and / or pharmacokinetic properties of the fusion construct.

[0088] The linker sequence may be a natural linker from a multi-domain protein. Natural linkers A linker is a short peptide that separates two different domains or motifs within a protein sequence.

[0089] In one embodiment, the linker may be a BamHI site. By way of non-limiting example the BamHI site has the amino acid sequence GS and / or the DNA sequence GGATCC .

[0090] The bio-circuits of the present disclosure are triggered by one or more stimulants. In some embodiments the stimulant is a small molecule. In some embodiments the small molecule is cell permeable. In some embodiments the small molecule is FDA approved, safe and orally administered.

[0091] In some embodiments, the ligand binds to carbonic anhydrase. In some embodiments the ligand binds and inhibits carbonic anhydrase function and is herein referred to as a carbonic anhydrase inhibitor.

[0092] In some embodiments, the ligand is a small molecule that binds to carbonic anhydrase 2 . In one embodiment, the small molecule is a CA2 inhibitor. In some embodiments the ligand is a small molecule selected from acetazolamide, celecoxib, baldecoxib, rofecoxib, me tazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zo nisamide, dansylamide, and dichlorphenamide. In some embodiments, the ligand is acetazolamide, brinzolamide, dorzolamide hydrochloride , dichlorphenamide, chlorthalidone, methazolamide, topiramate, indapa Mid, ambroxol hydrochloride, glimepiride, tetracaine hydrochloride, and celecoxib are small molecules selected from. In some embodiments, the ligand is acetazol amide, brinzolamide, dorzolamide hydrochloride, dichlorphenamide, chlorthalidone, me tazolamide, or topiramate. In some embodiments the ligand is a small molecule selected from acetazolamide, brinzolamide, dorzolamide hydrochloride, dichlorph enamide, or methazolamide. In some embodiments the ligand is a CA2 inhibitor selected from acetazolamide (ACZ).

[0093] In some embodiments, a ligand that does not affect the activity of immune cells, and / or a chimeric antigen receptor is preferably selected in the absence of SRE.

[0094] In some embodiments, the compositions of the present disclosure include a promoter.

[0095] As used herein, a promoter is defined as a DNA sequence recognized by the transcriptional apparatus of a cell that is necessary to initiate the specific transcription of the polynucleotide sequence of the present disclosure. A vector can include a natural or non-natural promoter operably linked to the polynucleotide of the present disclosure. The selected promoter can be strong, weak, constitutive, inducible, tissue-specific, development-stage-specific, and / or organism-specific. A strong constitutive promoter sequence can drive high-level expression of a polynucleotide sequence operably linked thereto. Examples of strong constitutive promoters include the immediate early cytome galovirus (CMV) promoter and Elongation Growth Fa ctor. A strong constitutive promoter sequence can drive high-level expression of a polynucleotide sequence operably linked thereto. Examples of strong constitutive promoters include the immediate early cytome galovirus (CMV) promoter and Elongation Growth Factor 1 alpha (EF1α) promoter. A strong constitutive promoter can drive high-level expression of a polynucleotide sequence operably linked thereto. Examples of strong constitutive promoters include the immediate early cytome galovirus (CMV) promoter and Elongation Growth Factor 1 alpha (EF1α) promoter. It contains unlimited amounts of ctor-1 Alpha (EF-1α). Other constitutive promoters that can be used include simian virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, avian leukemia virus promoter, spleen focus-forming virus (SFFV) promoter , mouse stem cell virus (MSCV) promoter, Epstein-Barr virus immediate early pro moter, Rous sarcoma virus promoter, and phosphoglycerate kinase (P GK) promoter, actin promoter, myosin promoter, hemoglobin pro moter, ubiquitin C (Ubc) promoter, human U6 small nuclear protein pro moter, and creatine kinase promoter, including but not limited to these human gene promoters. Synthetic promoters include the MND promoter and the RPBSA promoter. In some cases, inducible promoters such as, but not limited to, the metallothionein promoter, glucocorticoid promoter, progesterone promoter, and tetracycline promoter may be used.

[0096] In some embodiments, the optimal promoter is selected based on its ability to achieve minimal expression of the SRE and payload of the present disclosure in the absence of ligand, and detectable expression in the presence of ligand.

[0097] Additional promoter elements, such as enhancers, are used to control the frequency of transcription initiation may be used. Such regions may be located 10 to 100 base pairs upstream or downstream of the starting site. and may be located at. In some cases, two or more promoter elements may be used to activate transcription jointly or independently.

[0098] The bio - circuits of the present disclosure may include at least one SRE derived from CA2 (referred to as "CA2 SRE") that is operably coupled to at least one payload of interest. and may include at least one effector module. These types of bio - circuits and effector modules are referred to as "CA2 bio - circuits" and "CA2 effector modules". respectively. Additionally, the CA2 effector module may include additional features including, but not limited to, signal sequences, linkers, spacers, tags, flags, cleavage sites, and IRES. Any of the exemplary SREs (e.g., DRD), payloads of interest, signal sequences, linkers, spacers, hinges, tags, flags, cleavage sites, and IRES taught herein or known in the art may be combined to create the CA2 effector modules of the present disclosure.

[0099] In one embodiment, the CA2 effector module includes a payload of interest. The payload of interest may be a wild - type sequence, a fragment of a wild - type sequence, and / or may include one or more mutations. In one embodiment, the CA2 effector module produces a control interleukin - 15 (IL15). In some embodiments, the IL15 payload is at the N - terminus of the DRD. ​​​​​​​R may include any of the IL15-related sequences in Table 3 or may be derived from any of the IL15-related sequences in Table 3. In some embodiments, at least one payload in the CA2 effector module is an IL15 (e.g., an IL15 payload) that includes an amino acid sequence that is at least 95%, or at least 96%, or at least 97%, or at least 98 %, or at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO:8, and the payload may be encoded by a nucleic acid sequence that includes the nucleotide sequence of SEQ ID NO:9). In some embodiments, the payload is a membrane-bound form of IL15. In some embodiments, the payload is a membrane-bound form of IL15 that includes a transmembrane domain and an intracellular tail. In some embodiments, the payload is a membrane-bound form of IL15 that includes an IL15 polypeptide component that includes the amino acid sequence of SEQ ID NO:8, a transmembrane domain, and an intracellular tail, where the transmembrane domain is at the C-terminus of the IL15 polypeptide component and the intracellular tail is at the C-terminus of the transmembrane domain. In some embodiments, the payload is a membrane-bound form of IL15 that includes a transmembrane domain, an intracellular tail, and one or more linkers. In some embodiments, the linker is a peptide domain that can be placed between the SRE or DRD and the payload or between different domains within the payload. In some embodiments, the linker is a peptide domain that includes glycine and serine amino acid residues. In some embodiments, the peptide linker that includes glycine and serine amino acid residues may be 2 to 36 amino acids in length. In one embodiment, CA2 ​​​​​​​​​​​​ At least one payload in the effector module is a linker (GS)15 , the B7.1 hinge, the B7.1 transmembrane domain, the B7.1 intracellular tail, and a linker (G S), and is a membrane-bound form of IL15. The CA2 effector module is not only the IL1 5 payload component, but may also include a transmembrane domain and / or a payload component of the cytoplasmic domain from another parent protein. In one embodiment, at least one payload in the CA2 effector module is compared to the wild-type sequence, contains at least one mutation. In one embodiment, at least one payload in the CA2 effector module contains at least one amino acid substitution compared to the wild-type sequence.

[0100] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0101] In various embodiments, the effector module is a controlled membrane-bound interleukin- produces 15 (IL15). In some embodiments, the effector module is IL15-293 or IL15-295 as described in Table 3. In various embodiments the IL15 payload is expressed as a CA2 DRD fusion protein that includes a membrane-bound form of IL15 protein.

[0102] The CA2 biocircuit and / or CA2 effector module of the present disclosure can be monocistronic or multicistronic, meaning that one (monocistronic) or two or more (multicistronic) messages (e.g., the payload of interest) are produced. If two messages are produced, the CA2 biocircuit or the CA2 effector module is considered bicistronic. In one embodiment, at least one CA2 effector module of the present disclosure is monocistronic

[0103] Various embodiments of the present disclosure provide nucleic acid molecules that include one or more of the described polynucleotides In some embodiments, the nucleic acid molecule includes a polynucleotide encoding a recombinant protein that includes a drug-responsive domain (DRD) operably linked to an IL15 payload, where the DRD is derived from human carbonic anhydrase II (CA2) and includes one, two, three, four or more mutations relative to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the nucleic acid molecule further includes a second polynucleotide encoding a chimeric antigen receptor (CAR) or a T cell receptor (TCR), and the CAR or TCR includes an antigen-binding domain specific for an antigen of interest. In some embodiments ​​​​​​​​​​In some cases, the CAR or TCR includes an antigen-binding domain specific for the antigen of interest, for example , the CAR includes an antigen-binding domain specific for CD19.

[0104] The present teachings include a pharmaceutical composition comprising one or more of the CA2 biocircuits, CA2 effector modules, or systems of the present disclosure , and optionally further comprising at least one pharmaceutically acceptable additive or inert ingredient.

[0105] As used herein, the term "pharmaceutical composition" refers to the preparation of one or more of the CA2 biocircuits or components described herein, or a pharmaceutically acceptable salt thereof , optionally including other chemical components such as physiologically suitable carriers and additives. The term "additive" or "inert ingredient" refers to an inert or inactive substance added to the pharmaceutical composition to further facilitate the administration of the compound. Non-limiting

[0106] examples of such inert ingredients are disclosed herein.

[0107]

[0108] In some embodiments, the composition is administered to a human, such as a human patient or subject. For the purposes of the present disclosure, the phrase "active ingredient" typically refers to any one or more of the CA2 biocircuit components described herein to be delivered as described. The description of the pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, but it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other animal, such as a non-human animal, such as a non-human mammal. Subjects to which the pharmaceutical composition is administered include agricultural animals such as cows, horses, chickens, and pigs

[0108] Non-human mammals include, but are not limited to, domestic animals such as animals, cats, and dogs, or laboratory animals such as mice, rats, rabbits, dogs, and non-human primates. It is considered that non-human mammals including research animals such as those mentioned above are included, but not limited to these.

[0109] The pharmaceutical composition according to the present disclosure may be prepared in large quantities, packaged, and / or sold as a single unit dose and / or as a plurality of single unit doses. As used herein, a "unit dose" is an individual quantity of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of the active ingredient is usually equal to the dose of the active ingredient administered to a subject and / or a convenient fraction of such a dose, such as half or one-third of such a dose. When used, the relative amounts of the active ingredient, pharmaceutically acceptable additives or inactive ingredients, and / or any additional ingredients in the pharmaceutical composition according to the present disclosure vary depending on the identity, size, and / or condition of the subject being treated, and further depending on the route by which the composition is administered. By way of example, the composition may contain from 0.1% to 100%, such as from 0.5% to 50%, from 1% to 30% %, from 5% to 80%, at least 80% (w / w) of the active ingredient.

[0110] The therapeutic effect or remission of a disease can be evaluated, for example, by measuring the progression of the disease, the remission of the disease, the severity of symptoms, the reduction of pain, the quality of life, the dose of drug therapy required to maintain therapeutic efficacy, the level of disease markers, or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. By measuring any one of such parameters, or any combination of parameters, the treatment or prevention can be evaluated. For example, the composition may contain from 0.1% to 100%, such as from 0.5% to 50%, from 1% to 30% %, from 5% to 80%, at least 80% (w / w) of the active ingredient.

[0111] The therapeutic effect or remission of a disease can be evaluated, for example, by measuring the progression of the disease, the remission of the disease, the severity of symptoms, the reduction of pain, the quality of life, the dose of drug therapy required to maintain therapeutic efficacy, the level of disease markers, or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. By measuring any one of such parameters, or any combination of parameters, the treatment or prevention can be evaluated. The therapeutic effect or remission of a disease can be evaluated, for example, by measuring the progression of the disease, the remission of the disease, the severity of symptoms, the reduction of pain, the quality of life, the dose of drug therapy required to maintain therapeutic efficacy, the level of disease markers, or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. By measuring any one of such parameters, or any combination of parameters, the treatment or prevention Monitoring the preventive effect is well within the ability of those skilled in the art. For the administration of the compositions of the present disclosure, for example, "effective against" cancer means that administration in a clinically appropriate manner results in, among other things, improvement of symptoms, cure, reduction of disease burden, reduction of tumor mass or cell number, extension of lifespan, improvement of quality of life, or other effects that are typically recognized as positive by physicians proficient in the treatment of a particular type of cancer, in at least a statistically significant proportion of patients. For the administration of the composition, for example, "effective against" cancer means that administration in a clinically appropriate manner results in, among other things, improvement of symptoms, cure, reduction of disease burden, reduction of tumor mass or cell number, extension of lifespan, improvement of quality of life, or other effects that are typically recognized as positive by physicians proficient in the treatment of a particular type of cancer and that result in a beneficial effect in at least a statistically significant proportion of patients.

[0112] The therapeutic or preventive effect becomes apparent when there is a statistically significant improvement in one or more parameters of the disease state, or when the symptoms do not worsen or do not appear where they are predicted to appear. As an example, in a measurable parameter of the disease, a change of at least 10% and preferably at least 20%, 30%, 40%, 50% or more can suggest an effective treatment. The effectiveness of a given composition or formulation of the present disclosure can also be determined using experimental animal models for a given disease as is well known in the art. When using an experimental animal model, the therapeutic effect is demonstrated when a statistically significant change is observed. % and preferably at least 20%, 30%, 40%, 50% or more favorable change can suggest an effective treatment. The effectiveness of a given composition or formulation of the present disclosure can also be determined using experimental animal models for a given disease as is well known in the art. When using an experimental animal model, the therapeutic effect is demonstrated when a statistically significant change is observed. The compositions of the present disclosure may be formulated in any manner suitable for delivery. The formulations may be nanoparticles, poly lactic glycolic acid copolymer (PLGA) microspheres, lipidoids, lipoplexes

[0113] The compositions of the present disclosure may be formulated in any manner suitable for delivery. The formulations may be nanoparticles, poly lactic glycolic acid copolymer (PLGA) microspheres, lipidoids, lipoplexes, liposomes, polymers, carbohydrates (including monosaccharides), cationic lipids, and combinations thereof, but are not limited thereto.

[0114] In some embodiments, the formulation or other preparation may include at least one additive that is an inert ingredient. As used herein, the term "inert ingredient" refers to one or more inert agents included in the preparation. In some embodiments, all or some of the inert ingredients that may be used in the formulations of the present disclosure may or may not be approved by the U.S. Food and Drug Administration (FDA). The compositions of the present disclosure may be delivered to cells or subjects through one or more routes and modalities. The viral vectors containing one or more of the CA2 biocircuits, CA2 effector modules, SREs, payloads, and other components described herein may be used to deliver them to cells and / or subjects. Other modalities may be used, such as mRNA, as a plasmid, and as a recombinant protein, etc. The pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload of the present disclosure may be delivered to cells, tissues, organs, and / or living organisms in a naked form. As used herein, the term "naked" refers to the delivery of an SRE or payload-containing pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module, without including agents or modifications that promote transfection or permeability. The naked pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload are delivered to cells, tissues, organs using the routes of administration well known in the art and described herein. and / or living organisms.

[0115] The pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload of the present disclosure may be delivered to cells, tissues, organs, and / or living organisms in a naked form. As used herein, the term "naked" refers to the delivery of an SRE or payload-containing pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module, without including agents or modifications that promote transfection or permeability. The naked pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload are delivered to cells, tissues, organs and / or living organisms using the routes of administration well known in the art and described herein. As used herein, the term "naked" refers to the delivery of an SRE or payload-containing pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module, without including agents or modifications that promote transfection or permeability. The naked pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload are delivered to cells, tissues, organs and / or living organisms using the routes of administration well known in the art and described herein. The naked pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload are delivered to cells, tissues, organs and / or living organisms using the routes of administration well known in the art and described herein. The naked pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules, containing the SRE or payload are delivered to cells, tissues, organs and / or living organisms using the routes of administration well known in the art and described herein. ​and / or may be delivered to a living organism. In some embodiments, naked delivery may include a formulation in a simple buffer such as saline or PBS.

[0116] In some embodiments, a pharmaceutical composition comprising an SRE or payload of the present disclosure, a CA2 biocircuit, a CA2 biocircuit component, a CA2 effector module may be formulated using the methods described herein. The formulation may include an SRE or payload, a modified and / or unmodified pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module. The formulation may further include a cell permeant agent, a pharmaceutically acceptable carrier, a delivery agent, a biodegradable or biocompatible polymer, a solvent, and / or a sustained release delivery depot, but is not limited thereto. The formulations of the present disclosure may be delivered to cells using routes of administration well known in the art and described herein.

[0117] A pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising an SRE or payload may be formulated for direct delivery to an organ or tissue by any of several methods in the art including, but not limited to, direct immersion or a water bath, using a catheter, a substrate such as a fabric or biodegradable material coated with or impregnated with the composition, such as a gel, powder, ointment, cream, gel, lotion, and / or drops.

[0118] In another aspect of the present disclosure, the CA2 biocircuit, CA2 effector module of the present disclosure ​​​ーle, SRE (e.g., CA2 DRD), a payload of interest (e.g., IL15), and polynucleotides encoding the composition, and vectors comprising said polynucleotides - may be introduced into cells. As a non-limiting example, the cells may be effector immune cells .

[0119] In various embodiments, the present disclosure provides cells comprising one or more nucleic acid molecules, one or more vectors, or one or more recombinant proteins of the present disclosure. In some embodiments, methods are provided for regulating the expression, function, and / or level of the IL15 payload in cells, said methods comprising administering to the cells an agent to which the DRD responds, the agent being administered in an amount sufficient to regulate the expression, function, and / or level of the IL15 payload. In some embodiments, the cells are isolated. In some embodiments, the cells are bacterial cells. In some embodiments, the cells are mammalian cells. The mammalian cells may be human cells. The human cells may be T cells, natural killer (NK) cells, or tumor infiltrating lymphocytes (TIL) . In some embodiments, the cells are CD4+ or CD8+ T cells . In some embodiments, the human T cells or human NK cells further comprise a polynucleotide encoding a chimeric antigen receptor (CAR) or a T cell receptor (TCR), and the CAR or TCR comprises an antigen binding domain specific for an antigen of interest. In some embodiments, the CAR comprises an antigen binding domain specific for CD19 . . In some embodiments, the cells are isolated. In some embodiments, the cells are bacterial cells. In some embodiments, the cells are mammalian cells. The mammalian cells may be human cells. The human cells may be T cells, natural killer (NK) cells, or tumor infiltrating lymphocytes (TIL) . In some embodiments, the cells are CD4+ or CD8+ T cells . In some embodiments, the human T cells or human NK cells further comprise a polynucleotide encoding a chimeric antigen receptor (CAR) or a T cell receptor (TCR), and the CAR or TCR comprises an antigen binding domain specific for an antigen of interest. In some embodiments, the CAR comprises an antigen binding domain specific for CD19 . . In some embodiments, the cells are CD4+ or CD8+ T cells . In some embodiments, the human T cells or human NK cells further comprise a polynucleotide encoding a chimeric antigen receptor (CAR) or a T cell receptor (TCR), and the CAR or TCR comprises an antigen binding domain specific for an antigen of interest. In some embodiments, the CAR comprises an antigen binding domain specific for CD19 . . In some embodiments, the CAR or TCR comprises an antigen binding domain specific for an antigen of interest. In some embodiments, the CAR comprises an antigen binding domain specific for CD19 .

[0120] In one aspect of the present disclosure, the CA2 biocircuit, CA2 effector module of the present disclosure , SRE (e.g., CA2 DRD), the payload of interest (e.g., IL15), and the polynucleotide encoding the composition may be packaged into a viral vector, or integrated into a viral genome that allows for transient or stable expression of the polynucleotide. Suitable viral vectors are retroviral vectors including lentiviral vectors and gamma-retroviral vectors. To construct a retroviral vector, a polynucleotide molecule encoding the CA2 biocircuit, CA2 effector module, CA2 DRD, or the payload of interest (e.g., immunotherapeutic agent) is inserted into the viral genome in place of certain viral sequences to produce a replication-deficient virus. The recombinant viral vector is subsequently introduced into a packaging cell line that contains gag, pol, and env genes but does not contain LTR (for lentiviral vectors) and packaging components. Recombinant retroviral particles are secreted into the medium, subsequently collected, optionally concentrated, and used for gene transfer. Lentiviral vectors are particularly suitable if they can affect both dividing and non-dividing cells. The vector may be introduced into cells by physical methods such as needles, electroporation, sonoporation, hydrooporation; chemical carriers such as inorganic particles (e.g., calcium phosphate, silica, gold), and / or non-viral methods by chemical means. In some embodiments, synthetic or natural biodegradable agents are cationic lipids.

[0121] , may be used for delivery such as liquid nanoemulsions, nanoparticles, peptide-based vectors, or polymer-based vectors.

[0122] The CA2 bio-circuit system, CA2 effector module, SRE and / or payload of the present disclosure may be delivered using one or more modalities. The present disclosure , CA2 bio-circuit, CA2 effector module, SRE (e.g., CA2 DRD ), and the IL15 payload of the subject, and vectors that package the polynucleotides of the present disclosure encoding combinations thereof are also provided. The vectors of the present disclosure are used to deliver the packaged polynucleotides to cells, local tissue sites, or subjects. These vectors may be of any type, including DNA vectors, RNA vectors, plasmids, viral vectors and particles. Viral vector technology is well known and is described in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor La boratory, New York). Viruses useful as vectors include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated virus (AA V) vectors, herpes simplex virus vectors, retroviral vectors, oncolytic viruses, etc. In some embodiments, the virus vectors useful for introducing one or more nucleic acid molecules encoding the DRD and IL15 payloads exemplified in the present specification into cells are adenoviruses, adeno associated virus (AAV), alphavirus, flavivirus, herpesvirus, measles viruses, etc. vectors, herpes simplex virus vectors, retroviral vectors, oncolytic viruses, etc., but are not limited thereto. In some embodiments, the viral vectors useful for introducing one or more nucleic acid molecules encoding the DRD and IL15 payloads exemplified in the present specification into cells are adenoviruses, adeno associated virus (AAV), alphavirus, flavivirus, herpesvirus, measles virus, etc. virus, etc. may be derived from a virus, rhabdovirus, retrovirus, lentivirus, Newcastle disease virus (NDV), poxvirus, or picornavirus.

[0123] Generally, the vector includes an origin of replication that functions in at least one living organism, a promoter sequence and a convenient restriction endonuclease site, as well as one or more selectable markers, e.g., a drug resistance gene.

[0124] In some embodiments, the recombinant expression vector may include regulatory sequences, such as transcription and translation start and stop codons, specific to the type of host cell into which the vector is introduced.

[0125] In some embodiments, the vectors of the disclosure may contain one or more of the payloads taught herein, and two or more payloads may be included in one CA2 effector module. In this case, two or more payloads are co-regulated by the same stimulant. In other embodiments, the vectors of the disclosure may contain two or more CA2 effector modules, each containing a different payload. In this case, the two or more CA2 effector modules and payloads are regulated by different stimulants, resulting in independent control of the two or more components separately. In other embodiments, the vectors of the disclosure may contain one or more CA2 effector modules and one or more non-CA2 effector modules, each CA2 effector module containing a different payload. In this case, the CA2 effector modules and payloads are regulated by different stimulants, providing separate independent control of the two or more components. The termodule and payload are regulated by different stimulants, and independent control of two or more components is separately provided.

[0126] In some embodiments, the lentiviral vehicle / particle may be used as a delivery modality. Lentiviruses are a sub group of the retrovirus family of viruses, named because reverse transcription of the viral RNA genome into DNA is required prior to integration into the host genome. Thus, the most important feature of lentiviral vehicles / particles is the integration of their genetic material into the genome of the target / host cell. Examples of lentiviruses include human immunodeficiency virus: HIV-1 and HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), equine infectious anemia virus (EIAV), equine infectious anemia virus, visna maedi, and caprine arthritis encephalitis virus (CAEV). (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), equine infectious anemia virus (EIAV), equine infectious anemia virus, visna maedi, and caprine arthritis encephalitis virus (CAEV). (CAEV). (CAEV). are included.

[0127] Typically, lentiviral particles that make up a gene delivery vehicle are not capable of replicating on their own (also referred to as "self-inactivating"). Lentiviruses can affect both dividing and non-dividing cells through an entry mechanism that passes through the intact host nuclear membrane (Naldin i L et al., Curr.Opin.Biotechnol, 1998, 9:457-46 3). Recombinant lentiviral vehicles / particles are generated by complex attenuation of HIV pathogenic genes. For example, the genes Env, Vif, Vpr, Vpu, Nef , and Tat are deleted, and a biologically safe vector is created. Accordingly, 3). Recombinant lentiviral vehicles / particles are generated by complex attenuation of HIV pathogenic genes. For example, the genes Env, Vif, Vpr, Vpu, Nef , and Tat are deleted, and a biologically safe vector is created. Accordingly, , and Tat are deleted, and a biologically safe vector is created. Accordingly, For example, a lentiviral vehicle derived from HIV-1 / HIV-2 can mediate efficient delivery, integration, and long-term expression into non-dividing cells. As used herein, the term "recombinant" refers to vectors and other nucleic acids that contain both lentiviral sequences and non-lentiviral retroviral sequences. Lentiviral particles may be generated by co-expressing viral packaging elements and the vector genome itself in producer cells such as human HEK293T cells. These elements are usually provided on three or four separate plasmids. The producer cells are co-transfected with a plasmid encoding lentiviral components including the viral core (i.e., structural proteins) and enzymatic components, as well as the envelope protein (referred to as the packaging system), and a plasmid encoding a genome containing the foreign transgene, and transferred to target cells, the vehicle itself (also referred to as the transfer vector). Generally, the plasmid or vector is contained in the producer cell line. The plasmid / vector is introduced into the producer cell line by transfection, transduction, or infection.

[0128] Methods of transfection, transduction, or infection are well known to those skilled in the art. As a non-limiting example, the packaging and transfer constructs are usually introduced into the producer cell line by calcium phosphate transfection, lipofection, or electroporation with a dominant selectable marker such as neo, DHFR, Gln synthetase, or ADA, followed by selection in the presence of the appropriate drug and isolation of clones. ​

[0129] The producer cells produce recombinant virus particles containing a foreign gene, for example, the CA2 effector module of the present disclosure. The recombinant virus particles are recovered from the culture medium and titrated by standard methods used by those skilled in the art. The recombinant lentiviral vehicle can be used to affect target cells. The recombinant virus particles are recovered from the culture medium and titrated by standard methods used by those skilled in the art. The recombinant lentiviral vehicle can be used to affect target cells. The recombinant virus particles are recovered from the culture medium and titrated by standard methods used by those skilled in the art. The recombinant lentiviral vehicle can be used to affect target cells. The recombinant virus particles are recovered from the culture medium and titrated by standard methods used by those skilled in the art. The recombinant lentiviral vehicle can be used to affect target cells.

[0130] Cells that can be used to produce high-titer lentiviral particles include HEK293T cells, 293G cells, STAR cells (Relander et al., Mol. Ther., 2005, 11:452-459), FreeStyle® 293 expression system (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 293G cells, STAR cells (Relander et al., Mol. Ther., 2005, 11:452-459), FreeStyle® 293 expression system (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 11:452-459), FreeStyle® 293 expression system (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 11:452-459), FreeStyle® 293 expression system (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 11:452-459), FreeStyle® 293 expression system (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety. 3):357-369; Lee et al., Biotechnol Bioeng, 2012, 109(96):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110), but are not limited thereto, and each of which is hereby incorporated by reference in its entirety.

[0131] In some embodiments, the envelope protein may be a heterologous envelope protein from another virus, such as the G protein of vesicular stomatitis virus (VSV G) or the baculovirus gp64 envelope protein. The VSV-G glycoprotein is from the genus Vesiculovirus: Carajas virus (CJSV), Chandipura virus (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Mara In some embodiments, the envelope protein may be a heterologous envelope protein from another virus, such as the G protein of vesicular stomatitis virus (VSV G) or the baculovirus gp64 envelope protein. The VSV-G glycoprotein is from the genus Vesiculovirus: Carajas virus (CJSV), Chandipura virus (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Mara In some embodiments, the envelope protein may be a heterologous envelope protein from another virus, such as the G protein of vesicular stomatitis virus (VSV G) or the baculovirus gp64 envelope protein. The VSV-G glycoprotein is from the genus Vesiculovirus: Carajas virus (CJSV), Chandipura virus (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Mara In some embodiments, the envelope protein may be a heterologous envelope protein from another virus, such as the G protein of vesicular stomatitis virus (VSV G) or the baculovirus gp64 envelope protein. The VSV-G glycoprotein is from the genus Vesiculovirus: Carajas virus (CJSV), Chandipura virus (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Mara (CHPV), Cocal virus (COCV), Isfahan virus (ISFV), Mara Maraba virus (MARAV), Piry virus (PIRYV), Araguaia virus of vesicular stomatitis (VSAV), Indiana virus of vesicular stomatitis (VSIV), and New Jersey virus of vesicular stomatitis (VSNJV), and / or species classified in the genus, and / or koi rhabdovirus, BeAn157575 virus (BeAn157575), Boteke virus (BTKV), CQIV virus, Eel rhabdovirus (EVA), Gray Lodge virus (GLOV), Jurona virus (JURY), Klamath virus (KLAV), Kwatta virus (KWAV), Rajoy virus (LJV), MSPV virus, Mount Elgon bat virus (MEBV), Perv virus (PERV), Pike fry rhabdovirus (PFRV), Port virus (PORV), Rady virus (RADIV), Spring viraemia of carp virus (SVCV), Tupaia virus (TUPV), Ulcerative disease rhabdovirus (UDR V), and species temporarily classified in the genus Betanodavirus such as Yug Bogdanova virus (YBV) may be particularly selected from. gp64 and other baculovirus en v proteins are Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), Anagrapha falcifera multiple nuclear polyhedrosis virus, Bom byx mori multiple nuclear polyhedrosis virus, Choristoneura fumifera na multiple nuclear polyhedrosis virus, Orgyia pseudotsugata single capsid multiple nuclear polyhedrosis virus, Epiphyas postvittana multiple nuclear polyhedrosis virus, multiple nuclear polyhedrosis virus of the American white moth, multiple nuclear polyhedrosis virus of the silkworm, Dolly viruses, such as the cytoplasmic polyhedrosis virus of Antheraea pemyi, and can be derived from batken virus.

[0132] Other elements provided to the lentiviral particle are either at the 5' or 3' end, a retroviral export element, optionally, a lentiviral response element (RRE), a promoter - or an active portion thereof, and a locus control region (LCR) or an active portion thereof, which may contain a retroviral long terminal repeat (LTR). The CA2 effector module is bound to the vector.

[0133] Methods for generating recombinant lentiviral particles are discussed in the art, for example, in U.S. Pat. Nos. 8, 846,385, 7,745,179, 7,629,153, 7,575, 924, 7,179,903, and 6,808,905, the contents of each of which are hereby incorporated by reference in their entirety.

[0134] Lentiviral vectors used may be selected from pLVX, pLenti, pLenti6, p LJM1, FUGW, pWPXL, pWPI, pLenti CMV puro DES T, pLJM1-EGFP, pULTRA, pInducer20, pHIV-EGFP , pCW57.1, pTRPE, pELPS, pRRL, and pLionII, but are not limited thereto.

[0135] Lentiviral vectors, including recently approved products such as tisagenlecleucel (KYMRIAH (registered trademark)) for relapsed / refractory B-cell lymphoma, are in preclinical studies. For clinical applications, it is used to introduce the transgene into T cells (e.g., primary human T cells or Jurkat cells). The VSV-G pseudotyped third-generation lentiviral vector provides high titers, high transduction efficiency, and safety, and has become the vector of choice for T cell manipulation. Although not wishing to be bound by theory, T cell manipulation typically involves activation of T cells with CD3 / CD 28 antibodies, followed by lentiviral transduction, and further followed by cell proliferation that can last from 5 to 30 days (e.g., 9 to 14 days or 9 to 15 days). Generally, integration of the lentiviral transgene may take longer than 7 days to be sufficiently stable in T cells (e.g., primary human T cells or Jurkat cells). In some embodiments, to determine the transgene expression kinetics, lentivirus carrying the transgene (e.g., IL15) can be transduced into CD3 / CD 28-activated primary human T cells. The cells can be analyzed by methods described herein and / or well known in the art with respect to viability, viral genome integration (e.g., using quantitative PCR), transcription level (e.g., using quantitative RT-PCR), and cell surface expression of the transgene. The cells can be analyzed after transduction,

[0136] prior to transduction and / or 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or more than 30 days after transduction, etc. As a non-limiting example, the cells can be analyzed between 3 and 14 days after transduction. For example, the cells can be analyzed between 3 and 14 days after transduction. prior to transduction and / or 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or more than 30 days after transduction, etc. As a non-limiting example, the cells can be analyzed between 3 and 14 days after transduction. At various time points (e.g., day 3, 4, 5, 6, 7, 8, 9, 10, 11, 1 2, 13, and / or 14), it may be analyzed. As a non-limiting example, cells may be analyzed 3 to 15 days after transduction. As a non-limiting example, cells may be analyzed 9 to 15 days after transduction.

[0137] In some embodiments, CD3 / CD28-activated primary human T cells can be reactivated by CD3 / CD28 beads after transduction. Cells may be reactivated 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 28, 29, 30 days or more than 30 days after transduction. Cells may be analyzed for viability, viral genome integration (e.g., using quantitative PCR), transcription level (e.g., using quantitative RT-PCR), cell surface expression of the transgene, copy number, and / or mR NA level, by methods described herein and / or well-known in the art.

[0138] In some embodiments, the cell viability of activated primary human T cells transduced with a lentivirus carrying a transgene is more than 65%, 70%, 75%, 80%, 85%, 9 0%, 95%, 97%, or 99%. As a non-limiting example, the cell viability is more than 90%. As a non-limiting example, the cell viability is more than 85%.

[0139] In some embodiments, the cell viability of activated primary human T cells transduced with a lentivirus carrying a transgene is The cell viability of the transfected cells is 65%, 70%, 75%, 80%, 85%, 90% , more than 95%, 97%, or 99%. As a non-limiting example, the cell viability is more than 90 %. As a non-limiting example, the cell viability is more than 85%.

[0140] In some embodiments, the integration of the transgene into the genome of the cell may be at or above the saturation point. As a non-limiting example, the saturation point may be 3 copies per cell .

[0141] In some embodiments, the integration of the transgene into the genome may be high at the initial point of evaluation and then decrease to a low integration value until it stabilizes during the remaining culture. As a non-limiting example, the integration of the transgene into the genome may increase to 20 copies per cell during the initial time point and then decrease to 2 copies per cell and stabilize throughout the remaining culture .

[0142] In some embodiments, the transduction of the T cell's ability may be evaluated. T cells from at least one donor may be transduced with a lentivirus containing a transgene at a dose predicted to reach the saturation level (e.g., sufficient virus such that each cell should contain a copy) and at a high lentivirus dose more than 5-fold above saturation. The copies per cell, percentage of cells, and MFI (or concentration of the transgene in the medium) may be detected to determine whether all cells are expressing the transgene . As a non-limiting example, T cells from two different donors may be transduced with a lentivirus containing a transgene. The transduction may be at saturation and 5-fold above saturation ​​​​​​​ There may be two doses, and 5 to 10 days after transduction, all groups may reach or exceed the predicted saturation level of the integrated transgene and similar expression intensities across the groups, but not all cells may be expressing the transgene. Even when provided from the same donor, not all T cells may have equal transduction susceptibility. The proportion of all cells expressing GFP (above the detection threshold) may vary depending on the donor, lot, and / or viral dose.

[0143] In some embodiments, a certain proportion of cultured T cells (e.g., primary human T cells and / or Jurkat cells) may express the transgene. The proportion of cultured T cells expressing the transgene may be 5%, 10%, 15%, 20%, 25%, 30%, 35% %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%

[0144] In some embodiments, the mRNA levels in the culture may decrease during the course of the study. The decrease may not be limited to a particular transgene, and the trend may be related to the complexity of the expressed protein. can be observed across several classes of numbers. To increase the mRNA level, the cell may be reactivated after the mRNA level has decreased from the initial level. The cell may be reactivated 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or more than 30 days after transduction. As a non-limiting example, to increase the mRNA level in the culture, the cell may be reactivated with CD3 / CD28 beads for 1 to 3 days after transduction. As a non-limiting example, to increase the mRNA level in the culture the cell may be reactivated with CD3 / CD 28 beads for 14 days after transduction. As a non-limiting example, to increase the mRNA level in the culture the cell may be reactivated with CD3 / CD28 beads for 15 days after transduction .

[0145] In some embodiments, the surface expression of the culture may decrease during the course of the study. For example, the surface expression may decrease between 3 to 13 days, 3 to 14 days, or 3 to 15 days after transduction . To increase the surface expression, the cell may be reactivated after the surface expression has decreased from the initial level . The cell may be reactivated 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days , 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days , 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or more than 30 days after transduction. As a non-limiting example, to increase the surface expression in the culture the cell may be reactivated with CD3 / CD28 beads for 13 days after transduction This is acceptable. As a non-limiting example, to increase surface expression in culture, cells may be reactivated with CD3 / CD28 beads 14 days after transduction. As a non-limiting example to increase surface expression in culture, cells may be reactivated with CD3 / CD28 beads 15 days after transduction.

[0146] In some embodiments, the transgene is IL15 (e.g., a membrane-bound IL15 payload when combined with other effector module components as described in Table 3). Cell viability may be greater than 90% in cells transduced with IL15. Cell viability may be greater than 85% in cells transduced with IL15. When the cells are primary T cells transduced with IL15, the number of viable cells may increase over the initial time point and then decrease. When the cells are Jurkat cells transduced with IL15, the number of viable cells may increase for at least 10 days. The copy number per cell for cells transduced with IL15 may be higher at the initial time point and decrease by 50% or more at later time points. For primary human T cells transduced with IL15, the level of soluble IL15 in the medium may show a slight increase in the restimulated group, but may steadily decline over the course of the study. For Jurkat cells transduced with IL15, the level of soluble IL15 in the medium may show a decrease in IL15 secretion in the first half of the culture and may remain low throughout the second half of the culture time.

[0147] In some embodiments, the lentivirus-engineered cells described herein are Stabilize after the initial decrease in copy number, with RNA and surface expression levels decreasing over time, and re-stimulation has genomic DNA integration, where RNA and surface expression increase after re-stimulation.

[0148] In some embodiments, the lentivirus-engineered cells may be evaluated using the following 14-day method where the sample is collected 5-fold through culture - On day -1, T cells (e.g., , primary human T cells or Jurkat cells) may be thawed and CD3 / CD28 beads are added. On day 0, lentivirus is added for each condition (e.g., 4 mL of cells at 0. 5e6 / mL), and control non-transduced cells are present. On day 1, the medium is made 2-fold to 8 mL, and on day 2, the medium is made 2-fold to 16 mL. On day 3, 4 mL is harvested, and on day 4 the medium is made 2-fold to 24 mL. After harvesting 4 mL on day 6, the medium is made 2-fold to 40 mL . The cells can be split on day 8 (e.g., 14 mL of 0.5e6 cells / mL), followed by harvesting 4 mL on day 6 and making the medium 2-fold to 40 mL. After harvesting 4 mL on day 10 the medium may be made 2-fold to 20 mL. On day 13, after harvesting 4 mL, the medium is made 2-fold to 32 mL. The culture is split in half, and half of the culture is activated overnight (CD3 / CD28 activation beads 1:1) and stimulated. On day 14, 4 mL of each stimulated and unstimulated cells are harvested and the culture is terminated. The copy number of the transgene per cell is assayed by harvesting the cells, extracting genomic DNA, and then quantifying by standard curve qPCR against the endogenous genome and against the transgene sequence, and then converting the detected quantity to a ratio The mean fluorescence intensity (MFI) is determined for each group by an appropriate staining method Assayed by FLO in Attune. The percentage to be expressed may also be quantified by FLO in Attune by quantifying the percentage of cells that emit fluorescence above the threshold. Assayed by FLO in Attune, which may quantify the percentage of cells that emit fluorescence above the threshold. The soluble payload can be quantified by collecting the culture supernatant at each marked time point and performing a Meso Scale Discovery plate assay (MSD) to normalize it with respect to cell density. The soluble payload can be quantified by collecting the culture supernatant at each marked time point and performing a Meso Scale Discovery plate assay (MSD) to normalize it with respect to cell density. In some embodiments, the CA2 effector module of the present disclosure may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo.

[0149] In some embodiments, the CA2 effector module of the present disclosure may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. In some embodiments, the CA2 effector module of the present disclosure may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. In some embodiments, the CA2 effector module of the present disclosure may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. In some embodiments, the CA2 effector module of the present disclosure may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. In some embodiments, the CA2 effector module of the present disclosure may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo.

[0150] The present disclosure provides a method comprising administering any one or more of the components of the CA2 bio-circuit system to a subject in need thereof. These may be administered to the subject by any amount and by any route that is effective in preventing or treating a disease, disorder, and / or disease (e.g., a disease, disorder, and / or disease associated with working memory deficit). The exact amount needed varies depending on the subject's species, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. The present disclosure provides a method comprising administering any one or more of the components of the CA2 bio-circuit system to a subject in need thereof. These may be administered to the subject by any amount and by any route that is effective in preventing or treating a disease, disorder, and / or disease (e.g., a disease, disorder, and / or disease associated with working memory deficit). The exact amount needed varies depending on the subject's species, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. The present disclosure provides a method comprising administering any one or more of the components of the CA2 bio-circuit system to a subject in need thereof. These may be administered to the subject by any amount and by any route that is effective in preventing or treating a disease, disorder, and / or disease (e.g., a disease, disorder, and / or disease associated with working memory deficit). The exact amount needed varies depending on the subject's species, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. The present disclosure provides a method comprising administering any one or more of the components of the CA2 bio-circuit system to a subject in need thereof. These may be administered to the subject by any amount and by any route that is effective in preventing or treating a disease, disorder, and / or disease (e.g., a disease, disorder, and / or disease associated with working memory deficit). The exact amount needed varies depending on the subject's species, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. The present disclosure provides a method comprising administering any one or more of the components of the CA2 bio-circuit system to a subject in need thereof. These may be administered to the subject by any amount and by any route that is effective in preventing or treating a disease, disorder, and / or disease (e.g., a disease, disorder, and / or disease associated with working memory deficit). The exact amount needed varies depending on the subject's species, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. The present disclosure provides a method comprising administering any one or more of the components of the CA2 bio-circuit system to a subject in need thereof. These may be administered to the subject by any amount and by any route that is effective in preventing or treating a disease, disorder, and / or disease (e.g., a disease, disorder, and / or disease associated with working memory deficit). The exact amount needed varies depending on the subject's species, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc.

[0151] In some embodiments, the present disclosure provides control in a subject in need thereof. A method of treating a disease or disorder responsive to IL15, comprising: (a) administering to a subject a therapeutically effective amount of a nucleic acid molecule, vector, recombinant protein, cell, or pharmaceutical composition of the present disclosure; and (b) administering to the subject a therapeutically effective amount of a stimulant, wherein the DRD responds to the stimulant and the expression of the IL15 payload is regulated in response to the stimulant. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide .

[0152] In some embodiments, the present disclosure provides a method of treating a malignant tumor that expresses a tumor-associated antigen in a subject in need thereof, comprising: (a) administering to the subject a therapeutically effective amount of a polynucleotide encoding a CAR or TCR, or a pharmaceutical composition thereof, and a therapeutically effective amount of a human T cell or human NK cell of the present disclosure, wherein the CAR or TCR comprises an antigen-binding domain specific for the tumor-associated antigen; and (b) administering to the subject a therapeutically effective amount of a stimulant, wherein the CA2 DRD responds to the stimulant and the expression of the IL15 payload is regulated in response to the stimulant. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant is acetazolamide, celecoxib, valdecoxib, ​​​​is selected. In some embodiments, the stimulant administered to the subject is acetazol amide.

[0153] In some embodiments, the present disclosure provides a method of treating a malignant tumor in a subject in need thereof, comprising: (a) administering to the subject a therapeutically effective amount of the human TILs of the present disclosure; and (b) administering to the subject a therapeutically effective amount of a stimulant, wherein CA2 DRD responds to the stimulant and the expression of the IL15 payload is regulated in response to the stimulant. In some embodiments, the stimulant is selected from acetazolamide, celecoxib, baldecozib, rofecoxib, methazolamide, dorzolamide, brinzolamide, dichlorphenamide, ethoxzolamide, zonisamide, dansylamide, or dichlorphenamide. In some embodiments, the stimulant

[0154] administered to the subject is acetazolamide. Compositions according to the present disclosure are typically formulated in unit dosage form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage of the compositions of the present disclosure will be within the purview of a medical doctor, within the scope of sound medical judgment. It will be further understood that the specific therapeutically effective, prophylactically effective, or suitable imaging dosage level for any particular patient will depend upon the disorder being and are determined by various factors, including similar factors well-known in the medical field.

[0155] The compositions of the present disclosure may be used in various dosages to avoid T cell anergy, prevent cytokine release syndrome, and minimize toxicity associated with immunotherapy. For example, low dosages of the compositions of the present disclosure may be used to treat patients with high tumor burden at the beginning of the disease. On the other hand, patients with low tumor burden may be treated with high dosages and continuous dosages of the compositions of the present disclosure, ensuring that a minimal tumor antigen load is recognized. In another example, the compositions of the present disclosure may be delivered pulsatilely, reducing tonic T cell signaling and enhancing in vivo persistence. In some embodiments, toxicity may be minimized by first using a low dosage prior to administering the compositions of the present disclosure at a high dosage. Administration may be modified when serum markers such as ferritin, serum C-reactive protein, IL6, IFN-γ, and TNF-α increase. Prior to administering the compositions of the present disclosure at a high dosage, toxicity may be minimized by first using a low dosage. Administration may be modified when serum markers such as ferritin, serum C-reactive protein, IL6, IFN-γ, and TNF-α increase.

[0156] Also provided herein is a method of administering a ligand according to the present disclosure to a subject in need thereof. The ligand may be administered to the subject or cells by any amount and by any route of administration effective to modulate the CA2 biocircuit of the present disclosure. The exact amount needed will vary from subject to subject depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. The subject may be human, mammalian, or animal. The compositions according to the present disclosure are typically formulated in unit dosage form for ease of administration and uniformity of dosage. However, the total daily amount of the compositions of the present disclosure It is understood that the dosage can be determined by the attending physician within the scope of correct medical judgment. In certain embodiments, the ligand according to the present disclosure is administered to the subject per day per kg of body weight, once or multiple times a day, in an amount of about 0.0001 mg / kg to about 100 mg / kg, about 0.001 mg / kg to about 0.05 mg / kg, about 0.005 mg / kg to about 0.05 mg / kg, about 0.001 mg / kg to about 0.005 mg / kg, about 0.05 mg / kg to about 0.5 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0 .01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 25 mg / kg, about 10 mg / kg to about 100 mg / kg, about 50 m g / kg to about 500 mg / kg, about 100 mg / kg to about 1000 mg / kg to achieve a sufficient dosage level for delivery. In some embodiments, the dosage level is per day per subject per kg of body weight, or once or multiple times a day, in an amount of 1 mg / kg, 5 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / k g, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / k g, 90 mg / kg, 100 mg / kg, 100 mg / kg, 110 mg / kg, 120 mg / kg, 130 mg / kg, 140 mg / kg, 150 mg / kg, 160 mg / k g, 170 mg / kg, 180 mg / kg, 190 mg / kg or mg / kg may be used.

[0157] The present disclosure is a method for delivering any of the ligands described herein to cells or tissues. comprising the step of contacting the cell or tissue with the ligand, and can be performed in vitro, ex vivo, or in vivo. In certain embodiments the ligand according to the present disclosure is from about 1 nM to about 10 nM, from about 5 nM to about 50 nM, from about 10 nM to about 100 nM, from about 50 nM to about 500 nM, from about 100 nM to about 1000 nM, from about 1 μM to about 10 μM, from about 5 μM to about 50 μM, from about 10 μM to about 100 μM, from about 25 μM to about 250 μM, from about 50 μM to about 500 μM, and can be administered to the cell at a dosage level sufficient to deliver it. In some embodiments, the ligand can be administered to the cell at a dosage selected from, but not limited to, 0.00064 μM, 0.0 032 μM, 0.016 μM, 0.08 μM, 0.4 μM, 1 μM, 2 μM, 10 μM, 50 μM, 75 μM, 100 μM, 150 μM, 175 μM, 200 μM, 250 μM but not limited thereto.

[0158] The desired dosage of the ligand of the present disclosure can be delivered only once, three times a day, twice a day, once a day, every other day, every three days, weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage can be delivered by multiple administrations (e.g., 2, 3, 4, 5, 6 7, 8, 9, 10, 11, 12, 13, 14, or more administrations). When multiple administrations are used, a divided dosing regimen as described herein can be used. As used herein, "divided dosage" means dividing the "single unit dosage" or the total daily dosage into two or more administrations, e.g., administering the "single unit dosage" in two or more doses. As used herein, "single unit dosage" means one administration / one dose per degree / single path / single contact, i.e., any therapeutic agent administered in a single dosing event dose. The desired dosage of the ligands of the present disclosure may be administered as a "pulse dose" or as a "continuous flow". As used herein, a "pulse dose" is a series of single unit doses of any therapeutic agent administered at a set frequency over a period of time. As used in this specification, "continuous flow" is the dosage of a therapeutic agent that is continuously administered over a period of time at a single path / single contact, i.e., in a continuous dosing event. The total daily dose, the amount given or prescribed over 24 hours, may be administered by any of these methods, or as a combination of these methods, or by any other method suitable for drug administration as may be.

[0159] In some embodiments, the composition for immunotherapy may be administered to cells ex vivo and then administered to a subject. Immune cells can be isolated and expanded ex vivo using a variety of methods known in the art. For example, methods for isolating cytotoxic T cells are described in U.S. Pat. Nos. 6,805,861 and 6,531,451 each of which is incorporated herein by reference in its entirety. Isolation of NK cells is described in U.S. Pat. No. 7,435,596, the content of which is incorporated herein by reference in its entirety.

[0160] In some embodiments, depending on the nature of the cells, the cells may be introduced into a host organism, e.g., a mammal, in a variety of ways including injection, transfusion, infusion, local dropwise or transplantation. In some aspects, the cells described herein may be introduced into the . The number of cells used is determined by a number of factors, including the context, the purpose of introduction, the lifespan of the cells, the protocol used, for example, the number of administrations, the proliferative capacity of the cells, etc. The cells may be in a physiologically acceptable medium. In some embodiments, the cells described herein may be administered to a subject having a disease or disorder in multiple administrations. The administration typically results in the improvement of one or more symptoms of cancer and / or the treatment or prevention of cancer or the disorder or its symptoms.

[0161] In some embodiments, the composition for immunotherapy may be administered in vivo. In some embodiments, the CA2 biocircuit, CA2 effector molecule, SRE, payload (IL15) of the present disclosure, and the polypeptide of the present disclosure comprising the composition may be delivered to a subject in vivo. The in vivo delivery of immunotherapeutic agents is well described technically. For example, the method of cytokine delivery is described in European Patent No. EP0930892A1, the content of which is incorporated herein by reference.

[0162] The pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE (e.g., CA2 DRD), payload (e.g., IL15), vector, and cells of the present disclosure may be administered by any route and may result in a therapeutic effect.

[0163] The pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure may be administered by any route and may result in a therapeutic effect.

[0164] The pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure may be administered by any route and may result in a therapeutic effect. ​​​​​​​​​​​​​The o circuit component, the CA2 effector module, may be administered by any route and may result in a therapeutic effect. These include enteral (into the intestine), gastrointestinal, epidural (into the dura mater), oral (via the mouth), transdermal, peridural, intracerebral (into the cerebrum), intraventricular (into the ventricles), topical (application to the skin), intradermal (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into the vein), rapid intravenous injection, intravenous drip, intraarterial (into the artery), intramuscular (into the muscle), intracardiac (into the heart), intraosseous injection (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal (injection or infusion into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavernosal injection (into the diseased cavity), intracavitary (into the base of the penis), intravaginal administration, intrauterine, extraamniotic administration, transdermal (diffusion through intact skin for systemic distribution), transmucosal (diffusion through the mucosa), transvaginal, insufflation (aspiration through the nose), sublingual, sublabial, enema, eye drops (onto the conjunctiva), otic, via the auricle (into or through the ear), buccal (directed towards the cheek), conjunctival, cutaneous, dental (to one or more teeth), iontophoresis, endocervical, intracavitary, intratracheal, extracorporeal, hemodialysis, infiltration, interstitial, intraperitoneal, intraamniotic, intraarticular, intrahepatic, intrapulmonary, intrabursal, intracartilaginous (inside the cartilage), intrasacral (inside the cauda equina), intracisternal (inside the cisterna magna cerebellomedularis), intracorneal (inside the cornea), intracoronal (dental intracoronal), intracoronary (inside the coronary artery), intracavernosal (inside the expansile space of the corpus cavernosa of the penis), intradiscal (inside the intervertebral disc), intraductal (inside the gland duct) The following may be mentioned as having a therapeutic effect. These include enteral (into the intestine), gastrointestinal, epidural (into the dura mater), oral (via the mouth), transdermal, peridural, intracerebral (into the cerebrum), intraventricular (into the ventricles), topical (application to the skin), intradermal (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into the vein), rapid intravenous injection, intravenous drip, intraarterial (into the artery), intramuscular (into the muscle), intracardiac (into the heart), intraosseous injection (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal (injection or infusion into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavernosal injection (into the diseased cavity), intracavitary (into the base of the penis), intravaginal administration, intrauterine, extraamniotic administration, transdermal (diffusion through intact skin for systemic distribution), transmucosal (diffusion through the mucosa), transvaginal, insufflation (aspiration through the nose), sublingual, sublabial, enema, eye drops (onto the conjunctiva), otic, via the auricle (into or through the ear), buccal (directed towards the cheek), conjunctival, cutaneous, dental (to one or more teeth), iontophoresis, endocervical, intracavitary, intratracheal, extracorporeal, hemodialysis, infiltration, interstitial, intraperitoneal, intraamniotic, intraarticular, intrahepatic, intrapulmonary, intrabursal, intracartilaginous (inside the cartilage), intrasacral (inside the cauda equina), intracisternal (inside the cisterna magna cerebellomedularis), intracorneal (inside the cornea), intracoronal (dental intracoronal), intracoronary (inside the coronary artery), intracavernosal (inside the expansile space of the corpus cavernosa of the penis), intradiscal (inside the intervertebral disc), intraductal (inside the gland duct) The following may be mentioned as having a therapeutic effect. These include enteral (into the intestine), gastrointestinal, epidural (into the dura mater), oral (via the mouth), transdermal, peridural, intracerebral (into the cerebrum), intraventricular (into the ventricles), topical (application to the skin), intradermal (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into the vein), rapid intravenous injection, intravenous drip, intraarterial (into the artery), intramuscular (into the muscle), intracardiac (into the heart), intraosseous injection (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal (injection or infusion into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavernosal injection (into the diseased cavity), intracavitary (into the base of the penis), intravaginal administration, intrauterine, extraamniotic administration, transdermal (diffusion through intact skin for systemic distribution), transmucosal (diffusion through the mucosa), transvaginal, insufflation (aspiration through the nose), sublingual, sublabial, enema, eye drops (onto the conjunctiva), otic, via the auricle (into or through the ear), buccal (directed towards the cheek), conjunctival, cutaneous, dental (to one or more teeth), iontophoresis, endocervical, intracavitary, intratracheal, extracorporeal, hemodialysis, infiltration, interstitial, intraperitoneal, intraamniotic, intraarticular, intrahepatic, intrapulmonary, intrabursal, intracartilaginous (inside the cartilage), intrasacral (inside the cauda equina), intracisternal (inside the cisterna magna cerebellomedularis), intracorneal (inside the cornea), intracoronal (dental intracoronal), intracoronary (inside the coronary artery), intracavernosal (inside the expansile space of the corpus cavernosa of the penis), intradiscal (inside the intervertebral disc), intraductal (inside the gland duct) ​​​​​​​​​​​​​​​​ within, within the duodenum (inside the duodenum), within the dura mater (inside or beneath the dura mater), within the epidermis (in the epidermis), within the esophagus (in the esophagus), within the stomach (inside the stomach), within the gingiva (inside the gingiva), within the ileum (intraileal) (inside the distal part of the small intestine), within the lesion (inside the local lesion or directly introduced into the local lesion), within the lumen (inside the lumen of a tube), within the lymph (inside the lymph), within the medulla (inside the medullary cavity of a bone), within the meninges (inside the meninges), within the myocardium (inside the myocardium), within the eye (inside the eye), within the ovary (inside the ovary), within the pericardium (inside the pericardium), within the pleura (inside the pleura), within the prostate (inside the prostate), within the lung (inside the lung or its bronchi), within the nasal cavity (i ntrasinal) (inside the nose or the periorbital sinuses), within the spinal cord (inside the spinal column), within the joint synovial bursa (inside the synovial cavity of a joint), within the tendon (inside the tendon), within the testis (inside the testis), also within the subarachnoid space (inside the cerebrospinal fluid at any level of the cerebrospinal axis), within the thoracic cavity (inside the chest (inside the thoracic cavity), within the duct (inside the fine ducts of an organ), within the tumor (inside the tumor), within the tympanic cavity (inside the middle ear (auru s media)), within the blood vessel (inside one or more blood vessels), within the ventricle (inside the ventricle ), iontophoresis (using an electric current in which ions of a soluble salt move into the body's tissues) , perfusion (immersing or flowing into an open wound or body cavity), larynx (directly to the larynx), nasogastric (through the nose and into the stomach), occlusive dressing therapy (covered with a dressing material that closes the area following local route administration ), eye (to the outer eye), oropharynx (directly to the mouth and pharynx), parenteral, percutaneous (perc utaneous), perijoint, epidural (peridural), perineural, periodontal, rectum , respiration (by oral or nasal inhalation for local or systemic effects ), into the path, behind the eyeball (behind the bridge or behind the eyeball), into the myocardium (entering the myocardium), soft tissue , subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), via the trachea (through the wall of the trachea), into the tympanic membrane (across or through the tympanic cavity), into the ureter (into the ureter ), into the urethra (into the urethra), vagina, sacral block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis, or the spinal cord, including but not limited to these.

[0165] In some embodiments, pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules comprising the SRE or payload of the present disclosure may be administered parenterally. Liquid dosage forms for oral and parenteral administration may include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and / or elixirs, including but not limited to these. In addition to the active ingredient, liquid dosage forms may contain, for example , water and other solvents; ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate , benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 - butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, germ, olive , castor, sesame oils), glycerol, tetrahydrofurfuryl alcohol, solubilizing and emulsifying agents such as polyethylene glycol and fatty acid esters of sorbitan; and inert diluents commonly used in the art such as these, and mixtures thereof. In addition to the inert diluent, oral compositions may contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and / or aromatic agents. For parenteral administration it may contain inert diluents such as water, saline, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents, antibacterial agents such as benzyl alcohol or methyl paraben, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, buffers such as acetates, citrates or phosphates and agents for adjusting tonicity such as sodium chloride or dextrose. Intravenous formulations may further contain suitable carriers such as polyvinylpyrrolidone. Liposomal formulations may be used to encapsulate the active ingredient. The pharmaceutical compositions may be formulated to be isotonic with the blood. The pharmaceutical compositions may be sterilized by conventional sterilization techniques or may be sterile filtered. The resulting aqueous solutions may be packaged for use as such or lyophilized, and the lyophilized preparation may be combined with a suitable solvent just prior to use to form a liquid preparation can include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, In certain embodiments, the composition is mixed with solubilizing agents such as CREMOPHOR®, alcohol, oil , modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or a combination thereof. In other embodiments, surfactants such as hydroxypropyl cellulose are included.

[0166] Injectable formulations, for example, sterile intravenous administration formulations or aqueous or oily injection suspensions, may be formulated according to known techniques using suitable dispersing agents, wetting agents, and / or suspending agents. Sterile injectable formulations may be, for example, solutions in 1,3 - butanediol, sterile injectable solutions, suspensions, and / or emulsions in non - toxic parenterally acceptable diluents and / or solvents. Acceptable vehicles and solvents that may be used are water, Ringer's solution, U.S.P., and isotonic saline. Sterile fixed oils have been used heretofore as solvents or suspending agents. For this purpose, any sterile fixed oil containing synthetic mono - or diglycerides can be used. Fatty acids such as oleic acid can be used in the preparation of injection solutions.

[0167] Injectable formulations can be sterilized, for example, by filtration through a bacteria - retaining filter and / or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water for injection or other sterile injectable media prior to use.

[0168] The CA2 bio - circuit, CA2 effector module, SRE, stimulant, composition of the present disclosure, or one or more of the stimulant, CA2 bio - circuit, CA2 effector module Systems comprising may be used in a variety of applications including therapies, diagnosis and prognosis, bioengineering, bioprocessing, biofactories, research agents, metabolomics, gene expression, enzyme replacement, and the like, but are not limited thereto. In accordance with the present disclosure, CA2-IL15 biocircuits and systems may be used in the development and implementation of cell therapies such as adoptive cell therapy. CA2-IL15 biocircuits and systems may be used to effect CAR T cell therapy, T cell receptor (TCR) cell therapy, CAR NK cell

[0169] therapy, TCR NK cell therapy, TIL therapy, and any of them may be used in combination therapy with other treatment lines (e.g., radiation, cytokines). In some embodiments, the CA2-IL15 biocircuits and systems may be used to engineer immune cells including T cells such as CD8 T cells and CD4 T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTLs), tumor infiltrating lymphocytes (TILs), lymphokine activated killer (LAK) cells, memory T cells, regulatory T cells (Tregs), helper T

[0170] cells, cytokine induced killer (CIK) cells, and any combination thereof. In other embodiments, the CA2-IL15 bi 8 + circuits and systems may be used to engineer immune stimulatory cells generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) that may be used for ACT. In some embodiments, the CA2-IL15 biocircuits and systems may be used for A + In some embodiments, the CA2-IL15 biocircuits and systems may be used to engineer immune cells including T cells such as CD8 T cells and CD4 T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTLs), tumor infiltrating lymphocytes (TILs), lymphokine activated killer (LAK) cells, memory T cells, regulatory T cells (Tregs), helper T cells, cytokine induced killer (CIK) cells, and any combination thereof. In other embodiments, the CA2-IL15 bi circuits and systems may be used to engineer immune stimulatory cells generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) that may be used for ACT. In some embodiments, the CA2-IL15 biocircuits and systems may be used for A In some embodiments, the CA2-IL15 biocircuits and systems may be used to engineer immune cells including T cells such as CD8 It may be used to engineer autologous or allogeneic immune cells that can be used for CT. In some embodiments, the CA2-IL15 biocircuit and system may be used to engineer T cells, TIL, or NK cells. In some embodiments the immune cells are NK cells derived from umbilical cord blood, iPSC, or peripheral blood mononuclear cells.

[0171] In some embodiments, the cells engineered by CA2-IL15 used for ACT may be T cells engineered to express a CAR or TCR containing an antigen-binding domain specific for an antigen in the target's tumor cells. In other embodiments the cells engineered by CA2-IL15 used for ACT may be NK cells engineered to express a CAR or TCR containing an antigen-binding domain specific for an antigen in the target's tumor cells. In some embodiments, the cells engineered by CA2-IL15 used for ACT may be a mixture of T cells and NK cells, either or both of which may express a CAR or TCR. In some embodiments, the cells engineered by CA2-IL15 used for ACT may be a mixture of T cells and NK cells, either or both of which may express a CAR or TCR. A chimeric antigen receptor (CAR), when introduced into the phenotype of immune cells (e.g., T cells and NK cells), can redirect the immune cells against a target (e.g.,

[0172] a tumor cell) that expresses a molecule recognized by the extracellular targeting portion of the CAR. As used herein, the term " chimeric antigen receptor (CAR)" refers to a synthetic receptor that mimics a TCR on the surface of a T cell. Generally, a CAR consists of an extracellular targeting domain, a transmembrane domain / region, and an intracellular signaling / activation domain. In a standard CAR receptor, the extracellular portion mimics a TCR on the surface of a T cell. Generally, a CAR consists of an extracellular targeting domain, a transmembrane domain / region, and an intracellular signaling / activation domain. In a standard CAR receptor, the extracellular portion mimics a TCR on the surface of a T cell. Generally, a CAR consists of an extracellular targeting domain, a transmembrane domain / region, and The target domain, transmembrane domain, and intracellular signaling / activation domain are linearly configured as a single fusion protein. The extracellular region contains a target domain / portion (e.g., scFv ) that recognizes a specific tumor antigen (e.g., tumor neoantigen) or other tumor cell surface molecules. The intracellular region contains the intracellular signaling domain (immunoreceptor tyrosine-based activation motif) of the TCR complex (e.g., the signaling region of CD3ζ), as well as / and one or more costimulatory signaling domains from CD28, 4-1BB (CD137), and OX-40 (CD134) may be included. When expressed by T cells or NK cells, CAR confers antigen specificity determined by the extracellular target portion of CAR on T cells or NK cells.

[0173] In some embodiments, the extracellular target domain is linked to the intracellular signaling domain through a hinge (also called a spacer or spacer region) and a transmembrane region. The hinge connects the extracellular target domain to the transmembrane domain that traverses the cell membrane and is connected to the intracellular signaling domain. The hinge may need to be modified to optimize the efficacy of the CAR-expressing cells on cancer cells depending on the size of the target protein to which the target portion binds, as well as the size and affinity of the target domain itself. When the target portion is recognized and binds to the target cell, the intracellular signaling domain induces an activation signal in CAR T cells or CAR NK cells, which is further amplified by a "second signal" from one or more intracellular costimulatory domains. Once activated, CAR T cells or CAR NK cells can destroy the target cells. ​​​​​​​​​

[0174] In some embodiments, the disclosure provides immune cells that include a CA2-IL15 effector module and further include a chimeric antigen receptor (CAR). The CAR may be controlled by DRD or may be constitutively expressed. In some embodiments , the CAR is constitutively expressed.

[0175] In some embodiments, the constitutively expressed or controlled CAR, and the CA2-IL15 effector module are encoded in different vectors. In some embodiments, a single vector includes both the CA2-IL15 effector module and the constitutively expressed or controlled CAR and forms a tandem construct. The CA2-IL15 effector module and the CAR may be separated from each other by an internal ribosome entry site (IRES); a ribosome skipping sequence 2A peptide selected from foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), porcine teschovirus-1 2A (P2A), or Thosea asigna virus 2A (T2A); or other ribosome skipping sequences or ribosome entry sequences, resulting in a bicistronic construct. In some embodiments, the 2A sequence is the P2A sequence. The IRES, 2 A sequence, or other ribosome skipping sequences or ribosome entry sequences cause the expression of upstream and downstream sequences to be expressed as two independent polypeptides . In some embodiments, a single vector, in order, includes a sequence encoding the CAR, a sequence encoding the CA2-IL15 effector module, and an IRES, 2A sequence, or other ribosome skipping sequence or ribosome entry sequence between the two sequences to cause the expression of the upstream and downstream sequences as two independent polypeptides. In some embodiments, a single vector includes, in order, a sequence encoding the CAR, a sequence encoding the CA2-IL15 effector module, and an IRES, 2A sequence, or other ribosome skipping sequence or ribosome entry sequence between the two sequences to cause the expression of the upstream and downstream sequences as two independent polypeptides. In some embodiments, a single vector includes, in order, a sequence encoding the CAR, a sequence encoding the CA2-IL15 effector module, and an IRES, 2A sequence, or other ribosome skipping sequence or ribosome entry sequence between the two sequences . In some embodiments, a single vector includes, in order, a sequence encoding the CAR, It includes a P2A sequence and a sequence encoding a CA2-IL15 effector module. The sequence encoding the CAR may be either 5' or 3' of the sequence encoding the CA2-IL15 effector module.

[0176] When a T cell receptor (TCR) is transduced into immune cells (e.g., T cells and NK cells), it can redirect the immune cells towards a target (e.g., a tumor cell) that expresses a molecule recognized by the TCR. The TCR is a molecule that includes variable α and β chains (also known as TCRα and TCRβ, respectively) or variable γ and δ chains (also known as TCRγ and TCRδ, respectively), or an antigen-binding portion or fragment thereof that specifically binds to a peptide bound to an MHC molecule. In some embodiments, the TCR is TCRαβ. Generally, TCRs are typically found on the surface of T cells that are responsible for recognizing antigens bound to major histocompatibility complex (M HC) molecules. As used herein, the term TCR includes not only the antigen-binding portion or antigen-binding fragment thereof, but also the complete TCR. In some embodiments, the TCR is a full-length TCR that includes both the α and β chains. In some embodiments, the TC

[0177] R is the antigen-binding portion or fragment of the TCR that binds to a specific peptide bound in an MHC molecule, e.g., a part of each of the α and β chains. In some embodiments, the antigen-binding portion or fragment includes the variable domains of the TCR, such as the variable α (Vα) chain and variable β (Vβ) chain, which are sufficient to bind to a specific MHC-peptide complex. In some embodiments, the antigen-binding portion or fragment includes the variable domains of the TCR, such as the variable α (Vα) chain and variable β (Vβ) chain, which are sufficient to bind to a specific MHC-peptide complex. In some embodiments, the antigen-binding portion or fragment includes the variable domains of the TCR, such as the variable α (Vα) chain and variable β (Vβ) chain, which are sufficient to bind to a specific MHC-peptide complex.

[0178] The variable domains of the TCR mainly contribute to MHC-peptide antigen recognition, binding, and specificity and contain complementarity-determining regions (CDRs). The CDRs within the variable regions of the TCR chains are typically separated by framework regions (FRs) that are less variable than the CDRs. In some embodiments, one or more CDRs of the TCR form all or substantially all of the antigen binding site of a given TCR molecule. In some embodiments, CDR3 is the major CDR responsible for antigen binding or specificity and the interaction with the processed peptide portion of the peptide-MHC complex.

[0179] The α- and β-chains of the TCR may include constant domains, transmembrane domains, and short cytoplasmic tails. The cytoplasmic tail of the TCR firmly anchors the protein in the cell membrane and associates there with invariant subunits of the CD3 complex that are involved in the signaling capacity of the TCR complex.

[0180] In some embodiments, the present disclosure provides CAR T cells or TCR T cells that are "armed" with a CA2-IL15 effector module and improve the efficacy and persistence of engineered cells.

[0181] In some embodiments, the present disclosure provides CAR NK cells or TCR NK cells that are "armed" with a CA2-IL15 effector module and improve the efficacy and persistence of engineered cells, or prevent immune exhaustion and aging.

[0182] In some embodiments, the present disclosure provides a CA2-IL15 effector module Provided are TILs that are engineered and that improve the efficacy and persistence of the engineered cells.

[0183] In some embodiments, the cells of the disclosure may be autologous, allogeneic, syngeneic, or xenogeneic in relation to a particular individual subject. In some embodiments, the cells of the disclosure may be mammalian cells, particularly human cells. The cells described herein may be primary cells or immortalized cell lines.

[0184] Cancer immunotherapy aims to induce or restore the responsiveness of the immune system to cancer. Adoptive cell therapy is a form of active immunotherapy that aims to induce an endogenous and persistent tumor antigen-specific immune response. The response can be enhanced by non-specific stimulation of immune response modifiers such as cytokines, but cytokine stimulation can cause toxicity or immune exhaustion.

[0185] Despite significant progress, the efficacy of current immunotherapy strategies is limited by the associated toxicity. These are, in part, related to the narrow therapeutic window of immunotherapy, which becomes apparent from the need to push therapeutic doses to the brink of potentially lethal toxicity in order to obtain clinically meaningful treatment efficacy. Further, the dose expands in vivo because adoptively transferred immune cells often unexpectedly continue to expand rapidly in the patient's body.

[0186] A major risk associated with immunotherapy is off-target, but tumor-extrinsic side effects resulting from T cell activation in response to normal tissue expression of tumor-associated antigens (TAAs).

[0187] Immunotherapy is on-target, tumor-on, when tumor cells die in response to immunotherapy. It may also cause toxicity. The adverse effects include tumor lysis syndrome, cytokine release syndrome , and related macrophage activation syndrome. Importantly, these adverse effects may occur during tumor destruction, thus toxicity may result even if immunotherapy on the tumor is successful. Therefore, an approach to controllably manage immunotherapy is highly desirable as it has the potential to reduce toxicity and maximize efficacy.

[0188] The present disclosure provides systems, compositions, immunotherapeutic agents, and methods for cancer immunotherapy. These compositions provide controllable regulation of gene expression and function in immunotherapy. The present disclosure also provides CA2 biocircuits, CA2 effector modules, stimulus-responsive elements (SREs), and payloads, as well as polynucleotides encoding any of the foregoing. In one aspect, the systems, compositions, immunotherapeutic agents, and other components of the present disclosure can be controlled by separately added stimulants that provide significant adaptability to control cancer immunotherapy. Further, the systems, compositions, and methods of the present disclosure may be combined with therapeutic agents such as chemotherapeutic drugs, small molecules, gene therapy, and antibodies.

[0189] The adjustable nature of the systems and compositions of the present disclosure has the potential to increase the efficacy and duration of immunotherapy. By reversibly silencing the biological activity of adoptively transferred cells using the compositions of the present disclosure, the potential of cell therapy can be maximized without causing irreversible killing or ending the therapy.

[0190] The present disclosure provides a method for fine-tuning immunotherapy after administration to a patient. Thereby, subsequently The safety and efficacy of immunotherapy are improved, and the population of subjects benefiting from immunotherapy increases.

[0191] In one embodiment, the CA2 biocircuit, CA2 effector module, SRE, and components that regulate expression levels and the activity of any agent may be used in immunotherapy. As a non-limiting example, the immunotherapeutic agent used in the constructs of the present disclosure is IL15, which induces an immune response in cells and subjects.

[0192] In some embodiments, the composition for inducing an immune response may include a CA2 effector module. In some embodiments, the CA2 effector module may include a stimulatory response element (SRE) operably linked to human IL15 comprising the amino acid sequence of SEQ ID NO: 8.

[0193] In some embodiments, the CA2 biocircuit, CA2 effector module, and compositions of the present disclosure are related to the post-translational regulation of the antitumor immune response of the protein (payload) function of the immunotherapeutic agent.

[0194] In some embodiments, cells that are genetically engineered to express at least one CA2 biocircuit, CA2 effector module, SRE (e.g., CA2 DRD), and / or the payload (immunotherapeutic agent) of interest may be used in adoptive cell therapy (ACT). As used herein, adoptive cell transfer refers to the administration of immune cells (from autologous, allogeneic, or genetically engineered hosts) that have direct anti-cancer activity. ACT has demonstrated efficacy in clinical applications against malignant and infectious diseases. ​

[0195] According to the present disclosure, CA2 biocircuits and systems may be used in the development and implementation of cell therapies such as adoptive cell therapy. The CA2 biocircuits, CA2 effector modules, and their SREs and payloads are used in cell therapy and may be used alone or in combination with other treatment lines (e.g., radiation, cytokines) to effect immunotherapy. Herein, methods of use in adoptive cell therapy are provided. In one embodiment, the method comprises preconditioning a subject in need thereof, removing a portion of the subject's T cells, engineering the subject's T cells with a CA2 effector module of the present disclosure, and administering to the subject the engineered T cells that express the CA2 effector module, wherein the engineered cells successfully engraft in the subject's body. In another embodiment, the method comprises preconditioning a subject in need thereof and administering to the subject allogeneic engineered T cells that express the CA2 effector module, wherein the engineered cells successfully engraft in the subject's body. In some embodiments, the method comprises removing a malignancy from a subject, isolating tumor-infiltrating lymphocytes (TILs) from the tumor, engineering the TILs with a CA2 effector module of the present disclosure, and administering the engineered TILs to the subject.

[0196]

[0197]

[0198] It involves a process that successfully penetrates the remaining tumors or metastases in the body.

[0199] In some embodiments, the SRE, CA2 biocircuit, and compositions of the present disclosure may be used to minimize the preconditioning regimen associated with adoptive cell therapy. As used herein, "preconditioning" refers to any therapeutic regimen administered to a subject to improve the outcome of adoptive cell therapy. Preconditioning strategies include, but are not limited to, total body irradiation and / or lymphodepleting chemotherapy. Adoptive cell therapy clinical trials without preconditioning have not been able to demonstrate clinical benefits, indicating the importance of ACT. However, preconditioning is associated with significant toxicity and limits the cohort of subjects suitable for ACT. In some cases, immune cells for ACT may be engineered to express cytokines such as IL15 using the SRE of the present disclosure as a payload, reducing the need for preconditioning. However, preconditioning is associated with significant toxicity and limits the cohort of subjects suitable for ACT. In some cases, immune cells for ACT may be engineered to express cytokines such as IL15 using the SRE of the present disclosure as a payload, reducing the need for preconditioning. In some embodiments, NK cells engineered to express the composition may be used for ACT. NK cell activation induces perforin / granzyme-dependent apoptosis in target cells. NK cell activation also induces the secretion of cytokines such as IFNγ, TNF-α, and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and increase the adaptive immune response using upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs). In some embodiments, NK cells engineered to express the composition may be used for ACT. NK cell activation induces perforin / granzyme-dependent apoptosis in target cells. NK cell activation also induces the secretion of cytokines such as IFNγ, TNF-α, and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and increase the adaptive immune response using upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs).

[0200] In some embodiments, NK cells engineered to express the composition may be used for ACT. NK cell activation induces perforin / granzyme-dependent apoptosis in target cells. NK cell activation also induces the secretion of cytokines such as IFNγ, TNF-α, and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and increase the adaptive immune response using upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs). These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and increase the adaptive immune response using upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs). These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and increase the adaptive immune response using upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs).

[0201] ​​Immune cells can be isolated and expanded ex vivo using a variety of methods well known in the art. For example, methods for isolating and expanding cytotoxic T cells are described in U.S. Patents Nos. 6,805,861 and 6,531,451; U.S. Patent Publication No. US20160 348072A1 and International Patent Publication No. WO2016168595A1, the entire contents of each of which are incorporated herein by reference. The isolation and expansion of NK cells are described in U.S. Patent Publication No. US20150152387A1, U.S. Patent No. 7,435,596 ; and Oyer, J.L. (2016). Cytotherapy. 18(5): 653 - 63, the entire contents of each of which are incorporated herein by reference. In particular, human primary NK cells can be expanded in the presence of feeder cells, such as bone marrow cell lines engineered to express membrane - bound IL1 5 and 4 - 1BBL.

[0202] In some embodiments, the activation and expansion of T cells for ACT is achieved by antigen stimulation of a chimeric antigen receptor (CAR) transiently expressed on the cell surface. Such activation methods are taught in International Patent No. WO2017015427, the entire contents of which are incorporated herein by reference.

[0203] In some embodiments, immune cells may be activated by an antigen conjugated to an antigen - presenting cell (APC). In some embodiments, the APC may be an antigen - specific or non - specific dendritic cell, macrophage, or B cell. The APC may be autologous or syngeneic in their organs. In some embodiments, the APC is an artificial antigen-presenting cell (aAPC), such as a cell-based aAPC or a cell-free aAPC may be. Cell-based aAPCs can be genetically engineered allogeneic cells such as human erythroleukemia cells or either xenogeneic cells such as mouse fibroblasts and Drosophila cells selected from. Alternatively, the APC may be cell-free, and the antigen or co-stimulatory domain is presented on the surface of a synthetic such as latex beads, polystyrene beads, lipid vesicles, or exosomes In some embodiments, adoptive cell therapy is performed by autologous transplantation, and the cells are

[0204] derived from a subject in need of treatment, and the cells are administered to the same subject following separation and processing In other examples, ACT may involve allogeneic transplantation, and the cells are ultimately separated and / or prepared from a donor subject other than the recipient subject who will ultimately receive the cell therapy The donor and recipient subjects may be genetically identical, similar or may express the same HLA class or subtype After genetic modification using the SRE, CA2 biocircuit, and compositions of the present disclosure, the cells are

[0205] administered to a subject in need thereof. Methods of administering cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, for methods of adoptive T cell therapy, see, for example, U.S. Patent Publication No. 2 003 / 0170238 to Gruenberg et al.; U.S. Patent No. 4,690,915 to Rosenberg ; Rosenberg (2011) Nat Rev Clin Oncol. 8(1 ; 0):577-85) is described in, for example, Themeli et al. (2013) Nat Biotechnol. 31(10):928-933; Tsukahara et al. (2 013) Biochem Biophys Res Commun 438(1):8 4-9; Davila et al. (2013) PLoS ONE 8(4):e61338, each of which is incorporated herein by reference in its entirety.

[0206] In some embodiments, immune cells engineered with CA2-IL15 for ACT may be further modified to express one or more immunotherapeutic agents that promote immune cell activation, infiltration, proliferation, survival, and anti-tumor function. The immunotherapeutic agent may be a tumor cell; a second cytokine or cytokine receptor; a chimeric switch receptor that converts an inhibitory signal to a stimulatory signal; a homing receptor that directs the adoptively transferred cell to a target site such as a tumor tissue; an agent that optimizes the metabolism of immune cells; or a safety switch gene (e.g., a suicide gene) that kills activated T cells when a serious event is observed after adoptive cell transfer or when the transferred immune cells are no longer needed, which may be a CAR or TCR specific for a target molecule.

[0207] In some embodiments, the immune cells used for adoptive cell transfer are genetically engineered with the overall goal of further improving their ability to kill tumors in cancer patients, and their persistence, cytotoxicity, tumor targeting ability, and ability to be directed to the site of disease in vivo can be improved. One example is the CA2 effector moiety of the present disclosure that includes IL15. ​​​​​​​​​​​To introduce IL-15 into immune cells and promote the proliferation and survival of immune cells. Cells Transduction of IL-15 into cells allows immune cells to proliferate without the addition of exogenous cytokines, and cytokine-expressing NK cells may increase tumor cell cytotoxicity.

[0208] In some embodiments, the CA2 biocircuit, SRE, or CA2 effector -module may be utilized to prevent T cell exhaustion. As used herein "T cell exhaustion" refers to the gradual and progressive loss of T cell function resulting from chronic T cell activation. T cell exhaustion is a major factor limiting the effectiveness of antiviral and antitumor immunotherapies. In exhausted T cells, the apoptosis rate of multiple inhibitory receptors is high, surface expression is high, and at the same time, the proliferative and cytokine-producing abilities are low. T cell activation leading to exhaustion can occur either in the presence or absence of antigen.

[0209] In some embodiments, the CA2 biocircuits and their components may be used to prevent T cell exhaustion in the context of chimeric antigen receptor - T cell therapy (CAR-T). In this regard, exhaustion may in some cases result from oligomerization of the scFv of the CAR on the cell surface, which leads to continuous activation of the intracellular domain of the CAR. As a non-limiting example, the CARs of the present disclosure may include scFvs that cannot oligomerize. As another non-limiting example, a CAR that is rapidly internalized and re-expressed following antigen exposure may be selected to prevent chronic scFv oligomerization on the cell surface. In one embodiment, the framework region of the scFv is a constitutive CAR sig ​It may be modified to prevent NF signaling.

[0210] The adjustable CA2 biocircuit of the present disclosure controls the surface expression of CAR on the T cell surface and may be used to prevent chronic T cell activation. The CAR of the present disclosure may be engineered to minimize depletion. As a non-limiting example, the 4-1-BB signaling domain may be incorporated into the CAR design along with membrane-bound IL15 expression controlled by the CA2 biocircuit, SRE, or CA2 effector module exemplified in Table 3 of the present disclosure to improve T cell depletion.

[0211] In some embodiments, the adjustable nature of the CA2-IL15 biocircuit of the present disclosure may be utilized to reverse human T cell depletion observed in tonic CAR signaling. Using the compositions of the present disclosure to reversibly silence the biological activity of adoptively transferred cells may be utilized to reverse tonic signaling, which can then reactivate the T cells. Reversal of depletion may be measured by downregulation of multiple inhibitory receptors associated with depletion.

[0212] In some embodiments, the compositions of the present disclosure may be used to alter the TIL (tumor-infiltrating lymphocyte) population in a subject. In one embodiment, any of the payloads described herein may be used to alter the ratio of CD4-positive cells to the CD8-positive population. In some embodiments, TILs may be sorted ex vivo and engineered to express any of the cytokines described herein. The payloads of the present disclosure expand the CD4 and / or CD8 populations of TILs and TI It may be used to enhance the L-mediated immune response.

[0213] In the present disclosure, there is provided a method for reducing tumor volume or burden in a subject in need thereof, the method comprising introducing into the body of the subject a composition of the present disclosure. There is also provided a method for treating cancer in a subject, the method comprising administering to the subject an effective amount of effector immune cells in which the gene is recombined and expresses at least one CA2 effector module of the present disclosure.

[0214] The present disclosure relates to a method for treating cancer in a subject, wherein the gene is recombined and expresses at least one CA2 effector module of the present disclosure. There is also provided a method for treating cancer in a subject, the method comprising administering to the subject an effective amount of effector immune cells in which the gene is recombined and expresses at least one CA2 effector module of the present disclosure. There is also provided a method for treating cancer in a subject, the method comprising administering to the subject an effective amount of effector immune cells in which the gene is recombined and expresses at least one CA2 effector module of the present disclosure.

[0215] Various cancers can be treated with the pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules of the present disclosure containing the SRE and IL15 payloads of the present disclosure. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, and also refers to the pathological conditions characterized by the growth of such malignant neoplasms. Cancers include, but are not limited to, tumors or hematological malignancies such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, testis, thyroid, and uterus, as well as all types of lymphoma / leukemia, cytoma, and sarcoma.

[0216] Types of cytomas that can be treated with the compositions of the present disclosure include papilloma / carcinoma, choriocarcinoma, endodermal sinus tumor, teratoma, adenoma / adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma , choriocarcinoma, endodermal sinus tumor, teratoma, adenoma / adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma Rhabdomyosarcoma, mesothelioma, hemangioma, osteoma, chondroma, glioma, lymphoma / leukemia, squamous cell carcinoma Small cell carcinoma, large cell undifferentiated carcinoma, basal cell carcinoma, and undifferentiated carcinoma of the paranasal sinuses Including, but not limited to, these.

[0217] Types of tumors that can be treated with the compositions of the present disclosure include soft tissue sarcomas such as alveolar soft part sarcoma Angiosarcoma, dermatofibrosarcoma, desmoid tumor, fibromatosis, fibrous histiocytoma, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, perivascular epitheloid cell tumor, angiosarcoma Hematangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and Askin tumor Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma, including, but not limited to, these.

[0218] As non-limiting examples, carcinomas that can be treated include acute granulocytic leukemia, acute lymphocytic leukemia, acute myeloid leukemia, adenocarcinoma, adenoma, adrenal cancer, adrenocortical cancer, anal cancer, anaplastic astrocytoma, angiosarcoma, appendiceal cancer, astrocytoma, basal cell carcinoma, B-cell lymphoma, Cholangiocarcinoma, bladder cancer, bone cancer, bowel cancer, brain cancer, brainstem glioma, brain tumor, breast cancer, carcinoid tumor, cervical cancer, cholangiocarcinoma, chondrosarcoma, chronic lymphocytic leukemia, chronic myeloid leukemia Colon cancer, colorectal cancer, craniopharyngioma, cutaneous lymphoma, cutaneous melanoma, diffuse astrocytoma, ductal carcinoma in situ, endometrial cancer, epithelioma, esophageal cancer, Ewing's sarcoma, extrahepatic cholangiocarcinoma, eye cancer, fallopian tube cancer ​​​​​​​​cancer), fibrosarcoma, gallbladder cancer (GallblaDRDer cancer), gastric cancer, gastrointestinal cancer, gastrointestinal carcinoid cancer, gastrointestinal stromal tumor, general, germ cell tumor , glioblastoma multiforme, glioma, hairy cell leukemia, head and neck cancer, hemangioendothelioma, h odgkin lymphoma, Hodgkin disease, Hodgkin lymphoma (Hodgkin’s lymphoma), hypopharyngeal cancer, invasive ductal carcinoma, invasive lobular cancer, inflammatory breast cancer, intestinal cancer, intrahepatic bile duct cancer, invasive (Invasive) / invasive (i nfiltrating) breast cancer, islet cell cancer, jaw cancer, Kaposi sarcoma, kidney cancer, laryngeal cancer , leiomyosarcoma, leptomeningeal metastasis, leukemia, lip cancer, liposarcoma, liver cancer, non-invasive lobular cancer, low-grade astrocytoma, lung cancer, lymph node cancer, lymphoma, male breast cancer, medullary cancer, medulloblastoma, melanoma, meningioma, Merkel cell cancer, mesenchymal chondrosarcoma, mesenchymous ), mesothelioma, metastatic breast cancer, metastatic melanoma, metastatic squamous cell carcinoma of the neck, mixed glioma, oral cancer n (Mouth cancer), mucinous cancer, mucosal melanoma, multiple myeloma, nasal cavity cancer, u pper pharyngeal cancer, neck cancer, neuroblastoma, neuroendocrine tumor, non-Hodgkin lymphoma (Non-Hod gkin lymphoma), non-Hodgkin lymphoma (Non-Hodgkin’s l ymphoma), non-small cell lung cancer, oat cell cancer, eye cancer (Ocular cance r), uveal melanoma, anaplastic glioma, oral cancer (Oral cancer) (Oral cavity cancer), middle pharyngeal cancer, osteogenic sarcoma, osteosarcoma, ovarian can cer, ovarian epithelial cancer, ovarian germ cell tumor, primary peritoneal cancer of the ovary, ovarian sex cord-stromal tumor, Paget ’s disease, pancreatic cancer, papillary cancer, paranasal sinus cancer (Paranasal sinus cancer ) Parathyroid cancer, pelvic cancer, penile cancer, peripheral nervous system cancer, peritoneal cancer, pharyngeal cancer (Pha ryngeal cancer), pheochromocytoma, pilocytic astrocytoma, pineal tumor, pine aloblastoma, pituitary cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer , renal pelvis cancer, rhabdomyosarcoma, salivary gland cancer, sarcoma, osteosarcoma, soft tissue sarcoma, uterine sarcoma, paranasal sinus cancer, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sar coma, spinal cancer, vertebral column cancer, spinal cord cancer, spinal tumor, squamous cell carcinoma, stomach cancer, synovial sarcoma, T cell lymphoma), testicular cancer, throat cancer (Throat cancer), thymoma / thymus cancer , thyroid cancer, tongue cancer, tonsil cancer, transitional cell carcinoma, transitional cell carcinoma, transitional cell carcinoma, triple negative breast cancer , fallopian tube cancer (Tubal cancer), tubular cancer, ureteral cancer, ureteral cancer, uri nary tract cancer, uterine adenocarcinoma, uterine cancer, uterine sarcoma, vaginal cancer, and vulvar cancer.

[0219] In some embodiments, the pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure may be used to modulate or alter or harness the immune system to target one or more cancers. This approach may be considered in combination with immunomodulatory therapies, such as the administration of interferon, interleukin, colony stimulating factor, other monoclonal antibodies, vaccines, gene therapy, and non-specific immunosuppressive drugs, and is also contemplated as an anti-cancer treatment in combination with the pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure. This approach may be considered in combination with immunomodulatory therapies, such as the administration of interferon, interleukin, colony stimulating factor, other monoclonal antibodies, vaccines, gene therapy, and non-specific immunosuppressive drugs, and is also contemplated as an anti-cancer treatment in combination with the pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure. This approach may be considered in combination with immunomodulatory therapies, such as the administration of interferon, interleukin, colony stimulating factor, other monoclonal antibodies, vaccines, gene therapy, and non-specific immunosuppressive drugs, and is also contemplated as an anti-cancer treatment in combination with the pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure. This approach may be considered in combination with immunomodulatory therapies, such as the administration of interferon, interleukin, colony stimulating factor, other monoclonal antibodies, vaccines, gene therapy, and non-specific immunosuppressive drugs, and is also contemplated as an anti-cancer treatment in combination with the pharmaceutical composition, CA2 biocircuit, CA2 biocircuit component, CA2 effector module comprising the SRE or payload of the present disclosure.

[0220] Cancer immunotherapy refers to a variety of treatments designed to induce the patient's own immune system to fight cancer. In some embodiments, pharmaceutical compositions, CA2 biocircuits, CA2 biocircuit components, CA2 effector modules comprising the SRE or payload of the present disclosure are designed as immuno - oncology treatments.

[0221] There are several types of cellular immunotherapies, including NK cells, tumor - infiltrating lymphocyte (TIL) therapy, and genetically engineered T cells with chimeric antigen receptor (CAR) or recombinant TCR technology.

[0222] In one embodiment, the CAR T cells or TCR T cells of the present disclosure may be "armed" T cells transformed by the CA2 - IL15 effector module to improve efficacy and persistence.

[0223] In one embodiment, patients may be stratified according to antigenic peptides presented by their immune cells, used as parameters, and a suitable patient cohort that may therapeutically benefit from the compositions of the present disclosure may be determined.

[0224] In some embodiments, the cells of the present disclosure may be autologous, allogeneic, syngeneic, or xenogeneic in relation to a particular individual subject.

[0225] In some embodiments, the cells of the present disclosure may be mammalian cells, particularly human cells. The cells of the present disclosure may be primary cells or immortalized cell lines.

[0226] The engineered immune cells are involved in the CA2 biocircuitry, CA2 effector modules, SREs, and one or more polynucleotides encoding the IL15 payload polypeptide. or a vector containing said polynucleotide into a cell composition. The vector can be a lentiviral vector or a gamma retroviral vector. The vector may be a viral vector, such as a viral vector. The immune cells of the present disclosure may be genetically modified and regulated using stimuli. Each patient will express at least one immunotherapy drug. definition

[0227] At various places in the specification, features or functions of compositions of the present disclosure are referred to as groups or Specifically, the present disclosure relates to each and every member of such groups and ranges. The following is a non-limiting list of definitions of terms: This is a general list.

[0228] Activity: As used herein, the term "activity" refers to something happening or being done. The compositions of the present disclosure may have an activity, which may be one or more of the following: In some embodiments, the biological event may involve a number of biological events. In some embodiments, the biological event may include a signal transduction event. or a plurality of corresponding proteins, receptors, small molecules, or biocircuits described herein. The present invention may include cell signaling events associated with protein interactions with any of the components. stomach.

[0229] Adoptive Cell Therapy (ACT): The term "adoptive cell therapy" or "adoptive cell transfer" refers to When used in the specification, it refers to cell therapy involving the transplantation of cells into a patient, and the cells may be derived from the patient, or another individual, and may be manipulated (altered) before being transplanted back into the patient's body. The therapeutic cells may be effector immune cells: CD4+ T cells; CD8+ T cells, natural killer cells (NK cells); and B cells and tumor infiltrating lymphocytes (TIL) derived from resected tumors, etc., which may be derived from the immune system. The most commonly transplanted cells are autologous anti-tumor T cells after ex vivo expansion or manipulation. For example, autologous peripheral blood lymphocytes are genetically engineered to express a T cell receptor (TCR) or chimeric antigen receptor (CAR) so as to be able to recognize a specific tumor antigen. Agent (drug): When used in the specification, the term "agent (drug)" refers to a biological, pharmaceutical, or chemical compound. Non-limiting examples include single or complex organic or inorganic molecules, peptides, proteins, oligonucleotides, antibodies, antibody derivatives, antibody fragments, receptors, and soluble factors. Antigen: When used in the specification, the term "antigen" is defined as a molecule that elicits an immune response when introduced into, or produced by, a subject, such as a tumor antigen caused by cancer growth itself. This immune response may involve either, or both, antibody production or activation of specific immunologically competent cells such as cytotoxic T lymphocytes and T helper cells. The antigen can be derived from a living organism, a protein / antigen subunit, whole or lysates of killed or inactivated cells. In the context of the present disclosure,

[0230]

[0231] In this context, the terms "target antigen" or "desired antigen" refer to the antibodies and / or the fragments, variants, mutants, and / or modified forms thereof described herein that immunospecifically bind to or interact with the proteins and / or other biomolecules provided herein. In some embodiments, the target antigen may comprise any of the polypeptides or payloads or proteins described herein, or a fragment or portion thereof.

[0232] - associated with: As used herein, the terms "associated with", "joined to", "linked to", "attached to", and "connected to" mean that when used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound. When used with respect to two or more parts, the parts are physically bound or connected to each other, either directly or through one or more additional parts that function as a linker, to form a sufficiently stable structure such that the parts remain physically bound in the state in which the structure is used, e.g., under physiological conditions. "Linked" need not be strictly by a direct covalent chemical bond. A sufficiently stable ionic or hydrogen bond or hybridization-based connectivity may be proposed such that the "linked" entities remain physically bound.

[0233] Self: As used herein, the term "self" is intended to refer to any substance derived from an individual that is later reintroduced into the same individual. As used herein, the term "self" is intended to refer to any substance derived from an individual that is later reintroduced into the same individual.

[0234] Cancer: As used herein, the term "cancer" refers to the uncontrolled growth of abnormal cells in the body. Refers to a broad group of various diseases characterized by uncontrolled cell growth. Uncontrolled cell division and proliferation results in the formation of malignant tumors that invade adjacent tissues and ultimately metastasize to distant parts of the body through the lymphatic system or bloodstream.

[0235] Costimulatory molecule: As used herein, in the context of immune T cell activation, refers to a group of immune cell surface receptors / ligands that bind between T cells and APCs and generate stimulatory signals in T cells that bind to stimulatory signals in T cells resulting from T cell receptor (TCR) recognition of antigen / MHC complexes (pMHC) in APCs.

[0236] Cytokine: The term "cytokine" as used herein refers to a family of small soluble factors with pleiotropic functions produced by many cell types that can affect and regulate the functions of the immune system.

[0237] Delivery: The term "delivery" as used herein refers to the act or method of delivering a compound, substance, entity, moiety, cargo, or payload. A "delivery agent" refers to any agent that promotes the in vivo delivery of at least some, one or more substances (including, but not limited to, the compounds and / or compositions of the present disclosure) to cells, subjects, or other biological system cells.

[0238] Destabilized: As used herein, the terms "destable", "destabilize", or "destabilized region" refer to a region or molecule that is less stable than the starting, reference, wild-type or native form of the same region or molecule.

[0239] Engineered: As used herein, embodiments of the present disclosure are engineered to have features or characteristics that are distinct from the starting point, wild-type, or native molecule, whether structurally or chemically diverged. When designed to have features or characteristics that are distinct from the starting point, wild-type, or native molecule, whether structurally or chemically diverged, they are "engineered."

[0240] Formulation: As used herein, "formulation" includes at least a compound and / or composition of the present disclosure, as well as a delivery agent.

[0241] Fragment: As used herein, "fragment" refers to a part of a molecule that is smaller than the whole molecule. For example, a fragment of a protein may include a polypeptide obtained by digesting the full-length protein. In some embodiments, a fragment of an antibody includes a portion of the antibody. For example, a fragment of a protein may include a polypeptide obtained by digesting the full-length protein. In some embodiments, a fragment of an antibody includes a portion of the antibody. For example, a fragment of a protein may include a polypeptide obtained by digesting the full-length protein. In some embodiments, a fragment of an antibody includes a portion of the antibody. For example, a fragment of a protein may include a polypeptide obtained by digesting the full-length protein. In some embodiments, a fragment of an antibody includes a portion of the antibody.

[0242] Functional: As used herein, a "functional" biomolecule is a biological entity that has a structure and exhibits the characteristics and / or activities by which it is characterized. Functional: As used herein, a "functional" biomolecule is a biological entity that has a structure and exhibits the characteristics and / or activities by which it is characterized.

[0243] Immune cell: The term "immune cell," as used herein, refers to any cell of the immune system that originates from hematopoietic stem cells in the bone marrow and gives rise to two major lineages of cells: myeloid progenitor cells (which give rise to myeloid cells such as monocytes, macrophages, dendritic cells, megakaryocytes, and granulocytes) and lymphoid progenitor cells (which give rise to lymphoid cells such as T cells, B cells, and natural killer (NK) cells). Exemplary immune system cells include CD4+ T cells, Immune cell: The term "immune cell," as used herein, refers to any cell of the immune system that originates from hematopoietic stem cells in the bone marrow and gives rise to two major lineages of cells: myeloid progenitor cells (which give rise to myeloid cells such as monocytes, macrophages, dendritic cells, megakaryocytes, and granulocytes) and lymphoid progenitor cells (which give rise to lymphoid cells such as T cells, B cells, and natural killer (NK) cells). Exemplary immune system cells include CD4+ T cells, CD8+ T cells, CD4-CD8-double negative T cells, Tγδ cells, Tαβ cells, regulatory T cells, natural killer cells, and dendritic cells. Macrophages and dendritic T cells, natural killer cells, and dendritic cells. Macrophages and dendritic cells, as well as macrophages and dendritic cells, as well as macrophages and dendritic Cells may be referred to as "antigen-presenting cells" or "APCs" and, when complexed with peptides, are specialized cells that can activate T cells when the major histocompatibility complex (MHC) receptors on the surface of the APC interact with the T cell receptors (TCRs) on the surface of T cells.

[0244] Immunotherapy: As used herein, the term "immunotherapy" refers to a type of treatment of a disease by inducing or restoring an immune system response to the disease.

[0245] Immunotherapeutic agent: As used herein, the term "immunotherapeutic agent" refers to the treatment of a disease by inducing or restoring an immune system response to the disease by a biological, pharmaceutical, or chemical compound.

[0246] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than inside a living organism (e.g., an animal, a plant, or a microorganism).

[0247] In vivo: As used herein, the term "in vivo" refers to events that occur inside a living organism (e.g., an animal, a plant, or a microorganism or a cell or its tissue).

[0248] Linker: As used herein, a linker refers to a moiety that connects two or more domains, moieties, or entities. In one embodiment, the linker may contain 10 or more atoms. In a further embodiment, the linker may contain a group of atoms, e.g., 10 to 1, 000 atoms, and may contain carbon, amino, alkylamino, oxygen, sulfur, sulfoxy ​​​​​​​​​​ atoms or groups such as, but not limited to, carbonyl, sulfonyl, and imine and may include loops. In some embodiments, the linker may include one or more nucleic acids including one or more nucleotides. In some embodiments, the linker may include an amino acid, peptide, polypeptide, or protein. In some embodiments, the moiety attached by the linker may include, but is not limited to, an atom, chemical group, nucleoside, nucleotide, nucleobase, sugar, nucleic acid, amino acid, peptide, polypeptide, protein, protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example and may include one or more nucleic acids including one or more nucleotides. In some embodiments, the linker may include an amino acid, peptide, polypeptide, or protein. In some embodiments, the moiety attached by the linker may include, but is not limited to, an atom, chemical group, nucleoside, nucleotide, nucleobase, sugar, nucleic acid, amino acid, peptide, polypeptide, protein, protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example and may include an amino acid, peptide, polypeptide, or protein. In some embodiments, the moiety attached by the linker may include, but is not limited to, an atom, chemical group, nucleoside, nucleotide, nucleobase, sugar, nucleic acid, amino acid, peptide, polypeptide, protein, protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example In some embodiments, the moiety attached by the linker may include, but is not limited to, an atom, chemical group, nucleoside, nucleotide, nucleobase, sugar, nucleic acid, amino acid, peptide, polypeptide, protein, protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example nucleoside, nucleotide, nucleobase, sugar, nucleic acid, amino acid, peptide, polypeptide, protein, protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example protein, protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example protein complex, payload (e.g., therapeutic agent), or marker (including, but not limited to, chemical, fluorescent, radioactive, or bioluminescent markers). The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example The linker can be used for any beneficial purpose, such as, but not limited to, administering a payload as described herein, or forming multimers or conjugates. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example aryl, or heterocyclyl, each of which can be optionally substituted as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example polyethyleneglycols (e.g., ethylene or propylene glycol monomer units such as diethyleneglycol, dipropyleneglycol, triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example triethyleneglycol, tripropyleneglycol, tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example tetraethyleneglycol, or tetrapropyleneglycol), and dextran polymers. Other examples include, for example and dextran polymers. Other examples include, for example , disulfide bonds (-S-S-) or azo bonds (-N=N-) that can be cleaved using a reducing agent or photolysis, etc., are included in the linker, but are not limited thereto. Non-limiting examples of selectively cleavable bonds include, for example, not only ester bonds that can be cleaved by acidic or basic hydrolysis, but also, for example, tris(2-carboxyethyl ) phosphine (TCEP), or the use of other reducing agents, and / or amide bonds that can be cleaved by photolysis. Modified: As used herein, the term "modified" refers to a change in the state or structure of a molecule or entity as compared to a parent or reference molecule or entity. The molecule may be modified in many ways, including chemically, structurally, and functionally. In some embodiments, the compounds and / or compositions of the present disclosure are modified by the introduction of non-natural amino acids.

[0249] Mutations: As used herein, the term "mutation" refers to a change and / or alteration. In some embodiments, the mutation may be a change and / or alteration to a protein (including peptides and polypeptides) and / or a nucleic acid (including polynucleic acids). In some embodiments, the mutation includes a change and / or alteration to a protein and / or nucleic acid sequence. Such changes and / or alterations may include the addition, substitution, and / or deletion of one or more amino acids (in the case of proteins and / or peptides) and / or nucleotides (in the case of nucleic acids and / or polynucleic acids, such as polynucleotides). In some embodiments, the mutation is an amino acid and

[0250] and In some embodiments, the mutation is a change and / or alteration to a protein (including peptides and polypeptides) and / or a nucleic acid (including polynucleic acids). In some embodiments, the mutation includes a change and / or alteration to a protein and / or nucleic acid sequence. Such changes and / or alterations may include the addition, substitution, and / or deletion of one or more amino acids (in the case of proteins and / or peptides) and / or nucleotides (in the case of nucleic acids and / or polynucleic acids, such as polynucleotides). In some embodiments, the mutation includes a change and / or alteration to a protein and / or nucleic acid sequence. Such changes and / or alterations may include the addition, substitution, and / or deletion of one or more amino acids (in the case of proteins and / or peptides) and / or nucleotides (in the case of nucleic acids and / or polynucleic acids, such as polynucleotides). In some embodiments, the mutation includes the addition, substitution, and / or deletion of one or more amino acids (in the case of proteins and / or peptides) and / or nucleotides (in the case of nucleic acids and / or polynucleic acids, such as polynucleotides). In some embodiments, the mutation is an amino acid and / or nucleotide addition and / or substitution, such addition and / or substitution may include one or more amino acids and / or nucleotide residues, and may include modified amino acids and / or nucleotides. As a result of a mutation, change, or alteration, the resulting construct, molecule, or sequence may be referred to herein as a variant.

[0251] Neoantigen: As used herein, the term "neoantigen" refers to a tumor antigen that is present in tumor cells but not in normal cells and does not induce deletion of their cognate antigen-specific T cells in the thymus (i.e., central tolerance). These tumor neoantigens provide a "foreign" signal similar to a pathogen and may induce an effective immune response necessary for cancer immunotherapy. A neoantigen may be specific to a particular tumor. A neoantigen is a peptide / protein having a missense mutation (missense neoantigen), or a new peptide having a long, completely novel stretch of amino acids from a novel open reading frame (neoORF). NeoORFs can be generated in some tumors by out-of-frame insertions or deletions (due to defects in DNA mismatch repair that cause microsatellite instability), gene fusions,

[0252] read-through mutations at stop codons, or translation of improperly Any unintended effects on multiple targets, genes, cellular transcripts, cells, and / or tissues Refers to.

[0253] Operably linked: As used herein, the phrase "operably linked" Refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties, etc. Refers to.

[0254] Payload or payload of interest (POI): The terms "payload" and "payload of interest (POI)" are used interchangeably herein. Payload of interest (POI) refers to any protein or compound whose function is altered. In the context of the present disclosure, the POI is a component of the immune system, including both the innate and adaptive immune systems. The payload of interest may be a protein, a fusion construct encoding a fusion protein, or a non-coding gene, or variants and fragments thereof. When based on amino acids, the payload of interest may be referred to as the protein of interest. Refers to. Refers to. In the context of the present disclosure, the POI is a component of the immune system, including both the innate and adaptive immune systems. Refers to. The payload of interest may be a protein, a fusion construct encoding a fusion protein, or a non-coding gene, or variants and fragments thereof. Refers to.

[0255] Pharmaceutically acceptable additives: The term "pharmaceutically acceptable additives" as used herein refers to any component other than the active agent (e.g., as described herein) that is present in a pharmaceutical composition and has substantially non-toxic and non-inflammatory properties in a subject. In some embodiments, the pharmaceutically acceptable additive is a vehicle capable of suspending and / or dissolving the active agent. Additives include, for example, antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (pigments), emollients, emulsifiers, excipients (diluents), film formers, or Refers to. Refers to. Refers to. Refers to. Refers to. Refers to. It may contain coatings, fragrances, flavoring agents, flow enhancers, lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners, and water of hydration. Exemplary additives include butylhydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxy propylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, crystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pre-gelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol are included, but are not limited thereto.

[0256] Pharmaceutically acceptable salts: The pharmaceutically acceptable salts of the compounds described herein are in the form of the disclosed compounds, and the acid or base moiety is in its salt form (e.g., such as produced by reacting a free base moiety with a suitable organic acid). Examples of pharmaceutically acceptable salts include inorganic or organic acid salts of basic residues such as amines; alkalis or organic salts of acidic residues such as carboxylic acids, etc., but are not limited thereto. Representative acid addition salts include acetic acid Salts, adipates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, citrates, cyclopentanepropionates, digluconates, dodecyl sulfates, ethanesulfonates, fumarates, glucoheptonates, glycerophosphates, hemisulfates, heptonates, hexanoates, hydrobromides, hydrochlorides, hydroiodides, 2-hydroxy- ethanesulfonates, lactobionates, lactates, laurates, lauryl sulfates, malates, maleates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectinates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propionates, stearates, succinates, sulfates, tartrates, thiocyanates, toluenesulfonates, undecanoates, valerates, etc. are included. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc., and non-toxic ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc., including but not limited to these, non-toxic ammonium, quaternary ammonium, and amine cations are included. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts from non-toxic inorganic or organic acids. In some embodiments, pharmaceutically acceptable salts are prepared from parent compounds containing basic or acidic or in a mixture of the two, the free acid or base form of these compounds can be prepared by reacting with a stoichiometric amount of a suitable base or acid; usually, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. A list of suitable salts can be found in Remington’s Pharmaceutical Science s, 17th Edition, Mack Publishing Company, Easton, Pa ., 1985, p. 1418, Pharmaceutical Salts: Prop erties, Selection, and Use, P.H. Stahl and C. G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1 -19 (1977), each of which is incorporated herein by reference in its entirety. Pharmaceutically acceptable solvates: The term “pharmaceutically acceptable solvate” as used herein refers to a crystalline form of a compound in which molecules of a suitable solvent are incorporated into the crystal lattice . For example, a solvate may be prepared by crystallization, recrystallization, or precipitation from a solution containing an organic solvent, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (e.g., mono-, di-, and trihydrates), N-methylpyrrolidinone (NMP ), dimethyl sulfoxide (DMSO), N,N’-dimethylformamide (DMF), N,N’-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyr one (DMPU), and the like. Remidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvated compound is called a "hydrate". In some embodiments, the solvent incorporated into the solvated compound is of a type or level physiologically acceptable to the living organism to which the solvated

[0257] Compound is administered (e.g., in a unit dosage form of a pharmaceutical composition). Stable: As used herein, "stable" refers to a compound or entity that is

[0258] robust enough to withstand separation at useful purity from the reaction mixture and can preferably be formulated into an effective therapeutic agent. In some embodiments, stability is measured relative to an absolute value. In some embodiments, stability is measured relative to a

[0259] secondary situation or state, or relative to a reference compound or entity. Standard CAR: As used herein, the term "standard CAR" refers to the standard design of a chimeric antigen receptor. The components of the

[0260] CAR fusion protein, including an extracellular scFv fragment, a For experimental, diagnostic, prophylactic, and / or therapeutic purposes, any living organism to which a composition according to the present disclosure can be administered is meant. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants. By "subject" is meant any living organism to which a composition according to the present disclosure can be administered. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants. and / or plants.

[0261] T cells: T cells are immune cells that produce a T cell receptor (TCR). T cells can be naive (not exposed to antigen; increased expression of CD62L, CCR7, CD28, CD3, CD127, and CD45RA; and decreased expression of CD45RO compared to TCM), memory T cells (TM) (experienced antigen and long-lived), and effector cells (cytotoxic after experiencing antigen). TM can be further classified into subsets of central memory T cells ( TCM; increased expression of CD62L, CCR7, CD28, CD127, CD45RO, and CD95; and decreased expression of CD54RA compared to naive T cells) and effector memory T cells (TEM; decreased expression of CD62L, CCR7, CD28, CD45RA; and increased expression of CD127 compared to naive T cells or TCM). Effector T cells (TE) refer to antigen-experienced CD8+ cytotoxic T lymphocytes with decreased expression of CD62L, CCR7, CD28 and positive for granzyme and perforin compared to TCM. Other exemplary T cells include not only Tr1, Th3, CD8+CD28-, and Qa-1 restricted T cells, but also regulatory T cells such as CD4+CD25+ (Foxp3+) regulatory T cells and Treg17 cells.

[0262] T cell receptor: The T cell receptor (TCR) is a member of the immunoglobulin superfamily that has a variable antigen-binding domain, a constant domain, a membrane transmembrane region, and a short cytoplasmic tail, and can specifically bind to an antigen peptide bound to an MHC receptor. TCRs can be found on the surface of cells or in a soluble form and usually consist of a heterodimer having α and β chains (also known as TCRα and TCRβ, respectively), or γ and δ chains (also known as TCRγ and TCRδ, respectively). The extracellular portion of a TCR chain (e.g., an α-chain, β-chain ) contains two immunoglobulin domains, a variable domain at the N-terminus (e.g., an α-chain variable domain or Vα, β-chain variable domain or Vβ), and one constant domain adjacent to the cell membrane (e.g., an α-chain constant domain or Cα and β-chain constant domain or Cβ). Similar to immunoglobulins, the variable domain contains complementarity-determining regions (CDRs) separated by framework regions (FRs). TCRs are usually associated with the CD3 complex to form a TCR complex. As used herein, the term "TCR complex" refers to the complex formed by the association of TCR with CD3. For example, a TCR complex can consist of a CD3γ chain, a CD3δ chain, two CD3ε chains, a homodimer of CD3ζ chains, a TCRα chain, and a TCRβ chain. Alternatively, a TCR complex can consist of a CD3γ chain, a CD3δ chain, two CD3ε chains, a homodimer of CD3ζ chains, a TCRγ chain , and a TCRδ chain. "Components of a TCR complex" as used herein refers to a TCR chain (i.e., TCRα, TCRβ, TCRγ, or TCRδ) , a CD3 chain (i.e., CD3γ, CD3δ, CD3ε, or CD3ζ), or two ​​​​​​​​​​ The complex formed by the above TCR chain or CD3 chain (e.g., the complex of TCRα and TCR β, the complex of TCRγ and TCRδ, the complex of CD3ε and CD3δ, CD 3γ and CD3ε complex, or the sub-TCR complex of TCRα, TCRβ, CD3γ, CD3δ, and two CD3ε chains.

[0263] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to a amount of an agent (e.g., nucleic acid, drug, therapeutic, diagnostic, prophylactic, etc.) that, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or illness, treats the infection, disease, disorder, and / or illness, ameliorates their symptoms, diagnoses, prevents, and / or delays their onset. In some embodiments, a therapeutically effective amount is provided as a single dose. In some embodiments, a therapeutically effective amount is administered in a dosage regimen that includes multiple doses. One of ordinary skill in the art will understand that in some embodiments, a unit dosage form may be considered to contain a therapeutically effective amount of a particular agent or entity if it contains an amount effective when administered as part of such a dosage regimen.

[0264] Treat or treating: As used herein, the terms "treat" or "treating" preferably refer to an approach for obtaining a beneficial or desired result, including a beneficial or desired clinical result. Such beneficial or desired clinical results include, but are not limited to, one or more of the following: the growth of cancerous cells and other abnormal cells Reduce (or destroy cancerous cells or other abnormal cells), found in cancer Reduce the metastasis of cancerous cells, reduce the size of tumors, reduce the symptoms resulting from the disease Improve the quality of life of the person suffering from the disease, reduce the dosage of other drug therapies required to treat the disease Slow down the progression of the disease, and / or extend the individual's survival period .

[0265] Regulate: As used herein, the term "regulate" means to prepare, balance, or adapt one thing in response to a stimulus or towards a particular result. In one non-limiting example, the SRE and / or DRD of the present disclosure regulate the function or structure of the composition to which they are added, adhered, or conjugated in response to a particular stimulus and / or environment. Equivalents and Scope

[0266] One of ordinary skill in the art will recognize and be able to ascertain many equivalents of the specific embodiments of the present disclosure described herein with only routine experimentation. The scope of the present disclosure is not intended to be limited to the above description, but rather is what is set forth in the appended claims.

[0267] In the claims, articles such as "a", "an", and "the" may mean one or more than one unless the contrary is indicated or is otherwise apparent from the context. A claim or description that includes "or" between one or more members of a group means, unless the contrary is indicated or is otherwise apparent from the context, one, two or more of the group members. when present in, used in, or related to a given product or process, or all are is considered to hold. This disclosure includes embodiments in which only one member of the group is present in, used in, or related to a given product or process. This disclosure includes embodiments in which two or more, or all members of the group are present in, used in, or related to a given product or process.

[0268] It should also be noted that the term "comprising" is intended to be open-ended and permits the inclusion of additional elements or steps, but does not require them. When the term "comprising" is used herein, the term "consisting of" is also included and disclosed

[0269] When ranges are given, the endpoints are included. Further, unless otherwise indicated or not apparent from the context and understanding of one of ordinary skill in the art, values expressed as ranges are to be construed as including, in the context of this disclosure, any specific value or sub-range within the range to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise

[0270] In addition, it is understood that any particular embodiment of the present disclosure that falls within the scope of the prior art may be expressly excluded from any one or more of the claims. Such embodiments are considered known to one of ordinary skill in the art and thus may be excluded herein even if the exclusion is not expressly stated Regardless of whether or not, for any reason, any one or more claims may be excluded therefrom.

[0271] The terms used are terms of description and not of limitation, and that within the broader aspect thereof, changes may be made within the scope of the appended claims without departing from the true scope and spirit of the disclosure is understood.

[0272] The present disclosure has been described in some detail and with some particularity with respect to several described embodiments, but no such matter or embodiment or any particular embodiment is intended to be limiting, and in view of the prior art, the appended claims are to be construed so as to provide the broadest interpretation of such scope as can be effected, and thus, to effectively encompass the intended scope of the present disclosure and is to be construed in reference to the appended claims. The present disclosure is further illustrated by the following non-limiting examples. is further illustrated by the following non-limiting examples. is further illustrated by the following non-limiting examples. is further illustrated by the following non-limiting examples.

Examples

[0273] Figure 1 shows a representative procedure for in vitro characterization and / or verification of ACZ-controlled mbIL15 expression in T cells As shown in Figure 1, for example, according to the procedure described in Example 1, T cells may be transduced with an mbIL15 construct Following transduction, for example, according to the procedure described in Example 2, the T cells are treated under control conditions or with ACZ and assayed for IL15 expression and / or antigen-independent cell proliferation in vitro.

[0274] Figure 2 shows the in vivo expression of ACZ-controlled mbIL15 in T cells Shows representative procedures for characterization and / or verification. As shown in Figure 2, for example, in Example 1 According to the procedure described in, mbIL15 constructs may be transduced into T cells . After transduction, the T cells are, for example, according to the procedure described in Example 3, murine subjects (e.g g., NSG mice) and specimens of mice treated with vehicle or ACZ are assayed for I L15 expression and / or antigen-independent cell proliferation Example 1. T cell transduction by an mbIL15 construct controlled by acetazolamide (ACZ)

[0275] This example shows a method that can be used to prepare an mbIL15 construct controlled by ACZ, and a method that can be used for transduction of T cells by an mbIL15 construct controlled by ACZ IL15 construct assembly

[0276] OT-IL15-292, OT-IL15-293, OT-IL15-294, and OT-IL15-295 were each constructed in a pELN S vector (third-generation self-inactivating lentiviral expression vector) using standard molecular biology techniques. The co don-optimized IL15, GS linker, B7-1 hinge, transmembrane domain, and cytoplasmic tail encoding gene fragments (Gblocks) were purchased from Integrated DN A Technologies, Inc. (IDT, Coralville, Iowa) . The gene fragments were inserted into the pELNS vector and controlled by the EF1a promoter using Gibson assembly (NEBuilder Hifi) ​​​placed below. The collected plasmids were transformed into Escherichia coli (NEB stable) with respect to amplification and sequence confirmed before proceeding with virus production.

[0277] Table 4 presents the nucleic acid and amino acid sequences for the components of the constitutive IL15 constructs (OT-IL15-292 and OT-IL15-294) and the ACZ-controlled IL15 constructs (OT-IL15-293 and OT-IL15-295) disclosed herein. The amino acids underlined in bold in Table 4 indicate the differences in the B7-1 cytoplasmic tail between the construct tracts OT-IL15-292 / OT-IL15-293 and OT-IL15-294 / OT-IL15-295. The constructs OT-IL15-293 and OT-IL15-295 contain destabilizing domains classified in Table 4 as CA2 (M1del, L156H).

[0278] [Table 4-1] [Table 4-2] [Table 4-3]

[0279] Table 5 presents the nucleic acid and amino acid sequences for the constitutive IL15 (IL15-292 and IL15-2 94) and the ACZ-controlled IL15 (IL15-293 and IL15-29 5 constructs.

[0280] ​

Table 5-1

Table 5-2

Table 5-3

Table 5-4

Table 5-5

[0281] HEK293T cells were seeded on collagen-coated tissue culture plates until they reached 70 % confluence. Cells were transfected with the pELNS transfer vector carrying the constitutive (IL15-292 or IL15-294) or control (IL15-293 or IL15-295) IL 15 constructs, and the packaging plasmids (pRSV.REV, pMDLg / p.RRE, and pMD2.G) using Lipofectamine 3000 transfection reagent in Opti-MEM medium. The medium was replaced with serum-free medium 6 - 8 hours after transfection. The supernatant containing the virus was collected 24 hours after transfection, fresh medium was added, and the supernatant was collected again 48 hours after transfection. The virus was transfected. The medium was replaced with serum-free medium 6 - 8 hours after transfection. The supernatant containing the virus was collected 24 hours after transfection, fresh medium was added, and the supernatant was collected again 48 hours after transfection. The supernatant containing the virus was collected 24 hours after transfection, and fresh medium was added. The supernatant was collected again 48 hours after transfection. The virus The supernatant was filtered to remove debris and concentrated by ultracentrifugation on a 20% sucrose density gradient. The virus was resuspended, aliquoted, and stored in a -80°C freezer. The nucleotide sequences of pELNS transfer vectors OT-IL15-292, OT-IL15-293, OT-IL15-294, and OT-IL15-295 are SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37, respectively. respectively.

[0282] pELNS transfer vectors OT-IL15-292, OT-IL15-293, OT-IL15-294, and OT-IL15-295 L15-294, and OT-IL15-295 are SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37, respectively. respectively.

[0283] As used herein, the lentivirus used to transduce cells is referred to by their construct name (e.g., IL15-292, IL15-293, IL15-294, IL15-295, CD19-IL15-057, CD19-IL15-058, or CD19-063) or their transfer vector name (e.g., OT-IL15-292, OT-IL15-293, OT-IL15-294, OT-IL15-295, OT-CD19-IL15-057, OT-CD19-IL15-058, or OT-CD19-063). For example, IL15-292, IL15-293, IL15-294, IL15-295, CD19-IL15-057, CD19-IL15-058, or CD19-063) or their transfer vector name (e.g., OT-IL15-292, OT-IL15-293, OT-IL15-294, OT-IL15-295, OT-CD19-IL15-057, OT-CD19-IL15-058, or OT-CD19-063). 4, IL15-295, CD19-IL15-057, CD19-IL15-058, or CD19-063) or their transfer vector name (e.g., OT-IL15-292, OT-IL15-293, OT-IL15-294, OT-IL15-295, OT-CD19-IL15-057, OT-CD19-IL15-058, or OT-CD19-063). For example, OT-IL15-292, OT-IL15-293, OT-IL15-294, OT-IL15-295, OT-CD19-IL15-057, OT-CD19-IL15-058, or OT-CD19-063). For example, OT-CD19-IL15-057, OT-CD19-IL15-058, or OT-CD19-063). As used herein, the lentivirus used to transduce cells is referred to by their construct name (e.g., IL15-292, IL15-293, IL15-294, IL15-295, CD19-IL15-057, CD19-IL15-058, or CD19-063) or their transfer vector name (e.g., OT-IL15-292, OT-IL15-293, OT-IL15-294, OT-IL15-295, OT-CD19-IL15-057, OT-CD19-IL15-058, or OT-CD19-063). T cell stock

[0284] T cells were isolated from Leukopak collected from healthy human donors. After PBMC separation by Ficoll density gradient, T cells were isolated using a negative selection kit (StemCell Technologies) according to the manufacturer's protocol. The T cells were resuspended in cell freezing medium (Bambanker), aliquoted, and stored in liquid nitrogen. After PBMC separation by Ficoll density gradient, T cells were isolated using a negative selection kit (StemCell Technologies) according to the manufacturer's protocol. The T cells were resuspended in cell freezing medium (Bambanker), aliquoted, and stored in liquid nitrogen. After PBMC separation by Ficoll density gradient, T cells were isolated using a negative selection kit (StemCell Technologies) according to the manufacturer's protocol. The T cells were resuspended in cell freezing medium (Bambanker), aliquoted, and stored in liquid nitrogen. The T cells were resuspended in cell freezing medium (Bambanker), aliquoted, and stored in liquid nitrogen. The T cells were resuspended in cell freezing medium (Bambanker), aliquoted, and stored in liquid nitrogen. Lentiviral transduction of T cells

[0285] T cells were thawed, the cells were washed and counted. The T cells were mixed with CD3 / CD28 beads (Invitrogen cat#11141D) at a bead to T cell ratio of 3:1. 5×10 5 cells / well were added to a 24-well plate in 500 μL of medium. The cells were activated for 24 hours. The next day, lentivirus was thawed and added to each well at different volumes. After 24 hours, 500 μL of fresh medium was added to the wells and the cells were grown by adding equal volumes of fresh medium every 2 - 3 days to maintain a cell density of 0.5 - 1×1 0 / mL. The cells were analyzed by flow cytometry and expression was confirmed on day 5 6 or 6. The cells were grown for 9 - 10 days. Example 2. In vitro analysis of mbIL15 expression controlled by ACZ and ACZ-controlled T cell proliferation

[0286] This example shows (i) ACZ-controlled mbIL15 expression in T cells, and (ii) in vitro verification of ACZ-controlled proliferation of T cells expressing ACZ-controlled mbIL15.

[0287] Human primary T cells capable of constitutively expressing mbIL15 or ACZ-controlled mbIL15 were prepared according to the method described in Example 1 above. See Figure 1.

[0288] After transduction and growth of the T cells, the CD3 / CD28 beads were removed using a magnet, the cells were washed twice, resuspended in fresh medium and counted. The cells were placed in a 12-well plate at 1 ×10 6 in 2 mL. Non-transduced cells from one well served as a control.​​​​ and cultured in the presence of 2 ng / mL of IL15. T cells expressing the control construct were cultured in the absence or presence of acetazolamide (ACZ, 30, 10, 3, 1, 0.3 μM). Cell numbers were monitored by flow cytometry every 3 - 4 days, and the cells were cultured for 10 - 12 days. At each time point, 100 μL of cells were collected from the wells and analyzed by flow cytometry. The cells were split as needed. Cell cultures were maintained in 12 - well plates by taking a portion and adding medium to a new plate. The volume of each well was recorded before and after splitting, and the final volume for cell number assessment was calculated. IL15 or ACZ was replenished at the final concentration in the fresh medium added during each split. See Figure 1.

[0289] The number of T cells was determined by flow cytometry. The number of cells transduced with the empty vector (EV) decreased to background levels in 3 - 5 days in the absence of IL15, and the cells proliferated 11 - fold in the presence of 2 ng / mL of exogenous IL15 (Figure 3A). T cells expressing constitutive IL15 - 292 and IL15 - 294 proliferated 18 - 21 - fold in 10 days, respectively (Figure 3A). In T cells expressing IL15 - 293, the maximum proliferation was 9.5 - 11 - fold at 30, 10, 3 μM (Figure 3B). At the lowest concentration tested (0.3 μM), the cells proliferated 3.3 - fold. These cells survived longer (0.8 - fold) compared to EV cells without drug treatment (0.8 - fold). In T cells expressing IL15 - 295, the maximum proliferation was at 30, 10, At 3 μM, it was 8.2 - 10 - fold, and the cells had a 4.9 - fold increase at the lowest concentration tested (0.3 μM). Without drug treatment, these cells survived longer (0.9 - fold) compared to EVs.

[0290] The effect of different concentrations of ACZ on IL15 expression was examined. T cells were started at 100 μM, treated with ACZ for 24 hours, and diluted 3 - fold between 9 points. Analysis of %IL15 + T cells (Figure 4A) and IL15 mean fluorescence intensity (MFI) (Figure 4B) showed similar dose - response curves for both OT - IL15 - 293 and OT - IL15 - 295. Expression increased 4 - 5 - fold between the highest and lowest concentrations of ACZ (both %IL15 + T cells and IL15 MFI). 50 EC50 values were 0.29 μM and 0.22 μM based on %IL15 + T cells, and 0.65 μM and 0.44 μM based on IL15 MFI for OT - IL15 - 293 and OT - IL15 - 295, respectively. Example 3. In vivo analysis of mbIL15 expression controlled by ACZ and ACZ - controlled T - cell proliferation

[0291] This example shows (i) ACZ - controlled mbIL15 expression in T cells, and (ii) in vivo verification of ACZ - controlled proliferation of T cells expressing ACZ - controlled mbIL15. NK cell proliferation

[0292] A portion of PBMCs isolated from Leukopak was used to isolate NK cells using a negative selection kit (StemCell Technologies) according to the manufacturer's protocol. ​​​​​​​​​​​were used to increase. Cells were transfected with a vector expressing 4-1BB-L and membrane-bound IL21 and cultured for 7-14 days at a ratio of 1:1 with recombinant IL2 (100 U / mL). Proliferation was monitored by cell counting and purity was evaluated by flow cytometry. In vivo analysis

[0293] Human primary T cells capable of expressing constitutive mbIL15 or mbIL15 controlled by ACZ were prepared according to the method described in Example 1 above. After transduction and proliferation of T cells, CD3 / CD28 beads were removed using a magnet, and the cells were washed twice and resuspended in fresh medium and counted. T cells were mixed with expanded NK cells and each animal received 5×10 T cells and 2×10 6 expanded NK cells. 6 The cells were injected into NSG mice by intravenous injection. Animals injected with T cells expressing a control construct were administered 200 mg / kg of ACZ or vehicle by PO injection daily. Every 3-4 days, 50 μL of blood was analyzed by flow cytometry for the presence of T cells and NK cells using antibodies against mouse and human CD45, CD3, and CD56. IL15 expression on day 25 was analyzed using an anti-human IgG antibody conjugated to IL15Ra-Fc and a fluorescent dye. See Figure 2.

[0294] Proliferation of T cells expressing constitutive and controlled IL15 constructs and their effect on bystander NK cells were analyzed in vivo in NSG mice for 25 days. Evaluated (Figs. 5A-5B). The number of cells transduced with the empty vector (EV) decreased slowly over time. T cells expressing constitutive IL15-292 and IL15-294 proliferated up to 13-fold compared to the frequency on day 3. In mice injected with T cells expressing the control construct, the frequency of cells decreased in the presence of vehicle treatment. In the group treated daily with ACZ, cells proliferated up to 7-8-fold compared to the frequency on day 3. Bystander NK cells survived and proliferated in the presence of T cells expressing the constitutive IL15 construct or in the presence of T cells expressing the control IL15 construct treated daily with ACZ.

[0295] IL15 expression in in vivo T cells on day 25 was analyzed by flow cytometry (Fig. 5C). T cells transduced with the constitutive constructs IL15-292 and IL15- 294 expressed IL15 at high levels (82% and 61%). IL15 expression was <1.5% not only in the EV group but also in vehicle-treated IL15-293 and IL15-295. IL15 expression levels were 11% and 9% in T cells transduced with IL15-293 and IL15-295 in the group treated with ACZ. Example 4: In vivo analysis of efficacy and proliferation in CART cells expressing constitutive and control mbIL15

[0296] This example shows that control mbIL15 conjugated with ACZ administration enhances the anti-tumor efficacy and proliferation of CD19 CART cells in the presence of CD19-positive tumors. Generation and Lentivirus of Tandem CD19 CAR and mbIL15 Constructs Stock

[0297] Lentiviral vector constructs co-expressing CD19 CAR and mbIL15 Structures and lentivirus stocks were basically generated as described in Example 1 The CD19 CAR sequence (AA sequence: SEQ ID NO: 38; NA sequence: SEQ ID NO: 3 9) consists of a CD8a leader sequence (aa1-21 in Uniprot ID P01732 ), the FMC63 (anti-CD19) single-chain variable fragment (scFv), the hinge and transmembrane domains from CD8 (aa138-206 in Uniprot ID P01732) , the co-stimulatory domain from 4-1BB (aa21 -255 in Uniprot ID Q07011), and the CD3zeta signaling domain (aa52-164 in Uniprot IDP2 0963). The bicistronic transgene expression cassette (5' to 3' as described)

[0298] contains a regulatory or constitutive mbIL15, a P2A sequence (AA sequence: SEQ ID NO: 40; NA sequence : SEQ ID NO: 41), and anti-CD19 CAR downstream of P2A (see Figure 6). For the control construct (CD19-IL15-058; AA sequence: SEQ ID NO: 42; NA sequence : SEQ ID NO: 43), an IL15-293 construct containing mbIL15 operably linked to CA2 (L156H) DRD was used (AA sequence: SEQ ID NO : 24, NA sequence: SEQ ID NO: 25). For the constitutive construct (CD19-IL15- 057; AA sequence: SEQ ID NO: 45; NA sequence: SEQ ID NO: 46), the CA2 region For the constitutive construct (CD19-IL15-057; AA sequence: SEQ ID NO: 45; NA sequence: SEQ ID NO: 46), the CA2 region For the constitutive construct (CD19-IL15-057; AA sequence: SEQ ID NO: 45; NA sequence: SEQ ID NO: 46), the CA2 region A construct containing mbIL15 operably linked to a native array was used (see Figure 6). The nucleotide sequence of lentivirus OT-CD19-IL15-058 is SEQ ID NO: 44, and the nucleotide sequence of lentivirus OT-CD19-IL15-057 is SEQ ID NO: 45. Expression of the mbIL15-CAR construct in peripheral blood T cells

[0299] Peripheral blood T cells were activated, transduced, and expanded until day 10, and then frozen in cell freezing medium basically as described in Example 1 and used in an in vivo human Nalm6-Luc xenograft tumor model. mbIL15 and CAR expression were analyzed by flow cytometry using a recombinant protein containing the extracellular domain of human CD19 fused to an anti-IL15 antibody and the human IgG1 Fc domain (CD19-Fc), respectively. Cells transduced with only CD19 CAR or non-transduced cells were used as controls. 72% of the cells transduced with the control CD19 CAR construct were CAR+mbIL15- (Figure 7A). For cells transduced with a lentiviral vector expressing constitutive mbIL15 and CAR (CD19-IL15-057), 26% of the cells were CAR+, and 13% were double positive for CAR+mbIL15+. For cells transduced with a vector expressing control mbIL15 and CAR (CD19-IL15-058), 25% were CAR+mbIL15- in the absence of ACZ, and 9.7% were CAR+mbIL15+ double positive after 24 hours of exposure to 10 μM ACZ. These results show that the constitutive ​ or lentiviral vectors expressing CD19 CAR in combination with control mbIL15 After transduction of T cells with the vector, expression of both CAR and mbIL15 was confirmed . Evaluation of mbIL15-CAR T cells in the Nalm6-Luc xenograft model

[0300] To evaluate the effect of mbIL15 on the antitumor activity of CAR T cells, lentiviral vectors expressing CD19 CAR with or without constitutive or control mbIL15 were used to transduce T cells, which were then injected into mice after transplantation of CD19+ Nalm6-Luc tumors . CD19+ Nalm6 cells expressing luciferase (Nalm6-Lu c) were injected into NSG mice via the intravenous route (1×10 / mouse), and tumor growth was measured once or twice a week by bioluminescence imaging (total flux units of photons / second (p / s 6 ) after intraperitoneal injection of D-luciferin. On day 6, when the average tumor size reached approximately 10 total p / s, animals were randomly withdrawn into new cages (N = 8 per group). CD19 CAR T cells (engineered with or without constitutive or control mbIL15 ) were thawed for injection into tumor-bearing mice. CAR expression in T cells was determined after thawing and 24-hour restimulation with anti-CD3 / CD28 beads . CAR T cells across different groups were normalized based on %CAR+ cells. Each mouse received 0.3×10 6 CAR+ cells, and the total number of T cells in the injected product was adjusted to 7×10 T cells by addition of T cells transduced with EV . 6 6 . ​​​​​​Adjusted.

[0301] The first group received T cells engineered with EV as a negative control, and the second group , received control CART cells without mbIL15 (CD19-063; AA sequence: SEQ ID NO: 48; NA sequence: SEQ ID NO: 49; vector sequence: SEQ ID NO: 50), and the third group received CART cells that constitutively express mbIL5 (CD19-IL15-057) . Groups 4 and 5 received CART cells that co-expressed control mbIL15 (CD19-IL15-058 ), and one group was administered 200 mg / kg of AC Z by daily PO administration, while the other group was treated daily with vehicle until the end of the study (~50 days). To monitor T cell proliferation, animals were added to each group ([[]] n = 4 for blood and n = 4 for bone marrow). Blood (50 μL) was taken from the submandibular vein on days 7, 14, and 21, and bone marrow (from the femur) was collected on day 14 after T cell injection. Erythrocytes were lysed and stained with fluorescent dye-conjugated antibodies against human CD45, CD3, and mouse CD45, and the cells were analyzed by flow cytometry . Tumor growth was measured until day 55 after tumor transplantation, and the evaluation items included not only the effects on the health of the animals, such as hind limb paralysis and weight loss, but also included 10 total flux units. The tumor growth in individual mice in each group is shown in Figure 7B, and the group means are shown in Figure 7 10 C. In all animals in group 2 treated with T cells transduced with EV, rapid

[0302] tumor growth was observed, and in the treatment with control CART cells that did not achieve complete remission, tumor growth was , Delayed until the 25th. CART cells expressing control mbIL15 and vehicle treatment Tumor growth rates in mice treated with were similar to those in the control CART group. Control In contrast, tumors were treated with CART cells expressing constitutive mbIL15, and control mbIL15 In the groups treated with ACZ in addition to the CART cells expressing, 5 out of 8 and 6 out of 8 animals regressed to background levels, respectively. The number of T cells In the blood of mice treated with control T cells, control CART, and CART expressing control mbIL15 decreased over time (to <0.2% on day 21, Figure 7 D), and was low in the bone marrow (to <1% on day 14, Figure 7E). In contrast, constitutive mbI In mice treated with CART expressing control mbIL15 with L15 or ACZ, the number of T cells increased over time in the blood (to >1% on day 21, Figure 7D), and was high in the bone marrow (20% for constitutive, 10% for control plus ACZ, Figure 7E). These results demonstrate that control mbIL15 conjugated with ACZ treatment enhances the CART anti-tumor response compared to T cells expressing only CAR after injection of sub-optimal CAR T cell doses, and promotes the expansion of CAR-engineered T cells after tumor clearance. Example 5: Isolation of TILs from patient tumor specimens

[0303] Tumor specimens of the head and neck were obtained from the Cooperative Human Tissue Network. The tumor specimens were cut into 1-3 mm fragments in Hank's balanced salt solution (HBSS) buffer , and the fragments were treated with 6000 IU / mL of ​2 mL of medium containing IL2 (1X penicillin / streptomycin, 1 mM sodium pyruvate, 1X HEPES, 50 μM 2-mercaptoethanol (Invitrogen ), and 10% heat-inactivated human AB serum (Valley Bio)) supplemented RPMI-1640) was placed in a 24-well plate at 1 fragment / well. Half of the medium was replaced with fresh medium containing IL2 on day 5 from the start, and the cells were split into multiple wells to become confluent over 3 weeks. This culture process is called the pre-rapid expansion protocol (REP). TILs from other tumor types are isolated using

[0304] essentially the same process. To determine the change in the frequency of T cells before and after pre-REP culture, a portion of the tumor fragment was digested with collagenase and deoxyribonuclease I prior to pre-REP culture to generate a single-cell suspension, which was compared to the cells obtained after pre-REP culture. The frequency of T cells was analyzed by flow cytometry using fluorescent dye-conjugated anti-CD45 and anti-CD3 antibodies. As shown in Figure 8A, almost half (44.29 ± 21.67%) of the cells in the pre-culture tumor cell suspension were

[0305] CD45+, and only ~39.85 ± , TILs from a number of other human tumor types have been isolated in the same manner. Example 6. In vitro analysis of regulated mbIL15 expression by ACZ in TILs BaEV pseudotyped lentivirus production

[0306] HEK293T cells were cultured on collagen-coated tissue culture plates for 70 min. The cells were seeded to 50% confluence in Opti-MEM medium with no liposomes. Use Fectamine 3000 transfection reagent to transfect constitutively (IL15-292 ) or control (IL15-293) IL15 constructs, and packaging plugs Smids (pRSV.REV, pMDLg / pRRE, and OT-BaEVg-002( The cells were transfected with the pELNS transfer vector carrying SEQ ID NO:51). The medium was replaced with serum-free medium 6 to 8 hours after transfection. The supernatant containing the lysate was harvested 24 hours after transfection, and fresh medium was added. The supernatant was collected again 48 hours after transfection. The virus was then filtered to remove debris and concentrated by low-speed ultracentrifugation. It was suspended, aliquoted and stored in a -80C freezer. Transduction of TILs with lentivirus

[0307] 96-well uncoated tissue culture plates were incubated at 37°C for 2 hours or at 4°C overnight. Incubated with 35 μg / mL RetroNectin (Takara Bio) in PBS. RetroNectin was removed and the plate was washed with PBS. The BaEV pseudotyped lentivirus and TIL cell medium prepared as above were added at 50 μL / well. The total volume of the wells was added to each well and the plates were centrifuged at low speed for 2 hours at 32°C. TILs generated from head and neck tumor specimens prepared as described in Example 5 were engineered in PREP culture after 3 weeks. TILs were activated for 24 hours in 24-well plates with anti-CD3 / CD28 beads at a bead-to-T cell ratio of 3:1. The activated TILs were placed on virus-coated plates and centrifuged at 800 g for 2 hours and cultured in medium for 4 days at 37°C. Cells from one well were treated similarly without adding virus and used as a negative control ("non-transduced"). Cells transduced with the control mbIL15 construct were treated with either 10 μM ACZ or DMS O for 24 hours. Expression of control mbIL15 in TILs in response to ACZ

[0308] mbIL15 expression was determined by flow cytometry using two staining reagents: a fluorescent dye-conjugated anti-IL15 antibody and a recombinant protein containing the extracellular domain of IL15Ra fused to the human IgG1 Fc domain (IL15Ra-Fc). The frequency of mbIL1 5+ cells was determined based on co-staining with anti-IL15 and IL15Ra-Fc (identified as the IL15+IL15Ra-F c+ double-positive population). As shown in Figure 8B, 45.5% of the TILs expressed constitutive mbIL15 (IL15-292). In the presence of DMSO, control mbIL15 (IL15-293) expression was 1 7.1% with a low MFI. In contrast, in the presence of ACZ, control mbIL15 expression increased to 42.5% with a high M FI. These data indicate that ACZ increases the expression of transduced TI ​​​​In L, it is shown that mbIL15 induced by CA2 DRD is controlled. Example 7: In vivo analysis of TILs expressing constitutive and regulated mbIL15

[0309] To evaluate the effect of regulated mbIL15 on the antitumor activity of tumor-infiltrating lymphocytes (TILs), a human patient-derived xenograft (hPDX) model is used. TILs are isolated from patient tumor specimens, e.g., head and neck tumor specimens as described in Example 6. TILs are transduced with either the BaEV pseudotyped lentiviral vector containing either the IL15-292 construct or the IL15-293 construct, or the BaEV pseudotyped lentiviral empty vector (EV) as described in Example 6, and subsequently optionally frozen. Patient-derived xenografts (hPDX) engrafted with TILs from tumor specimens are made by subcutaneous implantation into the right flank of NSG mice. Tumor growth is measured once or twice a week using calipers. At the start of the study, tumors are measured and the mice are randomly withdrawn and cohorted into new cages such that the average tumor volume is similar across all groups (N = 8 per group). Engineered and engrafted TILs are thawed if necessary, stimulated with PMA, and subsequently injected into mice bearing tumors. Each mouse receives an equal number of engineered TILs.

[0310] Group 1 receives non-transduced TILs supplemented with recombinant human IL2 (hIL2) as a benchmark control, and Group 2 receives TILs transduced with constitutive mbIL15 (IL15-292 ). Groups 3 and 4 receive TILs transduced with regulated mbIL15 (IL Receive TIL transfected with (15-293). Group 3 is administered 200 mg / kg of ACZ PO daily, and Group 4 is treated daily with vehicle until the end of the study. To monitor TIL persistence, animals are added to each group (n = 4 for blood). Blood (50 μL) is taken from the submandibular vein on the pre-determined day. Red blood cells are lysed and stained with fluorescent dye-conjugated antibodies against human CD45, CD3, and mouse CD45, and the cells are analyzed by flow cytometry. Tumor growth is measured up to approximately 90 days, and the evaluation items include not only the effects on animal health such as tumor necrosis and weight loss, but also maximum caliper measurements.

[0311] Tumor growth in individual mice in each group is continued, and group averages are collected. In animals in Group 1 treated with hIL2 in addition to non-transfected TIL, a delay in tumor growth is expected. Since little mbIL15 is expressed by TIL, no tumor growth inhibition is observed in Group 4 In contrast, in Groups 2 and 3, both groups have TIL that express mbIL15, which enhances their persistent and correlated anti-tumor activity, so the tumors will regress substantially, in some cases to baseline. Example 8: Isolation of NK Cells from Cord Blood

[0312] Cryopreserved mononuclear cell fraction cord blood units were obtained from BioBridge Global or from. Cord blood was diluted 1:1 with phosphate buffered saline (PBS) and layered over a cushion of Ficoll l-Paque+ (Sigma Cat.No.GE17-1440-02) ​It was centrifuged above. The leptomeninges containing mononuclear cells (MNCs) were collected and the MNCs were washed and counted. NK cells were isolated from the MNCs using the EasySep Human NK Cell Iso lation Kit (Stemcell Technologies Cat.No. 17955). The NK cells were counted and their purity was checked by FACS using CD56 , CD16, CD3, and viability staining. Example 9: In vitro analysis of controlled mbIL15 expression by ACZ in NK cells NK cell proliferation

[0313] One day before NK cell isolation as described in Example 8, feeder cells (4-1BBL and mb K562 cells expressing IL-21) were thawed in complete NK cell medium (RPMI (ThermoFisher) with Glutamax, 10% heat-inactivated fetal bovine serum (Gibco), 1 X penicillin / streptomycin, 1 mM sodium pyruvate, 1X HEPES , 50 μM 2-mercaptoethanol). On the day of NK cell isolation, 10× 10 6 of the feeder cells were treated with mitomycin C to inhibit their proliferation, washed to remove excess drug. NK cells were added to the feeder cells at an effector-to-target ratio of 1:2 in NK cell medium supplemented with 200 U / mL of recombinant human IL2 (rhIL 2; PeproTech). The NK cell culture was increased by supplementing the cell culture with NK cell medium and rhIL2 every two days and analyzed by FACS for NK cell proliferation. Transduction of NK cells with lentivirus

[0314] ​​The 96-well non-coated tissue culture plates were incubated at 37 °C for 2 hours or at 4 °C overnight, cultured with 35 μg / mL RetroNectin (Takara Bio) in PBS and then RetroNectin was removed and the plates were washed with PBS. BaEV pseudotyped lentivirus prepared as described in Example 6 and NK cell medium were added to each well at a total volume of 50 μL / well, and the plates were centrifuged at low speed at 32 °C for 2 hours. 100 μL of NK cell transduction medium (NK cell medium with 1 mg / mL Synperon ic F 108 (Sigma-Aldrich) and 200 U / mL rhIL2) containing 1×10 of NK cells was added to each well, and the cells were grown in NK cell medium for 4 days. Control of mbIL15 construct by ACZ NK cells from three different donors were isolated, grown, and transduced with BaEV pseudotyped lentivirus containing either the IL15-292 construct or the IL15-293 construct. The titer of the IL15-292 lentivirus was 2.38×10 5 T U / mL while the titer of the IL15-293 lentivirus was 6.51×10 T

[0315] U / mL (as measured by Jurkat qPCR titer), and 4 μL of lentivirus and 46 μL of NK cell medium were added to each well. After the cells were grown for 4 days, 10 μM ACZ or vehicle (DMSO) was added and the cells were cultured overnight. Expression of mbIL15 was analyzed the next day (5 days after transduction) using FACS. 8 T U / mL while the titer of the IL15-293 lentivirus was 6.51×10 8 T U / mL (as measured by Jurkat qPCR titer), and 4 μL of lentivirus and 46 μL of NK cell medium were added to each well. After the cells were grown for 4 days, 10 μM ACZ or vehicle (DMSO) was added and the cells were cultured overnight. Expression of mbIL15 was analyzed the next day (5 days after transduction) using FACS. After the cells were grown for 4 days, 10 μM ACZ or vehicle (DMSO) was added and the cells were cultured overnight. Expression of mbIL15 was analyzed the next day (5 days after transduction) using FACS. After the cells were grown for 4 days, 10 μM ACZ or vehicle (DMSO) was added and the cells were cultured overnight. Expression of mbIL15 was analyzed the next day (5 days after transduction) using FACS. After the cells were grown for 4 days, 10 μM ACZ or vehicle (DMSO) was added and the cells were cultured overnight. Expression of mbIL15 was analyzed the next day (5 days after transduction) using FACS.

[0316] mbIL15 expression was determined by flow cytometry using two staining reagents: IL15Ra-Fc and anti-CD56 antibody. The frequency of mbIL15+ cells was determined relative to the number of NK cells as determined by anti-CD56 antibody. As shown in Figure 9, more than 40% of NK cells from umbilical cord blood of two out of three donors expressed mbIL15, and approximately 70% of NK cells from umbilical cord blood of one out of three donors expressed mbIL15. In the presence of DMSO, the constitutive mbIL15 expression was less than 10% in NK cells regardless of the donor. In contrast, in the presence of ACZ, the constitutive mbIL15 expression increased by more than 40% in NK cells regardless of the donor. These data indicate that ACZ induces mbIL15 controlled by CA2 DRD in transduced NK cells. For evaluating the effect of constitutive mbIL15 on the anti-tumor activity of NK cells, an HL-60 animal model of acute myeloid leukemia was used. Umbilical cord blood NK cells were transduced with a BaEV pseudotyped lentiviral vector containing either the IL15-292 construct or the IL15-293 construct as described in Example 9, or a BaEV pseudotyped lentiviral empty vector (EV), and were optionally frozen after transduction. HL-60 cells expressing luciferase (HL-60-luc) were intravenously injected into NSG mice (1×10 / mouse), and tumor growth was measured by bioluminescence imaging (after intraperitoneal injection of D-luciferin). As shown in Figure 9, more than 40% of NK cells from umbilical cord blood of two out of three donors expressed mbIL15, and approximately 70% of NK cells from umbilical cord blood of one out of three donors expressed mbIL15. In the presence of DMSO, the constitutive mbIL15 expression was less than 10% in NK cells regardless of the donor. In contrast, in the presence of ACZ, the constitutive mbIL15 expression increased by more than 40% in NK cells regardless of the donor. These data indicate that ACZ induces mbIL15 controlled by CA2 DRD in transduced NK cells. Example 10: In vivo analysis of NK cells expressing constitutive and controlled mbIL15 To evaluate the effect of constitutive mbIL15 on the anti-tumor activity of NK cells, an HL-60 animal model of acute myeloid leukemia was used. Umbilical cord blood NK cells were transduced with a BaEV pseudotyped lentiviral vector containing either the IL15-292 construct or the IL15-293 construct as described in Example 9, or a BaEV pseudotyped lentiviral empty vector (EV), and were optionally frozen after transduction. HL-60 cells expressing luciferase (HL-60-luc) were intravenously injected into NSG mice (1×10

[0317] / mouse), and tumor growth was measured by bioluminescence imaging (after intraperitoneal injection of D-luciferin). Umbilical cord blood NK cells were transduced with a BaEV pseudotyped lentiviral vector containing either the IL15-292 construct or the IL15-293 construct as described in Example 9, or a BaEV pseudotyped lentiviral empty vector (EV), and were optionally frozen after transduction. HL-60 cells expressing luciferase (HL-60-luc) were intravenously injected into NSG mice (1×10 / mouse), and tumor growth was measured by bioluminescence imaging (after intraperitoneal injection of D-luciferin). HL-60 cells expressing luciferase (HL-60-luc) were intravenously injected into NSG mice (1×10 / mouse), and tumor growth was measured by bioluminescence imaging (after intraperitoneal injection of D-luciferin). 6 / mouse), and tumor growth was measured by bioluminescence imaging (after intraperitoneal injection of D-luciferin). Measured once or twice a week in units of total photon flux per second (p / s). On day 6 the average tumor size was approximately 10 6 total p / s was reached, the animals were randomly assigned to new cages (N = 8 per group). Engineered NK cells were thawed as needed and injected into mice bearing HL-60 tumors. Each mouse received an equal number of mbIL15+ cells and the total number of NK cells in the injected product was adjusted by the addition of NK cells transduced with EV Group 1 received NK cells engineered with EV as a negative control, and Group 2 received NK cells transduced with constitutive mbIL5 (construct IL15-292). Groups 3 and 4 received NK cells transduced with control mbIL15 (construct IL15-293)

[0318] Group 3 was administered 200 mg / kg of ACZ PO daily, and Group 4 was treated daily with vehicle until the end of the study. Animals were added to each group to monitor NK proliferation (n = 4 for blood analysis). Blood (50 μL) was collected from the submandibular vein on days 7, 14, and 21. Red blood cells were lysed and stained with fluorescent dye-conjugated antibodies against human CD45, CD3, and mouse CD45, and the cells were analyzed by flow cytometry. Tumor growth was measured until approximately 30 days and the evaluation included effects on animal health such as hind limb paralysis and weight loss, as well as the maximum total flux units (10 (50 μL) was taken from the submandibular vein on days 7, 14, and 21. Red blood cells were lysed and stained with fluorescent dye-conjugated antibodies against human CD45, CD3, and mouse CD45, and the cells were analyzed by flow cytometry. Tumor growth was measured until approximately 30 days up to and included effects on animal health such as hind limb paralysis and weight loss, as well as the maximum total flux units (10 ) 10 ) are included Tumor growth is measured in individual mice in each group and group averages are collected In all animals in Group 1 injected with NK cells transduced with EV, rapid tumor Tumor growth is expected. The tumor growth rate in the mice of Group 4 will be similar to that of the control EV group because almost no mbIL15 is expressed. In contrast, in Groups 2 and 3, the mice in both groups express mbIL15 in NK cells, and these cells show higher proliferation and persistence compared to the NK cells of Groups 1 and 4. Therefore, the tumors will substantially regress. This example shows that ACZ can induce in vivo expression of mbIL15 in transduced NK cells and has a higher NK anti-tumor response than NK cells that are transduced and treated with a vehicle and express almost no mbIL15.

[0319] In the above detailed description, the present invention has been described with reference to specific embodiments. However, it will be recognized that various modifications and changes can be made without departing from the scope of the present invention as described in the appended claims.

[0320] The following items are examples of various embodiments of the present disclosure.

[0321] Item 1. A nucleic acid molecule comprising a polynucleotide encoding a recombinant protein comprising a drug-responsive domain (DRD ) operably linked to an IL15 payload, wherein the DRD is derived from human carbonic anhydrase II (CA2) and contains one, two, three, four, or more mutations relative to SEQ ID NO: 1 or SEQ ID NO: 2.

[0322] Item 2. The DRD contains one, two, three, or more ​​​​​The nucleic acid molecule of item 1, comprising four amino acid additions, substitutions, and / or deletions.

[0323] Item 3. DRD is the nucleic acid molecule of item 2, comprising the amino acid sequence of SEQ ID NO: 4.

[0324] Item 4. DRD is the nucleic acid molecule of item 3, consisting of the amino acid sequence of SEQ ID NO: 4.

[0325] Item 5. The IL15 payload is any of the nucleic acid molecules of items 1 to 4, comprising the amino acid sequence of SEQ ID NO: 8. Any nucleic acid molecule.

[0326] Item 6. The IL15 payload is any one of the nucleic acid molecules of items 1 to 5, which is the N-terminus of DRD. Of the nucleic acid molecule.

[0327] Item 7. The IL15 payload is the nucleic acid molecule of item 6, which is a membrane-bound IL15 polypeptide. Molecular.

[0328] Item 8. The membrane-bound IL15 polypeptide comprises an IL15 polypeptide component having the amino acid sequence of SEQ ID NO: 8, a transmembrane domain, and an intracellular tail. The transmembrane domain is at the C-terminus of the IL15 polypeptide component, and the intracellular tail is at the C-terminus of the transmembrane domain. The nucleic acid molecule of item 7. 5 polypeptide component, transmembrane domain, and intracellular tail, and the transmembrane domain is , the C-terminus of the IL15 polypeptide component, and the intracellular tail is the C-terminus of the transmembrane domain End, the nucleic acid molecule of item 7.

[0329] Item 9. The membrane-bound IL15 polypeptide further comprises a linker between the IL15 polypeptide component and the transmembrane domain. The nucleic acid molecule of item 8. Main, the nucleic acid molecule of item 8.

[0330] Item 10. The IL15 payload further comprises one or more components selected from the group consisting o...

Claims

【Claim 1】 The invention described in the specification.

Citation Information

Patent Citations

  • Il15 compositions and methods for immunotherapy

    WO2018161026A1