Method for producing genetically modified non-human mammals and application thereof

Abstract

To provide a method for producing genetically modified non-human mammals for producing a humanized antibody, and application thereof.SOLUTION: A production method includes: a step (1) of disrupting an endogenous heavy-chain immunoglobin locus in a non-human mammal; and a step (2) of introducing a human-derived IGHV gene, a human-derived IGHD gene, a human-derived IGHJ gene, and endogenous IgHG2c genes, IgHE genes, IgHA genes and an LCR region of the non-human mammal into the non-human mammal obtained in the step (1). The non-human mammal produced by the production method can efficiently produce humanized whole antibodies, heavy chain-only antibodies or nanobodies after immunization with an antigen, and has a relatively high immune titer. Further, the production method can obtain positive animals with a relatively high efficiency, thereby easily producing humanized mice with different antibody diversity, and achieving nanobody sequence diversity in multiple breeds of mice.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a method for producing a genetically modified non-human mammal and its applications.

Background Art

[0002] In the bodies of camelids and sharks, antibodies with a unique structure, heavy-chain-only antibodies, are generated. These antibodies are composed only of heavy chains, and the molecular weight of their variable region fragments (15 kDa) is approximately one-tenth of that of conventional antibodies (150 - 160 kDa). The variable region fragments of heavy-chain-only antibodies are also called nanobodies. Nanobodies are widely applied in the development of bispecific / multispecific antibodies, CAR-T cell therapy, etc. By January 2023, four nanobody-based therapeutic drugs had been marketed. Here, the nanobody-based BCMA CAR-T therapy developed by NASDAQ:LEGN has obtained excellent clinical effects. In addition, more than 10 molecules developed as neutralizing antibodies have entered clinical phase II / III. The research, development, and application of nanobody drugs are still in a relatively early stage and have great potential for application and development prospects.

[0003] The fully human nanobody mouse is a fully human nanobody mouse used in the development of nanobody drugs. Based on the independently developed humanized technology of genomic fragment from hundreds of KB to mega base pair (abbreviated as mega B) level, the humanization of the antibody heavy-chain gene was realized, covering the main human heavy-chain variable region genes. Using HuNano Mouse, it was possible to directly screen antibody gene sequences such as fully human nanobodies for treatment, bispecific antibodies, and those for CAR-T against major diseases. The fully human nanobody sequences produced can be used in drug development without humanization and modification in vitro, saving a large amount of time and cost and reducing the risk of subsequent drug development. The use of fully human nanobody mice has become an inevitable trend in the development of therapeutic nanobody drugs.

[0004] Technologies often used in the production of large-fragment (over 100 Kb) gene humanized animal models include chromosome engineering, RMCE (recombinase-mediated cassette exchange), and single BAC gene recombination. The hurdle of chromosome engineering technology is high, the research and development cycle reaches about 5 years, and it depends on the recipient species of embryonic stem cells. Its use is limited to species that can isolate highly efficient embryonic stem cells, such as mice. In the RMCE technology, the size of the target fragment recombined into the genome is about 200 kb each time. To complete the gene modification at the mega B level, it is necessary to perform gene recombination on embryonic stem cells at least 5 to 6 times, and it takes about 5 years to complete the construction of the animal model. The size of the fragment of single BAC gene recombination is restricted by the size of BAC. Generally, the transferred gene in one time is 200 kb, and the transfer of mega B gene cannot be realized.

[0005] In addition, the immune titer of the fully human nanobody mouse is generally lower than that of the wild mouse, which means that the diversity of the selected antibody sequences is small.

[0006] Therefore, how to improve the immune titer of the fully human nanobody mouse and how to improve the diversity of the generated antibodies are technical problems that need to be urgently solved in this field.

[0007] The information disclosed in this background art section is only for the purpose of deepening the understanding of the overall background of the present invention, and it should not be recognized or regarded as suggesting in any form that this information constitutes prior art well-known to those skilled in the art.

Summary of the Invention

Problems to be Solved by the Invention

[0008] Object of the Invention: In view of the above problems existing in the prior art, an object of the present invention is to provide a method for producing a genetically modified non-human mammal capable of efficiently producing a humanized antibody (including whole antibody, antibody consisting of only heavy chain, and nanobody), a method for producing a humanized antibody that specifically binds to an antigen based on the non-human mammal produced by the production method, and a method for obtaining a biological sample.

[0009] By adopting the MBGE introduction system based on the method for producing a genetically modified non-human mammal of the present invention, a fully human nanobody-producing mouse with mega B-level genomic fragment humanization can be produced within a short time (for example, within 6 months), and the efficiency of obtaining positive mice reaches about 15% with a single injection, so that humanized mice with different antibody diversities can be easily produced (for example, improving the nanobody sequence diversity with multiple strains of mice), and the produced non-human mammal has a very high immune titer and can efficiently produce a humanized antibody (including whole antibody, antibody consisting of only heavy chain, and nanobody).

Means for Solving the Problems

[0010] Solution: To achieve the object of the present invention, the present invention provides the following technical solutions.

[0011] According to a first aspect, the present invention provides a genetically modified non-human mammal comprising disruption of an endogenous heavy chain immunoglobulin locus.

[0012] In some preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy chain immunoglobulin locus comprises deletion of a gene fragment of the CH1 fragment of the mouse antibody gene heavy chain IgHM, deletion of a gene fragment of the CH1 fragment of the mouse antibody gene light chain Igkc, and deletion of a gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

[0013] In some other preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy-chain immunoglobulin locus is deletion of a gene fragment of a fragment between IgHM and IgHA-CH1 of the heavy chain of the mouse antibody gene, deletion of a gene fragment of the CH1 fragment of the light chain Igkc of the mouse antibody gene, and deletion of a gene fragment of a fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene.

[0014] The non-human mammal genetically modified as described above can be used as a background animal, and by introducing an appropriate human-derived antibody gene into it, a non-human mammal capable of producing a humanized antibody can be produced.

[0015] According to a second aspect, the present invention provides a method for producing a non-human mammal genetically modified as described in the first aspect above, and the production method includes a step of disrupting the endogenous heavy-chain immunoglobulin locus in a non-human mammal.

[0016] Preferably, the non-human mammal is a mouse.

[0017] In some preferred specific embodiments, the disruption of the endogenous heavy-chain immunoglobulin locus is deletion of a gene fragment of the CH1 fragment of the heavy chain IgHM of the mouse antibody gene, deletion of a gene fragment of the CH1 fragment of the light chain Igkc of the mouse antibody gene, and deletion of a gene fragment of a fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene.

[0018] More preferably, the gene fragment is deleted by CRISPR-Cas9 gene editing technology, Here, the sgRNAs for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM include the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2, and / or the sgRNAs for deleting the CH1 fragment of the mouse antibody gene light chain Igkc include the sgRNA shown in SEQ ID NO: 3, and / or the sgRNAs for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ include the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0019] In some other preferred specific embodiments, the disruption of the endogenous heavy chain immunoglobulin locus is deletion of the gene fragment of the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain, deletion of the gene fragment of the CH1 fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

[0020] More preferably, the gene fragment is deleted by CRISPR-Cas9 gene editing technology, Here, the sgRNAs for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain include the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 6, and / or the sgRNAs for deleting the CH1 fragment of the mouse antibody gene light chain Igkc include the sgRNA shown in SEQ ID NO: 3, and / or the sgRNAs for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ include the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0021] According to a third aspect, the present invention provides a genetically modified non-human mammal, wherein the non-human mammal includes disruption of the endogenous heavy chain immunoglobulin locus, and the endogenous heavy chain immunoglobulin locus of the non-human mammal includes a human-derived IGHV gene, a human-derived IGHD gene, a human-derived IGHJ gene, and the endogenous IgHG2c gene, IgHE gene, IgHA gene and LCR region of the non-human mammal.

[0022] In some preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy-chain immunoglobulin locus is deletion of the gene fragment of the CH1 fragment of the mouse antibody gene heavy chain IgHM, deletion of the gene fragment of the CH1 fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

[0023] In some other preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy-chain immunoglobulin locus is deletion of the gene fragment of the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain, deletion of the gene fragment of the CH1 fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

[0024] In an implementable embodiment, the human-derived IGHV gene is at least 18 human-derived IGHV genes including hIGHV4-59, hIGHV3-53, hIGHV5-51, hIGHV3-49, hIGHV3-48, hIGHV1-46, hIGHV3-43, hIGHV4-39, hIGHV3-33, hIGHV4-30-2, hIGHV1-24, hIGHV3-23, hIGHV3-21, hIGHV3-11, hIGHV3-7, hIGHV4-4, hIGHV1-2, hIGHV6-1, Preferably, the human-derived IGHV gene further includes one, a plurality, or all of the human-derived IGHV genes selected from hIGHV1-58, hIGHV1-45, hIGHV3-35, hIGHV4-28, hIGHV2-26, hIGHV3-20, hIGHV1-18, hIGHV3-15, hIGHV3-13, hIGHV5-10-1, hIGHV3-64D, hIGHV2-5, hIGHV7-4-1, hIGHV1-3, More preferably, the human-derived IGHV gene further comprises one kind, a plurality of kinds or all of the human-derived IGHV genes selected from hIGHV3-60, hIGHV3-57, hIGHV7-56, hIGHV4-55, hIGHV3-54, hIGHV3-52, hIGHV3-50, hIGHV3-47, hIGHV3-42, hIGHV3-41, hIGHV3-38, hIGHV3-37, hIGHV3-36, hIGHV7-34-1, hIGHV4-34, hIGHV3-33-2, hIGHV3-32, hIGHV3-30-2, hIGHV3-30, hIGHV3-29, hIGHV7-27, hIGHV3-25, hIGHV3-22, hIGHV3-19, hIGHV1-17, hIGHV3-16, hIGHV1-14, hIGHV1-12, hIGHV3-6.

[0025] In an executable embodiment, the human-derived IGHD gene comprises at least fifteen human-derived IGHD genes including IGHD1-1, IGHD3-3, IGHD6-6, IGHD1-7, IGHD3-10, IGHD6-13, IGHD1-14, IGHD2-15, IGHD3-16, IGHD5-18, IGHD6-19, IGHD1-20, IGHD3-22, IGHD1-26, IGHD7-27, Preferably, the human-derived IGHD gene further comprises one kind, a plurality of kinds or all of the human-derived IGHD genes selected from IGHD2-2, IGHD2-8, IGHD3-9, IGHD3-10, IGHD4-11, IGHD5-12, IGHD3-16, IGHD4-17, IGHD2-21, IGHD4-23, IGHD5-24, IGHD6-25. More preferably, the human-derived IGHD gene further comprises one kind, a plurality of kinds or all of the human-derived IGHD genes selected from IGHD3-3, IGHD3-10, IGHD3-16, IGHD5-18.

[0026] In an executable embodiment, the human-derived IGHJ gene is all human-derived IGHJ genes, and / or the endogenous IgHG2c gene of the non-human mammal is the endogenous complete (full-length) IgHG2c gene of the non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain. When the endogenous IgHG2c gene of the non-human mammal is the endogenous complete IgHG2c gene of the non-human mammal, after immunization with an antigen, what is produced is a humanized whole antibody. When the endogenous IgHG2c gene of the non-human mammal is an endogenous IgHG2c gene segment lacking the CH1 domain of the non-human mammal, after immunization with an antigen, what is produced is an antibody with only a humanized heavy chain.

[0027] Preferably, the human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene are operably connected and VDJ rearrangement is possible. More preferably, the human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene that are operably connected and / or VDJ rearranged are operably connected to the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal. Preferably, there is an endogenous IgHM Switch region of the human mammal between the human-derived IGHJ gene and the endogenous IgHG2c gene of the non-human mammal.

[0028] Most preferably, the endogenous heavy chain immunoglobulin locus of the non-human mammal contains all the genes shown in Table 13.

[0029] According to a fourth aspect, the present invention provides a method for producing a genetically modified non-human mammal described in the third aspect above. The production method includes: Step (1) of disrupting the endogenous heavy chain immunoglobulin locus in a non-human mammal; Step (2) of introducing a human-derived IGHV gene, a human-derived IGHD gene, a human-derived IGHJ gene, and the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal obtained in step (1), characterized by including this.

[0030] In an executable embodiment, the non-human mammal is a mouse, and the disruption of the endogenous heavy-chain immunoglobulin locus in step (1) includes deletion of the gene fragment of the CH1 fragment of the mouse antibody gene heavy chain IgHM, deletion of the gene fragment of the CH1 fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ. Preferably, gene editing technology, such as CRISPR-Cas9 technology, is used to delete the gene fragments as described above. More preferably, the sgRNA for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM includes the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2, and / or the sgRNA for deleting the CH1 fragment of the mouse antibody gene light chain Igkc includes the sgRNA shown in SEQ ID NO: 3, and / or the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0031] In some other executable embodiments, the non-human mammal is a mouse, and the disruption of the endogenous heavy-chain immunoglobulin locus in step (1) includes deletion of the gene fragment of the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain, deletion of the gene fragment of the CH1 fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ. Preferably, gene editing technology, such as CRISPR-Cas9 technology, is used to delete the gene fragments as described above. More preferably, the sgRNA for deleting the fragment between IgHM and IgHA-CH1 of the heavy chain of the mouse antibody gene includes the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 6, and / or the sgRNA for deleting the CH1 fragment of the light chain Igkc of the mouse antibody gene includes the sgRNA shown in SEQ ID NO: 3, and / or the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene includes the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0032] In some specific embodiments, the non-human mammal is a mouse, and in step (2), The human-derived IGHV gene is at least It contains 18 types of human-derived IGHV genes including hIGHV4-59, hIGHV3-53, hIGHV5-51, hIGHV3-49, hIGHV3-48, hIGHV1-46, hIGHV3-43, hIGHV4-39, hIGHV3-33, hIGHV4-30-2, hIGHV1-24, hIGHV3-23, hIGHV3-21, hIGHV3-11, hIGHV3-7, hIGHV4-4, hIGHV1-2, hIGHV6-1, and optionally further contains one, multiple, or all human-derived IGHV genes selected from hIGHV1-58, hIGHV1-45, hIGHV3-35, hIGHV4-28, hIGHV2-26, hIGHV3-20, hIGHV1-18, hIGHV3-15, hIGHV3-13, hIGHV5-10-1, hIGHV3-64D, hIGHV2-5, hIGHV7-4-1, hIGHV1-3, and further optionally contains one, multiple, or all human-derived IGHV genes selected from hIGHV3-60, hIGHV3-57, hIGHV7-56, hIGHV4-55, hIGHV3-54, hIGHV3-52, hIGHV3-50, hIGHV3-47, hIGHV3-42, hIGHV3-41, hIGHV3-38, hIGHV3-37, hIGHV3-36, hIGHV7-34-1, hIGHV4-34, hIGHV3-33-2, hIGHV3-32, hIGHV3-30-2, hIGHV3-30, hIGHV3-29, hIGHV7-27, hIGHV3-25, hIGHV3-22, hIGHV3-19, hIGHV1-17, hIGHV3-16, hIGHV1-14, hIGHV1-12, hIGHV3-6 And / or, the human-derived IGHD gene is at least It contains 15 types of human-derived IGHD genes, namely IGHD1-1, IGHD3-3, IGHD6-6, IGHD1-7, IGHD3-10, IGHD6-13, IGHD1-14, IGHD2-15, IGHD3-16, IGHD5-18, IGHD6-19, IGHD1-20, IGHD3-22, IGHD1-26, IGHD7-27, and optionally further contains 1, a plurality, or all of the human-derived IGHD genes selected from IGHD2-2, IGHD2-8, IGHD3-9, IGHD3-10, IGHD4-11, IGHD5-12, IGHD3-16, IGHD4-17, IGHD2-21, IGHD4-23, IGHD5-24, IGHD6-25, and further optionally further contains 1, a plurality, or all of the human-derived IGHD genes selected from IGHD3-3, IGHD3-10, IGHD3-16, IGHD5-18, And / or, the human-derived IGHJ genes are all human-derived IGHJ genes, And / or, the endogenous IgHG2c gene of the non-human mammal is the endogenous complete IgHG2c gene of the non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain. When the endogenous IgHG2c gene of the non-human mammal is the endogenous complete IgHG2c gene of the non-human mammal, after immunization with an antigen, what is produced is a humanized whole antibody. When the endogenous IgHG2c gene of the non-human mammal is an endogenous IgHG2c gene segment lacking the CH1 domain of the non-human mammal, after immunization with an antigen, what is produced is an antibody with only a humanized heavy chain.

[0033] In a preferred embodiment of the above specific embodiment, in step (2), To the mouse obtained in step (1), (I) A total of n BAC clones containing all of the aforementioned human-derived IGHV genes, human-derived IGHD genes, and human-derived IGHJ genes, where n is an integer between 3 and 8, preferably between 4 and 7, and most preferably, n is 4, and there are gene homologous sequences of 5 kb to 50 kb between the n BAC clones so as to perform gene splicing (splicing) via homologous gene sequences (for example, the 10 kb gene sequence at the end in the nth BAC clone is homologous to the 10 kb gene sequence at the head in the (n + 1)th BAC clone), the n BAC clones, (II) The human-derived IGHV gene, human-derived IGHD gene, human-derived IGHJ gene, and the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal are introduced by a method of introducing one or more BAC clones containing the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal.

[0034] More preferably, in step (2), The human-derived IGHV gene, human-derived IGHD gene, human-derived IGHJ gene, and the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal are introduced by a method of introducing 6 BAC clones into the mouse obtained in step (1), and the 6 BAC clones are (i) 4 BAC clones containing all of the aforementioned human-derived IGHV genes and human-derived IGHD genes in total, (ii) 1 BAC clone containing all human-derived IGHD genes and all human-derived IGHJ genes, (iii) 1 BAC clone containing the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal, Here, so as to ligate genes by overlapping gene sequences, there are mutually terminal 5 kb to 50 kb gene homologous sequences (preferably 5 kb to 20 kb gene homologous sequences) between each of the BAC clones in (i) and between the BAC clone in (i) and the BAC clone in (ii), Preferably, the genes contained in the six BAC clones are shown in Table 13.

[0035] In the non-human mammal produced by the above production method, between the human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene, they are operably connected, and VDJ rearrangement is possible, and the human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene that are operably connected and / or VDJ rearranged are operably connected to the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal, And / or, there is an endogenous IgHM Switch region of the human mammal between the human-derived IGHJ gene and the endogenous IgHG2c gene of the non-human mammal.

[0036] According to a fifth aspect, the present invention provides a method for producing a humanized whole antibody or an antibody consisting of only a heavy chain or a nanobody that specifically binds to an antigen, the method comprising: Exposing the genetically modified non-human mammal described in the above third aspect or the genetically modified non-human mammal produced by the production method described in the above fourth aspect to the antigen in step (1); Collecting B cells from the non-human mammal obtained in step (1), extracting RNA, reverse-transcribing it into cDNA, amplifying an antibody gene fragment using the cDNA as a template, and cloning the antibody gene fragment into a phage display vector in step (2); Expressing the target antibody in the phage vector obtained in step (2), washing the phage, concentrating (enriching) the phage expressing the target antibody, and expressing it. The obtained target antibody is a humanized whole antibody or an antibody consisting of only a heavy chain in step (3); Optionally, step (4) of cloning the variable region fragment of the obtained antibody consisting only of the heavy chain to obtain a humanized nanobody is included.

[0037] According to a sixth aspect, the present invention provides a method for producing a humanized antibody or nanobody consisting only of a heavy chain that specifically binds to an antigen, the method comprising: After exposing a genetically modified non-human mammal described in the above third aspect or a genetically modified non-human mammal produced by the production method described in the above fourth aspect to the antigen, step (1) of collecting B cells; Sequencing the nucleic acid encoding the immunoglobulin heavy chain variable region and optionally the light chain variable region in the B cells collected in step (1) to obtain the nucleic acid sequences of the heavy chain variable region and the light chain variable region of the humanized monoclonal antibody or the nucleic acid sequence of the heavy chain variable region of the humanized nanobody, step (2); Based on the sequence obtained in step (2), step (3) of expressing a humanized whole antibody or an antibody consisting only of the heavy chain that specifically binds to the antigen; Optionally, step (4) of cloning the variable region fragment of the obtained antibody consisting only of the heavy chain to obtain a humanized nanobody is included.

[0038] According to a seventh aspect, the present invention provides a method for obtaining a biological sample, the method comprising: Step (1) of exposing a genetically modified non-human mammal described in the above third aspect or a genetically modified non-human mammal produced by the production method described in the above fourth aspect to the antigen; Step (2) of collecting a biological sample from the animal.

[0039] Preferably, the biological sample is spleen tissue (spleen tissue), spleen cells or B cells.

[0040] According to an eighth aspect, the present invention provides a biological sample obtained by the method described in the above seventh aspect.

[0041] According to a ninth aspect, the present invention provides an sgRNA composition, which includes an sgRNA for deleting the CH1 fragment of the mouse antibody heavy chain IgHM, an sgRNA for deleting the CH1 fragment of the mouse antibody light chain Igkc, and an sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody light chain Igλ.

[0042] Preferably, the sgRNA for deleting the CH1 fragment of the mouse antibody heavy chain IgHM includes the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2. Preferably, the sgRNA for deleting the CH1 fragment of the mouse antibody light chain Igkc includes the sgRNA shown in SEQ ID NO: 3. Preferably, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody light chain Igλ includes the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0043] According to a tenth aspect, the present invention provides an sgRNA composition, which includes an sgRNA for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody heavy chain, an sgRNA for deleting the CH1 fragment of the mouse antibody light chain Igkc, and an sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody light chain Igλ.

[0044] Preferably, the sgRNA for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody heavy chain includes the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 6. Preferably, the sgRNA for deleting the CH1 fragment of the mouse antibody light chain Igkc includes the sgRNA shown in SEQ ID NO: 3. Preferably, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody light chain Igλ includes the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0045] According to the 11th aspect, the present invention provides a CRISPR-Cas9 gene editing system, and the CRISPR-Cas9 gene editing system includes the sgRNA composition and Cas9 protein described in the 9th or 10th aspect above.

[0046] According to the 12th aspect, the present invention provides a gene knockout vector, and the gene knockout vector includes a DNA sequence encoding the sgRNA in the sgRNA composition described in the 9th or 10th aspect above.

[0047] According to the 13th aspect, the present invention provides a mouse embryonic stem cell, and the mouse embryonic stem cell includes the gene knockout vector described in the 12th aspect above.

Advantages of the Invention

[0048] The genetically modified non-human mammal produced by the production method of the present invention has a relatively high immune titer and can efficiently produce an antibody of only a humanized heavy chain or a nanobody after immunization with an antigen, and is an efficient production platform for humanized whole antibodies or antibodies of only a heavy chain or nanobodies. In addition, the efficiency of obtaining positive animals by the method for producing non-human mammals described in the present invention is relatively high (reaching about 15%), whereby humanized mice with different antibody diversities can be easily produced, and nanobody sequence diversity can be realized in multi-variety mice.

Brief Description of the Drawings

[0049] One or more embodiments are illustratively explained by images in the corresponding drawings, and these illustrative explanations do not constitute a limitation on the embodiments. Here, the technical term "illustrative" means "used as an example, embodiment or explanation". Any embodiment described as "illustrative" here does not need to be construed as being superior to or better than other embodiments.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Modes for Carrying Out the Invention

[0050] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present invention, but not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative labor all belong to the protection scope of the present invention.

[0051] In addition, to better explain the present invention, in the following specific embodiments, many specific details are shown. Those skilled in the art will understand that the present invention can be implemented similarly even without specific specific details. In some examples, in order to emphasize the gist of the present invention, raw materials, elements, methods, means, etc. well known to those skilled in the art are not described in detail.

[0052] Unless otherwise specifically stated, throughout the specification and the claims, the term "comprising" or for example "comprises" or "is comprised of" is understood to include the stated element or component, but does not exclude other elements or other components.

[0053] In the following examples, the mice used are C57BL / 6 mice purchased from Charles River Laboratories. The starting age of the mice for construction is 4 to 6 weeks old, and the body weight is about 18 g to 22 g.

[0054] Example 1: Design of sgRNA for deleting the CH1 region of the mouse IgHM gene (hereinafter also referred to as the "IgM gene"), production and identification of gene knockout mice (hereinafter abbreviated as "IgM mice" or "IgM homozygous mice").

[0055] To delete the CH1 region of the mouse IgHM gene, one target upstream and downstream of the first exon of the mouse IgHM gene was selected, and one sgRNA was designed for each target. A schematic diagram of the sgRNA target is shown in Figure 1, where the five-star symbols in the figure represent the positions of the upstream and downstream targets, respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 1.

[0056] 1. Construction of IgM mice, 1.1 The specific steps include sgRNA primer design, sgRNA in vitro transcription, mouse embryonic injection (embryonic injection), and positive mouse identification.

[0057] 1.2 Experimental reagents: MEGAshortscript TM Kit MEGAclear TM Kit Purification for Large Scale Transcription Reactions 1.3 sgRNA Primer Design

Table 1

[0058]

Table 2

[0059]

Table 3

[0060] 1.5 In Vitro Transcription 1.5.1 The transcription system is shown in Table 4.

[0061]

Table 4

[0062] 1.5.2 Agarose gel electrophoresis of sgRNA transcription products is shown in Figure 2.

[0063] 1.6 Transplant the cells containing the above sgRNA and Cas9 protein into the host animal body. Promote ovulation in mice, perform in vitro fertilization, culture the fertilized eggs, then mix the sgRNA and Cas9 protein, subject the mouse fertilized eggs to electroporation (electrical perforation), or inject Cas9 protein (or Cas9 mRNA, commercially available) together with the sgRNA into the mouse fertilized eggs by microinjection.

[0064] By transplanting the above fertilized egg cells into the body of a surrogate mother mouse, F0 generation chimeric mice can be produced. Extract the genomic DNA of the mouse tail, perform PCR amplification, and analyze the PCR amplification products to detect individuals in which knockout has occurred in the F0 generation mice.

[0065] In the above PCR amplification, the PCR primers mIghM-teko-1F and mIghM-teko-1R are designed at both ends of the deletion sequence, and their sequences are shown in Table 5.

[0066]

Table 5

[0067] From the analysis of the sequencing results of the PCR products, it was confirmed that the length of the deletion sequence is 323bp. Therefore, the PCR products amplified by the above primers can detect both the deleted gene and the wild-type gene according to the fragment size. Here, for the wild-type gene and the gene with the target sequence deleted, the sizes of the target bands amplified by the primers mIghM-teko-1F and mIghM-teko-1R are 907bp and 584bp (results not shown), respectively.

[0068] Select F0 generation chimeric mice in which the gene has been accurately knocked out and use them for subsequent breeding and identification.

[0069] 1.7 Breeding of Heterozygous and Homozygous Gene Knockout Mice: The F0 generation mice with targeted gene knockout are mated with wild-type mice to obtain F1 generation mice. The tail genome of the mice is extracted and detected by PCR. By selecting the gene knockout positive F1 generation heterozygous mice that can be stably inherited, and then mating the F1 generation heterozygous mice with each other, gene knockout positive F2 generation homozygous mice, that is, IgM homozygous mice, can be obtained. Genotyping is performed on the obtained F2 generation and subsequent generations of homozygous mice. The method is the same as the above step (1.6). At the same time, the homozygous positive mice and heterozygous mice identified by sequencing are used as the homozygous positive control (lane labeled as "+") and heterozygous control (lane labeled as "+ / -") respectively. Furthermore, a wild-type mouse control (lane labeled as "-") and a negative control without DNA template (also called "water control") are set, and the results are shown in Figure 3.

[0070] Figure 3 shows that IgM homozygous mice were reliably obtained by the above process.

[0071] Example 2: Design of sgRNA for deleting mouse antibody gene light chain Igkc (hereinafter also referred to as "IgK gene"), production and identification of gene knockout mice (hereinafter abbreviated as "IgK mice" or "IgK homozygous mice").

[0072] To knockout the mouse Igkc gene, one target was selected in the exon of the mouse Igkc gene, and one sgRNA was designed for this target. The schematic diagram of the sgRNA target is shown in Figure 4, and the sequence of the designed one sgRNA and its target sequence are shown in Table 3.

[0073] 2. Construction of IgK Mice: 2.1 The specific steps include sgRNA primer design, in vitro transcription of sgRNA, mouse embryonic injection, and identification of positive mice.

[0074] 2.2 Experimental reagents: MEGAshortscript TM Kit MEGAclear TM Kit Purification for Large Scale Transcription Reactions 2.3 sgRNA primer design

Table 6

[0075] 2.4.2 The Touchdown process was shown in Table 3 above.

[0076] The PCR products were recovered with a recovery reagent cassette and used for the next experiment, in vitro transcription.

[0077] 2.5 In vitro transcription 2.5.1 The transcription system was shown in Table 4 above.

[0078] The above transcription system was incubated in a 37 °C constant temperature incubator for 18 h and recovered with the MEGAclear TM Kit Purification for Large Scale Transcription Reactions reagent cassette.

[0079] 2.5.2 The agarose gel electrophoresis of the IgK-sgRNA transcription product is shown in Figure 5. Figure 5 shows that after the above transcription process, a single transcription product, that is, IgK-sgRNA, can be obtained and used for the subsequent introduction process.

[0080] 2.6 Introduction of the above sgRNA and Cas9 protein into the fertilized eggs of host animals: After promoting ovulation in mice, performing in vitro fertilization, and culturing the fertilized eggs, sgRNA and Cas9 protein were mixed, and mouse fertilized eggs were subjected to electroporation, or Cas9 protein (or Cas9 mRNA, commercially available) was injected into mouse fertilized eggs together with sgRNA by the method of microinjection.

[0081] By transplanting the above fertilized egg cells into the body of a surrogate mother mouse, F0 generation chimeric mice can be produced. By extracting the tail genomic DNA of the mouse, performing PCR amplification, and analyzing the PCR amplification products, individuals in which knockout occurred in the F0 generation mice were detected.

[0082] In the above PCR amplification, the PCR primers KC-nF and KC-nR were designed on both sides of the deletion sequence, and the sequences are shown in Table 7.

[0083]

Table 7

[0084] Select F0 generation chimeric mice in which the gene has been accurately knocked out and use them for subsequent breeding and identification.

[0085] 2.7 Breeding of heterozygous and homozygous gene knockout mice: The F0 generation mice with targeted gene knockout were mated with wild-type mice to obtain F1 generation mice. The tail genomes of the mice were extracted and detected by PCR to select the gene knockout positive F1 generation heterozygous mice that could be stably inherited. Then, when the F1 generation heterozygous mice were mated with each other, gene knockout positive F2 generation homozygous mice, that is, homozygous mice with Igkc knockout, could be obtained. Genotyping was performed on the obtained F2 generation and subsequent homozygous mice, and the method was the same as that in step (2.6) above, and the results are shown in Figure 6.

[0086] Figure 6 shows that IgK homozygous mice were reliably obtained by the above process.

[0087] Example 3: Design of sgRNA for deleting the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene (hereinafter also referred to as the "IgL gene"), production and identification of gene knockout mice (hereinafter abbreviated as "IgL mice" or "IgL homozygous mice").

[0088] To delete the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene, one target was selected upstream of the exon of the mouse Iglc2 gene, and one target was selected downstream of the exon of the mouse Iglc1 gene, and one sgRNA was designed for each target. The schematic diagram of the sgRNA target is shown in Figure 7, where the five-star symbols in the figure represent the positions of the upstream and downstream targets respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 8.

[0089] 3. Construction of IgL mice: 3.1 The specific steps include sgRNA primer design, sgRNA in vitro transcription, mouse embryo injection, and positive mouse identification.

[0090] 3.2 Experimental reagents: MEGAshortscript TM Kit, MEGAclear TM Kit, Purification for Large Scale Transcription Reactions、 3.3 sgRNA Primer Design、

Table 8

[0091] 3.4.2 The Touchdown process is shown in Table 3 above.

[0092] The PCR products were recovered with a recovery reagent cassette and used for the next experiment, in vitro transcription.

[0093] 3.5 In Vitro Transcription、 3.5.1 The transcription system is shown in Table 4 above.

[0094] The above transcription system was incubated in a 37 °C constant temperature incubator for 18 h and recovered with a MEGAclear TM Kit Purification for Large Scale Transcription Reactions reagent cassette.

[0095] 3.5.2 sgRNA transcription product agarose gel electrophoresis is shown in Figure 8. Figure 8 shows that after the above transcription process, single transcription products were obtained respectively, that is, as described above, the two sgRNAs designed based on the upstream and downstream targets can be used in the subsequent introduction process.

[0096] 3.6 Introduction of the sgRNA and Cas9 protein into the fertilized eggs of host animals: After promoting ovulation in mice, performing in vitro fertilization, and culturing the fertilized eggs, sgRNA and Cas9 protein were mixed, and mouse fertilized eggs were subjected to electroporation, or Cas9 protein (or Cas9 mRNA, commercially available) was injected into mouse fertilized eggs together with sgRNA by the method of microinjection.

[0097] By transplanting the above fertilized egg cells into the body of a surrogate mother mouse, F0 generation chimeric mice can be produced. By extracting the tail genomic DNA of the mouse, performing PCR amplification, and analyzing the PCR amplification products, individuals in which knockout occurred in the F0 generation mice were detected.

[0098] In the above PCR amplification, the PCR primers LC2-nF1 and IgL-R2 were designed on both sides of the deletion sequence, and the sequences are shown in Table 9.

[0099]

Table 9

[0100] Select F0 generation chimeric mice in which the gene has been accurately knocked out and use them for subsequent breeding and identification.

[0101] 3.7 Breeding of heterozygous and homozygous gene knockout mice: The F0 generation mice with the target gene knocked out were mated with wild-type mice to obtain F1 generation mice. The tail genomes of the mice were extracted and detected by PCR to select the gene knockout positive F1 generation heterozygous mice that could be stably inherited. Then, when the F1 generation heterozygous mice were mated with each other, gene knockout positive F2 generation homozygous mice, that is, homozygous mice with Igkc knocked out, could be obtained. Genotyping was performed on the obtained F2 generation and subsequent homozygous mice, and the method was the same as that in step (3.6) above, and the results are shown in Figure 9.

[0102] Figure 9 shows that IgL homozygous mice were reliably obtained by the above process.

[0103] Example 4: Design of sgRNA for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain (hereinafter also referred to as "IgA gene"), production and identification of gene knockout mice (hereinafter abbreviated as "IgA mice" or "IgA homozygous mice").

[0104] To delete the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain, one target was selected upstream of the exon of the mouse IgHM gene, and one target was selected downstream of exon 1 of the mouse IgHA gene, and one sgRNA was designed for each target. The schematic diagram of the sgRNA target is shown in Figure 10, where the five-star symbols in the figure represent the positions of the upstream and downstream targets respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 10.

[0105] 4. Construction of IgA mice: 4.1 The specific steps include sgRNA primer design, sgRNA in vitro transcription, mouse embryonic injection, and positive mouse identification.

[0106] 4.2 Experimental reagents: 4.2.1 MEGAshortscript TM Kit, 4.2.2 MEGAclear TM Kit, Purification for Large Scale Transcription Reactions、 4.3 sgRNA Primer Design、

Table 10

[0107] 4.4.2 The Touchdown process is shown in Table 3 above.

[0108] The PCR products were recovered with a recovery reagent cassette and used for the next experiment, in vitro transcription.

[0109] 4.5 In Vitro Transcription、 4.5.1 The transcription system is shown in Table 4 above.

[0110] The above transcription system was incubated in a 37 °C constant temperature incubator for 18 h and recovered with a MEGAclear TM Kit Purification for Large Scale Transcription Reactions reagent cassette.

[0111] 4.5.2 Agarose gel electrophoresis of IgA-sgRNA transcription products is shown in Figure 11. Figure 11 shows that after the above transcription process, single transcription products were obtained respectively, that is, as described above, the two sgRNAs designed based on the upstream and downstream targets can be used in the subsequent introduction process.

[0112] 4.6 Introduction of the sgRNA and Cas9 Protein into Host Animal Fertilized Eggs: After promoting ovulation in mice, performing in vitro fertilization, culturing the fertilized eggs, mixing the sgRNA and Cas9 protein, subjecting the mouse fertilized eggs to electroporation, or injecting the Cas9 protein (or Cas9 mRNA, commercially available) together with the sgRNA into the mouse fertilized eggs by the method of microinjection.

[0113] By transplanting the above fertilized egg cells into the body of a surrogate mother mouse, F0 generation chimeric mice can be produced. Mouse tail genomic DNA was extracted, PCR amplified, and gel electrophoresis and sequencing analysis were performed on the PCR amplification products to detect individuals in which knockout occurred in the F0 generation mice.

[0114] In the above PCR amplification, the PCR primers IgA-KO-1F and IgA-KO / WT-1R were designed on both sides of the deletion sequence, and the sequences are shown in Table 11.

[0115]

Table 11

[0116] From the analysis of the PCR product sequencing results, it was confirmed that the length of the deletion sequence is about 163 kb. Amplify gene knockout mice with the above primers below The size of the PCR product is 1170 bp. The PCR primer IgA-KO / WT-1R was designed at a position close to the 3' end on the deletion sequence. The primers IgA-WT-1F and IgA-KO / WT-1R were used to detect the target fragment where gene deletion did not occur, and the size of the PCR product is 724 bp. It is also possible to confirm whether it is a wild-type gene or a gene with the target sequence deleted according to the size of the PCR product fragment.

[0117] Select F0 generation chimeric mice in which the gene is accurately knocked out and use them for subsequent breeding and identification.

[0118] 4.7 Breeding of Heterozygous and Homozygous Gene Knockout Mice: The F0 generation mice with targeted gene knockout were mated with wild-type mice to obtain F1 generation mice. The tail genomes of the mice were extracted and detected by PCR to select the gene knockout positive F1 generation heterozygous mice that could be stably inherited. Then, when the F1 generation heterozygous mice were mated with each other, gene knockout positive F2 generation homozygous mice, that is, homozygous mice with IgA knockout, could be obtained. Genotyping was performed on the obtained F2 generation and subsequent homozygous mice. The method was the same as that in step (4.6) above. At the same time, the homozygous positive mice identified by sequencing were used as homozygous positive controls (i.e., the lanes labeled with "+"), and further, wild-type mouse controls (i.e., the lanes labeled with "-") and negative controls without DNA templates (also called "water controls") were set. The results are shown in Figure 12.

[0119] Figure 12 shows that IgA homozygous mice were reliably obtained by the above process.

[0120] Example 5: Production and Identification of Three Gene Knockout Mice of IgM, IgK, and IgL (referred to as "IgM-KL mice" in the text).

[0121] The IgM homozygous mice produced in Example 1 were mated with the IgK homozygous mice produced in Example 2 to obtain IgM-IgK heterozygous mice. At the same time, the IgM homozygous mice produced in Example 1 were mated with the IgL homozygous mice produced in Example 3 to obtain IgM-IgL heterozygous mice. Then, the obtained IgM-IgK heterozygous mice were mated with the IgM-IgL heterozygous mice to obtain IgM(+ / +)IgK(+ / -)IgL(+ / -) mice. Finally, the IgM(+ / +)IgK(+ / -)IgL(+ / -) mice were self-crossed to obtain IgM(+ / +)IgK(+ / +)IgL(+ / +) mice, which were named IgM-KL mice.

[0122] Mouse tail genomic DNA is extracted, subjected to PCR amplification, and the amplification product is analyzed by gel electrophoresis to determine the target mouse strain. Primers for identifying IgM, IgK, and IgL gene deletions are simultaneously identified by sequencing, as described in Examples 1, 2, and 3, using homozygous positive mice and heterozygous mice of the corresponding knockout genes as homozygous positive controls (lanes labeled "+") and heterozygous controls (lanes labeled "+ / -"), respectively. Additionally, a wild-type mouse control (lane labeled "-") and a negative control without a DNA template (also called "water control") are set, and the genotype identification results are shown in FIGS. 13A, 13B, and 13C.

[0123] FIGS. 13A, 13B, and 13C show that three gene knockout mice of IgM, IgK, and IgL were successfully obtained by the above process.

[0124] Example 6: Production and identification of triple gene knockout mice of IgA, IgK, and IgL (referred to as "IgA-KL mice" in the text).

[0125] The IgM-KL homozygous mice produced in Example 5 were crossed with the IgA homozygous mice produced in Example 4 to obtain IgA-KL heterozygous mice. Then, the obtained IgA-KL heterozygous mice were self-crossed to obtain IgA(+ / +)IgK(+ / +)IgL(+ / +) mice, which were named IgA-KL mice.

[0126] Mouse tail genomic DNA is extracted, PCR amplification is performed, and the amplified product is subjected to gel electrophoresis analysis to determine the target mouse strain. The primers for identifying IgA and IgK deletions are as described in Example 4 and Example 2, respectively. The primers for identifying IgL deletions are shown in Table 12 below. At the same time, homozygous positive mice of the corresponding knockout genes identified by sequencing are used as homozygous positive controls (lanes labeled "+"), and furthermore, wild-type mouse controls (lanes labeled "-") and negative controls without DNA templates (also called "water controls") are set, and the genotype identification results are shown in FIGS. 14A, 14B, and 14C.

[0127]

Table 12

[0128] Example 7: Production and identification of genetically modified mouse IgM-KL-hIgHD mice of the present invention.

[0129] In this example, six BACs carrying all the antibody gene sequences of human or mouse origin to be introduced (to be introduced) were introduced into the IgM-KL mice produced in Example 5 to produce IgM-KL-hIgHD mice and IgA-KL-hIgHD mice. The six BACs are called CH17-268I9, CTD-3054M17, CTD-2548B8-CZ, RP11-965B13, CH17-185P21-CZ and RP23-351J19-CZ, respectively. Here, four BACs, CH17-268I9, CTD-3054M17, CTD-2548B8-CZ and RP11-965B13, have a total of about 70 V genes. CH17-185P21-CZ contains the complete human D region gene and the J region gene. RP23-351J19-CZ contains mouse-derived IgHG2c (when producing conventional antibodies, it is a complete IgHG2c segment; when producing nanobodies, it is an IgHG2c segment lacking CH1. In this example, the introduced segment is the IgHG2c segment lacking CH1), IgHE, IgHA and the LCR region (35 kb) (detailed information on the genes carried by each BAC is shown in Table 13). The two parts above (that is, between the human-derived J region and the mouse-derived IgHG2c gene) are connected by the Switch region of mouse IgHM.

[0130] Among the six BAC clones used above, CH17-268I9, CTD-3054M17 and RP11-965B13 are the original BAC clone strains purchased from Invitrogen (Shanghai) Trading Co., Ltd. CTD-2548B8-CZ, RCH17-185P21-CZ and RP23-351J19-CZ are the strains obtained after modification based on their respective original BAC clone strains (that is, CTD-2548B8, RCH17-185P21 and RP23-351J19 were also purchased from Invitrogen (Shanghai) Trading Co., Ltd.). The specific modification methods are as follows.

[0131] First, a blank BAC strain was prepared for electroporation competence. First, the pKD46-Tet plasmid (Wuhan Biling Biotechnology Co., Ltd., P7957) was electroporated into the competence. Recombinant fragments to be awaited (shown in SEQ ID NOs: 76-78 respectively) were constructed by the method of OverLap-PCR or enzymatic cleavage and ligation. After preparing the BAC bacteria with the pKD46-Tet plasmid for electroporation competence, the recombinant fragments to be awaited were electroporated into the competence, screened with the corresponding antibiotics, and the positive clones were verified by colony PCR. Finally, BAC was extracted from the bacteria and Fast-NGS sequencing confirmation was performed.

[0132]

Table 13

[0133] The specific process is as follows.

[0134] (1) Six BACs with all the human-derived antibody gene sequences to be introduced were introduced into the IgM-KL mice produced in Example 5. Specifically, first, the BAC plasmid was extracted, then the BAC backbone was cut with the corresponding restrictive endonuclease, purified, the purified BAC genes were mixed in equimolar amounts to prepare an injection solution, and then the injection solution was injected into the male pronucleus of the fertilized egg by pronucleus. Finally, it was transplanted into a surrogate production mouse to obtain F0 generation mice into which the human-derived antibody gene had been transferred. Then, PCR identification was performed on the introduced antibody gene sequence, and the primers used are shown in Table 14.

[0135]

Table 14

[0136] The results are shown in Figure 15.

[0137] The above results indicate that the introduction of all the above genes was successful, that is, this example successfully obtained IgM-KL-hIgHD mice.

[0138] Example 8: Production and identification of genetically modified mouse IgA-KL-hIgHD mice of the present invention.

[0139] In this example, the IgM-KL-hIgHD mice produced in Example 7 were mated with IgA-KL homozygous mice to obtain F1 generation mice that are IgA-KL-hIgHD heterozygous mice. The F1 generation heterozygous mice were mated with each other, and the obtained F2 generation positive homozygous mice are, that is, IgA-KL-hIgHD mice.

[0140] The genotype identification results of the F2 generation IgA-KL-hIgHD mice are shown in Figure 16.

[0141] The above results indicate that the introduction of all the above genes was successful, that is, this example successfully obtained IgA-KL-hIgHD mice.

[0142] Example 9: Phenotype detection of IgM gene-edited mice.

[0143] (1) Antigen immune response and titer detection of IgM homozygous mice: Using OVA (chicken ovalbumin purchased from Beijing Borsi Technology Co., Ltd.) as an antigen, three IgM homozygous mice (manufactured in Example 1) were immunized respectively. The specific process is as follows. Select mice at 6 - 8 weeks of age, add the same volume of Freund's complete adjuvant to the antigen and emulsify it so that it is insoluble in water, then multiple subcutaneous injections can be performed on the mice. The initial immunization injection dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0144] Two weeks after the first immunization, the second immunization was performed subcutaneously. After adding the same volume of Freund's incomplete adjuvant to the antigen and emulsifying it, multiple subcutaneous injections were performed on the mice. The injection dose was reduced to 25 μg / mouse, and the injection volume was 0.2 mL / mouse.

[0145] Blood was collected on days 0, 17, and 24 respectively, coated with goat anti - mouse IgM polyclonal antibody, and the IgM antibody titer in the serum was detected using biotin - labeled antigen and HRP - Streptavidin. The experimental results of the antigen immune titers of the three IgM homozygous mice are shown in Figures 17A, 17B, and 17C respectively.

[0146] As can be seen from Figures 17A - C, after the third immunization of the three IgM homozygous mice with OVA, the IgM antibody titer in the serum increased, but the overall titer was very low.

[0147] (2) Serum Western blotting experiment of IgM gene knockout mice by CRP immunization: According to the product instruction of CNBr - activated SepharoseTM 4B (purchased from GE, product number 17043001), a CRP (i.e., human C - reactive protein purchased from Baiqiao Ruijing) antigen - affinity column material was prepared, and the volume of the CRP - Sepharose packing agent prepared with 1.5 mg CRP antigen was made to be 1.5 mL.

[0148] C57BL / 6 wild-type mice (purchased from Charles River Laboratories) at 6 - 8 weeks of age, IgM heterozygous mice (F1 generation heterozygous mice produced in Example 1), and IgM homozygous mice (F2 generation homozygous mice produced in Example 1) were each immunized with 1 mouse (the immunization process was the same as OVA immunization). On the 7th day after the third immunization, 20 - 50 μL of mouse blood was collected, left to clot at room temperature for about 30 min, and serum was collected after centrifugation. 1 μL of each sample was taken, 100 μL of PBS was added, 10 μL of CRP-Sepharose filler was added, and after reacting at room temperature for 60 min, centrifuged at 6000 rpm for 30 s, and the supernatant was discarded. The filler was washed 3 times with PBS, resuspended in 10 μL of PBS and boiled, electrophoresed on 12% SDS-PAGE, and after blocking the transferred membrane PVDF, reacted with goat anti-mouse IgM antibody (Sigma, ISO2-1KT), and further developed, and the results are shown in Figure 18.

[0149] As can be seen from Figure 18, after immunization with CRP antigen, IgM antibodies specifically reactive to antigen CRP were detected in C57BL / 6 wild-type mice (lane 1), IgM CH1 ko heterozygous mice (lane 2), and IgM CH1 ko homozygous mouse serum (lane 3). Under reducing conditions, the size of the homozygous mouse IgM heavy chain was 60 KD, which was clearly smaller than the wild-type mouse IgM heavy chain of 78 KD, proving that the knockout of the CH1 domain was successful in the IgM mouse strain.

[0150] (III) RT-PCR detection of IgM gene knockout mice by CRP immunization: Spleen cells were collected from IgM homozygous mice after the third immunization with the CRP antigen in (2) above, total RNA was extracted using Trizol, reverse transcribed to obtain cDNA, and the variable region and a part of the CH2 gene connected thereto were amplified using IgM subtype antibody-specific primers. The upstream primer was the MHV1-12 mixed primer, and the downstream primer was IgHM-CH2-R4. The primers used and their sequences are shown in Table 15. Here, the variable bases S, Y, R, W, M, and K are defined in the art. Specifically, S is G or C, Y is C or T, R is A or G, W is A or T, M is A or C, and K is G or T.

[0151]

Table 15

[0152]

Table 16

[0153]

Table 17

[0154] Example 10: Detection of the phenotype of IgA gene-edited mice.

[0155] (1) Antigen immune response and titer detection of IgA homozygous mice: IgA homozygous mice (produced in Example 4) were immunized with CRP (human C-reactive protein) and OVA (chicken ovalbumin) as antigens, respectively. The immunization method is as follows. Select mice at 6 - 8 weeks of age, add an equal volume of Freund's complete adjuvant to the antigen protein, and emulsify it so that it does not dissolve in water, then it can be used for multiple-point subcutaneous injection of mice. The initial immunization injection dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse. After the initial immunization, subsequent subcutaneous immunizations are performed every 2 weeks. After adding an equal volume of Freund's incomplete adjuvant to the antigen protein and emulsifying it, it is injected subcutaneously into mice at multiple points. The injection dose is reduced to 25 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0156] The method for detecting serum titer is as follows: Dilute the antigen protein to 2 μg / mL, put 100 μL into a polystyrene enzyme-linked detection plate for coating, and use Biotin-goat anti-mouse IgA (Abcam, ab97231) to detect specific IgA antibodies that bind to the antigen protein in the serum.

[0157] The results are shown in FIGS. 20A and 20B, which indicate that blood is collected on the 8th day after the third immunization with the antigen protein. The results of serum titer detection by ELISA show that there are almost no IgA antibodies that specifically bind to the antigen protein in the IgA-CH1-KO homozygous mouse body, where the serum titers did not exceed 1:400 in all cases.

[0158] (2) Serum Western blotting experiment of IgA homozygous mice by CRP immunization: According to the product instruction of CNBr-activated SepharoseTM 4B (purchased from GE, product number 17043001), a CRP antigen affinity column material was prepared, and the volume of the CRP-Sepharose packing agent prepared with 1.5 mg of CRP antigen was made 1.5 mL.

[0159] Two C57BL / 6 wild-type mice at 6 - 8 weeks old and one IgA homozygous mouse (produced in Example 4) were immunized with CRP (human C-reactive protein). The immunization process was the same as that in the above-mentioned first part. On the 7th day after the third immunization, 20 - 50 μL of mouse blood was collected, left to clot at room temperature for about 30 min, and serum was collected after centrifugation. 2 μL of serum was taken from each sample, 100 μL of PBS was added, 10 μL of CRP-Sepharose filler was added, and after reacting at room temperature for 60 min, it was centrifuged at 6000 rpm for 30 s, and the supernatant was discarded. The filler was washed 3 times with PBS, resuspended in 10 μL of PBS and boiled, electrophoresed on 12% SDS-PAGE, and after blocking the transferred membrane PVDF, it was reacted with goat anti mouse IgG Fc HRP (JACKSON, 115-035-071) and further developed.

[0160] According to the design of this application, the genes of mouse IgM, IgD, IgG, and IgE were knocked out, and the CH1 gene of the IgA heavy chain was knocked out. Therefore, if IgA mice are immunized with antigen proteins, only IgA heavy chain antibodies (not containing the CH1 domain) will be generated. The molecular weight of a single heavy chain of IgA is about 40 KD. The antibodies produced by C57BL / 6 wild-type mice and IgA homozygous mice after immunization with antigen proteins were separated, electrophoresed, developed, etc., and the results are shown in Figure 21. Figure 21 is a Western blotting of mouse serum under reducing conditions. Here, Lane 1 and Lane 2 are serum samples of C57BL / 6 mice after immunization, and Lane 3 is a serum sample of IgA homozygous mice after immunization. This result shows that the antibodies produced by IgA homozygous mice are as expected, and it is proved that the knockout of the gene sequence from CH1 of mouse genomic IgHM to IgHA-CH1 was successful.

[0161] (III) RT-PCR detection of splenocytes of IgA homozygous mice by CRP immunization: Spleen cells of IgA homozygous mice after the third immunization with CRP antigen in (2) above were collected, total RNA was extracted with Trizol, reverse transcribed to obtain cDNA, and the variable region and a part of the CH2 gene connected thereto were amplified using IgA subtype antibody-specific primers. The upstream primer was the MHV1-12 mixed primer (the sequences of each primer are shown in Table 15 above), and the downstream primer was IgHA-CH2-R3 (its sequence is CTGCATCCTTCCCAGTGGAG, i.e., SEQ ID NO: 61).

[0162] The PCR reaction system is shown in Table 16 above (except that the downstream primer is different).

[0163] The PCR reaction process is the same as that in Table 17 above.

[0164] The PCR amplification product was ligated to the pEASY (registered trademark)-Blunt Zero Cloning vector, transformed into TOP10 strains, plated (ampicillin resistant), four clones were collected for colony PCR, and the results are shown in Figure 22A. These four positive clones were sequenced, and some of the sequencing results are shown in Figure 22B. As can be seen from this part of the sequencing results, the FR4 of the IgA heavy chain variable region expressed in IgA homozygous mice is directly connected to CH2 (starting amino acid sequence GPPPPCPPCPP, SEQ ID NO: 75), suggesting that the gene sequence between CH1 of mouse genomic IgHM and IgHA-CH1 was successfully knocked out.

[0165] Example 11: Phenotype detection of IgM-KL&IgA-KL homozygous mice.

[0166] (1) Antigen immune reaction and titer detection of IgM-KL&IgA-KL homozygous mice: Wild-type C57BL / 6, IgM-KL homozygous mice (manufactured in Example 5), IgA homozygous mice (manufactured in Example 4, used as a control), and IgA-KL (manufactured in Example 6) homozygous gene knockout mice were immunized with OVA (chicken egg white albumin) respectively. The specific process is as follows. Select 6- to 8-week-old mice. Add the same volume of Freund's complete adjuvant to the antigen and emulsify it so that it is insoluble in water. Then, multiple subcutaneous injections can be performed on the mice. The initial immunization dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0167] Two weeks after the initial immunization, perform the second immunization subcutaneously. After adding the same volume of Freund's incomplete adjuvant to the antigen and emulsifying it, perform multiple subcutaneous injections on the mice. Reduce the injection dose to 25 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0168] The method for detecting serum titer is as follows. Dilute the antigen protein to 2 μg / mL, put 100 μL into a polystyrene enzyme-linked detection plate for coating. For IgM-KL mice, use goat anti-mouse IgM antibody (Sigma, ISO2-1KT), and for IgA-KL mice, use Biotin-goat anti-mouse IgA (Abcam, ab97231) to detect the specific IgA antibody that binds to the antigen protein in the serum.

[0169] The results are shown in Figures 23A and 23B, which indicate that blood is collected on the 8th day after the third immunization with the antigen protein. The results of serum titer detection by ELISA show that almost no antibodies specifically binding to the antigen protein appear in the bodies of IgM-KL and IgA-KL homozygous mice. Here, neither serum titer exceeded 1:400.

[0170] (2) Serum Western blotting experiment of IgM-KL&IgA-KL homozygous mice by OVA immunization: After the third immunization with OVA, collect the sera of four types of mice, namely IgM, IgM-KL, IgA, and IgA-KL, and perform Coomassie Brilliant Blue staining to examine the protein abundance. The results are shown in Figure 24A.

[0171] In the tests of each group, the amount of serum sample was 0.5 μL for all. After boiling and denaturing, the samples were attached to a 12% SDS-PAGE gel for electrophoresis. After blocking the transferred membrane PVDF, the light chain protein expression status in the mouse serum was detected using the goat anti-mouse Kappa polyclonal antibody (HRP*Polyclonal Goat Anti-Mouse Kappa, C030214) and the goat anti-mouse Lamda polyclonal antibody (HRP*Polyclonal Goat Anti-Mouse Lamda, C030213) of Shanghai Rai Biotechnology Co., Ltd. The results are shown in Figures 24B and 24C.

[0172] As can be seen from Figures 24B and 24C, after antigen immunization, Kappa and Lamda antibodies that specifically react with antigen OVA were detected in both IgM (lane 1) and IgA mice (lane 3), while no Kappa and Lamda antibodies that specifically react with antigen OVA were detected in IgM-KL (lane 2) and IgA-KL mice (lane 4), proving that the knockout of the light chain protein in IgM-KL and IgA-KL mice is complete.

[0173] Example 12: Phenotype detection of IgM-KL-hIgHD homozygous mice.

[0174] (I) Antigen immune response and titer detection of IgM-KL-hIgHD homozygous mice: IgM-KL-hIgHD homozygous mice were immunized with the GCC-mFc protein. Mice aged 6 - 8 weeks were selected. If the same volume of Freund's complete adjuvant was added to the antigen and emulsified so that it was insoluble in water, multiple-point subcutaneous injection of mice could be performed. The initial immunization injection dose was 100 μg / mouse, and the injection volume was 200 μL / mouse.

[0175] Two weeks after the first immunization, the second immunization was performed subcutaneously. After adding the same volume of Freund's incomplete adjuvant to the antigen and emulsifying it, multiple-point injection was carried out subcutaneously in mice. The injection dose was reduced to 50 μg / mouse, and the injection volume was 200 μL / mouse. The specific immunization plan is shown in Table 18.

[0176]

Table 18

[0177] The results are shown in Figure 25. Blood was collected on the 7th day after the 5th immunization with the antigen protein. As can be seen from the serum titer detection by ELISA, antibodies that specifically bind to the antigen protein appeared in the IgM-KL-hIgHD homozygous mice, and here, all the serum titers exceeded 1:24000.

[0178] (2) Serum Western blotting experiment of IgM-KL-hIgHD homozygous mice by GCC-mFc immunization: After the 5th immunization with GCC-mFc, sera of IgM-KL-hIgHD (#3492, #3493, #3304) and non-immunized C57BL / 6 mice (#3347) were collected for Western experiments, aiming to verify whether there is antibody expression of only human-mouse chimeric heavy chains in IgM-KL-hIgHD homozygous mice.

[0179] In the tests of each group, the amount of the serum sample was 0.5 μL for all. After boiling and denaturing, the sample was attached to a 12% SDS-PAGE gel for electrophoresis. After blocking the transfer membrane PVDF, goat anti mouse IgG Fc HRP (JACKSON, 115-035-071) was used to detect the expression status of the human-mouse chimeric nanobody protein in the above mouse serum. The results are shown in Figure 26.

[0180] As can be seen from Figure 26, for IgM-KL-hIgHD (#3492, #3493, #3304) by immunization with GCC-mFc antigen, human-mouse chimeric nanobodies that specifically react with the antigen GCC-mFc were detected in all. For non-immunized C57BL / 6 mice (#3347), mouse complete antibody proteins were detected, proving that there is antibody expression of only human-mouse chimeric heavy chains in IgM-KL-hIgHD mice.

[0181] (III) V(D)J rearrangement of human variable region genes in IgM-KL-hIgHD homozygous mice: 1) Analyze the gene sequences of the heavy chain variable regions in mice by NGS sequencing. Select one non-immunized and one IgM-KL-hIgHD homozygous mouse immunized with GCC-mFc. Collect the spleen cells of the mice respectively, which are used for extracting RNA, and then reverse-transcribe the RNA into cDNA with a reverse transcription reagent cassette (Takara, 6110A). Combine 10 primers of human-derived V genes and 3 specific primers of human-derived J genes respectively, perform PCR amplification using the cDNA of the sample as a template to obtain heavy chain variable region sequence fragments, and then sequence them. The human-derived gene-specific primer sequences are shown in Table 19.

[0182]

Table 19

[0183] Next, the PCR products were subjected to NGS sequencing.

[0184] 2) Analysis of NGS sequencing results, The sequencing results and human immunoglobulin sequences were analyzed by bioinformatics techniques to identify the expression of human VH, DH, and JH genes after V(D)J recombination. Among the 1,323,424 valid sequencing Reads of the IgM-KL-hIgHD naive mouse samples, as a result, the expression of most VH gene segments, all DH genes, and all JH gene fragments (Table 20) was detected. Among these gene segments, there are some VH genes located near a certain region and some VH genes far from a certain region. From the data results in Table 20, it was found that the human VH, DH, and JH genes on the human-mouse chimeric nanobody gene transferred in the hIgHD scheme can be rearranged and expressed in IgM-KL background mice.

Table 20

[0185]

Table 21

[0186] Example 13: Detection of the phenotype of IgA-KL-hIgHD homozygous mice.

[0187] (1) Antigen immune response and titer detection of IgA-KL-hIgHD homozygous mice: Immunize IgA-KL-hIgHD homozygous mice and IgA-KL mice with CD93 protein. Select mice at 6 - 8 weeks of age. Add the same volume of Freund's complete adjuvant to the antigen and emulsify it so that water is insoluble, then multiple subcutaneous injections into mice can be performed. The initial immunization injection dose is 100 μg / mouse, and the injection volume is 200 μL / mouse.

[0188] Two weeks after the first immunization, perform the second immunization subcutaneously. After adding the same volume of Freund's incomplete adjuvant to the antigen and emulsifying it, perform multiple subcutaneous injections into mice. Reduce the injection dose to 50 μg / mouse, and the injection volume is 200 μL / mouse. The specific immunization plan is shown in Table 22.

[0189]

Table 22

[0190] As shown in Figure 28, blood was collected on the 7th day after the 5th immunization of the antigen protein. As can be seen from the detection of serum titer by ELISA, antibodies that specifically bind to the antigen protein appeared in the IgA-KL-hIgHD homozygous mice, where the serum titers all exceeded 1:72000. However, there was no immune titer in the IgA-KL background mice, suggesting that all the antibodies that appeared in the IgA-KL-hIgHD mice were produced by the expression of the human-derived antibody gene sequence hIgHD transferred.

[0191] (2) Serum Western blotting experiment of immunized IgA-KL-hIgHD homozygous mice with CD93: Serum from IgA-KL-hIgHD (#3756, #3577), IgA-KL (#3702, #3706) and non-immunized C57BL / 6 mice (#10252) after the 5th immunization was collected using CD93 for Western experiments, aiming to verify whether there is human-mouse chimeric nanobody expression in IgA-KL-hIgHD homozygous mice.

[0192] In each group of tests, the amount of serum sample was 0.2 μL. After boiling and denaturing, the sample was attached to a 12% SDS-PAGE gel for electrophoresis. After blocking the transmembrane PVDF, goat anti-mouse IgG Fc HRP (JACKSON, 115-035-071) was used to detect the expression status of human-mouse chimeric nanobody protein in the above mouse sera. The results are shown in Figure 29.

[0193] As can be seen from Fig. 29, human-mouse chimeric nanobodies were detected in both IgA-KL-hIgHD (#3756, #3577) after immunization with the CD93 antigen. No IgG antibodies were detected in IgA-KL (#3702, #3706) after immunization with the CD93 antigen. Mouse complete antibody proteins were detected in non-immunized C57BL / 6 mice (#10252). It was demonstrated that human-mouse chimeric nanobody expression occurred in IgA-KL-hIgHD mice.

[0194] (III) V(D)J rearrangement of human variable region genes in IgA-KL-hIgHD homozygous mice: 1) Analyze the gene sequences of the heavy chain variable regions in mice by NGS sequencing. Select one non-immunized and one CD93-immunized IgA-KL-hIgHD homozygous mouse, collect the spleen cells of the mice respectively, and use them for RNA extraction. Then, reverse transcribe the RNA into cDNA with a reverse transcription reagent cassette (Takara, 6110A). Combine 10 primers of human-derived V genes and 3 specific primers of human-derived J genes respectively, perform PCR amplification using the cDNA of the sample as a template to obtain a heavy chain variable region sequence fragment, and then sequence it. The human-derived gene-specific primer sequences are shown in Table 19 above.

[0195] Since the PCR products of the two samples require NGS sequencing and data analysis, it is necessary to add a barcode sequence specific to the 5' end of the primers in Table 19. Therefore, ACAGAG is added to the 5' end of the F primer used for IgA-KL-hIgHD naive mice, AGACTG is added to the 5' end of the R primer, AGTGCT is added to the 5' end of the F primer used for IgA-KL-hIgHD immunized mice, and TCCGGA is added to the 5' end of the R primer. The samples of IgA-KL-hIgHD were PCR amplified with the primers added with the barcode sequence respectively, and the PCR amplification products were subjected to agarose gel electrophoresis. As shown in Figures 30A and 30B, they represent the PCR products of the IgA-KL-hIgHD naive samples and the PCR products of the IgA-KL-hIgHD immunized samples respectively.

[0196] Next, the PCR products were subjected to NGS sequencing.

[0197] 2) Analysis of NGS sequencing results, The sequencing results and the human immunoglobulin sequences were analyzed by bioinformatics techniques to identify the expression of human VH, DH, and JH genes after V(D)J recombination. Among the 895,880 valid sequencing Reads of the IgA-KL-hIgHD naive mouse samples, as a result, the expression of most VH gene segments, all DH genes, and all JH gene fragments (Table 23) was detected. Among these gene segments, there are some VH genes located near a certain region and some VH genes far from a certain region. From the data results in Table 23, it was found that the human VH, DH, and JH genes on the human-mouse chimeric nanobody gene transferred in the hIgHD scheme can be rearranged and expressed in IgM-KL background mice.

Table 23

Table 24

[0198] Finally, it should be noted that the above examples are for explaining the technical solutions of the present invention, but not for limiting it. Although the present invention has been described in detail with reference to the above examples, those skilled in the art can still modify the technical solutions described in each of the above examples, or equivalently replace some of their technical features. However, it is understood that these modifications or replacements do not deviate from the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the present invention.

Claims

1. A method for producing a genetically modified non-human mammal, comprising the step of disrupting the endogenous heavy chain immunoglobulin locus in the non-human mammal. The production method is characterized in that it includes the step of disrupting the endogenous heavy chain immunoglobulin locus in the non-human mammal.

2. The non-human mammal is a mouse, and the disruption of the endogenous heavy chain immunoglobulin locus includes deletion of the gene fragment of the CH1 fragment of the mouse antibody gene heavy chain IgHM, deletion of the gene fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ. Preferably, the gene fragment is deleted by the CRISPR-Cas9 gene editing technique. Here, the sgRNAs for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM include the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2, and / or the sgRNAs for deleting the mouse antibody gene light chain Igkc include the sgRNA shown in SEQ ID NO: 3, and / or the sgRNAs for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ include the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO:

5. The production method according to claim 1 is characterized by this.

3. The non-human mammal is a mouse, and the disruption of the endogenous heavy chain immunoglobulin locus includes deletion of the gene fragment of the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain, deletion of the gene fragment of the mouse antibody gene light chain Igkc, and deletion of the gene fragment of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ. Preferably, the gene fragment is deleted by the CRISPR-Cas9 gene editing technique. Here, the sgRNAs for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain include the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 6, and / or the sgRNAs for deleting the mouse antibody gene light chain Igkc include the sgRNA shown in SEQ ID NO: 3, and / or the sgRNAs for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ include the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO:

5. The production method according to claim 1 is characterized by this.

4. A method for producing a genetically modified non-human mammal, comprising According to the production method according to any one of claims 1 to 3, step (1) of producing a non-human mammal I to be genetically modified, step (2) of introducing a human-derived IGHV gene, a human-derived IGH D gene, a human-derived IGH J gene, and an endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of a non-human mammal into the genetically modified non-human mammal I obtained in step (1), characterized in that the production method comprises:

5. The non-human mammal is a mouse, and in step (2), The human-derived IGHV gene is at least The human-derived IGHV gene includes 18 types of human-derived IGHV genes such as hIGHV4-59, hIGHV3-53, hIGHV5-51, hIGHV3-49, hIGHV3-48, hIGHV1-46, hIGHV3-43, hIGHV4-39, hIGHV3-33, hIGHV4-30-2, hIGHV1-24, hIGHV3-23, hIGHV3-21, hIGHV3-11, hIGHV3-7, hIGHV4-4, hIGHV1-2, hIGHV6-1. Optionally, it further includes 1 type, a plurality of types, or all of the human-derived IGHV genes selected from hIGHV1-58, hIGHV1-45, hIGHV3-35, hIGHV4-28, hIGHV2-26, hIGHV3-20, hIGHV1-18, hIGHV3-15, hIGHV3-13, hIGHV5-10-1, hIGHV3-64D, hIGHV2-5, hIGHV7-4-1, hIGHV1-3. Further optionally, it further includes 1 type, a plurality of types, or all of the human-derived IGHV genes selected from hIGHV3-60, hIGHV3-57, hIGHV7-56, hIGHV4-55, hIGHV3-54, hIGHV3-52, hIGHV3-50, hIGHV3-47, hIGHV3-42, hIGHV3-41, hIGHV3-38, hIGHV3-37, hIGHV3-36, hIGHV7-34-1, hIGHV4-34, hIGHV3-33-2, hIGHV3-32, hIGHV3-30-2, hIGHV3-30, hIGHV3-29, hIGHV7-27, hIGHV3-25, hIGHV3-22, hIGHV3-19, hIGHV1-17, hIGHV3-16, hIGHV1-14, hIGHV1-12, hIGHV3-6. and / or, the human-derived IGH D gene is at least IGHD1-1, IGHD3-3, IGHD6-6, IGHD1-7, IGHD3-10, IGHD6-13, IGHD1-14, IGHD2-15, IGHD3-16, IGHD5-18, IGHD6-19, IGHD1-20, IGHD3-22, IGHD1-26, IGHD7-27, including 15 human-derived IGH D genes, and optionally, one, a plurality, or all of the human-derived IGH D genes selected from IGHD2-2, IGHD2-8, IGHD3-9, IGHD3-10, IGHD4-11, IGHD5-12, IGHD3-16, IGHD4-17, IGHD2-21, IGHD4-23, IGHD5-24, IGHD6-25, and further optionally, one, a plurality, or all of the human-derived IGH D genes selected from IGHD3-3, IGHD3-10, IGHD3-16, IGHD5-18 and / or, the human-derived IGH J gene is all human-derived IGH J genes and / or, the endogenous IgHG2c gene of the non-human mammal is the endogenous complete IgHG2c gene of the non-human mammal or an endogenous IgHG2c gene segment lacking the CH1 domain. The production method according to claim 4, characterized in that

6. In step (2), In the mouse obtained in step (1), (I) n BAC clones in total containing all of the human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene, where n is an integer between 3 and 8, preferably, n is an integer between 4 and 7, more preferably, n is 4, and there are gene homologous sequences of 5 kb to 50 kb at the head and tail between the n BAC clones so as to perform gene splicing through homologous gene sequences, and (II) one or more BAC clones containing the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal, and introducing the human-derived IGHV gene, human-derived IGHD gene, human-derived IGHJ gene, and the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal by this method. The production method according to claim 5, characterized in that

7. In step (2), The human-derived IGHV gene, human-derived IGHD gene, human-derived IGHJ gene, and endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of a non-human mammal are introduced into the mouse obtained in step (1) by a method of introducing six BAC clones. The six BAC clones are (i) four BAC clones that collectively contain all of the human-derived IGHV genes, (ii) one BAC clone that contains all human-derived IGHD genes and all human-derived IGHJ genes, (iii) one BAC clone that contains the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal, and here, there are gene homologous sequences of 5 kb to 50 kb at the head and tail with each other between the BAC clones in (i) and between the BAC clone in (i) and the BAC clone in (ii) so as to ligate the genes by overlapping gene sequences. Preferably, there are gene homologous sequences of 5 kb to 20 kb at the head and tail with each other between the BAC clones in (i) and between the BAC clone in (i) and the BAC clone in (ii). Preferably, the genes contained in the six BAC clones are shown in the following table. Here, "mIgHG2c-CH1" represents the mIgHG2c gene sequence from which the CH1 segment has been removed. The production method according to claim 6, characterized in that.

8. The human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene are operably connected, and VDJ rearrangement is possible. And the human-derived IGHV gene, human-derived IGHD gene, and human-derived IGHJ gene that are operably connected and / or VDJ rearranged are operably connected to the endogenous IgHG2c gene, IgHE gene, IgHA gene, and LCR region of a non-human mammal. And / or, there is an endogenous Switch region of IgHM of a human mammal between the human-derived IGHJ gene and the endogenous IgHG2c gene of a non-human mammal. The production method according to claim 7, characterized in that.

9. A method for producing a humanized whole antibody or an antibody consisting of only a heavy chain or a nanobody that specifically binds to an antigen, Step (1) of exposing a genetically modified non-human mammal produced by the production method according to any one of claims 4 to 8 to an antigen. Collect B cells from the non-human mammal obtained in step (1), extract RNA, reverse transcribe it into cDNA, amplify the antibody gene fragment using the cDNA as a template, and clone the antibody gene fragment into a phage display vector (step (2)); Express the target antibody in the phage vector obtained in step (2), wash the phage, concentrate the phage expressing the target antibody, and express it. The obtained target antibody is a humanized whole antibody or an antibody consisting only of a heavy chain (step (3)); Optionally, cloning the variable region fragment of the obtained antibody consisting only of a heavy chain to obtain a humanized nanobody (step (4)). A method comprising the steps. [

10. ] A method for producing a humanized whole antibody, an antibody consisting only of a heavy chain, or a nanobody that specifically binds to an antigen, After exposing a genetically modified non-human mammal produced by the production method according to any one of claims 4 to 8 to the antigen, collecting B cells (step (1)); Sequencing the nucleic acid encoding the immunoglobulin heavy chain variable region and optionally the light chain variable region in the B cells collected in step (1) to obtain the nucleic acid sequences of the heavy chain variable region and the light chain variable region of the humanized monoclonal antibody or the nucleic acid sequence of the heavy chain variable region of the humanized nanobody (step (2)); Based on the sequence obtained in step (2), expressing a humanized whole antibody or an antibody consisting only of a heavy chain that specifically binds to the antigen (step (3)); Optionally, cloning the variable region fragment of the obtained antibody consisting only of a heavy chain to obtain a humanized nanobody (step (4)). A method comprising the steps. [

11. ] An sgRNA composition comprising an sgRNA for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM, an sgRNA for deleting the mouse antibody gene light chain Igkc, and an sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ. Preferably, the sgRNA for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM comprises the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2, and / or the sgRNA for deleting the mouse antibody gene light chain Igkc comprises the sgRNA shown in SEQ ID NO: 3, and / or the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ comprises the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO:

5. An sgRNA composition characterized by this.

12. An sgRNA composition comprising an sgRNA for deleting a fragment between IgHM and IgHA-CH1 of the heavy chain of a mouse antibody gene, an sgRNA for deleting the mouse antibody gene light chain Igkc, and an sgRNA for deleting a fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ, preferably, the sgRNA for deleting a fragment between IgHM and IgHA-CH1 of the heavy chain of the mouse antibody gene comprises the sgRNAs shown in SEQ ID NO: 1 and SEQ ID NO: 6, and / or the sgRNA for deleting the mouse antibody gene light chain Igkc comprises the sgRNA shown in SEQ ID NO: 3, and / or the sgRNA for deleting a fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ comprises the sgRNAs shown in SEQ ID NO: 4 and SEQ ID NO: 5, an sgRNA composition characterized by this.

13. A CRISPR-Cas9 gene editing system comprising the sgRNA composition according to claim 11 or 12 and a Cas9 protein, a CRISPR-Cas9 gene editing system characterized by this.

14. A gene knockout vector comprising a DNA sequence encoding the sgRNA in the sgRNA composition according to claim 11 or 12, a gene knockout vector characterized by this.

15. A mouse embryonic stem cell comprising the gene knockout vector according to claim 14, a mouse embryonic stem cell characterized by this.

Images