Compounds and methods for reducing LRRK2 expression
Modified oligonucleotides targeting LRRK2 nucleic acid reduce LRRK2 expression, addressing the lack of effective treatments for Parkinson's disease by improving motor function and reducing neuropathy and aggregates.
Patent Information
- Application Number
- JP2025076009
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-06-27
- Filing Date
- 2025-05-01
- Publication Date
- 2025-08-20
AI Technical Summary
Current treatments for neurodegenerative diseases, particularly Parkinson's disease, lack effective options, especially for non-LRRK2-mediated cases, and there is a need for compounds and methods to reduce LRRK2 expression to ameliorate symptoms such as ataxia, neuropathy, and aggregate formation.
Development of oligomeric compounds, specifically modified oligonucleotides with 90% complementarity to LRRK2 nucleic acid, incorporating modified sugars, sugar surrogates, and internucleoside linkages, to reduce LRRK2 RNA and protein levels, thereby targeting LRRK2-mediated and non-LRRK2-mediated Parkinson's disease.
The modified oligonucleotides effectively decrease LRRK2 expression, leading to improved motor function, reduced neuropathy, and decreased aggregate formation, providing therapeutic benefits for Parkinson's disease.
Smart Images

Figure 2025121956000001 
Figure 2025121956000002 
Figure 2025121956000003
Abstract
Description
[Technical Field]
[0001] Sequence Listing This application has been filed in electronic format with a Sequence Listing. The Sequence Listing is provided under the file name BIOL0324WOSEQ_ST25.txt, created on June 14, 2019, and is 1.12 MB in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of leucine-rich repeat kinase 2 (LRRK2) RNA in cells or animals, and in certain instances, for reducing the amount of LRRK2 protein in cells or animals. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease. Such symptoms and characteristics include ataxia, neuropathy, and aggregate formation. Such neurodegenerative diseases include Parkinson's disease. [Background technology]
[0003] The LRRK2 gene encodes a protein with an armadillo repeat (ARM) domain, an ankyrin repeat (ANK) domain, a leucine-rich repeat (LRR) domain, a kinase domain, a RAS domain, a GTPase domain, and a WD40 domain. This protein is primarily present in the cytoplasm but also associates with the outer mitochondrial membrane. One segment of the LRRK2 protein is leucine-rich and may be involved in signal transduction and cytoskeletal assembly. Other portions of the LRRK2 protein are also thought to be involved in protein-protein interactions. Further studies have shown that the LRRK2 protein has enzymatic functions known as kinase activity, including phosphorylation and GTPase activity. LRRK2 is active in the brain and other tissues throughout the body.
[0004] Genome-wide association studies have linked LRRK2 to Parkinson's disease. Indeed, LRRK2 is the largest known genetic contributor to Parkinson's disease. Despite this, Parkinson's disease is not considered a genetic disorder. The majority of Parkinson's disease cases are idiopathic. Approximately 10 percent of Parkinson's disease cases are linked to genetic causes. Mutations in the LRRK2 gene are the most common cause of Parkinson's disease in this relatively small group, accounting for 1 to 2 percent of all Parkinson's disease cases.
[0005] Currently, there is a lack of acceptable options for treating neurodegenerative diseases such as Parkinson's disease, including non-LRRK2-mediated Parkinson's disease. Accordingly, it is a goal herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases. Summary of the Invention
[0006] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of LRRK2 RNA, and in certain embodiments, for reducing the amount of LRRK2 protein in a cell or animal. In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the animal has Parkinson's disease. In certain embodiments, compounds useful for reducing LRRK2 RNA expression are oligomeric compounds. In certain embodiments, compounds useful for reducing LRRK2 RNA expression are modified oligonucleotides.
[0007] Also provided are methods useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is Parkinson's disease. In embodiments, the Parkinson's disease is either LRRK2-mediated Parkinson's disease or non-LRRK2-mediated Parkinson's disease. In certain embodiments, the symptoms or characteristics include ataxia, neuropathy, and aggregate formation. In certain embodiments, improvement of these symptoms results in improved motor function, reduced neuropathy, and a reduction in the number of aggregates. DETAILED DESCRIPTION OF THE INVENTION
[0008] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components comprising two or more subunits, unless expressly stated otherwise.
[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, listed in this application, including but not limited to patents, patent applications, articles, books, and papers, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.
[0010] definition Unless specific definitions are provided, the terminology used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other materials referenced throughout this disclosure are incorporated herein by reference in their entirety.
[0011] Unless otherwise indicated, the following terms have the following meanings:
[0012] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).
[0013] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.
[0014] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.
[0015] As used herein, "administering" means providing a pharmaceutical agent to an animal.
[0016] As used herein, "animal" means a human or non-human animal.
[0017] As used herein, "antisense activity" refers to any detectable and / or measurable change attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.
[0018] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.
[0019] As used herein, "ameliorating" in the context of treatment refers to an improvement in at least one symptom relative to the same symptom in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of the symptom, or a delay in the onset of the symptom, or a delay in the progression of the severity or frequency of the symptom. In certain embodiments, the symptoms or characteristics are ataxia, neuropathy, and aggregate formation. In certain embodiments, the improvement of these symptoms results in improved motor function, reduced neuropathy, and a reduction in the number of aggregates.
[0020] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0021] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
[0022] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, eg, in a cell, animal, or human.
[0023] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more regions thereof and another nucleic acid or one or more regions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide means that an oligonucleotide is complementary to another oligonucleotide or nucleic acid at every nucleoside of the oligonucleotide.
[0024] As used herein, "composite group" means a group of atoms that is directly attached to an oligonucleotide. The composite group includes a composite moiety and a composite linker that attaches the composite moiety to the oligonucleotide.
[0025] As used herein, "composite linker" means a single bond or group of atoms that comprises at least one bond connecting a composite moiety to an oligonucleotide.
[0026] As used herein, "conjugated moiety" means a group of atoms that is attached to an oligonucleotide via a conjugated linker.
[0027] As used herein, "adjacent" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "adjacent nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.
[0028] As used herein, "constrained ethyl" or "cEt" or "cEt-modified sugar" means a β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.
[0029] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar.
[0030] As used herein, "chirally enriched population" refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population containing a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom. A chirally enriched population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.
[0031] As used herein, "gapmer" refers to a modified oligonucleotide containing an internal region having multiple nucleosides that support RNase H cleavage, interspaced between external regions having one or more nucleosides, where the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions. The internal region may be referred to as the "gap," and the external regions may be referred to as the "wings." Unless otherwise indicated, "gapmer" refers to the sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides in the gap of a gapmer are unmodified 2'-deoxyribosyl. Thus, "MOE gapmer" refers to a gapmer having a 2'-MOE nucleoside sugar motif in both the wings and the 2'-deoxynucleoside gap. Unless otherwise indicated, MOE gapmers may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.
[0032] As used herein, a "hotspot region" is a range of nucleobases of a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
[0033] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
[0034] As used herein, the term "internucleoside linkage" refers to a covalent bond between adjacent nucleosides within an oligonucleotide. As used herein, a "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom. It is a decorated internucleoside bond.
[0035] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of the oligomeric compound. The linker nucleoside is not considered part of the oligonucleotide moiety of the oligomeric compound, even if it is adjacent to the oligonucleotide.
[0036] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification, such as a substitution, that does not form a bridge between the two atoms of the sugar but rather forms a second ring.
[0037] As used herein, "mismatched" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.
[0038] As used herein, "MOE" refers to methoxyethyl. "2'-MOE" or "2'-MOE modified sugar" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of the ribosyl sugar moiety. As used herein, "2'-MOE nucleoside" refers to a nucleoside containing a 2'-MOE modified sugar.
[0039] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0040] As used herein, unless otherwise specified, "RNA" refers to RNA transcripts that encode proteins and include pre-mRNA and mature mRNA.
[0041] As used herein, "neurodegenerative disease" refers to a condition characterized by progressive loss of function or structure, including loss of motor function and death of nerve cells. In certain embodiments, the neurodegenerative disease is Parkinson's disease. In certain embodiments, Parkinson's disease may be LRRK2-mediated Parkinson's disease or non-LRRK2-mediated Parkinson's disease.
[0042] "Non-LRRK2-mediated Parkinson's disease" is a diagnosis of Parkinson's disease that is not associated with a causative LRRK2 gene mutation. Causative LRRK2 gene mutations include G2019S, R1441C, R1441G, I2020T, and Y1699C. A diagnosis of Parkinson's disease can be achieved by any method, including evaluating an individual's medical history, signs and symptoms, and standard clinical tests or assessments. Genetic testing for mutations associated with LRRK2, such as G2019S, R1441C, R1441G, I2020T, and Y1699C, can determine whether an individual has non-LRRK2-mediated Parkinson's disease. An individual diagnosed with Parkinson's disease but without a causative LRRK2 mutation has non-LRRK2-mediated Parkinson's disease. "Identifying an animal having non-LRRK2-mediated Parkinson's disease" means identifying an animal that has been diagnosed with Parkinson's disease or is predisposed to developing Parkinson's disease without a causative LRRK2 mutation.
[0043] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a modified nucleobase is a nucleobase that has at least one modification. A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G that can pair with an unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A general base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the order of adjacent nucleobases in a nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage modifications.
[0044] As used herein, "nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides lacking a nucleobase. "Linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are present between the linked ones).
[0045] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a complex group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."
[0046] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.
[0047] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0048] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.
[0049] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.
[0050] As used herein, "prodrug" refers to a therapeutic agent that is in a form outside the body that is converted into a different form within an animal or its cells. Typically, a prodrug within an animal The conversion of is facilitated by the action of enzymes (eg, endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.
[0051] As used herein, "reducing or inhibiting the amount or activity" refers to a reduction or blocking of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a total elimination of transcriptional expression or activity.
[0052] As used herein, "RNAi compound" refers to an antisense compound that acts, at least in part, through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound regulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.
[0053] As used herein, "self-complementary" in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
[0054] As used herein, " siRNA " refers to a ribonucleic acid molecule having a double-stranded structure, comprising two antiparallel and substantially complementary nucleic acid strands.The two strands that form the double-stranded structure can be different parts of one larger RNA molecule, or can be separate RNA molecules.When the two strands are part of one larger molecule, and therefore are connected by consecutive nucleic acid bases between the 3'-end of one strand and the 5'-end of each other strand that form the double-stranded structure, the connected RNA strands are called "hairpin loops".The number of nucleotides of the RNA strands can be the same or different.
[0055] As used herein, "standard cell assay" means the assay described in Example 4 and reasonable variations thereof.
[0056] As used herein, "standard in vivo assay" means the experiment described in Example 14, and reasonable variations thereof.
[0057] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center having a random stereochemical configuration. For example, in a population of molecules containing a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of the chiral center is considered random when it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
[0058] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) deoxyribosyl moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.
[0059] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing sugar surrogates can be conjugated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.
[0060] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect.
[0061] As used herein, "target region" means the portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0062] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.
[0063] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic effect in an animal, e.g., ameliorates symptoms of a disease.
[0064] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 2 to 50 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 90% complementary to an equal length portion of an LRRK2 nucleic acid, and said modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.
[0065] Embodiment 2: An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-3847.
[0066] Embodiment 3: An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases, said portion comprising: an isometric portion of nucleobases 18,633 to 18,658 of SEQ ID NO: 2; an isometric portion of nucleobases 21,721 to 21,755 of SEQ ID NO: 2; an isometric portion of nucleobases 27,963 to 28,016 of SEQ ID NO: 2; an isometric portion of nucleobases 35,415 to 35,446 of SEQ ID NO: 2; an isometric portion of nucleobases 77,221 to 77,264 of SEQ ID NO: 2; an isometric portion of nucleobases 81,581 to 81,612 and / or 87,838 to 87,869 of SEQ ID NO: 2; an isometric portion of nucleobases 81,627 to 81,651 of SEQ ID NO: 2; an isometric portion of nucleobases 82,058 to 82,081 of SEQ ID NO: 2; an isometric portion of nucleobases 82,180 to 82,220 of SEQ ID NO: 2; an isometric portion of nucleobases 82,500 to 82,525 of SEQ ID NO: 2; an isometric portion of nucleobases 91,038 to 91,067 of SEQ ID NO: 2; an isometric portion of nucleobases 92,148 to 92,173 of SEQ ID NO: 2; an isometric portion of nucleobases 98,186 to 98,220 of SEQ ID NO: 2; an isometric portion of nucleobases 98,218 to 98,242 of SEQ ID NO: 2; an isometric portion of nucleobases 99,199 to 99,223 of SEQ ID NO: 2; an isometric portion of nucleobases 119,903 to 119,936 of SEQ ID NO: 2; or The oligomeric compound is complementary to an isometric portion of nucleobases 4,062 to 4,086 of SEQ ID NO:1.
[0067] Embodiment 4. The oligomeric compound of any of embodiments 1-3, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
[0068] Embodiment 5. The oligomeric compound of any one of embodiments 1 to 4, wherein said modified oligonucleotide comprises at least one modified nucleoside.
[0069] Embodiment 6. The oligomeric compound of embodiment 5, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
[0070] Embodiment 7. The oligomeric compound of embodiment 6, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
[0071] Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.
[0072] Embodiment 9. The oligomeric compound of any one of embodiments 5 to 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
[0073] Embodiment 10. The oligomeric compound of embodiment 9, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety, including a 2'-MOE modified sugar or a 2'-OMe modified sugar.
[0074] Embodiment 11. The oligomeric compound of any one of embodiments 5 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.
[0075] Embodiment 12. The oligomeric compound of embodiment 11, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.
[0076] Embodiment 13. The modified oligonucleotide comprises: a 5' region consisting of 1 to 5 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides, and a sugar motif comprising a 3' region consisting of 1 to 5 linked 3' region nucleosides; Each of the 5' region nucleosides and each of the 3' region nucleosides are modified 13. The oligomeric compound of any of embodiments 1-12, wherein each of said central region nucleosides comprises an unmodified 2'-deoxyribosyl sugar moiety.
[0077] Embodiment 14. The oligomeric compound of any one of embodiments 1 to 13, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
[0078] Embodiment 15. The oligomeric compound of embodiment 14, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.
[0079] Embodiment 16. The oligomeric compound of embodiment 14 or 15, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
[0080] Embodiment 17. The oligomeric compound of embodiment 14 or 16, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
[0081] Embodiment 18 The oligomeric compound of any of embodiments 14, 16, or 17, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0082] Embodiment 19. The oligomeric compound of any one of embodiments 1 to 18, wherein the modified oligonucleotide comprises at least one modified nucleobase.
[0083] Embodiment 20 The oligomeric compound of embodiment 19, wherein the modified nucleobase is 5-methylcytosine.
[0084] Embodiment 21. The oligomeric compound of any one of embodiments 1 to 20, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 20, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides.
[0085] Embodiment 22. The oligomeric compound of any one of embodiments 1 to 21, wherein the modified oligonucleotide consists of 17 or 20 linked nucleosides.
[0086] Embodiment 23. The oligomeric compound of any one of embodiments 1 to 22, consisting of the modified oligonucleotide.
[0087] Embodiment 24. The oligomeric compound of any one of embodiments 1 to 22, comprising a conjugated group comprising a conjugated moiety and a conjugated linker.
[0088] Embodiment 25. The oligomeric compound of embodiment 24, wherein the complex group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.
[0089] Embodiment 26 The oligomeric compound of embodiment 24 or 25, wherein the composite linker consists of a single bond.
[0090] Embodiment 27 The oligomeric compound of embodiment 25, wherein the composite linker is cleavable.
[0091] Embodiment 28. The oligomeric compound of embodiment 27, wherein the composite linker comprises 1 to 3 linker nucleosides.
[0092] Embodiment 29. The oligomeric compound of any one of embodiments 24 to 28, wherein the composite group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.
[0093] Embodiment 30. The oligomeric compound of any one of embodiments 24-28, wherein the composite group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.
[0094] Embodiment 31. The oligomeric compound of any one of embodiments 1 to 30, comprising a terminal group.
[0095] Embodiment 32. The oligomeric compound of any one of embodiments 1 to 31, wherein the oligomeric compound is a single-stranded oligomeric compound.
[0096] Embodiment 33. The oligomeric compound of any one of embodiments 1-27 or 29-31, wherein the oligomeric compound does not comprise a linker nucleoside.
[0097] Embodiment 34. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1 to 31 or 33.
[0098] Embodiment 35. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1 to 33 or an oligomeric duplex according to embodiment 34.
[0099] Embodiment 36. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 33 or an oligomeric duplex according to embodiment 34, and a pharmaceutically acceptable carrier or diluent.
[0100] Embodiment 37. A modified oligonucleotide of the following formula:
[0101] [ka]
[0102] Or its salt.
[0103] Embodiment 38. A modified oligonucleotide of the following formula:
[0104] [ka]
[0105] Or its salt.
[0106] Embodiment 39. A modified oligonucleotide of the following formula:
[0107] [ka]
[0108] Or its salt.
[0109] Embodiment 40. A modified oligonucleotide of the following formula:
[0110] [ka]
[0111] Or its salt.
[0112] Embodiment 41. A modified oligonucleotide of the following formula:
[0113] [ka]
[0114] Or its salt.
[0115] Embodiment 42. A modified oligonucleotide of the following formula:
[0116] [ka]
[0117] Or its salt.
[0118] Embodiment 43. The modified oligonucleotide of any one of embodiments 37 to 42, which is a sodium salt of the formula.
[0119] Embodiment 44. A modified oligonucleotide of the following formula:
[0120] [ka]
[0121] Embodiment 45. A modified oligonucleotide of the following formula:
[0122] [ka]
[0123] Embodiment 46. A modified oligonucleotide of the following formula:
[0124] [ka]
[0125] Embodiment 47. A modified oligonucleotide of the following formula:
[0126] [ka]
[0127] Embodiment 48. A modified oligonucleotide of the following formula:
[0128] [ka]
[0129] Embodiment 49. A modified oligonucleotide of the following formula:
[0130] [ka]
[0131] Embodiment 50. A chirally enriched population of modified oligonucleotides according to any one of embodiments 37 to 49, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
[0132] Embodiment 51. The chirally enriched population of embodiment 50, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.
[0133] Embodiment 52. The chirally enriched population of embodiment 50 or 51, wherein the population is enriched for modified oligonucleotides having at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.
[0134] Embodiment 53. The chirally enriched population of embodiment 50, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
[0135] Embodiment 54. The chirally enriched population of embodiment 53, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.
[0136] Embodiment 55. The chirally enriched population of embodiment 53, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.
[0137] Embodiment 56. The chirally enriched population of embodiment 50 or embodiment 53, wherein the population is enriched for modified oligonucleotides having at least three adjacent phosphorothioate internucleoside linkages in the Sp-Sp-Rp configuration in the 5' to 3' direction.
[0138] Embodiment 57. A population of modified oligonucleotides according to any one of embodiments 37 to 49, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.
[0139] Embodiment 58. A pharmaceutical composition comprising a modified oligonucleotide according to any one of embodiments 37 to 49 and a pharmaceutically acceptable diluent or carrier.
[0140] Embodiment 59. The pharmaceutical composition of embodiment 58, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid.
[0141] Embodiment 60. The pharmaceutical composition of embodiment 59, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.
[0142] Embodiment 61. A method comprising administering to an animal the pharmaceutical composition of any of embodiments 36 or 58-60.
[0143] Embodiment 62. A method for treating a disease associated with LRRK2, comprising administering to an individual having or at risk of developing a disease associated with LRRK2 a therapeutically effective amount of a pharmaceutical composition of any of embodiments 36 or 58-60, thereby treating the disease associated with LRRK2.
[0144] Embodiment 63 The method of embodiment 62, wherein the disease associated with LRRK2 is a neurodegenerative disease.
[0145] Embodiment 64. The method of embodiment 63, wherein the neurodegenerative disease is Parkinson's disease.
[0146] Embodiment 65. The method of embodiment 64, wherein at least one symptom or feature of the neurodegenerative disease is ameliorated.
[0147] Embodiment 66. The method of embodiment 65, wherein the symptom or characteristic is any of ataxia, neuropathy, and aggregate formation.
[0148] Embodiment 67. An oligomeric compound comprising a modified oligonucleotide of the following formula: Ges mCeo Teo mCeo Aes Tds Ads Tds mCds Tds Ads Ads Ads Gds Ads mCeo mCeo Ges mCes Ae (SEQ ID NO: 222); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage.
[0149] Embodiment 68. An oligomeric compound comprising a modified oligonucleotide of the following formula: Tes mCeo Aeo mCeo mCes Ads mCds Ads Ads Ads mCds Tds mCds Ads Tds Geo Geo Aes mCes Te (SEQ ID NO: 888); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage.
[0150] Embodiment 69. An oligomeric compound comprising a modified oligonucleotide of the following formula: Aes mCeo mCeo mCeo Tes Tds Tds mCds mCds Ads Tds Gds Tds Gds Ads Aeo mCeo Aes Tes Te (SEQ ID NO: 1431); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage.
[0151] Embodiment 70. An oligomeric compound comprising a modified oligonucleotide of the following formula: Aes mCeo Geo mCeo Aes mCds Tds Tds Ads Ads mCds Ads Ads Tds Ads Teo mCeo Aes Tes Ae (SEQ ID NO: 3590), wherein A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage.
[0152] Embodiment 71. An oligomeric compound comprising a modified oligonucleotide of the following formula: Aes Geo mCeo Aeo Aes Tds mCds Ads Tds Tds Gds Gds Tds Ads Gds mCeo Aeo Tes Aes mCe (SEQ ID NO: 3385), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage.
[0153] Embodiment 72. An oligomeric compound comprising a modified oligonucleotide of the following formula: mCes Geo mCes Aes mCes Tds Tds Ads Ads mCds Ads Ads Tds Ads Tds mCes Aeo Tes Aes Te (SEQ ID NO: 852), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage.
[0154] Embodiment 73 The oligomeric compound of embodiment 3, wherein the modified oligonucleotide is an RNAi compound.
[0155] Embodiment 74 The oligomeric compound of embodiment 73, wherein the RNAi compound is ssRNA or siRNA.
[0156] I. Certain Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides composed of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.
[0157] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
[0158] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions corresponding to other types of modified sugar moieties.
[0159] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be at any position of the furanosyl, including, but not limited to, the 2', 4', and / or 5' positions. In certain embodiments, one or more non-bridging substituents of a non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituent groups for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10The 2'-substituents are alkyl, and are described in Cook et al., US Pat. No. 6,531,584, Cook et al., US Pat. No. 5,859,221, and Cook et al., US Pat. No. 6,005,087. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, e.g., 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0160] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is alkyl.
[0161] In certain embodiments, 2'-substituted nucleosides non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0162] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0163] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridged sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,399,845). al., US 7,741,457, and Swayze et al. al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,022,193), et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', and each R, R a , and R b are independently H, a protecting group, or C1-C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).
[0164] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, and During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.
[0165] Additional bicyclic sugar moieties are known in the art, see, for example, Freier et al. l.,Nucleic Acids Research,1997,25(22),4429-4443、Albaek et al.,J.Org.Chem.,2006,71,7731-7740、Singh et al.,Chem.Commun.,1998,4,455-456、Koshkin et al. al.,Tetrahedron,1998,54,3607-3630、Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222、Singh et al.,J.Org.Chem.,1998,63,10035-10039、Srivastava et al. al., J.Am.Chem.Soc.,2007,129,8362-8379、Wengel et al.,US7,053,207、Imanishi et al.,US6,268,490、Imanishi et al.US6,770,748、Imanishi et al.,USRE44,779、Wengel et al.,US6,794,499、Wengel et al.,US6,670,461、Wengel et al.,US7,034,133、Wengel et al.,US8,080,644、Wengel et al., US8,034,909, Wengel et al., US8,153,365, Wengel et al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al., WO2007 / 134181, Seth et al. al., US 7,547,684, Seth et al., US 7,666,854, Seth et al., US 8,088,746, Seth et al., US 7,750,131, Seth et al., US 8,030,467, Seth et al., US 8,268,980, Seth et al., US 8,546,556, Seth et al., US 8,530,640, Migawa et al., US 9,012,421, Seth et al., US 8,501,805, and U.S. Patent Publications Allerson et al., US 2008 / 0039618 and Migawa et al., US 2015 / 0191727.
[0166] In certain embodiments, bicyclic sugar moieties and nucleosides conjugated to such bicyclic sugar moieties are further defined by their isomeric configuration, for example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.
[0167] [ka]
[0168] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been conjugated to oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified in the embodiments exemplified herein, unless otherwise specified, they are in the β-D configuration.
[0169] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridging sugars).
[0170] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents, as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'-position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5'-position.
[0171] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:
[0172] [ka]
[0173] ("F-HNA", see, e.g., Swayze et al., US 8,088,904, Swayze et al., US 8,440,803, Swayze et al., US 8,796,437, and Swayze et al., US 9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides containing additional modified THP compounds having the formula:
[0174] [ka]
[0175] wherein, independently for each of the modified THP nucleosides: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is a modified THP is an internucleoside linking group connecting the nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugated group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.
[0176] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0177] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and two or more heteroatoms. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure:
[0178] [ka]
[0179] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents from the morpholino structures described above. Such sugar surrogates are referred to herein as "modified morpholinos."
[0180] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.
[0181] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in the modified nucleosides.
[0182] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, which are called abasic nucleosides.
[0183] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8 -substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, general bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0184] Publications teaching the preparation of certain of the above modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Manohara et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,000; 66, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al. al.,US5,459,255、Froehler et al.,US5,484,908、Matteucci et al.,US5,502,177、Hawkins et al.,US5,525,711、Haralambidis et al.,US5,552,540、Cook et al al.,US5,587,469、Froehler et al.,US5,594,121、Switzer et al.,US5,596,091、Cook et al.,US5,614,617、Froehler et al.,US5,645,985、Cook et al al.,US5,681,941 Cook et al.,US5,811,534 Cook et al.,US5,750,692 Cook et al.,US5,948,903 Cook et al.,US5,587,470 Cook et al al.,US5,763,588;Froehler et al.,US5,830,653;Cook et al.,US5,808,027;Cook et al.,6,166,199.Matteucci et al.,US6,005,096.
[0185] 3. The smooth surface of the snowflake In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.Two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom.Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphate, including phosphodiester linkage ("P=O") (also referred to as unmodified or native linkage), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P=S"), and phosphorodithioate ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to natural phosphate linkages. In certain embodiments, internucleoside linkages containing chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.
[0186] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. The chirality of the modified oligonucleotides is enriched. In certain embodiments, the specific arrangement of the phosphorothioate linkages is present in at least 65% of the molecules in the population. In certain embodiments, the specific arrangement of the phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, the specific arrangement of the phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, the specific arrangement of the phosphorothioate linkages is present in at least 90% of the molecules in the population. In certain embodiments, the specific arrangement of the phosphorothioate linkages is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, the methods described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase:
[0187] [ka]
[0188] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.
[0189] Neutral internucleoside linkages include, without limitation, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH moieties.
[0190] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).
[0191] 1. A specific glycomotif In certain embodiments, oligonucleotides comprise one or more types of modified and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in defined patterns or sugar motifs, and in certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.
[0192] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside in the wing being different from at least a portion of the sugar moiety of the nucleoside in the gap. Specifically, at least the sugar moiety of the nucleoside in each wing most adjacent to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).
[0193] In certain embodiments, a gapmer wing comprises 1 to 5 nucleosides. In certain embodiments, each nucleoside in each gapmer wing is a modified nucleoside. In certain embodiments, at least one nucleoside in each gapmer wing is a modified nucleoside. In certain embodiments, at least two nucleosides in each gapmer wing are modified nucleosides. In certain embodiments, at least three nucleosides in each gapmer wing are modified nucleosides. In certain embodiments, at least four nucleosides in each gapmer wing are modified nucleosides.
[0194] In certain embodiments, the gapmer gap contains 7 to 12 nucleosides. In certain embodiments, each nucleoside in the gapmer gap is an unmodified 2'-deoxynucleoside. In certain embodiments, at least one nucleoside in the gapmer gap is a modified nucleoside.
[0195] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides, and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside.
[0196] In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, and each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.
[0197] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer can be provided using the notation [nucleoside number in the 5'-wing]-[nucleoside number in the gap]-[nucleoside number in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleosides include unmodified deoxynucleoside sugars. Thus, a 5-10-5 MOE gapmer consists of five linked MOE-modified nucleosides in the 5'-wing, ten deoxynucleosides in the gap, and five linked MOE nucleosides in the 3'-wing.
[0198] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.
[0199] 2. Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its region in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases in the modified oligonucleotide are unmodified nucleobases.
[0200] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5'-end of the oligonucleotide.
[0201] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.
[0202] 3. Certain internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
[0203] C. A certain length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides ranging from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of target RNA in an oocyte injection model. 25 nucleobase-long oligonucleotides with 8 or 11 mismatches near the end of the oligonucleotide were able to direct specific cleavage of target RNA, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was observed with 13 nucleobase-long oligonucleotides containing 1 or 3 mismatches. This was achieved using oligonucleotides.
[0204] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of linked nucleosides X through Y, where X represents the smallest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30 0, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16 ~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20,19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 2 Consisting of 2 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
[0205] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are conjugated to modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modifications, motif, and overall length. In certain embodiments, each of such parameters is independent of the other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may or may not be modified and may or may not follow the gapmer modification pattern of sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides are characterized by the gapmer pattern of sugar modifications. The nucleic acid may contain one or more modified nucleobases of the formula: Unless otherwise indicated, all modifications are independent of the nucleobase sequence.
[0206] E. Certain populations of modified oligonucleotides A population of modified oligonucleotides, in which all of the modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chirally enriched population. All of the chiral centers of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched in β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.
[0207] F. Nucleic Acid Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence.In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.
[0208] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugated groups and / or terminal groups. A conjugated group comprises one or more conjugated moieties and a conjugated linker connecting the conjugated moieties to the oligonucleotide. A conjugated group can be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugated group can be attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugated group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, a conjugated group or terminal group is attached at the 3'- and / or 5'-terminus of the oligonucleotide. In certain such embodiments, a conjugated group (or terminal group) is attached at the 3'-terminus of the oligonucleotide. In certain embodiments, a conjugated group is attached proximal to the 3'-terminus of the oligonucleotide. In certain embodiments, a conjugated group (or terminal group) is attached at the 5'-terminus of the oligonucleotide. In certain embodiments, a conjugated group is attached proximal to the 5'-terminus of the oligonucleotide.
[0209] Examples of terminal groups include, but are not limited to, composite groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides, independently modified or unmodified.
[0210] A. A specific complex group In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugated group modifies one or more properties of the conjugated oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugated group confers new properties to the conjugated oligonucleotide, e.g., a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugated groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, such as dodecane-diol or undecyl residues (Saison-Behmoaras et al. al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamines or polyethylene glycol chains (Manoharan et al. al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc cluster (e.g., WO2014 / 179620).
[0211] 1. Composite part Conjugated moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.
[0212] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.
[0213] 2. Composite Linker The conjugated moiety is linked to the oligonucleotide by a conjugated linker.In certain oligomeric compounds, the conjugated linker is a single chemical bond (i.e., the conjugated moiety is directly linked to the oligonucleotide by a single bond).In certain embodiments, the conjugated linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.
[0214] In certain embodiments, the composite linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the composite linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the composite linker comprises a group selected from alkyl and amido groups. In certain embodiments, the composite linker comprises a group selected from alkyl and ether groups. In certain embodiments, the composite linker comprises at least one phosphorus moiety. In certain embodiments, the composite linker comprises at least one phosphate group. In certain embodiments, the composite linker comprises at least one neutral linking group.
[0215] In certain embodiments, composite linkers, including those described above, are known in the art to be useful for attaching bifunctional linking moieties, e.g., composite groups, to parent compounds such as the oligonucleotides provided herein. Generally, bifunctional linking moieties contain at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the composite group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0216] Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated linkers include, but are not limited to, substituted or unsubstituted C-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C-C 10 Alkynyl is included, and a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0217] In certain embodiments, a composite linker comprises 1 to 10 linker nucleosides. In certain embodiments, a composite linker comprises 2 to 5 linker nucleosides. In certain embodiments, a composite linker comprises exactly 3 linker nucleosides. In certain embodiments, a composite linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, a linker nucleoside is unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleoside is typically Typically, they are linked to each other and to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.
[0218] As used herein, linker nucleosides are not considered part of an oligonucleotide. Thus, in embodiments where an oligomeric compound includes an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the oligomeric compound also includes a composite group containing a composite linker containing linker nucleosides, those linker nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may include (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a composite group containing 1 to 10 linker nucleosides contiguous with nucleosides in the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound exceeds 30. Alternatively, an oligomeric compound may include a modified oligonucleotide consisting of 8 to 30 nucleosides and no composite group. The total number of adjacent linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise specified, composite linkers contain 10 or fewer linker nucleosides. In certain embodiments, composite linkers contain 5 or fewer linker nucleosides. In certain embodiments, composite linkers contain 3 or fewer linker nucleosides. In certain embodiments, composite linkers contain 2 or fewer linker nucleosides. In certain embodiments, composite linkers contain 1 or fewer linker nucleosides.
[0219] In certain embodiments, it is desirable to cleave the composite group from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain composite moieties are well taken up by certain cell types, but once the oligomeric compound is taken up, it is desirable to cleave the composite group to release the uncomplexed or parent oligonucleotide. Thus, certain composite linkers can contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms with 1, 2, 3, 4, or 5 or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.
[0220] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugated moiety or conjugated group.
[0221] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the composite linker or composite moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0222] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include 5'-phosphanates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.
[0223] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a region complementary to the target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a composite group, and (2) a second modified or unmodified oligonucleotide and optionally a composite group. Either or both of the oligomeric compounds of the oligomeric duplex may comprise a composite group. The oligonucleotides of each oligomeric compound of the oligomeric duplex may comprise non-complementary overhanging nucleosides.
[0224] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid and produce at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce or inhibit the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds contain a nucleobase sequence that hybridizes to one or more target nucleic acids, produces one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids in a manner that produces significant undesired antisense activity, or does not hybridize to one or more non-target nucleic acids.
[0225] In certain antisense activities, the hybridization of antisense compounds to target nucleic acids results in the recruitment of proteins that cleave target nucleic acids. For example, certain antisense compounds result in RNase H-mediated cleavage of target nucleic acids. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.
[0226] In certain antisense activities, antisense compounds or portions of antisense compounds are incorporated into RNA-induced silencing complexes (RISCs), ultimately resulting in the cleavage of target nucleic acids. For example, certain antisense compounds cause the cleavage of target nucleic acids by Argonaute. The antisense compounds incorporated into RISCs are RNAi compounds. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA). It could be.
[0227] In certain embodiments, the hybridization of the antisense compound to the target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid.In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in the alteration of the splicing of the target nucleic acid.In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and proteins or other nucleic acids.In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in the alteration of the translation of the target nucleic acid.
[0228] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in the phenotype of a cell or animal.
[0229] V. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, which comprise introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from a long non-coding RNA, a short non-coding RNA, or an intronic RNA molecule.
[0230] A. Complementarity / Mismatch with Target Nucleic Acid Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches with bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, including 28 and 42 nucleobase oligonucleotides containing two or three sequences from the tandem oligonucleotide, respectively, for their ability to terminate translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest level than the 28 or 42 nucleobase oligonucleotides.
[0231] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20. 0 nucleobases in length.
[0232] In certain embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, while the activity against non-targets is reduced by a larger amount. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically positioned within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region. In certain embodiments, the mismatches are located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3'-end of the gap region. In certain embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 5'-end of the wing region. In certain embodiments, the mismatches are located at positions 4, 3, 2, or 1 from the 3'-end of the wing region.
[0233] B.LRRK2 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is LRRK2. In certain embodiments, the LRRK2 nucleic acid has the sequence set forth in SEQ ID NO:1 (GENBANK Accession No. NM_198578.3) and SEQ ID NO:2 (GENBANK Accession No. NT_029419.11 truncated from nucleotides 2759000 to 2909000).
[0234] In certain embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of LRRK2 RNA, and in certain embodiments, reduces the amount of LRRK2 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 ameliorates one or more symptoms or features of a neurodegenerative disease. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the symptoms or features are ataxia, neuropathy, and aggregate formation. In certain embodiments, contacting cells with a modified oligonucleotide complementary to SEQ ID NO:1 or SEQ ID NO:2 results in improved motor function, reduced neuropathy, and a reduced number of aggregates. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.
[0235] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system (CNS). Such tissues include brain tissues such as the cortex, substantia nigra, striatum, midbrain, and brainstem, as well as the spinal cord.
[0236] VI. Certain Pharmaceutical Compositions In certain embodiments, provided herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS comprises or consists of pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0237] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0238] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0239] In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.
[0240] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to animals, including humans. Thus, for example, the present disclosure also features pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugated groups attached to the oligonucleotide, where the conjugated groups are cleaved by endogenous nucleases in the body.
[0241] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made with a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to muscle tissue.
[0242] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0243] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody. Contains som.
[0244] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components may be varied; for example, other surfactants may be substituted for Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.
[0245] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
[0246] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in protonated (free acid) form, ionized (anionic) form, or a form associated with ionization and cations (salts), but aqueous solutions of such compounds exist in equilibrium among these forms. For example, the phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among the free acid, anionic, and salt forms. Unless otherwise indicated, the compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in ensemble forms with multiple positions, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. Drawn structures always show a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include corresponding forms as well. As used herein, structures depicting the free acid of a compound followed by the term "or a salt thereof" explicitly include all such forms, which may be fully or partially protonated / deprotonated / associated with cations. In certain instances, one or more specific cations are identified.
[0247] In certain embodiments, the oligomeric compounds disclosed herein are in an aqueous solution containing sodium. In certain embodiments, the oligomeric compounds are in an aqueous solution containing potassium. In certain embodiments, the oligomeric compounds are in artificial CSF. In certain embodiments, the oligomeric compound is in PBS. In certain embodiments, the oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0248] VII. Certain Compositions 1. Compound No. 780241 Compound No. 780241 may be characterized as a 5-10-5 MOE gapmer having the sequence (5'-3') of GCTCATATCTAAAGACCGCA (incorporated herein as SEQ ID NO: 222), wherein each of nucleosides 1-5 and 16-20 (5'-3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-deoxynucleosides. The internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0249] Compound No. 780241 may be characterized by the following chemical notation: Ges mCeo Teo mCeo Aes Tds Ads Tds mCds Tds Ads Ads Ads Gds Ads mCeo mCeo Ges mCes Ae, where: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0250] Compound No. 780241 may be represented by the following chemical structure:
[0251] [ka]
[0252] Compound No. 780241 may be represented by the following chemical structure:
[0253] [ka]
[0254] 2. Compound No. 802714 Compound No. 802714 may be characterized as a 5-10-5 MOE gapmer having the sequence (5'-3') of TCACCACAAACTCATGGACT (incorporated herein as SEQ ID NO: 888), wherein each of nucleosides 1-5 and 16-20 (5'-3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-deoxynucleosides. The internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0255] Compound No. 802714 may be characterized by the following chemical notation: Tes mCeo Aeo mCeo mCes Ads mCds Ads Ads Ads mCds Tds mCds Ads Tds Geo Geo Aes mCes Te, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0256] Compound No. 802714 may be represented by the following chemical structure:
[0257] [ka]
[0258] Compound No. 802714 may be represented by the following chemical structure:
[0259] [ka]
[0260] 3. Compound No. 803268 Compound No. 803268 may be characterized as a 5-10-5 MOE gapmer having the sequence (5'-3') of ACCCTTTCCATGTGAACATT (incorporated herein as SEQ ID NO: 1431), wherein each of nucleosides 1-5 and 16-20 (5'-3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-deoxynucleosides. The internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0261] Compound No. 803268 may be characterized by the following chemical notation: Aes mCeo mCeo mCeo Tes Tds Tds mCds mCds Ads Tds Gds Tds Gds Ads Aeo mCeo Aes Tes Te, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0262] Compound No. 803268 may be represented by the following chemical structure:
[0263] [ka]
[0264] Compound No. 803268 may be represented by the following chemical structure:
[0265] [ka]
[0266] 4. Compound No. 876031 Compound No. 876031 may be characterized as a 5-10-5 MOE gapmer having a sequence (5'-3') of ACGCACTTAACAATATCATA (incorporated herein as SEQ ID NO: 3590), wherein each of nucleosides 1-5 and 16-20 (5'-3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-deoxynucleosides. The internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0267] Compound No. 876031 may be characterized by the following chemical notation: Aes mCeo Geo mCeo Aes mCds Tds Tds Ads Ads mCds Ads Ads Tds Ads Teo mCeo Aes Tes Ae, where: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0268] Compound No. 876031 may be represented by the following chemical structure:
[0269] [ka]
[0270] Compound No. 876031 may be represented by the following chemical structure:
[0271] [ka]
[0272] 5. Compound No. 876604 Compound No. 876604 may be characterized as a 5-10-5 MOE gapmer having the sequence (5'-3') of AGCAATCATTGGTAGCATAC (incorporated herein as SEQ ID NO: 3385), wherein each of nucleosides 1-5 and 16-20 (5'-3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-deoxynucleosides. The internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0273] Compound No. 876604 may be characterized by the following chemical notation: Aes Geo mCeo Aeo Aes Tds mCds Ads Tds Tds Gds Gds Tds Ads Gds mCeo Aeo Tes Aes mCe, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0274] Compound No. 876604 may be represented by the following chemical structure:
[0275] [ka]
[0276] Compound No. 876604 may be represented by the following chemical structure:
[0277] [ka]
[0278] 6. Compound No. 934556 Compound No. 934556 may be characterized as a 5-10-5 MOE gapmer having the sequence (5'-3') of CGCACTTAACAATATCATAT (incorporated herein as SEQ ID NO: 852), wherein each of nucleosides 1-5 and 16-20 (5'-3') contains a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, and nucleosides 2-3 and 17-18 are 2'-deoxynucleosides. The internucleoside bond between 8 is a phosphodiester internucleoside bond, and the internucleoside bond between nucleosides 1-2, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 is a phosphorothioate internucleoside bond, and each cytosine is a 5-methylcytosine.
[0279] Compound No. 934556 may be characterized by the following chemical notations: mCes Geo mCes Aes mCes Tds Tds Ads Ads mCds Ads Ads Tds Ads Tds mCes Aeo Tes Aes Te, where A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0280] Compound No. 934556 may be represented by the following chemical structure:
[0281] [ka]
[0282] Compound No. 934556 may be represented by the following chemical structure:
[0283] [ka]
[0284] VIII. Specific Hot Spot Areas 1. Nucleic acid bases 18,633 to 18,658 of SEQ ID NO: 2 In certain embodiments, nucleobases 18,633-18,658 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 18,633-18,658 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 18,633-18,658 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0285] The nucleobase sequences of SEQ ID NOs: 852, 1997, 2073, 2148, 3513, and 3590 are complementary to nucleobases 18,633 to 18,658 of SEQ ID NO:2.
[0286] In certain embodiments, a modified oligonucleotide complementary to nucleobases 18,633 to 18,658 of SEQ ID NO: 2 is used in at least one single-dose assay. Achieve at least a 54% reduction of LRRK2 RNA in vitro.
[0287] 2. Nucleic acid bases 21,721 to 21,755 of SEQ ID NO: 2 In certain embodiments, nucleobases 21,721-21,755 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 21,721-21,755 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 21,721-21,755 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0288] The nucleobase sequences of SEQ ID NOs: 291, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, and 880 are complementary to nucleobases 21,721 to 21,755 of SEQ ID NO: 2.
[0289] In certain embodiments, a modified oligonucleotide complementary to nucleobases 21,721 to 21,755 of SEQ ID NO: 2 achieves at least a 52% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0290] 3. Nucleic acid bases 27,963 to 28,016 of SEQ ID NO: 2 In certain embodiments, nucleobases 27,963-28,016 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 27,963-28,016 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 27,963-28,016 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0291] The nucleobase sequences of SEQ ID NOs: 293, 886, 887, 888, 889, 890, 891, 892, 893, and 3745 are complementary to nucleobases 27,963 to 28,016 of SEQ ID NO: 2.
[0292] In certain embodiments, a modified oligonucleotide complementary to nucleobases 27,963 to 28,016 of SEQ ID NO: 2 achieves at least a 39% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0293] 4. Nucleic acid bases 35,415 to 35,446 of SEQ ID NO: 2 In certain embodiments, nucleobases 35,415 to 35,446 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, the siRNA is complementary to nucleobases 35,415 to 35,446 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide The oligonucleotide is complementary to nucleobases 35,415-35,446 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3': sooosssssssssssss.
[0294] The nucleobase sequences of SEQ ID NOs: 920, 921, 2378, 2454, 2530, 2606, 2683, 2759, 2835, 3061, 3137, 3212, and 3288 are complementary to nucleobases 35,415 to 35,446 of SEQ ID NO: 2.
[0295] In certain embodiments, a modified oligonucleotide complementary to nucleobases 35,415 to 35,446 of SEQ ID NO: 2 achieves at least a 42% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0296] 5. Nucleic acid bases 77,221 to 77,264 of SEQ ID NO: 2 In certain embodiments, nucleobases 77,221-77,264 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 77,221-77,264 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 77,221-77,264 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0297] The nucleobase sequences of SEQ ID NOs: 131, 217, 1106, 1107, and 1108 are complementary to nucleobases 77,221 to 77,264 of SEQ ID NO:2.
[0298] In certain embodiments, a modified oligonucleotide complementary to nucleobases 77,221 to 77,264 of SEQ ID NO: 2 achieves at least a 51% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0299] 6. Nucleic acid bases 81,581 to 81,612 and 87,838 to 87,869 of SEQ ID NO: 2 In certain embodiments, nucleobases 81,581-81,612 and 87,838-87,869 of SEQ ID NO:2 comprise hotspot regions. In certain embodiments, an siRNA is complementary to nucleobases 81,581-81,612 and 87,838-87,869 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 81,581-81,612 and 87,838-87,869 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are hotspot regions. phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0300] The nucleobase sequences of SEQ ID NOs: 667, 668, 669, 670, 671, 1785, 1786, 1787, 1788, 1789, 1790, 1791, and 1792 are complementary to nucleobases 81,581 to 81,612 and 87,838 to 87,869 of SEQ ID NO: 2.
[0301] In certain embodiments, modified oligonucleotides complementary to nucleobases 81,581-81,612 and 87,838-87,869 of SEQ ID NO: 2 achieve at least a 38% reduction in LRRK2 RNA in vitro in at least one single-dose assay.
[0302] 7. Nucleic acid bases 81,627 to 81,651 of SEQ ID NO: 2 In certain embodiments, nucleobases 81,627-81,651 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 81,627-81,651 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 81,627-81,651 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0303] The nucleobase sequences of SEQ ID NOs: 674, 1799, 1800, 1801, 1802, and 1803 are complementary to nucleobases 81,627 to 81,651 of SEQ ID NO:2.
[0304] In certain embodiments, a modified oligonucleotide complementary to nucleobases 81,627 to 81,651 of SEQ ID NO: 2 achieves at least a 66% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0305] 8. Nucleic acid bases 82,058 to 82,081 of SEQ ID NO: 2 In certain embodiments, nucleobases 82,058-82,081 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 82,058-82,081 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 82,058-82,081 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0306] The nucleobase sequences of SEQ ID NOs: 222, 1130, 1131, 1132, and 1133 are complementary to nucleobases 82,058 to 82,081 of SEQ ID NO: 2.
[0307] In certain embodiments, a modified oligonucleotide complementary to nucleobases 82,058 to 82,081 of SEQ ID NO: 2 achieves at least a 53% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0308] 9. Nucleic acid bases 82,180 to 82,220 of SEQ ID NO: 2 In certain embodiments, nucleobases 82,180-82,220 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 82,180-82,220 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 82,180-82,220 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0309] The nucleobase sequences of SEQ ID NOs: 225, 1145, 2005, 2840, 3369, 3446, 3521, 3598, and 3674 are complementary to nucleobases 82,180 to 82,220 of SEQ ID NO: 2.
[0310] In certain embodiments, a modified oligonucleotide complementary to nucleobases 82,180 to 82,220 of SEQ ID NO: 2 achieves at least a 64% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0311] 10. Nucleic acid bases 82,500 to 82,525 of SEQ ID NO: 2 In certain embodiments, nucleobases 82,500-82,525 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 82,500-82,525 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 82,500-82,525 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0312] The nucleobase sequences of SEQ ID NOs: 439, 1807, 1808, 1809, 1810, 1811, and 1812 are complementary to nucleobases 82,500 to 82,525 of SEQ ID NO: 2.
[0313] In certain embodiments, a modified oligonucleotide complementary to nucleobases 82,500 to 82,525 of SEQ ID NO: 2 achieves at least a 49% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0314] 11. Nucleic acid bases 91,038 to 91,067 of SEQ ID NO: 2 In certain embodiments, nucleobases 91,038-91,067 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 91,038-91,067 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 91,038-91,067 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0315] The nucleobase sequences of SEQ ID NOs: 692, 1826, 1827, 1828, 1829, 1830, 1831, 1832, 1833, 1834, and 1835 are complementary to nucleobases 91,038 to 91,067 of SEQ ID NO: 2.
[0316] The modified oligonucleotides of compound numbers 780642, 803664, 803665, 803666, 803667, 803668, 803669, 803670, 803671, 803672, and 803673 are complementary to nucleobases 91,038 to 91,067 of SEQ ID NO:2.
[0317] In certain embodiments, a modified oligonucleotide complementary to nucleobases 91,038 to 91,067 of SEQ ID NO: 2 achieves at least a 42% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0318] 12. Nucleic acid bases 92,148 to 92,173 of SEQ ID NO: 2 In certain embodiments, nucleobases 92,148-92,173 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 92,148-92,173 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 92,148-92,173 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0319] The nucleobase sequences of SEQ ID NOs: 1213, 2613, 2690, 3143, 3219, and 3295 are complementary to nucleobases 92,148 to 92,173 of SEQ ID NO:2.
[0320] In certain embodiments, a modified oligonucleotide complementary to nucleobases 92,148 to 92,173 of SEQ ID NO: 2 achieves at least a 59% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0321] 13. Nucleic acid bases 98,186 to 98,220 of SEQ ID NO: 2 In certain embodiments, nucleobases 98,186 to 98,220 of SEQ ID NO: 2 are The siRNA comprises a cross-spot region. In certain embodiments, the siRNA is complementary to nucleobases 98,186-98,220 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is complementary to nucleobases 98,186-98,220 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0322] The nucleobase sequences of SEQ ID NOs: 1231, 1232, 2462, 2538, 2614, 2691, 2767, 3069, 3144, 3220, and 3296 are complementary to nucleobases 98,186 to 98,220 of SEQ ID NO: 2.
[0323] In certain embodiments, a modified oligonucleotide complementary to nucleobases 98,186 to 98,220 of SEQ ID NO: 2 achieves at least a 55% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0324] 14. Nucleic acid bases 98,218 to 98,242 of SEQ ID NO: 2 In certain embodiments, nucleobases 98,218-98,242 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 98,218-98,242 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 98,218-98,242 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0325] The nucleobase sequences of SEQ ID NOs: 150, 1233, 2008, 3372, 3449, and 3524 are complementary to nucleobases 98,218 to 98,242 of SEQ ID NO:2.
[0326] In certain embodiments, a modified oligonucleotide complementary to nucleobases 98,218 to 98,242 of SEQ ID NO: 2 achieves at least a 38% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0327] 15. Nucleic acid bases 99,199 to 99,223 of SEQ ID NO: 2 In certain embodiments, nucleobases 99,199-99,223 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 99,199-99,223 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 99,199-99,223 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiesterases. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3': sooosssssssssssss.
[0328] The nucleobase sequences of SEQ ID NOs: 1243, 2311, 2387, 2920, 2995, and 3755 are complementary to nucleobases 99,199 to 99,223 of SEQ ID NO:2.
[0329] In certain embodiments, a modified oligonucleotide complementary to nucleobases 99,199 to 99,223 of SEQ ID NO: 2 achieves at least a 52% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0330] 16. Nucleic acid bases 119,903 to 119,936 of SEQ ID NO: 2 In certain embodiments, nucleobases 119,903-119,936 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 119,903-119,936 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 119,903-119,936 of SEQ ID NO:2. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3': soooosssssssssssooss.
[0331] The nucleobase sequences of SEQ ID NOs: 750, 1927, 1928, 1929, 1930, 1931, 1932, 1933, 1934, 1935, 2822, 2898, 3351, and 3733 are complementary to nucleobases 119,903 to 119,936 of SEQ ID NO: 2.
[0332] In certain embodiments, a modified oligonucleotide complementary to nucleobases 119,903 to 119,936 of SEQ ID NO: 2 achieves at least a 51% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0333] 17. Nucleic acid bases 4,062 to 4,086 of SEQ ID NO: 1 In certain embodiments, nucleobases 4,062-4,086 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an siRNA is complementary to nucleobases 4,062-4,086 of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 4,062-4,086 of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, a gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the order 5' to 3':sooossssssssssssooss.
[0334] The nucleic acid base sequences of SEQ ID NOs: 39, 231, 232, 233, 1161, and 1162 are complementary to nucleic acid bases 4,062 to 4,086 of SEQ ID NO:1.
[0335] In certain embodiments, a modified oligonucleotide complementary to nucleobases 4,062 to 4,086 of SEQ ID NO: 1 achieves at least a 56% reduction of LRRK2 RNA in vitro in at least one single-dose assay.
[0336] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.
[0337] While certain compounds, compositions, and methods described herein are described with specificity according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. listed in this application are incorporated herein by reference in their entirety.
[0338] The sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA," as appropriate; indeed, sequences that may be modified with any combination of chemical modifications. Those of skill in the art will readily understand that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH in place of a single 2'-H in DNA) or as an RNA with a modified base (thymine (methylated uracil) in place of uracil in RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids comprising any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including, but not limited to, those having the sequence "AUCGAUCG" and those compounds containing RNA bases, such as those having some DNA bases and some RNA bases, such as "AUCGATCG", and oligomeric compounds having other modified nucleobases, such as "ATmCGAUCG"; m C denotes a cytosine base containing a methyl group at the 5-position.
[0339] Certain compounds described herein (e.g., modified oligonucleotides) possess one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described with undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms), unless otherwise specified. Similarly, all tautomeric forms of the compounds herein are included unless otherwise indicated. Unless otherwise indicated, compounds disclosed herein are intended to include corresponding salt forms.
[0340] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive or radioactive isotope of the indicated element. For example, compounds herein containing hydrogen atoms include: 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36In certain embodiments, non-radioactive isotope substitution can impart new properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. [Example]
[0341] The following examples illustrate certain specific embodiments of the present disclosure, but are not intended to be limiting. Furthermore, when specific embodiments are provided, the inventors have contemplated the general application of these specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides rational support for additional oligonucleotides having the same or similar motifs. Furthermore, for example, if a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are considered suitable unless otherwise indicated.
[0342] Example 1: Effect of 5-10-5 MOE Gapmer with Phosphorothioate Internucleoside Linkages on Human LRRK2 RNA Expression in Vitro, Single Dose Modified oligonucleotides complementary to human LRRK2 nucleic acid were designed and tested for their effect on LRRK2 RNA in vitro.
[0343] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with 5,000 nM of modified oligonucleotides or no modified oligonucleotides compared to untreated controls. Approximately 24 hours later, RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human primer probe set RTS3133_MGB (forward sequence TTCCACACTTGCGGTCTTTAGA, designated herein as SEQ ID NO: 11; reverse sequence GCGGGACCTGGTAGGTACTG, designated herein as SEQ ID NO: 12; probe sequence ATGAGCAGCAATGAT, designated herein as SEQ ID NO: 13). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. Modified oligonucleotides with percent control values marked with an asterisk (*) target the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and effectiveness of oligonucleotides targeting the amplicon region.
[0344] The modified oligonucleotides in Table 1 are 5-10-5 MOE gapmers. Gapmers are 20 nucleobases long, with a central gap segment containing 10 2'-deoxynucleosides flanked by wing segments on both the 5' and 3' ends containing five 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3')eeeeeddddddddddeeeee, where "d" represents a 2'-deoxyribose sugar and "e" represents a 2'-MOE modified sugar. Each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine residue is a 5-methylcytosine. The "start site" indicates the 5'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence. The "end site" indicates the 3'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence.
[0345] Each modified oligonucleotide listed in Table 1 below is complementary to the human LRRK2 nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not complementary to that particular nucleic acid sequence with 100% complementarity. As shown below, modified oligonucleotides complementary to sequences of human LRRK2 RNA are The oligonucleotides reduced the amount of human LRRK2 RNA.
[0346] [Table 1-1]
[0347] [Table 1-2]
[0348] [Table 1-3]
[0349] [Table 1-4]
[0350] [Table 1-5]
[0351] [Table 1-6]
[0352] [Table 1-7]
[0353] [Table 1-8]
[0354] [Table 1-9]
[0355] [Table 1-10]
[0356] [Table 1-11]
[0357] [Table 1-12]
[0358] Example 2: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro, single dose Modified oligonucleotides complementary to human LRRK2 nucleic acid were designed and tested for their effect on LRRK2 RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.
[0359] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with either 5,000 nM of the modified oligonucleotide or no modified oligonucleotide, as opposed to an untreated control. After approximately 24 hours, RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using human primer probe sets RTS3132 (forward sequence CATCACTCAGGCTGTTAAGACAAGA designated herein as SEQ ID NO: 14, reverse sequence CAGCTGCCAGCAAAGATATCAA designated herein as SEQ ID NO: 15, probe sequence CTTTGCCACCTCCACCACCCCA designated herein as SEQ ID NO: 16), RTS3133_MGB (forward sequence TTCCACACTTGCGGTCTTTAGA designated herein as SEQ ID NO: 11, reverse sequence GCGGGACCTGGTAGGTACTG designated herein as SEQ ID NO: 12, probe sequence ATGAGCAGCAATGAT designated herein as SEQ ID NO: 13), and RTS3146_MGB (forward sequence GAGCTTCCTCACGCAGTTCAC designated herein as SEQ ID NO: 17, reverse sequence TGCTGGGTCTTGAAAATGAAGA designated herein as SEQ ID NO: 18, probe sequence TTCTAAATGAATCAGGAGTCC designated herein as SEQ ID NO: 19). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. Modified oligonucleotides, with the percentage of control values marked with an asterisk (*), target the amplicon region of the primer-probe set.
[0360] The modified oligonucleotides in Table 2 are 5-10-5 MOE gapmers. Gapmers are 20 nucleobases long, with a central gap segment containing 10 2'-deoxynucleosides flanked by wing segments on both the 5' and 3' ends containing five 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3')eeeeeddddddddddeeeee, where "d" represents a 2'-deoxyribose sugar and "e" represents a 2'-MOE modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages of each gapmer are: are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif of a gapmer is (5' to 3') soooossssssssssssooss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. "Start site" indicates the 5'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence. "Stop site" indicates the 3'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence.
[0361] Each modified oligonucleotide listed in Table 2 below is complementary to the human LRRK2 nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not complementary to that particular nucleic acid sequence with 100% complementarity. As shown below, modified oligonucleotides complementary to sequences of human LRRK2 RNA reduced the amount of human LRRK2 RNA.
[0362] [Table 2-1]
[0363] [Table 2-2]
[0364] [Table 2-3]
[0365] [Table 2-4]
[0366] [Table 2-5]
[0367] [Table 2-6]
[0368] [Table 2-7]
[0369] Example 3: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro, single dose Modified oligonucleotides complementary to human LRRK2 nucleic acid were designed and tested for their effect on LRRK2 RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.
[0370] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with modified oligonucleotides at a concentration of 3,000 nM versus untreated controls, or without modified oligonucleotides. Approximately 24 hours later, RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR using the human primer probe set RTS3132, as described in Example 2. LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. Modified oligonucleotides with a percentage of the control value marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of oligonucleotides targeting the amplicon region.
[0371] The modified oligonucleotides in Tables 3-9 are 5-10-5 MOE gapmers. Gapmers are 20 nucleobases long, with a central gap segment containing 10 2'-deoxynucleosides flanked by wing segments on both the 5' and 3' ends containing five 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3')eeeeeddddddddddeeeee, where "d" represents a 2'-deoxyribose sugar and "e" represents a 2'-MOE modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages in each gapmer are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif of a gapmer is (5' to 3') soooossssssssssssooss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "start site" indicates the 5'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence. The "end site" indicates the 3'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence.
[0372] Each modified oligonucleotide listed in Tables 3-9 below is complementary to the human LRRK2 nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not complementary to that particular nucleic acid sequence with 100% complementarity. As shown below, modified oligonucleotides complementary to sequences of human LRRK2 RNA reduced the amount of human LRRK2 RNA.
[0373] [Table 3-1]
[0374] [Table 3-2]
[0375] [Table 3-3]
[0376] [Table 3-4]
[0377] [Table 3-5]
[0378] [Table 3-6]
[0379] [Table 4-1]
[0380] [Table 4-2]
[0381]
Table 4-3
[0382]
Table 4-4
[0383]
Table 4-5
[0384]
Table 4-6
[0385]
Table 4-7
[0386]
Table 5-1
[0387]
Table 5-2
[0388]
Table 5-3
[0389]
Table 5-4
[0390]
Table 5-5
[0391]
Table 5-6
[0392]
Table 6-1
[0393]
Table 6-2
[0394]
Table 6-3
[0395]
Table 6-4
[0396]
Table 6-5
[0397]
Table 6-6
[0398]
Table 6-7
[0399]
Table 6-8
[0400]
Table 6-9
[0401]
Table 6-10
[0402]
Table 6-11
[0403]
Table 6-12
[0404]
Table 7-1
[0405]
Table 7-2
[0406]
Table 7-3
[0407]
Table 7-4
[0408]
Table 7-5
[0409]
Table 7-6
[0410]
Table 7-7
[0411]
Table 8-1
[0412]
Table 8-2
[0413]
Table 8-3
[0414]
Table 8-4
[0415]
Table 8-5
[0416]
Table 8-6
[0417]
Table 8-7
[0418]
Table 8-8
[0419]
Table 9-1
[0420]
Table 9-2
[0421]
Table 9-3
[0422] [Table 9-4]
[0423] [Table 9-5]
[0424] [Table 9-6]
[0425] [Table 9-7]
[0426] Example 4: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro, single dose Modified oligonucleotides complementary to human LRRK2 nucleic acid were designed and tested for their effect on LRRK2 RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.
[0427] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with modified oligonucleotides at a concentration of 4,000 nM or without modified oligonucleotides, as compared to untreated controls. Approximately 24 hours later, RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR using the human primer probe set RTS3132, as described in Example 2. LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. Modified oligonucleotides with a percentage of the control value marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of oligonucleotides targeting the amplicon region.
[0428] The modified oligonucleotides in Tables 10-50 are 5-10-5 MOE gapmers. The gapmers are 20 nucleobases long, with a central gap segment containing 10 2'-deoxynucleosides flanked by wing segments on both the 5' and 3' ends containing five 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3')eeeeeddddddddddeeeee, where "d" represents a 2'-deoxyribose sugar and "e" represents a 2'-MOE modified sugar. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages in each gapmer are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage motif of a gapmer is (5' to 3') soooossssssssssssooss, where "o" represents a phosphodiester internucleoside linkage and "s" represents a phosphorothioate internucleoside linkage. The "start site" indicates the 5'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence. The "end site" indicates the 5'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence. The complementary 3'-terminal nucleoside in the nucleic acid sequence is indicated.
[0429] Each modified oligonucleotide listed in Tables 10-50 is complementary to the human LRRK2 nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not complementary to that particular nucleic acid sequence with 100% complementarity. As shown below, modified oligonucleotides complementary to sequences of human LRRK2 RNA reduced the amount of human LRRK2 RNA.
[0430] [Table 10-1]
[0431] [Table 10-2]
[0432] [Table 10-3]
[0433] [Table 10-4]
[0434] [Table 10-5]
[0435] [Table 10-6]
[0436] [Table 11-1]
[0437] [Table 11-2]
[0438]
Table 11-3
[0439]
Table 11-4
[0440]
Table 11-5
[0441]
Table 11-6
[0442]
Table 11-7
[0443]
Table 12-1
[0444]
Table 12-2
[0445]
Table 12-3
[0446]
Table 12-4
[0447]
Table 12-5
[0448]
Table 12-6
[0449]
Table 13-1
[0450]
Table 13-2
[0451]
Table 13-3
[0452]
Table 13-4
[0453]
Table 13-5
[0454]
Table 13-6
[0455]
Table 14-1
[0456]
Table 14-2
[0457]
Table 14-3
[0458]
Table 14-4
[0459]
Table 14-5
[0460]
Table 14-6
[0461]
Table 14-7
[0462]
Table 15-1
[0463]
Table 15-2
[0464]
Table 15-3
[0465]
Table 15-4
[0466]
Table 15-5
[0467]
Table 15-6
[0468]
Table 16-1
[0469]
Table 16-2
[0470]
Table 16-3
[0471]
Table 16-4
[0472]
Table 16-5
[0473]
Table 16-6
[0474]
Table 17-1
[0475]
Table 17-2
[0476]
Table 17-3
[0477]
Table 17-4
[0478]
Table 17-5
[0479]
Table 17-6
[0480]
Table 18-1
[0481]
Table 18-2
[0482]
Table 18-3
[0483]
Table 18-4
[0484]
Table 18-5
[0485]
Table 18-6
[0486]
Table 19-1
[0487]
Table 19-2
[0488]
Table 19-3
[0489]
Table 19-4
[0490]
Table 19-5
[0491]
Table 19-6
[0492]
Table 20-1
[0493]
Table 20-2
[0494]
Table 20-3
[0495]
Table 20-4
[0496]
Table 20-5
[0497]
Table 20-6
[0498]
Table 21-1
[0499]
Table 21-2
[0500]
Table 21-3
[0501]
Table 21-4
[0502]
Table 21-5
[0503]
Table 21-6
[0504]
Table 21-7
[0505]
Table 22-1
[0506]
Table 22-2
[0507]
Table 22-3
[0508]
Table 22-4
[0509]
Table 22-5
[0510]
Table 22-6
[0511]
Table 22-7
[0512]
Table 23-1
[0513]
Table 23-2
[0514]
Table 23-3
[0515]
Table 23-4
[0516]
Table 23-5
[0517]
Table 23-6
[0518]
Table 23-7
[0519]
Table 23-8
[0520]
Table 23-9
[0521]
Table 24-1
[0522]
Table 24-2
[0523]
Table 24-3
[0524]
Table 24-4
[0525]
Table 24-5
[0526]
Table 24-6
[0527]
Table 24-7
[0528]
Table 25-1
[0529]
Table 25-2
[0530]
Table 25-3
[0531]
Table 25-4
[0532]
Table 25-5
[0533]
Table 25-6
[0534]
Table 26-1
[0535]
Table 26-2
[0536]
Table 26-3
[0537]
Table 26-4
[0538]
Table 26-5
[0539]
Table 26-6
[0540]
Table 27-1
[0541]
Table 27-2
[0542]
Table 27-3
[0543]
Table 27-4
[0544]
Table 27-5
[0545]
Table 27-6
[0546]
Table 28-1
[0547]
Table 28-2
[0548]
Table 28-3
[0549]
Table 28-4
[0550]
Table 28-5
[0551]
Table 28-6
[0552]
Table 28-7
[0553]
Table 29-1
[0554]
Table 29-2
[0555]
Table 29-3
[0556]
Table 29-4
[0557]
Table 29-5
[0558]
Table 29-6
[0559]
Table 29-7
[0560]
Table 30-1
[0561]
Table 30-2
[0562]
Table 30-3
[0563]
Table 30-4
[0564]
Table 30-5
[0565]
Table 30-6
[0566]
Table 30-7
[0567]
Table 31-1
[0568]
Table 31-2
[0569]
Table 31-3
[0570]
Table 31-4
[0571]
Table 31-5
[0572]
Table 31-6
[0573]
Table 32-1
[0574]
Table 32-2
[0575]
Table 32-3
[0576]
Table 32-4
[0577]
Table 32-5
[0578]
Table 32-6
[0579]
Table 33-1
[0580]
Table 33-2
[0581]
Table 33-3
[0582]
Table 33-4
[0583]
Table 33-5
[0584]
Table 33-6
[0585]
Table 34-1
[0586]
Table 34-2
[0587]
Table 34-3
[0588]
Table 34-4
[0589]
Table 34-5
[0590]
Table 34-6
[0591]
Table 35-1
[0592]
Table 35-2
[0593]
Table 35-3
[0594]
Table 35-4
[0595]
Table 35-5
[0596]
Table 35-6
[0597]
Table 36-1
[0598]
Table 36-2
[0599]
Table 36-3
[0600]
Table 36-4
[0601]
Table 36-5
[0602]
Table 36-6
[0603]
Table 37-1
[0604]
Table 37-2
[0605]
Table 37-3
[0606]
Table 37-4
[0607]
Table 37-5
[0608]
Table 37-6
[0609]
Table 38-1
[0610]
Table 38-2
[0611]
Table 38-3
[0612]
Table 38-4
[0613]
Table 38-5
[0614]
Table 38-6
[0615]
Table 39-1
[0616]
Table 39-2
[0617]
Table 39-3
[0618]
Table 39-4
[0619]
Table 39-5
[0620]
Table 39-6
[0621]
Table 39-7
[0622]
Table 40-1
[0623]
Table 40-2
[0624]
Table 40-3
[0625]
Table 40-4
[0626]
Table 40-5
[0627]
Table 40-6
[0628]
Table 41-1
[0629]
Table 41-2
[0630]
Table 41-3
[0631]
Table 41-4
[0632]
Table 41-5
[0633]
Table 41-6
[0634]
Table 42-1
[0635]
Table 42-2
[0636]
Table 42-3
[0637]
Table 42-4
[0638]
Table 42-5
[0639]
Table 42-6
[0640]
Table 43-1
[0641]
Table 43-2
[0642]
Table 43-3
[0643]
Table 43-4
[0644]
Table 43-5
[0645]
Table 43-6
[0646]
Table 44-1
[0647]
Table 44-2
[0648]
Table 44-3
[0649]
Table 44-4
[0650]
Table 44-5
[0651]
Table 44-6
[0652]
Table 45-1
[0653]
Table 45-2
[0654]
Table 45-3
[0655]
Table 45-4
[0656]
Table 45-5
[0657]
Table 45-6
[0658]
Table 46-1
[0659]
Table 46-2
[0660]
Table 46-3
[0661]
Table 46-4
[0662]
Table 46-5
[0663]
Table 46-6
[0664]
Table 47-1
[0665]
Table 47-2
[0666]
Table 47-3
[0667]
Table 47-4
[0668]
Table 47-5
[0669]
Table 47-6
[0670]
Table 48-1
[0671]
Table 48-2
[0672]
Table 48-3
[0673]
Table 48-4
[0674]
Table 48-5
[0675]
Table 48-6
[0676]
Table 49-1
[0677]
Table 49-2
[0678]
Table 49-3
[0679]
Table 49-4
[0680]
Table 49-5
[0681] [Table 49-6]
[0682] [Table 49-7]
[0683] [Table 50-1]
[0684] [Table 50-2]
[0685] [Table 50-3]
[0686] [Table 50-4]
[0687] [Table 50-5]
[0688] [Table 50-6]
[0689] [Table 50-7]
[0690] Example 5: Effect of 5-10-5 MOE gapmers with phosphorothioate internucleoside linkages on human LRRK2 RNA expression in vitro, multiple doses Selected modified oligonucleotides from Example 1 above were tested at various doses in SH-SY5Y cells. Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at concentrations of 1.125 μM, 2.250 μM, 4.500 μM, 9.000 μM, and 18.000 μM, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set RTS3133_MGB (described in Example 1 herein). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. As shown in the table below, LRRK2 RNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC50 was calculated using Prism6 software using the formula "log(inhibitor) vs. response-variable slope (4 parameters)".
[0691] [Table 51]
[0692] Example 6: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro, multiple doses Selected modified oligonucleotides from Examples 2 and 3 above were tested at various doses in SH-SY5Y cells. Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at concentrations of 0.333 μM, 1.000 μM, 3.000 μM, and 9.000 μM, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set RTS3132 (described in Example 2 above). Total RNA content, as measured by RIBOGREEN®, was 0.333 μM, 1.000 μM, 3.000 μM, and 9.000 μM. The LRRK2 RNA level was adjusted according to the amount. The results are presented in the table below as a percentage of the LRRK2 RNA level relative to untreated control cells. As shown in the table below, the LRRK2 RNA level was reduced in a dose-dependent manner in the modified oligonucleotide-treated cells. The IC50 was calculated using Prism6 software using the formula "log (inhibitor) vs. response - variable slope (4 parameters)".
[0693] [Table 52-1]
[0694] [Table 52-2]
[0695] [Table 53-1]
[0696] [Table 53-2]
[0697] Example 7: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro, multiple doses Selected modified oligonucleotides from Example 4 above were tested at various doses in SH-SY5Y cells. Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at 0.296, 0.888, 2.666, and 8.000 μM concentrations, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set RTS3132 (described in Example 2 herein). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. As shown in the table below, LRRK2 RNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC50 was calculated using Prism6 software using the formula "log(inhibitor) vs. response-variable slope (4 parameters)".
[0698] [Table 54-1]
[0699] [Table 54-2]
[0700] [Table 55-1]
[0701] [Table 55-2]
[0702] [Table 56-1]
[0703] [Table 56-2]
[0704] [Table 57-1]
[0705] [Table 57-2]
[0706] Example 8: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro, multiple doses Selected modified oligonucleotides from Example 4 above were tested at various doses in SH-SY5Y cells. Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at concentrations of 0.444, 1.333, 4.000, and 12.000 μM, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set RTS3132 (described in Example 2 herein). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. As shown in the table below, LRRK2 RNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC50 was calculated using Prism6 software using the formula "log(inhibitor) vs. response-variable slope (4 parameters)".
[0707] [Table 58-1]
[0708] [Table 58-2]
[0709] [Table 59-1]
[0710] [Table 59-2]
[0711] [Table 60-1]
[0712]
Table 60-2
[0713]
Table 61-1
[0714]
Table 61-2
[0715]
Table 62-1
[0716]
Table 62-2
[0717]
Table 63-1
[0718]
Table 63-2
[0719]
Table 64-1
[0720] Table 64-2
[0721]
Table 65-1
[0722]
Table 65-2
[0723]
Table 66-1
[0724]
Table 66-2
[0725]
Table 67-1
[0726]
Table 67-2
[0727]
Table 68-1
[0728]
Table 68-2
[0729]
Table 69-1
[0730]
Table 69-2
[0731]
Table 70-1
[0732] [Table 70-2]
[0733] Example 9: Design of a gapmer with mixed internucleoside linkages complementary to human LRRK2 RNA Modified oligonucleotides complementary to human LRRK2 nucleic acids were designed. The modified oligonucleotides in Table 71 are gapmers. Gapmers have a central gap segment containing 2'-deoxynucleosides and are flanked by wing segments at both the 5' and 3' ends containing cEt nucleosides and / or 2'-MOE nucleosides. All cytosine residues throughout each gapmer are 5'-methylcytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate internucleoside linkages. The sequence and chemical notation column specifies the sequence, including 5'-methylcytosine, sugar chemistry, and internucleoside linkage chemistry, where the subscript "d" represents a 2'-deoxyribose sugar, the subscript "e" represents a 2'-MOE modified sugar, the subscript "k" represents a cEt modified sugar, the subscript "o" represents a phosphodiester internucleoside linkage, the subscript "s" represents a phosphorothioate internucleoside linkage, and the subscript "m" before a cytosine residue indicates a 5-methylcytosine. "Start Site" indicates the 5'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence. "Stop Site" indicates the 3'-terminal nucleoside to which the gapmer is complementary in a human nucleic acid sequence.
[0734] Each modified oligonucleotide listed in the table below is complementary to the human LRRK2 nucleic acid sequence SEQ ID NO: 1 or SEQ ID NO: 2, as indicated. "N / A" indicates that the modified oligonucleotide is not complementary to that particular nucleic acid with 100% complementarity.
[0735] [Table 71-1]
[0736]
Table 71-2
[0737]
Table 71-3
[0738]
Table 71-4
[0739]
Table 71-5
[0740]
Table 71-6
[0741]
Table 71-7
[0742]
Table 71-8
[0743]
Table 71-9
[0744]
Table 71-10
[0745]
Table 71-11
[0746] [Table 71-12]
[0747] [Table 71-13]
[0748] [Table 71-14]
[0749] [Table 71-15]
[0750] [Table 71-16]
[0751] Example 10: Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human LRRK2 RNA expression in vitro via free uptake Modified oligonucleotides selected from the above examples were tested ad libitum in A431 cells at various doses. Cells were seeded at a density of 10,000 cells per well with the modified oligonucleotides at concentrations of 0.039, 0.156, 0.625, 2.500, and 10.000 μM, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set RTS3132 (described in Example 2 herein). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. As shown in the table below, LRRK2 RNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC50 was calculated using Prism6 software using the formula "log(inhibitor) vs. response-variable slope (4 parameters)".
[0752] [Table 72-1]
[0753] [Table 72-2]
[0754] Example 11: Effects of modified oligonucleotides on rhesus monkey LRRK2 RNA in vitro, multiple doses A modified oligonucleotide selected from the above examples that is also complementary to rhesus monkey LRRK2. Nucleotides were tested at various doses in LLC-MK2 monkey cells. Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at concentrations of 0.011, 0.034, 0.103, 0.309, 0.926, 2.778, 8.333, and 25.000 μM, as specified in the table below. Control oligonucleotides, 676630, a 5-10-5 MOE gapmer with a mixed phosphodiester and phosphorothioate backbone of unknown target, and the sequence CCTATAGGACTATCCAGGAA (SEQ ID NO: 3848), were also tested. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set hLRRK2 LTS35700 (forward sequence CCAGGTACAATGCAAAGCTTAAT, designated herein as SEQ ID NO: 20; reverse sequence TCAGTCCAATCACTGACAAGTT, designated herein as SEQ ID NO: 21; probe sequence TTGGGAAGTCCTTGGTGTTCACCA, designated herein as SEQ ID NO: 22). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. As shown in the table below, LRRK2 RNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC50 was calculated using Prism 6 software using the "log(inhibitor) vs. response - variable slope (4 parameters)" formula.
[0755] [Table 73]
[0756] *This modified oligonucleotide is complementary to, and contains one mismatch to, rhesus LRRK2 nucleic acid SEQ ID NO:3. **These modified oligonucleotides are complementary to rhesus LRRK2 nucleic acid SEQ ID NO:3 and contain two mismatches thereto.
[0757] Example 12: Effect of modified oligonucleotides on human LRRK2 RNA expression in vitro, multiple doses The modified oligonucleotides described above were tested at various doses in SH-SY5Y cells. Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with 0.011, 0.034, 0.103, 0.309, 0.926, 2.778, 8.333, and 25.000 μM of the modified oligonucleotides, as specified in the table below. A control oligonucleotide, 676630, a 5-10-5 MOE gapmer with a mixed phosphodiester and phosphorothioate backbone of unknown target, was also tested. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and LRRK2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human LRRK2 primer probe set LTS35700 (described in Example 11 herein). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. The results are presented in the table below as a percentage of LRRK2 RNA levels relative to untreated control cells. As shown in the table below, LRRK2 RNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC50 was calculated using Prism6 software using the formula "log (inhibitor) vs. response - variable slope (4 parameters)".
[0758] [Table 74]
[0759] Example 13: Activity of modified oligonucleotides complementary to human LRRK2 in transgenic mice, 2-week assessment To assess activity after two weeks, the modified oligonucleotides were tested in a human BAC wild-type LRRK2 transgenic mouse model (B6; SJL-Tg(LRRK2)66Mjff / J; stock number 013725, The Jackson Laboratory). Mice hemizygous for the BAC LRRK2-Wt transgene are viable and fertile. These mice express the wild-type human leucine-rich repeat kinase 2 (LRRK2) gene under the direction of the human LRRK2 promoter / enhancer region of the BAC transgene (Ouyang Y et al., 2011). Mice from this model express human LRRK2 in various tissues, including the spinal cord and brain.
[0760] treatment LRRK2 transgenic mice each received a single intracerebroventricular (ICV) dose of 300 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of four mice. A group of four mice received PBS as a negative control.
[0761] RNA analysis After two weeks, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time PCR analysis measuring LRRK2 RNA expression using primer probe set hLRRK2 LTS35700 (described herein above in Example 11). The results are presented in the table below as percent LRRK2 RNA levels relative to the PBS control, normalized using cyclophilin A.
[0762] As shown in the table below, treatment with the modified oligonucleotides resulted in a reduction of human LRRK2 RNA compared to the PBS control.
[0763] [Table 75-1]
[0764] [Table 75-2]
[0765]
Table 75-3
[0766]
Table 76-1
[0767]
Table 76-2
[0768]
Table 76-3
[0769]
Table 77-1
[0770]
Table 77-2
[0771]
Table 78-1
[0772]
Table 78-2
[0773]
Table 79-1
[0774]
Table 79-2
[0775]
Table 79-3
[0776]
Table 80-1
[0777]
Table 80-2
[0778]
Table 81-1
[0779]
Table 81-2
[0780]
Table 82-1
[0781]
Table 82-2
[0782]
Table 83-1
[0783]
Table 83-2
[0784]
Table 84-1
[0785] [Table 84-2]
[0786] [Table 85-1]
[0787] [Table 85-2]
[0788] [Table 86-1]
[0789] [Table 86-2]
[0790] [Table 87-1]
[0791] [Table 87-2]
[0792] Example 14: Activity of modified oligonucleotides complementary to human LRRK2 in transgenic mice, 8-week assessment The modified oligonucleotides were tested in a human BAC wild-type LRRK2 transgenic mouse model (described hereinabove) to assess activity after 8 weeks. Mice hemizygous for the BAC LRRK2-Wt transgene are viable and fertile. These mice express the wild-type human leucine-rich repeat kinase 2 (LRRK2) gene under the direction of the human LRRK2 promoter / enhancer region of the BAC transgene (Ouyang Y et al., 2011). Mice from this model express human LRRK2 in various tissues, including the spinal cord and brain.
[0793] treatment LRRK2 transgenic mice each received a single ICV dose of 300 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of four mice. A group of four mice received PBS as a negative control.
[0794] RNA analysis After 8 weeks, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time PCR analysis measuring LRRK2 RNA expression using primer probe set hLRRK2 LTS35700 (described herein above in Example 11). The results are presented in the table below as percent LRRK2 RNA levels relative to the PBS control, normalized using cyclophilin A.
[0795] As shown in the table below, treatment with the modified oligonucleotides resulted in a reduction of human LRRK2 RNA compared to the PBS control.
[0796] [Table 88]
[0797] [Table 89]
[0798] Example 15: Activity of modified oligonucleotides complementary to human LRRK2 in transgenic rats To assess activity, the modified oligonucleotides were tested in a human BAC G2019S mutant LRRK2 transgenic rat (NTac:SD-Tg(LRRK*G2019S)571Cjli; Taconic) model. This model was created by pronuclear injection of the entire human LRRK2 gene carrying the G2019S mutation into NTac:SD zygotes. Rats from this model express human LRRK2 in various tissues, including the spinal cord and brain (West AB et al., J. Comp. Neurology, 2014, 522(11):2465-2480).
[0799] treatment LRRK2 transgenic rats each received a single ICV dose of 1,000 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of 4-5 rats. A group of 4 rats received PBS as a negative control.
[0800] RNA analysis After two weeks, the rats were sacrificed and RNA was extracted from brainstem, cortical brain tissue, spinal cord, lung, and kidney for real-time PCR analysis measuring RNA expression of LRRK2 using primer probe set hLRRK2 LTS35700 (described herein above in Example 11). The results are presented in the table below as percent LRRK2 RNA levels relative to the PBS control, normalized using cyclophilin A.
[0801] As shown in the table below, treatment with the modified oligonucleotides resulted in a reduction of human LRRK2 RNA compared to the PBS control.
[0802] [Table 90]
[0803] Example 16: Efficacy of modified oligonucleotides complementary to human LRRK2 in transgenic rats To test the efficacy of the oligonucleotides, the modified oligonucleotides were tested in the human BAC G2019S mutant LRRK2 transgenic rat (NTac:SD-Tg(LRRK*G2019S)571Cjli) model described herein above.
[0804] treatment LRRK2 transgenic rats each received a single intracerebroventricular (ICV) dose of 10, 30, 100, 300, 700, 1,000, or 3,000 μg of the modified oligonucleotides listed in the table below. Each treatment group consisted of five rats. A group of five rats received PBS as a negative control for each dosing group.
[0805] RNA analysis After two weeks, the rats were sacrificed and RNA was extracted from the cortex for real-time PCR analysis measuring LRRK2 RNA expression using primer probe set hLRRK2 LTS35700 (described herein above in Example 11). The results are presented in the table below as percent LRRK2 RNA levels relative to the PBS control, normalized using cyclophilin A.
[0806] As shown in the table below, treatment with the modified oligonucleotides resulted in a reduction in human LRRK2 RNA compared to the PBS control. Dose-response data were analyzed using GraphPad Prism 6 software (San Diego, CA). ED 50 Values were calculated from the log-transformed dose or concentration and individual animal LRRK2 RNA levels using the built-in GraphPad formula "log(agonist) vs. response--Find ECanything" with the following constraints: 50 was calculated using bottom value > 0, top value = 100, and F = 50.
[0807] [Table 91]
[0808] Example 17: Tolerance of modified oligonucleotides complementary to LRRK2 in wild-type mice, 3-hour FOB assessment The modified oligonucleotides described above were tested in wild-type female C57 / B16 mice to assess their tolerability. Each wild-type female C57 / B16 mouse received a single ICV dose of 700 μg of the modified oligonucleotide listed in the table below. Each treatment group consisted of four mice. A group of four mice received PBS as a negative control for each experiment (identified in a separate table below). Three hours after injection, the mice were evaluated according to seven different criteria: (1) the mouse was alert, alert, and responsive; (2) the mouse stood or hunched without stimulation; (3) the mouse exhibited any movement without stimulation; (4) the mouse exhibited forward movement after being lifted; (5) the mouse exhibited any movement after being lifted; (6) the mouse responded to a tail pinch; and (7) the mouse was breathing normally. For each of the seven criteria, mice were given a subscore of 0 if the criterion was met and 1 if it was not met (Functional Observational Overall Score or FOB). After all seven criteria were assessed, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below.
[0809] [Table 92-1]
[0810] [Table 92-2]
[0811] [Table 93]
[0812] [Table 94]
[0813] [Table 95]
[0814] [Table 96]
[0815] [Table 97]
[0816] [Table 98-1]
[0817] [Table 98-2]
[0818] Example 18: Tolerance of modified oligonucleotides complementary to human LRRK2 in rats, 3-hour FOB assessment The modified oligonucleotides described above were tested in Sprague Dawley rats to assess the tolerability of the oligonucleotides. Each rat received a single intrathecal (IT) dose of 3 mg of the oligonucleotide listed in the table below. Each treatment group consisted of 3–4 rats. A group of 4 rats received PBS as a negative control for each experiment (identified in a separate table below). Three hours after injection, each rat was assessed for movement of seven different body parts. The seven body parts were: (1) rat tail, (2) rat rearward posture, (3) rat hind limbs, (4) rat hind paws, (5) rat front paws, (6) rat forward posture, and (7) rat head. For each of the seven different body parts, each rat was given a subscore of 0 if the body part was moving or 1 if the body part was not moving. For each of the seven criteria, rats were given a subscore of 0 if the criterion was met or 1 if the criterion was not met (Functional Observational Rating Score, or FOB). After assessing all seven criteria, scores were summed for each rat and averaged within each treatment group. The results are presented in the table below.
[0819] [Table 99]
[0820] [Table 100]
[0821] [Table 101]
[0822] [Table 102]
[0823] [Table 103]
[0824] [Table 104]
[0825] Table 105
[0826] Table 106
[0827] Table 107
[0828] Table 108
[0829] Table 109
[0830] Table 110
[0831] Table 111
[0832] Table 112
[0833] Table 113
[0834] Table 114
[0835] [Table 115]
[0836] Example 19: Prophylactic reduction of LRRK2 with modified oligonucleotides in the PFF model Wild-type mice received a single ICV injection of 700 μg of the oligonucleotides listed in the table below or PBS vehicle alone. Each treatment group consisted of 11 or 12 mice. Two weeks after oligonucleotide treatment, preformed fibrils (PFFs) of α-synuclein were injected into the striatum, resulting in the formation of α-synuclein aggregates in several brain regions and motor deficits, as described (see Luk et al., Science, 2012, 338, 949-953). One control group did not receive PFF injections. Fifty-five days after oligonucleotide treatment, motor function was tested in the wire-hanging test. Results are presented in the table below as the average length of time mice in each treatment group spent on the wire.
[0837] One day after the wire-hanging test, all mice in each treatment group were sacrificed, except for the group that received neither oligonucleotide nor PFF injection, in which only four mice were sacrificed. Animals were perfused with ice-cold PBS. The ipsilateral hemisphere was fixed and processed for immunochemistry. The contralateral midbrain and striatum were dissected and subjected to RNA analysis. The entire contralateral cortex was then excised and frozen until analysis. LRRK2 RNA expression was analyzed by quantitative real-time PCR using the mouse primer probe set RTS3043 (forward sequence GGCGAGTTATCCGCACCAT, designated herein as SEQ ID NO: 23; reverse sequence CCAAAACCAGCATGACATTCTTAA, designated herein as SEQ ID NO: 24; probe sequence TGAGAGCCATGGCCACAGCACAA, designated herein as SEQ ID NO: 25). LRRK2 RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. The results are shown in the table below as the average percent inhibition relative to the wild-type control group, which received neither oligonucleotide treatment nor PFF injection.
[0838] The levels of LRRK2, α-synuclein, and highly phosphorylated α-synuclein (p-α-syn) protein in the cortex were analyzed by Western blot. Contralateral cortical tissue was first homogenized in RIPA buffer and centrifuged at 13,300 × g. The supernatant was subjected to Western blot analysis for LRRK2 protein levels, with β-tubulin used as a loading control. The results showed that LRRK2 protein levels in the cortex were significantly lower in oligonucleotide-treated animals than in animals that did not receive oligonucleotide treatment. The pellet was resuspended in RIPA buffer and centrifuged at 100,000 × g. The resulting insoluble material was further suspended in 2% SDS buffer and then spun at 100,000 × g. The resulting supernatant was analyzed by Western blot for α-synuclein and p-α-syn. The results showed that PFF injection recruited endogenous mouse α-synuclein into insoluble aggregates, as reported in Luk et al. The aggregates were also hyperphosphorylated. Oligonucleotide treatment reduced aggregate formation, as evidenced by the reduction of insoluble mouse α-synuclein and p-α-syn in Western blots. p-α-syn aggregates in the substantia nigra were visualized by immunohistochemistry. The average number of aggregates observed for equal-sized samples from each treatment group is shown in the table below. One-way ANOVA of the results indicated significant differences between PBS-treated and oligonucleotide-treated animals.
[0839] [Table 116]
[0840] Example 20: Reduction of LRRK2 by modified oligonucleotides in the PFF model The effect of oligonucleotide reduction in wild-type mice after injection of PFFs was evaluated using 690093. Mice were treated as described in Example 19, except that oligonucleotide treatment was administered 2 weeks after PFF injection instead of 2 weeks before. Each treatment group consisted of 10 animals. 55 days after PFF injection, mice were treated with 690093 as described in Example 19. The mice were evaluated in a wire-hanging test. One day after the wire-hanging test, the mice were sacrificed, and the midbrain, striatum, and substantia nigra were collected and LRRK2 RNA and p-α-syn aggregates were measured as described in Example 19. The results are shown in the table below as the average for each treatment group. The entry "nd" indicates that no data was collected for that treatment group. The results show that the modified oligonucleotides improved motor function and reduced the number of pathological aggregates, even when administered after the onset of the PFF model.
[0841] [Table 117]
[0842] Example 21: Prophylactic reduction of LRRK2 with modified oligonucleotides in the PFF model in a longitudinal study The modified oligonucleotides were tested in longitudinal studies to determine whether long-term treatment with the modified oligonucleotides would protect dopaminergic neurons. Accumulation of α-syn aggregates in the substantia nigra pars compacta impaired dopaminergic neuron survival over time (Luk 2012, Tran 2014).
[0843] The effect of oligonucleotide reduction in wild-type mice after injection of PFFs was assessed using 690093 or the control oligonucleotide 676630, a target-unknown 5-10-5 MOE gapmer with a mixed phosphodiester and phosphorothioate backbone. Mice were treated as described in Example 19, except that they received a second ICV dose of 690093 on day 90 and were sacrificed 180 days after the first ICV treatment. Each treatment group consisted of 12 animals. At sacrifice, the midbrain, striatum, and substantia nigra were collected as described in Example 19, and LRRK2 RNA and p-α-syn aggregates were measured, and dopaminergic cells were quantified by immunohistochemistry using an anti-tyrosine hydroxylase (TH) antibody. Results are presented in the table below as the average for each treatment group. The results show that in the group treated with the modified oligonucleotide complementary to LRRK2, the number of pathological aggregates was reduced over the long-term treatment course. In addition, quantification of TH-positive neurons showed that 690093-mediated LRRK2 inhibition rescued TH-positive cells in the ipsilateral substantia nigra pars compacta compared with control-treated cells.
[0844] [Table 118]
[0845] Example 22: Tolerance of modified oligonucleotides complementary to human LRRK2 in rats, longitudinal assessment In a separate study conducted under the same conditions, the modified oligonucleotides described above were tested in Sprague Dawley rats to evaluate the long-term tolerability of the oligonucleotides. Each Sprague Dawley rat received a single intrathecal (IT) delivery of 3 mg of oligonucleotide or PBS. Starting one week after treatment, trained observers weighed and evaluated each animal weekly for adverse events for six weeks. Adverse events were defined as neurological dysfunction not typical of PBS-treated control animals, including, but not limited to, abnormal limb dislocation, abnormal gait, tremors, abnormal breathing, paralysis, and spasticity. The onset of an adverse event was defined as the week after dosing when the abnormality was first recorded. If no adverse events occurred, a "no event" was recorded. The onset of an adverse event typically correlates with growth failure, defined as a lack of weight gain / maintenance similar to that of PBS-treated animals. Similar tolerability assessments are described in Ostergaard et al., Nucleic Acids Res. 2013 Nov;41(21):9634-9650 and Southwell et al., Mol Ther. 2014 Dec;22(12):2093-2106. As shown in the table below, 876031, 780241, 802714, 803268, 876604, and 934556 were well tolerated in long-term tolerability assessments.
[0846] [Table 119] In one aspect, the present invention may be as follows. [Aspect 1] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to an equal-length portion of an LRRK2 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage. [Embodiment 2] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence containing at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 adjacent nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30 to 3847. [Embodiment 3] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases, wherein the portion is an isometric portion of nucleobases 18,633 to 18,658 of SEQ ID NO: 2; an isometric portion of nucleobases 21,721 to 21,755 of SEQ ID NO: 2; an isometric portion of nucleobases 27,963 to 28,016 of SEQ ID NO: 2; an isometric portion of nucleobases 35,415 to 35,446 of SEQ ID NO: 2; an isometric portion of nucleobases 77,221 to 77,264 of SEQ ID NO: 2; an isometric portion of nucleobases 81,581 to 81,612 and / or 87,838 to 87,869 of SEQ ID NO: 2; an isometric portion of nucleobases 81,627 to 81,651 of SEQ ID NO: 2; an isometric portion of nucleobases 82,058 to 82,081 of SEQ ID NO: 2; an isometric portion of nucleobases 82,180 to 82,220 of SEQ ID NO: 2; an isometric portion of nucleobases 82,500 to 82,525 of SEQ ID NO: 2; an isometric portion of nucleobases 91,038 to 91,067 of SEQ ID NO: 2; an isometric portion of nucleobases 92,148 to 92,173 of SEQ ID NO: 2; an isometric portion of nucleobases 98,186 to 98,220 of SEQ ID NO: 2; an isometric portion of nucleobases 98,218 to 98,242 of SEQ ID NO: 2; an isometric portion of nucleobases 99,199 to 99,223 of SEQ ID NO: 2; an isometric portion of nucleobases 119,903 to 119,936 of SEQ ID NO: 2; or The oligomeric compound is complementary to an isometric portion of nucleobases 4,062 to 4,086 of SEQ ID NO:1. [Aspect 4] The oligomeric compound of any one of Aspects 1 to 3, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide. [Aspect 5] The oligomeric compound according to any one of Aspects 1 to 4, wherein the modified oligonucleotide comprises at least one modified nucleoside. [Aspect 6] The oligomeric compound of Aspect 5, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. [Aspect 7] The oligomeric compound of Aspect 6, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety. [Aspect 8] The oligomeric compound of Aspect 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, and the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-. [Aspect 9] The oligomeric compound of any one of Aspects 5 to 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. [Aspect 10] The oligomeric compound of Aspect 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety that includes a 2'-MOE modified sugar or a 2'-OMe modified sugar. [Aspect 11] The oligomeric compound according to any one of Aspects 5 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate. [Aspect 12] The oligomeric compound according to Aspect 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA. [Aspect 13] The modified oligonucleotide is a 5' region consisting of 1 to 5 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides, and a sugar motif comprising a 3' region consisting of 1 to 5 linked 3' region nucleosides; 13. The oligomeric compound of any one of Aspects 1 to 12, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises an unmodified 2'-deoxyribosyl sugar moiety. [Aspect 14] The oligomeric compound according to any one of Aspects 1 to 13, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [Aspect 15] The oligomeric compound of Aspect 14, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. [Embodiment 16] The oligomeric compound of embodiment 14 or 15, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 17] The oligomeric compound of Aspect 14 or 16, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [Embodiment 18] The oligomeric compound of any of embodiments 14, 16, or 17, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Aspect 19] The oligomeric compound according to any one of Aspects 1 to 18, wherein the modified oligonucleotide comprises at least one modified nucleobase. [Aspect 20] The oligomeric compound of Aspect 19, wherein the modified nucleobase is 5-methylcytosine. [Aspect 21] The oligomeric compound according to any one of Aspects 1 to 20, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 20, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides. [Aspect 22] The oligomeric compound according to any one of Aspects 1 to 21, wherein the modified oligonucleotide consists of 17 or 20 linked nucleosides. [Aspect 23] The oligomeric compound according to any one of Aspects 1 to 22, which comprises the modified oligonucleotide. [Embodiment 24] The oligomeric compound according to any one of embodiments 1 to 22, comprising a composite group comprising a composite moiety and a composite linker. [Aspect 25] The oligomeric compound according to Aspect 24, wherein the complex group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands. [Aspect 26] The oligomeric compound of Aspect 24 or 25, wherein the composite linker consists of a single bond. [Aspect 27] The oligomeric compound according to aspect 25, wherein the composite linker is cleavable. [Aspect 28] The oligomeric compound of Aspect 27, wherein the composite linker comprises 1 to 3 linker nucleosides. [Aspect 29] The oligomeric compound of any one of Aspects 24 to 28, wherein the composite group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. [Aspect 30] The oligomeric compound of any one of Aspects 24 to 28, wherein the composite group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. [Aspect 31] The oligomeric compound according to any one of Aspects 1 to 30, which comprises a terminal group. [Aspect 32] The oligomeric compound according to any one of Aspects 1 to 31, wherein the oligomeric compound is a single-stranded oligomeric compound. [Aspect 33] The oligomeric compound according to any one of Aspects 1 to 27 or 29 to 31, wherein the oligomeric compound does not contain a linker nucleoside. [Aspect 34] An oligomeric duplex comprising the oligomeric compound according to any one of aspects 1 to 31 or 33. [Aspect 35] An antisense compound comprising or consisting of the oligomeric compound according to any one of Aspects 1 to 33 or the oligomeric duplex according to Aspect 34. [Aspect 36] A pharmaceutical composition comprising the oligomeric compound according to any one of Aspects 1 to 33 or the oligomeric duplex according to Aspect 34, and a pharmaceutically acceptable carrier or diluent. [Embodiment 37] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 222) Or its salt. [Embodiment 38] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 888) Or its salt. [Embodiment 39] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 1431) Or its salt. [Embodiment 40] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 3590) Or its salt. [Embodiment 41] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 3385) Or its salt. [Embodiment 42] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 852) Or its salt. [Aspect 43] A modified oligonucleotide according to any one of Aspects 37 to 42, which is a sodium salt of the above formula. [Embodiment 44] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 222). [Embodiment 45] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 888). [Embodiment 46] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 1431). [Embodiment 47] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 3590). [Embodiment 48] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 3385). [Embodiment 49] A modified oligonucleotide of the following formula: [ka] (SEQ ID NO: 852). [Aspect 50] A chirally enriched population of modified oligonucleotides according to any one of aspects 37 to 49, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration. [Embodiment 51] A chirally enriched population according to embodiment 50, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration. [Embodiment 52] A chirally enriched population according to embodiment 50 or 51, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration. [Embodiment 53] A chirally enriched population according to embodiment 50, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [Aspect 54] A chirally enriched population according to aspect 53, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage. [Embodiment 55] A chirally enriched population according to embodiment 53, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage. [Embodiment 56] A chirally enriched population according to embodiment 50 or embodiment 53, wherein the population is enriched for modified oligonucleotides having at least three adjacent phosphorothioate internucleoside linkages in an Sp-Sp-Rp configuration in the 5' to 3' direction. [Aspect 57] A population of modified oligonucleotides according to any one of Aspects 37 to 49, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom. [Aspect 58] A pharmaceutical composition comprising the modified oligonucleotide according to any one of Aspects 37 to 49 and a pharmaceutically acceptable diluent or carrier. [Aspect 59] A pharmaceutical composition described in Aspect 58, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid. [Aspect 60] The pharmaceutical composition described in Aspect 59, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. [Aspect 61] A method comprising administering to an animal a pharmaceutical composition described in any one of aspects 36 or 58 to 60. [Aspect 62] A method for treating a disease associated with LRRK2, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any of Aspects 36 or 58 to 60 to an individual having or at risk of developing a disease associated with LRRK2, thereby treating the disease associated with LRRK2. [Aspect 63] The method described in Aspect 62, wherein the disease associated with LRRK2 is a neurodegenerative disease. [Aspect 64] The method described in Aspect 63, wherein the neurodegenerative disease is Parkinson's disease. [Aspect 65] The method of aspect 64, wherein at least one symptom or characteristic of the neurodegenerative disease is ameliorated. [Aspect 66] The method described in Aspect 65, wherein the symptom or characteristic is any one of ataxia, neuropathy, and aggregate formation. [Embodiment 67] An oligomeric compound comprising a modified oligonucleotide of the following formula: Ges mCeo Teo mCeo Aes Tds Ads Tds mCds Tds Ads Ads Ads Gds Ads mCeo mCeo Ges mCes Ae (SEQ ID NO: 222); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage. [Embodiment 68] An oligomeric compound comprising a modified oligonucleotide of the following formula: Tes mCeo Aeo mCeo mCes Ads mCds Ads Ads Ads mCds Tds mCds Ads Tds Geo Geo Aes mCes Te(SEQ ID NO:888); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage. [Embodiment 69] An oligomeric compound comprising a modified oligonucleotide of the following formula: Aes mCeo mCeo mCeo Tes Tds Tds mCds mCds Ads Tds Gds Tds Gds Ads Aeo mCeo Aes Tes Te (SEQ ID NO: 1431); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage. [Embodiment 70] An oligomeric compound comprising a modified oligonucleotide of the following formula: Aes mCeo Geo mCeo Aes mCds Tds Tds Ads Ads mCds Ads Ads Tds Ads Teo mCeo Aes Tes Ae (SEQ ID NO: 3590), wherein A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage. [Embodiment 71] An oligomeric compound comprising a modified oligonucleotide of the formula: Aes Geo mCeo Aeo Aes Tds mCds Ads Tds Tds Gds Gds Tds Ads Gds mCeo Aeo Tes Aes mCe (SEQ ID NO: 3385), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage. [Embodiment 72] An oligomeric compound comprising a modified oligonucleotide of the formula: mCes Geo mCes Aes mCes Tds Tds Ads Ads mCds Ads Ads Tds Ads Tds mCes Aeo Tes Aes Te (SEQ ID NO: 852), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e = 2'-MOE modified sugar; d = 2'-deoxyribose sugar, s = phosphorothioate internucleoside linkage, and The oligomeric compound wherein o = phosphodiester internucleoside linkage. [Aspect 73] The oligomeric compound of Aspect 3, wherein the modified oligonucleotide is an RNAi compound. [Aspect 74] The oligomeric compound according to Aspect 73, wherein the RNAi compound is ssRNA or siRNA.
Claims
[Claim 1] The invention described in the specification.