High-throughput method to screen cognate t cell and epitope reactivities in primary human cells
The immune cell assay with HTO tracking and single-cell sequencing addresses the limitations of conventional methods by enabling efficient, high-throughput analysis of T-cell responses to various antigens, providing detailed TCR sequence and epitope specificity information using small sample volumes.
Patent Information
- Application Number
- JP2025070853
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-10-03
- Filing Date
- 2025-04-22
- Publication Date
- 2025-07-10
AI Technical Summary
Conventional methods for evaluating antigen-specific T-cell activity are costly, require large blood volumes, and are limited to HLA class I reactivity, making high-throughput correlation of TCR sequences with epitopes challenging.
An immune cell assay using a hashtag oligonucleotide (HTO) tracking system for simultaneous analysis of CD8+ and CD4+ T cells, combined with single-cell sequencing, to identify epitope specificity, TCR sequences, and cell surface protein expression, enabling high-throughput analysis of T-cell reactivity.
Enables efficient, cost-effective, and high-throughput analysis of T-cell responses to various antigens using small sample volumes, providing detailed information on TCR sequences and epitope specificity.
Smart Images

Figure 2025105774000003 
Figure 2025105774000004 
Figure 2025105774000005
Abstract
Description
Technical Field
[0001] Cross - reference to Related Applications This application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 62 / 910,379, filed on October 3, 2019, the entire disclosure of which is incorporated herein by reference.
[0002] Reference to a Sequence Listing Submitted as a Text File via EFS - WEB The sequence listing described in the file 10669_ST25.txt is 5 kilobytes, was created on October 2, 2020, and is incorporated herein by reference.
Background Art
[0003] As interest in antigen - specific T - cell activity in human diseases has become increasingly focused, it has been necessary to be able to correlate epitope - specific TCR sequences with cognate epitopes presented in the context of HLA. However, identifying which epitopes result in productive T - cell activation and the TCR sequences of the responding T - cells has historically been a technically challenging problem that persists to date.
[0004] Conventional methods used to evaluate antigen - specific T - cell binding and reactivity include multimer staining and functional T - cell assays (e.g., ELISPOT, cell killing assays) in which T - cells are re - exposed to epitopes detected by cytokine or cytolytic responses. While these methods are useful, they may require expensive individual HLA - haplotype - specific reagents (multimers) and large volumes of blood to evaluate reactivity potential at high throughput. In addition, since HLA class II (CD4+ T - cell) multimers are scarce, multimer - based investigations are focused on HLA class I (CD8+ T - cell) reactivity.
[0005] Accordingly, there is a need for a high-throughput method that can provide information, inter alia, correlating homologous TCRα and β polypeptides of a TCR with the epitopes recognized by the TCR. SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEM
[0006] Disclosed herein is an immune cell assay that can simultaneously assay CD8+ and / or CD4+ T cells against a plurality of target T cell epitopes and can be used with autologous and primary immune cells. The reactivity of the antigen is associated with individual T cells using a hashtag oligonucleotide (HTO) tracking system, and this association is later deconvolved by single cell sequencing to provide single cell level information such as (a) epitope specificity, (b) paired alpha / beta chain TCR sequences of single cells, (c) endogenous single cell RNA transcriptome information, (d) cell surface protein expression (e.g., using CITE-seq antibodies), (e) multimer staining (when multimers are included), and any combination thereof. Accordingly, provided herein are immune cell assay methods, compositions and kits therefor, and their use, for example, for making TCR therapeutics.
[0007] In one embodiment, the method described herein comprises sorting activated T cells from a composition comprising other cells, such as autologous antigen presenting cells (APCs), based on the expression of an activation-induced marker (AIM) on the activated T cells, wherein the activated T cells are labeled with an HTO conjugate molecule.
[0008] In some embodiments, the method described herein (e.g., for identifying an antigen capable of activating a TCRα chain sequence and / or a TCRβ chain sequence of a T cell, and optionally a T cell receptor (TCR) that specifically binds to the antigen) comprises (I) Sorting activated T cells from a composition comprising a native biological sample based on the expression of an activation-induced marker (AIM), wherein the native biological sample comprises: (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing a peptide presented in the context of the surface-bound MHC, the T cells and MHC; (b) a native antigen; (c) a native hashed tag oligonucleotide (HTO) that can be used to specifically identify (and / or specifically discriminates) the native antigen, wherein the native HTO is conjugated to a molecule that labels the T cells with the native HTO; and optionally, (d) a medium that supports the activation of the T cells, the sorting; (II) Performing single-cell sequencing analysis on the activated T cells sorted in (I) to identify the native HTO conjugated to the molecule that labels the activated T cells with the native HTO, wherein identifying the native HTO identifies the antigen capable of activating the activated T cells, and optionally, the single-cell sequencing analysis also identifies (i) one or more genes expressed by the activated T cells, and / or (ii) the TCRα and / or β chain sequences of the TCR expressed by the activated T cells, the identifying; comprising.
[0009] Some of the methods described herein further comprise creating a plurality of biological samples, e.g., native biological samples, prior to the sorting step, such that the sorted composition comprises a plurality of native biological samples. Embodiments of some methods are steps of creating a plurality of biological samples by equally distributing a collection of cells comprising T cells and antigen-presenting cells (APCs) isolated from a subject into individual samples, wherein each biological sample optionally comprises a medium and cytokines that support the viability, activation, and / or activity of the T cells and / or APCs, the steps.
[0010] Some method embodiments include creating a plurality of distinct biological samples by delivering each of a plurality of biological samples, a single distinct antigen, and / or a single distinct HTO that can be used to specifically identify (and / or that specifically identifies) the distinct antigen prior to sorting, where the distinct HTO is conjugated to a molecule that labels T cells with the distinct HTO, each of the plurality of biological samples includes a collection of cells including T cells and APCs isolated from a subject, and after delivery of the distinct antigen and / or the distinct HTO conjugated to a molecule that labels T cells with the distinct HTO, each of the plurality of biological samples becomes a distinct biological sample that includes (a) a collection of cells including T cells and APCs isolated from the subject, (b) the distinct antigen, (c) the distinct HTO that specifically identifies the distinct antigen and is conjugated to a molecule that labels T cells with the HTO, and optionally, (d) a medium that supports the viability, activity, and / or activation of the T cells and APCs. Optionally, the plurality of distinct biological samples can be pooled prior to sorting by the methods described herein such that the composition sorted in (I) includes the plurality of distinct biological samples. Some method embodiments herein include creating a plurality of biological samples and, prior to the sorting step, creating a plurality of distinct biological samples (e.g., from the plurality of biological samples), and optionally pooling the plurality of distinct biological samples to create a composition that can be sorted according to the methods described herein.
[0011] In some methods described herein, sorting is fluorescence-activated cell sorting of activated T cells based on AIM expression, where the fluorescence-activated cell sorting includes detecting T cells that express AIM with a fluorescently labeled antibody that specifically binds to AIM. Such methods can further include incubating a distinct biological sample (or a composition including one or more distinct biological samples) with a fluorescently labeled ligand (e.g., a fluorescently labeled antibody) that specifically binds to AIM.
[0012] In some embodiments, the methods described herein further comprise performing functional and / or phenotypic analysis on activated T cells analyzed by single cell sequencing. In some embodiments, the functional and / or phenotypic analysis is performed prior to the single cell sequencing analysis. In some embodiments, the functional and / or phenotypic analysis is performed simultaneously with the single cell sequencing analysis. In some embodiments, the functional and / or phenotypic analysis is performed after the single cell sequencing analysis. In some embodiments, the functional and / or phenotypic analysis is performed prior to, simultaneously with, and / or after the single cell sequencing analysis. In some embodiments, the functional and / or phenotypic analysis includes flow cytometry analysis. In some embodiments, the functional and / or phenotypic analysis includes CITE-seq analysis. In some embodiments, the functional and / or phenotypic analysis includes multimer analysis. In some embodiments, the functional and / or phenotypic analysis includes any combination of flow cytometry analysis, CITE-seq analysis, and multimer analysis. In some embodiments, further functional and / or phenotypic analysis measures the expression levels of one or more of CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3 at the protein and / or RNA level.
[0013] In some embodiments, the methods described herein involve identifying the TCRα-chain sequence and / or the TCRβ-chain sequence of a TCR that specifically binds to an antigen, preferably, the identifying comprising the TCRα-chain sequence and / or the TCRβ-chain sequence being, respectively, a TCRα-chain variable region sequence (Vα / Jα sequence) and / or a TCRβ-chain variable region sequence (Vβ / Jβ sequence). In some embodiments, the method comprises identifying the TCRα-chain sequence and / or the TCRβ-chain sequence of a TCR that specifically binds to an antigen, and the method further comprises utilizing the TCRα-chain sequence and / or the TCRβ-chain sequence in the production of a therapeutic agent, such as a human therapeutic agent. Alternatively, the method can also include a TCRδ / TCRγ sequence, such as a TCRδ / TCRγ variable region sequence.
[0014] Compositions useful in the methods described herein are also described herein. In some embodiments, the composition comprises (a) a T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell is capable of recognizing a peptide presented in the context of the surface-bound MHC, the T cell and the MHC, (b) an antigen, (c) a hash tag oligonucleotide (HTO) that specifically discriminates the antigen, wherein the HTO is conjugated to a molecule that labels the T cell with the HTO, and optionally, (d) a native biological sample comprising a medium that supports the activation of the T cell. In some embodiments, the composition comprises two or more biological samples, such as a first and a second biological sample, wherein the first biological sample comprises (a) a first T cell and a first surface-bound MHC, wherein the first T cell is capable of recognizing a peptide presented in the context of the first surface-bound MHC, the first T cell and the first surface-bound MHC, (b) a first antigen, and (c) a first HTO that can be used to specifically discriminate the first antigen, preferably a first HTO that specifically discriminates the first antigen, wherein the first HTO is conjugated to a first molecule that labels the first T cell with the first HTO, and the second biological sample comprises (a) a second T cell and a second surface-bound MHC, wherein the second T cell is capable of recognizing a peptide presented in the context of the second surface-bound MHC, the second T cell and the second surface-bound MHC, (b) a second antigen, and (c) a second HTO that specifically discriminates the second antigen, wherein the second HTO is conjugated to a second molecule that labels the second T cell with the second HTO, (i) the first T cell and the second T cell are isolated from the same subject, (ii) the first antigen and the second antigen are not the same, (iii) the first molecule that labels the first T cell with the first HTO and the second molecule that labels the second T cell with the second HTO are the same, the first HTO and the second HTO are not the same, and optionally, either or both of the first and second biological samples further comprise a medium that supports the activation of the first and second T cells.
[0015] Kits are also described herein. In some embodiments, the kits described herein include a plurality of unique antigens and a plurality of unique hashtag oligonucleotides (HTOs), and each of the plurality of unique HTOs can be used to specifically identify, preferably specifically identify, only one of the plurality of unique antigens. In some kit embodiments, each of the plurality of unique HTOs is conjugated to the same molecule, and the kit includes a plurality of molecules conjugated with the unique HTOs. In some kit embodiments described herein, each of the plurality of unique antigens includes unique and overlapping peptide sequences from a single protein, such as a pathogenic antigen, a tumor-associated antigen, or a transplantation antigen.
[0016] In some embodiments herein, the surface-bound MHC is a cell membrane-bound MHC, for example, the surface-bound MHC is expressed on the surface of a cell, such as an antigen-presenting cell (APC). In some method, composition, kit, or use embodiments, the APC is a dendritic cell derived from a mononuclear cell. In some composition, method, kit, or use embodiments, the APC is a dendritic cell. In some method, composition, kit, or use embodiments, the APC is a monocyte. In some method, composition, kit, or use embodiments, the APC is a macrophage. In some method, composition, kit, or use embodiments, the APC is a B cell. In some method, composition, kit, or use embodiments, the surface-bound MHC is expressed on the surface of a population of cells, such as a population of APCs, for example, the population of APCs includes dendritic cells derived from monocytes, dendritic cells, monocytes, macrophages, B cells, and any combination thereof. In some embodiments, the T cells and APC(s) are autologous. In some embodiments, the T cells and APC(s) are each isolated from a human donor. In some embodiments, peripheral blood mononuclear cells (e.g., isolated from a human donor) provide the T cells and the surface-bound MHC (e.g., the MHC expressed on the surface of the APC(s)).
[0017] The methods, compositions, kits, and uses described herein can be advantageously performed with small-volume samples, such as small-volume human samples. In some embodiments, the cell collection comprises a sufficient number of peripheral blood mononuclear cells (PBMCs) isolated from a subject, such as a human subject, such that the cell collection can be equally distributed among a plurality of individual biological samples. In some embodiments, the cell collection comprises a sufficient number of PBMCs such that the cell collection can be equally distributed among at least two individual biological samples, each containing at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs. For example, the cell collection can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell collection comprises a sufficient number of PBMCs such that the cell collection can be equally distributed among at least three individual samples, each containing at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs. For example, the cell collection can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the cell collection comprises a sufficient number of PBMCs such that the cell collection can be equally distributed among at least two individual biological samples, each containing at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6Can be equally distributed among at least five individual samples containing the PBMCs. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that each collection of cells contains at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs and can be equally distributed among at least 10 individual samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that each collection of cells contains at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs and can be equally distributed among at least 20 individual samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that each collection of cells contains at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs and can be equally distributed among at least 30 individual samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that each collection of cells contains at least about 1×10 5PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs can be equally distributed among at least 50 individual samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of T cells and antigen-presenting cells (APCs) (e.g., dendritic cells (DCs)), such that the collection of cells can be equally distributed among a plurality of individual biological samples. In some embodiments, the collection of cells contains a sufficient number of APCs and T cells isolated from a subject, such as a human subject, such that the collection of cells contains APCs and T cells (e.g., DCs and T cells) in an APC:T cell ratio of about 1:1, about 1:5, or about 1:10, respectively, and can be equally distributed among a plurality of individual biological samples. For example, each sample contains at least about 5×10 3 , 5×10 4 , or 5×10 5 DCs, and about 5×10 3 , 1×10 4 , 2.5×10 4 , 5×10 4 , 1×10 6 , 2.5×10 5 , 5×10 5 , 1×10 6 , 2.5×10 6 , or 5×10 6 T cells. For example, the collection of cells can be derived from about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject.
[0018] The antigen used in the method described herein, or which is part of a composition or kit described herein, can be an antigen selected from the group consisting of (I) (i) a bacterial antigen or a part thereof, (ii) a viral antigen or a part thereof, (iii) an allergen or a part thereof, (iv) a tumor-associated antigen or a part thereof, and (v) combinations thereof, and / or (II) (i) an amino acid sequence, (ii) a nucleotide sequence, (iii) a lysate, and (iv) combinations thereof.
[0019] The methods, compositions, kits, and uses described herein each include a hash tag oligonucleotide (HTO) conjugated to a molecule, and the molecule can be used to label cells (e.g., T cells) with the HTO. In some embodiments, the molecule used to label the cells can include a ligand, such as an antibody. In some embodiments, an HTO-conjugated ligand, such as an HTO-conjugated antibody, binds to a cell surface molecule. In some embodiments, the cell surface molecule is ubiquitously expressed by most cells. In some embodiments, the cell surface molecule is or includes β2 microglobulin. In some embodiments, the cell surface molecule is or includes CD298. In some embodiments, the cell surface molecule can be selectively expressed by T cells. In some embodiments, the cell surface molecule is or includes a T cell surface molecule selected from the group consisting of CD2, CD3, CD4, CD8, and any combination thereof. In some embodiments, the cell surface molecule is or includes CD2. In some embodiments, the cell surface molecule is or includes CD3. In some embodiments, the cell surface molecule is or includes CD4. In some embodiments, the cell surface molecule is or includes CD8. In some embodiments, the molecule used to label the cells with the HTO can include, for example, preferably a lipid that incorporates itself into the cell membrane, such as the cell membrane of dividing cells. In some embodiments, the HTO-conjugated molecule includes an HTO-conjugated lipid, such as a lipid-modified oligonucleotide. In some embodiments, the molecule used to label the cells with the HTO is or includes cholesterol. In some embodiments, the HTO-conjugated molecules described herein include HTO-conjugated cholesterol, such as a cholesterol-modified oligonucleotide.
[0020] The methods described herein include sorting activated T cells based on the expression of activation-induced markers (AIMs). Accordingly, some of the method, composition, kit, and use embodiments described herein include agents useful in such sorting procedures. In some embodiments, the agent includes a fluorescently labeled ligand that specifically binds to AIM, such as a fluorescently labeled antibody that specifically binds to AIM. In some method, composition, or kit embodiments herein, AIM is or includes any marker that is upregulated by T cells upon activation of the T cells. In some method, composition, kit, or use embodiments herein, AIM is an AIM selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, and any combination thereof, or includes the same. In some method, composition, kit, or use embodiments herein, AIM is CD137 / 4-1BB or includes CD137 / 4-1BB. In some method, composition, kit, or use embodiments herein, AIM is CD107 or includes CD107. In some method, composition, kit, or use embodiments herein, AIM is IFNγ or includes IFNγ. In some method, composition, kit, or use embodiments herein, AIM is PD-1 or includes PD-1. In some method, composition, kit, or use embodiments herein, AIM is CD40L or includes CD40L. In some method, composition, kit, or use embodiments herein, AIM is OX40 or includes OX40. In some method, composition, kit, or use embodiments herein, AIM is CD25 or includes CD25. In some method, composition, kit, or use embodiments herein, AIM is CD69 or includes CD69.In some method, composition, kit, or use embodiments herein, the AIM is, or comprises, CD28. In some method, composition, kit, or use embodiments herein, the AIM is, or comprises, HLA-DR. In some method, composition, kit, or use embodiments herein, the AIM is, or comprises, CX3CR1. In some method, composition, kit, or use embodiments herein, the AIM is, or comprises, TIM3. In some method, composition, kit, or use embodiments herein, the AIM is, or comprises, LAG3. In some method, composition, kit, or use embodiments herein, the AIM is, or comprises, TIGIT.
[0021] The methods described herein can include performing functional and / or phenotypic analysis on activated T cells analyzed by single cell sequencing. Thus, in some embodiments, the methods, compositions, kits, or uses described herein can include additional reagents, such as antibodies and / or MHC multimers, any or both of which can be useful for flow cytometry analysis and / or CITE-seq analysis.
[0022] Some of the methods, compositions, kits, and use embodiments described herein include a medium that supports the viability, activation, and / or activity of existing T cells (and optionally, other cells, such as antigen-presenting cells, such as dendritic cells). In some embodiments, the medium includes one or more cytokines. In some embodiments, the medium includes IL-2. In some embodiments, the medium includes IL-4. In some embodiments, the medium includes IL-7. In some embodiments, the medium includes IL-15. In some embodiments, the medium includes IL-21. In some embodiments, the medium includes GM-CSF. In some embodiments, the medium includes FLT3L. In some embodiments, the medium includes any combination of IL-2, IL-4, IL-7, IL-15, GM-CSF, and FLT3L. In some embodiments, the medium includes a cytokine selected from the group consisting of IL-2, IL-7, IL-15, GM-CSF, IL-4, and any combination thereof.
[0023] Also described herein is the use of the methods, compositions, and / or kits described herein to analyze a patient's immune response to a vaccine mediated by T cells. In some embodiments, the methods, compositions, and / or kits described herein may be useful for analyzing a patient's immune response to an immunotherapy mediated by T cells. In some embodiments, the methods, compositions, and / or kits described herein may be useful for analyzing a T cell-mediated immune response in a patient during the patient's immunotherapy. In some embodiments, the methods, compositions, and / or kits described herein may be useful for analyzing a patient's T cell response to a self-antigen. In some embodiments, the methods, compositions, and / or kits described herein may be useful for analyzing a patient's T cell response to a transplantation antigen. In some embodiments, the methods, compositions, and kits described herein can be used to identify one or more TCR variable region sequences of activated T cells (e.g., the CDR3 sequence of the TCRα chain and / or the CDR3 sequence of the TCRβ chain). In some embodiments, one or more TCR variable region sequences thus identified can be used to generate T cells that comprise one or more TCR variable region sequences identified using the methods, compositions, and kits described herein, for use as human therapeutics. In certain aspects, for example, the following items are provided. (Item 1) A method of identifying an antigen capable of activating a T cell and, optionally, the TCRα chain sequence and / or the TCRβ chain sequence of a T cell receptor (TCR) that specifically binds to the antigen, the method comprising: (I) sorting activated T cells from a composition comprising a native biological sample based on the expression of an activation-induced marker (AIM), wherein the native biological sample comprises: (a) a T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell is capable of recognizing a peptide presented in the context of the surface-bound MHC, the T cell and the MHC; (b) a native antigen; (c) A unique hash tag oligonucleotide (HTO) used to specifically identify the native antigen, wherein the unique HTO is conjugated to a molecule that labels the T cell with the unique HTO, and optionally, (d) A medium that supports the activation of the T cells including the sorting; (II) Performing single cell sequencing analysis on the activated T cells sorted in (I), and identifying the unique HTO conjugated to the molecule that labels the activated T cells with the unique HTO, wherein identifying the unique HTO identifies the antigen capable of activating the activated T cells, and optionally, the single cell sequencing analysis is one or more of the following: (i) One or more genes expressed by the activated T cells, and / or (ii) The TCRα and / or β chain sequences of the TCR expressed by the activated T cells also identifying, the identifying, including the method. (Item 2) Before sorting, one or both of the following steps (if any): A step of creating a plurality of biological samples by equally distributing a collection of cells including T cells and antigen presenting cells (APCs) isolated from a subject into individual samples, wherein each biological sample optionally includes a medium and cytokines that support T cell and / or APC viability, activation, and / or activity, the step; A step of creating a plurality of unique biological samples by delivering a unique antigen and / or a unique HTO used to specifically identify the unique antigen to each of the plurality of biological samples, wherein the unique HTO is conjugated to a molecule that labels the T cell with the unique HTO, the step; including, each of the plurality of biological samples includes a collection of cells including T cells and APCs isolated from a subject, and optionally includes a medium that supports the viability, activity, and / or activation of the T cells and APCs, After delivery of the native HTO conjugated to the native antigen and / or a molecule that labels the T cells with the native HTO, each of the plurality of biological samples is, (a) a collection of cells comprising T cells and APCs isolated from a subject, (b) a native antigen, (c) a native HTO that specifically identifies the native antigen and is conjugated to a molecule that labels the T cells with the HTO, and optionally, (d) a medium that supports the viability, activity, and / or activation of the T cells and APCs to form a native biological sample comprising, (I) the composition sorted in (I) comprises a plurality of native biological samples, The method according to item 1. (Item 3) The method according to item 2, wherein the APCs comprise monocyte-derived dendritic cells, dendritic cells, monocytes, macrophages, B cells, or combinations thereof. (Item 4) The method according to any one of items 1 to 3, wherein sorting comprises fluorescence-activated cell sorting of activated T cells based on the expression of the activation-induced marker (AIM). (Item 5) The method according to item 4, wherein the AIM is selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, and any combination thereof. (Item 6) The method according to item 4 or item 5, wherein fluorescence-activated cell sorting is based on detection using a fluorescently labeled antibody against the AIM. (Item 7) Performing further functional analysis and / or phenotypic analysis on the activated T cells analyzed in II, and optionally, the further functional analysis and / or phenotypic analysis is selected from the group consisting of flow cytometry analysis, CITE-seq, multimer analysis, and combinations thereof, according to any one of the preceding items. (Item 8) The method according to item 7, wherein the further functional analysis and / or phenotypic analysis measures the expression level of one or more proteins and / or RNAs among CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA-DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3. (Item 9) The method according to any one of the preceding items, wherein the peripheral blood mononuclear cells yield the T cells and surface-bound MHC. (Item 10) The method according to any one of the preceding items, wherein the molecule that labels the T cells with the native HTO comprises an antibody that binds to a cell surface molecule. (Item 11) The method according to any one of the preceding items, wherein the AIM is CD137 / 4-1BB or comprises the same. (Item 12) The method according to any one of the preceding items, wherein the method comprises identifying the TCRα chain sequence and / or TCRβ chain sequence of a TCR that specifically binds to the antigen, and the TCRα chain sequence and / or TCRβ chain sequence are respectively the TCRα chain variable region sequence and / or TCRβ chain variable region sequence. (Item 13) The method according to any one of the preceding items, wherein the method comprises identifying the TCRα chain sequence and / or TCRβ chain sequence of a TCR that specifically binds to the antigen, and the method further comprises using the TCRα chain sequence and / or TCRβ chain sequence in the preparation of a therapeutic agent. (Item 14) (a) A T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell is capable of recognizing a peptide presented in the context of the surface-bound MHC, the T cell and the MHC, (b) An antigen, (c) A hash tag oligonucleotide (HTO) that specifically identifies the antigen, wherein the HTO is conjugated to a molecule that labels the T cell with the HTO, and, optionally, (d) A medium that supports the activation of the T cell A composition comprising a biological sample containing the same. (Item 15) (a) The MHC is expressed on the surface of an antigen-presenting cell (APC), and optionally, the T cell and the APC are autologous, the T cell and the APC are each isolated from a human donor, and / or, the APC is selected from the group consisting of monocyte-derived dendritic cells, dendritic cells, monocytes, macrophages, B cells, and combinations thereof, (b) The antigen is (I) (i) A bacterial antigen or a portion thereof, (ii) A viral antigen or a portion thereof, (iii) An allergen or a portion thereof, (iv) A tumor-associated antigen or a portion thereof, and (v) Combinations thereof selected from the group consisting of, and / or, (II) (i) An amino acid sequence, (ii) A nucleotide sequence, (iii) A cell lysate, and (iv) Combinations thereof comprising, (c) The HTO conjugate molecule comprises an antibody that binds to a cell surface molecule or lipid, and / or (d) The medium comprises a cytokine that supports the viability of the T cell and / or APC, The composition according to item 14. (Item 16) the antibody binds to a cell surface marker selected from the group consisting of β2-microglobulin, CD298, CD2, CD3, CD4, CD8, and any combination thereof, or the lipid is incorporated into the cell membrane, The composition according to item 15. (Item 17) The composition according to item 15 or item 16, wherein the cytokine that supports the viability of the T cell and / or the APC is selected from the group consisting of IL-2, IL-7, IL-15, GM-CSF, IL-4, and any combination thereof. (Item 18) further comprising a second biological sample, the second biological sample comprising (a) a second T cell and a second surface-bound MHC, wherein the second T cell is capable of recognizing a peptide presented in the context of the second surface-bound MHC, the second T cell and the second surface-bound MHC; (b) a second antigen; (c) the second HTO that specifically discriminates the second antigen, wherein the HTO is conjugated to a second molecule that labels the second T cell with the second HTO, the second HTO; and, optionally, (d) a medium that supports the activation of the second T cell and comprising (i) the T cell and the second T cell are isolated from the same subject; (ii) the antigen and the second antigen are not the same; (iii) the molecule that labels the T cell with the HTO and the second molecule that labels the second T cell with the second HTO are the same, and the HTO and the second HTO are not the same; The composition according to any one of items 15 to 17. (Item 19) The composition according to any one of items 14 to 18, wherein the composition further comprises an agent that enables sorting of activated T cells based on the expression of activation-induced marker (AIM). (Item 20) The composition according to item 19, wherein the agent enabling sorting of activated T cells based on the expression of AIM is a fluorescently labeled antibody that specifically binds to the AIM. (Item 21) The composition according to item 19 or item 20, wherein the AIM is selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT. (Item 22) The composition according to any one of items 14 to 21, wherein the composition contains an antibody and / or an MHC multimer useful for flow cytometry analysis or CITE-seq of the composition. (Item 23) A plurality of unique antigens, and A plurality of unique hashtag oligonucleotides (HTOs), each of which specifically identifies only one of the plurality of unique antigens, the HTO A kit containing the same. (Item 24) The kit according to item 23, further comprising an agent enabling sorting of activated T cells based on the expression of their activation-induced marker (AIM), and optionally, the agent enabling sorting of activated T cells based on the expression of AIM is a fluorescently labeled antibody that specifically binds to the AIM. (Item 25) Each of the plurality of unique HTOs is conjugated to the same molecule, and the kit contains a plurality of molecules conjugated with the unique HTOs, the kit according to item 23 or 24. (Item 26) The kit according to any one of items 23 to 25, wherein each of the plurality of unique antigens contains unique and overlapping peptide sequences from a single protein. (Item 27) The kit according to item 26, wherein the single protein is selected from the group consisting of a pathogenic antigen, a tumor-associated antigen, or a transplantation antigen. (Item 28) Use of the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27 for analyzing a T cell-mediated immune response of a patient to a vaccine. (Item 29) Use of the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27 for analyzing a T cell-mediated immune response of a patient to immunotherapy. (Item 30) Use of the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27 for analyzing a T cell-mediated immune response in a patient during immunotherapy of the patient. (Item 31) Use of the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27 for analyzing a T cell response of a patient to a self-antigen. (Item 32) Use of the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27 for analyzing a T cell response of a patient to a transplantation antigen. (Item 33) Use of the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27 for identifying one or more TCR variable region sequences of activated T cells. (Item 34) Use according to item 33, wherein the one or more TCR variable region sequences comprise a CDR3 sequence of a TCRα chain and / or a CDR3 sequence of a TCRβ chain. (Item 35) Use of the one or more TCR variable region sequences identified in item 33 or 34 in the preparation of a human therapeutic agent. (Item 36) The use according to item 35, wherein the human therapeutic agent comprises T cells comprising one or more TCR variable region sequences identified using the method according to any one of items 1 to 13, the composition according to any one of items 14 to 22, or the kit according to any one of items 23 to 27.
Brief Description of the Drawings
[0024]
Figure 1
Figure 2A
Figure 2B
Figure 3A
Figure 3B
Figure 4
Figure 5
Figure 6A
Figure 6B
Figure 6C
Figure 6D
Figure 7A
Figure 7B
Figure 8A-1
Figure 8A-2
Figure 8B-1
Figure 8B-2
Figure 9A
Figure 9B
Figure 9C
DETAILED DESCRIPTION OF THE INVENTION
[0025] As a method for bypassing conventional flow cytometry analysis, oligonucleotide (oligo) tag antibodies have been developed. See, for example, WO2018144813, which is hereby incorporated by reference in its entirety. Such oligo tag antibodies can be used as tools for binding proteins on the surface of live cells and can assist in single cell tracking for single cell RNA sequencing (scRNA SEQ) experiments. The method described in Stoeckius (2017) bioRxiv (also published in (2018) Genome Biology 19:224) uses oligo tag antibodies that have single protein specificity expressed in all target cells, in addition to unique oligonucleotide tags (also called hashed oligonucleotides or HTOs) with unique sequences per sample to track individual samples that are ultimately pooled for sequencing library preparation. In this method, each cell can be tagged with a unique oligonucleotide sequence that identifies the sample from which the cell is derived. By detecting this oligonucleotide sequence and including it in the sequencing library, the identity of the sample can be measured from the resulting sequencing information. Conventionally, lineage-specific antibodies are used to pool multiple samples into a single single cell sequencing (scSEQ) library preparation, for example, to multiplex samples and normalize data to improve efficiency.
[0026] For example, the use of HTOs in functional assays for characterizing antigen-specific T cell responses has been previously described, where the HTOs are conjugated to multimers of the major histocompatibility complex (MHC) (see, for example, Bentzen et al. (2016) Nature Biotechnology 34:1037-45). MHC is expressed by antigen presenting cells (APCs) and presents peptides to T cells that recognize the peptides. Arbitrarily, CD8 + T cells pair with MHC I, while CD4 +T cells form a complex with MHC II. Also, due to the extreme polymorphism of MHC, it becomes important to know which allele is recognized by the T cell itself, and this enables us to say that any response is due to the presentation of the peptide itself, rather than the presentation of foreign MHC. Therefore, in order to effectively stimulate antigen-specific T cells and enable the characterization of peptide-specific T cell responses, the peptide must be presented to the corresponding T cells in an MHC with a matching class and haplotype.
[0027] Previously, peptide-specific T cell responses were measured using proliferation assays, chromium-based cytotoxicity assays, Ca 2+Characterized by functional assays such as flux assays, and more generally, cytokine detection assays such as ELISPOT and intracellular cytokine flow cytometry staining. Multiplexing of such assays is described in Klinger et al. (2015) PLoS One DOI: 10.1371 / journal.pone.0141561. However, these functional assays were limited in that they could not elaborate antigen specificity nor characterize responses at the single cell level. Some of these limitations were overcome by flow cytometry MHC tetramer staining. Using flow cytometry MHC tetramer staining, specific T cell responses can be evaluated with fluorophore-conjugated MHC multimers loaded with the peptide of interest. Identification of T cells that specifically bind to and are likely to be activated by MHC multimers loaded with the peptide of interest was achieved by sorting these cells bound to fluorescent MHC multimers and, in some cases, other antibodies. The transition from fluorescently labeled MHC multimers to HTO-conjugated MHC multimers removes the limiting factor of a small number of fluorescent tags available for characterizing activated T cells. In addition, similar to differentiation antibodies, differentiation MHC multimers are useful for tracking individual samples pooled for sequence analysis, whereby the HTO sequence is detected and included in the sequencing library, and the MHC / peptide combinations bound to the analyzed T cells are identified. However, unlike the method described above by Stoeckius (2017) bioRxiv (also published in (2018) Genome Biology 19:224), using HTO-conjugated MHC multimers provides more than just sample tracking in that such use also results in functional analysis, e.g., identification of MHC / peptide combinations capable of binding to specific T cells.
[0028] Functional assays for tracking antigen-specific T cell responses at the single cell level are described herein, which do not require (but do not prohibit) the use of MHC multimers. Generally, the methods described herein use differentiation molecules to track activated T cells from individual assay wells. Cells from all wells are labeled with one or more oligotag molecules that can be incorporated into, for example, the cell membrane (e.g., one or more oligotag lipids) and / or bind to one or more ubiquitous cell surface markers (e.g., one or more oligotag antigen-binding proteins) before different unique culture fluids are pooled. Once the cells are hashed, their origin and cognate antigen can be determined and there is no need to keep the samples separate. After pooling, activated cells can be sorted from these cells in the unactivated pool using a functional assay for flow cytometry analysis of activation-induced markers (AIM).
[0029] Non-limiting, exemplary illustrations of the methods described herein are illustrated in FIG. 1. As shown in this non-limiting example, in step (1), a unique antigen, such as a unique T cell epitope (e.g., “1”, “2”, “3”) (which may be a protein, peptide, RNA, cell, cell lysate, etc.), and / or a single stimulus, or a pool of stimuli, is added to each of the individual wells containing one of the plurality of biological samples, where each of the plurality of biological samples contains T cells and MHC recognized by the T cells, e.g., each of the plurality of samples contains autologous peripheral blood mononuclear cells (PBMC). The biological samples are cultured with the unique antigen for a time sufficient for activated T cells to upregulate activation-induced markers (e.g., 6 to 72 hours). In some non-limiting, exemplary embodiments, culturing the biological samples with the antigen for only one night (e.g., about 18 to 24 hours) is necessary, for example, for upregulation of AIM by activated T cells during restimulation of activated T cells. In some non-limiting embodiments, the biological samples are first primed with the antigen for, for example, about 1 or 2 weeks, e.g., about 7 to 14 days, to allow for pre-proliferation of reactive T cells prior to the overnight restimulation culture. Following restimulation, in step (2), each individual cell is incubated with a unique hashed tag oligonucleotide (HTO) conjugated to a molecule (e.g., lipid, antibody, etc.) that specifically binds to cell surface markers (e.g., β2-microglobulin, CD2, CD298, CD3, CD4, and / or CD8, etc.) incorporated into the cell membrane and / or expressed by T cells regardless of activation state, where each unique HTO (e.g., “1”, “2”, “3”) identifies the unique antigen in each individual well. In step (3), all of the unique biological samples are multiplexed, e.g., pooled, and after pooling, in step (4), the composition containing the pool of unique biological samples is incubated with agents useful for detecting activation-induced markers expressed by activated T cells (e.g., CD137 / 4-1BB), and optionally, other single cell sequencing and flow cytometry reagents including, but not limited to, CITE-seq antibodies, fluorescent tag antibodies, and oligonucleotide tag multimers.The non-limiting embodiment shown in FIG. 1 shows adding these additional reagents after pooling, although in other non-limiting embodiments, these additional reagents may be added before pooling. In step (5), cells labeled with an agent useful for detecting activation-induced markers, such as a fluorescently labeled antibody that specifically binds to an activation-induced marker, and another T cell marker (e.g., CD137 / 4-1BB+CD3+ T cells), are functionally enriched by AIM fluorescence-activated cell sorting (FACS). In step (6), the transcriptome of each of the enriched cells is then analyzed, for example, by encapsulating a population of sorted cells into 10X Genomics Single Cell Gel Bead-In Emulsions (GEMS) to fractionate the cells into single cells and performing RNA sequencing on each cell. In the non-limiting embodiment shown in FIG. 1, a 5' sequencing library for HTO, the transcriptome (5'mRNA), TCR-seq, CITE-seq, and / or oligomers are generated for high-throughput single cell sequencing in step (6). In step (7), individual HTO clusters are computationally demultiplexed to reveal which antigens individual cells were exposed to.
[0030] The described functional assays provide many benefits. For example, the methods described herein can be fully personalized, e.g., by using autologous T cells and MHC. In addition, the methods described herein enable the simultaneous interrogation of many reactivities even when the biological samples being tested are limited. Alloantigen / T cell reactivity can be discriminated at the single cell or pooled cell level. By using reagents that are not MHC-specific, flexible application of the method across patient samples is enabled, and in addition, the complementary ability of both information in MHC-unrestricted methods, e.g., CD4+ and CD8+ T cell information, can be captured simultaneously, and by using functional phenotypes (e.g., activation-induced markers), it helps to identify and evaluate only activated T cells. In addition, the methods described herein are compatible with methods in the next stage of development that evaluate the phenotype and transcriptome of activated T cells in a rapid and cost-effective manner that can inform the development and / or determination of personalized therapies. In this method, the immune response to a therapy (vaccine, immunotherapy, etc.), e.g., T cell reactivity to vaccine-encoded antigens, viral antigens, and / or tumor antigens, can be evaluated. Similarly, immune surveillance of autoreactivity, e.g., T cell reactivity to self-antigens, can also be assayed. The methods described herein can be useful, e.g., for the discovery of TCRs spanning a number of antigens of interest, and / or for the discovery of TCR:epitope binding and algorithm generation, and for the development of therapies. For example, the complexity of epitope:TCR sequence data provided by the methods described herein can be useful for discovering haplotype-specific rules regarding TCR sequence(s) and / or structural features associated with specific HLA-peptide binding.
[0031] Accordingly, one or more of the following steps: Differentiating a biological sample containing T cells and MHC, for example, incubating the biological sample with a unique antigen (e.g., a T cell epitope) and a unique barcode (e.g., a hashtag oligonucleotide) to form a unique biological sample, pooling a plurality of unique biological samples, enriching for activated T cells based on a functional assay (e.g., sorting for AIM against activation-induced markers, such as CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT, with a fluorescently labeled antibody), performing a sequencing method, and optionally, other well-known methods (e.g., CITE-seq analysis, flow cytometry analysis, and / or multimer staining) on the activated cells, e.g., on a single cell basis, to identify (a) the unique barcode of the activated T cell and thus, the antigen that activated the T cell, and optionally, (b) other sequences that may be useful for identifying, for example, the TCRα and β sequences of the activated T cell, e.g., for therapeutic development, A method comprising the above is described herein.
[0032] Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0033] Unless the context clearly indicates otherwise, the singular forms "a", "an", and "the" include the plural forms. Thus, for example, a reference to "a method" includes one or more methods and / or the types of steps described herein and / or will be apparent to one of ordinary skill in the art reading the present disclosure.
[0034] The terms "about" or "approximately" include being within a meaningful range of a value. The acceptable variations encompassed by the terms "about" or "approximately" vary depending on the particular system being studied and can be readily understood by one of ordinary skill in the art.
[0035] T cells bind to epitopes at small antigenic determinants on the surface of antigen-presenting cells associated with the major histocompatibility complex (MHC). T cells bind to these epitopes through the T cell receptor (TCR) complex on the surface of the T cell. The T cell receptor is a heterodimeric structure composed of two chains: an α (alpha) and a β (beta) chain, or a γ (gamma) and a δ (delta). The α chain is encoded by a nucleic acid sequence located within the α locus on human chromosome 14, which also contains the entire δ locus, and the β chain is encoded by a nucleic acid sequence located within the β locus on human chromosome 7. The majority of T cells have an αβ TCR, while a minority of T cells have a γδ TCR. Although the α and β chains are commonly referred to herein, the methods, compositions, and / or kits described herein can equally apply to γδ TCR chains.
[0036] T cell receptor α and β polypeptides (and, similarly, γ and δ polypeptides) are linked to each other via disulfide bonds. Each of the two polypeptides that make up the TCR contains an extracellular domain, a transmembrane domain, and a cytoplasmic tail, including a constant region and a variable region (the transmembrane domain and cytoplasmic tail are also part of the constant region). The variable region of the TCR determines its antigen specificity and, like immunoglobulins, contains three complementarity-determining regions (CDRs), e.g., CDR1, CDR2, and CDR3. Also, like immunoglobulin genes, the T cell receptor variable gene loci (e.g., the TCRα and TCRβ loci) contain a number of non-rearranged V(D)J segments (variable (V), joining (J), and, for TCRβ and δ, diversity (D) segments). During T cell development in the thymus, the TCRα variable gene locus undergoes rearrangement such that the resulting TCRα variable domain is encoded by a particular combination of VJ segments (Vα / Jα sequence), and the TCRβ variable gene locus undergoes rearrangement such that the resulting TCRβ variable domain is encoded by a particular combination of VDJ segments (Vβ / Dβ / Jβ sequence). The TCRα and β variable domains, particularly CDR1, CDR2, and CDR3, and more specifically CDR3, confer the specificity by which the TCR binds to MHC.
[0037] The terms "major histocompatibility complex" and "MHC" include the terms "human leukocyte antigen" or "HLA" (generally, the latter two being conserved for human MHC), naturally occurring MHC, individual chains of MHC (e.g., MHC class I α (heavy) chain, β2-microglobulin, MHC class II α chain, and MHC class II β chain), individual subunits of such chains of MHC (e.g., α1, α2, and / or α3 subunits of the α-chain of MHC class I α difference, α1-α2 subunits of MHC class II α chain, β1-β2 subunits of MHC class II β chain), in addition to portions (e.g., peptide-binding portions, e.g., peptide-binding grooves), variants, and various derivatives (including fusion proteins) thereof, and such portions, variants, and derivatives retain the ability to present antigenic peptides for recognition by T cell receptors (TCRs), e.g., antigen-specific TCRs. MHC I includes a peptide-binding groove formed by the α1 and α2 domains of an α heavy chain capable of accommodating peptides of about 8-10 amino acids. Despite the fact that both classes of MHC bind to the core of about 9 amino acids (e.g., about 5-17 amino acids) within the peptide, the open-ended nature of the MHC class II peptide-binding groove (α1 domain of the class II MHCα polypeptide associated with the β1 domain of the class II MHCβ polypeptide) allows for a wide range of peptide lengths. Although peptide-binding MHC class II usually varies in length from 13-17 amino acids, shorter or longer lengths are not uncommon. Consequently, peptides can move within the MHC class II peptide-binding groove, and at any given time, the location where the nonamer is directly present within the groove changes.
[0038] The term "antigen", when introduced, encompasses any agent (e.g., protein, peptide, polysaccharide, glycoprotein, glycolipid, nucleotide, a portion thereof, or a combination thereof) that is recognized by an immunocompetent host by the host's immune system and elicits an immune response in the host. T cell receptors (TCRs) recognize peptides presented in the context of the major histocompatibility complex (MHC) as part of the immunological synapse. Peptide-MHC (pMHC) complexes are recognized by TCRs with the specificity of the interaction by the peptide (epitope) and TCR idiotype. Thus, the term "antigen" encompasses peptides presented in the context of MHC, such as peptide-MHC complexes, such as pMHC complexes. Peptides presented by MHC can also be referred to as "epitopes" or "antigenic determinants". The terms "peptide", "antigenic determinant", "epitope", etc. encompass not only those naturally presented by antigen-presenting cells (APCs), but any desired peptide, provided that it is recognized by T cells when appropriately presented to the T cells. For example, peptides having an artificially prepared amino acid sequence can also be used as epitopes.
[0039] TCR engagement with cognate pMHC is generally of short duration, but this interaction can be stabilized by the "avidity effect" obtained by incorporating multiple pMHCs on a single scaffold, e.g., a surface, using, for example, multimers, e.g., tetramers, dextramers, etc. A variety of pMHC multimerization platforms have been utilized, and many of these are commercially available. See, for example, Wooldridge et al. (2009) Immunol. 126:147-64. To accommodate such avidity effects, in some embodiments, the MHCs herein are preferably bound to a surface, whereby an appropriate density of MHCs can be achieved.
[0040] Non-limiting exemplary surfaces to which MHC can bind in the non-limiting embodiments disclosed herein include a For example, it is expressed on the surface of MHC on the surface of antigen-presenting cells (e.g., professional antigen-presenting cells such as dendritic cells, monocytes, macrophages, and B cells), on the surface of liposomes, on the envelope membrane of viral vectors, etc., the cell membrane, b beads, c cell culture dishes, such as the wells of multi-well plates, and, d multimers, such as tetramers, dextramers, etc. can be mentioned.
[0041] Antigens can include synthetic peptides, proteins, mRNAs, viruses, viral vectors, DNAs, live cells, cell lysates, etc. In some non-limiting embodiments, the antigen is a tumor-associated antigen and includes its peptide moiety. In such embodiments, the tumor-associated antigen can be selected from the group consisting of ALK, BAGE protein, BIRC5 (survivin), BIRC7, CA9, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD27, CD30, CD33, CD38, CD40, CD44, CD52, CD56, CD79, CDK4, CEACAM3, CEACAM5, CLEC12A, EGFR, EGFR variant III, ERBB2 (HER2), ERBB3, ERBB4, EPCAM, EPHA2, EPHA3, FCRL5, FLT3, FOLR1, GAGE protein, GD2, GD3, GPNMB, GM3, GPR112, IL3RA, KIT, KRAS, LGR5, EBV-derived LMP2, L1CAM, MAGE protein, MLANA, MSLN, MUC1, MUC2, MUC3, MUC4, MUC5, MUC16, MUM1, ANKRD30A, NY-ESO1 (CTAG1B), OX40, PAP, PAX3, PAX5, PLAC1, PRLR, PMEL, PRAME, PSMA (FOLH1), RAGE protein, RET, RGS5, ROR1, SART1, SART3, SLAMF7, SLC39A6 (LIV1), STEAP1, STEAP2, TERT, TMPRSS2, Thompson-Newell antigen, TNFRSF17, TYR, UPK3A, VTCN1, WT1.
[0042] In another embodiment, the antigen may be associated with an infectious disease. In such an embodiment, for example, a biological sample can be made into a native biological sample by adding a pathogen or an epitope derived therefrom. In such an embodiment, the infectious disease-related antigen may be a viral antigen, and the viral antigen may be selected from the group consisting of HIV, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes virus (e.g., HSV-1, HSV-2, CMV, HAV-6, VZV, Epstein-Barr virus), adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackievirus, coronavirus (e.g., SARS-CoV-2), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV, dengue virus, papillomavirus, molluscum contagiosum virus, poliovirus, rabies virus, JC virus, Ebola virus, and arbovirus encephalitis virus antigen. In such another embodiment, the antigen associated with an infectious disease may be a bacterial antigen, and the bacterial antigen may be selected from the group consisting of Chlamydia, Rickettsia, Mycobacterium, Staphylococcus, Streptococcus, Pneumococcus, Meningococcus, Gonococcus, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Diphtheria, Salmonella, Bacillus, Cholera, Tetanus, Botulinum, Anthrax, Plague, Leptospira, and Lyme disease bacterial antigen.
[0043] As used in the methods described herein, the term "biological sample" means biologically active cells, activators of biologically active cells, and optionally, a culture containing cell viability and / or biological activation, for example, a medium that supports cell activity. Biologically active cells may be a homogeneous population of cells, such as a particular type of isolated cells (e.g., T cells), or a mixture of different cell types (e.g., peripheral blood mononuclear cells (PBMCs), co-cultures of antigen-presenting cells (APCs) and T cells, co-cultures of dendritic cells (DCs) and T cells, etc.), which can be isolated from or contained in a biological fluid or tissue isolated from a subject, such as a human, mammalian, or other species subject. Non-limiting examples of biological fluids or tissues include serum, plasma, whole blood, peripheral blood, saliva, urine, vaginal or cervical secretions, amniotic fluid, placental fluid, cerebrospinal fluid, serous fluid, or mucosal secretions (e.g., buccal, vaginal, or rectal). Further examples of other samples include blood-derived or biopsy-derived biological samples or tissues, such as tissues containing tumor-infiltrating lymphocytes (e.g., tumors), nodules, etc.
[0044] Some non-limiting biological samples disclosed herein include T cells and surface-bound MHCs that present antigens (e.g., T cell epitopes). For example, the biologically active cells are T cells and the activating factor is a surface-bound MHC that presents an antigen (e.g., a T cell epitope). Some non-limiting biological samples disclosed herein include T cells, surface-bound MHCs that present antigens (e.g., T cell epitopes), and one or more cytokines that support the viability, activation, and / or activity of T cells. For example, the biologically active cells are T cells, the activating factor is a surface-bound MHC that presents an antigen (e.g., a T cell epitope), and the medium contains one or more cytokines that support the viability, activation, and / or activity of T cells. In some embodiments, the cytokines that support the viability, activation, and / or activity of T cells include interleukins selected from the group consisting of IL-2, IL-4, IL-7, IL-15, IL-21, and combinations thereof. Some non-limiting biological samples disclosed herein include T cells and surface-bound MHCs that present antigens, where the MHC is expressed on the surface of antigen-presenting cells, such as somatic cells, and the antigen-presenting cells may optionally be professional antigen-presenting cells selected from the group consisting of monocyte-derived dendritic cells, dendritic cells, monocytes, macrophages, and B cells. These non-limiting biological samples, which include T cells and surface-bound MHCs that present antigens and where the MHC is expressed on the surface of antigen-presenting cells, may optionally further include cytokines that support the viability, activation, and / or activity of T cells (e.g., IL-2, IL-4, IL-7, IL-15, and / or IL-21) and / or cytokines that support the viability, activation, and / or activity of antigen-presenting cells (e.g., GM-CSF, FLT3L, and / or IL-4). Additional cytokines, or combinations of cytokines, useful for supporting the viability, activation, and / or activity of T cells and / or antigen-presenting cells (as well as the amounts of such cells for supporting the viability, activation, and / or activity of T cells and / or antigen-presenting cells) are well known in the art.In some embodiments, additional factors that activate APCs, such as IFNα, LPS, poly-IC, TNF, IL-1β, IL-6, PGE2, etc., are included in the medium that supports cell viability.
[0045] Biological samples are often obtained from or derived from a specific source, subject, or patient.
[0046] "Individual" or "subject" or "animal" means a human, veterinary animal (such as a cat, dog, cow, horse, sheep, pig, etc.), and an experimental animal model of a disease (such as a mouse, rat). In one embodiment, the subject is a human.
[0047] In non-limiting embodiments herein, the biological sample comprises peripheral blood mononuclear cells (PBMCs) derived from a subject. The biological samples described herein can include freshly isolated PBMCs, cryopreserved, newly thawed PBMCs, or PBMCs primed, for example cultured, in the presence of an antigen for about one week, with an expanded memory response and an increased assay signal.
[0048] Generally, the biological samples described herein (e.g., native biological samples) contain a sufficient number of T cells and surface-bound MHC that support T cell activation in response to an antigen, e.g., at least 1×10 5 、5×10 5 、1×10 6 cells, or more total peripheral blood mononuclear cells. 1 mL of whole (human) blood can contain 5×10 5 ~3×10 6 peripheral blood mononuclear cells (PBMCs), and / or can contain 5×10 3 ~5×10 5 APCs (e.g., dendritic cells), and can contain 5×10 3 ~5×10 6Since it can be used to isolate individual T cells, the methods described herein advantageously result from a combination of cell differentiation and multiplexing, and are carried out on small blood volume samples, such as small human blood samples. As a non-limiting example, a collection of cells derived from 10 mL of whole blood isolated from a subject can, anywhere, contain 5×10 6 ~3×10 7 PBMCs, such that the collection of cells can be equally distributed among at least 20 biological samples, each containing a plurality of individual biological samples, e.g., each containing from about 1×10 5 ~1×10 6 PBMCs, and / or from 1×10 5 ~5×10 5 DCs, and 1×10 5 ~5×10 6 T cells, etc., and then pooled (after adding a unique antigen and / or unique HTO to each) and assayed according to the methods described herein. Thus, in some embodiments, the collection of cells contains a sufficient number of peripheral blood mononuclear cells (PBMCs), and in some embodiments where the collection of cells can be equally distributed among a plurality of biological samples, the collection of cells contains a sufficient number of PBMCs, such that the collection of cells can be equally distributed among at least two individual biological samples, each containing at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs, such that the collection of cells can be equally distributed among at least two individual biological samples, each containing at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6Can be equally distributed into at least three separate samples containing the PBMCs. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that the collection of cells each contains at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs and can be equally distributed into at least five separate samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that the collection of cells each contains at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs and can be equally distributed into at least ten separate samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that the collection of cells each contains at least about 1×10 5 PBMCs, at least about 5×10 5 PBMCs, or at least about 1×10 6 PBMCs and can be equally distributed into at least twenty separate samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that the collection of cells each contains at least about 1×10 5Individual PBMCs, at least about 5×10 5 Individual PBMCs, or at least about 1×10 6 Individual PBMCs can be equally distributed among at least 30 individual samples. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of PBMCs such that the collection of cells can be equally distributed among at least 50 individual samples, each containing at least about 1×10 5 Individual PBMCs, at least about 5×10 5 Individual PBMCs, or at least about 1×10 6 Individual PBMCs. For example, the collection of cells can be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject. In some embodiments, the collection of cells contains a sufficient number of T cells and antigen-presenting cells (APCs) (e.g., dendritic cells (DCs)) such that the collection of cells can be equally distributed among a plurality of individual biological samples. In some embodiments, the collection of cells contains a sufficient number of T cells and antigen-presenting cells (APCs) (e.g., dendritic cells (DCs)) such that the collection of cells can be equally distributed among a plurality of individual biological samples. In some embodiments, the collection of cells contains a sufficient number of APCs and T cells isolated from a subject, such as a human subject, such that the collection of cells can be equally distributed among a plurality of individual biological samples, each containing APCs and T cells (e.g., DCs and T cells) at an APC:T cell ratio of about 1:1, about 1:5, or about 1:10. For example, each sample contains at least about 5×10 3 , 5×10 4 , or 5×10 5 DCs, and about 5×10 3 , 1×10 4 , 2.5×10 4 , 5×10 4 , 1×10 6 , 2.5×10 5 , 5×105 、 1×10 6 、 2.5×10 6 、 or 5×10 6 T cells. For example, the collection of cells can be derived from about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, such as a human subject.
[0049] A biological sample isolated from a subject may be further diluted with physiological saline, buffer, or a physiologically acceptable diluent. Alternatively, a biological sample from a subject can be concentrated by conventional methods. A biological sample isolated from a subject can also be divided into two or more aliquots to form "a plurality of biological samples", and each of the plurality of biological samples contains approximately the same number of biologically active cells (e.g., T cells) and approximately the same amount of support reagent. Thus, unless otherwise specified, as used herein, "a plurality of biological samples" means a plurality of different populations of biologically active cells, and each population of biologically active cells is isolated from the same subject, contains approximately the same number of biologically active cells, and is maintained with similar culture conditions, e.g., a support reagent that supports the viability, activation, and / or activity of the biologically active cells.
[0050] In some embodiments of the present invention, a biological sample is primed ex vivo, for example pre-expanded, by incubating with an antigen for about one week (e.g., about 7 to 10 days), and then, after restimulation in vitro with an antigen for about 1 to 3 days (e.g., 6 to 72 hours, e.g., 18 to 24 hours), differentiation, enrichment, and / or analysis of the native biological sample is performed. In some embodiments of the present invention, a biological sample is not primed ex vivo prior to in vitro restimulation with an antigen, and then differentiation of the biological sample, enrichment of the native biological sample, and / or analysis is performed. Ex vivo priming is generally not necessary for biological samples that may not encounter an antigen in vivo. Priming and restimulation procedures, including the timing for the biological sample (e.g., priming for 7 to 10 days and restimulation for 6 to 72 hours, e.g., 18 to 24 hours), including the timing for biological samples containing T cells, are well known in the art.
[0051] In some non-limiting embodiments, each of a plurality of biological samples becomes a unique biological sample by being incubated with its own unique stimulus, or combination of unique stimuli (e.g., an antigen, or a pool of antigens (e.g., T cell epitopes)), and / or its own unique barcode, e.g., (hash tag oligonucleotide), for multiplexing and optional multiplexing.
[0052] As used herein, “hashing,” “barcoding,” “tagging,” etc. involve contacting biologically active cells of a unique biological sample with a molecule conjugated to a unique barcode, such as a unique hashed tag oligonucleotide (HTO), where the unique barcode identifies a unique feature of the unique biological sample, such as a unique antigen (e.g., a unique T cell epitope), or the absence of a unique antigen, and the molecule is incorporated into the cell membrane of a cell surface marker expressed by the biologically active cell and / or specifically binds to the cell surface marker, regardless of the activation state of the biologically active cell. In some embodiments, the HTO molecule can be incorporated into any cell, e.g., any dividing cell, and / or binds to a cell surface marker expressed by most or any cell (e.g., β - microglobulin, CD298). In some embodiments, the selected cell marker is expressed by T cells (e.g., CD2, CD3, CD4, and / or CD8, etc.), regardless of the activation state. Two or more molecules that label cells with HTO in two or more different ways (e.g., one molecule can incorporate itself into the cell membrane while the other binds to a marker, and the two or more molecules can bind to two or more different markers) are each conjugated to HTO and each is used in a hashing method to tag the same unique biological sample. In some embodiments, the two or more molecules can contain the same barcode. In some embodiments, the two or more markers used to hash a unique biological sample can be the same or different markers.In some embodiments, a first unique biological marker may be tagged with a first molecule conjugated to a first unique barcode (e.g., a first HTO), a second unique biological sample may be tagged with a second molecule conjugated to a second unique barcode (e.g., a second HTO), and a third biological sample may be tagged with a third molecule conjugated to a third barcode (e.g., a third barcode), wherein the first, second, and third molecules are each identical, e.g., each capable of integrating itself into the cell membrane or each specifically binding to the same marker, and each of the first, second, and third molecules contains a unique barcode that is sufficiently different such that the first, second, and third molecules can be distinguished from each other. By hash tagging, each of the samples and reagents derived from the same sample can be subsequently detected, traced, and / or quantified. After washing away the unbound molecules, the uniquely differentiated unique biological samples are pooled and optionally incubated with additional reagents for further functional and phenotypic analysis of antigen-specific activated T cells (e.g., flow cytometry analysis, and / or fluorescence-activated cell sorting, single-cell sequencing analysis, etc.).
[0053] Some non-limiting embodiments can further improve the sensitivity and / or robustness of the methods described herein. For example, in some non-limiting embodiments, typically sufficient enrichment is obtained by pooling 20 potential reactive oligodifferentiated assay samples per scSEQ sample. In some embodiments, the sensitivity of the assay can be increased by using a combinatorial differentiation approach. For example, cells are labeled with two or more molecules that each label the reactive HTO in two or more different ways (e.g., one molecule capable of integrating itself into the cell membrane while the other binds to a marker, and the two or more molecules can bind to two or more different markers (e.g., β2-microglobulin and CD2)), each conjugated to the same barcode, e.g., an HTO containing the same sequence, and each is used in a hash tagging method to tag the same unique biological sample.
[0054] For example, the generation and use of "hash tag oligonucleotides", "HTO", etc., which optionally and preferably in some non-limiting embodiments involve conjugation of hash tag oligonucleotides to molecules that bind to activation-induced markers (e.g., antibodies or other macromolecules such as lipids), are well known. See, for example, WO2018144813; Stoeckius et al. (2018) Genome Biol. 19:224; van Buggenum JAGL et al., each of which is incorporated herein by reference in its entirety. Generally, HTOs contain nucleic acids with unique barcodes, e.g., unique sequences measurable by standard polymerase chain reactions, e.g., single-cell RNA sequencing procedures that sequence a cell transcriptome (see, e.g., Stoeckius et al. (2017) Nat. Method 9:2579-10). The unique sequence, in the embodiments described herein, discriminates, for example, a single stimulus, or a combination of stimuli, that causes an activation-induced marker to be expressed in a biological sample. Conjugation chemistries that activate biological samples, e.g., iEDDA click chemistry, can be used to conjugate hash tag oligonucleotides to ligands that bind to molecules, e.g., cell surface markers (e.g., structurally expressed cell surface markers), e.g., covalently attach them. In some embodiments, the cell surface markers are expressed by most, or any, cells, including T cells (e.g., β2-microglobulin, CD298). In some embodiments, the selected cell markers are expressed by T cells (e.g., CD2, CD3, CD4, and / or CD8, etc.) regardless of the activation state. Although oligotag antibodies are described herein, other oligotag tracking molecules other than antibodies, such as oligotag cell membranes that incorporate lipids and cell-permeable nucleic acids, can be used, particularly for further functional and / or phenotypic characterization based on single-cell sequencing analysis.
[0055] The hash tag oligonucleotides (HTOs) used in these compositions and methods can be conjugated to any naturally occurring or synthetic biological or chemical molecule, and these can be used to label cells, such as lipids incorporated into cell membranes, and / or ligands that specifically bind to identified individual markers. The binding can be covalent or non-covalent, i.e., it can be conjugated or by any known means, taking into account the nature of the ligand and its corresponding target. The terms “first HTO-conjugate molecule” and “further HTO-conjugate molecule” or “second HTO-conjugate molecule” etc. mean HTO-conjugate molecules that label cells in different ways. For example, one molecule can incorporate itself into the cell membrane while a second molecule binds to a marker, and two or more molecules can bind to different targets or different parts of a target. For example, a plurality of “first HTO-conjugate molecules” incorporate into the cell membrane or bind to the same marker at the same site. A plurality of further HTO-conjugate molecules bind to a marker different from that of the first HTO-conjugate molecule and different from any further HTO-conjugate molecule. The HTO-conjugate molecules (e.g., the first HTO-conjugate molecule, as well as further HTO-conjugate molecules, e.g., the second, third, fourth, and fifth HTO-conjugate molecules etc.) can be independently selected from peptides, proteins, antibodies or antibody fragments (e.g., the antigen-binding portion of an antibody), antibody mimetics, affibodies, ribo- or deoxyribonucleic acid sequences, aptamers, lipids, cholesterol, polysaccharides, lectins, or chimeric molecules formed from multiple identical or different molecules.Further non-limiting examples of HTO-conjugate molecules include Fab, Fab’, F(ab’)2, Fv fragments, single-chain Fv (scFv), diabodies (Dab), symbodies, nanobodies, BiTE, SMIP, DARPin, DNL, duoCALIN, adnectin, finomer, Kunitz Domains Albu-dabs, DARTs, DVD-IG, Covx bodies, peptibodies, scFv-Ig, SVD-Ig, dAb-Ig, knob-in-hole, triomAb, etc., or combinations thereof. In some embodiments, the molecule conjugated to HTO is a recombinant or naturally occurring protein. In certain embodiments, the molecule conjugated to HTO is a monoclonal or polyclonal antibody, or a fragment thereof. In one embodiment, the molecule to which HTO conjugates can also be directly labeled with one or more detectable labels such as fluorophores that are measurable by a method independent of the method for measuring or detecting the barcode (e.g., HTO) according to well-known methods.
[0056] In some embodiments, the HTO-conjugate molecule contains lipids that are themselves incorporated into the cell membrane. In some embodiments, the HTO-conjugate molecule contains cholesterol that is itself incorporated into the cell membrane. In some embodiments, the HTO-conjugate molecule contains lipid and cholesterol-modified oligonucleotides (LMO and CMO). See, for example, McGinnis et al. (2019) Nature Methods 16:619-26, which is incorporated herein by reference in its entirety.
[0057] Assays for further functional and phenotypic analysis of antigen-specific activated T cell populations are well known in the art and include, but are not limited to, fluorescence-activated cell sorting using fluorescently labeled binding proteins (e.g., antibodies) or MHC multimers, and / or flow cytometry analysis, single-cell RNA sequencing (scRNA-seq), and / or cell indexing of transcriptomes and epitopes by sequencing (CITE-seq) analysis. "Flow cytometry" includes methods that involve suspending cells or particles in a fluid and injecting the suspension into a flow cytometer, whereby the sample is ideally passed one cell at a time through a laser beam and light scattering is characteristic of the cell and its components. Cells labeled with fluorescent labels absorb the laser light and emit it in a band of wavelengths that can be used to distinguish the cells. In a preferred embodiment, after differentiation and pooling, the native biological sample is enriched for activated T cells, e.g., sorted for cells that express an activation-induced marker. In one embodiment, prior to or simultaneously with any further functional and phenotypic analysis of the cells, e.g., prior to or simultaneously with any further flow cytometry analysis and / or single-cell sequencing analysis (which may include CITE-seq analysis of any CITE-seq reagents added to the biological sample before and after sorting), the cells are enriched for activated T cells, e.g., sorted, using a fluorescently labeled antibody against an activation-induced marker and fluorescence-activated cell sorting (FACS). "CITE-seq" includes, for example, methods for measuring the protein expression levels of a sample using oligonucleotide-labeled molecules, e.g., oligonucleotide-labeled molecules, during a single-cell sequencing approach, as described in Stoeckius et al. (20017) Nat.Methods 14:865-868, which is hereby incorporated by reference in its entirety. In some non-limiting embodiments, further functional and phenotypic analysis of the cells includes flow cytometry analysis with fluorescently labeled antibodies that indicate the protein expression levels of cell surface markers, e.g., activation markers, or intracellular proteins, e.g., intracellular cytokines.In some non-limiting embodiments, further functional and phenotypic analysis of the cells includes single-cell RNA sequencing of each activated cell. Non-limiting exemplary platforms for single-cell RNA sequencing include plate-based approaches, or microfluidics / nanowell approaches such as Drop-seq (Macosko, et al. (2015) Cell 161:1202-14), InDrop (Kein et al. (2015) Cell 161:1187-1201), 10X Genomics (Zhen et al (2017) Nat. Commun. 8:1-12), and droplet-based microfluidics approaches such as the Illumina® / BIO-RAD single cell sequencing solution (but not limited to these). Since the mRNA expression level may not fully correlate with the protein expression level in the cell, in some non-limiting embodiments, single-cell RNA sequencing is performed in combination with CITE-Seq analysis using, for example, oligonucleotide-tagged antibodies, MHC multimers, etc. (see, for example, WO2018144813, which is incorporated herein by reference in its entirety).
[0058] An "activation-induced marker" (AIM) is a marker that is expressed or whose expression is upregulated after activation of T cells. Well-known activation-induced markers for T cells include, but are not limited to, CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, etc. In some embodiments, the T cell activation marker, such as the activation-induced marker, includes CD40L. CD40L can also be referred to as CD154. In some embodiments, the T cell activation marker, such as the activation-induced marker, includes CD137. CD137 is also referred to herein as 4-1BB. Thus, CD137 / 4-1BB refers to molecules known in the art such as CD137, 4-1BB, etc., and the terms "CD137", "4-1BB", and "CD137 / 4-1BB" can be used interchangeably. CD137 / 4-1BB is a transient T cell activation marker that is rapidly upregulated upon antigen-specific TCR engagement and remains expressed in cells for approximately 72 hours. In the methods described herein, 20-36 hours after exposure to the antigen appears to be the optimal time point for functional enrichment of CD137 / 4-1BB expression and detection. In some embodiments, the activation-induced marker includes CD107. CD107 can also be referred to as CD107a or LAMP1. In some embodiments, the activation-induced marker includes interferon gamma (IFNγ), which can also be referred to as gamma interferon, IFNG, IFG, etc. In some embodiments, the activation-induced marker includes PD-1, which can also be referred to as programmed cell death 1, CD279, and HPD-1. In some embodiments, the activation-induced marker includes TNF receptor superfamily member 4, which can also be referred to as OX40 and / or CD134. In some embodiments, the activation-induced marker includes interleukin-2 receptor alpha, which can also be referred to as IL-2R, IL-2Rα, and / or CD25.In some embodiments, the activation-induced marker includes CD69, which can also be referred to as leukocyte surface antigen Leu-23 and / or MLR3. In some embodiments, the activation-induced marker includes CD28, which can also be referred to as Tp44 and / or T cell-specific surface glycoprotein. In some embodiments, the activation-induced marker includes major histocompatibility complex class II DR, which can also be referred to as HLA-DR. In some embodiments, the activation-induced marker includes CXC motif chemokine receptor (CX3CR1), which can also be referred to as IL-8 receptor, IL-8Rα, and / or CDw128a. In some embodiments, the activation-induced marker includes TIM3, which can also be referred to as hepatitis A virus cellular receptor 2, T cell membrane protein 3, and / or CD366. In some embodiments, the activation-induced marker includes lymphocyte activation gene 3 (LAG3), which can also be referred to as CD223. In some embodiments, the activation-induced marker includes T cell immunoreceptor with Ig and ITIM domains (TIGIT), which can also be referred to as V-set and immunoglobulin domain-containing protein 9 (VSIG9), and / or V-set and / or transmembrane domain-containing 3 (VSTM3).
[0059] The terms "immunoglobulin", "antibody", "antibodies", "binding protein", etc. mean monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fvs (scFv), single-chain antibodies, Fab fragments, F(ab’) fragments, disulfide-bonded Fvs (sdFV), intrabodies, minibodies, diabodies, and anti-idiotype (anti-Id) antibodies (e.g., including anti-Id antibodies against antigen-specific TCRs), and any epitope-binding fragments of any of the foregoing. The terms "antibody" and "antibodies" also mean shared diabodies such as those disclosed in U.S. Patent Application Publication No. 20070004909, which is hereby incorporated by reference in its entirety, and Ig-DARTS such as those disclosed in the same Publication No. 20090060910, which is hereby incorporated by reference in its entirety.
[0060] As used herein, the term "detectable label" means a reagent, moiety, or compound that can provide a detectable signal, depending on the assay format used. The label can be associated with only molecules and / or with unique barcodes (e.g., unique HTO) or functional portions thereof. Alternatively, different labels can be used for each component of the HTO-conjugated molecule. Such labels can provide a detectable signal alone or in combination with other compositions or compounds. In one embodiment, the labels interact and can provide a detectable signal. In a particular embodiment, the label is visually detectable, e.g., by colorimetric analysis. Various enzyme systems operate to reveal colorimetric signals in assays. For example, glucose oxidase (using glucose as a substrate) releases peroxide as a product that produces oxidized TMB, which appears blue, in the presence of a hydrogen donor such as peroxidase and tetramethylbenzidine (TMB). Other examples include horseradish peroxidase (HRP) or alkaline phosphatase (AP), and hexokinase in combination with glucose-6-phosphate dehydrogenase, which interacts with ATP, glucose, and NAD+ to obtain NADH, among other products, which is detected by an increase in absorbance at a wavelength of 340 nm. Other label systems available with the described methods and molecules are detectable by other means. For example, colored latex microparticles (Bangs Laboratories, Indiana) in which dyes are embedded can be used instead of enzymes to provide a visual signal indicating the presence of labeled molecules in applicable assays. Still other labels include fluorescent compounds, fluorophores, radioactive compounds or elements. In one embodiment, fluorescent dyes detectable by fluorescence, e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), choline phosphine-0 (CPO) or tandem dyes, PE-cyanine-5 or 7 (PC5 or PC7), PE-Texas Red (ECD), PE-cyanine-5.5, rhodamine, PerCP, and Alexa dyes.In particular, combinations of such labels, such as Texas Red and rhodamine, FITC+PE, FITC+PECy5, and PE+PECy7, can be used according to the assay method. The selection and / or generation of suitable labels for use in labeling any component of a molecule and / or a polymeric molecule is within the scope of the art in view of the present specification.
[0061] The terms "specifically binds to", "binds in a specific manner", etc. indicate that the molecule involved in specific binding can (1) stably bind, e.g., associate, e.g., form intermolecular non-covalent bonds under physiological conditions, and (2) under physiological conditions, is unable to bind to other molecules other than a specific binding pair.
[0062] The term "protein" includes all types of naturally occurring and synthetic proteins, including glycoproteins, as well as any other types of modified proteins (e.g., proteins obtained by phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, PEGylation, biotinylation, etc.), including protein fragments of any length, fusion proteins, and modified proteins, but is not limited thereto.
[0063] Unless otherwise specified, the terms "oligonucleotide," "nucleic acid," and "nucleotide" include both DNA, RNA, modified bases, or combinations of these bases. In some embodiments, the hashtag oligonucleotide comprises DNA. In some embodiments, the hashtag oligonucleotide comprises 3 to 100, 3 to 50, 3 to 30, 5 to 30, 10 to 20, 5 to 20, or 5 to 15 nucleotides. In some embodiments, the hashtag oligonucleotide comprises a sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 80, 91, 92, 93, 94, 95, 96, 97, 98, 99, or up to 100 nucleotides. In some embodiments, the hashtag oligonucleotide comprises a polyA sequence, which can comprise 10 or more (e.g., 10 to 40, 10 to 30, or 10 to 20) consecutive adenosine nucleotides, derivatives or variants of adenosine nucleotides.
[0064] The term "self" refers to biological components isolated from the same source, and includes biological components that have not been isolated from the same source but have physical (e.g., amino acid sequence) and functional characteristics as if the biological components were isolated from the same source. In contrast, "heterologous" refers to an agent or component from a different source.
[0065] In accordance with the disclosure herein, within the scope of the art, conventional molecular biology, microbiology, and recombinant DNA techniques may be used. Such techniques are well described in the literature. For example, each of the publications, which are hereby incorporated by reference in their entirety, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989 (herein referred to as “Sambrook et al., 1989”); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds. (1985)]; Transcription And Translation [B.D. Hames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); Ausubel, F.M. et al. (eds.). Current Protocols in Molecular Biology. John Wiley & See Sons, Inc., 1994. These techniques include site-directed mutagenesis.For example, each of the publications, which are hereby incorporated by reference in their entirety, includes Kunkel, Proc. Natl. Acad. Sci. USA 82: 488-492 (1985), U.S. Patent No. 5,071,743, Fukuoka et al., Biochem. Biophys. Res. Commun. 263:357-360 (1999); Kim and Maas, BioTech. 28:196-198 (2000); Parikh and Guengerich, BioTech. 24:428-431 (1998); Ray and Nickoloff, BioTech. 13:342-346 (1992); Wang et al., BioTech. 19:556-559 (1995); Wang and Malcolm, BioTech. 26: 680-682 (1999); Xu and Gong, BioTech. 26:639-641 (1999), U.S. Patent Nos. 5,789,166 and 5,932,419, Hogrefe, Strategies 14.3:74-75 (2001), U.S. Patent Nos. 5,702,931, 5,780,270, and 6,242,222, Angag and Schutz, Biotech. 30:486-488 (2001), Wang and Wilkinson, Biotech. 29:976-978 (2000), Kang et al., Biotech. 20:44-46 (1996), Ogel and McPherson, Protein Engineer. 5:467-468 (1992), Kirsch and Joly, Nucl. Acids Res. 26:1848-1850 (1998), Rhem and Hancock, J. Bacteriol. 178:3346-3,349 (1996), Boles and Miogsa, Curr. Genet. 28:197-198 (1995), Barrenttino et al., Nuc. Acids Res. 22:541-542 (1993), Tessier and Thomas, Meths. Molec. Biol. 57:229-237, and Pons et al., Meth. Molec. Biol. 67:209-218.
[0066] Methods and Compositions The compositions and methods described herein are useful for (a) detecting the presence or absence of functional activation of a biological sample, such as cells, isolated from a subject, such as a human subject, and / or (b) identifying stimuli and optionally unique cognate TCR sequences.
[0067] In one embodiment, a method for identifying a T cell receptor (TCR) α-chain sequence and / or TCR β-chain sequence of a TCR that specifically binds to an antigen capable of activating T cells, such as a T cell epitope, and optionally an antigen described herein, to a T cell, is (I) sorting activated T cells from a composition comprising a native biological sample based on the expression of activation-induced markers (AIMs), wherein the native biological sample comprises (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing a peptide presented in the context of the surface-bound MHC, the T cells and MHC, (b) a native antigen, (c) a native hashed tag oligonucleotide (HTO) that can be used to specifically identify the native antigen, preferably a native HTO that specifically identifies the native antigen, the native HTO being conjugated to a molecule that labels the T cells with the native HTO, and optionally, (d) a medium that supports the activation of T cells comprising, the sorting, and (II) performing single cell sequencing analysis on the activated T cells sorted in (I) to identify the native HTO conjugated to a molecule that labels the activated T cells with the native HTO, wherein identifying the native HTO identifies the antigen capable of activating the activated T cells, and optionally, the single cell sequencing analysis is one or more of the following: (i) one or more genes expressed by the activated T cells, and / or (ii) the TCR α and / or β-chain sequences of the TCR expressed by the activated T cells also identifying, the identifying, and comprising.
[0068] In some embodiments, the methods described herein include (I) sorting one or more activated T cell(s) from a composition comprising a pool of native biological samples, (II) performing single cell sequencing analysis on the activated T cells sorted in (I) to identify an antigen to which the activated T cells are reactive, and comprising. In some embodiments, each of the native biological samples sorted in (I) comprises (a) a T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell is capable of recognizing a peptide presented in the context of the surface-bound MHC, and each T cell of each native biological sample is isolated from the same subject and each MHC of each native biological sample has the same haplotype (optionally, each MHC of each native biological sample is derived from the same sample and binds to the same surface, such as the cell membrane of an antigen-presenting cell), the T cell and the MHC, (b) a native antigen, such as a T cell epitope, (c) a unique hashed tag oligonucleotide (HTO), wherein the unique hashed tag oligonucleotide is conjugated to a molecule that labels the T cell with the HTO and the unique HTO comprises a unique nucleotide sequence that specifically identifies a native antigen, such as the T cell epitope of (b), the HTO, and optionally, (d) a medium that supports activation of the T cell and comprising, In some embodiments, the single cell array determination analysis of (II) identifies a unique HTO conjugated to a component, and the unique nucleotide sequence of the unique HTO identifies an antigen capable of activating activated T cells, such as a T cell epitope. The HTO-conjugate molecule includes a lipid that incorporates itself into the cell membrane. In some embodiments, the HTO-conjugate molecule includes a ligand specifically bound to a cell surface marker expressed by T cells. In some embodiments, the cell surface marker expressed by T cells is ubiquitously expressed by many cells. For example, the cell surface marker may be β2 microglobulin. In some embodiments, the cell surface marker can be selectively expressed by all T cells, regardless of the activation state. In some embodiments, the cell marker is selected from the group consisting of β2 microglobulin, CD298, CD2, CD3, CD4, CD8, and combinations thereof. In some embodiments, the single cell array determination analysis also identifies one or more genes expressed by activated T cells and / or the TCRα and / or β chain sequences of the TCR expressed by activated T cells.
[0069] In some embodiments, the method further comprises forming a pool of distinct biological samples. Forming a pool of distinct biological samples can include, for example, isolating from a subject and equally distributing a biological sample comprising at least T cells, and preferably MHC (such as peripheral blood mononuclear cells (PBMCs), T cells, and APCs, etc.) into individual samples to create a plurality of biological samples, and maintaining the biological samples under conditions that support T cell viability, activation, and / or activity (e.g., each biological sample includes a medium, as well as cytokines that support the viability and activity of PBMCs, such as T cells and APCs). As described herein, the T cells and MHC used in the methods described herein can be derived from any source. In some embodiments, the MHC is expressed on antigen-presenting cells. For example, the biological sample includes T cells and MHC expressed on the surface of antigen-presenting cells (APCs). In some embodiments, the T cells and APCs are autologous. Non-limiting and exemplary sources of APCs include whole peripheral blood mononuclear cells (PBMCs), monocyte-derived dendritic cells (DCs), B cells, macrophages, normal tissues or tumor cells, APC cells, etc. The T cells can be stimulated using co-culture of the APCs with the T cells. In some embodiments, whole PBMCs provide both APCs and T cells.
[0070] In some of these and other embodiments, the method further comprises generating a personalized biological sample by (i) delivering a native antigen, such as a native T cell epitope, to a biological sample isolated from a subject and containing at least T cells and preferably also MHC, and / or (ii) delivering a native HTO conjugated to a molecule that labels T cells with HTO. In some embodiments, the personalized biological sample is primed with the native antigen for about 7 to 10 days before restimulation with the antigen simultaneously, and after restimulation, the sample is differentiated with the native HTO. In some embodiments, the personalized biological sample is not primed ex vivo with the antigen simultaneously with restimulation and is differentiated with the native HTO (e.g., the sample is primed in vivo). In some embodiments, the sample is restimulated for at least 6 hours before being differentiated. In some embodiments, the sample is restimulated for at least 16 hours before being differentiated. In some embodiments, the sample is restimulated for at least about 18 to 24 hours before being differentiated. In some embodiments, the sample is restimulated for about 48 hours before being differentiated. In some embodiments, the sample is restimulated for about 72 hours before being differentiated. In some embodiments, the sample is restimulated for 96 hours or less before being differentiated. In some embodiments, the method further comprises pooling personalized biological samples to generate a composition comprising the personalized biological samples.
[0071] In some embodiments, sorting one or more activated T cells comprises an activation-induced marker (AIM) assay. In some embodiments, the AIM assay comprises fluorescence-activated cell sorting of activated T cells bound to a fluorescently labeled ligand that specifically binds to an activation-induced marker. Thus, in some embodiments, the methods described herein comprise incubating a native biological sample with a fluorescently labeled ligand that specifically binds to an activation-induced marker prior to sorting activated T cells from a composition comprising a pool of native biological samples. The incubation step can occur simultaneously with any differentiation step and / or after the pooling step of the native biological samples.
[0072] In some embodiments, the fluorescently labeled ligand is a fluorescently labeled antibody and / or the activation-induced marker is selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT, and combinations thereof. In some embodiments, the activation-induced marker comprises CD137 / 4-1BB.
[0073] In some embodiments, the method comprises performing further functional and / or phenotypic analysis of the activated T cells. In some embodiments, the further functional and / or phenotypic analysis comprises flow cytometry analysis, CITE-seq analysis, multimer analysis, or combinations thereof. In some embodiments, the further functional and / or phenotypic analysis measures one or more proteins and / or expression levels of CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA-DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3.
[0074] For example, biologically active cell differentiation samples in which cells exhibit a detectable function are also described herein. In some embodiments, the compositions described herein are (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the context of the surface-bound MHC, said T cells and MHC, (b) an antigen, such as a T cell epitope, (c) a hashtag oligonucleotide (HTO), wherein the HTO is conjugated to a molecule that labels the T cells with the HTO, and the HTO contains a nucleotide sequence that specifically discriminates an antigen, such as the T cell epitope of (b), said HTO, and optionally, (d) a medium that supports the activation of the T cells comprising a biological sample comprising. In some embodiments, the molecule that labels the T cells with the HTO is a lipid. In some embodiments, the molecule that labels the T cells with the HTO is an antibody that binds to a cell marker.
[0075] Compositions that can be used in the methods described herein are also described herein. In some embodiments, the compositions described herein are (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the context of the surface-bound MHC, said T cells and MHC, (b) an antigen, (c) a hashtag oligonucleotide (HTO) that specifically discriminates the antigen, said HTO being conjugated to a molecule that labels the T cells with the HTO, and optionally, (d) a medium that supports the activation of the T cells comprising a biological sample comprising.
[0076] In some embodiments, the composition comprises a pool of distinct biological samples (e.g., at least two), such as a composition comprising a first and a second biological sample (and in some embodiments, additional biological samples), wherein each of the first and second biological samples (a) A T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell can recognize a peptide presented in the context of the surface-bound MHC, said T cell and MHC, (b) An antigen, such as a T cell epitope, (c) A hashtag oligonucleotide (HTO), wherein the HTO is conjugated to a molecule that labels the T cell with the HTO, the HTO contains a nucleotide sequence that can be used, and preferably specifically discriminates, to specifically discriminate the antigen of (b), and optionally, (d) A medium that supports the activation of T cells comprising. In some embodiments, the second biological sample is (a) A second T cell and a second surface-bound MHC, wherein the second T cell can recognize a peptide presented in the context of the second surface-bound MHC, said second T cell and second surface-bound MHC, (b) A second antigen, such as a second T cell epitope, (c) A second HTO, wherein the hashtag oligonucleotide is conjugated to a second molecule that labels the T cell with the HTO, the second HTO contains a second sequence that specifically discriminates the second antigen, such as the second T cell epitope of (b), and, optionally, (d) A second medium that supports the activation of the second T cell, comprising, (i) The T cells of the first sample and the second T cells are isolated from the same subject, the MHC of the first sample and the second MHC are bound to the same surface, preferably having the same haplotype (e.g., isolated from the same source), (ii) the antigen of the first sample, such as the first T cell epitope, and the second antigen, such as the second T cell epitope, are not the same, (iii) the first molecule and the second molecule are the same, and the first nucleotide sequence of the first HTO and the second nucleotide sequence of the second HTO are not the same.
[0077] In some embodiments, the compositions described herein include at least two distinct biological samples. In some embodiments, the compositions described herein include at least three distinct biological samples. In some embodiments, the compositions described herein include at least four distinct biological samples. In some embodiments, the compositions described herein include at least five distinct biological samples. In some embodiments, the compositions described herein include at least six distinct biological samples. In some embodiments, the compositions described herein include at least seven distinct biological samples. In some embodiments, the compositions described herein include at least eight distinct biological samples. In some embodiments, the compositions described herein include at least nine distinct biological samples. In some embodiments, the compositions described herein include at least ten distinct biological samples. In some embodiments, the compositions described herein include at least eleven distinct biological samples. In some embodiments, the compositions described herein include at least twelve distinct biological samples. In some embodiments, the compositions described herein include at least thirteen distinct biological samples. In some embodiments, the compositions described herein include at least fourteen distinct biological samples. In some embodiments, the compositions described herein include at least fifteen distinct biological samples. In some embodiments, the compositions described herein include at least seventeen distinct biological samples. In some embodiments, the compositions described herein include at least eighteen distinct biological samples. In some embodiments, the compositions described herein include at least nineteen distinct biological samples. In some embodiments, the compositions described herein include at least twenty distinct biological samples. In some embodiments, the compositions described herein include at least thirty distinct biological samples. In some embodiments, the compositions described herein include at least fifty distinct biological samples. In some embodiments, the compositions described herein include at least eighty distinct biological samples.In some embodiments, the compositions described herein include at least 100 unique biological samples.
[0078] In some embodiments of the compositions described herein, MHC is expressed on the surface of antigen-presenting cells (APCs), such as dendritic cells. In some embodiments, the T cells and APCs are autologous, the T cells and APCs are each isolated from a human donor, and / or the APC is a dendritic cell.
[0079] In some embodiments of the compositions described herein, the antigen, such as a T cell epitope, is selected from the group consisting of (i) a bacterial antigen or a portion thereof, (ii) a viral antigen or a portion thereof, (iii) an allergen or a portion thereof, (iv) a tumor-associated antigen or a portion thereof, and (v) combinations thereof. In some embodiments of the compositions described herein, the antigen, such as a T cell epitope, includes (i) an amino acid sequence, (ii) a nucleotide sequence, (iii) a cell lysate, and (iv) combinations thereof.
[0080] In some embodiments of the compositions described herein, the HTO is conjugated to a molecule that is an antibody, and / or the molecule binds to a cell surface marker selected from the group consisting of β2-microglobulin, CD298, CD2, CD3, CD4, and / or CD8.
[0081] In some embodiments, the medium includes cytokines that support the viability of T cells and / or APCs, and optionally, the cytokines are selected from the group consisting of IL-2, IL-7, IL-15, IL-21, GM-CSF, IL-4, FLT3L, and combinations thereof. In some embodiments, the medium includes anti-CD28 and / or anti-CD3 antibodies instead of or in addition to cytokines (s) that support the viability of T cells and / or APCs.
[0082] In some embodiments, the biological sample comprises peripheral blood mononuclear cells (PBMCs) isolated from a subject. In some embodiments, the PBMCs are freshly isolated PBMCs. In other embodiments, the PBMCs are cryopreserved, freshly thawed PBMCs. In some embodiments, the biological sample comprises a co-culture of dendritic cells and T cells, such as autologous dendritic cells and T cells.
[0083] In some embodiments, the compositions described herein further comprise a fluorescently labeled antibody that specifically binds to a T cell activation marker, and optionally, the T cell activation marker is selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT, and combinations thereof. In some embodiments, the compositions described herein further comprise additional antibodies useful for flow cytometry analysis or analysis, and / or MHC multimers (e.g., fluorescently labeled multimers and / or oligotag multimers).
[0084] Kit The methods and compositions provided herein can be useful for high-throughput assessment of immune responses. Since the methods provided herein can be used with patient samples regardless of MHC haplotype, kits for such shelf analysis of T cell responses are also provided herein.
[0085] In some embodiments, the kit comprises a plurality of unique antigens, e.g., a plurality of unique T cell epitopes, and a plurality of unique HTO-conjugate molecules, each of the plurality of unique HTO-conjugate molecules comprising a unique HTO sequence and a unique HTO comprising the same molecule, each of the plurality of unique HTO sequences being assigned to only one of the plurality of unique antigens (e.g., one of the plurality of unique T cell epitopes), whereby the unique HTO sequence can identify the assigned unique antigen (e.g., T cell epitope). In some embodiments, each of the plurality of antigens is derived from the same source. For example, the plurality of antigens comprises a panel of overlapping peptides derived from a single antigen, e.g., to assist in epitope mapping. In some embodiments, the single antigen can be a pathogenic antigen, e.g., a bacterial or viral antigen. In non-limiting embodiments, such a kit comprises a plurality of antigens (e.g., T cell epitopes) derived from a pathogenic antigen, which can be useful in vaccine development or monitoring of a patient's immune response to an established vaccine. In some embodiments, the single antigen can be a tumor-associated antigen. In non-limiting embodiments, such a kit comprises a plurality of antigens (e.g., T cell epitopes) derived from a tumor-associated antigen, which can be useful in immunotherapy development, e.g., in the identification of TCR variable (e.g., CDR3) sequences associated with T cell-mediated cytotoxicity against tumor cells. In some embodiments, the single antigen can be a self-antigen. In non-limiting embodiments, such a kit comprises a plurality of antigens (e.g., T cell epitopes) derived from a self-antigen, which can be useful in monitoring a patient's autoimmune response. In some embodiments, the single antigen can be a transplantation antigen. In non-limiting embodiments, such a kit comprises a plurality of antigens (e.g., T cell epitopes) derived from a transplantation antigen, which can be useful in the identification of donor organs that are less likely to be rejected by a subject and / or in the establishment of graft-versus-host disease. Some kit embodiments can further comprise additional components, e.g., negative and / or positive control antigens, buffers, vials, instructions for use, multi-well culture dishes, etc.
[0086] Such kits can be useful, for example, in (1) high-throughput analysis of T cell responses for potential or ongoing therapies such as vaccines, immunotherapies, etc., (2) during autoimmune diseases or transplant rejection, (3) for the development of TCR-based therapeutics, and / or (4) for TCR:epitope binding algorithms. Accordingly, provided herein are also methods of use of the high-throughput screening methods, compositions, and / or kits described herein for assessing an immune response and / or identifying TCR sequences (e.g., TCR variable sequences, e.g., TCRα and / or β variable sequences, e.g., TCRα and / or β CDR1, CDR2, and / or CDR3 sequences) associated with activated T cells involved in the immune response.
[0087] Use The methods and compositions provided herein can be useful for assessing an immune response. Accordingly, also described herein are methods of use of high-throughput screening methods, related compositions, and / or related kits for studying an immune response in the context of T cell activation, immune tolerance, etc.
[0088] The methods described herein do not appear to affect the relative fractions of different cell fractions of a sample (e.g., peripheral blood mononuclear cells (PMBC), aspirates), particularly the fraction of antigen-specific T cells, from the time of isolation through any pre-stimulation or restimulation culture until the time of cell sorting. Accordingly, provided herein are methods of use of the high-throughput screening methods, compositions, and / or kits described herein for assessing the relative population size of antigen-specific T cells within a sample.
[0089] Also provided herein are methods of using the high-throughput screening methods, compositions, and / or kits described herein to test vaccine candidates. In one embodiment, provided herein are methods of evaluating whether a vaccine activates an immune response (e.g., T cell proliferation, cytokine release, etc.) in a subject and results in the generation of effector, and additionally memory T cells (e.g., central and effector memory T cells), and / or methods of identifying the molecular phenotypes of activated immunological immune responses.
[0090] The present invention also provides methods of using the high-throughput screening methods, related compositions, and / or kits described herein for adoptive T cell therapy. Accordingly, provided herein are methods of treating or alleviating a disease or medical condition (e.g., cancer) in a subject (e.g., a mammalian subject, e.g., a human subject). In some embodiments, the disease or medical condition is cancer. In other embodiments, the disease or medical condition is caused by a virus or bacterium.
[0091] In some embodiments, the adoptive T cell therapy described herein uses the high-throughput screening methods, compositions, and / or kits described herein to identify nucleic acid sequences encoding TCRα and / or β variable domains, e.g., the sequences of CDR1, CDR2, and / or CDR3 of the TCRα and / or β variable domains of antigen-specific T cells (or, in other embodiments, nucleic acid sequences encoding TCRγ and / or δ variable domains), as well as to identify cognate antigens. In some embodiments, nucleic acid sequences encoding TCRα and / or β variable domains, e.g., the sequences of CDR1, CDR2, and / or CDR3 of the identified TCRα and / or β variable domains (or, in other embodiments, nucleic acid sequences encoding TCRγ and / or δ variable domains) are used in the drug discovery of human therapeutics.
[0092] In one embodiment, the human therapeutic agent is a T cell that has (e.g., has been transfected or transduced with, or in another case has had the nucleic acid of interest introduced into it) a nucleic acid sequence of interest such that the T cell expresses a TCR having affinity for the antigen of interest (e.g., a human T cell, e.g., a T cell derived from a human subject). In one aspect, the subject for whom the therapeutic agent is used is in need of a treatment for a particular disease or medical condition, and the antigen is associated with the disease or medical condition. In one aspect, the T cell is a cytotoxic T cell, the antigen is a tumor-associated antigen, and the disease or medical condition is cancer. In one aspect, the T cell is derived from the subject. Thus, in the adoptive T cell therapy of the methods described herein, upon identification of the nucleic acid and cognate antigen, the nucleic acid sequence of the T cell receptor identified by the methods described herein or a portion thereof (e.g., the nucleic acid sequence of the TCR variable domain) can be cloned into an expression vector (e.g., a retroviral vector), the vector introduced into T cells derived from the subject, the T cells caused to express antigen-specific T cells, and the T cells injected into the subject.
[0093] In other embodiments of the adoptive T cell therapy described herein, a nucleic acid sequence(s) encoding the TCRα and / or β variable domain(s), e.g., the sequences of CDR1, CDR2, and / or CDR3 of the TCRα and / or β variable domain of an antigen-specific T cell (or, in other embodiments, a nucleic acid sequence encoding the TCRγ and / or δ variable domain(s)) is used in the production of a human T cell receptor therapeutic. In one embodiment, the therapeutic receptor is a soluble T cell receptor. Considerable effort has been expended to generate soluble T cell receptors or TCR variable regions for use in therapeutics. The generation of soluble T cell receptors hinges on obtaining rearranged TCR variable regions. One approach is to design a single-chain TCR containing TCRα and TCRβ and, similarly, an scFv immunoglobulin format, and fuse these to each other via a linker (see, e.g., International Application No. 2011 / 044186). The resulting scTv, when similar to an scFv, provides a thermally stable, soluble form of the TCRα / β binding protein. An alternative approach is to design a soluble TCR having a TCRβ constant domain (see, e.g., Chung et al., (1994) Functional three-domain single-chain T-cell receptors, Proc. Natl. Acad. Sci. USA. 91:12654-58); in addition, engineering non-natural disulfide bonds and introducing them at the interface between TCR constant domains (Boulter and Included were those described in Jakobsen (2005) Stable, soluble, high-affinity, engineered T cell receptors: novel antibody-like proteins for specific targeting of peptide antigens, Clinical and Experimental Immunology 142:454-60; see also U.S. Patent No. 7,569,664). Other formats of soluble T cell receptors have been described. Using the methods described herein, sequences of T cell receptors that bind to a target antigen with high affinity can be determined, and then soluble T cell receptors can be designed based on the sequences.
[0094] Using soluble T cell receptors that include sequences identified according to the high-throughput methods, compositions, and / or kits described herein, the function of a target protein, such as a viral, bacterial, or tumor-related protein, can be blocked. Alternatively, the soluble T cell receptor can be fused to a moiety capable of killing infected or cancerous cells, such as a cytotoxic molecule (e.g., a chemotherapeutic agent), a toxin, a radionuclide, a prodrug, an antibody, etc. The soluble T cell receptor can also be fused to an immunostimulatory molecule, such as a cytokine, a chemokine, etc. The soluble T cell receptor can also be fused to an immunosuppressive molecule, such as a molecule that prevents other cells bearing an antigen recognized by T cells from being killed by T cells. Such soluble T cell receptors fused to immunosuppressive molecules can be used, for example, in the blockade of autoimmunity. Various exemplary immunosuppressive molecules that can be fused to the soluble T cell receptor are identified in Ravetch and Lanier (2000) Immune Inhibitory Receptors, Science 290:84-89, which is incorporated herein by reference.
[0095] Non-limiting and exemplary embodiments are shown below.
[0096] Embodiment 1. A method for identifying the T cell receptor (TCR) α and / or β chain sequences of a TCR that recognizes a target epitope, comprising sorting T cells labeled with an oligonucleotide-conjugated antibody from a pool of T cells, wherein the oligonucleotide tag comprises a sequence associated with a unique epitope, antigen, or antigen pool.
[0097] Embodiment 2. The method according to Embodiment 1, further comprising, after sorting, measuring the sequence of the oligonucleotide tag to measure the epitope, antigen, or antigen pool that activated the T cells labeled with the oligonucleotide-conjugated antibody.
[0098] Embodiment 3. Before the sorting step, one or more of the following steps: For example, preparing a peripheral blood mononuclear cell (PBMC) sample from a plurality of culture media in a multi-well culture plate, wherein each culture medium contains an antigen-presenting cell (APC) and a medium and cytokine that support T cell function and proliferation, the step of preparing; Preparing a unique culture medium by delivering one of each of the plurality of culture media to a unique antigen or antigen pool of interest, for example, adding a single antigen (or antigen pool) of interest to a plurality of culture media, such as one well of a culture plate, wherein each culture medium (well) contains a unique antigen or antigen pool, the step of preparing; Adding a unique oligonucleotide tag associated with the unique culture medium to the unique culture medium; Optionally, adding other surface staining antibodies and multimers that may also include oligomer tags, such as CITE-seq and oligodextranmer reagents; Pooling the culture media; The method according to Embodiment 1 or Embodiment 2.
[0099] Embodiment 4. For example, preparing a peripheral blood mononuclear cell (PBMC) sample from a plurality of culture solutions in a multi-well culture plate, wherein each culture solution contains an antigen-presenting cell (APC), a medium and cytokines that support T cell function and proliferation, and the above preparation, Preparing a unique culture solution by delivering one of each of the plurality of culture solutions to a target specific antigen or antigen pool, for example, adding a target single antigen (or antigen pool) to a plurality of culture solutions, for example, one well of a culture plate, wherein each culture solution (well) contains a unique antigen or antigen pool, and the above preparation, Adding an antibody that binds to a T cell activation marker to the unique culture solution in an amount sufficient to label all cells present in each well, and a molecule tagged with a unique oligonucleotide tag associated with the above unique culture solution, Optionally, adding other surface staining antibodies and multimers that may also include an oligomer tag, such as a CITE-seq oligo-dextran reagent, Pooling the above culture solutions, Sorting these T cells labeled with an antibody that binds to a T cell activation marker and is tagged with a unique oligonucleotide tag, Measuring the nucleic acid sequence from the T cells sorted in step (5) that contains the nucleic acid sequence of the above unique oligonucleotide tag, The method according to any one of Embodiments 1 to 3, comprising:
[0100] Embodiment 5. The method according to any one of Embodiments 1 to 4, wherein the T cell activation marker includes CD137 / 4-1BB.
[0101] Embodiment 6. A method for identifying an antigen capable of activating a T cell receptor (TCR) α-chain sequence and / or TCRβ-chain sequence of a T cell and optionally a T cell that specifically binds to the antigen, wherein the method is as follows: (I) Sorting activated T cells from a composition comprising a native biological sample based on the expression of an activation-induced marker (AIM), wherein the native biological sample comprises (a) T cells and surface-bound major histocompatibility complex (MHC), wherein the T cells are capable of recognizing peptides presented in the context of the surface-bound MHC, said T cells and MHC, (b) a native antigen, (c) a native hashed tag oligonucleotide (HTO) that is specifically distinguishable from, and / or used to distinguish, for example, a native HTO that specifically discriminates said native antigen, and wherein said native HTO is conjugated to a molecule that labels said T cells with said native HTO, and optionally, (d) a medium that supports the activation of T cells comprising, said sorting; (II) Performing single-cell sequencing analysis on the activated T cells sorted in (I) to identify the native HTO conjugated to a molecule that labels the activated T cells with the native HTO, wherein identifying the native HTO identifies the antigen capable of activating the activated T cells, and optionally, the single-cell sequencing analysis is one or more of the following: (i) one or more genes expressed by the activated T cells, and / or (ii) the TCRα and / or β chain sequences of the TCR expressed by the activated T cells also identifying, said identifying; comprising, said method.
[0102] Embodiment 7. Prior to sorting, one or both of the following step(s): Creating a plurality of biological samples by equally distributing a collection of cells comprising T cells and antigen-presenting cells (APCs) isolated from a subject into individual samples, wherein each biological sample optionally comprises a medium and cytokines that support the viability, activation, and / or activity of the T cells and / or APCs, said step; A step of preparing a plurality of native biological samples by delivering a native antigen and / or a native HTO that can specifically identify, and / or is used to specifically identify, for example, a native HTO that specifically identifies the above native antigen, to each of the plurality of biological samples, wherein the step of conjugating the native HTO to a molecule that labels T cells with the native HTO, and optionally, the step of combining the plurality of native biological samples so that the composition sorted in (I) contains the plurality of native biological samples. comprising each of the plurality of biological samples comprises a collection of cells containing T cells and APCs isolated from a subject, and optionally comprises a medium that supports the viability, activity, and / or activation of the T cells and APCs. After delivering the native antigen and / or native HTO conjugated to a molecule that labels T cells with the native HTO, each of the plurality of biological samples (a) a collection of cells containing T cells and APCs isolated from a subject (b) a native antigen (c) a native HTO that specifically identifies the native antigen and is conjugated to a molecule that labels T cells with HTO, and optionally (d) a medium that supports the viability, activity, and / or activation of T cells and APCs The method according to Embodiment 6, which becomes a native biological sample containing.
[0103] Embodiment 8. The method according to Embodiment 7, wherein the APC comprises monocytes-derived dendritic cells, dendritic cells, monocytes, macrophages, B cells, or a combination thereof.
[0104] Embodiment 9. The method according to any one of Embodiments 6 to 8, wherein sorting comprises fluorescence-activated cell sorting of activated T cells based on the expression of activation-induced markers (AIM).
[0105] Embodiment 10. The method according to embodiment 9, wherein the AIM is selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, and any combination thereof.
[0106] Embodiment 11. The method according to embodiment 9 or 10, wherein the fluorescence-activated cell sorting is based on detection using a fluorescently labeled antibody against the above AIM.
[0107] Embodiment 12. The method according to any one of embodiments 6 to 11, further comprising performing functional analysis and / or phenotypic analysis on the activated T cells analyzed in II, and optionally, the further functional analysis and / or phenotypic analysis is selected from the group consisting of flow cytometry analysis, CITE-seq, multimer analysis, and combinations thereof.
[0108] Embodiment 13. The method according to embodiment 12, wherein the further functional analysis and / or phenotypic analysis measures the expression levels of one or more proteins and / or RNAs among CD3, CD4, CD8, CD25, CD27, CD28, CD45RA, CD62L, HLA-DR, CD137 / 4-1BB, CD69, CD278, CD274, CD279, CD127, CD197, IFNγ, GZMH, GNLY, CD38, CCL3, and LAG3.
[0109] Embodiment 14. The method according to any one of embodiments 6 to 13, wherein the peripheral blood mononuclear cells yield T cells and surface-bound MHC.
[0110] Embodiment 15. The method according to any one of embodiments 6 to 14, wherein the molecule that labels the above T cells with the above unique HTO includes an antibody that binds to a cell surface molecule.
[0111] Embodiment 16. The method according to any one of embodiments 6 to 15, wherein the AIM is CD137 / 4-1BB or includes this.
[0112] Embodiment 17. The method according to any one of Embodiments 6 to 16, wherein the method includes identifying the TCRα chain sequence and / or the TCRβ chain sequence of a TCR that specifically binds to the antigen, and the TCRα chain sequence and / or the TCRβ chain sequence are each a TCRα chain variable region sequence and / or a TCRβ chain variable region sequence.
[0113] Embodiment 18. The method according to any one of Embodiments 6 to 17, wherein the method includes identifying the TCRα chain sequence and / or the TCRβ chain sequence of a TCR that specifically binds to the antigen, and the method further includes using the TCRα chain sequence and / or the TCRβ chain sequence in the preparation of a therapeutic agent.
[0114] Embodiment 19. (a) A T cell and a surface-bound major histocompatibility complex (MHC), wherein the T cell can recognize a peptide presented in the context of the surface-bound MHC, the T cell and the MHC, (b) An antigen, (c) A hash tag oligonucleotide (HTO) that specifically identifies the antigen, wherein the HTO is conjugated to a molecule that labels the T cell with the HTO, the HTO, and, optionally, (d) A medium that supports the activation of T cells A composition comprising a biological sample containing the same.
[0115] Embodiment 20. (a) The MHC is expressed on the surface of an antigen-presenting cell (APC), and optionally, the T cell and the APC are autologous, the T cell and the APC are each isolated from a human donor, and / or, the APC is selected from the group consisting of monocyte-derived dendritic cells, dendritic cells, monocytes, macrophages, B cells, and combinations thereof, (b) The antigen is (I) (i) A bacterial antigen or a portion thereof, (ii) A viral antigen or a portion thereof, (iii) An allergen or a portion thereof, (iv) A tumor-associated antigen or a portion thereof, and (v) Combinations thereof selected from the group consisting of, and / or (II) (i) An amino acid sequence, (ii) A nucleotide sequence, (iii) A cell lysate, and (iv) Combinations thereof comprising, (c) The HTO conjugate molecule is (I) An antibody that binds to a cell surface molecule, or (II) A lipid comprising, and / or (d) The medium contains cytokines that support the viability of the T cells and / or APCs, The composition according to embodiment 19.
[0116] Embodiment 21. The antibody binds to a cell surface marker selected from the group consisting of β2-microglobulin, CD298, CD2, CD3, CD4, CD8, and any combination thereof, or The lipid is incorporated into the cell membrane, the composition according to embodiment 20.
[0117] Embodiment 22. The cytokine that supports the viability of the T cells and / or the APCs is selected from the group consisting of IL-2, IL-7, IL-15, GM-CSF, IL-4, and any combination thereof, the composition according to embodiment 20 or embodiment 21.
[0118] Embodiment 23. Further comprising a second biological sample, the second biological sample being (a) A second T cell and a second surface-bound MHC, wherein the second T cell is capable of recognizing a peptide presented in the context of the second surface-bound MHC, the second T cell and the second surface-bound MHC, (b) A second antigen, (c) A second HTO that specifically discriminates a second antigen, wherein the HTO conjugates to a second molecule that labels the second T cell with the second HTO, the second HTO, and, optionally, (d) A medium that supports the activation of the second T cell comprising (i) the T cell and the second T cell are isolated from the same subject, (ii) the antigen and the second antigen are not the same, (iii) the molecule that labels the T cell with the HTO and the second molecule that labels the second T cell with the second HTO are the same, and the HTO and the second HTO are not the same, the composition according to any one of Embodiments 20 to 22.
[0119] Embodiment 24. The composition according to any one of Embodiments 19 to 23, wherein the composition further comprises an agent that enables sorting of activated T cells based on the expression of an activation-induced marker (AIM).
[0120] Embodiment 25. The composition according to Embodiment 24, wherein the agent that enables sorting of activated T cells based on the expression of AIM is a fluorescently labeled antibody that specifically binds to the AIM.
[0121] Embodiment 26. The composition according to Embodiment 24 or Embodiment 25, wherein the AIM is selected from the group consisting of CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, and / or TIGIT.
[0122] Embodiment 27. The composition according to any one of Embodiments 19 to 26, wherein the composition comprises an antibody and / or an MHC multimer useful for flow cytometry analysis or CITE-seq of the composition.
[0123] Embodiment 28. A plurality of unique antigens, and A plurality of unique hash tag oligonucleotides (HTOs), each of which specifically binds to only one of the plurality of unique antigens, the HTOs A kit comprising the same.
[0124] Embodiment 29. The kit according to embodiment 28, further comprising an agent that enables sorting of activated T cells based on the expression of an activation-induced marker (AIM), and optionally, the agent that enables sorting of activated T cells based on the expression of AIM is a fluorescently labeled antibody that specifically binds to the AIM.
[0125] Embodiment 30. Each of the plurality of unique HTOs is conjugated to the same molecule, and the kit comprises a plurality of molecules conjugated with the unique HTOs, according to embodiment 28 or 29.
[0126] Embodiment 31. Each of the plurality of unique antigens comprises unique and overlapping peptide sequences from a single protein, according to any one of embodiments 28 to 30.
[0127] Embodiment 32. The kit according to embodiment 31, wherein the single protein is selected from the group consisting of a pathogenic antigen, a tumor-associated antigen, or a transplantation antigen.
[0128] Embodiment 33. Use of the method according to any one of embodiments 1 to 18, the composition according to any one of embodiments 19 to 27, or the kit according to any one of embodiments 28 to 32 for analyzing a T cell-mediated immune response of a patient to a vaccine.
[0129] Embodiment 34. Use of the method according to any one of embodiments 1 to 18, the composition according to any one of embodiments 19 to 27, or the kit according to any one of embodiments 28 to 32 for analyzing a T cell-mediated immune response of a patient to immunotherapy.
[0130] Embodiment 35. Use of the method according to any one of Embodiments 1 to 18, the composition according to any one of Embodiments 19 to 27, or the kit according to any one of Embodiments 28 to 32 for analyzing a T cell-mediated immune response in a patient during immunotherapy of the patient.
[0131] Embodiment 36. Use of the method according to any one of Embodiments 1 to 18, the composition according to any one of Embodiments 19 to 27, or the kit according to any one of Embodiments 28 to 32 for analyzing a patient's T cell response to a self-antigen.
[0132] Embodiment 37. Use of the method according to any one of Embodiments 1 to 18, the composition according to any one of Embodiments 19 to 27, or the kit according to any one of Embodiments 28 to 32 for analyzing a patient's T cell response to a transplantation antigen.
[0133] Embodiment 38. Use of the method according to any one of Embodiments 1 to 18, the composition according to any one of Embodiments 19 to 27, or the kit according to any one of Embodiments 28 to 32 for identifying one or more TCR variable region sequences of activated T cells.
[0134] Embodiment 39. The use according to Embodiment 38, wherein the one or more TCR variable region sequences comprise a CDR3 sequence of the TCRα chain and / or a CDR3 sequence of the TCRβ chain.
[0135] Embodiment 40. Use of one or more TCR variable region sequences identified in Embodiment 38 or 39 in the preparation of a human therapeutic agent.
[0136] Embodiment 41. The use according to Embodiment 40, wherein the human therapeutic agent comprises T cells comprising one or more TCR variable region sequences identified using the method according to any one of Embodiments 1 to 18, the composition according to any one of Embodiments 19 to 27, or the kit according to any one of Embodiments 28 to 32.
[0137] Although the present invention has been specifically illustrated and described with reference to a number of embodiments, those skilled in the art will understand that various changes in form and detail can be made to the various embodiments disclosed herein without departing from the spirit and scope of the invention, and that the various embodiments disclosed herein are not intended to limit the claims.
Example
[0138] Non-limiting embodiments of the methods described herein are shown in FIG. 1. The examples herein use fractionation techniques in combination with functional assays, such as enrichment of activation-induced markers (AIM) cells and single-cell transcriptome sequencing, to screen for cognate T cells and antigen reactivity, such as T cell epitope reactivity, and provide data that such methods are particularly useful in primary human cells.
[0139] Before describing more specific and illustrative applications of the method, the general method is shown here.
[0140] General Materials and Methods Human peripheral blood mononuclear cells (PBMCs): Cryopreserved PBMCs were purchased (Precision for Medicine Frederick, Maryland) or isolated from fresh blood from human subjects isolated by density gradient centrifugation using Ficoll-Paque Plus (GE Healthcare Life Sciences, 45-001, 749) reagent according to the manufacturer's instructions and cryopreserved in cryopreservation medium (90% human serum (Millipore Sigma), 10% tissue culture grade DMSO (Millipore Sigma, 2438)) for later analysis.
[0141] Peptide: The peptide was custom synthesized by Genscript (Piscataway, NJ). The lyophilized peptide was reconstituted in DMSO at 10 - 50 mg / mL with respect to the stock solution and then diluted to 10 μg / mL in the appropriate assay medium for use. According to the manufacturer's instructions, CEF Control Peptide Pool (Anaspec, AS - 61036 - 003) was used at 10 μg / mL and Cell Stimulation Cocktail (ThermoFisher, 00 - 4970 - 93) was used.
[0142] Primary cell cultures: Cryopreserved PBMCs were thawed and incubated in CellGenix GMP DC serum - free medium (CellGenix, 20801 - 0500) containing 5% human serum AB (Millipore Sigma, H3667) and 1% penicillin - streptomycin (ThermoFisher Scientific, 15140163). The culture medium was a supplement containing dendritic cell and T - cell supporting cytokines: T - cell medium (CellGenix dendritic cell medium, catalog number 20801 - 0500 + 5% human serum AB (Sigma, catalog number H3667)) + 1% penicillin / streptomycin / L - glutamine (ThermoFisher, catalog number 10378 - 016), 5 ng / mL of T - cell supporting cytokines IL - 7 and IL - 15 (CellGenix, catalog numbers 1410 - 050 and 1413 - 050 respectively), and 10 U / mL of IL - 2 (Peprotech, catalog number 200 - 0).
[0143] Generation of oligotag - differentiated antibodies: In all human T cells, monoclonal antibodies highly specific for cell - surface targets (CD2, RPA - 2.10; Biolegend, catalog number 300202) were custom conjugated to a unique 15 - base oligonucleotide sequence containing a poly - A tail using published methods. See Stoeckius 2017, bioRxiv above.
[0144] Direct ex vivo IFNγ / granzyme B ELISPOT: A dual human IFNγ / granzyme B FluoroSpot assay kit was purchased from ImmunoSpot (Cleveland, OH) and used according to the manufacturer's procedure. Briefly, PBMCs were thawed and incubated for 48 hours at 200 μL per well with 200,000 cells per well on a FluoroSpot plate with peptide stimulation. ELISPOT reactivity was read on an ImmunoSpot Analyzer using the manufacturer's automated software.
[0145] Antibody and phenotypic characterization of T cells by flow cytometry: Fluorescently labeled antibodies were purchased from commercial vendors. To perform flow cytometry phenotypic characterization of surface proteins, cells were harvested, washed, and resuspended in flow cytometry BD BSA staining buffer (BD Biosciences, #554657) containing the antibody of interest. Cells were incubated for 30 minutes at 4°C, then washed twice before flow cytometry collection on an A3 Symphony cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo analysis software (FlowJo, Ashland, OR). Gates were set based on fluorescence minus one (FMO) controls.
[0146] Antigen-Specific T Cell Reactivity Assay: Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque Plus gradient isolation. PBMCs were seeded, for example aliquoted, into culture dishes in T cell medium (CellGenix GMP DC Medium, catalog number 20801-0500 + 5% human serum AB (Sigma, catalog number H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, catalog number 10378-016), dendritic cells supporting factor GM-CSF at 1000 U / mL, and factor IL-4 at 500 U / mL (CellGenix, #1412-050 and CellGenix, #1403-050 respectively), T cell supporting cytokines IL-7 and IL-15 at 5 ng / mL (CellGenix, #1410-050 and 1413-050 respectively), and IL-2 at 10 U / mL (Peprotech, catalog number 200-0). An individual antigen, for example the peptide of interest, was added to the assay wells at 10 μg / mL (Genscript) to form the native biological sample.
[0147] The overnight culture was harvested 24 hours after peptide stimulation and prepared for sorting and single cell sequencing. For the 10-day pre-proliferation culture, cells were supplied with fresh medium and cytokines every other day for one week after the first peptide addition. Next, the individual peptide of interest was added to the T cell proliferation culture for overnight restimulation, controlling the expression of activation-induced markers such as CD137 / 4-1BB and enabling functional T cell sorting based on antigen-specific AIM. After peptide restimulation, the cells were prepared for flow cytometry characterization or further processed to enable cell differentiation, pooling, and single cell sequencing.
[0148] Cell Differentiation after Functional T Cell Assay Performance: After functional stimulation, cells from individual assay wells were collected into 96-well assay blocks, washed, and resuspended in flow cytometry BD BSA staining buffer (BD Biosciences, #554657) containing the differentiation reagent of interest. The cells were resuspended at 1 μg / 106 Individual cells were stained with either one or two types of hashtag oligonucleotide (HTO) antibodies. The cells were incubated at 4°C for 30 minutes, washed twice, and then pooled. If oligonucleotide tag dextramers were included in the analysis, the samples were stained with dextramers and then proceeded to CITE-seq and flow cytometry antibody staining following the following oligotag dextramer staining procedure.
[0149] CITE-seq antibody staining and fluorescent antibody staining: After the cell differentiation staining procedure, the pooled and differentiated samples were resuspended in BD BSA staining buffer containing both CITE-seq antibodies and, in addition, fluorescent tag flow cytometry antibodies at their respective optimal concentrations. The cells were incubated at 4°C for 30 minutes, washed twice, and then sorted for single cell sequencing.
[0150] Oligotag dextramer staining and FACS sorting: Cryopreserved healthy donor PBMCs were briefly thawed in a 37°C water bath. CD8+ T cells were enriched using magnetic beads (Miltenyi Biotec). The cells were washed by centrifugation and treated with PBS (Gibco, 14190-250) containing benzonase (Millipore, 70664) and 50 nM dasatinib (Axon Medchem, 1392) for 45 minutes at 37°C. The cells were transferred to a 96-well assay block (Corning, 3960), centrifuged, and the supernatant was aspirated. The appropriate custom Immudex dCODE-PE dextramer pool (Copenhagen, Denmark) was added at 1 μL / 100 μL at room temperature for 30 minutes in the dark. Next, fluorescently labeled surface markers were added and the cells were incubated for an additional 30 minutes at 4°C. After washing, the cells were sorted immediately. Flow cytometry antibody staining and washing were performed with staining buffer (BD, 554657). Surface markers for FACS included the following markers and fluorochromes: Live / Dead-DAPI (Sigma, 10236276001) added on the sorter, CD3 BUV737 (BD Biosciences, 612750), CD4 BV510 (BD Biosciences, 563919), CD8 BUV805 (BD Biosciences, 612889), CCR7 AF647 (BioLegend 353218), and CD45RO BV605 (BioLegend 304238).
[0151] CD137 / 4-1BB+ T cell FACS sorting: Twenty-four hours after restimulation, cells were collected and stained with fluorescently labeled antibodies for FACS using an Astrios cell sorter (Beckman Coulter) with the following surface antibodies: CD3 (BD Biosciences, catalog number 612750) and CD137 / 4-1BB (Biolegend, catalog number 309828). Forward scatter plots, side scatter plots, and gates for the fluorescence channels were set to select live cells while excluding debris and doublets. Single CD3+CD137 / 4-1BB+ cells were sorted for further processing using a 100 μm nozzle.
[0152] Chromium single cell partitioning and library preparation: The sorted cells were then loaded onto a Chromium Single Cell 5’ Chip (10x Genomics, 1000287), processed through a Chromium controller to generate GEMs (gel beads in emulsion). RNA-Seq libraries were prepared using the Chromium Single Cell 5’ Chip (10x Genomics, 1000287) according to the manufacturer's protocol.
[0153] Bioinformatics methods Sequenced the transcriptome, TCR (VDJ), differentiation, CITE-seq, and dextramer libraries, and processed the raw sequencing data using the 10X CellRanger analysis pipeline. CellRanger analysis generated a feature-barcode UMI count matrix and TCR (VDJ) amino acid sequences. Features included gene expression, antibody differentiation, CITE-seq antibodies, and dextramer capture. Using the feature-barcode matrix as input, the R package Seurat v3.1.4 (Butler et al 2018) was used for downstream analysis. Standard log normalization of gene UMI counts was performed, followed by identification of the 1000 most variable genes and scaling and centering of the data. Next, principal component analysis (PCA) was performed, calculating and sorting 50 PCs. Next, clustering was performed using Seurat's graph-based clustering approach. A k-nearest neighbor (KNN) graph was calculated based on Euclidean distance in 20-dimensional PCA space and subsequently clustered at various resolutions. At each resolution, top marker genes were identified and used to create a heatmap of gene expression across different clusters. The optimal cluster resolution was measured during visual inspection. All cells belonging to the dead cell cluster, including mitochondrial genes as top gene markers, were removed from downstream analysis. Cells with fewer than 500 detected genes and a mitochondrial gene expression fraction of 0.25 or more were removed. Since one of the main goals of the assay was to identify T cell reactivity to various antigens driven by TCR-antigen interactions, any cells containing a single TCR chain, or a non-productive chain, or two or more α or β chains were also removed. Any outlier cells with a large number of detected genes and / or a large number of detected UMIs were also removed. For the remaining cells, data from other features (CITE-seq, differentiation, dextramer) were then processed. Data from the count matrices corresponding to these features were normalized using centered log ratio transformation and then scaled.Using the demultiplexed data, cells were demultiplexed using the MultiSeqDemux algorithm (McGinnis et al., 2019, Nature Methods 16:619 - 26; default parameters). Following the demultiplexing scheme, any cells not assigned to a hashtag were removed after multiplexing. For each cell, the paired TCR amino acid sequences defining the cell's unique functional clonotype were obtained. After demultiplexing, the clonotype size of each T cell clone was calculated in all cells associated with the hashtagged assay well. Any clonotype with a size >20 was considered to have potential reactivity to a specific antigen in the hashtagged well.
[0154] Example 1: Discrimination of CD137 / 4 - 1BB as an activation - induced marker (AIM) for functionally distinguishable antigen - specific T cell populations corresponding to multimer staining Materials and Methods Generally, in the methods described in this example, T cells from healthy HLA - A*0201+ human donors were pre - expanded in the presence of homologous synthetic peptides according to the methods described herein, and then stained with fluorescent - labeled antibodies and dextramer multimers for flow cytometry analysis to identify antigen - specific T cell populations.
[0155] Results In Figure 2A, dendritic cells (DCs) were derived from whole peripheral blood mononuclear cells (PBMCs) from healthy human donors. Briefly, CD14+ monocytes were isolated from PBMCs by magnetic selection using anti-CD14 magnetic beads (Miltenyi). CD14+ cells were cultured for 5 days in CellGenix CellGro DC medium supplemented with IL-4 and GM-CSF. On day 5, the DCs were pulsed for 2 hours with synthetic short peptides specific for HLA-A*0201, CMV pp65 (NLVPMVATV; SEQ ID NO: 16), or MART1 (ELAGIGILTV; SEQ ID NO: 15). Next, IFNα was added to the cells to activate them. On day 7, autologous T cells were added to the culture, and the medium was replaced with CellGenix CellGro medium supplemented with 5% human serum + supporting cytokines (IL7, IL-15, IL-2). These autologous DCs and T cells were cultured for 10 days to expand the relevant pre-existing antigen-specific T cell population. After 10 days of pre-expansion in culture, the T cells were restimulated for 24 hours with the relevant peptide or DMSO negative control. The target cell surface markers were evaluated by flow cytometry characterization (A3 Symphony analyzer, BD) using fluorescently labeled monoclonal antibodies and dextramer multimers.
[0156] The fraction of CD137 / 4-1BB+ CD8+ T cells from the culture was low before stimulation (x-axis, left panel), but the multimer robustly stained the target CD8+ T cell population: 25.5% CMV pp65 CD8+ T cells, 7.79% MART1+ T cells (x-axis, middle panel), as shown by the flow cytometry dot plot in Figure 2A. In other words, the cell culture conditions used in this particular example expanded pre-existing memory T cells but did not induce new T cell proliferation. However, after 24 hours of restimulation with the cognate peptide, CD137 / 4-1BB expression was upregulated in CD8+ T cells, and the overall size of the CD137 / 4-1BB+ population (x-axis) was similar to the multimer+ population (right panel).
[0157] In FIG. 2B, cells isolated from four HLA-A+0201+ healthy donors (HD1, HD2, HD3, and HD27) were cultured for 10 days in the presence of DMSO or CMV pp65 synthetic peptide using the same cell culture medium and staining method as described in this example. CMV pp65 multimer + CD8+ The fraction of T cells was evaluated by flow cytometry (FIG. 2B, upper panel). The expression of CD137 / 4-1BB in CD8+ T cells after 24-hour restimulation with CMV pp65 synthetic peptide relative to the DMSO control was also evaluated by flow cytometry (FIG. 2B, lower panel). Three of the four donors who were seropositive for CMV had measurable CMV pp65+ CD8+ T cells (HC1, HD2, HD27), while the CMV seronegative donor (HD3) did not have detectable CMV pp65+ T cells (FIG. 2B). In general, the population sizes of multimer + CD8+ and CD137 / 4-1BB+ CD8+ T cells are consistent (FIG. 2B).
[0158] In FIGS. 3A - 3B, peripheral blood mononuclear cells (PBMC) from healthy HLA - A*0201+ human donors (HD3 and HD27) were cultured for 10 days in a medium containing supportive cytokines (GM - CSF, IL - 4, IL7, IL - 15, IL - 2) and DMSO or a synthetic short - chain peptide of MART1 (ELAGIGILTV; SEQ ID NO: 15) to provide a baseline population (DMSO) or to expand the relevant pre - existing MART1 - specific T cells, respectively. After 10 days of pre - expansion in the culture medium, the T cells were restimulated for 24 hours with a DMSO negative control or the MART1 peptide. MART1 multimer+ CD8+ T cells and CD137 / 4 - 1BB CD8+ T cells from healthy donor 27 (HD27) were sorted by fluorescence - activated cell sorting (FACS) and encapsulated in a 10X Genomics single - cell dispenser for 5′ RNA and TCR single - cell sequencing library preparation, followed by high - throughput next - generation sequencing. Only cells that generated complete paired α and β TCR information were evaluated. Overlaps spanning the multimer+ and CD137 / 4 - 1BB+ samples were evaluated.
[0159] Before restimulation, both donors had detectable MART1+ CD8+ T cells (Figure 3A, upper panel). After 24 hours of restimulation with the cognate peptide, both donors (HD3 and HD27) upregulated CD137 / 4-1BB on the cell surface (Figure 3A, lower panel). However, one donor (HD27) had far more CD137 / 4-1BB+ T cells than multimer+ CD8+ T cells (Figure 3A). To test this discrepancy, functional T cell clones identified by multimer and CD137 / 4-1BB staining were further evaluated by assessing the overlap across multimer+ and CD137 / 4-1BB+ samples. There was significant overlap in the TCR sequences shared between multimer+ and CD137 / 4-1BB+ CD8+ T cells (Figure 3B). Generally, the CD137 / 4-1BB+ fraction contained more clonal populations than the MART1 multimer+ population. The most clonally expanded MART1 multimer+ TCRs were detected in CD137 / 4-1BB+ CD8+ T cells, and many less abundant TCRs were also detectable across both enriched populations. However, the CD137 / 4-1BB+ population captured TCRs not detected in the multimer+ population. In addition, many of the smaller TCR sequences from the MART1 multimer+ population were present as larger clone sizes in the CD137 / 4-1BB+ population.
[0160] The data shown in Figures 2A–B and 3A–B indicate that the activation-induced marker CD137 / 4-1BB is upregulated on human T cells after antigen-specific activation and that there is significant overlap between the single-cell paired α / β-chain T cell receptor (TCR) sequences between cultured multimer+ and CD137 / 4-1BB+ CD8+ T cells according to the methods described herein. Therefore, CD137 / 4-1BB can be used in functional assays, for example, as a functional enrichment activation-induced marker (AIM) for antigen-specific T cells. In addition, the use of CD137 / 4-1BB as a functional marker is as efficient as conventional multimer staining and yields similar functional assay results.
[0161] Example 2: Characterization of allogeneic T cells and epitope reactivity in primary human cells using hashtag oligonucleotides and enrichment of CD137 / 4-1BB on activated T cells As a feasible method, further validation of cell differentiation, AIM sorting, and / or single-cell sequencing analysis was performed to evaluate and characterize allogeneic antigens and TCR reactivity. A native biological sample containing PBMC and native viral peptides was differentiated with a hashtag oligonucleotide-conjugated anti-CD2 antibody and pooled. Functional activation was identified by CD137 / 4-1BB staining, and the use of CD137 / 4-1BB in functional assays was compared with conventional functional assays of ELISPOT / and dextramer staining.
[0162] Materials and Methods ELISPOT: PBMC from healthy HLA-A*0201+ human donors with known serum positivity against CMV, EBV, and influenza were plated at a concentration of 2 × 10 5 cells per well on a Dual Human IFNγ / GranzymeB FluoroSpot assay plate (ImmunoSpot, Cleveland, OH) by DMSO or individual HLA-A*0201+ restricted viral peptide stimulation (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, influenza A) for 48 hours. After incubation, ELISPOT reactivity occurred and was read on an ImmunoSpot analyzer using the manufacturer's instructions and automated software.
[0163] PBMC Cultivation for Subdivision and AIM Enrichment: Peripheral blood mononuclear cells (PBMCs) derived from healthy HLA-A*0201+ human donors were cultured for 10 days with medium, supportive cytokines (GM-CSF, IL-4, IL7, IL-15, IL-2), and individual HLA-A*0201+ restricted viral peptides (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, influenza A) to proliferate relevant, pre-existing antigen-specific T cells. After 10 days of pre-proliferation in the culture medium, the T cells were re-stimulated with the relevant peptides or DMSO negative control for 24 hours. The target cell surface markers were evaluated using fluorescently labeled monoclonal antibodies by flow cytometry characterization (A3 Symphony analyzer, BD). The relative fraction of CD137 / 4-1BB+ CD8+ T cells spanning viral peptide stimulation was evaluated by flow cytometry (provided as the percentage of total CD8+ T cells above the gate, CD8+ CD137 / 4-1BB+ T cell fraction).
[0164] Subdivision, AIM Enrichment, and Single-Cell Sequencing. Monoclonal human anti-CD2 antibodies labeled with unique hashtag oligonucleotides were added to each assay well of the PBMC biological samples described in this experiment to uniquely barcode the T cells from a given well with the stimulation received by the same cells. Next, all assay well samples were pooled and stained with fluorescent tag surface antibodies for FACS sorting and CITE-seq antibodies for scSEQ phenotyping. CD137 / 4-1BB+ CD8+ T cells were sorted and demultiplexed and analyzed, for example, by single-cell sequencing (10X Genomics 5’ RNA and TCR). Expression was normalized using the LogNormalize method that normalizes gene expression for each cell by total expression. Mathematically, the normalized expression is equal to log1p(UMI.Count*scaling.factor / (total UMI count)), where scaling.factor = 10,000 and log1p is the logarithm.
[0165] Oligotag dextramer activation and staining. CD8+ T cells were enriched using Miltenyi CD8+ T cell negative enrichment (Miltenyi). Next, the cells were incubated with benzonase (Millipore) and dasatinib (Axon) for 45 minutes, and then stained with the oligotag dextramer pool for 30 minutes at room temperature. Next, the cells were stained with fluorescently labeled CD3 (BD Biosciences, catalog number 612750), CD4 (BD Biosciences, catalog number 563919), CD8 (BD Biosciences, catalog number 612889), CCR7 (Biolegend, catalog number 353218), and CD45RO (Biolegend, catalog number 304238) and CITE-seq antibodies for an additional 30 minutes on ice. Using an Astrios cell sorter (Beckman Coulter), forward scatter plots, side scatter plots, and fluorescence-activated cell sorting (FACS) gating in the fluorescence channels were set to select live cells while excluding debris and doublets. For further processing, single CD3+ CD8+ dextramer+ were sorted using a 100 μm nozzle.
[0166] RNA sequencing clustering. RNA transcript expression was evaluated in CD137 / 4-1BB+ T cells sorted from AIM enrichment. Clustering was performed using Seurat's graph-based clustering approach using the k-nearest neighbor (KNN) graph, calculated based on Euclidean distance in 20-dimensional PCA space, and subsequently clustered at various resolutions.
[0167] Results As shown in FIGS. 4A and 4B, the proportion of antigen-specific cells in the biological sample was identified by cell differentiation and AIM enrichment (FIG. 4B), which correlates with the proportion identified by the conventional ELISPOT functional assay (FIG. 4A). Thus, the pre-expansion and restimulation procedures described herein appear to maintain the relative function of the antigen-specific T cell population.
[0168] The validation of the methodology provided in this specification is shown in Figure 6. The single-cell sequencing analysis of antigen-specific cells, concentrated and analyzed according to the method disclosed in this specification and the non-limiting embodiment shown in Figure 5, provides further validation. As shown in Figures 6A-C, the single-cell sequencing analysis assigned most cells to individual HTOs (80%), but approximately 8% were classified as "doublets" and "no HOT" was identified in approximately 12% of the cells. The relative numbers of cells corresponding to each HTO, and thus each reactivity (EBV YVL-9, CMV pp65, EBV LMP2A, EBV BMLF1, influenza M), reflected the relative numbers of cells identified by orthogonal functional assays including the ELISPOT shown in Figure 4A and the flow cytometry analysis shown in Figure 4B. The relative numbers of cells identified by each cell differentiation with unrealistic equal proliferation for each resulting stimulus are shown in Figure 6B.
[0169] CD137 / 4-1BB differentiated into CMV pp65, EBV BMLF1, or influenza M clones + The reactivity of T cells was confirmed by a parallel oligo-tag pool dextramer-based experiment. Figure 6D shows that HTO-40, HTO-47, and HTO-48 differentiated CD137 / 41BB proliferating TCRs show reactivity to the antigens identified by the hash tags, namely influenza M (HTO-40), EBV-BMLF1 (HTO-47), and pp65-CMV (HTO-48). This is observed by the presence of T cell clones with a clone size of ≧20 in the hash tag wells corresponding to these antigens. The number of unique clones is indicated by total clones (TC). The reactivity of these proliferating clones is confirmed by a parallel oligo-tag pool dextramer-based experiment. The number of CD137 / 4-1BB proliferating clones identical to the clones in the dextramer experiment with a clone size of ≧10 is indicated by OC. These overlapping clones (OC) show high expression of the dextramer corresponding to the differentiated antigen and low expression of the dextramer corresponding to the irrelevant antigen.
[0170] Further confirmation is shown in the demultiplexing of scSEQ data. Seven distinct clusters were resolved from RNA transcriptome analysis based on the gene expression patterns and levels of individual cells (Figure 7A). In particular, comparison of the population sizes of each antigen-specific T cell population discovered by demultiplexing of scSEQ data (Figure 7B) is consistent with the population sizes of antigen-specific T cells discovered by functional flow cytometry assay (Figure 4B). The data indicate that antigen-specific T cells are distinguishable by HTO demultiplexing of scSEQ data and that the relative population sizes for each antigen-specific T cell are maintained after demultiplexing. Furthermore, CITE-seq reagents are compatible with the cell differentiation, AIM sorting, and single-cell sequencing analysis described herein. By using such CITE-seq reagents, important layers of information can be added to improve cell subset identification and phenotyping. As a non-limiting example, CITE-seq data provides a measurement of the amount of protein on the surface of each cell, while RNA-seq data provides a measurement of the amount of transcript in each cell. The amount of protein and RNA-seq expression may not be correlated, and thus, both measurements provide complementary information. This is highlighted by the comparison of CD4 CITE-seq data shown in Figure 8A and CD4 RNA-seq data shown in Figure 8B.
[0171] Example 3: Functional and Phenotypic Analysis of Antigen-Specific T Cells For example, the use of cell differentiation, AIM sorting, single-cell sequencing, and CITE-seq antibody staining for the functional and phenotypic analysis of antigen-specific T cells, performed directly on PBMCs without 7 - 10 days of pre-expansion, is described herein.
[0172] Materials and Methods Cell Surface Antibody Staining: 5’ Human TCRα / β with cell partitioning, library preparation, and sequencing Single cells suspended in PBS with 0.04% BSA were loaded onto a Chromium Single Cell Instrument (10X Genomics). RNAseq, V(D)J, and antibody-derived tag libraries were prepared using the Chromium Single Cell 5’ Library, Gel Beads & Multiplex Kit (10X Genomics) by adding antibody-derived tag primers. After amplification, the cDNA was separated into small (<300bp) and large (>300bp) fragment fractions. The RNAseq and V(D)J libraries were prepared from the >300bp fraction. The library of cell surface antibody-derived tags was prepared from the <300bp fraction. To enrich a V(D)J library aliquot for TCRα / β, the cDNA was divided into two 20ng aliquots and amplified in two rounds using primers.
[0173] Specifically, for the first-round amplification, the primers used were MP147 (ACACTCTTTCCCTACACGACGC; SEQ ID NO: 17) for short-chain R1, MP120 (GCAGACAGACTTGTCACTGGA; SEQ ID NO: 18) for human TRAC, and MP121 (CTCTGCTTCTGATGGCTCAAACA; SEQ ID NO: 19) for human TRBC. For the second-round amplification, a 20 ng aliquot of the first round was amplified using MP147, MP128 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGGGTCAGGGTTCTGGATA; SEQ ID NO: 20) (nested R2 + human TRAC), and MP129 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGGGTCAGGGTTCTGGATA; SEQ ID NO: 21) (nested R2 + human TRBC). The V(D)J library was prepared from 25 ng of each hTRAC and hTRBC amplified cDNA. Paired-end sequencing was performed on the Illumina NextSeq500 for RNAseq and the antibody-derived tag library (26-bp for read 1, 8-bp i7 sample index, and 55-bp transcript read for UMI and cell barcode), as well as for the V(D)J library (150 bp for read 1, 8-bp i7 sample index, and 150-bp read for read 2).
[0174] Results PBMC isolated from donors were incubated with one of five unique HPV peptides. Antigen-specific T cells were clustered using HTO-based AIM sorting based on CD137 / 4-1BB and single-cell sequencing analysis (Figure 9A). Cells showing TCR clones not shared (above the positive signal threshold) across HTO samples were identified and TCR sequences of these clones were obtained (see, for example, Figure 9B). Figure 9B shows an exemplary illustration where each cell clone is represented by a different color in grayscale, and each cell of the clone is shown in the same color in grayscale. The number of hashtag-restricted clones, i.e., the number of clones associated with only one HTO, for each hashtag and the number of cells in each clone are shown in Table 1 below. [Table 1]
[0175] As shown in Table 1, cells identified by HTO-3 showed the largest number of TCR clones expressing TCRs specific for the cognate antigen, followed by cells clustered into HTO-5. Clones were identified by amino acid sequence, and exemplary CDR3 sequences of the TCRα and β pairs of some HTO-3-restricted TCRs are shown in Table 2 below. [Table 2]
[0176] Single-cell sequencing analysis shows that these T cell clones, which are lineage-restricted, i.e., not shared across HTO samples, express more markers associated with functional T cell responses. (Figure 9C; see also Figure 9B).
[0177] Disclosed herein is a unique method for rapidly identifying the amino acid sequence of an endogenous T cell receptor that specifically binds to an antigen and, in addition, confers the phenotypic characteristics of cells expressing antigen-specific T cells. Using this high-throughput method, novel and potentially personalized therapies can be rapidly identified and generated.
[0178] Equivalents One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
[0179] The entire contents of all non-patent literature, patent applications, and patents cited throughout this application are hereby incorporated by reference in their entirety.
Claims
【Claim 1】 The invention described in the specification.
Citation Information
Patent Citations
Methods for detecting peptide / MHC / TCR binding
WO2014145047A1
Methods for profiling the t-CEL- receptor repertoire
WO2016100977A1