FABP4 as therapeutic target in skin diseases
FABP4 inhibitors in pharmaceutical compositions address the ineffectiveness of current treatments for chronic inflammatory skin diseases by regulating keratinocyte and immune cell activity, providing therapeutic benefits for conditions like psoriasis and cutaneous T cell lymphoma.
Patent Information
- Application Number
- JP2025049897
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2016-10-25
- Filing Date
- 2025-03-25
- Publication Date
- 2025-07-30
AI Technical Summary
Current treatments for chronic inflammatory skin diseases like psoriasis, which involve abnormal differentiation and hyperproliferation of keratinocytes, are ineffective due to the lack of targeting FABP4's role in skin diseases.
Development of pharmaceutical compositions containing FABP4 inhibitors, such as (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403), to regulate keratinocyte and immune cell activity, thereby treating or preventing skin diseases by inhibiting FABP4 activity.
The FABP4 inhibitors effectively suppress the onset and progression of inflammatory skin diseases by reducing FABP4 activity, promoting therapeutic effects on conditions like psoriasis and cutaneous T cell lymphoma.
Smart Images

Figure 2025111444000014 
Figure 2025111444000015 
Figure 2025111444000016
Abstract
Description
Technical Field
[0001] The present invention relates to a method for regulating the proliferation and / or differentiation of keratinocytes and immune cells, and more specifically to a method for treating a condition characterized by hyperproliferative keratinocytes or inflammatory skin diseases.
Background Art
[0002] References considered relevant as background to the subject matter disclosed herein are listed below. [1]Furuhashi et al., Nat Rev Drug Discov 2008, 7(6), 489 - 503 [2]Coe et al., Biochim Biophys Acta 1998, 1391(3), 287 - 306 [3]Hotamisligil et al., Science 1996, 274(5291), 1377 - 1379 [4]Maeda et al., Cell Metab 2005, 1(2), 107 - 119 [5]Furuhashi et al., Nature 2007, 447(7147), 959 - 965 [6]Tuncman et al., PNAS 2006, 103(18), 6970 - 6975 [7]Garin - Shkolnik et al., Diabetes 2014, 63(3), 900 - 911 [8]Bolognia et al., Dermatology 2012, Sounders, 3 rd ed. [9]Krueger et al., Annals of the Rheumatic Diseases 2005(64), 30 - 36
[10] Siegenthaler et al., Biochem Biophys Res Commun 1990, 3, 190, 482 - 487 [II]Floresta et al., Eur J Med Chem 2017, 138, 854 - 873
[12] Cao et al., Cell Metab 2013, 17, 768 - 778
[13] Burak et a., Sci Transl Med 2015, 7, 319ra205
[14] Miao et al., Mol Cell Endocrinol 2015, 403, 1 - 9
[15] Won et al., Nat Mater 2014, 13, 1157 - 1164
[16] Madsen et al., J Invest Dermatol 1992, 99(3), 299 - 305
[17] Guttman - Yassky et al., J Allergy Immunol 2011, 127(5), 1110 - 1118
[18] Yuspa et al., J Cell Biol 1989, 109, 1207 - 1217
[19] Wu et al., Australasian Journal of Dermatology 2004, 45(1), 47 - 50
[20] Van der Fits et al., The Journal of Immunology 2009, 182(9), 5836 - 5845
[0003] The approval of the above - mentioned references in this specification should not be construed as meaning that they are in any way relevant to the patentability of the presently disclosed subject matter.
[0004] Fatty acid-binding protein (FABP) is a small cytoplasmic chaperone that functions as a carrier for hydrophobic molecules, particularly long-chain fatty acids and retinoic acid [1, 2]. Some members of the FABP family have been identified as important regulators of various metabolic functions and are associated with the development of insulin resistance, abnormal lipid metabolism, and atherosclerotic disease. FABP transports intracellular fatty acids and other hydrophobic ligands to cellular destinations such as enzymes, membranes, and the nucleus. FABP is also involved in the regulation of intracellular lipid metabolism and gene expression.
[0005] Family members of intracellular fatty acid chaperones are expressed in a tissue-specific manner. FABP4, also known as A-FABP or aP2, is the major fatty acid-binding protein in adipocytes and macrophages. Recent studies have shown that FABP4 is central to the pathway linking obesity and insulin resistance and plays an important role in whole-body glucose and lipid metabolism [3, 4]. FABP4 is pro-inflammatory in macrophages. An orally active small-molecule inhibitor of FABP4 has been found to be an effective therapeutic agent against severe atherosclerotic disease and type 2 diabetes in a mouse model [5]. Furthermore, individuals carrying the T87C polymorphism of the FABP4 promoter, which results in reduced transcriptional activity, have lower serum triglycerides and a significantly lower risk of atherosclerotic disease and type 2 diabetes compared to subjects carrying the homozygous WT allele [6].
[0006] The transcription factor peroxisome proliferator-activated receptor γ (PPARγ) is a major regulator of genes related to adipogenesis, insulin response, and immune function, and favorable results are obtained after its activation. PPARγ has been suggested to reduce the inflammatory response in cardiovascular cells, particularly endothelial cells. FABP4 has been observed to regulate the expression of PPARγ, such that inhibition of FABP4 increases the levels of PPARγ in macrophages and adipocytes, and overexpression of FABP4 decreases PPARγ [7]. Also, FABP4 has been shown to decrease PPARγ by causing its ubiquitination and subsequent proteasomal degradation. In vivo, FABP4 null mouse preadipocytes show high expression of PPARγ and significantly enhanced adipogenesis compared to WT mice, indicating that FABP4 regulates the differentiation process. Obesity, mainly visceral obesity, increases morbidity and mortality by promoting insulin resistance, diabetes, and atherosclerosis. It has also been found that FABP4 is increased and PPARγ is decreased in visceral fat in mice and humans compared to levels in subcutaneous fat.
[0007] The skin functions as a mechanical barrier against the outside world, but the immune system is also used for protection. However, the immune response of the skin is not always defensive but is inherently harmful and can cause disease [8]. Many skin diseases are caused by T lymphocytes and are thus immunologically mediated. As a result, many skin diseases respond favorably to immunosuppressive therapy administered systemically or locally. Many skin diseases follow a chronic course and are thus difficult to treat.
[0008] Psoriasis is a chronic inflammatory skin disease that affects approximately 2 to 4% of the world's population. Its etiology involves both epidermal defects and immunological dysfunctions. A prominent feature of psoriasis is the abnormal differentiation and hyperproliferation of keratinocytes. In psoriasis, infiltration of inflammatory cells and activation of T lymphocytes cause the release of cytokines, which in turn results in keratinocyte proliferation and abnormal differentiation [9].
[0009] FABP5 is a family member of FABP related to the epidermis and psoriasis, and it has been previously discovered to increase in psoriatic skin lesions
[10] . However, the role of FABP4, a metabolic regulator, in dermatological concentrations, particularly in psoriasis, has not yet been observed.
Summary of the Invention
[0010] The inventors of the present invention have discovered that FABP4 is an essential regulator in keratinocytes and immune cells related to the onset of skin diseases, such as inflammatory skin diseases like psoriasis. This enables the development of pharmaceuticals and compositions that may be useful for suppressing the onset of skin diseases and can be used for treating these diseases after they have occurred.
[0011] Accordingly, in a first aspect of the present disclosure, a pharmaceutical composition is provided that includes at least one FABP4 inhibitor for use in the treatment or prevention of skin diseases or conditions involving FABP4.
[0012] An FABP4 inhibitor means an agent that affects FABP4 activity by decreasing, restricting, or blocking the action, function, or expression of the FABP4 protein. Inhibition of FABP4 protein activity should be understood in a broad sense, including the range of inhibitory effects that an FABP4 inhibitor may have on normal protein activity (e.g., uninhibited or control). Inhibition of protein activity, although not necessarily so, may result in a change (e.g., an increase or decrease) in the level or activity of an indicator of protein activity. Thus, FABP4 protein activity is inhibited when the level or activity of any direct or indirect indicator of protein activity changes by at least 10%, at least 20%, at least 30%, at least 50%, at least 80%, at least 100%, or at least 250%, or more (e.g., increases or decreases) compared to a control measurement of the same indicator. Inhibition of protein activity may also be affected, for example, by inhibiting the expression of the gene encoding the protein or by decreasing the half-life of the mRNA encoding the protein.
[0013] According to some embodiments, the FABP4 inhibitor is selected from peptides, antibodies, antibody fragments, small molecules, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), and mixtures thereof.
[0014] The term small molecule means a molecule having a molecular weight of up to about 500 Da, sometimes up to about 1000 Da (daltons).
[0015] A small molecule is a compound having a ring as its main structural feature. This ring is typically a saturated or unsaturated (i.e., cycloalkyl or aryl) 3- to 10-membered ring (more typically a 5- to 6-membered ring), which is either entirely carbonaceous or contains one or more heteroatoms. That is, the main ring is cycloalkyl, heterocyclyl, aryl, or heteroaryl, where the heteroatoms are one or more of nitrogen, oxygen, and sulfur. Alternatively, the small molecule may be a system having two or more fused ring systems or spiro bonds, each being cycloalkyl, heterocyclyl, aryl, or heteroaryl, and each ring having 3 to 10 ring atoms (more typically, each having 5 or 6 ring atoms).
[0016] In other words, as used herein, cycloalkyl means a saturated monocyclic or polycyclic system, having in certain embodiments 3 to 10 carbon atoms, in other embodiments 3 to 6 carbon atoms, and in yet other embodiments 5 or 6 carbon atoms; cycloalkenyl and cycloalkynyl mean a monocyclic or polycyclic system containing at least one double bond and at least one triple bond.
[0017] The ring systems of cycloalkyl, cycloalkenyl and cycloalkynyl groups are composed of one ring or two or more rings that are linked to each other in a fused, bridged or spiro-bonded manner. Cycloalkyl(kenyl)(ynyl) means a cycloalkyl group containing at least one double bond and at least one triple bond. Heterocyclyl means a monocyclic or polycyclic non-aromatic ring system, which is 3 to 10 membered in one embodiment, 4 to 7 membered in another embodiment, and 5 to 6 membered in yet another embodiment. Here, in one or more predetermined embodiments, 1 to 4 of the atoms in the ring system are heteroatoms, i.e., elements other than carbon including but not limited to carbon, nitrogen, oxygen or sulfur. In embodiments where the heteroatom(s) is nitrogen, the nitrogen may optionally be substituted with alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl, heterocyclyl, acyl, guanidine, or nitrogen, and be quaternized to form an ammonium group, each of which may be further substituted.
[0018] As used herein, aryl means an aromatic monocyclic or polycyclic group containing 5 to 10 carbon atoms. Examples of aryl groups include, but are not limited to, unsubstituted or substituted fluorenyl, unsubstituted or substituted phenyl, and unsubstituted or substituted naphthyl groups.
[0019] Heteroaryl means, in certain embodiments, a monocyclic or polycyclic aromatic ring system of 5 to 18 members, and in one or more embodiments, 1 to 4 of the atoms in the ring system are heteroatoms, i.e., atoms other than carbon including but not limited to nitrogen, oxygen or sulfur. The heteroaryl group may optionally be fused to an aromatic or non-aromatic ring. Heteroaryl groups include, but are not limited to, furyl, imidazolyl, pyrimidinyl, tetrazolyl, thienyl, pyridyl, pyrrolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, triazolyl, quinolinyl and isoquinolinyl.
[0020] The main ring structure (either a single ring or a fused polycyclic system) may be substituted at each possible substitution position with various substituents such as alkoxy or alkylthio groups (RO- or RS- groups), halides (or halogen atoms, i.e., I, Br, Cl, and F), pseudohalides (e.g., cyanide, cyanate, thiocyanate, selenocyanate, trifluoromethoxy, azide), haloalkyl, haloalkoxy, ester (-COOR group), ether (-R’OR group), alkanoic acid (-ROOH), amino, sulfinyl (-S(O)-), sulfonyl (-S(O)2-), sulfo (-S(O)2O-), mono- or dialkylaminocarbonyl (-C(O)NHR or -C(O)NRR’), carboxamide (-NR’COR), amide (-C(O)NH-), thioamide (-C(S)NH-), oxyamide (-OC(O)NH-), thioamide (-SC(O)NH-), dithioamide (-SC(S)NH-), ureido (-HNC(O)NH-), thioureido (-HNC(S)NH-), formamide (-NH-C(O)-H), and others. Here, R and R’ are each a C1-C8 straight-chain or branched alkyl, alkylene, aryl, or heteroaryl group.
[0021] As used herein, amino refers to primary, secondary, or tertiary amines and is via a nitrogen atom bonded to a C1 to C6 straight-chain or branched alkyl. In the case of tertiary amines, the substituents may be the same or different.
[0022] In some embodiments, the small molecule is a carbazole alkanoic acid or a carbazole alkanoic acid derivative, an arylsulfonamide or an arylsulfonamide derivative, a sulfonylthiophene or a sulfonylthiophene derivative, a hydroxypyrimidine, a carbazole or a carbazole derivative, an indole or an indole derivative, a carbazole or a carbazole derivative, a benzoylbenzene or a benzoylbenzene derivative, a biphenyl-alkanoic acid or a biphenyl-alkanoic acid derivative, an oxazole-alkanoic acid or an oxazole-alkanoic acid derivative, a pyrimidine or a pyrimidine derivative, a pyrimidone or a pyrimidone derivative, a pyridine or a pyridine derivative, a pyrazine or a pyrazine derivative, a pyrazinone or a pyrazinone derivative, a tetrazole or a tetrazole derivative, a triazolopyrimidine or a triazolopyrimidine derivative, a triazolopyrimidinone or a triazolopyrimidinone derivative, a pyrazole or a pyrazole derivative, (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403) and 4-{[2-methoxycarbonylindol)-5-(2-thienyl)-3-thienyl]amino}-4-oxo-2-butyric acid (BMS480404), and salts, stereoisomers, hydrates and mixtures thereof, selected therefrom
[11] .
[0023] The term derivative means a chemically modified compound derived from the parent compound described herein, where the parent compound has different substituents and / or functional groups and the derivative has the same or similar biological properties / activities as the parent compound, as defined herein. For example, a pyrazole derivative is (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403).
[0024] The term alkanoic acid refers to an acid of a saturated or unsaturated carbon chain containing 1 (or 2) to 18 carbons, which is linear or branched, such as carboxylic acid, ethanoic acid, propanoic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, etc.
[0025] In other embodiments, the small molecule is selected from carbazole butanoic acid, arylsulfonamide, sulfone bithiophene or sulfone bithiophene derivative, 4-hydroxypyrimidine, 2-hydroxypyrimidine, carbazole or carbazole derivative, tetrahydrocarbazole or tetrahydrocarbazole derivative, 2,3-dimethylindole or 2,3-dimethylindole derivative, benzoylbenzene, biphenylalkanoic acid or biphenylalkanoic acid derivative, 2-oxazolealkanoic acid or 2-oxazole-alkanoic acid derivative, tetrahydropyrimidine or tetrahydropyrimidine derivative, pyridine or pyridine derivative, pyrazine or pyrazinone derivative, quinolone or quinolone derivative, arylcarboxylic acid or arylcarboxylic acid derivative, tetrazole, triazolopyrimidine or triazolopyrimidine derivative, indole or indole derivative, flavonoid (such as flavanol, flavanone, isoflavone, pyrazole or pyrazole derivative, etc.), (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403) and 4-{[2-methoxycarbonyl)-5-(2-thienyl)-3-thienyl]amino}-4-oxo-2-butyric acid (BMS480404), and salts, stereoisomers, hydrates and mixtures thereof.
[0026] Exemplary small molecules that are FABP4 inhibitors are shown in Table 1. TIFF2025111444000001.tif122170TIFF2025111444000002.tif221170 TIFF2025111444000003.tif214170TIFF2025111444000004.tif214170TIFF2025111444000005.tif208170TIFF2025111444000006.tif225170 TIFF2025111444000007.tif216170TIFF2025111444000008.tif232170TIFF2025111444000009.tif233170TIFF2025111444000010.tif209170TIFF2025111444000011.tif236170
[0027] In some embodiments, the small molecule can be selected from those detailed in Table 1.
[0028] In some embodiments, the small molecule is at least one selected from those detailed in Table 1.
[0029] In some other embodiments, the small molecule is selected from pyrazole or a pyrazole derivative, (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403), and 4-{[2-methoxycarbonyl)-5-(2-thienyl)-3-thienyl]amino}-4-oxo-2-butyric acid (BMS480404), and salts, stereoisomers, hydrates and mixtures thereof.
[0030] In a further embodiment, the small molecule may be (2-(2'-(5-ethyl-3,4-diphenylLH-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403). In some other embodiments, the small molecule may be 4-{[2-methoxycarbonyl)-5-(2-thienyl)-3-thienyl]amino}-4-oxo-2-butyric acid (BMS480404).
[0031] According to some embodiments, the FABP4 inhibitor is an antibody that specifically binds to FABP4 and inhibits its activity. This antibody is a polypeptide ligand that specifically recognizes and binds to an epitope of the antigen, i.e., the FABP4 protein or a fragment thereof, and includes at least a light chain or a heavy chain immunoglobulin variable region. This term means intact immunoglobulins and variants and portions thereof known in the art, such as Fab’ fragments, F(ab)’2 fragments, single-chain Fv proteins (“scFv”), and disulfide-stabilized Fv proteins (“dsFv”). This term also includes recombinant forms such as chimeric antibodies (e.g., humanized murine antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). See also Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co.); Kuby, Immunology 3rd Edition WH Freeman & Co., New York 1997.
[0032] The antibody may be a monoclonal antibody or a polyclonal antibody. Monoclonal antibodies are produced by a single clone of B lymphocytes or cells transfected with the light and heavy chain genes of a single antibody, and include humanized monoclonal antibodies. Polyclonal antibodies are antibodies secreted by various B cell lineages in the body.
[0033] The antibody is said to specifically bind to the FABP4 protein or a fragment thereof. That is, the antibody can be associated with the FABP4 protein and its fragments in a selective and preferred manner over binding to other molecular / macromolecular entities in which the FABP4 protein and its fragments are mixed. An antibody having an inhibitory effect (or neutralizing effect) on FABP4 inhibits or suppresses at least one activity of FABP, or at least one activity associated with FABP4, for example, by blocking the binding of FAPB4 to a ligand to which FAPB4 normally binds, or by disrupting or interfering with the protein-protein interaction of FABP4 with other proteins.
[0034] In some embodiments, the antibody is an anti-FABP4 antibody. Exemplary anti-FABP4 antibodies are described in the art and may include, among others, Ab anti-FABP4
[12] , AbCA33
[13] , Ab2E4
[14] , and the like.
[0035] The FABP4 inhibitor is, in some embodiments, an antisense or sense inhibitor. Antisense and sense inhibitors are biopolymers that bind (or hybridize) to messenger RNA (mRNA) produced by a specific gene, such as the gene encoding FABP4, and inactivate or regulate their expression. Antisense inhibitors are usually oligomeric compounds that are at least partially complementary to the region of the specific target nucleic acid molecule to which they hybridize and cause RNA interference (RNAi). Thus, RNAi acts through the targeting of mRNA via sequence-specific matching, resulting in the degradation or translational inhibition of the target mRNA and a change or loss of protein expression, such as the suppression of FABP4 expression. Non-limiting examples of antisense compounds include primers, probes, antisense oligonucleotides, siRNA, miRNA, shRNA, and ribozymes. Any of the antisense or sense inhibitors can be used to target a portion of dsDNA. This is to prevent the expression of that portion of dsDNA. Antisense molecules can bind to the plus strand, and sense molecules can bind to the minus strand. These compounds can be introduced as single-stranded, double-stranded, circular, branched, or hairpin compounds and can contain structural elements such as internal or terminal bulges or loops. Double-stranded antisense compounds may be double-stranded compounds or single-stranded with sufficient self-complementarity to form hybrids of complete or partial duplex compounds.
[0036] The FABP4 inhibitor may be a small interfering RNA (siRNA), which is a small dsRNA molecule of 19 to 25 bp having two overhanging nucleotides and having a phosphorylated 5' end and a hydroxylated 3' end. Examples of the specific delivery of interfering RNA to adipose tissue against cell type-specific carrier molecules are described in
[15] (incorporated herein by reference). In some embodiments, the FABP4 inhibitor is an siRNA comprising the nucleic acid sequences of SEQ ID NOs: 2 to 9. Sense 3' guagguaccuggaaacuuguu (SEQ ID NO: 2) Antisense 5' caaguuuccagguaccuacuu (SEQ ID NO: 3) Sense 3' gaaaugggauggaaaaucauu (SEQ ID NO: 4) Antisense 5' ugauuuuccaucccauuucuu (SEQ ID NO: 5) Sense 3' gaugugaucaccauuaaauuu (SEQ ID NO: 6) Antisense 5' auuuaauggugaucacaucuu (SEQ ID NO: 7) Sense 3' gaaagucaagagcaccauauu (SEQ ID NO: 8) Antisense 5' uauggugcucuugacuuucuu (SEQ ID NO: 9)
[0037] The selection of a suitable FABP4 inhibitor can be carried out by known suitable methods themselves (e.g., Hughes et al, Br J Pharmacol. 2011, 162(6)1239). For example, the active compound can be selected from a library and screened based on its selectivity for FABP4 and its resulting effectiveness against FABP4 inhibition.
[0038] Furthermore, as described above, the inventors have previously observed that the expression of PPARγ in macrophages and adipocytes is negatively regulated by FABP4, and that FABP4 is increased and PPARγ is decreased at inflammatory sites such as visceral fat [7]. The inventors have found that FABP4 is overexpressed in the skin, T lymphocytes, and keratinocytes, and that there is a negative correlation between the expression of FABP4 and the expression of PPARγ, for example, in the skin with inflammation. Therefore, although not wishing to be bound by theory, the inhibition of FABP4 that occurs simultaneously with the activation of PPARγ may have a synergistic effect on the treatment of various skin diseases.
[0039] Therefore, the pharmaceutical composition of the present disclosure includes at least one PPARγ agonist or can be used in combination with at least one PPARγ agonist. A PPARγ agonist is an agent that binds to the peroxisome proliferator-activated receptor and activates this receptor.
[0040] According to some embodiments, the pharmaceutical composition includes at least one PPARγ agonist. In some embodiments, the at least one PPARγ agonist is a thiazolidinedione derivative. In other embodiments, the PPARγ agonist can be selected from pioglitazone (Actos), rosiglitazone (Avandia), lobeglitazone (Duvie), ciglitazone, daruglitazone, englitazone, netoglitazone, riboglitazone, troglitazone (Rezulin), rhodanine, and other thiazolidinedione derivatives. As will be understood by those skilled in the art, other PPARγ agonists are included within the scope of the present disclosure, such as indole derivatives or various non-steroidal anti-inflammatory drugs (e.g., ibuprofen), as well as other PPARγ agonists.
[0041] The pharmaceutical composition of the present disclosure may contain a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are, for example, vehicles, adjuvants, excipients, or diluents, which are well known to those skilled in the art and generally readily available. See, for example, Remington’s Pharmaceutical Science by E.W. Martin, Mack Publishing Co, Easton, Pennsylvania, 15th Edition (1975). Pharmaceutically acceptable carriers are preferably those that are chemically inert to the active compound and have no harmful side effects or toxicity under the conditions of use. The choice of carrier is determined by the particular active agent and the particular method of administration of the composition. Accordingly, a wide variety of suitable pharmaceutical compositions in various formulations are encompassed by the present disclosure.
[0042] Pharmaceutically acceptable carriers are suitable for topical, oral, rectal, vaginal, transdermal, subcutaneous, intravenous, intramuscular, intraocular, and intranasal administration of the FABP4 inhibitor. The pharmaceutical composition is prepared by methods well known in the pharmaceutical industry. In manufacturing the pharmaceutical composition of the present disclosure, the components are usually mixed with excipients, diluted with excipients, or encapsulated within such carriers that can be manipulated into the desired form. Depending on the particular method of administration, the pharmaceutical composition can be formulated into tablets, pills, capsules, sachets, granules, powders, chewing gums, suspensions, emulsions, solutions, gels, lotions, oils, soaps, sprays, creams, ointments, films, microcapsules, microspheres, liposomes, vesicles, microemulsions, lipospheres, patches, and ethosomes.
[0043] According to some embodiments, the pharmaceutical composition can be adapted to deliver at least one FABP4 inhibitor locally, orally, by inhalation, nasally, transdermally, intraocularly, or parenterally to the circulatory system of the subject.
[0044] According to some embodiments, the pharmaceutical composition can be adapted to administer at least one FABP4 inhibitor by injection.
[0045] According to other embodiments, the pharmaceutical composition can be adapted to administer the at least one FABP4 inhibitor orally.
[0046] Formulations suitable for oral administration include: (a) liquid solutions such as an effective amount of the compound or a composition containing it dissolved in a diluent such as water, saline, or juice (e.g., orange juice); (b) capsules, sachets, tablets, lozenges, and troches each containing a predetermined amount of the active ingredient as a solid or granule; (c) powders; (d) suspensions in a suitable liquid; (e) suitable emulsions. Liquid formulations may contain diluents such as water and alcohols such as ethanol, benzyl alcohol, and polyethylene alcohol, and may or may not add pharmaceutically acceptable surfactants, suspending agents, or emulsifying agents. Capsule forms are of the usual hard or soft gelatin type and may contain, for example, surfactants, lubricants, and inert fillers such as lactose, sucrose, calcium phosphate, and corn starch. Tablet forms may contain lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, gum arabic, gelatin, guar gum, colloidal silicon dioxide, talc, magnesium stearate, calcium stearate, zinc stearate, one or more of stearic acid, and other excipients, coloring agents, diluents, buffering agents, disintegrants, preservatives, flavoring agents, and pharmacologically compatible carriers. Lozenge forms may usually contain the active ingredient in a flavoring agent such as sucrose and acacia or tragacanth, and troches may contain the active ingredient in an inert base such as gelatin and glycerin, or sucrose and acacia, emulsion, gel, and may also contain carriers known in the art in addition to this active ingredient.
[0047] The pharmaceutical composition of the present disclosure is for use in the treatment or prevention of inflammatory skin diseases and can be adapted to induce systemic or non-systemic effects. That is, this composition can be adapted to deliver the FABP4 inhibitor, which is the active agent, to the circulation system of the subject or to deliver the active agent to a target site (e.g., a specific layer of the skin).
[0048] As is known, human skin is composed of multiple layers and is divided into three main group layers: the stratum corneum, the epidermis, and the dermis, which are located on the outer surface of the skin. The stratum corneum is a cell layer filled with keratin in an extracellular lipid-rich matrix and is actually the main barrier to drug delivery to the skin. The epidermis and dermis are living tissues. The epidermis does not contain blood vessels, but the dermis contains capillary loops and can guide therapeutic drugs for trans-epithelial systemic distribution.
[0049] In some embodiments, the pharmaceutical composition is adapted to administer the at least one FABP4 inhibitor transdermally. In other embodiments, the pharmaceutical composition is adapted to administer the at least one FABP4 inhibitor locally across the skin layers. In some other embodiments, the pharmaceutical composition is adapted to locally deliver the at least one FABP inhibitor across the stratum corneum.
[0050] The pharmaceutical composition can be formulated into any form suitable for skin administration or topical administration, such as gels, lotions, oils, soaps, sprays, emulsions, creams, ointments, solutions, suspensions, films, microcapsules, microspheres, liposomes, vesicles, microemulsions, lipospheres, and patches.
[0051] The pharmaceutical composition of the present disclosure is used for the treatment or prevention of skin diseases or conditions in which FABP4 is overexpressed. In some embodiments, the skin disease or condition can be selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, follicular lichen planus, acute guttate parapsoriasis, chronic lichenoid pityriasis, erythematous rash, macular disease, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue disease (e.g., lupus), rosacea, folliculitis, acne, warts, ichthyosis, alopecia cicatrisata, cutaneous T-cell lymphoma (CTCL), actinic keratosis, squamous cell carcinoma, basal cell carcinoma, nevus, lichen simplex chronicus, psoriasis, keratosis, keratoderma, pruritus, burn, scar, scleroderma, and keloid.
[0052] According to some embodiments, the skin disease is lymphoma (CTCL).
[0053] In other embodiments, the pharmaceutical composition of the present disclosure is used for the treatment or prevention of inflammatory skin diseases or conditions. That is, this composition causes at least one therapeutic effect on skin diseases or conditions containing inflammatory components in which FABP4 is overexpressed.
[0054] In some embodiments, the inflammatory skin disease or condition can be selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, follicular lichen planus, acute guttate parapsoriasis, chronic lichenoid pityriasis, erythematous rash, macular disease, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue disease (e.g., lupus), rosacea, folliculitis, acne, warts, ichthyosis, vitiligo, alopecia cicatrisata, and CTCL.
[0055] According to such embodiments, the inflammatory skin disease is psoriasis. According to other embodiments, the inflammatory skin disease is dermatitis (atopic, seborrheic, contact).
[0056] According to another aspect, there is provided a topical formulation for the transdermal delivery of at least one FABP4 inhibitor, the composition comprising at least one FABP4 inhibitor and at least one pharmaceutically acceptable carrier. In some embodiments, the topical formulation may further comprise at least one PPARγ agonist.
[0057] A further aspect of the disclosure provides a method of treating or preventing a skin disease (e.g., an inflammatory skin condition) in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition comprising the inhibitor. The FABP4-inhibitor used in this treatment method can be selected from those detailed herein.
[0058] In a further aspect, there is provided a method of treating or preventing psoriasis in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition comprising the inhibitor.
[0059] Another aspect provides a method of treating or preventing CTCL in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition comprising the inhibitor.
[0060] The pharmaceutical compositions of the disclosure can be selected for treating, preventing or diagnosing any medical condition or symptom. As used herein, the term "treatment" or its linguistic variations means the administration of a therapeutic amount of an FABP4-inhibitor. This improves the undesirable symptoms associated with the disease, prevents the appearance of such symptoms prior to onset, delays the progression of the disease, delays the worsening of symptoms, promotes the onset of remission, reduces the irreversible damage that occurs during the progressive chronic phase of the disease, delays the onset of the progressive phase, reduces the severity or cures the disease, improves survival or more rapid recovery, and is effective in preventing the occurrence of symptoms or two or more of the above combinations.
[0061] As is known, the effective amount for the purposes of this specification is determined by the concepts known in the art. That amount must be effective to achieve the desired therapeutic effect, inter alia, depending on the type and severity of the disease to be treated and the treatment regimen. The effective amount is usually determined in a properly designed clinical trial (dose range trial), and those skilled in the art know how to properly conduct such a trial to determine the effective amount. As is generally known, the effective amount depends on various factors including various pharmacological parameters such as the affinity of the ligand for the receptor, its distribution profile in the body, its half-life in the body, etc., as well as any unwanted side effects, age, gender, and other factors.
[0062] According to some embodiments, this treatment method further comprises the step of administering a PPARγ agonist to the subject. The PPARγ agonist may be administered simultaneously with the at least one FABP4 inhibitor, or can be administered sequentially to the FABP4 inhibitor.
[0063] As used herein, simultaneously or its linguistic variations are used to mean that the components of a composition are administered at the same time, e.g., one is administered together with the other. Simultaneous administration means that if the circulating half-life concentration of the first administered component in the combination is present simultaneously in a therapeutically effective amount with another component to be administered later, within a certain period after the administration of the other component (e.g., within 5 minutes, 10 minutes, or even several hours), one of the components of the combination to be administered can be administered. The time delay between the administrations of these components varies depending on the exact nature of the components and the formulation containing the components, the interaction between the individual components, the respective half-lives of the components, and other factors that can be easily recognized by a skilled person.
[0064] Sequentially (or, separately) or its linguistic variations mean, in this specification, that the period between the administration of one component and another is significant, i.e., the component administered first in a therapeutically effective amount is no longer present (or present in an asymptomatic amount) in the bloodstream when the second (next) component is administered.
[0065] As described above, the inventors have found that FABP4 is overexpressed in keratinocytes or inflammatory cells (such as macrophages and lymphocytes) in skin tissue biopsies from patients with inflammatory skin diseases, but is not significantly expressed in uninvolved skin tissue. Therefore, the identification of FABP4 overexpression can be used to detect early-onset inflammatory skin diseases in a subject or to detect the predisposing factors of a subject suffering from an inflammatory skin disease.
[0066] Accordingly, another aspect of the present disclosure provides a method for detecting a predisposing factor (or detecting early onset) in a subject suffering from an inflammatory skin disease or condition, the method comprising a method for detecting the expression of FABP4 in a sample comprising a patient's keratinocytes or inflammatory cells (macrophages, lymphocytes). Here, the presence of FABP4 above a predetermined base level in the sample indicates a predisposing factor for developing an inflammatory skin disease or condition. The inflammatory skin disease or condition may be any of the diseases and conditions described herein.
[0067] In some embodiments, the predetermined base level is the level of FABP4 in a normal skin sample.
[0068] The term "predisposing factor" as used herein refers to the effect of one or more factors that make a subject susceptible to a condition, disease, or disorder such as an inflammatory skin disease. In some embodiments, the methods disclosed herein can be used to identify subjects with a predisposing factor for developing a condition, disease, or disorder.
[0069] It should be understood that the detection is qualitative or quantitative and can be performed by any suitable known method. Non-limiting examples of such methods include immunohistochemistry, PCR techniques (including RT-PCT and qRT-PCR), Western analysis, in situ hybridization, and the like.
[0070] Biological samples can be obtained directly or indirectly from a subject and include whole blood, plasma, serum, tears, mucus, saliva, urine, pleural effusion, tissue, cells (such as fibroblasts, peripheral blood mononuclear cells, or skin cells), and extracts of organs and / or tissues.
[0071] In some embodiments, the biological sample is a skin sample.
[0072] It should be understood that the detection of FABP4 in a sample means detecting the expression of FABP4 nucleic acid, the expression of FABP4 protein fragments, and / or the expression of FABP4 protein.
[0073] The control level or baseline level refers to a reference standard such as a known value indicating the base concentration or the expression of FABP4 in a healthy subject or derived from a non-involved sample of the subject. In certain examples, the control sample is taken from a subject known to not have a disease or condition such as psoriasis. In other examples, it is from a diagnosed subject but obtained at any time point before the onset of the disease, or before or earlier than the start of disease treatment.
[0074] The difference between the test sample and the control is an increase or conversely a decrease in the expression of FABP4 protein, fragment, or nucleic acid. This difference can be a qualitative difference or a quantitative difference such as a statistically significant difference. In some examples, the difference is an increase or decrease of at least about 10%, such as at least about 20%, at least about 30%, at least about 40%, at least about 50% relative to the control. At least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 250%, at least about 50% to about 300%, at least about 350%, at least about 400%, at least about 450%, or more than 500% increase or decrease.
[0075] In yet another aspect, the present disclosure provides a method of treating or preventing an inflammatory skin disease in a subject; Detecting the expression of FABP4 in a sample containing keratinocytes or inflammatory cells derived from a subject; Determining whether the FABP4 expression is above or below a predetermined base level; When the FABP4 expression in the sample is above a predetermined base level, administering a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition containing the same to the subject; comprising.
[0076] The subject to be treated or diagnosed refers to both humans and non-human mammals (i.e., humans and veterinary subjects such as humans, non-human primates, dogs, cats, horses, and cows).
[0077] As used herein, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise.
[0078] As used herein, the term "about" means including a deviation of ±10% from the specifically recited value of a parameter such as concentration, molecular weight, etc.
[0079] When a numerical range is set forth herein, it is meant to include any cited numeral (fractional or integral) within the recited range. The terms "range / range" between a first designation number and a second designation number and "range / range from the first designation number to the second designation number" are used interchangeably herein and are meant to include the first and second designation numbers, and all decimal and integral numerals therebetween.
[0080] [Brief Description of the Sequence] The nucleic acid sequences provided herein (Table 2 below) are shown using the standard abbreviations for nucleotide bases as defined in 37 C.F.R 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by reference to the strand shown.
[0081] TIFF2025111444000012.tif125170
Brief Description of the Drawings
[0082] To better understand the subject matter disclosed herein and to illustrate how it may be actually implemented, embodiments will be described as non-limiting examples with reference to the accompanying drawings.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Mode for Carrying Out the Invention
[0083] The following examples are provided for the description of specific features and / or embodiments. These examples should not be construed as limiting the disclosure to the specific features or embodiments described.
[0084] Example 1: Tissue Expression Analysis of FABP4, FABP5, and PPARγ in Human Psoriatic Skin Lesions Punch biopsies (4 mm in diameter) were obtained from the skin of patients with psoriasis (n = 10). Additionally, biopsies were obtained from the skin of patients with chronic dermatitis (n = 5). After surgically removing the excess skin, normal skin was obtained from the patients (n = 10). The tissues were fixed in formalin and embedded in paraffin. For histopathological examination by light microscopy, sections were stained with hematoxylin and eosin (H&E) and observed by a pathologist who confirmed the diagnosis. Additionally, for immunohistochemical analysis, sections were stained with the following antibodies: FABP4 (rabbit polyclonal anti-FABP4 antibody, PAB 12276, from Abnova), FABP5 (rabbit polyclonal anti-FABP5 antibody, SC-50379, from Santa Crus) and PPARγ (mouse monoclonal anti-PPARγ antibody, E-8, from Santa Crus), all diluted 1:50. Raffin-embedded tissues and cryopreserved tissues were processed according to standard protocols.
[0085] Figure 1C shows high expression levels of FABP4 detected in psoriatic skin lesions compared to normal skin in both the epidermis and dermis (Figure 1A). This finding was observed in all biopsies from psoriatic patients tested (100% morbidity). To the best of the inventors' knowledge, this is the first report of FABP4 expression in keratinocytes and dermal cells in psoriatic lesions. Without wishing to be bound by theory, this finding suggests that overexpression of FABP4 is associated with dysregulation of epidermal keratinocytes and dysregulation of psoriasis differentiation. Additionally, this finding supports the role of FABP4 in promoting inflammation in dermal immune cells, which is another important feature of psoriasis.
[0086] Although less than in psoriasis, an increase in FABP4 levels was also observed in both keratinocytes and inflammatory cells in the dermis in skin biopsies from patients with chronic dermatitis, as shown in Figure 1E (Figure 1C).
[0087] Furthermore, a negative correlation between the expression of FABP4 and PPARγ was observed in keratinocytes and immune cells: while PPARγ in normal skin was detected in a few cells in the entire epidermis and dermis as shown in Figure 1B, its expression was significantly decreased in psoriatic lesions and was only shown in the uppermost layer of the epidermis and not detected in dermal cells (Figure 1D). As shown in Figure 1F, the expression of PPARγ was also decreased in biopsies of skin with dermatitis. As previously reported (
[16] , not shown), FABP5 was expressed only in keratinocytes derived from psoriatic skin.
[0088] Psoriatic skin is characterized by a hyperproliferative epidermis consisting of multiple layers of keratinocytes, resulting in thickened skin. At higher magnification, FABP4 was shown throughout the hyperplastic epidermis in psoriatic lesions, and as shown in Figure 2B, the staining was mostly cytoplasmic in the basal layer and nuclear in the upper layers. FABP4 expression in the dermis was mainly observed in a cytoplasmic pattern in macrophages, lymphocytes, and endothelial cells as shown in Figure 2C. PPARγ expression in psoriatic skin was significantly decreased in the epidermis and only appeared in the uppermost layer and was not detected in the dermis compared to normal skin (see Figure 3B vs 3A).
[0089] This suggests that the tendency to develop skin diseases with inflammatory components can be detected by evaluating the expression of FABP, especially FABP4, in dermal and epidermal skin samples. It also suggests that the overexpression of FABP4 and the downregulation of PPARγ are associated with the pathogenesis of psoriasis.
[0090] Example 2: Tissue expression analysis of FABP4 in human cutaneous T-cell lymphoma (CTCL) skin lesions CTCL is a neoplasm of a group of skin-homing T cells. Mycosis fungoides (MF) represents the most common type of CTCL and accounts for approximately 50% of all primary cutaneous lymphomas. Although inherently malignant, MF follows a long clinical course with inflammatory dermatitis-like symptoms [8].
[0091] The expression of FABP4 in MF patients was examined by immunohistochemical analysis of lesional skin. Samples from five MF patients were tested and compared with normal human skin. Punch biopsies (6 mm in diameter) were obtained from diseased skin of MF patients. After surgically reducing the excess skin, normal skin was obtained from the patients. As described in Example 1, tissue sections were processed and stained with anti-FABP4 antibody.
[0092] As shown in Figures 4B and 4A respectively, for all patients tested, high expression levels of FABP4 were observed in MF lesions compared to normal skin. The expression of FABP4 was limited to infiltrating T lymphocytes in the epidermis and dermis. Intense cytoplasmic staining characteristic of MF was observed in dermal infiltrating cells as well as malignant cells penetrating the lower epidermis.
[0093] Therefore, because FABP4 protein is highly expressed in malignant CTCL T lymphocytes, detection of overexpression can be used to determine a patient's predisposition to the development of CTCL or enable early detection.
[0094] Many skin diseases (including psoriasis, dermatitis, CTCL) are mediated by lymphocytes, mainly lymphocytes
[17] . The expression of FABP4 has been reported in a limited repertoire of cell types only in macrophages, adipocytes and endothelial cells. In the immunohistochemical analysis performed by the present inventors, it was found that FABP4 is expressed in inflammatory cells of the dermis, both in macrophages and lymphocytes. The expression of FABP4 in lymphocytes is unprecedented and not common in dermal cells, so these findings are highly relevant to skin diseases.
[0095] Example 3: Overexpression of FABP4 in primary mouse keratinocytes As seen in psoriasis, the introduction of FABP4 into keratinocytes was suggested to create a hyperproliferative state with impaired differentiation. Differentiation was evaluated by measuring the expression of two keratinocyte differentiation markers, K1 and K5. K5 is a keratin whose level does not change during keratinocyte differentiation and thus serves as a loading control, while K1 is induced during normal keratinocyte differentiation.
[0096] To evaluate the effect of FABP4 overexpression in primary mouse keratinocytes, cells were infected with a lentiviral vector construct containing the FABP4 gene. The FABP4 lentiviral vector, named FABP4-T2A-EGFP, was constructed using the ABP4 gene under the CMV promoter and contains the green fluorescent protein (GFP) gene as an expression reporter. The presence of T2A residues at the N-terminus of the FABP4 protein makes it impossible to detect FABP4 with commercially available anti-FABP4 antibodies due to interference with their binding. Therefore, anti-GFP antibodies were used instead to verify infection and FABP4 overexpression.
[0097] To evaluate the expression of K1 and K5 differentiation markers in primary mouse keratinocytes regardless of the presence or absence of FABP4 expression, primary keratinocytes were prepared from neonatal mice as described above
[18] and infected with the FABP4-T2A-EGFP vector. Two internal controls were used: cells not infected with lentivirus and cells infected with an EGFP vector lacking the FABP4 gene. These cells were grown in differentiation medium containing three different concentrations of calcium. An increase in extracellular calcium from low (0.05 mM) to medium (0.12 mM) or high (1 mM) concentrations induced keratinocyte differentiation.
[0098] The expression of keratinocyte differentiation markers K1 and K5 in transfected and non-transfected cells is shown in Figure 5: Infection with lentivirus expressing FABP4-T2A-EGFP decreased K1 levels under both medium and high calcium conditions compared to non-infected cells and GFP-infected cells. As expected, the level of K5 did not change during keratinocyte differentiation without infection. The observation that FABP4 overexpression decreases K1 suggests that FABP4 interferes with the normal differentiation process of keratinocytes and promotes a hyperproliferative state similar to psoriasis.
[0099] Example 4: In Vivo Inhibition of FABP4 in a Mouse Imiquimod-Induced Psoriasis Model As described above, psoriasis is a chronic inflammatory skin disease. It occurs when the immune system mistakes skin cells for pathogens and sends out wrong signals that accelerate the growth of skin cells. Imiquimod (IMQ) is a potent immune activator that induces and exacerbates psoriasis when administered topically. Daily application of IMQ to the skin on the back of mice induces inflammatory scaly skin lesions similar to plaque psoriasis [19, 20]. IMQ-induced psoriasis in mice has been used for a long time as a model of human psoriasis.
[0100] The efficacy of oral administration of an FABP4 inhibitor in treating psoriasis in a mouse IMQ-induced model was tested.
[0101] BMS309403 (2-[2’-(5-Ethyl-3,4-diphenyl-1H-pyrazol-1-yl)[1,1’-biphenyl]-3-yl]oxy]-acetic acid, Formula I) was used as an FABP4 inhibitor: TIFF2025111444000013.tif71170
[0102] The tests were conducted using Balb / c mice (Envigo RMS (Israel) Ltd), and the average (±SD) body weight at the start of the test was 18.2 ± 0.81 g. The animals were allowed free access to a commercially available rodent diet (Teklad Certified Global 18% Protein Diet, Harlan catalog number 2018SC). The animals had free access to sterilized and acidified drinking water (pH 2.5 - 3.5).
[0103] The tests were conducted in the following 6 groups, each group containing 3 - 10 mice; - Group of naive mice (without IMQ) - 1 vehicle control group. The vehicle formulation is 10% 1 - methyl - 2 - pyrrolidone and 5% Cremophor EL in water for injection (WFI). - 1 treatment group administered cortisone acetate as a positive control - 1 tablet (each 25 mg, Rekah Pharm) was ground in a mortar. The powder was dissolved in 2.5 ml of WFI to obtain 10 mg / ml. The compound was orally administered once a day at 12.5 mg / kg body weight (body weight) to mice from the first day (day 1) of IMQ application for 6 days. - 3 treatment groups that received BMS (i.e., the test item) at 3 doses of 5, 15, and 30 mg / kg. BMS powder (Cayman Chemical) was dissolved in ethanol to make a 30 mg / ml solution. This stock solution was diluted with the vehicle to 3 different concentrations of 0.5, 1.5, and 3 mg / ml. A fresh aqueous solution was prepared daily. BMS was orally administered once a day from the first day (day 1) of IMQ application for 6 days.
[0104] IMQ induction: A commercially available IMQ cream (5%) (Aldara; 3M Pharmaceuticals) with a daily topical dose of 62.5 mg was applied for 6 consecutive days to shaved animals from all groups except the naive group. This is equivalent to an active compound dose of 3.125 mg per day.
[0105] Experimental conditions: All shaved animals except the naive group were topically applied with IMQ cream (Aldara™ 5% cream, #3 Pharmaceuticals) daily for 6 consecutive days starting from day 1 (approx. 60 mg / mouse). The test item, vehicle, and acetic acid cortisone were orally administered daily for 6 days. During the test, morbidity and mortality, body weight (BW), clinical signs, and scoring of the psoriasis area and severity index (PASI) were performed, and representative photographs were taken. The animals were sacrificed on day 9.
[0106] Scoring was performed in a "blinded" manner by trained observers, i.e., without being aware of the treatment. The clinical PASI score was used to score the severity of inflammation of the dorsal skin. Erythema, scaling, and thickening were scored independently on a scale of 0 to 4. 0, none; 1, slight; 2, moderate; 3, marked; 4, very marked. The PASI score, which is the cumulative score (erythema + scaling + thickening), could be used as a measure of the severity of inflammation (scale 0 to 12).
[0107] Mortality and morbidity: During both experiments, no animals died or were found in a diseased state. No abnormal clinical signs were observed in any of the animals during the test. No treatment effect on body weight was detected.
[0108] Scoring of the severity of skin inflammation: The severity of skin inflammation on the back, i.e., the mean PASI score, is shown in Figure 6. Each parameter, i.e., the severity of erythema, skin thickness, and scaling, was measured individually (Figures 7 to 9, respectively). According to the PASI score, all IMQ-treated groups showed a considerable skin reaction compared to the naive group, especially on days 5 and 7 of the test. On day 7, a significant improvement in skin inflammation was observed with BMS treatment. The medium dose of BMS (15 mg / kg) seemed to have the most influence on the severity of inflammation. This dose showed the best results for the parameters tested - erythema, skin thickness, and scaling. Representative photographs taken on day 7 are shown in Figures 10A to 10F.
[0109] In summary, all IMQ treatment groups showed a significant skin reaction compared to the naïve group, especially on days 5 and 7 of the test. On day 7, a significant improvement in the effect was observed in the BMS treatment group for all test parameters, namely the severity of inflammation, erythema, skin thickness, and scaling. The experiment was repeated three times and similar results were obtained.
Claims
1. A pharmaceutical composition comprising at least one FABP4 inhibitor for use in the treatment or prevention of skin diseases.
2. The pharmaceutical composition according to claim 1, wherein the at least one FABP4 inhibitor is selected from peptides, antibodies, antibody fragments, small molecules, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), and mixtures thereof.
3. The pharmaceutical composition, wherein the at least one FABP4 inhibitor is a small molecule having a molecular weight of about 1000 Da to 500 Da at most.
4. The small molecule is selected from the group consisting of carbazole butanoic acid, arylsulfonamide, sulfonylthiophene or sulfonylthiophene derivatives, 4-hydroxypyrimidine, 2-hydroxypyrimidine, carbazole or carbazole derivatives, tetrahydrocarbazole or tetrahydrocarbazole derivatives, 2,3-dimethylindole or 2,3-dimethylindole derivatives, benzoylbenzene, biphenylalkanoic acid or biphenylalkanoic acid derivatives, 2-oxazolealkanoic acid or 2-oxazolealkanoic acid derivatives, tetrahydropyrimidine or tetrahydropyrimidine derivatives, pyridine or pyridine derivatives, pyrazine or pyrazinone derivatives, quinolone or quinolone derivatives, arylcarboxylic acid or arylcarboxylic acid derivatives, tetrazole, triazolopyrimidine or triazolopyrimidine derivatives, indole or indole derivatives, flavonoids (such as flavanol, flavanone, isoflavone, pyrazole or pyrazole derivatives), (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403) and 4-{[(2-methoxycarbonyl)-5-(2-thienyl)-3-thienyl]amino}-4-oxo-2-butyric acid (BMS480404), and salts, stereoisomers, hydrates and mixtures thereof, the pharmaceutical composition according to claim 2 or 3.
5. The pharmaceutical composition according to claim 2, wherein the at least one FABP4 inhibitor is an antibody that specifically binds to FABP4 and inhibits its activity.
6. The pharmaceutical composition according to claim 2, wherein the FABP4 inhibitor is an siRNA containing the nucleic acid sequences of SEQ ID NOs: 2 to 9.
7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the FABP4 inhibitor is also an FABP5 inhibitor.
8. The pharmaceutical composition according to any one of claims 1 to 7, wherein the skin disease is selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, lichen planopilaris, acute guttate pityriasis lichenoides, chronic pityriasis lichenoides, pityriasis rubra pilaris, pityriasis versicolor, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue diseases (e.g., lupus), rosacea, folliculitis, acne, boils, ichthyosis, vitiligo, cicatricial alopecia, CTCL, actinic keratosis, squamous cell carcinoma, basal cell carcinoma, nevus, lichen simplex chronicus, psoriasis, keratosis, keratodermia, pruritus, burns, scars, calluses, and keloids.
9. The pharmaceutical composition according to claim 8, wherein the skin disease is CTCL.
10. The pharmaceutical composition according to any one of claims 1 to 7, wherein the skin disease is an inflammatory skin disease.
11. The pharmaceutical composition according to claim 10, wherein the inflammatory skin disease is selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, lichen planopilaris, acute guttate pityriasis lichenoides, chronic pityriasis lichenoides, pityriasis rubra pilaris, pityriasis versicolor, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue diseases (e.g., lupus), rosacea, folliculitis, acne, boils, ichthyosis, vitiligo, cicatricial alopecia, and CTCL.
12. The pharmaceutical composition according to claim 11, wherein the inflammatory skin disease is psoriasis.
13. The pharmaceutical composition according to any one of claims 1 to 12, further comprising a pharmaceutically acceptable carrier.
14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the at least one FABP inhibitor is adapted to be delivered locally, orally, by inhalation, nasally, transdermally, intravitreally, or parenterally to the circulation system of the subject.
15. The pharmaceutical composition according to claim 14, wherein the at least one FABP4 inhibitor is adapted to be administered transdermally.
16. The pharmaceutical composition according to claim 15, characterized in that it is adapted to topically administer the at least one FABP4 inhibitor across the skin layer.
17. The pharmaceutical composition according to claim 15 or 16, characterized in that it is adapted to deliver the at least one FABP4 inhibitor across the stratum corneum.
18. The pharmaceutical composition according to claim 17, characterized in that it is adapted to administer the at least one FABP4 inhibitor by injection.
19. The pharmaceutical composition according to claim 18, characterized in that it is adapted to administer the at least one FABP4 inhibitor orally.
20. The pharmaceutical composition according to any one of claims 1 to 19, characterized in that it is adapted to be used in combination with a PPARγ agonist.
21. The pharmaceutical composition according to any one of claims 1 to 19, further comprising a PPARγ agonist.
22. The pharmaceutical composition according to claim 20 or 21, characterized in that the PPARγ agonist is selected from thiazolidinedione, pioglitazone (Actos), rosiglitazone (Avandia), lobeglitazone (trade name Duvie), siglitazone, daruglitazone, englitazone, netoglitazone, riboglitazone, troglitazone (trade name Rezulin), and rhodamine.
23. In a topical formulation for transdermal delivery of at least one FABP4 inhibitor, the topical formulation, characterized in that the composition comprises at least one FABP4 inhibitor and at least one pharmaceutically acceptable carrier.
24. The topical formulation according to claim 23, further comprising at least one PPARγ agonist.
25. A method for treating or preventing a skin disease of a subject, characterized by comprising the step of administering to the subject in need thereof a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition containing the same.
26. The method according to claim 25, further comprising the step of administering a PPARγ agonist to the subject.
27. The method according to claim 26, characterized in that the PPARγ agonist is administered simultaneously with the at least one FABP4 inhibitor.
28. The method according to claim 26, wherein the FABP inhibitor and the PPARγ agonist are administered sequentially.
29. The method according to any one of claims 25 to 28, wherein the at least one FABP4 inhibitor is selected from peptides, antibodies, small molecules, small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), and mixtures thereof.
30. The method according to claim 29, wherein the at least one FABP4 inhibitor is a small molecule having a molecular weight of from about 1000 Da to 500 Da.
31. The small molecule is selected from the group consisting of carbazolebutanoic acid, arylsulfonamide, sulfonylthiophene or sulfonylthiophene derivative, 4-hydroxypyrimidine, 2-hydroxypyrimidine, carbazole or carbazole derivative, tetrahydrocarbazole or tetrahydrocarbazole derivative, 2,3-dimethylindole or 2,3-dimethylindole derivative, benzoylbenzene, biphenylalkanoic acid or biphenylalkanoic acid derivative, 2-oxazolealkanoic acid or 2-oxazolealkanoic acid derivative, tetrahydropyrimidine or tetrahydropyrimidine derivative, pyridine or pyridine derivative, pyrazine or pyrazinone derivative, quinolone or quinolone derivative, arylcarboxylic acid or arylcarboxylic acid derivative, tetrazole, triazolopyrimidine or triazolopyrimidine derivative, indole or indole derivative, flavonoid (such as flavanol, flavanone, isoflavone, pyrazole or pyrazole derivative), (2-(2'-(5-ethyl-3,4-diphenyl-1H-pyrazol-1-yl)(1,1'-biphenyl)-3-yl)oxy)-acetic acid (BMS309403) and 4-{[(2-methoxycarbonyl)-5-(2-thienyl)-3-thienyl]amino}-4-oxo-2-butyric acid (BMS480404), and salts, stereoisomers, hydrates and mixtures thereof, the method according to claim 29 or 30.
32. The method according to claim 29, wherein the at least one FABP4 inhibitor is an antibody that specifically binds to FABP4 and inhibits its activity.
33. The method according to claim 29, wherein the FABP4 inhibitor is an siRNA comprising a nucleic acid sequence of SEQ ID NO: 2 to 9.
34. The method according to any one of claims 25 to 33, wherein the FABP4 inhibitor is also an FABP5 inhibitor.
35. The method according to any one of claims 25 to 34, wherein the skin disease is selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, lichen planopilaris, acute guttate pityriasis, chronic pityriasis lichenoides, pityriasis rubra pilaris, pityriasis versicolor, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue diseases (e.g., lupus), rosacea, folliculitis, acne, boils, ichthyosis, vitiligo, cicatricial alopecia, CTCL, actinic keratosis, squamous cell carcinoma, basal cell carcinoma, nevus, chronic simple lichen, psoriasis, keratosis, keratodermia, pruritus, burns, scars, calluses, and keloids.
36. The method according to claim 35, wherein the skin disease is CTCL.
37. The method according to any one of claims 25 to 34, wherein the skin disease is an inflammatory skin disease.
38. The method according to claim 37, wherein the inflammatory skin disease is selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, lichen planopilaris, acute guttate pityriasis, chronic pityriasis lichenoides, pityriasis rubra pilaris, pityriasis versicolor, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue diseases (e.g., lupus), rosacea, folliculitis, acne, boils, ichthyosis, vitiligo, cicatricial alopecia, and CTCL lichen.
39. The method according to claim 38, wherein the inflammatory skin disease is psoriasis.
40. A method for treating or preventing psoriasis in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition comprising the same.
41. A method for treating or preventing CTCL in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition comprising the same.
42. In a method for detecting a predisposition in a subject having a skin disease or condition: A step of detecting the expression of FABP4 in a sample containing keratinocytes or inflammatory cells derived from the subject, wherein the presence of FABP4 in the sample exceeding a predetermined base level represents a predisposition to develop a skin disease or condition. The method is characterized by comprising this step.
43. The method according to claim 42, wherein the sample is a skin sample.
44. The method according to claim 42 or 43, wherein the predetermined base level is the level of FABP4 in a normal skin sample.
45. The method according to any one of claims 42 to 44, wherein the step of detecting comprises detecting the expression of FABP4 nucleic acid.
46. The method according to any one of claims 42 to 45, wherein the step of detecting comprises a step of detecting the expression of FABP4 protein or a fragment thereof.
47. The skin disease is selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, lichen planopilaris, acute guttate pityriasis rosea, chronic pityriasis lichenoides, pityriasis rubra pilaris, pityriasis versicolor, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue diseases (e.g., lupus), rosacea, folliculitis, acne, boils, ichthyosis, vitiligo, cicatricial alopecia, CTCL, actinic keratosis, squamous cell carcinoma, basal cell carcinoma, nevus, lichen simplex chronicus, psoriasis, keratosis, keratoderma, pruritus, burn, scar, callus, and keloid. The method according to any one of claims 42 to 46.
48. The method according to claim 47, wherein the skin disease is CTCL.
49. The method according to any one of claims 42 to 46, wherein the skin disease is an inflammatory skin disease.
50. The inflammatory skin disease is selected from the group consisting of psoriasis, dermatitis (atopic, seborrheic, contact), eczema, pityriasis lichenoides, lichen planus, lichen planopilaris, acute guttate pityriasis rosea, chronic pityriasis lichenoides, pityriasis rubra pilaris, pityriasis versicolor, graft-versus-host disease, histiocytosis, drug-induced rash, autoimmune connective tissue diseases (e.g., lupus), rosacea, folliculitis, acne, boils, ichthyosis, vitiligo, cicatricial alopecia, and CTCL. The method according to claim 49.
51. The method according to claim 50, characterized in that the inflammatory skin disease is psoriasis.
52. Detecting the expression of FABP4 in a sample containing keratinocytes or inflammatory cells from a subject, determining whether the expression of the FABP4 is above or below a predetermined base level, and when the FABP4 expression in the sample exceeds the predetermined base level, administering to the subject a therapeutically effective amount of at least one FABP4 inhibitor or a pharmaceutical composition containing the same, a method for treating or preventing a skin disease in a subject.