Chimeric polypeptides and uses thereof
Chimeric polypeptides with a sortilin receptor ligand improve the biodistribution and uptake of therapeutic peptides in lysosomal storage diseases, addressing limitations in current treatments by enhancing stability and targeting to CNS tissues.
Patent Information
- Application Number
- JP2025081436
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-10-22
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-13
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current treatments for lysosomal storage diseases, such as Pompe disease, face challenges with poor protein biodistribution and limited tissue uptake of therapeutic polypeptides, necessitating frequent infusions and lacking effective targeting to the central nervous system.
Development of chimeric polypeptides comprising a peptide of interest, such as lysosomal acid alpha-glucosidase (GAA), fused with a ligand for the sortilin receptor, to enhance stability and uptake in target tissues like the brain and spinal cord, using nucleic acid molecules and vectors like AAV for delivery.
The chimeric polypeptides demonstrate improved activity and stability in plasma, enhanced uptake by target tissues, and reduced immunogenicity, offering a more effective treatment approach for lysosomal storage diseases.
Smart Images

Figure 2025118870000001 
Figure 2025118870000002 
Figure 2025118870000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to nucleic acid molecules encoding chimeric polypeptides comprising a peptide of interest fused to one or more heterologous moieties, at least one of which is a ligand for a sortilin receptor. [Background technology]
[0002] Some treatments are based on the administration of a therapeutic polypeptide or a gene therapy vector expressing a therapeutic polypeptide. The polypeptide may be intended to circulate in the bloodstream to reach the target tissue. In this case, it is desirable to improve the properties of the therapeutic peptide in order to enhance its activity. For example, it may be beneficial to improve the stability of the therapeutic polypeptide in the plasma compartment or to promote the uptake of the circulating polypeptide by the target tissue where the therapeutic polypeptide is intended to exert its therapeutic activity.
[0003] Such circulating polypeptides include the lysosomal enzyme acid alpha-glucosidase (GAA) polypeptide. Specifically, in the context of Pompe disease, it is desirable to improve the activity of therapeutically administered GAA polypeptides. Pompe disease, also known as glycogen storage disease (GSD) type II and acid maltase deficiency, is an autosomal recessive metabolic muscle disorder caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase. GAA is an exo-1,4 and 1,6-α-glucosidase that hydrolyzes glycogen to glucose in lysosomes. GAA deficiency leads to glycogen accumulation in lysosomes, causing progressive damage to respiratory, cardiac, and skeletal muscles. The disease ranges from a rapidly progressive infantile course that is usually fatal by age 1–2 years to a more slowly progressing heterogeneous course that causes significant morbidity and early death in children and adults. Hirschhorn RR, The Metabolic and Molecular Bases of Inherited Disease, 3: 3389-3420 (2001, McGraw-Hill); Van der Ploeg and Reuser, Lancet 372: 1342-1351 (2008).
[0004] Current human therapies for treating Pompe disease involve the administration of recombinant human GAA, otherwise known as enzyme replacement therapy (ERT). ERT has demonstrated efficacy for severe infantile GSD II. However, the benefits of enzyme therapy are limited by poor protein biodistribution after peripheral intravenous delivery, lack of uptake by some tissues, and the need for frequent infusions.
[0005] The feasibility of gene therapy approaches to treat GSD-II as an alternative or adjunct to ERT is being investigated (Amalfitano, A. et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866; Ding, E. et al., (2002) Mol. Ther. 5:436-446; Fraites, TJ et al., (2002) Mol. Ther. 5:571-578; Tsujino, S. et al., (1998) Hum. Gene Ther. 9:1609-1616).
[0006] Modified GAA proteins have also been proposed in the past to improve the treatment of lysosomal storage diseases. Specifically, International Publication No. 2004064750 and Sun et al. 2006 disclose chimeric GAA polypeptides comprising a signal peptide operably linked to GAA as a means of enhancing targeting of proteins to the secretory pathway. International Publication Nos. 2018 / 046772, 2018 / 046775, and WO2018 / 046774 provide GAA variants to improve current gene replacement therapy for Pompe disease. These patent applications disclose GAA variants that have been shown to be more secreted and less immunogenic than their wild-type counterparts.
[0007] Further improvements to the GAA are described herein. [Prior art documents] [Patent documents]
[0008] [Patent Document 1] International Publication No. 2004064750 [Patent Document 2] International Publication No. 2018 / 046772 [Patent Document 3] International Publication No. 2018 / 046775 [Patent Document 4] International Publication No. 2018 / 046774 [Patent Document 5] International Patent Application No. PCT / EP2019 / 053061 [Patent Document 6] European Patent No. EP19 305455.8 [Patent Document 7] International Publication No. 2015 / 162302 [Patent Document 8] International Publication No. 2015013313 [Patent Document 9] International Publication No. 2015196179 [Patent Document 10] International Publication No. 2005 / 118792 [Non-patent literature]
[0009] [Non-Patent Document 1] Hirschhorn RR, The Metabolic and Molecular Bases of Inherited Disease, 3: 3389-3420 (2001, McGraw-Hill) [Non-patent document 2] Van der Ploeg and Reuser, Lancet 372: 1342-1351 (2008) [Non-patent document 3] Amalfitano, A. et al. (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866 [Non-patent document 4] Ding, E. et al. (2002) Mol. Ther. 5:436-446 [Non-Patent Document 5] Fraites, TJ et al. (2002) Mol. Ther. 5:571-578 [Non-patent document 6] Tsujino, S. et al. (1998) Hum. Gene Ther. 9:1609-1616 [Non-Patent Document 7] Hoefsloot et al. (1988) EMBO J. 7: 1697 [Non-patent document 8] Martiniuk, (1990) DNA and Cell Biology 9: 85
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
Non-licensed Document 12
Non-licensed Document 13
Non-licensed Document 14
Non-licensed Document 15
Non-licensed Document 16
Non-licensed Document 17
Non-licensed Document 18
Non-licensed Document 19
Non-licensed Document 20
Non-licensed Document 21
Non-licensed Document 22
Non-licensed Document 23
Non-licensed Document 24
Non-licensed Document 25
Non-licensed Document 26
Non-licensed Document 27
Non-licensed Document 28
Non-licensed Document 29
Non-patent document 30
Non-patent document 31
Non-patent document 32
Non-patent document 33
Non-patent document 34
Non-patented document 35
Non-patent document 36
Non-patent document 37
Non-patent document 38
Non-patent document 39
Non-patent document 40
Non-patent document 41
Non-patent document 42
[0010] The present invention relates to nucleic acid molecules encoding chimeric polypeptides comprising a peptide of interest fused to one or more heterologous moieties, at least one of which is a ligand for a sortilin receptor. [Means for solving the problem]
[0011] In a specific embodiment, the chimeric polypeptide comprises a peptide of interest fused to one heterologous moiety that is a ligand for a sortilin receptor.
[0012] In a specific embodiment, the ligand of the sortilin receptor is - a spargin peptide encoded by the nucleotide sequence of SEQ ID NO: 14 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity to the nucleotide sequence of SEQ ID NO: 14, - a neurotensin peptide encoded by the nucleotide sequence of SEQ ID NO: 15 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to the nucleotide sequence of SEQ ID NO: 15, or - a fragment of the neurotensin peptide encoded by the nucleotide sequence of SEQ ID NO: 16 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to the nucleotide sequence of SEQ ID NO: 16. is selected from.
[0013] In a specific embodiment, the ligand of the sortilin receptor is a spasdin peptide encoded by a nucleotide sequence comprising or consisting of SEQ ID NO:14.
[0014] In a specific embodiment, the peptide of interest is a functional GAA polypeptide that can be encoded by a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-3, or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-3.
[0015] In a specific embodiment, the peptide of interest is a functional GAA polypeptide corresponding to a truncated form of GAA. Specifically, the functional GAA polypeptide may be truncated at its N-terminus by 42 consecutive amino acids compared to GAA. In a specific embodiment, the truncated GAA is encoded by the nucleotide sequence of SEQ ID NO: 10 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to the nucleotide sequence of SEQ ID NO: 10.
[0016] In a specific embodiment, the heterologous moiety is fused to the N-terminus of the peptide of interest.
[0017] In a specific embodiment, the nucleic acid molecule of the present invention further comprises a signal peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 18 to 22, preferably SEQ ID NO: 21.
[0018] The present invention also relates to a nucleic acid construct comprising the above-described nucleic acid molecule operably linked to a promoter, which may optionally further comprise an intron. In a specific embodiment, the nucleic acid construct may comprise a promoter, an intron, the above-described nucleic acid molecule, and a polyadenylation signal, preferably in this order.
[0019] The present invention also relates to a vector, such as a viral vector, preferably a retroviral vector, such as a lentiviral vector, or an AAV vector, comprising the nucleic acid molecule or nucleic acid construct of the present invention. Specifically, the vector is a single-stranded or double-stranded self-complementary AAV vector, preferably a capsid derived from AAV, such as an AAV1 capsid, an AAV2 capsid, a variant AAV2 capsid, an AAV3 capsid, a variant AAV3 capsid, an AAV3B capsid, a variant AAV3B capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, a variant AAV6 capsid, an AAV7 capsid, The AAV vector may have an AAV8 capsid, an AAV9 capsid, an AAV10 capsid, such as an AAVcy10 capsid and an AAVrh10 capsid, an AAVrh74 capsid, an AAVdj capsid, an AAVAnc80 capsid, an AAV-LK03 capsid, an AAV2i8 capsid, and a porcine AAV capsid, such as an AAVpo4 capsid and an AAVpo6 capsid, or a chimeric capsid. In a specific embodiment, the AAV vector has an AAV8, AAV9, AAVrh74, or AAV2i8 capsid, specifically an AAV8, AAV9, or AAVrh74 capsid, more specifically an AAV8 capsid.
[0020] The present invention also relates to an isolated cell transformed with the above-mentioned nucleic acid molecule, nucleic acid construct or vector.
[0021] Additionally, chimeric polypeptides encoded by the nucleic acid molecules of the present invention are described herein.
[0022] The present invention further relates to a pharmaceutical composition comprising the above-described nucleic acid molecule, nucleic acid construct, vector, isolated cell, or chimeric polypeptide in a pharmaceutically acceptable carrier.
[0023] Also described are the above-mentioned nucleic acid molecules, nucleic acid constructs, vectors, isolated cells, or chimeric polypeptides for use as pharmaceuticals. In specific embodiments, the above-mentioned nucleic acid molecules, nucleic acid constructs, vectors, isolated cells, or chimeric polypeptides are for use in methods for treating lysosomal storage diseases, such as glycogen storage disease (GSD), mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II), metachromatic leukodystrophy (MLD), or mucopolysaccharidosis type VI (MPS VI), specifically for treating GSD II (Pompe disease). [Brief explanation of the drawings]
[0024] [Figure 1] 1 shows a schematic diagram of an expression cassette encoding a chimeric GAA variant of the present invention. The heterologous domain (HD) was cloned into the N-terminus of GAA. ITR: inverted terminal repeat from AAV2; Promoter: ApoE enhancer (ApoE) and hepatocyte-specific human alpha1-antitrypsin promoter (hAAT); Intron: optimized human hemoglobin β-subunit synthesis intron (HBB2.1) and signal peptide (sp7) from human chymotrypsinogen; HD: heterologous domain; GAAco: codon-optimized GAA; PolyA: human bovine growth hormone polyadenylation sequence; ApoB: apolipoprotein B domain; ApoE: apolipoprotein E domain; Spasdin: spasdin peptide; NT1-13: neurotensin amino acids 1-13; NT9-13: neurotensin amino acids 9-13; Linker: 3-amino acid linker. [Figure 2]Figure 1 shows the expression of chimeric GAA variants of the present invention in human hepatocyte cultures. Analysis of HuH7 lysates 72 hours after transfection with plasmids encoding the chimeric GAA variants sp7-ApoB-Δ42-GAAco (HD-ApoB), sp7-ApoE-Δ42-GAAco (HD-ApoE), sp7-spardin-Δ42-GAAco (HD-spardin), sp7-neurotensin 1-13-Δ42-GAAco (HD-NT1-13), and sp7-neurotensin 9-13-Δ42-GAAco (HD-NT1-9-13). The GAA variant sp7-Δ42-GAAco (HD0), lacking the heterologous domain, was used for comparison. CTRL: control cells transfected with a plasmid encoding enhanced green fluorescent protein, used as a negative control. Transfections were repeated in three independent experiments. For each replicate, GAA data were expressed as relative amounts compared to HD0 (HD0 = 100%). Data are shown as the mean ± standard deviation of the mean (SD) of three independent experiments. Statistical analysis: one-way ANOVA with Tukey's post-hoc test. *p<0.05. [Figure 3] Figure 1 shows the activity of GAA variants of the present invention in the plasma of Gaa- / - mice after AAV liver gene transfer. Analysis of GAA activity in the plasma of Gaa- / - mice measured 4 months after intravenous administration of an AAV8 vector encoding a chimeric GAA variant (AAV, n = 6 mice / group, vector dose: 5 x 1011 vg / kg); PBS-treated mice were used as a negative control (Ctrl n = 6 mice); HD-ApoB: sp7-ApoB-Δ42-GAAco, HD-Spardin: sp7-Spardin-Δ42-GAAco, HD0: sp7-Δ42-GAAco. Data are presented as mean ± standard deviation. Statistical analysis: One-way ANOVA with Tukey's post hoc multiple comparisons, "All groups vs. all, time point independent." Asterisks (*) and hashtags (#) indicate significant differences, as indicated in the legend. *p<0.05. [Figure 4]Figure 1 shows secretion of GAA variants of the present invention in the plasma of Gaa- / - mice after AAV liver gene transfer. Analysis of GAA secretion in the plasma of Gaa- / - mice measured 4 months after intravenous administration of AAV8 vectors encoding chimeric GAA variants (AAV, n = 6 mice / cohort, vector dose: 5 × 10 vg / kg); HD-ApoB: sp7-ApoB-Δ42-GAAco, HD-Spardin: sp7-Spardin-Δ42-GAAco, HD0: sp7-Δ42-GAAco. (A) Western blot of plasma using anti-hGAA antibody. Recombinant human GAA (rhGAA) was used as a positive control; molecular weight markers are indicated. (B) Quantification of GAA protein bands obtained from the Western blot shown in panel A. A nonspecific lower band was used for normalization of loading. Data are shown as mean ± standard deviation. Statistical analysis: One-way ANOVA with Tukey's post-hoc multiple comparisons, "all groups vs. others, time point independent", *p<0.05. [Figure 5] Analysis of glycogen content in the brains of Gaa- / - mice after AAV liver gene transfer. Analysis of glycogen content in the brains of Gaa- / - mice 4 months after treatment with an AAV8 vector encoding a chimeric GAA variant (AAV, n = 6 mice / cohort, dose: 5 × 1011 vg / kg); PBS-treated mice were used as negative controls (CTRL, n = 6 mice), and Gaa+ / + mice (n = 6 mice) were used as unaffected controls. Data are presented as mean ± standard deviation. Asterisks (*) and hashtags (#) indicate significant differences relative to the groups indicated in the legend, and brain glycogen content is shown. Statistical analysis: one-way ANOVA with Tukey's post hoc multiple comparisons, "all groups vs. others." *p < 0.05, #p < 0.05. [Figure 6]Analysis of glycogen content in tissues of Gaa- / - mice after AAV liver gene transfer. Analysis of glycogen content in tissues of Gaa- / - mice 4 months after treatment with an AAV8 vector encoding a chimeric GAA variant (AAV, n = 6 mice / cohort, dose: 5 × 10 vg / kg); PBS-treated mice were used as negative controls (CTRL, n = 6 mice), and Gaa+ / + mice (n = 6 mice) were used as unaffected controls. Data are shown as mean ± standard deviation. Asterisks (*) and hashtags (#) indicate significant differences relative to the groups indicated in the legend. Glycogen content in the heart (A), triceps (B), and spinal cord (C) is shown. Statistical analysis: one-way ANOVA with Tukey's post hoc multiple comparisons, "all groups vs. others." *p < 0.05, #p < 0.05. [Figure 7] Analysis of GAA immunogenicity in the plasma of Gaa- / - mice after AAV liver gene transfer. Analysis of anti-GAA IgG in the plasma of Gaa- / - mice 1 and 4 months after administration of an AAV8 vector encoding a chimeric GAA variant (AAV, n = 6 mice / cohort, dose: 5 x 1011 vg / kg); PBS-treated mice were used as negative controls (CTRL, n = 6 mice), and Gaa+ / + mice (n = 6 mice) were used as unaffected controls. Data are presented as mean ± standard deviation. Statistical analysis: one-way ANOVA with Tukey's post hoc multiple comparisons, "all groups vs. others." DETAILED DESCRIPTION OF THE INVENTION
[0025] The present inventors have conducted an extensive search for new methods to enhance the in vivo activity of a peptide of interest by fusing a heterologous moiety to the peptide of interest. Specifically, acid α-glucosidase polypeptide was used as a model peptide. As a result, the present inventors have shown that fusion proteins of GAA with a ligand for the sortilin receptor, specifically, a spudin peptide, have improved properties, including improved uptake in the central nervous system (CNS) and better activity in tissues such as the brain. Notably, adding a ligand to a GAA peptide does not induce an increased immunogenic response to the chimeric GAA polypeptide.
[0026] Thus, the present invention generally relates to chimeric polypeptides comprising a peptide of interest fused to one or more heterologous moieties, at least one of which is a ligand for a sortilin receptor.
[0027] 1-Nucleic acid molecule A first aspect of the present invention relates to a nucleic acid molecule encoding a chimeric polypeptide comprising a peptide of interest fused to one or more heterologous moieties, at least one of which is a ligand for a sortilin receptor.
[0028] By "chimeric protein" or "fusion protein" is meant a protein created through the joining of two or more genes that originally encoded separate proteins.
[0029] The chimeric polypeptide of the present invention comprises: - a peptide of interest; - one or more "heterologous moieties" derived from polypeptides different from the peptide of interest; It refers to the fusion of
[0030] Peptide of interest The peptide of interest can be any peptide for which improved in vivo activity is desired. Specifically, the peptide of interest is a circulating peptide. "Circulating peptide" refers to any peptide, polypeptide, or fragment thereof found in the blood circulation. The peptide of interest can also be a secreted peptide. "Secreted protein" refers to any peptide, polypeptide, or fragment thereof that is processed intracellularly for secretion into the extracellular environment. Specifically, the peptide of interest is a circulating peptide for which improved activity and / or stability in plasma is desired, or for which better lysosomal targeting and / or passage through the blood-brain barrier is desired to effectively reach the CNS. The peptide of interest can be any circulating peptide for which improved uptake and / or activity in a target tissue is desired. The target tissue can be, for example, the CNS, e.g., the brain or spinal cord, muscle, e.g., skeletal muscle, or liver. Specifically, the peptide is a peptide or polypeptide for which improved uptake and / or activity in the CNS, including the brain or spinal cord, is desired, specifically, for which improved uptake and / or activity in the brain is desired. Specifically, the peptide of interest can be any peptide that targets the lysosome.
[0031] In a specific embodiment, the peptide of interest is a therapeutic peptide, i.e., a peptide delivered for therapeutic purposes, e.g., to treat, prevent, or alleviate a disease or pathological condition. Specifically, therapeutic peptides are administered by injection of the peptide or by expression using a gene therapy vector.
[0032] In a specific embodiment, the peptide of interest is a peptide known to be deficient in a lysosomal disorder associated with a neurological condition.
[0033] In specific embodiments, the peptide of interest is selected from the group consisting of lysosomal acid α-glucosidase (GAA), alpha-iduronidase (IDUA), lysosomal hydrolase iduronate 2-sulfatase (IDS), arylsulfatase A (ARSA), alpha-galactosidase A (GLA), glucosylceramidase, β-galactosidase, β-hexosaminidase A, β-hexosaminidase B, β-galactosyl-ceramidase, acid sphingomyelinase, heparan sulfamidase, acetyl-CoA:α-glucosaminide N-acetyltransferase, and lysosomal acid α-glucosidase. The enzyme is selected from the group consisting of: glutamate, N-acetylglucosamine-6-sulfatase, β-glucuronidase, acid ceramidase, α-mannosidase, β-mannosidase, N-acetylgalactosaminidase, α-neuraminidase, palmitoyl-protein thioesterase 1, carboxypeptidase, multiple sulfatases, N-acetylglucosamine phosphate transferase, protective protein cathepsin A, neuraminidase, NPC2, GM2-activating protein, LAMP2, NPC1, sialin, CLN3, and mucolipin.
[0034] In a specific embodiment, the peptide of interest is lysosomal acid alpha-glucosidase or "GAA." In this embodiment, the nucleic acid molecule of the invention is - one or more heterologous moieties, at least one of which is a ligand for a sortilin receptor. - a functional GAA polypeptide fused to a heterologous moiety and encoding a chimeric GAA polypeptide comprising:
[0035] Lysosomal acid α-glucosidase, or "GAA" (EC 3.2.1.20) (1,4-α-D-glucan glucohydrolase), is an exo-1,4-α-D-glucosidase that hydrolyzes both α-1,4 and α-1,6 linkages to oligosaccharides to liberate glucose. Deficiency of GAA results in glycogen storage disease type II (GSDII), also called Pompe disease (although this term officially refers to the infantile-onset form of the disease). It catalyzes the complete breakdown of glycogen, slowing down the breakdown of glycogen. The 28-kb human acid α-glucosidase gene on chromosome 17 encodes a 3.6-kb mRNA that produces a 951-amino acid polypeptide (Hoefsloot et al., (1988) EMBO J. 7: 1697; Martiniuk et al., (1990) DNA and Cell Biology 9: 85). The enzyme undergoes cotranslational N-linked glycosylation in the endoplasmic reticulum. It is synthesized as a 110 kDa precursor form, which matures by extensive glycosylation modifications, phosphorylation, and proteolytic processing through an approximately 90 kDa endosomal intermediate to the final lysosomal 76 and 67 kDa forms (Hoefsloot, (1988) EMBO J. 7: 1697; Hoefsloot et al., (1990) Biochem. J. 272: 485; Wisselaar et al., (1993) J. Biol. Chem. 268: 2223; Hermans et al., (1993) Biochem. J. 289: 681).
[0036] In patients with GSD II, a deficiency in acid α-glucosidase causes massive accumulation of glycogen in lysosomes, disrupting cellular function (Hirschhorn, R. and Reuser, AJ (2001) In The Metabolic and Molecular Basis for Inherited Disease, (Scriver, CR et al., eds.), pp. 3389-3419 (McGraw-Hill, New York). In the most common infantile form, patients exhibit progressive muscle degeneration and cardiomyopathy and die before the age of 2 years. In juvenile and adult-onset forms, there is severe wasting.
[0037] The term "GAA" or "GAA polypeptide," as used herein, refers to mature (about 76 or about 67 kDa) and precursor (e.g., about 110 kDa) GAA, specifically precursor forms and modified or mutated forms of GAA protein by insertion, deletion, and / or substitution, or functional derivatives of GAA, i.e., fragments thereof and GAA variants (e.g., GAA II described by Kunita et al., (1997) Biochemica et Biophysica Acta 1362: 269; Hirschhorn, R. and Reuser, AJ, (2001) The Metabolic and Molecular Basis for Inherited Disease (Scriver, CR, Beaudet, AL, Sly, WS, and Valle, (D., ed.), pp. 3389-3419; McGraw-Hill, New York, pp. 3403-3405). Any GAA coding sequence known in the art can be used, see, e.g., SEQ ID NO: 1, GenBank Accession No. NM_00152, and Hoefsloot et al., (1988) EMBO J. 7: 1697 and Van Hove et al., (1996) Proc. Natl. Acad. Sci. USA 93: 65 (human), GenBank Accession No. NM_008064 (mouse), and Kunita et al., (1997) Biochemica et Biophysica Acta 1362: 269 (quail).
[0038] A nucleic acid molecule encoding a chimeric GAA polypeptide includes any "functional GAA polypeptide," i.e., it encodes a GAA protein that, when expressed, has the functionality of a wild-type GAA protein. As defined above, the functionality of wild-type GAA is to hydrolyze both α-1,4 and α-1,6 linkages of oligosaccharides and polysaccharides, more specifically, glycogen, to release glucose. A functional GAA protein encoded by a nucleic acid molecule can have at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or at least 100% of the hydrolytic activity against glycogen compared to a wild-type GAA protein encoded by a nucleic acid sequence of SEQ ID NOs: 1-3, e.g., compared to a GAA polypeptide having the amino acid sequence of SEQ ID NO: 4. The activity of the functional GAA polypeptide encoded by the nucleic acid molecule may further be greater than 100%, for example, greater than 110%, greater than 120%, greater than 130%, greater than 140%, or even greater than 150% of the activity of the wild-type GAA protein encoded by the nucleic acid sequence of SEQ ID NO: 1-3, for example, compared to a GAA polypeptide having the amino acid sequence of SEQ ID NO: 4.
[0039] Those skilled in the art can easily determine whether a nucleic acid molecule expresses a functional GAA protein. For example, one suitable in vitro method includes inserting the nucleic acid into a vector, such as a plasmid or a viral vector, transfecting or transducing the vector into host cells, such as 293T or HeLa cells, or other cells, such as Huh7, and assaying for GAA activity. Alternatively, a suitable in vivo method includes transducing a vector containing the nucleic acid into a mouse model of Pompe disease or another glycogen storage disorder, and assaying for the presence of functional GAA in the plasma and tissues of the mouse. Suitable methods are described in more detail in the experimental section below.
[0040] The sequence of the nucleic acid molecule encoding the functional GAA polypeptide preferably has at least 85 percent identity, more preferably at least 90 percent identity, and even more preferably at least 92 percent identity, specifically at least 95 percent identity, for example at least 98, 99, or 100 percent identity, to the nucleotide sequence of SEQ ID NOs: 1 to 3.
[0041] The term "identical" and its derivatives refer to sequence identity between two nucleic acid molecules or two amino acid molecules. If a position in both of the two compared sequences is occupied by the same base or amino acid, the molecules are identical at that position. The percent identity between two sequences is a function of the number of matching positions shared by the two sequences, divided by the number of positions being compared, multiplied by 100. For example, if 6 out of 10 positions in two sequences are identical, the two sequences are 60% identical. Generally, comparisons are performed by aligning the two sequences to maximize identity. Nucleic acid sequences can be aligned using various bioinformatics tools known to those skilled in the art, such as BLAST or FASTA.
[0042] In specific embodiments, the functional GAA polypeptides encoded by the nucleic acid molecules described herein are functional truncated forms of GAA. "Truncation form" or "truncated GAA" refers to a GAA polypeptide comprising one or more consecutive amino acids deleted from the N-terminal portion of a parent GAA polypeptide. According to the present invention, a "parent GAA polypeptide" is a functional precursor GAA sequence but lacks its signal peptide. For example, with reference to a typical wild-type human GAA polypeptide, the complete wild-type GAA polypeptide (i.e., the precursor form of GAA) is represented by SEQ ID NO:5 or SEQ ID NO:6 and has a signal peptide (corresponding to amino acids 1-27 of SEQ ID NO:5 or SEQ ID NO:6), while the parent GAA polypeptides that serve as the basis for truncated GAA forms of these wild-type human GAA polypeptides are represented by SEQ ID NO:7 and SEQ ID NO:8, respectively, and lack the signal peptide. In this example, amino acids 28-952 of SEQ ID NO:5 and the latter, corresponding to amino acids 28-952 of SEQ ID NO:6, are referred to as parent GAA polypeptides.
[0043] According to the present invention, a truncated GAA polypeptide is a functional GAA polypeptide, ie it has the functionality of a wild-type GAA polypeptide as defined above.
[0044] The amino acid sequence of the parent GAA polypeptide or its coding sequence can be derived from any source, including avian and mammalian species. The term "avian" as used herein includes, but is not limited to, chicken, duck, goose, quail, turkey, and pheasant. The term "mammal" as used herein includes, but is not limited to, humans, monkeys, and other non-human primates, cows, sheep, goats, horses, cats, dogs, rabbits, etc. In an embodiment of the invention, the parent GAA polypeptide is human, mouse, or quail, specifically a human GAA polypeptide.
[0045] In addition, the parent GAA polypeptide may be a functional variant of a GAA polypeptide that contains one or more amino acid modifications, e.g., amino acid insertions, deletions, and / or substitutions, compared to a known GAA polypeptide. For example, the parent polypeptide may be a functional derivative of a human GAA polypeptide, e.g., a polypeptide of SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, that has at least 80, 85, 90, 95, 96, 97, 98, or at least 99 percent sequence identity to the human GAA polypeptide. For example, a functional variant of a GAA polypeptide may have 0 to 50, 0 to 30, 0 to 20, 0 to 15, 0 to 10, or 0 to 5 amino acid changes relative to the parent GAA polypeptide, e.g., SEQ ID NO:7 or SEQ ID NO:8, specifically the parent GAA polypeptide set forth in SEQ ID NO:7. Specifically, the parent GAA polypeptide may consist of a human GAA polypeptide having the amino acid sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0046] Truncated forms of GAA according to the present invention are N-terminally truncated forms of a parent GAA polypeptide, in which at least one amino acid is deleted from the N-terminus of said parent GAA polypeptide. For example, a truncated GAA polypeptide may have 1 to 75 contiguous amino acids, or more than 75 contiguous amino acids, truncated from its N-terminus relative to the parent GAA polypeptide. Specifically, a truncated GAA polypeptide may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75 consecutive amino acids may be truncated from its N-terminus (e.g., SEQ ID NO: 7 or SEQ ID NO: 8, specifically, a truncated form of the parent hGAA protein set forth in SEQ ID NO: 7). Using alternative nomenclature, a GAA polypeptide resulting from truncation of one amino acid in the parent GAA polypeptide is referred to as a Δ1 GAA truncated form, a GAA polypeptide resulting from truncation of two consecutive amino acids from the N-terminus is referred to as a Δ2 GAA truncated form, a GAA polypeptide resulting from truncation of three consecutive amino acids in the parent GAA polypeptide is referred to as a Δ3 GAA truncated form, etc.In specific embodiments, the truncated GAA polypeptides of the invention are Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35 , Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, Δ45, Δ46, Δ47, Δ48, Δ49, Δ50, Δ51, Δ52, Δ53, Δ54, Δ55, Δ56, Δ57, Δ58, Δ59, Δ60, Δ61, Δ62, Δ63, Δ64, Δ65, Δ66, Δ67, Δ68, Δ69, Δ70, Δ71, Δ72, Δ73, Δ74, or Δ75 GAA truncated forms (specifically, SEQ ID NO:7 or SEQ ID NO:8, specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7).
[0047] In another specific embodiment, the truncated GAA polypeptide of the invention is a Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, Δ45, Δ46, or Δ47 GAA truncated form (specifically, a truncated form of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0048] In another specific embodiment, the truncated GAA polypeptide of the invention is a Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, Δ45, or Δ46 GAA truncated form (specifically, a truncated form of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0049] In another specific embodiment, the truncated GAA polypeptide of the invention is a Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, or Δ45 GAA truncated form (specifically, a truncated form of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0050] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, or Δ44 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0051] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0052] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0053] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0054] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0055] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0056] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0057] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0058] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0059] In more specific embodiments, the truncated GAA polypeptides of the invention are Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms (specifically, truncated forms of the parent hGAA protein set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7).
[0060] In a more specific embodiment, the truncated GAA polypeptide of the present invention is a Δ6, Δ7, Δ8, Δ9, or Δ10 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7), specifically a Δ7, Δ8, or Δ9 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7), more specifically a Δ8 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7).
[0061] In a more specific embodiment, the truncated GAA polypeptide of the present invention is a Δ27, Δ28, Δ29, Δ30, or Δ31 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7), specifically a Δ28, Δ29, or Δ30 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7), more specifically a Δ29 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7).
[0062] In another specific embodiment, the truncated GAA polypeptide of the present invention is a Δ40, Δ41, Δ42, Δ43, or Δ44 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7), specifically a Δ41, Δ42, or Δ43 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7), more specifically a Δ42 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7).
[0063] In a more specific embodiment, the truncated GAA polypeptide of the present invention is a Δ41, Δ42, Δ43, Δ44, or Δ45 truncated form of GAA (specifically, the hGAA protein shown in SEQ ID NO: 7), specifically a Δ42, Δ43, or Δ44 truncated form of GAA (specifically, the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, specifically, the hGAA protein shown in SEQ ID NO: 7), and more specifically a Δ43 truncated form of GAA (specifically, the hGAA protein shown in SEQ ID NO: 7).
[0064] In another embodiment, the truncated GAA polypeptide of the present invention is a Δ6, Δ7, Δ8, Δ9, Δ10, Δ27, Δ28, Δ29, Δ30, Δ31, Δ40, Δ41, Δ42, Δ43, Δ44, Δ45, Δ46, or Δ47 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically, the hGAA protein shown in SEQ ID NO: 7).
[0065] In another embodiment, the truncated GAA polypeptide of the present invention is a Δ7, Δ8, Δ9, Δ28, Δ29, Δ30, Δ41, Δ42, Δ43, or Δ44 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically, the hGAA protein shown in SEQ ID NO: 7).
[0066] In another embodiment, the truncated GAA polypeptide of the present invention is a Δ6, Δ7, Δ8, Δ9, Δ10, Δ40, Δ41, Δ42, Δ43, or Δ44 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically, the hGAA protein shown in SEQ ID NO: 7).
[0067] In another embodiment, the truncated GAA polypeptide of the present invention is a Δ8, Δ29, Δ42, Δ43, or Δ47 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically, the hGAA protein shown in SEQ ID NO: 7).
[0068] In another embodiment, the truncated GAA polypeptide of the present invention is a Δ8, Δ29, Δ42, or Δ43 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7).
[0069] In another embodiment, the truncated GAA polypeptide of the present invention is a Δ8 or Δ42 truncated form of GAA (specifically, SEQ ID NO: 7 or SEQ ID NO: 8, specifically the hGAA protein shown in SEQ ID NO: 7).
[0070] In a specific embodiment of the invention, the truncated GAA polypeptides of the invention are truncated forms of functional human GAA polypeptides. In a more specific embodiment, the parent hGAA polypeptide is the hGAA polypeptide set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7. In a variation of this embodiment, the truncated GAA polypeptides of the invention are selected from the group consisting of Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ29, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, Δ45, Δ46, Δ47, Δ48, Δ49, Δ50, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ 25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ 42, Δ43, Δ44, Δ45, Δ46, Δ47, Δ48, Δ49, Δ50, Δ51, Δ52, Δ53, Δ54, Δ55, Δ56, Δ57, Δ58, Δ 59, Δ60, Δ61, Δ62, Δ63, Δ64, Δ65, Δ66, Δ67, Δ68, Δ69, Δ70, Δ71, Δ72, Δ73, Δ74, or Δ75 It is a shortened form of GAA.
[0071] In a variation of this embodiment, the truncated GAA polypeptides of the invention comprise an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and include at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 , 98, or 99 percent identity to a functional variant thereof.
[0072] In a variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly SEQ ID NO:7 or SEQ ID NO:8, even more particularly an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 1 or a functional variant thereof having 97, 98, or 99 percent identity to a Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, Δ45, or Δ46 GAA truncated form.
[0073] In a variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, or a functional variant thereof having 6, 97, 98, or 99 percent identity to the Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, Δ44, or Δ45 GAA truncated form.
[0074] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and includes at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, Δ43, or Δ44 GAA truncated forms of functional variants thereof having 5, 96, 97, 98, or 99 percent identity.
[0075] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, , 95, 96, 97, 98, or 99 percent identity to a Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated form of a functional variant thereof having 95, 96, 97, 98, or 99 percent identity.
[0076] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly SEQ ID NO:7 or SEQ ID NO:8, even more particularly an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 1 or a functional variant thereof having 94, 95, 96, 97, 98, or 99 percent identity to the Δ1, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0077] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and includes at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, , 94, 95, 96, 97, 98, or 99 percent identity to a functional variant thereof.
[0078] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly SEQ ID NO:7 or SEQ ID NO:8, even more particularly an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and at least 75, 80, 85, 90, 91, 92, 96, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176 or a functional variant thereof having 93, 94, 95, 96, 97, 98, or 99 percent identity, or a Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0079] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, , 93, 94, 95, 96, 97, 98, or 99 percent identity of a functional variant thereof to a Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0080] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly SEQ ID NO:7 or SEQ ID NO:8, even more particularly an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 1 or a functional variant thereof having 92, 93, 94, 95, 96, 97, 98, or 99 percent identity, or a Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0081] In another variation of this embodiment, the truncated GAA polypeptide of the present invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 , 92, 93, 94, 95, 96, 97, 98, or 99 percent identity of a functional variant thereof to a Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0082] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly SEQ ID NO:7 or SEQ ID NO:8, even more particularly an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and is at least 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 90 or a functional variant thereof having 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0083] In another variation of this embodiment, the truncated GAA polypeptide of the present invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and is at least 75, 80, 85, 90, 100, 120, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, , 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity of a functional variant thereof to a Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, or Δ42 GAA truncated form.
[0084] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly, the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms of a functional variant thereof having 4, 95, 96, 97, 98, or 99 percent identity.
[0085] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and includes at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, , 94, 95, 96, 97, 98, or 99 percent identity or a functional variant thereof having Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated form.
[0086] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly, the sequence set forth in SEQ ID NO:7, and has at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms of functional variants thereof having 3, 94, 95, 96, 97, 98, or 99 percent identity.
[0087] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, , 93, 94, 95, 96, 97, 98, or 99 percent identity or a functional variant thereof having Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated form.
[0088] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, Δ2, Δ3, Δ4, Δ5, Δ6, Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms of the ...
[0089] In another variation of this embodiment, the truncated GAA polypeptide of the present invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in SEQ ID NO:7 or SEQ ID NO:8, particularly the sequence set forth in SEQ ID NO:7, and is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 , 92, 93, 94, 95, 96, 97, 98, or 99 percent identity or a functional variant thereof having Δ7, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated form.
[0090] In another variation of this embodiment, the truncated GAA polypeptide of the invention comprises an hGAA polypeptide, and more particularly, SEQ ID NO:7 or SEQ ID NO:8, even more particularly, an hGAA polypeptide set forth in SEQ ID NO:7, or in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and comprises at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, Δ8, Δ9, Δ10, Δ11, Δ12, Δ13, Δ14, Δ15, Δ16, Δ17, Δ18, Δ19, Δ20, Δ21, Δ22, Δ23, Δ24, Δ25, Δ26, Δ27, Δ28, Δ29, Δ30, Δ31, Δ32, Δ33, Δ34, Δ35, Δ36, Δ37, Δ38, Δ39, Δ40, Δ41, Δ42, or Δ43 GAA truncated forms of functional variants thereof having 1, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity.
[0091] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ6, Δ7, Δ8, Δ9, or Δ10, specifically a Δ7, Δ8, or Δ9, more specifically a Δ8 truncated form of an hGAA polypeptide, and more specifically ... functional variant thereof comprising an amino acid substitution in the sequence shown in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0092] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ27, Δ28, Δ29, Δ30, or Δ31, specifically a Δ28, Δ29, or Δ30, more specifically a Δ29 truncated form of an hGAA polypeptide, and more specifically a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0093] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ40, Δ41, Δ42, Δ43, or Δ44, specifically Δ41, Δ42, or Δ43, more specifically Δ42 truncated form of an hGAA polypeptide, and more specifically SEQ ID NO:7 or SEQ ID NO:8, specifically the hGAA polypeptide set forth in SEQ ID NO:7, or of a functional variant thereof comprising an amino acid substitution in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0094] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ41, Δ42, Δ43, Δ44, or Δ45, particularly a Δ42, Δ43, or Δ44, more particularly a Δ43 truncated form of an hGAA polypeptide, and more particularly a Δ41, Δ42, Δ43, Δ44, or Δ45, particularly a Δ42, Δ43, or Δ44, or a functional variant thereof comprising an amino acid substitution in the sequence shown in SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, particularly SEQ ID NO:7.
[0095] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ6, Δ7, Δ8, Δ9, Δ10, Δ27, Δ28, Δ29, Δ30, Δ31, Δ40, Δ41, Δ42, Δ43, Δ44, or Δ45, specifically Δ7, Δ8, Δ9, Δ28, Δ29, Δ30, Δ41, Δ42, Δ43, or Δ44, specifically Δ8, Δ29, Δ42, or Δ43 truncated form of an hGAA polypeptide, and more specifically SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, or a functional variant thereof comprising an amino acid substitution in the sequence shown in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0096] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ6, Δ7, Δ8, Δ9, Δ10, Δ40, Δ41, Δ42, Δ43, or Δ44, specifically a Δ8 or Δ42 truncated form of an hGAA polypeptide, and more specifically SEQ ID NO:7 or SEQ ID NO:8, specifically an hGAA polypeptide as set forth in SEQ ID NO:7, or of a functional variant thereof comprising an amino acid substitution in the sequence as set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0097] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ8, Δ29, Δ42, Δ43, or Δ47 truncated form of an hGAA polypeptide, and more particularly of SEQ ID NO:7 or SEQ ID NO:8, specifically the hGAA polypeptide set forth in SEQ ID NO:7, or of a functional variant thereof comprising an amino acid substitution in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0098] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ8, Δ29, Δ42, or Δ43 truncated form of an hGAA polypeptide, and more particularly of SEQ ID NO:7 or SEQ ID NO:8, specifically of the hGAA polypeptide set forth in SEQ ID NO:7, or of a functional variant thereof comprising an amino acid substitution in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0099] In another variation of this embodiment, the truncated GAA polypeptide of the present invention is a Δ8 or Δ42 truncated form of an hGAA polypeptide, and more particularly of SEQ ID NO:7 or SEQ ID NO:8, specifically of the hGAA polypeptide set forth in SEQ ID NO:7, or of a functional variant thereof comprising an amino acid substitution in the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0100] In a specific embodiment, the truncated GAA polypeptide of the present invention is a Δ42 truncated form of GAA (specifically, the hGAA protein set forth in SEQ ID NO: 7 or SEQ ID NO: 8, specifically SEQ ID NO: 7).
[0101] In specific embodiments, the truncated GAA polypeptide is a Δ42 truncated form of an hGAA polypeptide, and more specifically of SEQ ID NO:7 or SEQ ID NO:8, specifically the hGAA polypeptide set forth in SEQ ID NO:7, or of a functional variant thereof comprising an amino acid substitution in SEQ ID NO:7 or SEQ ID NO:8, specifically the sequence set forth in SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98, or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7. In specific embodiments, a functional variant of a GAA polypeptide may have, in addition to the truncation defined above, 0 to 50, 0 to 30, 0 to 20, 0 to 15, 0 to 10, or 0 to 5 amino acid changes relative to a parent GAA polypeptide, for example, a parent GAA polypeptide set forth in SEQ ID NO:7 or SEQ ID NO:8, specifically SEQ ID NO:7.
[0102] In a specific embodiment, the truncated hGAA polypeptide of the present invention has an amino acid sequence consisting of the sequence set forth in SEQ ID NO:66, SEQ ID NO:9, SEQ ID NO:67, SEQ ID NO:68, or SEQ ID NO:69, or a functional variant thereof comprising 1 to 5 amino acid substitutions, specifically 1 to 4 amino acid substitutions, specifically 1 to 3 amino acid substitutions, more specifically 1 to 2 amino acid substitutions, or specifically 1 amino acid substitution compared to the sequence set forth in SEQ ID NO:66, SEQ ID NO:9, SEQ ID NO:67, SEQ ID NO:68, or SEQ ID NO:69. In another specific embodiment, the truncated hGAA polypeptide of the present invention has an amino acid sequence consisting of the sequence set forth in SEQ ID NO:66, SEQ ID NO:9, SEQ ID NO:67, or SEQ ID NO:68, or a functional variant thereof comprising 1 to 5 amino acid substitutions, compared to the sequence set forth in SEQ ID NO:66, SEQ ID NO:9, SEQ ID NO:67, or SEQ ID NO:68. In certain embodiments, the truncated hGAA polypeptide of the present invention has an amino acid sequence consisting of the sequence set forth in SEQ ID NO: 66 or SEQ ID NO: 9, or a functional variant thereof comprising 1 to 5 amino acid substitutions, particularly 1 to 4 amino acid substitutions, particularly 1 to 3 amino acid substitutions, more particularly 1 to 2 amino acid substitutions, particularly 1 amino acid substitution, compared to the sequence set forth in SEQ ID NO: 66 or SEQ ID NO: 9.
[0103] In certain embodiments, the truncated hGAA polypeptide of the present invention has an amino acid sequence consisting of the sequence set forth in SEQ ID NO: 9, or a functional variant thereof comprising 1 to 5, particularly 1 to 4, particularly 1 to 3, more particularly 1 to 2, particularly 1 amino acid substitution compared to the sequence set forth in SEQ ID NO: 9.
[0104] Nucleic acid sequences encoding functional GAA polypeptides, particularly truncated GAA polypeptides, may be optimized for in vivo expression of the GAA polypeptide. Sequence optimization can include several modifications to the nucleic acid sequence, including codon optimization, increased GC content, reduced CpG island count, reduced alternative open reading frames (ARFs), and reduced splice donor and splice acceptor sites. Due to the degeneracy of the genetic code, different nucleic acid molecules may encode the same protein. It is also well known that the genetic codes of different organisms often tend to use one of several codons encoding the same amino acid over others. Through codon optimization, modifications are introduced into the nucleotide sequence that take advantage of the codon bias present in a given cellular context, so that the resulting codon-optimized nucleotide sequence is more likely to be expressed at a relatively high level in that cellular context compared to a non-codon-optimized sequence. In a preferred embodiment of the present invention, such a sequence-optimized nucleotide sequence encoding a truncated GAA is codon-optimized to improve its expression in human cells compared to a non-codon-optimized nucleotide sequence encoding the same truncated GAA protein, for example, by taking advantage of human-specific codon usage biases.
[0105] In specific embodiments, the optimized GAA coding sequence is codon-optimized and / or has an increased GC content and / or has a reduced number of alternative open reading frames and / or has a reduced number of splice donor and / or splice acceptor sites compared to nucleotides 82-2859 of the wild-type hGAA coding sequence of SEQ ID NO: 1. For example, the nucleic acid sequences of the invention provide at least a 2, 3, 4, 5, or 10% increase in GC content in the GAA sequence compared to the sequence of the wild-type GAA sequence. In specific embodiments, the nucleic acid sequences of the invention provide a 2, 3, 4, or more specifically, a 5% or 10% (specifically, 5%) increase in GC content in the GAA sequence compared to the sequence of the wild-type GAA nucleotide sequence. In specific embodiments, nucleic acid sequences of the invention encoding a functional GAA polypeptide are "substantially identical" to nucleotides 82-2859 of the sequence set forth in SEQ ID NO: 1, i.e., about 70% identical thereto, more preferably about 80% identical, even more preferably about 90% identical, even more preferably about 95% identical, and even more preferably about 97%, 98%, or even 99% identical thereto. As noted above, in addition to GC content and / or number of ARFs, sequence optimization can also include reducing the number of CpG islands and / or reducing the number of splice donor and acceptor sites within the sequence. Of course, as will be appreciated by those skilled in the art, sequence optimization is a balance between all of these parameters, and a sequence can be considered optimized if it has improved at least one of the above-mentioned parameters but not one or more of the other parameters, as long as the optimized sequence results in improved transgene expression, e.g., improved in vivo transgene expression and / or reduced immune response.
[0106] In addition, the compatibility of a nucleotide sequence encoding a functional GAA to the codon usage of human cells can be expressed as a codon compatibility index (CAI). The codon compatibility index is defined herein as a measure of the relative compatibility of the codon usage of a gene to the codon usage of highly expressed human genes. The relative compatibility (w) of each codon is the ratio of the usage frequency of each codon to the usage frequency of the most abundant codon for the same amino acid. The CAI is defined as the geometric mean of these relative compatibility values. Nonsynonymous codons and stop codons (depending on the genetic code) are excluded. CAI values range from 0 to 1, with higher values indicating a higher proportion of the most abundant codons (see Sharp and Li, 1987, Nucleic Acids Research 15:1281-1295; see also Kim et al., Gene. 1997, 199:293-301; zur Megede et al., Journal of Virology, 2000, 74:2628-2635). Preferably, a nucleic acid molecule encoding GAA has a CAI of at least 0.75 (e.g., 0.77), 0.8, 0.85, 0.90, 0.92, or 0.94.
[0107] The term "nucleic acid sequence" (or nucleic acid molecule) refers to a DNA or RNA molecule in single- or double-stranded form, particularly a DNA that encodes a functional GAA polypeptide according to the present invention.
[0108] In another embodiment of the present invention, a portion of the nucleic acid molecule of the present invention encoding a truncated GAA polypeptide has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, particularly at least 95 percent identity, for example at least 98, 99, or 100 percent identity, to the corresponding portion of the nucleotide sequence of sequence-optimized sequence SEQ ID NO: 2 or 3.
[0109] In preferred embodiments, the portion of the nucleic acid molecule of the invention that encodes a truncated GAA polypeptide has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, particularly at least 95 percent identity, for example at least 98, 99, or 100 percent identity, to SEQ ID NO: 10 or SEQ ID NO: 11, preferably SEQ ID NO: 10, which encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO: 9. In specific embodiments, the nucleic acid sequence encoding a truncated GAA polypeptide consists of the sequence set forth in SEQ ID NO: 10 or SEQ ID NO: 11, preferably SEQ ID NO: 10, which encodes a polypeptide having the amino acid sequence set forth in SEQ ID NO: 9.
[0110] In addition, the functional GAA polypeptide may be any of the functional GAA polypeptides described in patent applications WO 2018 / 046772, WO 2018 / 046775, and WO 2018 / 046774.
[0111] dissimilar parts The inventors' goal was to improve the activity of circulating peptides in vivo. They investigated the possibility of improving GAA activity by fusing the GAA polypeptide defined above with one or more heterologous moieties. By "heterologous moiety" is meant a peptide moiety derived from a peptide or polypeptide other than the peptide of interest, specifically other than GAA. In the context of the present invention, "heterologous moiety" means any peptide moiety that can improve the activity of the peptide of interest in vivo, for example, any peptide moiety that improves plasma stability, plasma activity, lysosomal targeting, uptake into target tissues, such as the CNS or skeletal muscle, and / or crossing the blood-brain barrier.
[0112] Specifically, the nucleic acid molecules of the present invention are - one or more heterologous moieties, at least one of which is a ligand for a sortilin receptor. - a peptide of interest as defined above fused to a heterologous moiety, The chimeric polypeptide encodes a chimeric polypeptide comprising:
[0113] "Ligand of a sortilin receptor" means any molecule capable of binding to a sortilin receptor, specifically any molecule capable of specifically binding to a sortilin receptor. The ligand may be a natural or synthetic molecule that binds to a sortilin receptor to form a receptor-ligand complex. Preferably, affinity is mediated by a ligand having a three-dimensional structure complementary to the three-dimensional structure of the sortilin receptor. Preferably, the ligand is a proteinaceous ligand.
[0114] The sortilin receptor is a type I membrane glycoprotein belonging to the vacuolar protein sorting 10 protein (Vps10p) receptor family. "Sortilin" is also referred to as neurotensin receptor 3 (NTR3), glycoprotein 95 (Gp95), or 100 kDa NT receptor. Human sortilin is registered in Swiss Prot under the identification number Q99523. In humans, sortilin is encoded by the SORT1 gene on chromosome 1 band 1p13.3. The sortilin receptor consists of a large extracellular domain (75 kDa), one transmembrane helix, and a short cytoplasmic tail. Sortilin receptors are expressed at high levels in the brain, spinal cord, heart, skeletal muscle, thyroid, placenta, and testis, and at lower levels in lymphoid organs, kidney, colon, and liver.
[0115] The ligand of the sortilin receptor can be any natural ligand, such as spagin, neurotensin (NT), lipoprotein lipase, alternative forms of nerve growth factor-beta (proNGF) and alternative forms of brain-derived neurotrophic factor (proBDNF), or receptor-associated protein (RAP).
[0116] In a specific embodiment, the ligand for the sortilin receptor is a spasdin peptide or a neurotensin peptide, or any functional fragment thereof. By "functional fragment" is meant any fragment that can bind to the sortilin receptor and improve the activity of a peptide of interest, specifically a GAA peptide. Specifically, any functional fragment that can improve the uptake and / or activity of a peptide of interest in the brain can be used. In a specific embodiment, the functional fragment has at least 5 amino acids.
[0117] In specific embodiments, the ligand for the sortilin receptor is a spargin peptide or a functional fragment thereof. Specifically, the amino acid sequence of the spargin peptide may have at least 80% identity, at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the amino acid sequence of SEQ ID NO: 31. For example, the spargin peptide may have 1, 2, 3, 4, or 5 amino acid changes compared to the spargin peptide set forth in SEQ ID NO: 31. In specific embodiments, the spargin peptide has the amino acid sequence set forth in SEQ ID NO: 31.
[0118] Specifically, the spadin peptide may be encoded by the nucleotide sequence of SEQ ID NO: 14 or by a nucleotide sequence having at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity or 100% identity to the nucleotide sequence of SEQ ID NO: 14.
[0119] In another specific embodiment, the ligand of the sortilin receptor is a neurotensin peptide or a functional fragment thereof. Specifically, the amino acid sequence of the neurotensin peptide may have at least 80% identity, at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the amino acid sequence of SEQ ID NO: 32. For example, the neurotensin peptide may have 1, 2, 3, 4, or 5 amino acid changes compared to the neurotensin peptide set forth in SEQ ID NO: 32. In a specific embodiment, the neurotensin peptide has the amino acid sequence set forth in SEQ ID NO: 32.
[0120] In specific embodiments, the neurotensin peptide is encoded by the nucleotide sequence of SEQ ID NO:15, or by a nucleotide sequence having at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the nucleotide sequence of SEQ ID NO:15.
[0121] In a specific embodiment, the ligand of the sortilin receptor is a fragment of a neurotensin peptide, specifically a fragment of the neurotensin peptide set forth in SEQ ID NO: 32. Specifically, the fragment of the neurotensin peptide may have at least 80% identity, at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the amino acid sequence of SEQ ID NO: 33. For example, the neurotensin peptide may have one, two, or three amino acid changes compared to the fragment of the neurotensin peptide set forth in SEQ ID NO: 33. In a specific embodiment, the fragment of the neurotensin peptide has the amino acid sequence set forth in SEQ ID NO: 33.
[0122] Specifically, a fragment of a neurotensin peptide is encoded by the nucleotide sequence of SEQ ID NO:16 or by a nucleotide sequence having at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the nucleotide sequence of SEQ ID NO:16.
[0123] In a specific embodiment, a peptide of interest, specifically a functional GAA polypeptide, is fused to at least one, two, three, four, or at least five heterologous moieties, at least one of which is a ligand for a sortilin receptor as defined above. Specifically, the peptide of interest may be fused to one, two, three, four, or five heterologous moieties. The heterologous moiety other than the ligand for a sortilin receptor may be any heterologous moiety that can improve the activity of the peptide of interest, specifically GAA. Specifically, any heterologous moiety that improves plasma stability, plasma activity, lysosomal targeting, uptake into target tissues, and / or passage through the blood-brain barrier may be used.
[0124] In a specific embodiment, the peptide of interest is fused to 1, 2, 3, 4, or 5 heterologous moieties, each of which is a ligand for a sortilin receptor as defined above. In a specific embodiment, the peptide of interest is fused to 1, 2, 3, 4, or 5 heterologous moieties, each of which is a spargin peptide. Thus, in this embodiment, the peptide of interest is fused to repeats of the same heterologous moiety, which is a spargin peptide as defined above.
[0125] In a specific embodiment, the peptide of interest, in particular a functional GAA peptide as defined above, is fused to one (i.e., one and only) heterologous moiety, which is a ligand of the sortilin receptor as defined above, in particular a spargin peptide, a neurotensin peptide, or any fragment thereof as defined above. In a specific embodiment, the peptide of interest, in particular a functional GAA peptide as defined above, is fused to one (i.e., one and only) heterologous moiety which is a spargin peptide as defined above.
[0126] In a specific embodiment, the peptide of interest is fused to at least two heterologous moieties, at least one of which is a ligand of the sortilin receptor as defined above, and at least one of which is the carboxy-terminal peptide (CTP) of human chorionic gonadotropin beta subunit (hCGβ).
[0127] The carboxy-terminal peptide (CTP) of human chorionic gonadotropin beta subunit (hCGβ) described herein comprises the amino acid sequence of positions 137 to 165 of the beta subunit of human chorionic gonadotropin set forth in SEQ ID NO: 34. In some embodiments, the CTP sequence peptide is 28, 29, 30, 31, 32, 33, or 34 amino acids in length. Preferably, the CTP of hCGβ is 28 amino acids in length.
[0128] In a specific embodiment, the hCGβ CTP is a functional variant that differs from native CTP by one to five amino acid substitutions. "Functional variant" refers to any hCGβ CTP that can improve the activity of GAA in vivo. Specifically, the amino acid sequence of hCGβ CTP can have at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the amino acid sequence of SEQ ID NO: 12. In a specific embodiment, the amino acid sequence of hCGβ CTP comprises or consists of SEQ ID NO: 12.
[0129] In specific embodiments, the CTP of hCGβ is encoded by the nucleotide sequence of SEQ ID NO: 13, or by a nucleotide sequence having at least 85% identity, at least 90% identity, at least 92% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to the nucleotide sequence of SEQ ID NO: 13.
[0130] In a specific embodiment, the peptide of interest, specifically a functional GAA polypeptide, is fused to two heterologous moieties, one of which is the CTP of hCGβ as defined above and the other of which is a spagin peptide as defined above.
[0131] In specific embodiments, one or more heterologous moieties are fused to the N-terminus and / or C-terminus of a peptide of interest, particularly a functional GAA polypeptide. In specific embodiments, one heterologous moiety is fused to the N-terminus and the same or a different heterologous moiety is fused to the C-terminus of the peptide of interest. In preferred embodiments, one or more heterologous moieties are fused to the N-terminus of the peptide of interest.
[0132] In a preferred embodiment, one heterologous moiety, a spudin peptide as defined above, is fused to the N-terminus of a peptide of interest, specifically a functional GAA polypeptide.
[0133] In a specific embodiment, one or more heterologous moieties are linked to the peptide of interest via a linker. The linker connecting the one or more heterologous moieties to the sequence of the peptide of interest can be a covalent bond or a peptide bond. Any conventional linker that allows for correct folding of the chimeric polypeptide can be used. In particular, any linker that can introduce flexibility between the linked domains of the polypeptide can be used. In a specific embodiment, the linker is a glycine-rich linker.
[0134] According to a specific embodiment, the linker may be any linker described in Chichili et al., Protein Sci. 2013 Feb;22(2):153-67.
[0135] In specific embodiments, the linker has an amino acid sequence selected from the group consisting of "GAP" (SEQ ID NO: 65), "GGGGSLVPRGSGGGGS" (SEQ ID NO: 48), "GSGSGS" (SEQ ID NO: 49), "GGGGSLVPRGSGGGG" (SEQ ID NO: 50), "GGSGGHMGSGG" (SEQ ID NO: 51), "GGSGGSGGSGG" (SEQ ID NO: 52), "GGSGG" (SEQ ID NO: 53), "GGSGGGGG" (SEQ ID NO: 54), "GSGSGSGS" (SEQ ID NO: 55), "GGGSEGGGSEGGGSEGGG" (SEQ ID NO: 56), "AAGAATAA" (SEQ ID NO: 57), "GGGGG" (SEQ ID NO: 58), "GGSSG" (SEQ ID NO: 59), "GSGGGTGGGSG" (SEQ ID NO: 60), "GSGSGSGSGGSG" (SEQ ID NO: 61), "GSGGSGGSGGSGGS" (SEQ ID NO: 62), "GSGGSGSGGSGGSG" (SEQ ID NO: 63), or "GT" (SEQ ID NO: 64).
[0136] In a preferred embodiment, the heterologous moiety is fused to the peptide of interest via a peptide linker having the amino acid sequence "GAP" (SEQ ID NO: 65).
[0137] Specifically, the peptide linker is encoded by the nucleotide sequence of SEQ ID NO:17 or by a nucleotide sequence that is at least 85% identical, at least 90% identical, at least 92% identical, at least 95% identical, at least 98% identical, at least 99% identical, or at least 100% identical to the nucleotide sequence of SEQ ID NO:17.
[0138] signal peptide The chimeric polypeptides of the invention can further comprise a signal peptide. Specifically, the chimeric GAA polypeptides encoded by the nucleic acid molecules of the invention can further comprise a signal peptide, such as the native signal peptide of GAA or an alternative signal peptide derived from another secreted protein. In the context of the present invention, a signal peptide is not a "heterologous moiety" as defined above.
[0139] Thus, the nucleic acid molecules of the present invention are - one or more heterologous moieties as defined above, wherein at least one of the heterologous moieties is a ligand of a sortilin receptor. - a peptide of interest as defined above, in particular a functional GAA polypeptide as defined above, fused to a heterologous moiety, and - optionally a signal peptide The chimeric polypeptide encodes a chimeric polypeptide comprising:
[0140] Non-limiting examples of such signal peptides include those described in WO 2018 / 046775. Specifically, the signal peptide can be selected from the group consisting of SEQ ID NOS: 18-22. Accordingly, the present invention provides chimeric GAA polypeptides comprising a signal moiety, one or more heterologous moieties, and a peptide of interest, e.g., a functional GAA polypeptide as defined above. In a specific embodiment, the signal peptide is the native signal peptide of GAA, e.g., the signal peptide of hGAA set forth in SEQ ID NOS: 18. In another embodiment, the signal peptide is an exogenous (or alternative) signal peptide derived from a protein different from GAA. In a specific embodiment, the alternative signal peptide is selected from the group consisting of SEQ ID NOS: 19, 20, 21, and 22, or a functional derivative thereof as defined below. Specifically, the signal peptide is selected from the group consisting of SEQ ID NOS: 20, 21, and 22, or a functional derivative thereof as defined below.
[0141] Specific exogenous signal peptides that are workable in the present invention include amino acids 1-20 of chymotrypsinogen B2 (SEQ ID NO:21), the signal peptide of human alpha-1-antitrypsin (SEQ ID NO:19), amino acids 1-25 of iduronate-2-sulfatase (SEQ ID NO:20), and amino acids 1-23 of protease C1 inhibitor (SEQ ID NO:22). The signal peptides of SEQ ID NO:18 and SEQ ID NOs:19-22 enable increased secretion of the chimeric GAA polypeptides, both in vitro and in vivo, compared to chimeric GAA polypeptides containing their native signal peptides. In a specific embodiment, the signal peptide has the sequence set forth in SEQ ID NO: 18-22 or a functional derivative thereof, i.e., a sequence which contains a deletion, insertion or substitution of 1 to 5, particularly 1 to 4, particularly 1 to 3, more particularly 1 to 2, particularly 1 amino acid compared to the sequence set forth in SEQ ID NO: 18-22, as long as the resulting sequence corresponds to a functional signal peptide, i.e., a signal peptide which allows the secretion of the GAA protein.
[0142] In a specific embodiment, the signal peptide sequence has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, specifically at least 95 percent identity, for example, at least 98, 99, or 100 percent identity, to a sequence selected from the group consisting of SEQ ID NOs: 18-22, preferably to a sequence selected from the group consisting of SEQ ID NOs: 19-22, more preferably to a sequence selected from the group consisting of SEQ ID NOs: 20-22, and even more preferably to the sequence of SEQ ID NO: 21. In a specific embodiment, the signal peptide sequence consists of a sequence selected from the group consisting of SEQ ID NOs: 18-22. Preferably, the signal peptide sequence consists of a sequence selected from the group consisting of SEQ ID NOs: 19-22, and more preferably, the signal peptide sequence consists of a sequence selected from the group consisting of SEQ ID NOs: 20-22. According to a preferred embodiment, the signal peptide sequence consists of the sequence set forth in SEQ ID NO: 21.
[0143] In a specific embodiment, the nucleic acid molecule encodes a chimeric GAA polypeptide comprising a signal peptide as defined above, a heterologous moiety as defined above, optionally a linker as defined above, and a functional GAA polypeptide as defined above, preferably in that order. Specifically, the chimeric GAA polypeptide comprises a signal peptide consisting of the sequence set forth in SEQ ID NO:21, a heterologous moiety consisting of the sequences set forth in SEQ ID NOs:31-33, optionally a linker of the sequence "GAP," and a functional GAA polypeptide consisting of the sequence set forth in SEQ ID NO:9, preferably in that order.
[0144] In specific embodiments, the nucleic acid molecule encodes a chimeric GAA polypeptide comprising or consisting of SEQ ID NO: 35-37, or a functional derivative thereof having at least 90% identity to the sequence set forth in SEQ ID NO: 35-37, specifically at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.
[0145] In a specific embodiment, the nucleic acid molecule of the present invention comprises or consists of a sequence of SEQ ID NO: 38-40 or a sequence having at least 90% identity to the sequence set forth in SEQ ID NO: 38-40, specifically at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.
[0146] 2. Nucleic Acid Constructs The present invention also relates to nucleic acid constructs comprising the nucleic acid molecules of the present invention. The nucleic acid constructs may correspond to expression cassettes comprising the nucleic acid sequences of the present invention operably linked to one or more expression control sequences and / or other sequences that improve transgene expression and / or sequences that enhance secretion and / or uptake of the encoded protein. As used herein, the term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or another transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Such expression control sequences, such as promoters, enhancers (e.g., cis-regulatory modules (CRMs)), introns, polyA signals, etc., are known in the art.
[0147] Specifically, the expression cassette may include a promoter. The promoter may be a ubiquitous promoter or a tissue-specific promoter, and may specifically be a promoter capable of promoting expression in cells or tissues in which expression of the peptide of interest is desired, for example, in cells or tissues in which expression of the peptide of interest is desired. When the peptide of interest is GAA, the promoter may be any promoter capable of promoting GAA expression in cells or tissues in which expression of the peptide of interest is desired in GAA-deficient patients. In a specific embodiment, the promoter is a promoter specific to the CNS, specifically, the brain. In a specific embodiment, the promoter is a liver-specific promoter, such as the alpha-1 antitrypsin promoter (hAAT) (SEQ ID NO: 23), transthyretin promoter, albumin promoter, thyroxine-binding globulin (TBG) promoter, or LSP promoter (containing the thyroid hormone-binding globulin promoter sequence, two copies of the alpha-1-microglobulin / bikunin enhancer sequence, and a leader sequence -34. Ill, CR et al. (1997). Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia A. Blood Coag. Fibrinol. 8: S23-S30.). Other useful liver-specific promoters are known in the art, such as those listed in the Liver Specific Gene Promoter Database compiled by the Cold Spring Harbor Laboratory (http: / / rulai.cshl.edu / LSPD / ). In a specific embodiment, the promoter is the hAAT promoter. In another embodiment, the promoter is a promoter that directs expression in one targeted tissue or cell (eg, muscle cells) and liver cells.For example, to some extent, muscle cell-specific promoters, such as the desmin, Spc5-12, and MCK promoters, may exhibit some leakage of expression into liver cells, which may be advantageous in inducing immune tolerance in a subject to the chimeric GAA protein expressed from the nucleic acid molecule.
[0148] Other tissue-specific or non-tissue-specific promoters may be useful in practicing the present invention. For example, the expression cassette may include a tissue-specific promoter that is a promoter different from a liver-specific promoter. For example, the promoter may be muscle-specific, such as the desmin promoter (and desmin promoter variants, e.g., desmin promoters containing natural or artificial enhancers), SPc5-12, or MCK promoter. In another embodiment, the promoter is a promoter specific to another cell lineage, such as the erythropoietin promoter for expression of the chimeric polypeptide from cells of the erythroid lineage.
[0149] In another embodiment, the promoter is a ubiquitous promoter. Representative ubiquitous promoters include the cytomegalovirus enhancer / chicken beta actin (CAG) promoter, the cytomegalovirus enhancer / promoter (CMV), the PGK promoter, the SV40 early promoter, and the like. In addition, the promoter may also be an endogenous promoter, such as an albumin promoter or a GAA promoter. In a specific embodiment, the promoter is any of the hybrid regulatory elements described in International Patent Application No. PCT / EP2019 / 053061, including the specific promoters designated "LiMP" and "LiNeuP."
[0150] In a specific embodiment, the promoter is any of the hybrid promoters described in patent application EP19 305455.8, which is incorporated herein by reference, wherein the hybrid promoter comprises one or more liver-selective enhancers operably linked to a muscle-selective promoter. Specifically, the promoter may be the specific promoters designated EP1, EP2, EP3, or EP4 in patent application EP19 305455.8, specifically the promoter designated EP4.
[0151] In a specific embodiment, the promoter is linked to an enhancer sequence, such as a cis-regulatory module (CRM) or an artificial enhancer sequence. For example, the promoter may be linked to an enhancer sequence, such as the human ApoE regulatory region (or human apolipoprotein E / CI locus, liver regulatory region HCR-1—Genbank accession number U32510, set forth in SEQ ID NO: 24). In a specific embodiment, the enhancer sequence, such as the ApoE sequence, is linked to a liver-specific promoter, such as those listed above, and specifically the hAAT promoter. Other CRMs useful in the practice of the present invention include those described in Rincon et al., Mol Ther. 2015 Jan;23(1):43-52; Chuah et al., Mol Ther. 2014 Sep;22(9):1605-13; or Nair et al., Blood. 2014 May 15;123(20):3195-9.
[0152] In another specific embodiment, the nucleic acid construct contains an intron, specifically an intron located between the promoter and the nucleic acid molecule of the present invention encoding the chimeric polypeptide. Introns can be introduced to increase mRNA stability and protein production. In a further embodiment, the nucleic acid construct contains a human beta-globin b2 (or HBB2) intron, a coagulation factor IX (FIX) intron, an SV40 intron, or a chicken beta-globin intron. In yet another embodiment, the nucleic acid construct of the present invention contains a modified intron (specifically a modified HBB2 or FIX intron) designed to reduce or even completely remove the number of alternative open reading frames (ARFs) found in the intron. Preferably, ARFs spanning a length of 50 bp and containing a stop codon in frame with the start codon are removed. ARFs can be removed by modifying the intron sequence. For example, modifications can be made by nucleotide substitution, insertion, or deletion, preferably by nucleotide substitution. By way of example, one or more nucleotides, specifically one nucleotide, within an ATG or GTG start codon present in the sequence of an intron of interest can be replaced to result in a non-start codon, for example, ATG or GTG can be replaced with CTG, which is not a start codon, within the sequence of an intron of interest.
[0153] The classical HBB2 intron used in the nucleic acid construct is set forth in SEQ ID NO: 25. For example, this HBB2 intron may be modified by eliminating the start codons (ATG and GTG codons) within the intron. In a specific embodiment, the modified HBB2 intron included in the construct has the sequence set forth in SEQ ID NO: 26. The classical FIX intron used in the nucleic acid construct is derived from the first intron of human FIX and is set forth in SEQ ID NO: 27. The FIX intron may be modified by eliminating the start codons (ATG and GTG codons) within the intron. In a specific embodiment, the modified FIX intron included in the construct of the present invention has the sequence set forth in SEQ ID NO: 28. The classical chicken beta globin intron used in the nucleic acid construct is set forth in SEQ ID NO: 29. The chicken beta globin intron may be modified by eliminating the start codons (ATG and GTG codons) within the intron. In a specific embodiment, the modified chicken beta globin intron included in a construct of the invention has the sequence shown in SEQ ID NO:30.
[0154] The inventors have previously shown in WO 2015 / 162302 that such modified introns, in particular modified HBB2 or FIX introns, have advantageous properties and can significantly improve transgene expression.
[0155] In a specific embodiment, a nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' direction, a promoter optionally preceded by an enhancer, a nucleic acid molecule of the invention (i.e., a sequence encoding a chimeric polypeptide of the invention), and a polyadenylation signal (e.g., a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or another natural or artificial polyadenylation signal). In a specific embodiment, a nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' direction, a promoter (e.g., an ApoE regulatory region), optionally preceded by an enhancer, an intron (specifically, an intron as defined above), a nucleic acid molecule of the invention, and a polyadenylation signal. In a more specific embodiment, a nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' direction, an enhancer, e.g., an ApoE regulatory region, a promoter, an intron (specifically, an intron as defined above), a nucleic acid molecule of the invention, and a polyadenylation signal. In a more specific embodiment of the present invention, an expression cassette comprising, in the 5' to 3' orientation, an ApoE regulatory region, a hAAT liver-specific promoter, an HBB2 intron (particularly, a modified HBB2 intron as defined above), a nucleic acid molecule of the present invention, and a bovine growth hormone polyadenylation signal, for example, a nucleic acid construct as set forth in SEQ ID NOs: 41-43, comprising a nucleic acid molecule of SEQ ID NOs: 38-40 encoding a chimeric GAA polypeptide.
[0156] In a specific embodiment, the expression cassette comprises an ApoE regulatory region, a hAAT liver-specific promoter, a codon-optimized HBB2 intron, the sequence of a nucleic acid molecule of the invention, and a bovine growth hormone polyadenylation signal.
[0157] When designing the nucleic acid constructs of the present invention, those skilled in the art will be mindful of the size limitations of the vectors used to deliver the constructs to cells or tissues. Specifically, those skilled in the art will understand that a major limitation of AAV vectors is their cargo capacity, which may vary depending on the AAV serotype, but is believed to be limited to approximately the size of the parent viral genome. For example, the maximum size that can be packaged into an AAV8 capsid is typically 5 kb. (Wu Z. et al., Mol Ther., 2010, 18(1): 80-86; Lai Y. et al., Mol Ther., 2010, 18(1): 75-79; Wang Y. et al., Hum Gene Ther Methods, 2012, 23(4): 225-33). Thus, in practicing the present invention, one skilled in the art will take care to select the components of the nucleic acid constructs of the present invention so that the resulting nucleic acid sequence, including the sequences encoding the AAV 5'- and 3'-ITRs, preferably does not exceed 110% of the cargo capacity of the AAV vector in which it is implemented, and in particular, preferably does not exceed 5.5 kb.
[0158] 3-Vector The present invention also relates to vectors comprising the nucleic acid molecules or constructs disclosed herein. Specifically, the vectors of the present invention are suitable for protein expression, preferably for use in gene therapy. In one embodiment, the vector is a plasmid vector. In another embodiment, the vector is a nanoparticle comprising a nucleic acid molecule of the present invention, specifically a messenger RNA encoding a chimeric polypeptide of the present invention. In another embodiment, the vector is a transposon-based system, such as the hyperactive Sleeping Beauty (SB100X) transposon system (Mates et al., 2009), which allows the nucleic acid molecule or construct of the present invention to be integrated into the genome of a target cell. In another embodiment, the vector is a viral vector suitable for gene therapy targeting any desired cell, such as liver tissue or cells, muscle cells, CNS cells (e.g., brain cells), or hematopoietic stem cells, e.g., cells of the erythroid lineage (e.g., red blood cells). In this case, the nucleic acid construct of the present invention also comprises sequences suitable for producing efficient viral vectors, as is well known in the art. In a specific embodiment, the viral vector is derived from an integrative virus. In particular, viral vectors can be derived from retroviruses or lentiviruses.In a more specific embodiment, the viral vector is an AAV vector, e.g., an AAV vector suitable for transducing liver tissue or cells, more specifically, AAV-1, -2, and AAV-2 variants (e.g., quadruple mutant capsid-optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, as disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [E-mail advance publication]), -3, and AAV-3 variants (e.g., Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV-3B variants, -4, -5, -6, and AAV-6 variants (e.g., AAV6 variants comprising the triple mutant AAV6 capsid Y731F / Y705F / T492V as disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev. 3, p. 16026), -7, -8, -9, -10, e.g., -cy10 and -rh10, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV serotypes, e.g., AAVpo4 and AAVpo6, or retroviral vectors, e.g., lentiviral vectors and alpha-retroviruses. As is known in the art, depending on the specific viral vector to be used, additional suitable sequences are introduced into the nucleic acid construct of the present invention to obtain a functional viral vector. Suitable sequences include AAV ITRs for AAV vectors, or LTRs for lentiviral vectors. Thus, the present invention also relates to the above-mentioned expression cassettes flanked on both sides by ITRs or LTRs.
[0159] The advantages of viral vectors are discussed below in this disclosure. Viral vectors, such as retroviral vectors, e.g., lentiviral vectors, or non-pathogenic parvoviruses, more preferably AAV vectors, are preferred for delivering the nucleic acid molecules or constructs of the present invention. The human parvovirus adeno-associated virus (AAV) is a naturally replication-deficient dependent virus that can integrate into the genome of infected cells and establish a latent infection. This last characteristic appears to be unique to mammalian viruses, as integration occurs at a specific site designated AAVS1, located on chromosome 19 of the human genome (19q13.3-qter).
[0160] AAV vectors have therefore generated considerable interest as potential vectors for human gene therapy. Among the favorable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected.
[0161] Among the well-characterized AAV serotypes isolated from humans or non-human primates (NHPs), human serotype 2 was the first AAV to be developed as a gene transfer vector. Other currently used AAV serotypes include AAV-1, AAV-2 variants (e.g., the quadruple mutant capsid-optimized AAV-2 comprising an engineered capsid with the changes Y44+500+730F+T491V, as disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [E-mail advance publication]), -3 and AAV-3 variants (e.g., the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes S663V+T492V, as disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV-3B variants, -4, -5, -6, and AAV-6 variants (e.g., Rosario et al., 2016, Mol Ther Methods Clin Dev. 3, p. 16026), -7, -8, -9, -10, e.g., -cy10 and -rh10, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV serotypes, e.g., AAVpo4 and AAVpo6, and tyrosine, lysine, and serine capsid mutants of AAV serotypes. In addition, other non-naturally engineered variants and chimeric AAVs may also be useful.
[0162] AAV viruses may be engineered using conventional molecular biology techniques to optimize these particles for cell-specific delivery of nucleic acid sequences, minimizing immunogenicity, tuning stability and particle lifetime, efficient degradation, and precise delivery to the nucleus.
[0163] Desirable AAV fragments for assembly into vectors include the cap protein, including vp1, vp2, vp3, and hypervariable regions, and the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments can be readily utilized in a variety of vector systems and host cells.
[0164] AAV-based recombinant vectors that lack Rep proteins integrate into the host genome with low efficiency and exist primarily as stable circular episomes that can persist in target cells for several years.
[0165] Instead of using naturally occurring serotypes of AAV, artificial AAV serotypes may be used in the context of the present invention, including, without limitation, AAVs with non-natural capsid proteins. Such artificial capsids can be generated by any suitable technique using a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with another selected AAV serotype, non-contiguous portions of the same AAV serotype, a non-AAV viral source, or a heterologous sequence that can be obtained from a non-viral source. The artificial AAV serotype can be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid.
[0166] Thus, the present invention relates to an AAV vector comprising a nucleic acid molecule or construct of the present invention. In the context of the present invention, an AAV vector comprises an AAV capsid capable of transducing a target cell of interest, in particular a hepatocyte. According to certain embodiments, the AAV vectors include AAV-1, -2, AAV-2 variants (e.g., quadruple mutant capsid-optimized AAV-2 comprising an engineered capsid with the changes Y44+500+730F+T491V, as disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [E-mail advance publication]), -3 and AAV-3 variants (e.g., AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes S663V+T492V, as disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV-3B variants, -4, -5, -6, and AAV-6 variants (e.g., Rosario et al., 2016, Mol Ther Methods Clin Dev. tyrosine, lysine, and serine capsid mutants of serotypes such as AAV6 variants (including the triple mutant AAV6 capsid Y731F / Y705F / T492V form disclosed in [PubMed] AAV6. 3, p. 16026), -7, -8, -9, -10, e.g., -cy10 and -rh10, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV, e.g., AAVpo4 and AAVpo6, and AAV serotypes. In a specific embodiment, the AAV vector is of the AAV8, AAV9, AAVrh74, or AAV2i8 serotype (i.e., the AAV vector has a capsid of the AAV8, AAV9, AAVrh74, or AAV2i8 serotype). In a more specific embodiment, the AAV vector is a pseudotyped vector, i.e., its genome and capsid are derived from AAVs of different serotypes. For example, a pseudotyped AAV vector can be a vector whose genome is derived from one of the AAV serotypes mentioned above and whose capsid is derived from another serotype.For example, the genome of a pseudotype vector can have a capsid derived from an AAV8, AAV9, AAVrh74, or AAV2i8 serotype, or the genome can be derived from a different serotype. In a specific embodiment, the AAV vector has a capsid of an AAV8, AAV9, or AAVrh74 serotype, specifically an AAV8 or AAV9 serotype, more specifically an AAV8 serotype.
[0167] In certain embodiments, when the vector is for use in delivering a transgene to muscle cells, the AAV vector may be selected from the group consisting of AAV8, AAV9, and AAVrh74, among others.
[0168] In another specific embodiment, when the vector is for use in delivering a transgene to liver cells, the AAV vector may be selected from the group consisting of AAV5, AAV8, AAV9, AAV-LK03, AAV-Anc80, and AAV3B, among others.
[0169] In another embodiment, the capsid is a modified capsid. In the context of the present invention, a "modified capsid" can be a chimeric capsid or a capsid comprising one or more variant VP capsid proteins derived from one or more wild-type AAV VP capsid proteins.
[0170] In a specific embodiment, the AAV vector is a chimeric vector, i.e., its capsid comprises VP capsid proteins from at least two different AAV serotypes, or comprises at least one chimeric VP protein that combines VP protein regions or domains from at least two AAV serotypes. Examples of such chimeric AAV vectors useful for transducing liver cells are described in Shen et al., Molecular Therapy, 2007 and Tenney et al., Virology, 2014. For example, a chimeric AAV vector can be derived by combining an AAV8 capsid sequence with a sequence from an AAV serotype other than the AAV8 serotype, such as any of those specifically mentioned above. In another embodiment, the capsid of the AAV vector comprises one or more variant VP capsid proteins, such as those described in WO2015013313, specifically the RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4, and RHM15-6 capsid variants, which exhibit enhanced liver tropism.
[0171] In another embodiment, modified capsids can also be derived by capsid modifications inserted by error-prone PCR and / or peptide insertion (e.g., as described in Bartel et al., 2011). In addition, capsid variants can contain single amino acid changes, such as tyrosine mutations (e.g., as described in Zhong et al., 2008).
[0172] In addition, the genome of an AAV vector can be either a single-stranded or self-complementary double-stranded genome (McCarty et al., Gene Therapy, 2003). Self-complementary double-stranded AAV vectors are generated by deleting the terminal resolution site (trs) from one of the AAV terminal repeats. These modified vectors, whose replicating genome is half the length of the wild-type AAV genome, tend to package DNA dimers. In a preferred embodiment, the AAV vector implemented in the practice of the present invention has a single-stranded genome and more preferably comprises an AAV8, AAV9, AAVrh74, or AAV2i8 capsid, specifically an AAV8, AAV9, or AAVrh74 capsid, e.g., an AAV8 or AAV9 capsid, more specifically an AAV8 capsid.
[0173] In a specific embodiment, the present invention relates to an AAV vector comprising a nucleic acid construct of the present invention in a single-stranded or double-stranded self-complementary genome (e.g., a single-stranded genome). In one embodiment, the AAV vector comprises an AAV8, AAV9, AAVrh74, or AAV2i8 capsid, specifically an AAV8, AAV9, or AAVrh74 capsid, e.g., an AAV8 or AAV9 capsid, more specifically, an AAV8 capsid. In a more specific embodiment, the nucleic acid is operably linked to a promoter, particularly a ubiquitous promoter or a liver-specific promoter. According to a specific variant embodiment, the promoter is a ubiquitous promoter, such as the cytomegalovirus enhancer / chicken beta actin (CAG) promoter, the cytomegalovirus enhancer / promoter (CMV), the PGK promoter, and the SV40 early promoter. In a specific variant, the ubiquitous promoter is a CAG promoter. According to another variation, the promoter is a liver-specific promoter, such as the alpha-1 antitrypsin promoter (hAAT), transthyretin promoter, albumin promoter, and thyroxine-binding globulin (TBG) promoter. In a particular variation, the liver-specific promoter is the hAAT liver-specific promoter of SEQ ID NO: 23. In a more specific embodiment, the nucleic acid construct contained in the genome of the AAV vector of the present invention further comprises an intron as described above, for example, an intron located between the promoter and the nucleic acid sequence encoding the chimeric polypeptide of the present invention. Representative introns that can be included in the nucleic acid construct introduced into the AAV vector genome include, but are not limited to, the human beta globin b2 (or HBB2) intron, the FIX intron, and the chicken beta-globin intron. The intron in the genome of the AAV vector may be a classical (or unmodified) intron, or a modified intron designed to reduce or even completely eliminate the number of alternative open reading frames (ARFs) within the intron.Modified and unmodified introns that can be used in implementing this embodiment in which the nucleic acid of the present invention is introduced into an AAV vector are described in detail above. In a specific embodiment, the AAV vector of the present invention, specifically an AAV8, AAV9, AAVrh74, or AAV2i8 capsid, specifically an AAV8, AAV9, or AAVrh74 capsid, for example, an AAV8 or AAV9 capsid, more specifically, an AAV8 capsid, comprises a modified (or optimized) intron in its genome, such as the modified HBB2 intron of SEQ ID NO: 26, the modified FIX intron of SEQ ID NO: 28, and the modified chicken beta-globin intron of SEQ ID NO: 30. In a more specific embodiment, the vector of the present invention is an AAV vector comprising an AAV8, AAV9, AAVrh74, or AAV2i8 capsid, specifically an AAV8, AAV9, or AAVrh74 capsid, e.g., an AAV8 or AAV9 capsid, more specifically an AAV8 capsid, and a genome comprising, in 5' to 3' orientation, an AAV 5'-ITR (e.g., an AAV2 5'-ITR), an ApoE regulatory region, a hAAT liver-specific promoter, an HBB2 intron (e.g., a modified HBB2 intron as defined above), a nucleic acid molecule of the present invention encoding a chimeric polypeptide, specifically a chimeric GAA polypeptide, a bovine growth hormone polyadenylation signal, and an AAV 3'-ITR (e.g., an AAV2 3'-ITR), e.g., an AAV 5'-ITR (e.g., an AAV2 5'-ITR) and an AAV 3'-ITR (e.g., an AAV2 The genome includes a nucleic acid construct shown in SEQ ID NOs: 41 to 43 flanked by a 3'-ITR.
[0174] In a specific embodiment of the present invention, the nucleic acid construct of the present invention comprises the above-described liver-specific promoter, and the vector is a viral vector capable of transducing liver tissue or cells as described above. This embodiment advantageously utilizes the tolerogenic and metabolic properties of the liver to produce a highly efficient and optimized vector that expresses a secreted form of GAA in liver cells and induces immune tolerance to the protein.
[0175] In addition, in a more specific embodiment, the present invention provides a combination of two vectors, e.g., two viral vectors, specifically two AAV vectors, to improve gene delivery and treatment efficacy in target cells. For example, the two vectors may each carry a nucleic acid molecule of the present invention encoding a chimeric polypeptide of the present invention under the control of a different promoter. In a specific embodiment, one vector contains a promoter that is a liver-specific promoter (such as one of those described above), and the other vector contains a promoter specific to another tissue targeted for treatment of glycogen storage disorders, such as a muscle-specific promoter, e.g., a desmin promoter. In a specific variation of this embodiment, this combination of vectors corresponds to multiple co-packaged AAV vectors produced as described in WO2015196179.
[0176] 4-Chimeric GAA Polypeptide In another aspect, the present invention provides chimeric polypeptides encoded by the nucleic acid molecules of the present invention described above. Specifically, the chimeric polypeptide is a chimeric GAA polypeptide comprising a functional GAA polypeptide fused to one or more heterologous domains, at least one of which is a ligand for a sortilin receptor as defined above. In specific embodiments, the chimeric GAA polypeptide has the sequence set forth in SEQ ID NOs: 35-37 or a functional derivative thereof having at least 90% identity, specifically at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NOs: 35-37.
[0177] In specific embodiments, the chimeric polypeptides, particularly the chimeric GAA polypeptides, can reduce glycogen levels in the CNS (e.g., spinal cord and brain), particularly the brain. In specific embodiments, the chimeric polypeptides, particularly the chimeric GAA polypeptides, provide improved reduction in glycogen levels in the CNS (e.g., spinal cord and brain), particularly the brain, compared to non-chimeric polypeptides, particularly non-chimeric GAA polypeptides, that are not fused to one or more heterologous domains as described above.
[0178] 5-cell The present invention also relates to isolated cells, e.g., liver cells, transduced with a nucleic acid molecule or construct of the present invention, as well as ex vivo gene therapy. Thus, the present invention relates to isolated cells, e.g., liver cells, comprising a nucleic acid molecule, nucleic acid construct, or vector of the present invention.
[0179] The cells of the present invention can be delivered to a subject in need thereof, e.g., a GAA-deficient patient, by any suitable route of administration, for example, injection into the liver or bloodstream of the subject. In a specific embodiment, the present invention comprises introducing a nucleic acid of the present invention into liver cells, specifically liver cells of the subject to be treated, and administering the transformed liver cells containing the nucleic acid to the subject. Advantageously, this embodiment is useful for secreting GAA from the cells. In a specific embodiment, the liver cells are liver cells obtained from the patient to be treated, or liver stem cells that have been further transformed and differentiated in vitro into liver cells for subsequent administration to the patient.
[0180] The present invention further relates to a transgenic non-human animal comprising in its genome a nucleic acid molecule or construct of the invention encoding a chimeric polypeptide according to the invention. In a specific embodiment, the animal is a mouse.
[0181] Aside from the specific delivery systems embodied in the examples below, a variety of delivery systems are known and can be used to administer the nucleic acid molecules or constructs of the invention, e.g., liposomes, microparticles, microcapsules, encapsulation in recombinant cells capable of expressing the nucleic acid sequences of the invention, receptor-mediated endocytosis, construction of therapeutic nucleic acids as part of retroviral or other vectors, etc.
[0182] In some embodiments, it may be desirable to introduce the chimeric polypeptide, nucleic acid molecule, nucleic acid construct, or isolated cell of the present invention into the liver of a subject by any suitable route.In addition, naked DNA, such as minicircle and transposon, can be used for delivery or lentiviral vector.Furthermore, gene editing technology, such as zinc finger nuclease, meganuclease, TALEN, and CRISPR, can also be used to deliver the coding sequence of the present invention.
[0183] 6- Pharmaceutical Compositions The present invention also provides pharmaceutical compositions comprising the nucleic acid molecules, nucleic acid constructs, vectors, chimeric polypeptides, or isolated cells of the present invention. Such compositions comprise a therapeutically effective amount of a therapeutic agent (the nucleic acid molecules, nucleic acid constructs, vectors, chimeric polypeptides, or cells of the present invention) and a pharmaceutically acceptable carrier. In certain embodiments, the term "pharmaceutically acceptable" means approved by federal or state regulatory agencies, or the United States or European Pharmacopoeia, or other generally recognized pharmacopoeias, for use in animals and humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be utilized as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, nonfat dry milk, glycerol, propylene glycol, water, ethanol, and the like.
[0184] The compositions may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like. Oral formulations may include standard carriers, such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic agent, preferably in purified form, together with an amount of carrier suitable to provide the form for proper administration to the subject. In a specific embodiment, the nucleic acid, vector, or cell of the invention is formulated in a composition comprising phosphate-buffered saline supplemented with 0.25% human serum albumin. In another specific embodiment, the nucleic acid, vector, or cell of the invention is formulated in a composition comprising lactated Ringer's solution and a non-ionic surfactant, such as Pluronic F68, at a final concentration of 0.01-0.0001% based on the total weight of the composition, e.g., 0.001%. The formulation may further comprise serum albumin, particularly human serum albumin, e.g., 0.25% human serum albumin. Other suitable formulations for either storage or administration are known in the art, e.g., from WO 2005 / 118792 or Allay et al., 2011.
[0185] In a preferred embodiment, the composition is formulated according to routine procedures as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. If necessary, the composition may also contain a solubilizing agent and a local anesthetic, such as lignocaine, to ease pain at the injection site.
[0186] 7-Administration and Use In certain embodiments, the nucleic acid molecules, nucleic acid constructs, vectors, chimeric polypeptides, or cells of the invention can be delivered in vesicles, particularly liposomes, hi yet other embodiments, the nucleic acid molecules, nucleic acid constructs, vectors, chimeric polypeptides, or cells of the invention can be delivered in a controlled release system.
[0187] Methods of administration of the nucleic acid molecules, nucleic acid constructs, vectors, chimeric polypeptides, or cells of the present invention include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. In specific embodiments, administration is via the intravenous or intramuscular route. The nucleic acid molecules, nucleic acid constructs, vectors, chimeric polypeptides, or cells of the present invention, whether or not vector-treated, can be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial linings or mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa), and may be administered together with other biologically active agents. Administration may be systemic or local.
[0188] In certain embodiments, it may be desirable to administer the pharmaceutical compositions of the present invention locally to the area in need of treatment, e.g., the liver. This can be accomplished, for example, using an implant, which can be a porous, non-porous, or gelatinous material, including a membrane, e.g., a sialastic membrane, or a fiber.
[0189] The amount of a therapeutic agent of the present invention (i.e., a nucleic acid molecule, nucleic acid construct, vector, chimeric polypeptide, or isolated cell of the present invention) that will be effective in treating a disease, specifically a glycogen storage disease, can be determined by standard clinical techniques. Additionally, in vivo and / or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose employed in the formulation will also depend on the route of administration and the severity of the disease, and should be determined according to the judgment of a healthcare professional and each patient's circumstances. The dosage of a nucleic acid molecule, nucleic acid construct, vector, chimeric polypeptide, or cell of the present invention administered to a subject in need thereof will vary based on several factors, including, but not limited to, the route of administration, the specific disease being treated, the age of the subject, or the level of expression required to achieve a therapeutic effect. Those skilled in the art can readily determine the required dosage range based on these and other factors, based on their knowledge in the art. For treatments involving administering a viral vector, e.g., an AAV vector, to a subject, a typical dose of the vector is at least 1 x 10 per kilogram of body weight. 8 Vector genome (vg / kg), e.g., at least 1 x 10 9 vg / kg, at least 1 × 10 10 vg / kg, at least 1 × 10 11 vg / kg, at least 1 × 10 12 vg / kg, at least 1 × 10 13 vg / kg, or at least 1 × 10 14 vg / kg.
[0190] The present invention further relates to a method for treating a lysosomal storage disease, comprising the step of delivering a therapeutically effective amount of a nucleic acid, vector, chimeric polypeptide, pharmaceutical composition, or cell of the present invention to a subject in need thereof.
[0191] In a specific embodiment, the lysosomal disorder is associated with a neurological condition.
[0192] Specifically, lysosomal diseases include glycogen storage diseases (GSDs), such as Pompe disease, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II), mucopolysaccharidosis type IIIA (MPS IIIA), mucopolysaccharidosis type IIIB (MPS IIIB), mucopolysaccharidosis type IIIC (MPS IIIC), mucopolysaccharidosis type IIID (MPS IIID), mucopolysaccharidosis type VII (MPSV II), metachromatic leukodystrophy (MLD), Gaucher disease type 2, Gaucher disease type 3, GM1 gangliosidosis, Tay-Sachs disease, Sandhoff disease, Fabry disease, The disease may be Krabbe disease, Niemann-Pick disease type A, metachromatic leukodystrophy, Farber disease, alpha-mannosidosis, beta-mannosidosis, Schindler disease, sialidosis, neuronal ceroid lipofuscinosis type 1 (NCL1), neuronal ceroid lipofuscinosis type 2 (NCL2), multiple sulfatase deficiency (MSD), mucolipidosis type II, mucolipidosis type IIIA, galactosialidosis, Niemann-Pick disease type C, GM2 activator protein deficiency, Danon disease, Salla disease, NCL3 disease, or mucolipidosis type IV.
[0193] In a specific embodiment, the disease is a glycogen storage disease, specifically GSDII (Pompe disease).
[0194] The present invention also relates to a method for reducing glycogen levels in the CNS (e.g., spinal cord and / or brain), specifically in the brain, comprising delivering a therapeutically effective amount of a nucleic acid, vector, chimeric polypeptide, pharmaceutical composition, or cell of the invention to a subject in need thereof.
[0195] In a specific embodiment, the present invention relates to a method for treating a glycogen storage disease, comprising delivering a therapeutically effective amount of a nucleic acid, vector, chimeric GAA polypeptide, pharmaceutical composition, or cell of the present invention to a subject in need thereof.
[0196] The present invention also relates to a method for treating a glycogen storage disease, the method not inducing an immune response against a transgene (i.e., a chimeric GAA polypeptide) or inducing a reduced immune response against the transgene, comprising the step of delivering a therapeutically effective amount of a nucleic acid molecule, nucleic acid construct, chimeric polypeptide, vector, pharmaceutical composition, or cell of the present invention to a subject in need thereof. The present invention also relates to a method for treating a glycogen storage disease, the method comprising repeated administration of a therapeutically effective amount of a nucleic acid molecule, nucleic acid construct, chimeric polypeptide, vector, pharmaceutical composition, or cell of the present invention to a subject in need thereof. In this embodiment, the nucleic acid molecule or nucleic acid construct of the present invention comprises a promoter that is functional in liver cells, thereby enabling immune tolerance to the expressed chimeric GAA polypeptide produced therefrom. Similarly, in this embodiment, the pharmaceutical composition used in this embodiment comprises a nucleic acid molecule or nucleic acid construct that comprises a promoter that is functional in liver cells. In the case of liver cell delivery, the cells may be cells previously obtained from a subject in need of treatment and engineered by introducing a nucleic acid molecule or nucleic acid construct of the present invention into the cells, thereby enabling them to produce the chimeric GAA polypeptide of the present invention. According to certain embodiments, in aspects involving repeated administration, the administration may be repeated at least once or more times, and may even be considered to be carried out according to a periodic schedule, for example, once per week, once per month, or once per year. The periodic schedule may also include administration once per 2, 3, 4, 5, 6, 7, 8, 9, or 10 years, or once per more than 10 years. In another specific embodiment, each administration of the viral vector of the present invention is carried out using a different virus for each successive administration, thereby avoiding a reduction in efficacy due to a possible immune response to the previously administered viral vector.For example, a viral vector comprising an AAV8 capsid may be administered first, followed by a vector comprising an AAV9 capsid, or even a virus unrelated to AAV, such as a retroviral or lentiviral vector.
[0197] The present invention also relates to a method for treating a glycogen storage disease, comprising delivering a therapeutically effective amount of a nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, pharmaceutical composition, or cell of the present invention to a subject in need thereof. A transgene can be used to produce high levels of GAA protein, providing therapeutic benefits such as improved GAA activity in plasma and / or tissues, e.g., skeletal muscle. The present invention also relates to a method for treating a glycogen storage disease, comprising repeatedly administering a therapeutically effective amount of a nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, pharmaceutical composition, or cell of the present invention to a subject in need thereof. In this embodiment, the nucleic acid molecule or nucleic acid construct of the present invention comprises a promoter functional in liver cells, thereby enabling immune tolerance to the expressed chimeric GAA polypeptide produced therefrom. Similarly, in this embodiment, the pharmaceutical composition used in this embodiment comprises a nucleic acid molecule or nucleic acid construct comprising a promoter functional in liver cells. In the case of liver cell delivery, the cells may be cells previously obtained from a subject in need of treatment and engineered by introducing a nucleic acid molecule or nucleic acid construct of the present invention into the cells, thereby enabling them to produce the chimeric GAA polypeptide of the present invention. According to certain embodiments, in aspects involving repeated administration, the administration may be repeated at least once or more times, and may even be considered to be carried out according to a periodic schedule, for example, once per week, once per month, or once per year. The periodic schedule may also include administration once per 2, 3, 4, 5, 6, 7, 8, 9, or 10 years, or once per more than 10 years. In another specific embodiment, each administration of the viral vector of the present invention is carried out using a different virus for each successive administration, thereby avoiding a reduction in efficacy due to a possible immune response to the previously administered viral vector.For example, a viral vector comprising an AAV8 capsid may be administered first, followed by a vector comprising an AAV9 capsid, or even a virus unrelated to AAV, such as a retroviral or lentiviral vector.
[0198] According to the present invention, treatment can include curative, palliative, or prophylactic effects. Thus, therapeutic and prophylactic treatments include alleviating symptoms of, preventing, or otherwise reducing the risk of developing a particular glycogen storage disease. The term "prophylactic" can be thought of as reducing the severity or onset of a particular condition. "Prophylactic" also includes preventing the recurrence of a particular condition in patients who have previously been diagnosed with that condition. "Therapeutic" can also include reducing the severity of an existing condition. The term "treatment," as used herein, refers to any regimen that can be beneficial to an animal, particularly a mammal, and more particularly a human subject.
[0199] The present invention also relates to an ex vivo gene therapy method for the treatment of glycogen storage diseases, comprising introducing a nucleic acid molecule or nucleic acid construct of the present invention into isolated cells, e.g., isolated hematopoietic stem cells, of a patient in need thereof, and introducing the cells into the patient in need thereof. In a specific embodiment of this aspect, the nucleic acid molecule or construct is introduced into the cells using a vector as defined above. In a specific embodiment, the vector is an integrative viral vector. In a more specific embodiment, the viral vector is a retroviral vector, e.g., a lentiviral vector. For example, the lentiviral vector disclosed in van Til et al., 2010, Blood, 115(26), 5329, can be used in the practice of the methods of the present invention.
[0200] The present invention also relates to a nucleic acid molecule, a nucleic acid construct, a vector, a chimeric GAA polypeptide, or a cell of the present invention for use as a medicament.
[0201] The present invention also relates to a nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, or cell of the invention for use in a method for treating a disease caused by a mutation in the GAA gene, particularly a method for treating Pompe disease. The present invention further relates to a nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, or cell of the invention for use in a method for treating a glycogen storage disease, such as GSDI (von Gierge disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII, and fatal congenital glycogen storage disease of the heart, more particularly GSDI, GSDII, or GSDIII, even more particularly GSDII and GSDIII, most particularly GSDII. The chimeric GAA polypeptides of the present invention can be administered to a patient in need thereof for use in enzyme replacement therapy (ERT), for example, for use in enzyme replacement therapy of one of the glycogen storage diseases, such as GSD III (Cori's disease), as well as GSDs IV, VI, IX, XI, and cardiac glycogenosis due to AMP-activated protein kinase gamma subunit 2 deficiency.
[0202] The present invention further relates to the use of a nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, or cell of the invention in the manufacture of a medicament useful for treating glycogen storage diseases, such as GSDI (von Gierge disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII, and fatal congenital glycogen storage diseases of the heart, more particularly GSDI, GSDII, or GSDIII, even more particularly GSDII and GSDIII, most particularly GSDII. [Example]
[0203] Materials and Methods GAA expression cassette and AAV vector The GAA transgene expression cassette used in this study contained a codon-optimized human GAA (hGAA) coding sequence [Puzzo F. et al., Sci Transl Med. 2017 Nov 29;9(418)]. Codon optimization was performed using a commercially available algorithm (Thermo Fisher Scientific) [Puzzo F. et al., Sci Transl Med. 2017 Nov 29;9(418)]. Heterologous domains (spargin, ApoE, ApoB) were cloned into the N-terminus of the GAA transgene, as shown in Figure 1. The transgene sequence was cloned into an AAV vector backbone under transcriptional control of the apolipoprotein E (hepatocyte control region enhancer) and human alpha1-antitrypsin (hAAT) promoter. All DNA sequences used in this study were synthesized by either GeneCust or ThermoFisher Scientific.
[0204] The AAV vectors used in this study were produced using a non-adenoviral transient transfection method of HEK293 cells as described [Puzzo F et al., Sci Transl Med. 2017 Nov 29;9(418)]. The titers of AAV vector stocks were determined using quantitative real-time PCR (qPCR) and SDS-PAGE, followed by SYPRO Ruby protein gel staining and band densitometry. All vector preparations used in this study were quantified in parallel prior to use. Primers used for qPCR on the AAV genome were annealed to BGH polyA (forward: tctagttgccagccatctgttgt (SEQ ID NO: 44), reverse: tgggagtggcaccttcca (SEQ ID NO: 45)) and codon-optimized hGAA (forward: agatacgccggacattggactg (SEQ ID NO: 46), reverse: gcacgcccagcagattgaac (SEQ ID NO: 47)). The AAV serotype used was AAV8 (Zincarelli et al., Mol Ther. 2008 Jun;16(6):1073-80).
[0205] In vitro experiments Human liver cancer cells (HuH7) were seeded in a 6-well plate (5 × 10 5 Cells were transfected at 1000 x g (cells / well) using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's instructions. 72 hours after transfection, cells were harvested and analyzed for GAA activity and Western blot analysis.
[0206] For enzyme uptake experiments, HuH7 cells were seeded in T75 well plates (1 × 10 7 HuH7-conditioned medium was collected and used to culture fibroblasts derived from a Pompe disease patient (GMO 20124 GSDII 3p). After 72 hours of culture, the fibroblasts were washed three times with PBS, harvested, and analyzed by Western blot analysis.
[0207] Mouse studies Wild-type C57BL / 6 mice were purchased from Charles River (Charles River, France). Gaa- / - mice were generated by targeted disruption of exon 6 (Raben N. et al., J Biol Chem. 1998 Jul 24;273(30):19086-92). Gaa- / - mice on a C57BL / 6J / 129X1 / SvJ background were used. Male littermates of affected Gaa- / - and unaffected Gaa+ / + mice were used. AAV vectors were delivered to 1. adult mice via the tail vein in a volume of 0.2 ml. Experimental groups were sized to allow statistical analysis, with all animals included in the analysis and no outliers excluded. Mice were randomly assigned to experimental groups, and personnel performing vector delivery and functional analysis were blinded to the identity of the groups.
[0208] GAA activity GAA activity was measured in mouse plasma (1 / 1000 to 1 / 2000 dilutions) and tissues. Snap-frozen tissue was homogenized in di UltraPure™ DNase / RNase-free distilled water (Thermo Fisher Scientific). 50 to 100 mg of tissue was weighed, homogenized, and centrifuged at 10,000 × g for 20 minutes to collect the supernatant. Enzyme reactions were set up in a 96-well plate using 10 μl of sample (plasma or tissue homogenate) and 20 μl of the substrate 4MU-alpha-D-glucoside. The reaction mixture was incubated at 37°C for 1 hour and then stopped by adding 150 μl of sodium carbonate buffer, pH 10.5. Using a standard curve (0–2500 pmol / μl 4MU), fluorescent 4MU released from each reaction mixture was measured at 449 nm (emission) and 360 nm (excitation) using an EnSpire Alpha plate reader (Perkin-Elmer). Protein concentrations of clarified supernatants were quantified by BCA (Thermo Fisher Scientific). To calculate GAA activity, the concentration of released 4MU was divided by the sample protein concentration, and activity was reported as nmol / hour / mg protein.
[0209] Western blot analysis HuH7 and fibroblast cell lysates were prepared using 10 mM PBS (pH 7.4) containing 1% Triton-X100 and protease inhibitors (Roche Diagnostics). Western blots of mouse plasma were performed on samples diluted 1:4 in distilled water. Mouse tissues were prepared for GAA activity as indicated. Protein concentrations were determined using the BCA protein assay (Thermo Fisher Scientific). SDS-page electrophoresis was performed on 4-12% polyacrylamide gels. After transfer, membranes were blocked with Odyssey buffer (Li-Cor Biosciences) and incubated with anti-GAA antibody (rabbit monoclonal, Abcam) or anti-vinculin (mouse monoclonal, Sigma-Aldrich). Membranes were washed, incubated with the appropriate secondary antibody (Li-Cor Biosciences), and visualized using the Odyssey imaging system (Li-Cor Biosciences).
[0210] Detection of anti-GAA antibodies Anti-GAA antibody measurements were performed according to published protocols. Briefly, maxisorp 96-well plates (Thermo Fisher Scientific) were coated with 1 μg / ml rhGAA. An IgG standard curve was generated by coating duplicate wells with 1-2 serial dilutions of commercially available mouse (Sigma Aldrich) recombinant IgG directly. Anti-mouse (Southern Biotech) IgG secondary antibody was used as the secondary antibody.
[0211] result 1. Cloning of GAA variants in AAV plasmids To improve the CNS targeting of GAA, we first selected five heterologous domains: 1. apolipoprotein B domain (ApoB), 2. apolipoprotein E domain (ApoE), 3. spargin, 4. neurotensin amino acids 1-13 (NT1-13), and neurotensin amino acids 9-13 (NT9-13). ApoB and ApoE domains are ligands for the LDL receptor and have previously been shown to enhance CNS targeting when conjugated to proteins (Bockenhoff A. et al., J. Neurosci., 2014, Vol. 34, No. 9, pp. 3122-3129; Sorrentino NC et al., EMBO Mol. Med., 2013, Vol. 5, No. 5, pp. 675-690; Spencer et al., PNAS 2007, Vol. 104, No. 18, pp. 7594-7599; Gleitz HFE et al., EMBO Mol. Med. 2018). In contrast, the sortilin ligands, spardin peptides NT1-13 and NT9-13, have not previously been conjugated to other proteins and / or utilized for CNS targeting.
[0212] ApoB, ApoE, spardin, NT1-13, and NT9-13 peptides were inserted into the N-terminus of the sp7-Δ42-GAAco variant [Puzzo F. et al., Sci Transl Med. 2017 Nov 29;9(418), Patent Application WO 2018 / 046774] to generate the sp7-ApoB-Δ42-GAAco variant (abbreviated as HD-ApoB), the sp7-ApoE-Δ42-GAAco variant (abbreviated as HD-ApoE), the sp7-spardin-Δ42-GAAco variant (abbreviated as HD-spardin), the sp7-NT1-13-Δ42-GAAco variant (abbreviated as HD-NT1-13 spardin), and the sp7-NT9-13-Δ42-GAAco variant (abbreviated as HD-NT9-13) (Figure 1). An amino acid linker (3 amino acids, Maga JA et al., J Biol Chem. 2013;288(3):1428-1438.) was placed between the stability domain and GAA to ensure proper enzyme folding (Figure 1).
[0213] To achieve efficient expression in the liver, all sp7-Δ42-GAAco variants were cloned into expression cassettes under the control of the human alpha-1 antitrypsin (hAAT) promoter and the hepatocyte-restricted apolipoprotein E (ApoE) enhancer. All transgene expression cassettes encoding sp7-Δ42-GAAco variants contained the same regulatory elements previously described [Puzzo F. et al., Sci Transl Med. 2017 Nov 29;9(418), Figure 1]: - AAV cis-packaging backbone containing two ITR sequences from AAV2 required for packaging of the viral genome - Apolipoprotein E (ApoE) hepatocyte control region enhancer - Hepatocyte-specific human alpha1-antitrypsin (hAAT) promoter - Human hemoglobin β-subunit synthesis intron (HBB2.1) to stabilize mRNA and enhance protein expression - A codon-optimized version of the GAA coding sequence lacking the endogenous signal peptide - Heterologous signal peptide (sp7) to enable GAA secretion - Bovine growth hormone (bGH) polyadenylation signal.
[0214] 2. Analysis of GAA Variants in Human Hepatocyte Cultures The production and enzymatic activity of GAA variants containing heterologous domains [sp7-ApoB-Δ42-GAAco (HD-ApoB), sp7-ApoE-Δ42-GAAco (HD-ApoE), sp7-spardin-Δ42-GAAco (HD-spardin), sp7-NT1-13-Δ42-GAAco (HD-NT1-13), and sp7-NT9-13-Δ42-GAAco variant (HD-NT9-13)] were first tested in culture in a human hepatocyte cell line (HuH7) by transient transfection with each pAAV plasmid. A variant lacking the heterologous domain (sp7-Δ42-GAAco, abbreviated as HD0) was used as a positive control. Three independent transient transfections of HuH7 cells were performed (Figure 2). Cells were harvested 72 hours after transfection, and GAA enzyme activity was measured in cell lysates (Figure 2). Compared to HD0, only the HD-spardin, HD-NT1-13, and HD-NT9-13 variants showed preserved enzyme activity in cell lysates, indicating proper enzyme production and maturation (Figure 2). HD-ApoE (Figure 2), which resulted in undetectable GAA activity in cells, was not subjected to further analysis.
[0215] 3. Analysis of GAA variants in a GAA knockout (GAA- / -) mouse Pompe disease model after AAV-mediated hepatic gene transfer We tested the therapeutic efficacy of chimeric HD-ApoB and HD-spardin GAA variants in a Gaa- / - mouse Pompe disease model after AAV liver gene transfer. We generated AAV8 vectors encoding each variant: sp7-ApoB-Δ42-GAAco (HD-ApoB) and sp7-spardin-Δ42-GAAco (HD-spardin). An AAV8 vector encoding the GAA variant sp7-Δ42-GAAco (HD0), lacking the heterologous domain, was used as a positive control. The AAV8 vectors were generated to efficiently transduce mouse hepatocytes. Two-month-old Gaa- / - mice (n = 6 per group) were intravenously injected with AAV8 vectors encoding HD-ApoB, HD-spardin, or HD0 as a comparison (vector dose: 5 × 10 11 PBS-treated littermate Gaa- / - mice (n = 6) were used as diseased controls (Ctrl). Littermate Gaa+ / + mice (n = 5) were used as non-diseased controls. The follow-up period of the study was 4 months.
[0216] Plasma samples were collected 4 months after treatment and analyzed to measure circulating GAA activity (Figure 3) and protein content (Figure 4). Circulating GAA activity was not significantly different between HD-spardin and HD0, but significantly lower activity was achieved in the HD-ApoB-treated group (Figure 3). Secretion of circulating GAA was readily confirmed in the plasma of all mice treated with AAV vectors at the end of the study (4 months after treatment) by Western blot analysis using an anti-GAA antibody (Figure 4A). Quantification of the GAA band (Figure 4B) showed no significant difference between HD-spardin and HD0, but significantly lower enzyme content was achieved in the HD-ApoB-treated group (Figure 4B), confirming the activity data (Figure 3). Overall, these data suggest that the chimeric HD-spardin variants are efficiently produced and secreted by hepatocytes after AAV liver gene transfer and possess preserved enzymatic activity.
[0217] To evaluate the therapeutic efficacy of the chimeric GAA variant, we then measured the amount of glycogen in the brain (Fig. 5). Notably, in the brain, glycogen clearance was significantly improved in Gaa- / - mice treated with the HD-spardin vector compared with both the HD-ApoB and HD0 vectors (Fig. 5). These results demonstrate the superiority of the HD-spardin chimeric polypeptide in terms of brain uptake and GAA activity in the brain.
[0218] Glycogen content was also measured in muscle (heart, triceps) and spinal cord (Figure 6). As expected, glycogen content was increased in all tissues of PBS-treated Gaa- / - mice compared with Gaa+ / + mice (Figure 6). Significant glycogen clearance was observed in the muscle and CNS of all AAV-treated cohorts (Figure 6). However, glycogen content in the CNS of AAV-treated Gaa- / - mice was still higher than that measured in Gaa+ / + mice. Notably, glycogen clearance was significantly improved in the spinal cord of Gaa- / - mice treated with the HD-spardin vector compared with the HD-ApoB vector (Figure 6C).
[0219] Finally, we evaluated the immunogenicity of the HD-spardin variants by measuring anti-GAA immunoglobulin G (IgG) in mouse plasma 1 and 4 months after vector administration (Fig. 7). No significant anti-GAA humoral immune response was observed in mice treated with the HD-spardin variants compared with HD0 (Fig. 7). Low (<1 μg / mL) and sporadic anti-GAA IgG was detected at 1 month, but returned to 0 by the end of the study, as observed in a previous AAV liver gene transfer study using secreted GAA [Puzzo F. et al., Sci Transl Med. 2017 Nov 29;9(418)] (Fig. 7).
[0220] Additionally, we assessed the uptake of chimeric GAA variants in Pompe disease fibroblasts in culture and demonstrated that the HD-spardin variants were readily internalized and matured within the cells (data not shown).
[0221] In summary, a chimeric GAA variant containing the spardin heterologous domain (abbreviated as HD-spardin) resulted in the preservation of GAA enzyme secretion and activity, and improved correction of pathological accumulation of glycogen in the CNS, specifically the brain, in the absence of an immune response in a mouse Pompe disease model.
Claims
1. 1. A nucleic acid molecule encoding a chimeric polypeptide comprising a peptide of interest fused to one or more heterologous moieties, at least one of which is - a spargin peptide encoded by the nucleotide sequence of SEQ ID NO: 14 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity to the nucleotide sequence of SEQ ID NO: 14, - a neurotensin peptide encoded by the nucleotide sequence of SEQ ID NO: 15 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to the nucleotide sequence of SEQ ID NO: 15, or - a fragment of a neurotensin peptide encoded by the nucleotide sequence of SEQ ID NO: 16 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to the nucleotide sequence of SEQ ID NO: 16, A nucleic acid molecule which is a ligand of a sortilin receptor selected from the group consisting of:
2. The nucleic acid molecule of claim 1, wherein the peptide of interest is a functional GAA polypeptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 3 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 3.
3. 3. The nucleic acid molecule of claim 1 or 2, wherein the peptide of interest is a functional GAA polypeptide corresponding to a truncated form of GAA, which is preferably shortened by 42 consecutive amino acids at its N-terminus compared to GAA, and which is more preferably encoded by the nucleotide sequence of SEQ ID NO: 10 or by a nucleotide sequence having at least 85% identity, preferably at least 90% identity, to the nucleotide sequence of SEQ ID NO:
10.
4. 4. The nucleic acid molecule of claim 1, wherein the heterologous moiety is fused to the N-terminus of the peptide of interest.
5. 5. The nucleic acid molecule according to any one of claims 1 to 4, further comprising a signal peptide having an amino acid sequence selected in the group consisting of SEQ ID NOs: 18 to 22, preferably SEQ ID NO:
21.
6. 6. A nucleic acid construct comprising the nucleic acid molecule of any one of claims 1 to 5 operably linked to a promoter, optionally further comprising an intron.
7. 7. The nucleic acid construct according to claim 6, comprising a promoter, an intron, a nucleic acid molecule according to claims 1 to 5, and a polyadenylation signal, preferably in this order.
8. A vector, such as a viral vector, preferably a retroviral vector, such as a lentiviral vector, or an AAV vector, comprising a nucleic acid molecule or a nucleic acid construct according to any one of claims 1 to 7.
9. Single-stranded or double-stranded self-complementary AAV vectors, preferably capsids derived from AAV, such as AAV1 capsid, AAV2 capsid, variant AAV2 capsid, AAV3 capsid, variant AAV3 capsid, AAV3B capsid, variant AAV3B capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, variant AAV6 capsid, AAV7 capsid, AAV8 capsid, capsid, AAV9 capsid, AAV10 capsid, such as AAVcy10 capsid and AAVrh10 capsid, AAVrh74 capsid, AAVdj capsid, AAVAnc80 capsid, AAV-LK03 capsid, AAV2i8 capsid, and porcine AAV capsids, such as AAVpo4 capsid and AAVpo6 capsid, or chimeric capsids, The AAV vector more preferably has an AAV8, AAV9, AAVrh74, or AAV2i8 capsid, particularly an AAV8, AAV9, or AAVrh74 capsid, more particularly an AAV8 capsid. The vector of claim 8.
10. 10. An isolated cell transformed with a nucleic acid molecule according to any one of claims 1 to 5, a nucleic acid construct according to claims 6 to 7, or a vector according to any one of claims 8 to 9.
11. A chimeric polypeptide encoded by the nucleic acid molecule of any one of claims 1 to 5.
12. 12. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 1 to 5, a nucleic acid construct according to claim 6 or 7, a vector according to claim 8 or 9, an isolated cell according to claim 10, or a chimeric polypeptide according to claim 11 in a pharmaceutically acceptable carrier.
13. A nucleic acid molecule according to any one of claims 1 to 5, a nucleic acid construct according to claim 6 or 7, a vector according to claim 8 or 9, an isolated cell according to claim 10, or a chimeric polypeptide according to claim 11, for use as a medicament.
14. Lysosomal storage diseases, specifically glycogen storage diseases (GSDs), for example, GSD II (Pompe disease), mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II), mucopolysaccharidosis type IIIA (MPS IIIA), mucopolysaccharidosis type IIIB (MPS IIIB), mucopolysaccharidosis type IIIC (MPS IIIC), mucopolysaccharidosis type IIID (MPS IIID), mucopolysaccharidosis type VII (MPSV II), metachromatic leukodystrophy (MLD), Gaucher disease type 2, Gaucher disease type 3, GM1 gangliosidosis, Tay-Sachs disease, Sandhoff disease, Fabry disease, Krabbe disease, Niemann-Pick disease type A, metachromatic leukodystrophy, Farber disease, α-mannosidosis, β-mannosidosis, Schindler disease, sialidosis, neuronal ceroid lipofus 12. The nucleic acid molecule of any one of claims 1 to 5, the nucleic acid construct of claim 6 or 7, the vector of claim 8 or 9, the cell of claim 10, or the chimeric polypeptide of claim 11, for use in a method for treating mucolipidosis type 1 (NCL1), neuronal ceroid lipofuscinosis type 2 (NCL2), multiple sulfatase deficiency (MSD), mucolipidosis type II, mucolipidosis type IIIA, galactosialidosis, Niemann-Pick disease type C, GM2 activator protein deficiency, Danon disease, Salla disease, NCL3 disease, or mucolipidosis type IV, in particular for treating GSDII (Pompe disease).
Citation Information
Patent Citations
Lysosomal targeting and uses thereof
WO2016025523A1
Acid-alpha glucosidase variants and uses thereof
WO2018046774A1
EP19305455.8
Improved constructs for expressing lysosomal polypeptides
WO2004064750A2
Compositions and methods to prevent AAV vector aggregation
WO2005118792A1