Oligonucleotide compositions and methods of use thereof

Oligonucleotides with targeted structural modifications effectively reduce disease-associated C9orf72 transcripts and proteins, addressing the ineffectiveness of current treatments for ALS and FTD by selectively knocking down harmful products while preserving normal functions.

JP2025125554APending Publication Date: 2025-08-27WAVE LIFE SCI LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025037970
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-03-01
Filing Date
2025-03-11
Publication Date
2025-08-27

Smart Images

  • Figure 2025125554000102
    Figure 2025125554000102
  • Figure 2025125554000001
    Figure 2025125554000001
  • Figure 2025125554000002
    Figure 2025125554000002
Patent Text Reader

Abstract

To provide a C9orf72 oligonucleotide, a composition, and a method for treatment of C9orf72-associated conditions, disorders, or diseases including amyotrophic lateral sclerosis and frontotemporal dementia.SOLUTION: Provided is an oligonucleotide comprising at least one modification of a sugar, a base, or an internucleotidic linkage, wherein the base sequence of the oligonucleotide is or comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is at least 80% identical with or complementary to a base sequence of a C9orf72 gene or a transcript thereof, and wherein a nucleobase at a 3' end of the oligonucleotide is optionally replaced by a replacement nucleobase selected from I, A, T, U, G, and C.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application Nos. 62 / 845,765, filed May 9, 2019, 62 / 851,558, filed May 22, 2019, 62 / 911,340, filed October 6, 2019, and 62 / 983,736, filed March 1, 2020, each of which is incorporated by reference in its entirety. [Background technology]

[0002] Oligonucleotides are useful in a variety of applications, including but not limited to, therapeutic, diagnostic and / or research applications, including the treatment of various conditions, disorders or diseases. Summary of the Invention [Means for solving the problem]

[0003] The present disclosure provides oligonucleotides and compositions thereof capable of reducing the level of C9orf72 transcripts (or their products). In some embodiments, the provided oligonucleotides and compositions can preferentially reduce the level of disease-associated C9orf72 transcripts (or their products) relative to non-disease-associated or low-disease-associated C9orf72 transcripts (see, e.g., Figure 1). Exemplary C9orf72 transcripts include transcripts from either strand of the C9orf72 gene and from various origins. In some embodiments, at least some C9orf72 transcripts are translated into protein. In some embodiments, at least some C9orf72 transcripts are not translated into protein. In some embodiments, certain C9orf72 transcripts primarily comprise intronic sequences.

[0004] A hexanucleotide repeat expansion in C9orf72 (chromosome 9, open reading frame 72) is reportedly the most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). C9orf72 gene variants containing this repeat expansion and / or their encoded products are also associated with other C9orf72-related disorders, such as corticobasal degeneration syndrome (CBD), atypical parkinsonism, olivopontocerebellar degeneration (OPCD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Huntington's disease (HD) phenocopy, Alzheimer's disease (AD), bipolar disorder, schizophrenia, and other non-movement disorders. In some embodiments, the present disclosure provides compositions and methods relating to oligonucleotides that target C9orf72 targets (e.g., C9orf72 oligonucleotides) and have the ability to knockdown or reduce the expression, levels, and / or activity of C9orf72 target genes and / or their gene products (transcripts, particularly repeat expansion-containing transcripts, proteins, etc.).

[0005] In some embodiments, the oligonucleotide targets a pathological or disease-associated C9orf72 mutation or variant that contains a repeat expansion. In some embodiments, the C9orf72 gene product is an RNA (e.g., mRNA, mature RNA, or pre-mRNA) transcribed from the C9orf72 gene, a protein translated from a C9orf72 RNA transcript (e.g., a dipeptide repeat protein translated from a hexanucleotide repeat), or a foci (plural: foci), which reportedly contain RNA containing a repeat expansion bound by an RNA-binding protein. In some embodiments, the C9orf72 oligonucleotide is capable of mediating preferential knockdown of repeat-expansion-containing C9orf72 RNA relative to non-repeat-expansion-containing C9orf72 RNA (C9orf72 RNA that does not contain the repeat expansion). In some embodiments, the C9orf72 oligonucleotide reduces the expression, activity, and / or level of a deleterious C9orf72 gene product (e.g., an RNA comprising a repeat expansion, a dipeptide repeat protein, or a focus) without reducing (or while reducing to a very low extent) the expression, activity, and / or level of a wild-type or non-detrimental C9orf72 gene product. In some embodiments, the C9orf72 oligonucleotide reduces the expression, activity, and / or level of a deleterious C9orf72 gene product, but does not reduce the expression, activity, and / or level of a wild-type or non-detrimental C9orf72 protein so much as to eliminate or significantly inhibit one or more beneficial and / or essential biological activities of the C9orf72 protein. Beneficial and / or essential activities of the C9orf72 protein are well known and include, but are not limited to, limiting inflammation, preventing autoimmunity, and preventing premature death.

[0006] Among other things, the present disclosure encompasses the recognition that controlling structural elements of C9orf72 oligonucleotides can have profound effects on the properties and / or activity of the oligonucleotide, including knockdown of C9orf72 target genes. In some embodiments, knockdown of the target gene is mediated by RNase H or steric hindrance affecting translation. In some embodiments, controlled structural elements of C9orf72 oligonucleotides include, but are not limited to, base sequence, chemical modifications (e.g., modifications of sugars, bases, and / or internucleotide linkages) or patterns thereof, altered stereochemistry (e.g., stereochemistry of backbone-chiral internucleotide linkages) or patterns thereof, wing structure, core structure, wing-core structure, wing-core-wing structure, or core-wing structure, and / or conjugation with additional chemical moieties (e.g., carbohydrate moieties, targeting moieties, etc.). In some embodiments, the present disclosure provides techniques (e.g., compounds, methods, etc.) for improving C9orf72 oligonucleotide stability while maintaining or increasing oligonucleotide activity, including compositions of oligonucleotides with improved stability. In some embodiments, provided oligonucleotides target C9orf72 or its products. In some embodiments, the target gene is C9orf72.

[0007] In some embodiments, the present disclosure encompasses the recognition that various optional additional chemical moieties, such as carbohydrate moieties, targeting moieties, etc., can be incorporated into c9orf72 oligonucleotides to improve one or more properties. In some embodiments, the additional chemical moiety is selected from glucose, GluNAc (N-acetylamine glucosamine), and anisamide moieties. These and other moieties are described in further detail herein, e.g., in Examples 1 and 2. In some embodiments, an oligonucleotide can include two or more additional chemical moieties, where the additional chemical moieties are identical or non-identical, or of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.), or non-identical. In some embodiments, certain additional chemical moieties facilitate delivery of the oligonucleotide to desired cells, tissues, and / or organs, including, but not limited to, specific cells, sites, or portions of the central nervous system (e.g., cerebral cortex, hippocampus, spinal cord, etc.). In some embodiments, certain additional chemical moieties facilitate internalization of the oligonucleotide. In some embodiments, certain additional chemical moieties increase oligonucleotide stability. In some embodiments, the present disclosure provides techniques for incorporating various additional chemical moieties into oligonucleotides. In some embodiments, the present disclosure provides, e.g., reagents and methods for introducing additional chemical moieties with an internucleotide linkage, sugar, and / or nucleobase (e.g., by covalent attachment to a site on the sugar, nucleobase, or internucleotide linkage, optionally via a linker).

[0008] In some embodiments, the present disclosure provides a method for producing a pharmaceutical composition comprising one or more of the features [limitations] as described herein. Although not limited thereto, the present disclosure demonstrates that surprisingly high target specificity can be achieved by oligonucleotides, e.g., C9orf72 oligonucleotides, whose structure includes the base sequences disclosed herein (wherein each U can optionally and independently be replaced with T, and vice versa), and / or chemical modifications, and / or stereochemistry, and / or patterns thereof, and / or combinations thereof).

[0009] In some embodiments, the present disclosure demonstrates that certain provided structural elements, techniques, and / or features are particularly useful for oligonucleotides that knock down C9orf72. Nevertheless, the teachings of the present disclosure are not limited to oligonucleotides that involve or function through any particular biochemical mechanism. In some embodiments, the present disclosure provides oligonucleotides that can function through mechanisms such as double-stranded RNA interference, single-stranded RNA interference, or mechanisms that act as antisense oligonucleotides to reduce the expression, activity, and / or level of the C9orf72 gene or its gene product by RNase H-mediated mechanisms or steric hindrance of translation.

[0010] Furthermore, the present disclosure relates to any C9orf72 oligonucleotide that functions through any mechanism and that includes any sequence, structure, or format (or a portion thereof) described herein, wherein the oligonucleotide includes at least one non-naturally occurring modification of a base, sugar, or internucleotide linkage. In some embodiments, the present disclosure relates to any C9orf72 oligonucleotide that includes at least one stereoregulated internucleotide linkage (including, but not limited to, a phosphorothioate linkage in the Sp or Rp configuration). In some embodiments, the present disclosure relates to any C9orf72 oligonucleotide that functions through any mechanism and that includes at least one stereoregulated internucleotide linkage (including, but not limited to, a phosphorothioate linkage in the Sp or Rp configuration). In some embodiments, the present disclosure provides C9orf72 oligonucleotides comprising any sequence, structure, or format (or portion thereof) described herein, optional additional chemical moieties (including, but not limited to, carbohydrate moieties and targeting moieties), stereochemistry or pattern of stereochemistry, internucleotide linkage or pattern of internucleotide linkages; sugar modification or pattern of sugar modifications; base modification or pattern of base modifications. In some embodiments, the sugar, nucleobase, or internucleotide linkage modification is a non-naturally occurring modification.

[0011] In some embodiments, the C9orf72 disorder-associated target allele comprises a hexanucleotide repeat expansion in intron 1, including but not limited to G4C2 or (GGGGCC)ng, where ng is 30 or greater. In some embodiments, ng is 50 or greater. In some embodiments, ng is 100 or greater. In some embodiments, ng is 150 or greater. In some embodiments, ng is 200 or greater. In some embodiments, ng is 300 or greater. In some embodiments, ng is 500 or greater.

[0012] The C9orf72 G4C2 repeat expansion in intron 1 reportedly accounts for 1 in 10 ALS cases among European populations. The G4C2 repeat reportedly accounts for only about 10% of transcripts (e.g., pathogenic allele transcripts V3 and V1 shown in Figure 1 ), and is associated with gain-of-function toxicity mediated, at least in part, by dipeptide repeat proteins and foci formation, e.g., of repeat expansion-containing transcripts, and / or spliced-out repeat expansion-containing introns, and / or antisense transcription of repeat expansion-containing regions and various nucleic acid binding proteins. In some embodiments, V1 is reportedly transcribed at very low levels (approximately 1% of total C9orf72 transcript levels) and does not significantly contribute to the levels of transcripts containing the hexanucleotide repeat expansion. Intronic nucleic acids containing the repeat expansion reportedly occur in pre-mRNA, partially spliced ​​mRNA, and / or partially spliced ​​mRNA. These nucleic acids can reside as RNA and / or spliced-out introns, and RNA foci containing these nucleic acids are associated with the sequestration of RNA-binding proteins. C9orf72 RNA foci are described, for example, in Liu et al., 2017, Cell Chemical Biology 24, 1-8; Niblock et al., Acta Neuropathologica Communications (2016) 4:18. Abnormal protein products, including dipeptide repeat proteins (DPR proteins), are reportedly produced from repeat expansions and are associated with neuronal toxicity. In some embodiments, the present disclosure provides oligonucleotides, compositions, and methods of use that target intronic sequences near G4C2 repeats and can reduce the levels of repeat expansion-containing transcripts, their encoded proteins, and / or associated foci. In some embodiments, the present disclosure provides C9orf72 oligonucleotides and compositions that target intronic sequences near G4C2 repeats to specifically knock down repeat expansion-containing transcripts via RNase-H while minimizing effects on normal C9orf72 transcripts. In some embodiments, in comparison to existing data, the present disclosure demonstrates that the provided techniques targeting intronic sequences (e.g., between the repeat and exon 1b) can effectively and / or preferentially reduce repeat expansion-containing product levels.

[0013] While not wishing to be bound by any particular theory, the present disclosure notes that several possible mechanisms for the deleterious disease-related effects of repeat expansions have been proposed in the literature. See, e.g., Edbauer et al. 2016 Curr. Opin. Neurobiol. 36:99-106; Conlon et al. Elife. 2016 Sep 13; 5. pii: e17820; Xi et al. 2015 Acta Neuropathol. 129: 715-727; Cohen-Hada et al. 2015 Stem Cell Rep. 7: 927-940; and Burguete et al. eLife 2015; 4: e08881. Among other things, the present disclosure provides techniques that can reduce or eliminate one or more or all deleterious disease-related C9orf72 products and / or disease-related effects.

[0014] While not wishing to be bound by any particular theory, this disclosure points out that foci formation is a possible mechanism for the deleterious effects of repeat-expansion-containing C9orf72 transcripts. Repeat expansion reportedly leads to retention of intron 1-containing C9orf72 mRNA. The majority of C9orf72 mRNAs that retain intron 1 accumulate in the nucleus, where they are targeted by specific degradation pathways that cannot process the G4C2 RNA repeat. The RNA subsequently aggregates into foci, which also contain RNA-binding proteins and sequester them from their normal function. (Niblock Acta Neuropathol Commun. 2016;4:18). Reportedly, antisense foci containing antisense C9orf72 products are significantly more frequent in cerebellar Purkinje neurons and motor neurons, while sense foci are significantly more frequent in cerebellar granule neurons. (Cooper-Knock et al. Acta Neuropathol (2015) 130:63-75). In some embodiments, the present disclosure provides techniques for reducing the level of foci. In some embodiments, the provided techniques reduce or eliminate the level of antisense and / or sense foci in one or more neurons.

[0015] Without wishing to be bound by any particular theory, the present disclosure points out that another possible mechanism for the deleterious effects of repeat expansion-containing C9orf72 transcripts is the generation of dipeptide repeat (DPR) proteins. A small fraction of C9orf72 mRNAs that retain intron 1 are exported to the cytoplasm and undergo RAN (repeat-associated non-AUG translation) translation into DPRs in all six reading frames. Niblock A cta Neuropathol Commun. 2016;4:18. Cooper-Knock et al. reported that inclusions containing sense- or antisense-derived dipeptide repeat proteins are present at significantly higher frequencies in cerebellar granule neurons or motor neurons, respectively; and that in motor neurons, the primary pathological target in ALS, the presence of antisense foci correlates with mislocalization of TDP-43, a hallmark of ALS neurodegeneration, but not sense foci. In some embodiments, the provided technology reduces the levels of one or more or all of the C9orf72 DPR protein products.

[0016] In some embodiments, gain-of-function and / or loss-of-function mechanisms lead to neurodegeneration in C9orf72-associated disorders. See, e.g., Mizielinska et al. 2014 Science 345:1192-94; Chew et al. 2015 Science 348:1151-1154; Jiang et al. 2016 Neuron 90:535-550; and Liu et al. 2016 Neuron 90:521-534; Gendron et al. Cold Spring Harb. Perspect. Med. 2017 Jan 27. pii:a024224; Haeusler et al. Nat Rev Neurosci. 2016 Jun;17(6):383-95; Koppers et al. Ann. Neurol. 2015;78:426-438; Todd et al. J. Neurochem. 2016 138(Suppl. 1) 145-162. In some embodiments, the techniques provided reduce unwanted acquired functions and / or restore or enhance desired functions.

[0017] In some embodiments, the provided oligonucleotides and compositions and methods of use thereof are useful for treating any of several C9orf72-associated disorders, including, but not limited to, amyotrophic lateral sclerosis (ALS). In some embodiments, the ALS is MIM:612069. Amyotrophic lateral sclerosis (ALS) is reportedly a fatal neurodegenerative disease clinically characterized by progressive paralysis, typically resulting in death, often due to respiratory failure, within 2-3 years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700). ALS is reportedly the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and currently there is no effective treatment. While approximately 10% of cases are familial in nature, the majority of patients diagnosed with this disease are classified as sporadic because it appears to occur randomly throughout the population (Chio et al., Neurology, 2008, 70, 533-537). Clinical, genetic, and epidemiological data reportedly support the hypothesis that ALS and frontotemporal dementia (FTD) represent a series of overlapping disorders pathologically characterized by the presence of TDP-43-positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133). Several genes, such as SOD1, TARDBP, FUS, OPTN, and VCP, have been identified as possible causes of classical familial ALS (Johnson et al., Neuron, 2010, 68, 857-864; Kwiatkowski et al., Science, 2009, 323, 1205-1208; Maruyama et al., Nature, 2010, 465, 223-226; Rosen et al., Nature, 1993, 362, 59-62; Sreedharan et al., Science, 2008, 319, 1668-1672; Vance et al., Brain, 2009, 129, 868-876). Linkage analysis of kinships involving multiple cases of ALS, FTD, and ALS-FTD reportedly identified C9orf72 as the critical locus for this disease. It has been suggested that this mutation is located on the short arm of the chromosome (Boxer et al., J. Neurol. Neurosurg. Psychiatry, 2011, 82, 196-203; Morita et al., Neurology, 2006, 66, 839-844; Pearson et al. J. Neurol., 2011, 258, 647-655; Vance et al., Brain, 2006, 129, 868-876). This mutation has been found to be the most common genetic cause of ALS and FTD. In some embodiments, the ALS-FTD-causing mutation is a large hexanucleotide (e.g., GGGGCC or G4C2) repeat expansion in the first intron of the C9orf72 gene on chromosome 9 (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hernandez et al., Neuron, 2011, 72, 245-256). The majority of cases linked to this region have a founder haplotype that encompasses the C9orf72 gene (Renton et al., Neuron, 2011, 72, 257-268). This locus on chromosome 9p21 accounts for nearly half of familial ALS and nearly one-quarter of all ALS cases in a cohort of 405 Finnish patients (Laaksovirta (E. et al., Lancet Neurol., 2010, 9, 978-985). The incidence of ALS is reportedly 1:50,000. Familial ALS reportedly accounts for 5-10% of all ALS cases; C9orf72 mutations may reportedly be the most common cause of ALS (40-50%). ALS is reportedly associated with degeneration of both upper and lower motor neurons in the motor cortex of the brain, brainstem, and spinal cord. Symptoms of ALS reportedly include muscle weakness and / or atrophy, difficulty swallowing or breathing, muscle spasms, and muscle rigidity. Respiratory failure is reportedly the leading cause of death. In some embodiments, the provided technologies reduce the severity and / or eliminate one or more symptoms associated with ALS or other C9orf72-associated conditions, disorders, and / or diseases.

[0018] In some embodiments, the provided oligonucleotides and compositions and methods of use thereof are useful for treating any of several C9orf72-associated disorders, including, but not limited to, frontotemporal dementia (FTD). In some embodiments, FTD is referred to as frontotemporal lobar degeneration or FTLD, MIM:600274. Frontotemporal dementia is reportedly the second most common form of presenile dementia and is reportedly associated with focal atrophy of the frontal or temporal lobes. Boxer et al. 2005 Alzheimer Dis. Assoc. Disord. 19(Suppl 1):S3-S6. FTD shares extensive clinical, pathological, and molecular overlap with amyotrophic lateral sclerosis. As reported by Gijselinck, Cold Spring Harb. Perspect. Med. 2017 Jan 27. pii:a026757, there are reportedly familial and individual cases in which both diseases occur (ALS-FTD) (Lomen-Hoerth TDP-43 inclusions in ALS and FTLD patients (Arai et al. 2006 Biochem. Biophys. Res. Comm. 351:602-611; Neumann et al. 2006 Science 314:130-133) may be indistinguishable despite their different pathological distributions in ALS and FTLD patients (Tsuji et al. 2012 Brain 135:3380-3391). Reportedly, there is evidence that ALS and FTLD may share common disease pathways, as their clinical and pathological hallmarks overlap. Thus, the pure forms of these diseases are considered to be opposite ends of a disease continuum (Lillo and Hodges 2009 J. Clin. Neurosci. 16:1131-1135). Genetic studies have reportedly identified mutations in the same genes in FTLD and ALS, such as TBK1, TARDBP, FUS, and VCP (Neumann et al. 2006; Kovacs et al. 2009 Mov. Disord. 24:1843-1847; Johnson et al. 2010 Neuron 68:8 57-864;Van Langenhove et al.2010 Neurology 74:366-371;Cirulli et al.2015 Science 347:1436-1441;Freischmidt et al.2015 Nat.Neurosci.18:631-636;Pottier et al.2015 Acta Neuropathol. 130:77-92). Reportedly, the identification of repeat expansion mutations in C9orf72 in patients with ALS, FTLD, and ALS-FTD provided genetic evidence for a common disease pathology (Gijselinck et al. 2010 Arch. Neurol. 67:606-616; De Jesus-Hernandez et al. 2011 Neuron 72:245-256; Renton et al. 2011 Neuron 72:257-268).

[0019] In some embodiments, the C9orf72 target is a specific allele (e.g., one that contains a repeat expansion) intended to alter the level, expression, and / or activity of one or more products (e.g., RNA and / or protein products such as dipeptide repeat proteins or DPRs). In many embodiments, the C9orf72 target allele is one whose presence and / or expression is associated with (e.g., correlates with) the presence, incidence, and / or severity of one or more diseases and / or conditions, including, but not limited to, ALS and FTD or other C9orf72-associated disorders or symptoms thereof. Alternatively or additionally, in some embodiments, the C9orf72 target allele is one for which altered expression, level, and / or activity of one or more gene products is correlated with amelioration of one or more aspects of a disease and / or condition (e.g., delayed onset, reduced severity, responsiveness to other therapies, etc.), including, but not limited to, ALS and FTD or other C9orf72-associated disorders.

[0020] In some embodiments, the neurological disorder is characterized by neuronal hyperexcitability. nA 50% decrease in C9orf72 activity due to and / or in the presence of elongation increases neurotransmission through glutamate receptors NMDA, AMPA, and kainite. Additionally, glutamate receptors reportedly accumulate in neurons. Increased neurotransmission and glutamate receptor accumulation reportedly lead to glutamate-induced excitotoxicity due to neuronal hyperexcitability. Inhibition of glutamate receptors reportedly can treat neuronal hyperexcitability. Impaired clearance of dipeptide repeat proteins generated from elongation reportedly enhances their neurotoxicity. C9orf72 reportedly promotes early endosomal transport through activation of RAB5, which requires phosphatidylinositol 3-phosphate (phosphase) (PI3P). PIKFYVE converts PI3P to phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2). Inhibition of PIKFYVE reportedly increases PI3P levels to compensate for changes in RAB5 levels, allowing early endosome maturation, which may ultimately lead to clearance of dipeptide repeat proteins. Neurons also reportedly use endosomal trafficking to regulate sodium and potassium ion channel localization. Inhibition of PIKFYVE reportedly can also treat neuronal hyperexcitability. In some embodiments, the provided techniques reduce neuronal hyperexcitability. In some embodiments, the provided techniques can be administered as part of the same treatment regime as a PIKFYVE inhibitor.

[0021] In some embodiments, the present disclosure provides: 1) common base sequence, 2) common backbone bond patterns, and 3) Common skeletal chiral center patterns an oligonucleotide composition comprising a first plurality of oligonucleotides sharing a The compositions are substantially pure preparations of single oligonucleotides in that the non-random or controlled levels of oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.

[0022] In some embodiments, the present disclosure provides a C9orf72 oligonucleotide composition comprising a first plurality of oligonucleotides capable of directing C9orf72 knockdown, wherein the oligonucleotides comprise: 1) Common base sequence and length, 2) common backbone bond patterns, and 3) Common skeletal chiral center patterns is a specific type of oligonucleotide characterized by: The compositions are chiral controlled in that they are enriched for oligonucleotides of a particular oligonucleotide type, as compared to substantially racemic preparations of oligonucleotides having the same base sequence and length.

[0023] In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions comprising a plurality of oligonucleotides sharing the same composition or structure, wherein the oligonucleotides comprise one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) chirality-controlled internucleotide linkages. In some embodiments, the base sequence of each oligonucleotide of the plurality comprises 15, 16, 17, 18, 19, 20 or more contiguous nucleobases that are identical to or complementary to the base sequence or a portion thereof of the C9orf72 gene or a transcript thereof.

[0024] In some embodiments, when aligned for maximum complementarity with its target sequence, the base sequence of a provided oligonucleotide contains one or more mismatches (e.g., not AT, not AU, not CG). In some embodiments, the mismatch is at the 3' end. In some embodiments, there are one, two, or no more than three mismatches. As demonstrated herein, an oligonucleotide whose base sequence contains one or more mismatches, when aligned with its target sequence, can unexpectedly provide increased activity (e.g., when contacted with the target transcript and RNase H to reduce the level of the target transcript), reduced toxicity, etc., compared to an oligonucleotide whose base sequence is perfectly complementary to the target sequence.

[0025] In some embodiments, the provided oligonucleotides (which can target C9orf72 or a target other than C9orf72) comprise one or more blocks. In some embodiments, a block comprises one or more consecutive nucleosides, and / or nucleotides, and / or sugars or bases, and / or internucleotide linkages. In some embodiments, the provided oligonucleotides comprise three or more blocks, where the blocks at both ends are not identical, and thus the oligonucleotides are asymmetric. In some embodiments, the blocks are wings or cores.

[0026] In some embodiments, a C9orf72 oligonucleotide comprises at least one wing and at least one core, where the wing structurally differs from the core in that the wing comprises a different structure (e.g., stereochemistry, additional chemical moieties, or chemical modifications (or patterns thereof) in the sugar, base, or internucleotide linkage) from the core, or vice versa. In some embodiments, provided oligonucleotides comprise a wing-core-wing structure. In some embodiments, provided oligonucleotides comprise a wing-core, core-wing, or wing-core-wing structure, where one wing differs in structure (e.g., stereochemistry, additional chemical moieties, or chemical modifications (or patterns thereof) in the sugar, base, or internucleotide linkage) from the other wing and core. (e.g., asymmetric oligonucleotides). In some embodiments, the oligonucleotide has or includes a wing-core, core-wing, or wing-core-wing structure, and the blocks are either wings or cores. In some embodiments, the core is also referred to as a gap.

[0027] Generally, the properties of oligonucleotide compositions as described herein can be assessed using any suitable assay.

[0028] Those of skill in the art will know and / or can readily develop appropriate assays for particular oligonucleotide compositions. [Brief explanation of the drawings]

[0029] [Figure 1] Figure 1 depicts exemplary C9orf72 transcripts. V3, V2, and V1 transcripts produced from healthy and pathological C9orf72 alleles are shown, where the pathological allele contains a hexanucleotide repeat expansion (denoted by a horizontal bar, (GGGGCC)30+). Downward arrows indicate the location of several exemplary C9orf72 oligonucleotide targeting introns. DETAILED DESCRIPTION OF THE INVENTION

[0030] definition As used herein, the following definitions shall apply unless otherwise stated. For purposes of this disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. In addition, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, Mb and March, J., John Wiley & Sons, New York: 2001.

[0031] As used herein in this disclosure, unless otherwise clear from the context, (i) the terms "a" or "an" may be understood to mean "at least one"; (ii) (iii) the word "or" may be understood to mean "and / or"; (iv) the terms "comprising," "comprise," "including" (including but not limited to) "including" (whether or not used with "but not limited to") and "include" (whether or not used with "but not limited to") are by themselves (iv) the term "another" may be understood to mean at least an additional / second one or more; (v) the term "about" or "approximately" may be understood to allow for standard deviation as understood by one of ordinary skill in the art; and (vi) when ranges are provided, the endpoints are included.

[0032] Unless otherwise indicated, descriptions of oligonucleotides and their components (e.g., base sequence, sugar modifications, internucleotide linkages, bond phosphorus stereochemistry, etc.) are in the 5' to 3' direction. As will be appreciated by those of skill in the art, in some embodiments, oligonucleotides can be provided and / or utilized as salt forms, particularly pharmaceutically acceptable salt forms, e.g., sodium salts. As will also be appreciated by those of skill in the art, in some embodiments, individual oligonucleotides within a composition can be (and can be dissolved in) different salt forms, e.g., when in a liquid composition, a particular such oligonucleotide can be in (and be dissolved in) different salt forms at a particular time, e.g., when in a liquid composition, an oligonucleotide chain can be in (and be dissolved in) an anionic form. For example, one of skill in the art will understand that at a given pH, an individual internucleotide bond along an oligonucleotide chain may be in the acid (H) form or in one of several possible salt forms (e.g., sodium salts or salts of different cations, depending on which ions may be present in the formulation or composition), and will consider the acid form (e.g., all cations, if present, to be H) to be the same composition and / or structure. + It will be appreciated that so long as each of the individual oligonucleotides (replaced by ) has the same composition and / or structure, such individual oligonucleotides can properly be considered to be of the same composition and / or structure.

[0033] Aliphatic: As used herein, "aliphatic" means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring (but not aromatic) that is fully saturated or contains one or more units of unsaturation, or a combination thereof. In some embodiments, an aliphatic group contains 1-50 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-20 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-10 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-9 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-8 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-7 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In yet other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in still other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and hybrids such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0034] Alkyl: As used herein, the term "alkyl" is given its ordinary meaning in the art and includes saturated aliphatic groups, including straight-chain alkyl groups, branched alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, an alkyl has 1-100 carbon atoms. In some embodiments, a straight-chain or branched-chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C for straight chain). 20 , C2 to C in the case of branched chains 20) or about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure (and such rings are monocyclic, bicyclic or polycyclic) or about 5, 6 or 7 carbons in the ring structure. In some embodiments, alkyl groups can be lower alkyl groups, where the lower alkyl group has from 1-4 carbon atoms (e.g., C1-C4 for a straight chain lower alkyl).

[0035] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0036] Approximately: As used herein, the term "approximately" or "about" in reference to a numerical value is generally interpreted to include values ​​within 5%, 10%, 15%, or 20% (more or less) of that value in either direction, unless otherwise stated or a different interpretation is clear from the context (except where such value falls below 0% or exceeds 100% of the possible value). In some embodiments, the term "about" in reference to a dosage When used, it means ±5 mg / kg / day.

[0037] Aryl: As used herein, the term "aryl," used alone or as part of a larger moiety such as "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, wherein at least one ring of the system is aromatic. In some embodiments, an aryl group refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, wherein at least one ring of the system is aromatic and wherein the rings of the system each contain 3 to 7 ring members. In some embodiments, an aryl group is a biaryl group. The term "aryl" may be used interchangeably with the term "aryl ring." In some embodiments of the present invention, "aryl" refers to an aromatic ring system, including, but not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, and the like, which may contain one or more substituents. Also included within the scope of the term "aryl," as used herein, are groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthymidyl, phenanthridinyl, or tetrahydronaphthyl.

[0038] Equivalent: The term "equivalent" is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit a comparison of the results obtained or the phenomena observed. In some embodiments, equivalent sets of conditions or circumstances are characterized by a plurality of substantially identical characteristics and one or a small number of dissimilar characteristics. One skilled in the art will understand that sets of conditions are equivalent to one another when they are characterized by a sufficient number and type of substantially identical characteristics to provide a basis for a reasonable conclusion that differences in the results obtained or phenomena observed under the various sets of conditions or circumstances are attributable to or indicative of differences in the dissimilar characteristics.

[0039] Alicyclic: The terms "alicyclic," "carbocycle," "carbocyclyl," "carbocyclic group," and "carbocycle" are used interchangeably and, as used herein, unless otherwise specified, refer to a saturated or partially unsaturated, but non-aromatic, cycloaliphatic monocyclic, bicyclic, or polycyclic ring system, as described herein, having 3 to 30 ring members. Alicyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, an alicyclic group has 3 to 6 carbons. In some embodiments, an alicyclic group is saturated and cycloalkyl. The term "alicyclic" can also include an alicyclic ring fused to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, an alicyclic group is bicyclic. In some embodiments, an alicyclic group is tricyclic. In some embodiments, an alicyclic group is polycyclic. In some embodiments, "alicyclic" refers to a C3-C6 monocyclic hydrocarbon or C8-C6 alkylene group that is fully saturated or contains one or more units of unsaturation, but is not aromatic, and has a single point of attachment to the rest of the molecule. 10 Bicyclic or polycyclic hydrocarbons, or C9-C6 rings that are fully saturated or contain one or more unsaturated units, but are not aromatic, and have a single point of attachment to the rest of the molecule. 16 Refers to polycyclic hydrocarbons.

[0040] Dosing regimen: As used herein, "dosing regimen" or "therapeutic regimen" refers to a set of unit doses (typically two or more doses) that are administered to a subject individually, typically spaced apart. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may include one or more doses. In some embodiments, a dosing regimen includes multiple doses, each spaced apart by the same amount of time. In some embodiments, a dosing regimen includes multiple doses and at least two different times spaced apart between individual doses. In some embodiments, all doses within a dosing regimen are administered in the same unit dose. In some embodiments, different doses in a dosing regimen are different values. In some embodiments, a dosing regimen includes a first dose at a first dose value, followed by one or more additional doses at a second dose value that is different from the first dose value. In some embodiments, a dosing regimen includes a first dose at a first dose value, followed by one or more additional doses at a second dose value that is the same as the first dose value.

[0041] Heteroaliphatic: The term "heteroaliphatic," as used herein, is given its ordinary meaning in the art and refers to an aliphatic group, as described herein, in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH, and CH are independently replaced with one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, a heteroaliphatic group is a heteroalkyl. In some embodiments, a heteroaliphatic group is a heteroalkenyl.

[0042] Heteroalkyl: The term "heteroalkyl," as used herein, is given its ordinary meaning in the art and refers to an alkyl group, as described herein, in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, and the like.

[0043] Heteroaryl: The terms "heteroaryl" and "heteroal-," as used herein, alone or as part of a larger moiety (e.g., "heteroaralkyl" or "heteroaralkoxy"), refer to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, where at least one ring of the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group has 5 to 10 ring atoms (i.e., monocyclic, bicyclic, or polycyclic), and in some embodiments, 5, 6, 9, or 10 ring atoms. In some embodiments, a heteroaryl group has 6, 10, or 14 π electrons shared within the cyclic array; and in addition to the carbon atoms, there are 1 to 5 heteroatoms. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyronyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group such as bipyridyl. The terms "heteroaryl" and "heteroar-," as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, and the bonding group or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic, bicyclic, or polycyclic. The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," all of which include optionally substituted rings.The term "heteroaralkyl" refers to an alkyl group substituted with a heteroaryl group, where the alkyl and heteroaryl portions independently are optionally substituted.

[0044] Heteroatom: The term "heteroatom," as used herein, means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic or substitutable nitrogen of a heterocycle (e.g., N, as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (such as in the case of N-substituted pyrrolidinyl); etc.).

[0045] Heterocycle: As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic group," and "heterocycle" are used interchangeably herein and refer to a monocyclic, bicyclic, or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated and has one or more, preferably 1-4, heteroatoms (as defined above) in addition to carbon atoms. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur, and nitrogen, the nitrogen can be N (such as in 3,4-dihydro-2H-pyrrolyl), NH (such as in pyrrolidinyl), or +It can be NR (such as in the case of N-substituted pyrrolidinyl). The heterocycle can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" are used interchangeably herein and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. Heterocyclyl groups can be monocyclic, bicyclic, or polycyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heterocyclyl, where the alkyl and heterocyclyl portions independently are optionally substituted.

[0046] In vitro: As used herein, the term "in vitro" refers to events that take place not within a living organism (e.g., an animal, plant, and / or microorganism), but in an artificial environment, such as a test tube or reaction vessel, cell culture.

[0047] In vivo: As used herein, the term "in vivo" refers to events that take place within an organism (e.g., an animal, a plant, and / or a microorganism).

[0048] Optionally substituted: As described herein, compounds of the present disclosure, e.g., oligonucleotides, may contain optionally substituted and / or substituted moieties. In general, the term "substituted," whether preceded by the term "optionally," means that one or more hydrogens of the specified moiety are replaced with a suitable substituent. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each of the group's substitutable positions, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituents may be the same or different at all positions. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents contemplated by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term "stable," as used herein, refers to the Refers to a compound that is substantially unchanged when subjected to conditions that allow for its production, detection, and in certain embodiments, its recovery, purification, and use for one or more purposes disclosed herein.

[0049] Suitable monovalent substituents on substitutable atoms, e.g., suitable carbon atoms, are independently: halogen; -(CH) 0~4 R 〇 ;-(CH2) 0~4 OR 〇 ;-O(CH2) 0~4 R 〇 , -O-(CH2) 0~4 C(O)OR 〇 ;-(CH2) 0~4 CH(OR 〇 )2;-(CH2) 0~4 Ph(R 〇 -(CH2) 0~4 O(CH2) 0~1 Ph(R 〇 -CH=CHPh(R 〇 -(CH2) 0~4 O(CH2) 0~1 -pyridyl (R 〇 -NO2; -CN; -N3; ​​-(CH2) 0~4N(R 〇 )2;-(CH2) 0~4 N(R 〇 )C(O)R 〇 ;N(R 〇 )C(S)R 〇 ;-(CH2) 0~4 N(R 〇 )C(O)NR 〇 2;-N(R 〇 )C(S)NR 〇 2;-(CH2) 0~4 N(R 〇 )C(O)OR 〇 ;-N(R 〇 )N(R 〇 )C(O)R 〇 ;-N(R 〇 )N(R 〇 )C(O)NR2;-N(R 〇 )N(R 〇 )C(O)OR 〇 ;-(CH2) 0~4 C(O)R 〇 ;-C(S)R 〇 ;-(CH2) 0~4 C(O)OR 〇 ;-(CH2) 0~4 C(O)SR 〇 ;-(CH2) 0~4 C(O)SiR 〇 3;-(CH2) 0~4 CO(O)R 〇 ;-OC(O)(CH2) 0~4 SR、-SC(S)SR 〇 ;-(CH2) 0~4 SC(O)R 〇 ;-(CH2) 0~4 C(O)NR 〇 2;-C(S)NR 〇 2;-C(S)SR 〇 ;-SC(S)SR 〇 、-(CH2) 0~4 OC(O)NR 〇 2;-C(O)N(OR 〇 )R 〇 ;-C(O)C(O)R 〇 ;-C(O)CH2C(O)R 〇 ;-C(NOR 〇 )R 〇 ;-(CH2)0~4 SSR 〇 ;-(CH2) 0~4 S(O)2R 〇 ;-(CH2) 0~4 S(O)2OR 〇 ;-(CH2) 0~4 OS(O)2R 〇 ;-S(O)2NR 〇 2;-(CH2) 0~4 S(O)R 〇 ;-N(R 〇 )S(O)2NR 〇 2;-N(R 〇 )S(O)2R 〇 ;-N(OR 〇 )R 〇 ;-C(NH)NR 〇 2;-Si(R 〇 )3;-OSi(R 〇 )3;-B(R 〇 )2;-OB(R 〇 )2;-OB(OR 〇 )2;-P(R 〇 )2;-P(OR 〇 )2;-OP(R 〇 )2;-OP(OR 〇 )2;-P(O)(R 〇 )2;-P(O)(OR 〇 )2;-OP(O)(R 〇 )2;-OP(O)(OR 〇 )2;-OP(O)(OR 〇 )(SR 〇 );-SP(O)(R 〇 )2;-SP(O)(OR 〇 )2;-N(R 〇 )P(O)(R 〇 )2;-N(R 〇 )P(O)(OR 〇 )2;-P(R 〇 )2[B(R 〇 )3];-P(OR 〇 )2[B(R 〇 )3];-OP(R 〇 )2[B(R 〇 )3];-OP(OR 〇 )2[B(R 〇 )3];-(C 1~4 Straight-chain or branched alkylene)O-N(R〇 )2; or -(C 1~4 Linear or branched alkylene)C(O)ON(R 〇 )2, where each R 〇 may be substituted as defined below and independently represent hydrogen, C1-C 20 Aliphatic, C1-C with 1 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus 20 Heteroaliphatic, -CH2-(C 6~14 aryl), -O(CH2) 0~1 (C 6~14 aryl), -CH2- (5-14 membered heteroaryl ring), a 5-20 membered monocyclic, bicyclic or polycyclic, saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the above definitions, R 〇 two independent occurrences of together with their intervening atoms form a 5-20 membered monocyclic, bicyclic or polycyclic, saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which can be substituted as defined below.

[0050] R 〇 (or R 〇 Suitable monovalent substituents for the ring formed by two independent occurrences of -(CH) together with their intervening atoms are independently halogen, -(CH) 0~2 R · ,-(Halo R · ), -(CH2) 0~2 OH, -(CH2) 0~2 OR · , -(CH2) 0~2 CH(OR · )2;-O(HaloR · ), -CN, -N3, -(CH2) 0~2 C(O)R · , -(CH2) 0~2 C(O)OH, -(CH2) 0~2 C(O)OR · , -(CH2) 0~2 SR · , -(CH2) 0~2 SH, -(CH2)0~2 NH2, -(CH2) 0~2 NHR · , -(CH2) 0~2 NR · 2, -NO2, -SiR · 3. -OSiR · 3. -C(O)SR · , -(C 1~4 Linear or branched alkylene)C(O)OR · or -SSR · (where each R · is unsubstituted or, if preceded by "halo", is substituted with only one or more halogens), and independently C1-C4 aliphatic, -CH2Ph, -O(CH2) 0~1 R is a 5-6 membered saturated, partially unsaturated, or aryl ring having Ph and 0-4 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus. 〇 Suitable divalent substituents for saturated carbon atoms of include ═O and ═S.

[0051] For example, suitable divalent substituents for suitable carbon atoms are, independently, the following: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2~3 O- or -S(C(R * 2)) 2~3 S-, where R * Each independent occurrence of represents hydrogen, C which may be substituted as defined below 1~6 Aliphatic and unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents attached to adjacent substitutable carbons of an "optionally substituted" group include -O(CR * 2) 2~3 O-, where R * Each independent occurrence of represents hydrogen, C which may be substituted as defined below1~6 It is selected from aliphatic and unsubstituted 5-6 membered saturated, partially unsaturated or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0052] R * Suitable substituents for the aliphatic groups are independently halogen, R · ,-(Halo R · ), -OH, -OR · , -O(HaloR · ), -CN, -C(O)OH, -C(O)OR · , -NH2, NHR · , -NR · 2 or -NO2 (each R · is unsubstituted or, if preceded by "halo", is substituted with one or more halogens only) and independently C1-C4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph or independently is a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms selected from nitrogen, oxygen and sulfur.

[0053] Oral: The phrases "oral administration" and "orally administered," as used herein, have their art-understood meanings and refer to administration of a compound or composition by mouth.

[0054] Parenteral: The phrases "parenteral administration" and "parenterally administered," as used herein, have their art-understood meaning and refer to modes of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraocular, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0055] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings with multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as defined herein.

[0056] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen that, when administered to a relevant population, exhibits a statistically significant probability of achieving a predetermined therapeutic effect. In some embodiments, a pharmaceutical composition may be specifically formulated for administration in a solid or liquid dosage form, including those designed for the following administrations: oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, ingested, or sublingual. pastes for application of the compound; parenteral administration, e.g., subcutaneous, intramuscular, intravenous or epidural injection, e.g., as a sterile solution or suspension or sustained release formulation; topical application, e.g., as a cream, ointment or controlled release patch or spray applied to the skin, lung or oral cavity; vaginal or rectal, e.g., as a pessary, cream or foam; sublingually; ophthalmically; transdermally; or intranasally, to the lungs and other mucosal surfaces.

[0057] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, materials, compositions and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other impairment or complication, commensurate with a reasonable benefit / risk ratio.

[0058] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulant, that is involved in carrying or transporting a compound of interest from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, for example, sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters; polycarbonates and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0059] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of compounds that are suitable for use in connection with pharmaceutical preparations, i.e., salts that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and that are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, arginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfate, formate, fumarate, glucoheptanoate, glycerophosphate, and gluconate. , hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate , stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates, and the like. In some embodiments, provided compounds contain one or more acidic groups, e.g., oligonucleotides, and pharmaceutically acceptable salts are alkali, alkaline earth metal, or ammonium (e.g., ammonium salts of N(R)3, where each R is independently as defined and described in this disclosure) salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt includes amine cations formed, where appropriate, with non-toxic ammonium, quaternary ammonium, and amine cations formed with counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and arylsulfonates. In some embodiments, provided compounds contain more than one acidic group, for example, provided oligonucleotides may contain two or more acidic groups (e.g., in natural phosphate linkages and / or modified internucleotide linkages). In some embodiments, pharmaceutically acceptable salts, or salts of such compounds in general, contain two or more cations, which may be the same or different. In some embodiments, in pharmaceutically acceptable salts (or salts in general), all ionized hydrogens in acidic groups are replaced with cations. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of a provided oligonucleotide. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of a provided oligonucleotide, wherein each acidic linkage group (e.g., each natural phosphate linkage, each phosphorothioate internucleotide linkage, etc.) is independently present as a sodium salt form (total sodium salt).

[0060] Protecting Group: The term "protecting group" as used herein is known in the art and is defined in Protecting Groups in Organic Synthesis, T.W. Greene and P.G.M. Butts, 3rd edition, John Wiley & Sons, 1999 (which are incorporated herein by reference in their entireties), and also include protecting groups specifically designed for nucleoside and nucleotide chemistry as described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al., 06 / 2012 (Chapter 2 is incorporated herein by reference in its entirety). Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethylcarbamate. t-Bumeoc), 1-(3,5-di-t-biphenylcarbamate)-1-methylethylcarbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethylcarbamate ( ... Tyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropyl allyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate ( Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2 -Methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenylcarbamate (Mtpc), 2,4-dimethyl-thiophenylcarbamate (Bmpc), 2-phosphinoethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p-(di Hydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivatives, N'-p-toluenesulfonylaminocarbonyl derivatives, N' -phenylaminothiocarbonyl derivatives, t-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N-dimethyl-carboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethyl-carboxamido)propyl carbamate, 1,1-Dimethyl-propynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotyl carbamate, p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazo) (phenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-Pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3- Nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-Triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethyl, [silyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrroli-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamine N-methylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, Np-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, Np-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexyl N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylborinic acid derivatives, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelates, N-zinc chelates, N-nitroamines, N-nitrosamines, amine N-oxides, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkylphosphoramidates, dibenzylphosphoramidates, diphenylphosphinamide Sulforamidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridine sulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0061] Suitable protected carboxylic acids further include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, and tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0062] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl. methyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacol methyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-Methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl , 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl , 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-dinitrobenzohydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-Tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylsilyl Diisopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoyl formate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropyl Pionate, 4-oxovalerate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyl dithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl Carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl aryl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzylthiocarbonate, 4-ethoxy-1-naphthothyl carbonate, methyldithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methyl,Valerate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetic acid, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetic acid, 2,4-bis(1,1-dimethylpropyl)phenoxyacetic acid, chlorodiphenylacetic acid, isobutyrate, monosuccinoate monosuccinoate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts).When protecting 1,2- or 1,3-diol, the protecting group may be methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene acetal, methyl ... Examples of suitable silyl groups include ethylene orthoesters, 1-methoxyethylidene orthoesters, 1-ethoxyethylidene orthoesters, 1,2-dimethoxyethylidene orthoesters, α-methoxybenzylidene orthoesters, 1-(N,N-dimethylamino)ethylidene derivatives, α-(N,N'-dimethylamino)benzylidene derivatives, 2-oxacyclopentylidene orthoesters, di-t-butylsilylene groups (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivatives (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivatives (TBDS), cyclic carbonates, cyclic boronic acid salts, ethyl borate, and phenyl borate.

[0063] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl(trityl), 4,4′-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoyl formate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4′-dimethoxytrityl, (D MTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (Pixyl), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting groups are selected from trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl. -dimethoxytrityl groups. In some embodiments, the phosphorus-linked protecting group is a group that is added to a phosphorus linkage (e.g., an internucleotide linkage) throughout oligonucleotide synthesis. In some embodiments, the protecting group is added to the sulfur atom of a phosphorothioate linkage. In some embodiments, the protecting group is added to the oxygen atom of an internucleotide phosphorothioate linkage. In some embodiments, the protecting group is added to the oxygen atom of an internucleotide phosphate linkage. In some embodiments, the protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl, N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0064] Sample: As used herein, a sample refers to a particular organism or material obtained therefrom. In some embodiments, a sample is a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, the source of interest includes an organism, such as an animal or a human. In some embodiments, a biological sample includes biological tissue or bodily fluid. In some embodiments, a biological sample is or includes bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy; cell-containing bodily fluids; free-floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymphatic fluid; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; lavages or washings, such as ductal lavage or bronchoalveolar lavage; aspirates; scrapings; bone marrow specimens; tissue biopsies; surgical specimens; feces, other bodily fluids, secretions, and / or excretions; and / or cells derived therefrom. In some embodiments, a biological sample is or includes cells obtained from an individual. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any suitable means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of bodily fluids (e.g., blood, lymph, stool, etc.), etc. In some embodiments, as the context will make clear, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., removing one or more components therefrom and / or adding one or more substances thereto), for example, filtration through a semipermeable membrane. Such a "processed sample" may include, for example, nucleic acids or proteins extracted from the sample or obtained by subjecting the primary sample to techniques such as mRNA amplification or reverse transcription, isolation and / or purification of specific components, etc. In some embodiments, the sample is an organism. In some embodiments, the sample is a plant. In some embodiments, the sample is an animal. In some embodiments, the sample is a human. In some embodiments, the sample is a non-human organism.

[0065] Subject: As used herein, the term "subject" or "test subject" refers to any organism to which a provided compound or composition is administered in accordance with the present disclosure, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, the subject may be afflicted with and / or susceptible to a disease, disorder, and / or condition.

[0066] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting all or nearly all extent or degree of a characteristic or property of interest. Those skilled in the art of biology will recognize that biological and chemical phenomena rarely, if ever, reach completeness. It will be understood that the invention will not be complete and / or will not proceed to completion or achieve or avoid an absolute consequence. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0067] Suffering from: An individual "suffering from" a disease, disorder, and / or condition has been diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0068] Susceptible: An individual who is "susceptible" to a disease, disorder, and / or condition is an individual who is at a higher risk than the general population of developing the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition is predisposed to contract the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not develop the disease, disorder, and / or condition.

[0069] Systemic: The phrases "systemic administration," "administered systemically," "peripheral administration," and "administered peripherally," as used herein, have their art-understood meaning of referring to administration of a compound or composition so that it enters the recipient's entire body.

[0070] Therapeutic Agent: As used herein, the phrase "therapeutic agent" refers to any agent that has a therapeutic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.

[0071] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a treatment regimen, elicits a desired biological response. In some embodiments, a therapeutically effective amount of a substance is an amount that, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be appreciated by those of skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance being delivered, the target cell or tissue, and the like. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, ameliorate, relieves, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of, one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0072] Treat: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to subjects who do not show signs of the disease, disorder, and / or condition. In this embodiment, for example, treatment may be administered to a subject who exhibits only early signs of a disease, disorder, and / or condition in order to reduce the risk of developing pathology associated with the disease, disorder, and / or condition.

[0073] Unsaturated: As used herein, the term "unsaturated" means that a moiety has one or more units of unsaturation.

[0074] Unit dose: As used herein, the phrase "unit dose" refers to an amount administered as a single administration of a pharmaceutical composition and / or administered in a physically discrete unit. In many embodiments, a unit dose comprises a predetermined amount of an active agent. In some embodiments, a unit dose comprises an entire single dose of a drug. In some embodiments, two or more unit doses are administered to achieve a total single administration. In some embodiments, administration of multiple unit doses is necessary or expected to be necessary to achieve the intended effect. A unit dose can be, for example, a predetermined amount of one or more therapeutic agents, a volume of a liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic agents in solid form, or a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents. It will be understood that a unit dose can be present in a formulation that includes any of a variety of ingredients in addition to a therapeutic agent. For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., can be included, as described below. Those skilled in the art will understand that in many embodiments, an appropriate total daily dosage of a particular therapeutic agent may comprise a fraction or multiple of a single unit dose, which may be determined by the attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dosage level for any particular subject or organism may vary depending on a variety of factors, including the disorder being treated and the severity of the disorder, the activity of the specific active compound used; the specific composition used; the age, weight, health, sex, and diet of the subject; the time of administration and its excretion rate of the specific active compound used; the duration of treatment; drugs and / or additional therapies used in combination or simultaneously with the specific compound used, and similar factors known in the medical arts.

[0075] Wild-type: As used herein, the term "wild-type" has its art-recognized meaning of referring to an entity having a structure and / or activity that occurs in nature in a "normal" state or situation (as opposed to a mutant, diseased, modified, etc.). Those of skill in the art will understand that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0076] Nucleic Acid: As used herein, the term "nucleic acid" includes any nucleotide and polymers thereof. As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule and, thus, include double- and single-stranded DNA and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA made from modified nucleotides and / or modified polynucleotides, such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides. These terms encompass polyribonucleotides or oligoribonucleotides (RNA) and polydeoxyribonucleotides or oligodeoxyribonucleotides (DNA); RNA or DNA derived from nucleobases and / or N-glycosides or C-glycosides of modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus internucleotide linkages. The term encompasses nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified internucleotide linkages. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing from 2 to about 10,000 nucleotide monomer units, and the prefix oligo- refers to a nucleic acid containing from 2 to about 200 nucleotide monomer units.

[0077] Nucleotide: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide composed of a nucleobase, a sugar, and one or more internucleotide linkages. Natural bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) are derivatives of purines or pyrimidines, although it should be understood that natural and unnatural base analogs are also included. Natural sugars are the pentoses (five-carbon sugars) deoxyribose (forming DNA) or ribose (forming RNA), although it should be understood that natural and unnatural sugar analogs are also included. Nucleotides are linked via internucleotide linkages to form nucleic acids or polynucleotides. Many internucleotide linkages are known in the art (e.g., but not limited to, phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothioates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate backbone of native nucleic acids, such as those described herein. In some embodiments, natural nucleotides contain naturally occurring bases, sugars, and internucleotide linkages. As described herein, in some embodiments, the term "nucleotide" also encompasses structural analogs that are used in place of natural or naturally occurring nucleotides, such as modified nucleotides and nucleotide analogs.

[0078] Modified Nucleotide: The term "modified nucleotide" includes any chemical moiety that is structurally different from a naturally occurring nucleotide but is capable of performing at least one function of a naturally occurring nucleotide. In some embodiments, a modified nucleotide comprises a modification in the sugar, base, and / or internucleotide linkage. In some embodiments, a modified nucleotide comprises a modified sugar, a modified nucleobase, and / or a modified internucleotide linkage. In some embodiments, a modified nucleotide is capable of performing at least one function of a nucleotide, e.g., forming a subunit in a polymer that is capable of base pairing with a nucleic acid comprising at least a complementary base sequence.

[0079] Analog: The term "analog" includes any chemical moiety that is structurally different from a reference chemical moiety or class of chemical moieties, but that is capable of performing at least one function of such reference chemical moiety or class of chemical moieties. As non-limiting examples, a nucleotide analog is structurally different from a nucleotide, but performs at least one function of a nucleotide; a nucleobase analog is structurally different from a nucleobase, but performs at least one function of a nucleobase, etc.

[0080] Nucleoside: The term "nucleoside" refers to a moiety in which a nucleobase or modified nucleobase is covalently linked to a sugar or modified sugar.

[0081] Modified Nucleoside: The term "modified nucleoside" refers to a moiety that is derived from a natural nucleoside or is chemically similar to a natural nucleotide, but contains a chemical modification that distinguishes it from a natural nucleoside. Non-limiting examples of modified nucleosides include those containing base and / or sugar modifications. Non-limiting examples of modified nucleosides include those having a 2' modification on the sugar. Further non-limiting examples of modified nucleosides include abasic nucleosides (nucleobases missing). In some embodiments, the modified nucleoside is capable of at least one function of a nucleoside, for example, forming a moiety in a polymer that is capable of base pairing with a nucleic acid containing at least a complementary base sequence.

[0082] Nucleoside Analog: The term "nucleoside analog" refers to a chemical moiety that is chemically different from a naturally occurring nucleoside but is capable of performing at least one function of a nucleoside. In some embodiments, a nucleoside analog comprises a sugar analog and / or a nucleobase analog. In some embodiments, a modified nucleoside is capable of performing at least one function of a nucleoside, e.g., forming a moiety in a polymer that is capable of base pairing with a nucleic acid containing a complementary base sequence.

[0083] Sugar: The term "sugar" refers to a monosaccharide or polysaccharide in a closed and / or open state. In some embodiments, a sugar is a monosaccharide. In some embodiments, a sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs that are used in place of traditional sugar molecules, such as glycols, polymers of which form the backbone of nucleic acid analogs, such as glycol nucleic acids (GNAs). As used herein, the term "sugar" also encompasses structural analogs that are used in place of natural or naturally occurring nucleotides, such as modified sugars and nucleotide sugars.

[0084] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. The modified sugar mimics the spatial arrangement, electronic properties, or any other physicochemical property of a sugar.

[0085] Nucleobase: The term "nucleobase" refers to the portion of a nucleic acid that participates in hydrogen bonding to bind one nucleic acid strand to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase is a "modified nucleobase," e.g., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, modified nucleobases mimic the spatial arrangement, electronic properties, or any other physicochemical properties of nucleobases, and retain the hydrogen bonding properties that bind one nucleic acid strand to another in a sequence-specific manner. In some embodiments, modified nucleobases can pair with all five natural bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of oligonucleotide double helix strands. As used herein, the term "nucleobase" also includes structural analogs that are used in place of natural or naturally occurring nucleotides, such as modified nucleobases and nucleobase analogs.

[0086] Modified nucleobase: The terms "modified nucleobase," "modified base," and the like refer to a chemical moiety that is chemically different from a nucleobase but can perform at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase that includes a modification. In some embodiments, a modified nucleobase is capable of performing at least one function of a nucleobase, for example, can form a moiety in a polymer that can base pair with a nucleic acid that includes at least a complementary base sequence.

[0087] Blocking group: The term "blocking group" refers to a group that masks the reactivity of a functional group. The functional group may subsequently be unmasked by removal of the blocking group. In some embodiments, the blocking group is a protecting group.

[0088] Moiety: The term "moiety" refers to a specific segment of a molecule's functionality. A chemical moiety is a commonly recognized chemical entity embedded in or attached to a molecule. do.

[0089] Solid Support: The term "solid support" refers to any support that allows for the synthesis of nucleic acids. In some embodiments, the term refers to glass or a polymer that is insoluble in the media used in the reaction steps performed to synthesize nucleic acids and that has been derivatized to contain reactive groups. In some embodiments, the solid support is highly cross-linked polystyrene (HCP) or controlled pore glass (CPG). In some embodiments, the solid support is controlled pore glass (CPG). In some embodiments, the solid support is a hybrid support of controlled pore glass (CPG) and highly cross-linked polystyrene (HCP).

[0090] Homology: "Homology" or "identity" or "similarity" refers to sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence, which can be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base, the molecules are identical at that position; when an equivalent site is occupied by an identical or similar (e.g., similar in steric and / or electronic properties) nucleic acid residue, the molecules can be called homologous (similar) at that position. Expression as a percentage of homology / similarity or identity refers to a function of the number of identical or similar nucleic acids at a position shared by the compared sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces the identity and homology / similarity.

[0091] In some embodiments, the term "homology" refers to a mathematically based comparison of sequence similarities and is used to identify genes with similar functions or motifs. The nucleic acid sequences described herein can be used as "query sequences" to perform searches against public databases to identify, for example, other family members, related sequences, or homologs. In some embodiments, such searches can be performed using the methods described in Altschul, et al. (1990) J. Mol. Biol. 215:403-10, can be used. In some embodiments, BLAST nucleotide searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST nucleotide searches can be performed with the NBLAST program, score=100, word length=12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the present disclosure. In some embodiments, gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402 to obtain gapped alignments for comparison purposes. When using BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and BLAST) can be used (see www.ncbi.nlm.nih.gov).

[0092] Identity: As used herein, "identity" means the percentage of nucleotide residues that are identical at corresponding positions in two or more sequences when the sequences are aligned for maximum sequence match, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those known in the art, including but not limited to those cited in WO 2017 / 192679.

[0093] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides, which may contain any combination of natural and unnatural nucleobases, sugars, and internucleotide linkages.

[0094] Oligonucleotides can be single-stranded or double-stranded. Single-stranded oligonucleotides are A double-stranded oligonucleotide comprising two oligonucleotide strands may have a double-stranded region (formed by two portions of the single-stranded oligonucleotide), and a double-stranded oligonucleotide comprising two oligonucleotide strands may have a single-stranded region, for example, in a region where the two oligonucleotide strands are not complementary to each other. Examples of oligonucleotides include, but are not limited to, structural genes, genes including regulatory and termination regions, self-replicating systems such as viral DNA or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNA, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adapters, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0095] Internucleotide linkage: As used herein, the phrase "internucleotide linkage" generally refers to the bond connecting the nucleotide units of an oligonucleotide or nucleic acid. In some embodiments, the internucleotide linkage is a phosphodiester bond (a natural phosphate bond) as present in naturally occurring DNA and RNA molecules. In some embodiments, the internucleotide linkage comprises a modified internucleotide linkage. In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" in which each oxygen atom of the phosphodiester bond is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from, but are not limited to, =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and N(R')-, where each R' is independently as defined and described in this disclosure. In some embodiments, the internucleotide linkage is a phosphotriester linkage, a phosphorothioate diester linkage, or a phosphotriester linkage. [ka] , or modified phosphorothioate triester linkages. In some embodiments, the internucleotide linkage is, for example, one of a PNA (peptide nucleic acid) or PMO (phosphorodiamidate morpholino oligomer) linkage. Those skilled in the art will understand that an internucleotide linkage can exist as an anion or cation at a given pH depending on the presence of an acidic or basic moiety in the linkage.

[0096] Non-limiting examples of modified internucleotide linkages are the modified internucleotide linkages designated s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17 and s18, as described in WO 2017 / 210647.

[0097] For example, (Rp,Sp)-ATsCs1GA has 1) a phosphorothioate internucleotide bond between T and C; [ka] and 2) between C and G [ka] Unless otherwise specified, the designation Rp / Sp preceding an oligonucleotide sequence describes the conformation of the chiral phosphorus atom in that internucleotide linkage in order from 5' to 3' of the oligonucleotide sequence. For example, in (Rp,Sp)-ATsCs1GA, the phosphorus in the "s" bond between T and C has the Rp conformation, and the phosphorus in the "s1" bond between C and G has the Sp conformation. In some embodiments, "All-(Rp)" or "All-(Sp)" is used to indicate that all chiral phosphorus atoms in the oligonucleotide have the same Rp or Sp conformation, respectively.

[0098] Oligonucleotide Type: As used herein, the phrase "oligonucleotide type" is used to define oligonucleotides having a particular base sequence, backbone linkage pattern (i.e., pattern of internucleotide linkage types, e.g., phosphate, phosphorothioate, etc.), pattern of backbone chiral centers (i.e., pattern of bond phosphorus stereochemistry (Rp / Sp)), and pattern of backbone phosphorus modifications. In some embodiments, oligonucleotides commonly referred to as a "type" are structurally identical to one another.

[0099] Those skilled in the art will appreciate that the synthesis methods of the present disclosure provide a degree of control during oligonucleotide chain synthesis, whereby each nucleotide unit of the oligonucleotide chain can be pre-designed and / or pre-selected to have a specific stereochemistry at the binding phosphorus and / or a specific modification at the binding phosphorus, and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is pre-designed and / or pre-selected to have a specific combination of stereocenters at the binding phosphorus. In some embodiments, the oligonucleotide chain is designed and / or pre-determined to have a specific combination of modifications at the binding phosphorus. In some embodiments, the oligonucleotide chain is designed and / or pre-selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or pre-selected to have a specific combination of one or more of the structural characteristics described above. In some embodiments, the present disclosure provides compositions (e.g., chiral controlled oligonucleotide compositions) containing or composed of multiple oligonucleotide molecules. In some embodiments, all of these molecules are the same type of molecule (i.e., structurally identical to each other). In many embodiments, the provided compositions contain multiple oligonucleotides of different types, typically in predetermined relative amounts.

[0100] Chiral control: As used herein, "chiral control" refers to the control of the stereochemistry of the chiral linkage phosphorus in a chiral internucleotide linkage within an oligonucleotide. In some embodiments, the control is achieved through chiral elements absent from the sugar and base moieties of the oligonucleotide; for example, in some embodiments, the control is achieved through one or more chiral auxiliary groups during the oligonucleotide preparation process, as exemplified in the present disclosure, which chiral auxiliary is often part of the chiral phosphoramidite used in the oligonucleotide preparation process. In contrast to chiral control, those skilled in the art will understand that conventional oligonucleotide synthesis without the use of a chiral auxiliary cannot control the stereochemistry at the chiral internucleotide linkage when such conventional oligonucleotide synthesis is used to form the chiral internucleotide linkage. In some embodiments, the control is achieved through one or more chiral auxiliary groups during the oligonucleotide preparation process, as exemplified in the present disclosure, which chiral auxiliary is often part of the chiral phosphoramidite used in the oligonucleotide preparation process. In contrast to chiral control, those skilled in the art will understand that conventional oligonucleotide synthesis without the use of a chiral auxiliary cannot control the stereochemistry at the chiral internucleotide linkage when such conventional oligonucleotide synthesis is used to form the chiral internucleotide linkage. The stereochemical assignment of each chiral linkage phosphorus in the chiral internucleotide linkage is controlled.

[0101] Chirality-controlled oligonucleotide composition: As used herein, the terms "chirality-controlled oligonucleotide composition," "chirality-controlled nucleic acid composition," and the like refer to a composition comprising a plurality of oligonucleotides (or nucleic acids) having 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphorus modifications, wherein the plurality of oligonucleotides (or nucleic acids) have the same bond phosphorus stereochemistry at one or more chiral internucleotide linkages (chirality-controlled or stereo-defined internucleotide linkages, the chiral bond phosphorus is Rp or Sp in the composition ("stereo-defined"), rather than random Rp and Sp as in non-chirality-controlled internucleotide linkages). The level of the plurality of oligonucleotides (or nucleic acids) in the chirality-controlled oligonucleotide composition is predetermined / controlled (e.g., stereoselectively forming one or more chiral internucleotide linkages via chirality-controlled oligonucleotide formulations). In some embodiments, about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 50%, 50%, 60%, 70%, 80%, 90%, 95 ... 0%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) are the plurality of oligonucleotides.In some embodiments, about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%) of all oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications in the chiral control oligonucleotide composition. or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% are the plurality of oligonucleotides. In some embodiments, the level is between about 1% and 100% (e.g., between about 5% and 100%, 10% to 100%) of all oligonucleotides in the composition, or of all oligonucleotides in the composition that have a shared base sequence (e.g., of multiple oligonucleotides or oligonucleotide types), or of all oligonucleotides in the composition that have a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, or of all oligonucleotides in the composition that have a common base sequence, a common pattern of base modifications, a common pattern of sugar modifications, a common pattern of internucleotide linkage types, and / or a common pattern of internucleotide linkage modifications. 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90% or approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90 %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%).In some embodiments, the plurality of oligonucleotides comprises about 1 to 50 (e.g., about 1 to 10, 1 to 20, 5 to 10, 5 to 20, 10 to 15, 10 to 20, 10 to 25, 10 to 30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more). In some embodiments, the plurality of oligonucleotides have about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90%, or about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 5 ... 0%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% have the same stereochemistry. In some embodiments, multiple oligonucleotides (or nucleic acids) are of the same configuration. In some embodiments, the level of the plurality of oligonucleotides (or nucleic acids) is about 1% to 100%, (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 10 ... 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, each chiral internucleotide linkage is a chiral-controlled internucleotide linkage, and the composition is a completely chiral-controlled oligonucleotide composition. In some embodiments, multiple oligonucleotides (or nucleic acids) are structurally identical.In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 95%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 96%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 97%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 98%. In some embodiments, the chiral controlled internucleotide linkage has a diastereomeric purity of at least 99%. In some embodiments, the level percentage is (DS). nc or at least (DS) nc where DS is the diastereomeric purity as described herein (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more), and nc is the number of chiral-controlled internucleotide linkages as described herein (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, the percentage level is (DS) nc or at least (DS) nc where DS is 95% to 100%. For example, when DS is 99% and nc is 10, the percentage is 90% or at least 90% (99%). 10≈0.90=90%). In some embodiments, the level of a plurality of oligonucleotides in a composition is expressed as the product of the diastereopurities of each chiral internucleotide bond in the oligonucleotide. In some embodiments, the diastereopurity of an internucleotide bond linking two nucleosides in an oligonucleotide (or nucleic acid) is expressed as the product of the diastereopurity of the internucleotide bond of a dimer linking the same two nucleosides. where the dimer is prepared using equivalent conditions, and in some instances, identical synthesis cycle conditions (e.g., for a linkage between Nx and Ny in an oligonucleotide where NxNy, the dimer is NxNy). In some embodiments, not all chiral internucleotide linkages are chiral-controlled internucleotide linkages, and the composition is a partially chiral-controlled oligonucleotide composition. In some embodiments, the non-chiral internucleotide linkages have a diastereomeric purity of less than about 80%, 75%, 70%, 65%, 60%, 55%, or about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., as understood by those skilled in the art from conventional oligonucleotide synthesis, e.g., phosphoramidite methods). In some embodiments, the multiple oligonucleotides (or nucleic acids) are of the same type. In some embodiments, a chiral-controlled oligonucleotide composition comprises non-random or controlled levels of distinct oligonucleotide or nucleic acid types. For example, in some embodiments, a chiral-controlled oligonucleotide composition comprises one or less oligonucleotide types. In some embodiments, chiral controlled oligonucleotide compositions comprise two or more oligonucleotide types. In some embodiments, chiral controlled oligonucleotide compositions comprise a plurality of oligonucleotide types. In some embodiments, chiral controlled oligonucleotide compositions are compositions consisting of oligonucleotides of an oligonucleotide type, which comprise a non-random or controlled number of oligonucleotides of that oligonucleotide type.

[0102] Chirally pure: As used herein, the phrase "chirally pure" is used to describe an oligonucleotide or composition thereof in which all or nearly all (the remainder being impurities) of the oligonucleotide molecules are present in a single diastereomeric type with respect to the linking phosphorus atom.

[0103] Predetermined: Predetermined (or predetermined) means, for example, intentionally selected, non-random, or controlled, as opposed to randomly occurring, randomly, or achieved without control. Upon reading this specification, one of skill in the art will understand that the present disclosure provides techniques that enable the selection of specific chemical and / or stereochemical features to be incorporated into oligonucleotide compositions, as well as the control of the preparation of oligonucleotide compositions having such chemical and / or stereochemical features. Such compositions provided are "predetermined" as described herein. A composition that may contain any oligonucleotide is not a "predetermined" composition because it is a composition that is accidentally produced by a process that is not controlled to intentionally produce specific chemical and / or stereochemical features. In some embodiments, a predetermined composition is a composition that can be intentionally reproduced (e.g., by repeating a controlled process). In some embodiments, a predetermining level of a plurality of oligonucleotides in a composition means that the absolute and / or relative amounts (ratios, percentages, etc.) of the plurality of oligonucleotides in the composition are controlled. In some embodiments, the predetermining level of the plurality of oligonucleotides in the composition is achieved by the preparation of chiral control oligonucleotides.

[0104] Bound phosphorus: As defined herein, the phrase "bound phosphorus" is used to indicate that the particular phosphorus atom involved is a phosphorus atom present in an internucleotide linkage, which phosphorus atom corresponds to the phosphate atom of a phosphodiester internucleotide linkage present in natural DNA and RNA. In some embodiments, the bound phosphorus atom is in a modified internucleotide linkage, where each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the bound phosphorus atom is chiral. In some embodiments, the bound phosphorus atom is achiral.

[0105] P-modification: As used herein, the term "P-modification" refers to any modification at the bound phosphorus other than a stereochemical modification. In some embodiments, a P-modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the bound phosphorus. In some embodiments, a "P-modification" includes the addition, substitution, or removal of a pendant moiety covalently attached to the bound phosphorus. 1 wherein X, L and R 1 are each independently as defined and described in this disclosure.

[0106] Blockmir: The term "blockmir," as used herein, refers to an oligonucleotide chain in which the pattern of structural features characterizing each individual nucleotide unit is characterized by the presence of at least two consecutive nucleotide units having a common structural feature at their internucleotide phosphorus linkage. A common structural feature refers to a common stereochemistry at the bond phosphorus or a common modification at the bond phosphorus. In some embodiments, at least two consecutive nucleotide units having a common structural feature at the internucleotide phosphorus linkage are referred to as a "block." In some embodiments, provided oligonucleotides are blockmirs.

[0107] In some embodiments, the blockmir is a "stereoblockmir", e.g., at least two consecutive nucleotide units have the same stereochemistry at the bond phosphorus. Such at least two consecutive nucleotide units form a "stereoblock".

[0108] In some embodiments, the blockmir is a "P-modified blockmir," e.g., at least two consecutive nucleotide units have the same modification at the linked phosphorus. Such at least two consecutive nucleotide units form a "P-modified block." For example, (Rp,Sp)-ATsCsGA is a P-modified blockmir because at least two consecutive nucleotide units, i.e., Ts and Cs, have the same P-modification (i.e., both are phosphorothioate diester). In the same oligonucleotide, (Rp,Sp)-ATsCsGA, Ts and Cs form a block, which is a P-modified block.

[0109] In some embodiments, the blockmir is a "linked blockmir," e.g., at least two consecutive nucleotide units have the same stereochemistry and the same modification at the linking phosphorus. At least two consecutive nucleotide units form a "linked block." For example, (Rp,Rp)-ATsCsGA is a linked blockmir because at least two consecutive nucleotide units, i.e., Ts and Cs, have the same stereochemistry (both Rp) and P-modification (both phosphorothioate). In the same oligonucleotide, (Rp,Rp)-ATsCsGA, TsCs form a block, which is a linked block.

[0110] In some embodiments, the blockmir comprises one or more blocks independently selected from a stereoblock, a P-modified block, and a conjugated block, hi some embodiments, the blockmir is a stereoblockmir with respect to one block, and / or a P-modified blockmir with respect to another block, and / or a conjugated blockmir with respect to yet another block.

[0111] The methods and structures described herein with respect to the compounds and compositions of the present disclosure also apply to their pharmaceutically acceptable acid or base addition salt forms, unless otherwise indicated.

[0112] Description of Specific Embodiments Oligonucleotides provide useful molecular tools in a wide variety of applications. For example, oligonucleotides (e.g., oligonucleotides targeting C9orf72) are useful in therapeutic, diagnostic, and research applications, including the treatment of various pathologies, disorders, and diseases. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) has advantages, for example, in the synthesis of endonucleic acids and in the development of new therapeutic strategies. The chirality of oligonucleotides is limited by their susceptibility to degradation and exonucleases. Therefore, various synthetic counterparts have been developed to circumvent these drawbacks. These counterparts include, among others, synthetic oligonucleotides containing chemical modifications, such as base modifications, sugar modifications, backbone modifications, etc., that render these molecules less susceptible to degradation and improve other properties and / or activities of the oligonucleotide. From a structural perspective, modifications to internucleotide linkages can introduce chirality, and certain oligonucleotide properties can be influenced by the configuration of the phosphorus atoms forming the backbone of the oligonucleotide. In many embodiments, the present disclosure provides technologies (e.g., oligonucleotides, compositions, methods, etc.) that contain chiral internucleotide linkages with chiral control. Among other things, the provided technology may provide increased activity (e.g., reduction in the level and / or activity of a target nucleic acid (e.g., various transcripts) and / or the product (e.g., various proteins) encoded thereby), selectivity (e.g., selective reduction in the level and / or activity of a particular target nucleic acid (e.g., various transcripts) and / or the product (e.g., various proteins) encoded thereby relative to one or more others), and / or reduced toxicity (e.g., reduced levels of undesired side effects, such as reduced levels of undesired immune activity).

[0113] Oligonucleotides In particular, the present disclosure provides oligonucleotides of various designs that can include various nucleobases and patterns thereof, sugars and patterns thereof, internucleotide linkages and patterns thereof, and / or additional chemical moieties and patterns thereof, as described herein. In some embodiments, the provided C9orf72 oligonucleotides can direct a decrease in the expression, level, and / or activity of one or more C9orf72 genes and / or their products (e.g., transcripts, mRNAs, proteins, etc.). In some embodiments, the provided C9orf72 oligonucleotides can reduce the expression, level, and / or activity of C9orf72 nucleic acids (e.g., genes, transcripts, mRNAs, etc., which may be either strand of the C9orf72 gene or may be transcribed therefrom) and / or products encoded thereby (e.g., various proteins and / or peptides, etc.) associated with various pathological conditions, disorders, or diseases. In some embodiments, the provided C9orf72 oligonucleotides can direct a decrease in the expression, level, and / or activity of one or more C9orf72 genes and / or their products in the cells of a subject or patient. In some embodiments, the cells normally express C9orf72 or normally produce C9orf72 protein. In some embodiments, provided C9orf72 oligonucleotides can direct a decrease in the expression, level, and / or activity of a C9orf72 target gene or gene product, and have a base sequence that consists of, includes, or includes a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous bases) of a C9orf72 oligonucleotide disclosed herein, wherein each T can be independently replaced with U, or vice versa, and the oligonucleotide includes at least one non-naturally occurring modification of the base, sugar, and / or internucleotide linkage.In some embodiments, the expression, level, and / or activity of C9orf72 nucleic acids (e.g., genes, transcripts, mRNAs, etc., which may be either strand of the C9orf72 gene or may be transcribed therefrom) and / or products encoded thereby (e.g., various proteins and / or peptides, etc.) associated with various conditions, disorders, and / or diseases is selectively reduced relative to the expression, level, and / or activity of C9orf72 nucleic acids and / or products encoded thereby that are less or not associated with the condition, disorder, or disease. In some embodiments, v1 and / or v3 transcripts (e.g., those shown in FIG. 1 , antisense and sense) and / or products thereof that comprise the expanded repeat are associated with various conditions, disorders, and / or diseases. In some embodiments, v2 transcripts are less or less associated with the condition, disorder, and / or disease compared to v1 and v3 transcripts that comprise the expanded repeat. As will be understood by one of ordinary skill in the art, two events or entities are "associated" with one another, as that term is used herein, if the presence, level, and / or form of one correlates with that of the other. For example, entities (e.g., A specific gene (e.g., a polypeptide, gene signature, metabolite, microorganism, transcript, etc.) is considered to be associated with a particular disease, disorder, or condition if its presence, level, and / or form correlates with the incidence of and / or susceptibility to the disease, disorder, or condition (e.g., across a relevant population).

[0114] In some embodiments, C9orf72 oligonucleotides can direct the reduction of the expression, level, and / or activity of a target gene, e.g., a C9orf72 target gene or its product. In some embodiments, C9orf72 oligonucleotides can direct the reduction of the expression, level, and / or activity of a C9orf72 target gene or its product through RNase H-mediated knockdown. In some embodiments, C9orf72 oligonucleotides can direct the reduction of the expression, level, and / or activity of a C9orf72 target gene or its product by sterically blocking translation after binding to the C9orf72 target gene mRNA and / or by altering or interfering with mRNA splicing. However, despite this, the present disclosure is not limited to any particular mechanism. In some embodiments, the present disclosure provides oligonucleotides, compositions, methods, etc. that can function via double-stranded RNA interference, single-stranded RNA interference, RNase H-mediated knockdown, steric hindrance of translation, or a combination of two or more such mechanisms.

[0115] In some embodiments, C9orf72 oligonucleotides may mediate a reduction in C9orf72 expression, levels, and / or activity. In some embodiments, C9orf72 oligonucleotides may mediate a reduction in C9orf72 expression, levels, and / or activity through a mechanism involving mRNA degradation and / or steric hindrance of translation of C9orf72 mRNA.

[0116] In some embodiments, C9orf72 oligonucleotides may mediate a reduction in the expression, level, and / or activity of two or more C9orf72 alleles. In some embodiments, C9orf72 oligonucleotides may selectively mediate a reduction in the expression, level, and / or activity of a C9orf72 allele associated with a condition, disorder, or disease relative to the expression, level, and / or activity of a C9orf72 allele less associated with or not associated with the condition, disorder, or disease. In some embodiments, C9orf72 oligonucleotides may selectively mediate a reduction in the expression, level, and / or activity of a C9orf72 transcript and / or product encoded thereby associated with a condition, disorder, or disease relative to the expression, level, and / or activity of a C9orf72 transcript and / or product encoded thereby less associated with or not associated with the condition, disorder, or disease.

[0117] In some embodiments, the present disclosure relates to methods for treating a C9orf72-associated disease, disorder, or condition, the method comprising administering a therapeutically effective amount of a C9orf72 oligonucleotide that can mediate a reduction in the expression, level, and / or activity of C9orf72. In some embodiments, multiple forms, e.g., alleles, of C9orf72 can exist, and the provided techniques can reduce the expression, level, and / or activity of two or more or all of the forms and their products. In some embodiments, the provided techniques selectively reduce the expression, level, and / or activity of C9orf72 transcripts and / or products encoded thereby that are associated with a condition, disorder, or disease relative to those that are less or not associated with the condition, disorder, or disease.

[0118] In some embodiments, the present disclosure relates to a method for treating a C9orf72-associated disease, disorder, or condition, comprising administering to a subject suffering therefrom a therapeutically effective amount of a provided oligonucleotide or composition thereof.

[0119] In some embodiments, the C9orf72 oligonucleotide is a C9orf72 oligonucleotide described herein. In some embodiments, the C9orf72 oligonucleotide comprises a base sequence (or portion thereof) described herein, in which each T may be independently substituted with U, and vice versa, a chemical modification or pattern of chemical modifications (or portion thereof) and / or format or portion thereof described herein. In some embodiments, the C9orf72 oligonucleotide has a base sequence comprising a base sequence (or portion thereof) in which each T may be independently substituted with U, a pattern of chemical modifications (or portion thereof), and / or an oligonucleotide format disclosed herein, e.g., as disclosed in a Table or otherwise disclosed herein. In some embodiments, such oligonucleotides, e.g., C9orf72 oligonucleotides, reduce the expression, level, and / or activity of a gene, e.g., a C9orf72 gene or gene product thereof.

[0120] In particular, a C9orf72 oligonucleotide can hybridize to its target nucleic acid (e.g., pre-mRNA, mature mRNA, etc.). For example, in some embodiments, a C9orf72 oligonucleotide can hybridize to a C9orf72 nucleic acid derived from a DNA strand (either strand of the C9orf72 gene). In some embodiments, a C9orf72 oligonucleotide can hybridize to a C9orf72 transcript. In some embodiments, a C9orf72 oligonucleotide can hybridize to a C9orf72 nucleic acid at any stage of RNA processing, including, but not limited to, pre-mRNA or mature RNA. In some embodiments, a C9orf72 oligonucleotide may hybridize to any element of a C9orf72 nucleic acid or its complement, including, but not limited to, a promoter region, an enhancer region, a transcription termination region, a translation initiation signal, a translation termination signal, a coding region, a non-coding region, an exon, an intron / exon or an exon / intron junction, a 5'UTR, or a 3'UTR. In some embodiments, a C9orf72 oligonucleotide may hybridize to its target with no more than two mismatches. In some embodiments, a C9orf72 oligonucleotide may hybridize to its target with no more than one mismatch. In some embodiments, a C9orf72 oligonucleotide may hybridize to its target with no mismatches (e.g., all CG and / or AT / U base pairings).

[0121] In some embodiments, the oligonucleotide may hybridize to two or more variants of the transcript. In some embodiments, the C9orf72 oligonucleotide may hybridize to two or more or all variants of the C9orf72 transcript. In some embodiments, the C9orf72 oligonucleotide may hybridize to two or more or all variants of the C9orf72 transcript derived from the sense strand. In some embodiments, the oligonucleotide selectively hybridizes to transcripts associated with a condition, disorder, or disease (e.g., those containing expanded repeats).

[0122] In some embodiments, the C9orf72 target of the C9orf72 oligonucleotide is a C9orf72 RNA that is not an mRNA.

[0123] In some embodiments, the oligonucleotide, e.g., C9orf72 oligonucleotide, contains an increased level of one or more isotopes. In some embodiments, the oligonucleotide, e.g., C9orf72 oligonucleotide, is labeled with, for example, one or more isotopes of one or more elements, e.g., hydrogen, carbon, nitrogen, etc. In some embodiments, the oligonucleotide, e.g., C9orf72 oligonucleotide in the provided composition, e.g., a plurality of the oligonucleotides in the composition, comprises a base modification, a sugar modification, and / or an internucleotide linkage modification, wherein the oligonucleotide contains an enriched level of deuterium ... The 9orf72 oligonucleotide is labeled with deuterium at one or more positions (- 1 H- 2 In some embodiments, one or more of the oligonucleotide strands or any moieties conjugated to the oligonucleotide strands (e.g., targeting moieties) 1 H 2 Substitute with H. Such oligonucleotides can be used in the compositions and methods described herein.

[0124] In some embodiments, the present disclosure provides: 1) have a common base sequence in the transcript that is complementary to a target sequence (e.g., a C9orf72 target sequence); and 2) containing one or more modified sugar moieties and / or modified internucleotide linkages An oligonucleotide composition is provided that includes a plurality of oligonucleotides.

[0125] In some embodiments, C9orf72 oligonucleotides sharing a common base sequence may have the same pattern of nucleoside modifications, such as sugar modifications, base modifications, etc. In some embodiments, the pattern of nucleoside modifications can be represented by a combination of position and modification. In some embodiments, the backbone linkage pattern includes the position and type (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.) of each internucleotide linkage.

[0126] In some embodiments, provided compositions comprise a plurality of oligonucleotides. In some embodiments, the plurality of oligonucleotides are of the same oligonucleotide type. In some embodiments, the plurality of oligonucleotides share a common base sequence. In some embodiments, the plurality of oligonucleotides share a common sugar modification pattern. In some embodiments, the plurality of oligonucleotides share a common base modification pattern. In some embodiments, the plurality of oligonucleotides share a common nucleoside modification pattern. In some embodiments, the plurality of oligonucleotides have the same composition. In some embodiments, the plurality of oligonucleotides are identical.

[0127] In some embodiments, as exemplified herein, the C9orf72 oligonucleotide is chiral and comprises one or more chiral internucleotide linkages. In some embodiments, the C9orf72 oligonucleotide is stereochemically pure. In some embodiments, the C9orf72 oligonucleotide is substantially separated from other stereoisomers.

[0128] In some embodiments, the C9orf72 oligonucleotide comprises one or more modified nucleobases, one or more modified sugars, and / or one or more modified internucleotide linkages.

[0129] In some embodiments, the C9orf72 oligonucleotide comprises one or more modified sugars. In some embodiments, the oligonucleotide of the present disclosure comprises one or more modified nucleobases. Various modifications can be introduced into the sugar and / or nucleobase according to the present disclosure. For example, in some embodiments, the modifications are those described in U.S. Patent No. 9,006,198. In some embodiments, the modification is as described in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,598,458, U.S. Patent No. 9,982,257, U.S. Patent No. 10,160,969, U.S. Patent No. 10,479,995, U.S. Patent Application Publication No. 2020 / 0056173, U.S. Patent Application Publication No. 2018 / 0216107, U.S. Patent Application Publication No. 2019 / 0127733, U.S. Patent No. 10,450,568, U.S. Patent Application Publication No. 2019 / 0077817, U.S. Patent Application Publication No. 2019 / 0249173, U.S. Patent Application Publication No. 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 and / or WO 2019 / 032612, each of which sugar, base and internucleotide linkage modifications are independently incorporated herein by reference.

[0130] As used in this disclosure, in some embodiments, "one or more" is 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, "one or more" is 1. In some embodiments, "one or more" is 2. In some embodiments, "one or more" is 3. In some embodiments, "one or more" is 4. In some embodiments, "one or more" is 5. In some embodiments, "one or more" is 6. In some embodiments, "one or more" is 7. In some embodiments, "one or more" is 8. In some embodiments, "one or more" is nine. In some embodiments, "one or more" is ten. In some embodiments, "one or more" is at least one. In some embodiments, "one or more" is at least two. In some embodiments, "one or more" is at least three. In some embodiments, "one or more" is at least four. In some embodiments, "one or more" is at least five. In some embodiments, "one or more" is at least six. In some embodiments, "one or more" is at least seven. In some embodiments, "one or more" is at least eight. In some embodiments, "one or more" is at least nine. In some embodiments, "one or more" is at least ten.

[0131] As used in this disclosure, in some embodiments, "at least one" is 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, "at least one" is 1. In some embodiments, "at least one" is 2. In some embodiments, "at least one" is 3. In some embodiments, "at least one" is 4. In some embodiments, "at least one" is 5. In some embodiments, "at least one" is 6. In some embodiments, "at least one" is 7. In some embodiments, "at least one" is 8. In some embodiments, "at least one" is 9. In some embodiments, "at least one" is 10.

[0132] In some embodiments, the C9orf72 oligonucleotide is or comprises a C9orf72 oligonucleotide described in the Tables.

[0133] As demonstrated in the present disclosure, in some embodiments, a provided oligonucleotide (e.g., a C9orf72 oligonucleotide) is characterized in that it knocks down its target (e.g., a C9orf72 transcript for a C9orf72 oligonucleotide) when contacted with the transcript in a knockdown system.

[0134] In some embodiments, the oligonucleotide is provided as a salt form. In some embodiments, the oligonucleotide contains a negatively charged internucleotide linkage (e.g., a phosphorothioate internucleotide linkage, a natural phosphate linkage, etc.) present in its salt form. In some embodiments, the oligonucleotide is provided as a salt. In some embodiments, the oligonucleotide is provided as a pharmaceutically acceptable salt. In some embodiments, the oligonucleotide is provided as a metal salt. In some embodiments, the oligonucleotide is provided as a sodium salt. In some embodiments, the oligonucleotide is provided as a metal salt, for example, a sodium salt, where each negatively charged internucleotide linkage is independently in salt form (e.g., in the case of a sodium salt, -OP(O)(SNa)-O- for a phosphorothioate internucleotide linkage, -OP(O)(ONa)-O- for a natural phosphate linkage, etc.).

[0135] In some embodiments, the present disclosure provides oligonucleotides comprising one or two wings and a core, and comprising or having a wing-core-wing, core-wing, or wing-core structure, wherein each wing and core independently comprises one or more nucleobases. In some embodiments, the provided oligonucleotides comprise or have a wing-core-wing structure. In some embodiments, the provided oligonucleotides comprise or have a core-wing structure. In some embodiments, the provided oligonucleotides comprise or have a wing-core structure. In some embodiments, the core is a region of contiguous nucleotide units as described herein. In some embodiments, each wing independently comprises one or more nucleobases as described herein.

[0136] In some embodiments, a wing-core-wing motif is represented as "XYZ," where "X" represents the length of the 5' wing (number of nucleobases unless otherwise specified), "Y" represents the length of the core, and "Z" represents the length of the 3' wing. In some embodiments, X is 1 to 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and Z is 1 to 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. In some embodiments, Y is 1 to 50, e.g., 5 to 50, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, X and Z are the same or different lengths and / or have the same or different modifications or modification patterns. In preferred embodiments, Y is 8 to 15 nucleotides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more nucleotides. In some embodiments, the oligonucleotides described herein have or comprise a wing-core-wing structure, e.g., 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4. In some embodiments, the oligonucleotides described herein have or include, for example, a 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8 wing-core or core-wing structure.

[0137] In some embodiments, a wing comprises one or more sugar modifications. In some embodiments, the two wings of a wing-core-wing structure comprise the same sugar modification. In some embodiments, the two wings of a wing-core-wing structure comprise different sugar modifications. In some embodiments, the two wings of a wing-core-wing structure comprise different sugar modification patterns. In some embodiments, the two wings of a wing-core-wing structure comprise different sugar modification patterns of the same sugar modification. In some embodiments, the two wings of a wing-core-wing structure comprise the same sugar modification pattern. In some embodiments, the wings comprise two or more different sugar modifications.

[0138] In some embodiments, the sugar modification comprises a 2'-modification, e.g., a 2'-OR, where R is as described herein but is not -H, such as a bicyclic sugar modification comprising a 2'-carbon (e.g., in an LNA sugar). In some embodiments, each sugar modification in a wing is independently a 2'-modification. In some embodiments, each sugar modification in both wings of a wing-core-wing arrangement is independently a 2'-modification. In some embodiments, the or each wing independently comprises two or more different sugar modifications, wherein each sugar modification is independently a 2'-modification. In some embodiments, each 2'-modification is independently a 2'-OR modification, where R is as described herein but is not H. In some embodiments, each 2'-modification is independently a 2'-OR modification, where R is an optionally substituted C 1~6 In some embodiments, each sugar modification is independently 2'-OMe or 2'-MOE.

[0139] In some embodiments, sugar modifications provide improved stability and / or hybridization compared to the absence of the sugar modification, hi some embodiments, certain sugar modifications, e.g., 2'-MOE, provide greater stability than 2'-OMe under otherwise identical conditions.

[0140] In some embodiments, a wing comprises one or more natural phosphate linkages. In some embodiments, a wing comprises one or more consecutive natural phosphate linkages. In some embodiments, a wing comprises one or more natural phosphate linkages and one or more modified internucleotide linkages. In some embodiments, a wing does not comprise a natural phosphate linkage, and each internucleotide linkage of a wing is independently a modified internucleotide linkage. In some embodiments, the modified internucleotide linkage is a phosphorothioate internucleotide linkage. In some embodiments, the modified internucleotide linkage is an Sp phosphorothioate internucleotide linkage. In some embodiments, a wing comprises one or more non-negatively charged internucleotide linkages. In some embodiments, a wing comprises one or more neutral internucleotide linkages. In some embodiments, each wing independently comprises one or more non-negatively charged internucleotide linkages. In some embodiments, each wing independently comprises one or more neutral internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkages or neutral internucleotide linkages are independently chiral controlled. In some embodiments, each non-negatively charged internucleotide linkage or neutral internucleotide linkage is independently chiral controlled. In some embodiments, a wing comprises 1 to 5, e.g., 1, 2, 3, 4, or 5, non-negatively charged internucleotide linkages. In some embodiments, a wing comprises 1 non-negatively charged internucleotide linkage. In some embodiments, a wing comprises 2 non-negatively charged internucleotide linkages. In some embodiments, a wing comprises 3 non-negatively charged internucleotide linkages. In some embodiments, a wing comprises 4 non-negatively charged internucleotide linkages. In some embodiments, a wing comprises 5 non-negatively charged internucleotide linkages. In some embodiments, each non-negatively charged internucleotide linkage is independently a neutral internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage or neutral internucleotide linkage is n001. In some embodiments, each is 001 and is optionally independently chiral controlled. In some embodiments, each non-negatively charged internucleotide linkage, e.g., n001, is independently chiral controlled.In some embodiments, n001 is chiral and Rp. In some embodiments, n001 is chiral and Sp. In some embodiments, the wings comprise one or more chiral phosphorothioate internucleotide linkages and one or more chiral neutral internucleotide linkages. In some embodiments, the wings comprise one or more chiral phosphorothioate internucleotide linkages and one or more natural phosphate linkages. In some embodiments, the wings comprise one or more chiral neutral internucleotide linkages and one or more natural phosphate linkages. In some embodiments, the wings comprise one or more chiral phosphorothioate nucleotide linkages. In some embodiments, the 5'-wing comprises an internucleotide linkage, one or more chiral-controlled neutral internucleotide linkages, and one or more natural phosphate linkages (e.g., a particular 5'-wing in a particular oligonucleotide in a table). In some embodiments, each internucleotide linkage in the wing is independently selected from a natural phosphate linkage and a phosphorothioate internucleotide linkage. In some embodiments, each internucleotide linkage in the wing is independently selected from a natural phosphate linkage, a phosphorothioate internucleotide linkage, and a non-negatively charged internucleotide linkage (e.g., a neutral internucleotide linkage such as n001). In some embodiments, each internucleotide linkage in the wing is independently selected from a phosphorothioate internucleotide linkage and a non-negatively charged internucleotide linkage (e.g., a neutral internucleotide linkage such as n001). In some embodiments, one or more or each phosphorothioate internucleotide linkage is independently chiral-controlled. In some embodiments, one or more or each phosphorothioate internucleotide linkage is independently chiral-controlled and is Sp. In some embodiments, one or more or each non-negatively charged internucleotide linkages (e.g., neutral internucleotide linkages such as n001) are independently chiral-controlled. In some embodiments, one or more or each non-negatively charged internucleotide linkages (e.g., neutral internucleotide linkages such as n001) are independently chiral-controlled and are Rp. In some embodiments, the pattern (e.g., including the type of internucleotide linkage and the bond phosphorus stereochemistry) of the wing (e.g., the 5'-wing) is or comprises SOOO, where S represents a phosphorothioate internucleotide linkage that is chiral-controlled and is Sp, and O represents a natural phosphate linkage. In some embodiments, the pattern of the wing (e.g., the 3'-wing) is or comprises SSSS. In some embodiments, the pattern of the wing (e.g., the 5'-wing) is or comprises SnROnR, where nR represents a non-negatively charged internucleotide linkage (e.g., a neutral internucleotide linkage such as n001) that is chiral-controlled and is Rp. In some embodiments, the pattern of the wing (eg, the 3'-wing) is or includes SnRSS.In some embodiments, the wing (e.g., 3'-wing) pattern is or includes SSnRS. In some embodiments, the wing (e.g., 3'-wing) pattern is or includes SSSnR. In some embodiments, a non-negatively charged or neutral internucleotide linkage is present between the two modified sugars. In some embodiments, the core can also have one or more non-negatively charged or neutral internucleotide linkages, each of which is optionally independently chiral controlled; in some embodiments, each is independently chiral controlled. In some embodiments, the core sugar (which in some embodiments does not contain a 2'-O-) is not linked to a neutral internucleotide linkage.

[0141] In some embodiments, for oligonucleotides that comprise or are wing-core-wing structures, the two wings differ in that they comprise different levels and / or types of chemical modifications, backbone chiral center stereochemistry, and / or patterns thereof. In some embodiments, the two wings differ in that they comprise different levels and / or types of sugar modifications, and / or internucleotide linkages, and / or internucleotide linkage stereochemistry, and / or patterns thereof. For example, in some embodiments, one wing comprises a 2'OR modification (R is an optionally substituted C 1~6 In some embodiments, one wing contains a modified internucleotide linkage (e.g., a 2-MOE alkyl linkage), while the other wing contains no such modification or a lower level (e.g., in number and / or percentage) of such modification; in addition, and alternatively, one wing contains a natural phosphate linkage, while the other wing contains no natural phosphate linkages or a lower level (e.g., in number and / or percentage) of natural phosphate linkages; in addition, and alternatively, one wing may contain a particular type of modified internucleotide linkage (e.g., a phosphorothioate diester internucleotide linkage), while the other wing contains no natural phosphate linkages or a lower level (e.g., in number and / or percentage) of that type. Additionally or alternatively, one wing may contain chiral modified internucleotide linkages with a bound phosphorus atom in a particular conformation (e.g., Rp or Sp), while the other wing contains no, or a lower level of, chiral modified internucleotide linkages with a bound phosphorus atom in a particular conformation; additionally or alternatively, each wing may contain a different pattern of sugar modifications, internucleotide linkages, and / or backbone chiral centers. In some embodiments, one wing contains one or more native phosphate linkages and one or more 2'-OR modifications (R is not -H or -Me), while the other wing contains no native phosphate linkages and no 2'-OR modifications (R is not -H or -Me). In some embodiments, one wing contains one or more native phosphate linkages and one or more 2'-MOE modifications, while each internucleotide linkage of the other wing is a phosphorothioate linkage and each sugar unit of the other wing contains a 2'-OMe modification. In some embodiments, one wing comprises one or more natural phosphate linkages and one or more 2'-MOE modifications, each internucleotide linkage of the other wing is an Sp phosphorothioate linkage, and each sugar unit of the other wing comprises a 2'-OMe modification.

[0142] In some embodiments, the core does not include sugars that include a 2'-modification. In some embodiments, the core does not include sugars that include a 2'-OR, where R is as described herein. In some embodiments, each core sugar includes two 2'-H (e.g., as typically found in natural DNA sugars).

[0143] In some embodiments, 70%, 80%, 90% or more, or 100% of the internucleotide linkages in the core are modified internucleotide linkages. In some embodiments, 70%, 80%, or 90% or more of the internucleotide linkages in the core are independently modified internucleotide linkages in the Sp configuration, and the core also contains 1, 2, 3, 4, or 5 internucleotide linkages selected from modified internucleotide linkages in the Rp configuration and natural phosphate linkages. In some embodiments, 70%, 80%, or 90% or more of the phosphorothioate internucleotide linkages in the core are independently modified internucleotide linkages in the Sp configuration, and the core also contains 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages in the Rp configuration. In some embodiments, the core further comprises 1 or 2 internucleotide linkages selected from modified internucleotide linkages in the Rp configuration and natural phosphate linkages. In some embodiments, the core further comprises no more than one internucleotide linkage selected from a modified internucleotide linkage in the Rp conformation and a natural phosphate linkage, and the remaining internucleotide linkages are independently modified internucleotide linkages in the Sp conformation. In some embodiments, the core further comprises no more than two internucleotide linkages each independently selected from a modified internucleotide linkage in the Rp conformation and a natural phosphate linkage, and the remaining internucleotide linkages are independently modified internucleotide linkages in the Sp conformation. In some embodiments, the core further comprises no more than one natural phosphate linkage, and the remaining internucleotide linkages are independently modified internucleotide linkages in the Sp conformation. In some embodiments, the core further comprises no more than two natural phosphate linkages, and the remaining internucleotide linkages are independently modified internucleotide linkages in the Sp conformation. In some embodiments, the core further comprises no more than one modified internucleotide linkage in the Rp conformation, and the remaining internucleotide linkages are independently modified internucleotide linkages in the Sp conformation. In some embodiments, the core further comprises two or fewer modified internucleotide linkages in the Rp configuration, with the remaining internucleotide linkages being independently modified internucleotide linkages in the Sp configuration. In some embodiments, the two natural phosphate linkages or two modified internucleotide linkages in the Rp configuration are separated by two or more modified internucleotide linkages in the Sp configuration. In some embodiments, the modified internucleotide linkage is of Formula I:In some embodiments, the modified internucleotide linkage is a phosphorothioate internucleotide linkage. As will be understood by one of skill in the art, the internucleotide linkages attached to the wing sugar and the core sugar can be considered the core internucleotide linkage.

[0144] The core and wings can be of various lengths. In some embodiments, the core is 5, 6 , 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleobases. In some embodiments, the wings comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleobases. In some embodiments, the wings comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 or fewer nucleobases. In some embodiments, for a wing-core-wing structure, both wings are the same length, e.g., 5 nucleobases. In some embodiments, the two wings are different lengths. In some embodiments, the core is 40%, 45%, 50%, 60%, 70%, 80%, or 90% or more of the total length of the oligonucleotide, as measured by the percentage of nucleoside units within the core. In some embodiments, the core is 50% or more of the total length of the oligonucleotide.

[0145] In some embodiments, oligonucleotides can be provided in various forms, including various salt forms, particularly pharmaceutically acceptable salt forms. In some embodiments, the present disclosure provides salts of oligonucleotides and pharmaceutical compositions thereof. In some embodiments, the salts are pharmaceutically acceptable salts. In some embodiments, each hydrogen ion that can be donated to a base (e.g., under conditions such as aqueous solution, pharmaceutical composition, etc.) is a non-H +The nucleotides are substituted with cations. For example, in some embodiments, pharmaceutically acceptable salts of oligonucleotides are all-metal ion salts, wherein each hydrogen ion (e.g., -OH, -SH, etc.) of each internucleotide bond (e.g., natural phosphate bond, phosphorothioate diester bond, etc.) is substituted with a metal ion. In some embodiments, the provided salts are all sodium salts. In some embodiments, the provided pharmaceutically acceptable salts are all sodium salts. In some embodiments, the provided salts are all sodium salts, wherein each internucleotide bond that is a natural phosphate bond (acid form -OP(O)(OH)-O-), if present, is present in its sodium salt form (-OP(O)(ONa)-O-), and each internucleotide bond that is a phosphorothioate diester bond (acid form -OP(O)(SH)-O-), if present, is present in its sodium salt form (-OP(O)(SNa)-O-).

[0146] In some embodiments, provided compounds, e.g., oligonucleotides, can modulate the activity and / or function of a C9orf72 target. In some embodiments, a C9orf72 target gene is a gene for which the expression and / or activity of one or more C9orf72 gene products (e.g., RNA and / or protein products) is intended to be altered. In some embodiments, C9orf72 is associated with a pathology, disorder, or disease. In many embodiments, a C9orf72 target gene is intended to be inhibited. Thus, in many embodiments, when a C9orf72 oligonucleotide as described herein acts on a particular C9orf72 target gene, the presence and / or activity of one or more gene products of that C9orf72 gene, particularly those associated with a pathology, disorder, or disease, is reduced when the oligonucleotide is present compared to when the oligonucleotide is absent.

[0147] In some embodiments, a C9orf72 target is a specific allele (e.g., a pathogenic allele associated with a condition, disorder, or disease) for which the expression and / or activity of one or more products (e.g., RNA and / or protein products) is intended to be altered. In many embodiments, the C9orf72 target allele is one whose presence and / or expression is associated with (e.g., correlates with) the presence, incidence, and / or severity of one or more diseases and / or conditions, e.g., C9orf72-associated disorders. Alternatively or additionally, in some embodiments, the C9orf72 target allele is one for which alterations in the level and / or activity of one or more gene products correlate with amelioration of one or more aspects of the disease and / or condition (e.g., delayed onset, reduced severity, responsiveness to other therapies, etc.). In some such embodiments, the C9orf72 oligonucleotides and methods of use thereof as described herein may preferentially or specifically target pathogenic alleles over non-pathological alleles, e.g., one or more less relevant / irrelevant alleles. In some embodiments, the C9orf72 target allele is one for which alterations in the level and / or activity of one or more gene products correlate with amelioration of one or more aspects of the disease and / or condition (e.g., delayed onset, reduced severity, responsiveness to other therapies, etc.). In some such embodiments, the C9orf72 oligonucleotides and methods of use thereof as described herein may preferentially or specifically target pathogenic alleles over non-pathological alleles, e.g., one or more less relevant / irrelevant alleles. Seventy-two pathogenic alleles comprise repeat expansions, e.g., hexanucleotide repeat expansions (HREs), e.g., expansions of more than about 30 up to 500 or 1000 or more hexanucleotide repeats. In some embodiments, transcripts from an allele can have two or more variants (e.g., from different splicing patterns). In some embodiments, the provided technology selectively reduces the expression, activity, and / or levels of transcripts (e.g., RNAs) and / or products (e.g., proteins) encoded thereby that are associated with a condition, disorder, or disease relative to those that are less or not associated with the condition, disorder, or disease.

[0148] In some embodiments, the C9orf72 target sequence is a sequence to which an oligonucleotide as described herein binds. In many embodiments, the C9orf72 target sequence is identical to or an exact complement of the sequence of a provided oligonucleotide or the sequence of consecutive residues therein (e.g., a provided oligonucleotide comprises a target binding sequence that is identical to or an exact complement of a C9orf72 target sequence). In some embodiments, a small number of differences / mismatches (e.g., no more than 1, 2, or 3) between (a relevant portion of) an oligonucleotide and its target sequence are tolerated. In many embodiments, the C9orf72 target sequence is present within a C9orf72 target gene. In many embodiments, the C9orf72 target sequence is present within a transcript (e.g., mRNA and / or pre-mRNA) produced from the C9orf72 target gene. In some embodiments, the C9orf72 target sequence includes one or more allelic sites (i.e., positions at which allelic variation occurs within a C9orf72 target gene). In some such embodiments, provided oligonucleotides bind preferentially or specifically to one allele over one or more other alleles.

[0149] In some embodiments, C9orf72 (chromosome 9 open reading frame 72) is a gene or gene product thereof, also referred to as C9ORF72, C9, ALSFTD, FTDALS, FTDALS1, DENNL72; External ID: MGI:1920455 HomoloGene:10137 GeneCards:C9orf72. In some embodiments, C9orf72 may also be informally referred to as C9. C9orf72 ortholog: Species: Human Entrez: 203228; Ensembl: ENSG00000147894; UniProt: Q96LT7; RefSeq (mRNA): NM_145005 NM_001256054 NM_018325; RefSeq (protein): NP_001242983 NP_060795 NP_659442; Location (UCSC): Chr9: 27.55-27.57 Mb; Species: Mouse Entrez:73205; Ensembl:ENSMUSG00000028300; UniProt:Q6DFW0; RefSeq(mRNA):NM_001081343; RefSeq(protein):NP_00107481; Location(UCSC):Chr4:35.19~35.23Mb. Nucleotides encoding C9orf72 include, without limitation, GENBANK Accession No. NM_001256054.1; GENBANK Accession No. NT_008413.18; GENBANK Accession No. BQ068108.1; GENBANK Accession No. NM_018325.3; GENBANK Accession No. DN993522.1; GENBANK Accession No. NM_145005.5; GENBANK Accession No. DB079375.1; GENBANK Accession No. BU194591.1; SEQ ID NO: 4141_014_A5; SEQ ID NO: 4008_73_A; and GENBANK Accession No. NT_008413.18. C9orf72 is reportedly a 481-amino acid protein with a molecular mass of 54,328 Da, which may undergo post-translational modifications of ubiquitination and phosphorylation. Expression levels of C9orf72 are reportedly highest in the central nervous system, where the protein is localized to the cytoplasm of neurons as well as presynaptic terminals.C9orf72 reportedly plays a role in regulating endosomal and lysosomal trafficking and has been shown to interact with RAB proteins involved in autophagy and endocytic trafficking. C9orf72 is a GTPase that reportedly mediates early endosomal trafficking. Mutations in C9orf72 have reportedly been associated with ALS and FTD. DeJesus-Hernandez et al. 2011 Neuron 72:245-256; Renton et al. 2011 Neuron 72:257-268; and Itzcovich et al. 2016. Neurobiol. Aging. Volume 40, Pages 192.e13-192.e15. Reportedly, subjects suffering from neurological diseases, such as C9orf72-associated disorders, may have hexanucleotide repeat expansions (e.g., (GGGGCC)n) in C9orf72.

[0150] In some embodiments, C9orf72 oligonucleotides can hybridize to C9orf72 nucleic acids derived from either DNA strand. In some embodiments, C9orf72 oligonucleotides can hybridize to C9orf72 antisense or sense transcripts. In some embodiments, C9orf72 oligonucleotides can hybridize to C9orf72 nucleic acids at any stage of RNA processing, including, but not limited to, pre-mRNA or mature mRNA. In some embodiments, C9orf72 oligonucleotides can hybridize to C9orf72 nucleic acids at any stage of RNA processing, including, but not limited to, promoter regions, enhancer regions, transcription termination regions, translation initiation signals, translation stop codons, coding regions, non-coding regions, exons, introns, 5' UTRs, 3' UTRs, repeat regions, hexanucleotide repeat expansions, splice junctions, intron / exon or exon / intron junctions, exon:exon splice junctions, exon splicing silencers (ESSs), and the like of C9orf72 nucleic acids. ), exon splicing enhancer (ESE), exon 1a, exon 1b, exon 1c, exon 1d, exon 1e, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, or intron 10, or its complement. The introns and exons alternate; intron 1 is between exon 1 (or 1a or 1b or 1c, etc.) and exon 2; intron 2 is between exons 2 and 3, and so on. In some embodiments, the base sequence of the oligonucleotide is identical to or complementary to a target sequence in intron 1. In some embodiments, the base sequence of the oligonucleotide is identical to or complementary to a target sequence that includes a portion from exon 1b and a portion from intron 1. In some embodiments, the C9orf72 oligonucleotide spans the junction between exon 1b and intron 1.

[0151] In some embodiments, the C9orf72 oligonucleotide can hybridize to a portion of the C9orf72 pre-mRNA represented by GENBANK Accession No. NT_008413.18, nucleosides 27535000 to 27565000, or its complement.

[0152] In some embodiments, the C9orf72 oligonucleotide can hybridize to an intron. In some embodiments, the C9orf72 oligonucleotide can hybridize to an intron that includes a hexanucleotide repeat.

[0153] In some embodiments, the C9orf72 oligonucleotide hybridizes to all C9orf72 variants from the sense strand. In some embodiments, the antisense oligonucleotides described herein selectively hybridize to C9orf72 variants from the sense strand, including but not limited to those containing hexanucleotide repeat extensions. In some embodiments, the hexanucleotide repeat extensions contain at least 24 repeats of any hexanucleotide. In some embodiments, the hexanucleotide repeat extensions contain at least 24 repeats of any hexanucleotide. The hexanucleotide repeat extension comprises at least 30 repeats of any hexanucleotide. In some embodiments, the hexanucleotide repeat extension comprises at least 50 repeats of any hexanucleotide. In some embodiments, the hexanucleotide repeat extension comprises at least 100 repeats of any hexanucleotide. In some embodiments, the hexanucleotide repeat extension comprises at least 200 repeats of any hexanucleotide. In some embodiments, the hexanucleotide repeat extension comprises at least 500 repeats of any hexanucleotide. In some embodiments, the hexanucleotide is GGGGCC, GGGGGG, GGGGGC, GGGGCG, CCCCGG, CCCCCC, GCCCCC, and / or CGCCCC. In some embodiments, the hexanucleotide GGGGCC is GGGGCCexp or (GGGGCC). n and is a repeat of the hexanucleotide GGGGCC.

[0154] In some embodiments, the pattern of backbone chiral centers of a provided oligonucleotide, or a region thereof (e.g., core), comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t[(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y, (Np)t[(Rp)n(Sp)m]y, or (Sp)t[(Rp)n(Sp)m]y, as described herein, where each of m, n, t, and y is independently 1 to 50. In some embodiments, at least one n is 1. In some embodiments, each n is independently 1. In some embodiments, y is 1. In some embodiments, y is 2. In some embodiments, the pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, where m > 2. In some embodiments, the pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, where n is 1, t > 1, and m > 2. In some embodiments, at least one n is 1, at least one t is 1 or greater, and at least one m is 2 or greater. In some embodiments, at least one n is 1, at least one t is 2 or greater, and at least one m is 3 or greater. In some embodiments, each n is 1. In some embodiments, at least one t > 1. In some embodiments, at least one t > 2. In some embodiments, at least one t > 3. In some embodiments, at least one t>4. In some embodiments, at least one m>1. In some embodiments, at least one m>2. In some embodiments, at least one m>3. In some embodiments, at least one m>4. In some embodiments, the pattern of backbone chiral centers comprises one or more achiral natural phosphate linkages. In some embodiments, the sum of m, t, and n (or m and n if there is no t in the pattern) is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more.In some embodiments, the sum is 5. In some embodiments, the sum is 6. In some embodiments, the sum is 7. In some embodiments, the sum is 8. In some embodiments, the sum is 9. In some embodiments, the sum is 10. In some embodiments, the sum is 11. In some embodiments, the sum is 12. In some embodiments, the sum is 13. In some embodiments, the sum is 14. In some embodiments, the sum is 15. In some embodiments, Sp is a configuration of phosphorothioate internucleotide linkages. In some embodiments, each Sp is a configuration of phosphorothioate internucleotide linkages. In some embodiments, Rp is a configuration of phosphorothioate internucleotide linkages. In some embodiments, each Rp is a configuration of phosphorothioate internucleotide linkages. In some embodiments, each Sp is a configuration of phosphorothioate internucleotide linkages with respect to the pattern of backbone chiral centers about the core. In some embodiments, each Rp is a phosphorothioate with respect to the pattern of backbone chiral centers about the core. This is the configuration of the thioate internucleotide bond.

[0155] Nucleotide sequence In some embodiments, provided C9orf72 oligonucleotides can direct a decrease in the expression, level, and / or activity of a C9orf72 gene or its gene product. In some embodiments, a C9orf72 target gene comprises a repeat expansion. In some embodiments, provided C9orf72 oligonucleotides can comprise any base sequence described herein or a portion thereof, where the portion is a span of at least 15 contiguous bases or a span of at least 15 contiguous bases containing 1 to 5 mismatches. In some embodiments, when aligned with the base sequence of its C9orf72 target (e.g., a sequence of the same length of a C9orf72 gene or transcript), the base sequence of the provided oligonucleotide is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or fully complementary to or identical to the target sequence. In some embodiments, there are no more than 1, 2, or 3 mismatches. In some embodiments, there are no more than 2 mismatches. In some embodiments, there is no more than one mismatch. In some embodiments, there are no mismatches. In some embodiments, a mismatch is present in a wing. In some embodiments, a mismatch is present in a 5'-wing. In some embodiments, a mismatch is present in a 3'-wing. In some embodiments, a mismatch is present in the core. In some embodiments, all "matches" are Watson-Crick base pairs. In some embodiments, there are one or more, e.g., one, two, or three, wobble base pairs. In some embodiments, there are one, two, or three or fewer wobble base pairs. In some embodiments, there are two or fewer wobble base pairs. In some embodiments, there are one or fewer wobble base pairs. In some embodiments, there are no wobble base pairs. In some embodiments, a wobble base pair is present in a wing. In some embodiments, a wobble base pair is present in a 5'-wing. In some embodiments, a wobble base pair is present in a 3'-wing. In some embodiments, a wobble base pair is present in the core.

[0156] In some embodiments, the base sequence of the C9orf72 oligonucleotide has sufficient length and identity to the C9orf72 transcript target to mediate target-specific knockdown. In some embodiments, the C9orf72 oligonucleotide is complementary to a portion of the transcript target sequence.

[0157] In some embodiments, the base sequence of the C9orf72 oligonucleotide is complementary to that of a C9orf72 target transcript. As used herein, "target transcript sequence," "target sequence," "target gene," and the like refer to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the C9orf72 gene, including mRNA that is the product of RNA processing of the primary transcript.

[0158] As used herein, the terms "complementary," "fully complementary," and "substantially complementary" may be used with respect to base matching between a C9orf72 oligonucleotide and a C9orf72 target sequence, as understood in the context of their use. In some embodiments, the base sequence of a C9orf72 oligonucleotide is complementary to the base sequence of a C9orf72 target sequence if, when maximally aligned, each base of the oligonucleotide is capable of base pairing with consecutive bases on the target strand. As a non-limiting example, if the target sequence has the base sequence 5'-GCAUAGCGAGCGAGGGAAAAC-3', for example, an oligonucleotide having the base sequence 5'GUUUUCCCUCGCUCGCUAUGC-3' is complementary or fully complementary to such a target sequence. Of course, it should be noted that substituting U for T or vice versa does not change the amount of complementarity.

[0159] As described herein, a polynucleotide that is "substantially complementary" to a C9orf72 target sequence is primarily or mostly complementary, but not 100% complementary. In some embodiments, a substantially complementary sequence (e.g., a C9orf72 oligonucleotide) has 1, 2, 3, 4, or 5 mismatches from a sequence that is 100% complementary to the target sequence.

[0160] In some embodiments, the base sequence of the C9orf72 oligonucleotide may include a CpG motif (e.g., when unmethylated), which may act as an immunostimulatory agent. In some embodiments, the C or G of the CpG motif is modified to replace the C and / or G with another base. In some embodiments, the base sequence of the C9orf72 oligonucleotide is or includes (or includes a span of at least 15 contiguous bases) the sequence of any C9orf72 oligonucleotide described herein, with the proviso that the C or G within the CpG motif, if present, is changed to another nucleobase. In some embodiments, the base sequence of the C9orf72 oligonucleotide is or includes (or includes a span of at least 15 contiguous bases) the sequence of any C9orf72 oligonucleotide described herein, with the proviso that the C within the CpG motif, if present, is changed to another nucleobase. In some embodiments, the base sequence of the C9orf72 oligonucleotide is or comprises (or comprises a span of at least 15 contiguous bases of) the sequence of any C9orf72 oligonucleotide described herein, with the proviso that the G in the CpG motif, if present, is replaced by another nucleic acid base.As used herein, phrases or other text relating to replacing a base in an oligonucleotide with a replacement base refer to a situation in which an oligonucleotide having a base sequence that is 100% complementary to the base sequence of a target sequence (e.g., mRNA) via Watson-Crick base pairing (e.g., each U or T base pair with A and each G base pair with C) is replaced with a replacement base, except that one base in the oligonucleotide (which normally forms a Watson-Crick base pair with the corresponding base in the target nucleic acid) is replaced with a replacement base (e.g., a nucleobase or nucleobase derivative) that cannot form a Watson-Crick base pair with the corresponding base in the target nucleic acid, but which can optionally form (but do not necessarily form) a non-Watson-Crick base pair with the corresponding base in the target nucleic acid sequence (including, but not limited to, wobble base pairs such as guanine-uracil (GU), hypoxanthine-uracil (IU), hypoxanthine-adenine (IA), and hypoxanthine-cytosine (IC)). In some embodiments, replacement of a base in an oligonucleotide with a replacement base introduces a mismatch into the target sequence at that position. In some embodiments, a C is replaced with a T (e.g., in the core or nucleoside C does not contain a 2'-OR or a substituent at the 2' position). In some embodiments, a C is replaced with a U (e.g., in the wing or nucleoside contains a substituent at the 2'-carbon). In some embodiments, one or more Cs are independently replaced. In some embodiments, each C in an oligonucleotide or portion thereof (e.g., 5'-wing, core, 3'-wing) is independently replaced.

[0161] In some embodiments, in the C9orf72 oligonucleotide, G is replaced by inosine (I). In some embodiments, the terms inosine or I, as used herein, are equated with the nucleobase hypoxanthine. In some embodiments, the term inosine, as used herein, is equated with a nucleoside comprising hypoxanthine and a sugar or modified sugar. In some embodiments, the C9orf72 oligonucleotide comprises a CpI motif (e.g., a CpG motif in which the nucleobase G is replaced by I). Non-limiting examples of such C9orf72 oligonucleotides include, but are not limited to, WV-21442 and WV-21445.

[0162] In some embodiments, C9orf72 oligonucleotides having CpG motifs In some embodiments, the C is modified (e.g., methylated to 5mC), for example, to reduce the immunogenicity of the CpG motif. In some embodiments, the modified C nucleoside, e.g., 5mC nucleoside, comprises a 2'-MOE modification. In some embodiments, in a CpG motif in the wing, the C is modified (e.g., methylated to 5mC). In some embodiments, in a CpG motif in the 5'-wing, the C is modified (e.g., methylated to 5mC). In some embodiments, in a CpG motif in the 3'-wing, the C is modified (e.g., methylated to 5mC). In some embodiments, in a CpG motif in the core, the C is modified (e.g., methylated to 5mC). In some embodiments, each C in the CpG motif is modified (e.g., methylated to 5mC). In some embodiments, one or more Cs not in a CpG motif are independently modified (e.g., methylated to 5mC). Non-limiting examples of such oligonucleotides include WV-21445, WV-21446, WV-23740, WV-23503 and WV-23491.

[0163] In some embodiments, the terminal base (e.g., at either the extreme 5' or 3' end) is a component of a CpG motif (e.g., a C in a CpG at the 5' end of the oligonucleotide or a G in a CpG at the 3' end). In some embodiments, the terminal base may contribute less to hybridization of the oligonucleotide to a target nucleic acid than a base that is not a terminal base (e.g., a non-terminal base). In some embodiments, the present disclosure relates to CpG oligonucleotides, wherein the terminal base is a component of a CpG motif and the terminal base is replaced by another base; in some embodiments, the terminal base of the CpG oligonucleotide is G and is replaced by I.

[0164] In some embodiments of sequences considered for design and construction of C9orf72 oligonucleotides, the terminal base is a component of a CpG motif and therefore is not included in the oligonucleotide sequence (e.g., the oligonucleotide is truncated by one base). Non-limiting examples of such oligonucleotides include WV-21557, WV-23486, WV-23435, and WV-23487.

[0165] In some embodiments, in the C9orf72 oligonucleotide, the terminal base is nucleobase A and the base is replaced by I or G. Non-limiting examples of such oligonucleotides include WV-21445, WV-21446, WV-23740, WV-23503, and WV-23491.

[0166] In some embodiments, the oligonucleotide targets C9orf72 and has the following base sequence: CCCACACCTGCTCTTGCTAG、AACAGCCACCCGCCAGGATG、AACCGGGCAGCAGGGACGGC、ACAGGCTGCGGTTGTTTCCC、ACCCACACCTGCTCTTGCTA、ACCCACTCGCCACCGCCTGC、ACCCCAAACAGCCACCCGCC、ACCCCCATCTCATCCCGCAT、ACCCGAGCTGTCTCCTTCCC、ACCCGCCAGGATGCCGCCTC、ACCCGCGCCTCTTCCCGGCA、ACCCTCCGGCCTTCCCCCAG、ACCGGGCAGCAGGGACGGCT、ACCTCTCTTTCCTAGCGGGA、ACGCACCTCTCTTTCCTAGC、ACTCACCCACTCGCCACCGC、AGCAACCGGGCAGCAGGGAC、AGCCGTCCCTGCTGCCCGGT、AGCGCGCGACTCCTGAGTTC、AGCTTGCTACAGGCTGCGGT、AGGATGCCGCCTCCTCACTC、AGGCTGCGGTTGTTTCCCTC、AGGCTGTCAGCTCGGATCTC、AGGGCCACCCCTCCTGGGAA、ATCCCCTCACAGGCTCTTGT、ATGCCGCCTCCTCACTCACC、ATTGCCTGCATCCG GGCCCC、CACCCACTCGCCACCGCCTG、CACCCCCATCTCATCCCGCA、CACCCGCCAGGATGCCGCCT、CACCTCTCTTTCCTAGCGGG、CACTCACCCACTCGCCACCG、CAGGATGCCGCCTCCTCACT、CAGGCTGCGGTTGTTTCCCT、CAGGGTGGCATCTGCTTCAC、CCAAACAGCCACCCGCCAGG、CCACCCGCCAGGATGCCGCC、CCACCCTCCGGCCTTCCCCC、CCACTCGCCACCGCCTGCGC、CCAGGATGCCGCCTCCTCAC、CCCAAACAGCCACCCGCCAG、CCCACTCGCCACCGCCTGCG、CCCCAAACAGCCACCCGCCA、CCCGCCAGGATGCCGCCTCC、CCTCACTCACCCACTCGCCG、CCCGCGCCTCTTCCCGGCAG、CCCGGCAGCCGAACCCCAAA、CCGACTTGCATTGCTGCCCT、CCGCAGCCTGTAGCAAGCTC、CCGCCAGGATGCCGCCTCCT、CCGCCTCCTCACTCACCCAC、CCGCGCCTCTTCCCGGCAGC、CCGCTTCTACCCGCGCCTCT、CCGGGCAGCAGGGACGGCTG、CCTAGCGGGACACCGTAGGT、CCTCACTCACCCACTCGCCA、CCTCCGGCCTTCCCCCAGGC、CCTCCTCACTCACCCACTCG、CCTCTCTTTCCTAGCGGGAC、CCTCTGCCAAGGCCTGCCAC、CCTCTTCCCGGCAGCCGAAC、CCTGAGTTCCAGAGCTTGCT、CCTGCTCTTGCTAGACCCCG、CCTGCTGCCCGGTTGCTTCT、CCTGGTTGCTTCACAGCTCC、CCTTCCCTGAAGGTTCCTCC、CGCACCTCTCTTTCCTAGCG、CGCATAGAATCCAGTACCAT、CGCCAGGATGCCGCCTCCTC、CGCCTCCTCACTCACCCACT、CGCCTCTTCCCGGCAGCCGA、CGCGCGACTCCTGAGTTCCA、CGCTTCTACCCGCGCCTCTT、CGGGCAGCAGGGACGGCTGA、CGGTTGTTTCCCTCCTTGTT、CTACCCGCGCCTCTTCCCGG、CTCACCCACTCGCCACCGCC、CTCACTCACCCACTCGCCAC、CTCAGTACCCGAGGCTCCCT、CTCCTCACTCACCCACTCGC、CTCTTCCCGGCAGCCGAACC、CTCTTGCTAGACCCCGCCCC、CTCTTTCCTAGCGGGACACC、CTGCGGTTGTTTCCCTCCTT、CTGCTCTTGCTAGACCCCGC、CTTCCCGGCAGCCGAACCCC、CTTCCTTGCTTTCCCGCCCT、CTTCTACCCGCGCCTCTTCC、CTTGCTAGACCCCGCCCCCA、CTTGGTGTGTCAGCCGTCCC、CTTGTTCACCCTCAGCGAGT、CTTTCCTAGCGGGACACCGT、GACATCCCCTCACAGGCTCT、GAGAGCCCCCGCTTCTACCC、GAGCTGCCCAGGACCACTTC、GAGCTTGCTACAGGCTGCGG、GAGGCCAGATCCCCATCCCT、GATCCCCATTCCAGTTTCCA、GATGCCGCCTCCTCACTCAC、GCAACCGGGCAGCAGGGACG、GCACCTCTCTTTCCTAGCGG、GCAGGCGGTGGCGAGTGGGT、GCAGGCGTCTCCACACCCCC、GCAGGGACGGCTGACACACC、GCATCCGGGCCCCGGGCTTC、GCATCCTGGCGGGTGGCTGT、GCCACCCGCCAGGATGCCGC、GCCAGATCCCCATCCCTTGT、GCCAGGATGCCGCCTCCTCA、GCCCTCAGTACCCGAGCTGT、GCCGCCTCCTCACTCACCCA、GCCGGGAAGAGGCGCGGGTAG、GCCGTCCCTGCTGCCCGGTT、GCCTCCTCACTCACCCACTC、GCCTCTCAGTACCCGAGGCT、GCCTCTTCCCGGCAGCCGAA、GCGCAGGCGGTGGCGAGTGGGTGAGTGAGGAGGCGGCATC、GCGCAGGCGGTGGCGAGTGGGTGAGTGAGG、GCGCGACTCCTGAGTTCCAG、GCGCGCGACTCCTGAGTTCC、GCGGCATCC、 TGGCGGGTGGC、GCGGTTGCGGTGCCTGCGCC、GCGGTTGTTTCCCTCCTTGT、GCTACAGGCTGCGGTTGTTT、GCTAGACCCCGCCCCCAAAA、GCTCTGAGGAGAGCCCCCGC、GCTCTTGCTAGACCCCGCCC、GCTGCGATCCCCATTCCAGT、GCTGCGGTTGTTTCCCTCCT、GCTGGAGATGGCGGTGGGCA、GCTGGGTGTCGGGCTTTCGC、GCTGTTTGACGCACCTCTCT、GCTTCTACCCGCGCCTCTTC、GCTTGCTACAGGCTGCGGTT、GCTTGGTGTGTCAGCCGTCC、GCTTTCCCGCCCTCAGTACC、GGACCCGCTGGGAGCGCTGC、GGATGCCGCCTCCTCACTCA、GGCAGCAGGGACGGCTGACA、GGCCTCTCAGTACCCGAGGC、GGCGGAGGCGCAGGCGGTGG、GGCGTCTCCACACCCCCATC、GGCTCCCTTTTCTCGAGCCC、GGCTGCGGTTGTTTCCCTCC、GGGAAGGCCGGAGGGTGGGC、GGGCAGCAGGGACGGCTGAC、GGGCTCTCCTCAGAGCTCGA、GGGTGTCGGGCTTTCGCCTC、GGTCCCTGCCGGCGAGGAGA、GTACCCGAGGCTCCCTTTTC、GTCAGCCGTCCCTGCTGCCC、GTCCCTGCTGCCCGGTTGCT、GTCCGTGTGCTCATTGGGTC、GTCGCTGTTTGACGCACCTC、GTCGGTGTGCTCCCCATTCT、GTGCAGGCGTCTCCACACCC、GTGCTGCGATCCCCATTCCA、GTGGCAGGCCTTGGCAGAGG、GTTCACCCTCAGCGAGTACT、GTTGCGGTGCCTGCGCCCGC、GTTGTTTCCCTCCTTGTTTT、TACAGGCTGCGGTTGTTTCC、TACCCGCGCCTCTTCCCGGC、TCACCCACTCGCCACCGCCT、TCACCCTCAGCGAGTACTGT、TCACTCACCCACTCGCCACC、TCCCCTCACAGGCTCTTGTG、TCCCGGCAGCCGAACCCCAA、TCCTCACTCACCCACTCGCC、TCCTTGCTTTCCCGCCCTCA、TCTCAGTACCCGAGGCTCCC、TCTTCCCGGCAGCCGAACCC、TCTTGCTAGACCCCGCCCCC、TGCCGCCTCCTCACTCACCC、TGCCTGCATCCGGGCCCCGG、TGCGGTTGTTTCCCTCCTTG、TGCTACAGGCTGCGGTTGTT、TGCTAGACCCCGCCCCCAAA、TGCTCTTGCTAGACCCCGCC、TGGAATGGGGATCGCAGCAC、TGGAATGGGGATCGCAGCACA、TGGCGAGTGGGTGAGTGAGGAGGCGGCATC、TGTGCTGCGATCCCCATTCC、TTCCAGAGCTTGCTACAGGC、TTCCCGGCAGCCGAACCCCA、TTCTACCCGCGCCTCTTCCC、TTGCTACAGGCTGCGGTTGT、TTGCTAGACCCCGCCCCCAA、TTTCCCCACACCACTGAGCT、ACCCACTCGCCA、ACCCACTCGCCA、ACTCACCCACTCGCCACCGC、ACTCACCCACTCGCCACCGC、ACTCACCCACTCGCCACCGC、ACTCACCCACTCGCCACCGC、ACTCACCCACTCGCCACCGC、ACTCGCCA、AUACUUACCUGG、CACTCGCCA、CCCACTCGCCA、CCCACTCGCCA、CCTCACTCACCCACTCGCC、CCTCACTCACCCACTCGCC、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCA、CCTCACTCACCCACTCGCCC、CCTCACTCACCCACTCGCCC、CCTCACTCACCCACTCGCCG、CCTCACTCACCCACTCGCCG、CCTCACTCACCCACTCGCCG、CCTCACTCACCCACTCGCCG、CCTCACTCACCCACTCGCCG、CCTCACT, CACCCACTCGCCG, CCTCACTCACCCACTCGCCI, CCTCACTCACCCACTCGCCI, CCTCACTCACCCACTCGCCU, CCTCACTCACCCACTCGCCU, CCTCACTCACCCACUCGCC, CCTCACTCACCCACUCGCC, CC TCACTCACCCACUCGCC, CCTCACTCACCCACUCGCCA, CCTGCTGCCCGGTTGCTTCT, CCTGCTGCCCGGTTGCUUCU, CCUGCTGCCCGGTTGCTTCT, CGCCUCCTCACTCACCCACU, CTCACTCACCCACTCGC and each nucleobase T may be independently and optionally replaced with a nucleobase U, and each U may independently and optionally be replaced with a T. Substitutions may be made, and nucleobase C and / or nucleobase G in one or more CpG motifs, if present, are replaced by another base; in some embodiments, a G nucleobase in a CpG motif is replaced by I.

[0167] In some embodiments, the base sequence of the oligonucleotide is, or comprises, or comprises at least a 15-base portion of ACTCACCCACTCGCCACCGC, wherein each nucleobase T can be independently and optionally substituted with a nucleobase U, and each U can be independently and optionally substituted with a T, and a nucleobase C and / or a nucleobase G in a CpG motif, if present, is replaced by another base; in some embodiments, a G nucleobase in a CpG motif is replaced by I. In some embodiments, the base sequence of the oligonucleotide is, or comprises, or comprises at least a 15-base portion of ACTCACCCACTCGCCACCGC, wherein each nucleobase T can be independently and optionally substituted with a nucleobase U, and each U can be independently and optionally substituted with a T, and one or more G in the CpG motif are independently substituted by I. In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises at least a 15 base portion thereof: ACTCACCCACTCGCCACCGC, where each nucleobase T can be independently and optionally substituted with a nucleobase U, and each U can be independently and optionally substituted with a T. In some embodiments, the base sequence of the oligonucleotide is, comprises, or comprises at least a 15 base portion thereof: ACTCACCCACTCGCCACCGC. As noted, the oligonucleotides of the present disclosure can include various base, sugar, and / or internucleotide linkage modifications; for example, in some embodiments, 5mC is utilized as the modified C.

[0168] The present disclosure provides various oligonucleotides in Table A1 and elsewhere, each of which has a defined base sequence. In some embodiments, the present disclosure encompasses any oligonucleotide having a base sequence that is, comprises, or comprises a portion of any of the base sequences of the oligonucleotides disclosed herein. In some embodiments, the present disclosure encompasses any oligonucleotide having a base sequence that is, comprises, or comprises a portion of any of the base sequences of the oligonucleotides disclosed herein, with any chemical modification, stereochemistry, format, structural feature (e.g., any structure or pattern of modification or portion thereof) and / or any other modification described herein (e.g., conjugation to another moiety, such as a targeting moiety, carbohydrate moiety, and / or multimerization). In some embodiments, a "portion" (e.g., of a base sequence or pattern of modification) is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nt in length. In some embodiments, a "portion" of a base sequence is at least 5 nt in length. In some embodiments, a "portion" of a base sequence is at least 10 nt in length. In some embodiments, a "portion" of a base sequence is at least 15 nt in length. In some embodiments, a "portion" of a base sequence is at least 20 nt in length.

[0169] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCA, where each T can be independently and optionally replaced with U.

[0170] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCA, where each T can be independently and optionally replaced with U.

[0171] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of ATACTTACCTGG, where each T can be independently and optionally replaced with U.

[0172] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CACTCGCCA, where each T can be independently and optionally replaced with U.

[0173] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of ACTCGCCA, where each T can be independently and optionally replaced with U.

[0174] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of ACCCACTCGCCA, where each T can be independently and optionally replaced with U.

[0175] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCCACTCGCCA, where each T can be independently and optionally replaced with U.

[0176] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of TGCCGCCTCCTCACTCACCC, where each T can be independently and optionally replaced with a U.

[0177] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of TGCCGCCTCCTCACTCACCC, where each T can be independently and optionally replaced with a U.

[0178] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of GCGCGACTCCTGAGTTCCAG, where each T can be independently and optionally replaced with a U.

[0179] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of TCCTTGCTTTCCCGCCCTCA, where each T can be independently and optionally replaced with a U.

[0180] In some embodiments, the oligonucleotide targets C9orf72 and includes the base sequence TCCTTGCTTTCCCGCCCTCA or a portion thereof. wherein each T can be independently and optionally replaced with U.

[0181] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of TCCTTGCTTTCCCGCCCTCA, where each T can be independently and optionally replaced with a U.

[0182] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of GTCCCTGCTGCCCGGTTGCT, where each T can be independently and optionally replaced with a U.

[0183] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of GTCCCTGCTGCCCGGTTGCT, where each T can be independently and optionally replaced with a U.

[0184] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of GTCCCTGCTGCCCGGTTGCT, where each T can be independently and optionally replaced with a U.

[0185] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTGCTGCCCGGTTGCTTCT, where each T can be independently and optionally replaced with a U.

[0186] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTGCTGCCCGGTTGCTTCT, where each T can be independently and optionally replaced with a U.

[0187] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTGCTGCCCGGTTGCTTCT, where each T can be independently and optionally replaced with a U.

[0188] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of GCTACCTATATG, where each T can be independently and optionally replaced with U.

[0189] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CTCTGGAACTCAGGAGTCGCGCGC, where each T can be independently and optionally replaced with U.

[0190] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCI, where each T can be independently and optionally replaced with U.

[0191] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCG, where each T can be independently and optionally replaced with U.

[0192] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of TCCTCACTCACCCACTCGCC, where each T can be independently and optionally replaced with a U.

[0193] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CTCACTCACCCACTCGCCAC, where each T can be independently and optionally replaced with U.

[0194] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of ACTCACCCACTCGCCACCGC, where each T can be independently and optionally replaced with a U.

[0195] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CGCCTCCTCACTCACCCACT, where each T can be independently and optionally replaced with U.

[0196] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCC, where each T can be independently and optionally replaced with a U.

[0197] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCA, where each T can be independently and optionally replaced with U.

[0198] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCC, where each T can be independently and optionally replaced with a U.

[0199] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCC, where each T can be independently and optionally replaced with U.

[0200] In some embodiments, the oligonucleotide targets C9orf72 and has a base sequence that is, includes, or includes a portion of CCTCACTCACCCACTCGCCT, where each T can be independently and optionally replaced with U.

[0201] In some embodiments, the portion of the base sequence is a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous (consecutive) bases. In some embodiments, the portion of the base sequence is a span of 15, 16, 17, 18, 19 or more contiguous (consecutive) bases. In some embodiments, the base sequence of the oligonucleotide is or comprises the above-described base sequence. In some embodiments, the base sequence of the oligonucleotide is the above-described base sequence.

[0202] In some embodiments, the nucleobase at the 5' end of the oligonucleotide is optionally replaced by a replacement nucleobase (as would be understood by one of skill in the art, which is different from the original 5'-terminal nucleobase). In some embodiments, the nucleobase at the 5' end of the oligonucleotide is replaced by a replacement nucleobase. In some embodiments, the nucleobase at the 3' end of the oligonucleotide is optionally replaced by a replacement nucleobase (as would be understood by one of skill in the art, which is different from the original 3'-terminal nucleobase). In some embodiments, the nucleobase at the 3' end of the oligonucleotide is replaced by a replacement nucleobase. In some embodiments, the replacement nucleobase is selected from I, A, T, U, G, and C. In some embodiments, the replacement nucleobase is I. In some embodiments, the replacement nucleobase is A. In some embodiments, the replacement nucleobase is T. In some embodiments, the replacement The replaced nucleobase is U. In some embodiments, the replaced nucleobase is G. In some embodiments, the replaced nucleobase is C. In some embodiments, when aligned with the target sequence, the replaced nucleobase creates a non-Watson-Crick base pair. In some embodiments, the replaced nucleobase creates a wobble base pair.

[0203] As demonstrated herein, in many embodiments, the substitutions can provide improved properties, activity, selectivity, and the like.

[0204] In some embodiments, the present disclosure provides C9orf72 oligonucleotides of the sequences described herein. In some embodiments, the disclosure provides C9orf72 oligonucleotides of the sequences described herein, wherein the oligonucleotides can lead to reduced expression, levels, and / or activity of the C9orf72 gene or its gene product. In some embodiments, the C9orf72 oligonucleotides of the sequences described include any of the structures described herein. In various sequences, U can be replaced with T, or vice versa, or the sequence can include a mixture of U and T. In some embodiments, the C9orf72 oligonucleotides are about 49, 45, 40, 30, 35, 25, 23, or less total nucleotides in length. In some embodiments, the portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides, including 0 to 3 mismatches. In some embodiments, the portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides with 0 to 3 mismatches, where a span with 0 mismatches is complementary and a span with one or more mismatches is a non-limiting example of substantial complementarity. In some embodiments, where the 5' end of the sequences described above begins with a U, the U can be deleted and / or replaced with another base. In some embodiments, the present disclosure encompasses any oligonucleotide having a base sequence that is, includes, or includes a portion of the base sequence of any oligonucleotide disclosed herein having a format or portion of a format disclosed herein.

[0205] In some embodiments, C9orf72 oligonucleotides can comprise any of the base sequences described herein. In some embodiments, C9orf72 oligonucleotides can comprise any of the base sequences described herein or portions thereof. In some embodiments, C9orf72 oligonucleotides can comprise any of the base sequences described herein or portions thereof, where the portion is a span of 15 contiguous bases or a span of 15 contiguous bases containing 1 to 5 mismatches. In some embodiments, C9orf72 oligonucleotides can comprise any of the base sequences described herein or portions thereof in combination with any other structural elements or modifications described herein. Specific examples of base sequences and useful structural elements, including modifications and their patterns, are listed in Table A1.

[0206] Non-limiting examples of C9orf72 oligonucleotides with various base sequences and modifications are disclosed below in Table 1A.

[0207] [Table 1]

[0208] [Table 2]

[0209] [Table 3]

[0210] [Table 4]

[0211] [Table 5]

[0212] [Table 6]

[0213] [Table 7]

[0214] [Table 8]

[0215] [Table 9]

[0216] [Table 10]

[0217] [Table 11]

[0218] [Table 12]

[0219] [Table 13]

[0220] [Table 14]

[0221] [Table 15]

[0222] Explanation of Table A1 This disclosure notes that some sequences, due to their length, are split across multiple rows in Table 1A. however, these sequences, like all oligonucleotides in Table 1A, are single-stranded (unless otherwise noted). As will be understood by those of skill in the art, when an internucleotide linkage is not specified between two nucleoside units, the internucleotide linkage is a phosphodiester linkage (a natural phosphate linkage), and unless otherwise indicated, the sugar is a natural DNA sugar with no 2'-position substitutions (two -H at the 2'-carbon). The moieties and modifications listed in the table (or compounds used to construct oligonucleotides containing these moieties or modifications): I: inosine; m:2'-OMe; m5: methyl at position 5 of C (nucleobase is 5-methylcytosine); m5Ceo: 5-methyl 2'-O-methoxyethyl C; m5mC: 5-methyl 2′-OMeC; eo:2'-MOE(2'-OCH2CH2OCH3); r:2'-OH; O, PO: phosphodiester (phosphate); this can be a bond, e.g., between a linker and an oligonucleotide chain, an internucleotide bond, etc. A phosphodiester shown in the stereochemistry / internucleotide bond column is not repeated in the description column; if an internucleotide bond is not shown in the description column, it is a phosphodiester. * , PS: phosphorothioate; this may be a bond, for example, a bond between a linker and an oligonucleotide chain, an internucleotide bond, etc. R, Rp: phosphorothioate in the Rp conformation; * Note that R denotes a single phosphorothioate in the Rp conformation; S, phosphorothioate in Sp:Sp conformation; * Note that S denotes a single phosphorothioate in the Sp conformation; n001: [ka] nX:stereorandomn001; nR or n001R: n001 in Rp configuration; nS or n001S: n001 in Sp configuration; X: stereorandom phosphorothioate; and L004: A linker having the structure -NH(CH2)4CH(CH2OH)CH2-, where -NH- is linked to Mod (via -C(O)-) or -H, and the -CH2- linking moiety is attached at the 3' end of the oligonucleotide chain, e.g., a phosphodiester (-OP(O)(OH)-O-, which may exist in salt form and may be shown as O or PO in the table) or a phosphorothioate (-OP(O)(SH)-O-, which may exist in salt form. In the table, when the phosphorothioate is not chiral controlled, * when chiral and having the Sp configuration, * When shown as S, S or Sp and is chiral controlled and has the Rp configuration, * The linker L004 is linked to the 3'-terminal sugar (which may be depicted as R, R, or Rp). For example, the absence of an asterisk immediately preceding L004 indicates that the bond is a phosphodiester bond. For example, in WV-18852, which terminates in mAL004, the linker L004 is linked to a phosphodiester bond (via a -CH2- moiety) at the 3' position of the 3'-terminal sugar (which is 2'-OMe and is linked to nucleobase A), and the L004 linker is linked to -H via -NH-.

[0223] For example, in some embodiments, the present disclosure provides: mA * Sm5Ceon001RTeom5Ceon001RmA * SC * SC * SC * RA * SC * ST * Sm5C * SG * Rm5C * SC * SmA * SmCn001Rm5Ceo * SmG * SmC or a pharmaceutically acceptable salt thereof, wherein: m represents a 2'-OMe modification to the nucleoside (e.g., mA is 2'-OMeA); * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; n001R represents an Rpn001 bond, where the n001 bond is [ka] having the structure eo represents a 2'-OCH2CH2OCH3 modification to a nucleoside (e.g., Teo is 2'-OCH2CH2OCH3T); * R represents an Rp phosphorothioate linkage; and m5 represents methyl at the 5-position of C (eg, in 5mC, the nucleobase is 5-methylcytosine).

[0224] In some embodiments, the present disclosure provides: mA * Sm5Ceon001RTeom5Ceon001RmA * SC * SC * SC * RA * SC * ST * Sm5C * SG * Rm5C * SC * SmA * SmC * Sm5Ceon001RmG * SmC or a pharmaceutically acceptable salt thereof, In the formula, m, * S, m5Ceo, n001R, eo, * R, m5, etc. are independently as indicated herein.

[0225] In some embodiments, the present disclosure provides: mA * Sm5Ceon001RTeom5Ceon001RmA * SC * SC * SC * RA * SC * ST * Sm5C * SG * Rm5C * SC * SmA * SmC * Sm5Ceo * SmGn001RmC or a pharmaceutically acceptable salt thereof, In the formula, m, * S, m5Ceo, n001R, eo, * R, m5, etc. are independently as indicated herein.

[0226] In some embodiments, the present disclosure provides: mC * Sm5CeoTeom5CeomA * SC * ST * SC * RA * SC * SC * RC * SA * SC * ST * Sm5mC * SmG * SmC * Sm5mC * SmG or a pharmaceutically acceptable salt thereof, In the formula, m, * S, m5Ceo, eo, * R, m5, etc. are independently as indicated herein.

[0227] In some embodiments, the present disclosure provides: mA * Sm5CeoTeom5CeomA* SC * SC * SC * RA * SC * ST * S m5C * SG * Rm5C * SC * SmA * SmC * Sm5mC * SmG * SmC or a pharmaceutically acceptable salt thereof, In the formula, m, * S, m5Ceo, eo, * R, m5, etc. are independently as indicated herein.

[0228] In some embodiments, the present disclosure provides: mC * Sm5CeoTeom5CeomA * SC * ST * SC * RA * SC * SC * RC * SA * SC * ST * Sm5Ceo * SmG * SmC * Sm5Ceo * SmG or a pharmaceutically acceptable salt thereof, In the formula, m, * S, m5Ceo, eo, * R, m5, etc. are independently as indicated herein.

[0229] In some embodiments, the present disclosure provides: mA * Sm5CeoTeom5CeomA * SC * SC * SC * RA* SC * ST * Sm5C * SG * Rm5C * SC * SmA * SmC * Sm5Ceo * SmG * SmC or a pharmaceutically acceptable salt thereof, In the formula, m, * S, m5Ceo, eo, * R, m5, etc. are independently as indicated herein.

[0230] Chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions In some embodiments, the provided C9orf72 oligonucleotides can lead to a decrease in the expression, level, and / or activity of a C9orf72 target gene or its gene product. In some embodiments, the C9orf72 target gene comprises a repeat expansion. In some embodiments, the C9orf72 target gene comprises a hexanucleotide repeat expansion.

[0231] In particular, the present disclosure provides chiral-controlled C9orf72 oligonucleotides and chiral-controlled C9orf72 oligonucleotide compositions of high purity and high diastereomeric purity. In some embodiments, the present disclosure provides chiral-controlled C9orf72 oligonucleotides and chiral-controlled C9orf72 oligonucleotide compositions of high purity. In some embodiments, the present disclosure provides chiral-controlled C9orf72 oligonucleotides and chiral-controlled C9orf72 oligonucleotide compositions of high diastereomeric purity.

[0232] In some embodiments, a C9orf72 oligonucleotide composition is a substantially pure preparation of a C9orf72 oligonucleotide type in that any oligonucleotides in the composition that are not of that oligonucleotide type are impurities from the preparation process of said oligonucleotide type, in some cases after certain purification procedures.

[0233] In some embodiments, the present disclosure provides chirality-controlled C9orf72 oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have a different stereochemistry and / or a different P modification compared to each other. In certain embodiments, the present disclosure provides chirality-controlled C9orf72 oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have a different P modification compared to each other. In certain embodiments, the present disclosure provides chirality-controlled C9orf72 oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have a different P modification compared to each other, and the chirality-controlled C9orf72 oligonucleotide comprises at least one phosphodiester internucleotide linkage. In certain embodiments, the present disclosure provides chirality-controlled C9orf72 oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have a different P modification compared to each other. At least two of the internucleotide linkages have a different P modification compared to each other, and the chiral-controlled C9orf72 oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate diester internucleotide linkage. In certain embodiments, the present disclosure provides chiral-controlled C9orf72 oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have a different P modification compared to each other, and the chiral-controlled C9orf72 oligonucleotide comprises at least one phosphorothioate triester internucleotide linkage. In certain embodiments, the present disclosure provides chiral-controlled C9orf72 oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have a different P modification compared to each other, and the chiral-controlled C9orf72 oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate triester internucleotide linkage.

[0234] In some embodiments, provided compounds, e.g., provided oligonucleotides, have a purity of 60% to 100%. In some embodiments, the purity is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the purity is at least 60%. In some embodiments, the purity is at least 70%. In some embodiments, the purity is at least 80%. In some embodiments, the purity is at least 85%. In some embodiments, the purity is at least 90%. In some embodiments, the purity is at least 91%. In some embodiments, the purity is at least 92%. In some embodiments, the purity is at least 93%. In some embodiments, the purity is at least 94%. In some embodiments, the purity is at least 95%. In some embodiments, the purity is at least 96%. In some embodiments, the purity is at least 97%. In some embodiments, the purity is at least 98%. In some embodiments, the purity is at least 99%. In some embodiments, the purity is at least 99.5%.

[0235] In some embodiments, provided compounds, e.g., provided oligonucleotides, have a stereochemical purity of 60% to 100%. In some embodiments, provided compounds, e.g., provided oligonucleotides, have a diastereomeric purity of 60% to 100%. In some embodiments, the diastereomeric purity is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, chiral elements, e.g., chiral centers (carbon, phosphorus, etc.), of provided compounds, e.g., provided oligonucleotides, have a diastereomeric purity of 60% to 100%. In some embodiments, the chiral element, e.g., the chiral center (carbon, phosphorus, etc.), has a diastereomeric purity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, each linking phosphorus of the chiral controlled internucleotide linkage independently has a diastereomeric purity of 85-100%, e.g., 90-100%, or at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the chirality-controlled internucleotide linkages of the multiple oligonucleotides in the chirality-controlled oligonucleotide composition independently have a diastereomeric purity of 85-100%, e.g., 90-100%, or at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, each phosphorothioate internucleotide linkage is independently chiral-controlled. In some embodiments, the diastereomeric purity is at least 60%. In some embodiments, the diastereomeric purity is at least 70%. %. In some embodiments, the diastereomeric purity is at least 80%. In some embodiments, the diastereomeric purity is at least 85%. In some embodiments, the diastereomeric purity is at least 90%. In some embodiments, the diastereomeric purity is at least 91%. In some embodiments, the diastereomeric purity is at least 92%. In some embodiments, the diastereomeric purity is at least 93%. In some embodiments, the diastereomeric purity is at least 94%. In some embodiments, the diastereomeric purity is at least 95%. In some embodiments, the diastereomeric purity is at least 96%. In some embodiments, the diastereomeric purity is at least 97%. In some embodiments, the diastereomeric purity is at least 98%. In some embodiments, the diastereomeric purity is at least 99%. In some embodiments, the diastereomeric purity is at least 99.5%.

[0236] In particular, the present disclosure provides various oligonucleotide compositions.In some embodiments, the present disclosure provides oligonucleotide compositions of the oligonucleotides described herein.In some embodiments, the oligonucleotide compositions, for example, C9orf72 oligonucleotide compositions, comprise a plurality of the oligonucleotides described in the present disclosure.In some embodiments, the oligonucleotide compositions, for example, C9orf72 oligonucleotide compositions, are chiral controlled.In some embodiments, the oligonucleotide compositions, for example, C9orf72 oligonucleotide compositions, are not chiral controlled (stereorandom).

[0237] The linking phosphorus of a natural phosphate bond is achiral. The linking phosphorus of many modified internucleotide linkages, such as phosphorothioate internucleotide linkages, is chiral. In some embodiments, during the preparation of oligonucleotide compositions (e.g., in conventional phosphoramidite oligonucleotide synthesis), the arrangement of the chiral linking phosphorus is not intentionally designed or controlled, resulting in a chiral-uncontrolled (stereorandom) oligonucleotide composition (substantially racemic preparation) that is a complex random mixture of various stereoisomers (diastereomers), and for an oligonucleotide having n chiral internucleotide linkages (the linking phosphorus is chiral), typically 2 n stereoisomers (e.g., when n is 10, 2 10 =1,032; when n is 20, 2 20 =1,048,576). These stereoisomers have the same constitution but differ with respect to the stereochemical pattern of their bound phosphorus.

[0238] In some embodiments, the present disclosure encompasses techniques for designing and preparing chiral-controlled oligonucleotide compositions. In some embodiments, the present disclosure provides chiral-controlled oligonucleotide compositions, e.g., many of the oligonucleotides in Table A1 containing S and / or R in their stereochemistry / linkage. In some embodiments, the chiral-controlled oligonucleotide compositions comprise a controlled / predetermined (not random, as in stereorandom compositions) level of multiple oligonucleotides, where the oligonucleotides share the same bond phosphorus stereochemistry at one or more chiral internucleotide linkages (chiral-controlled internucleotide linkages). In some embodiments, the oligonucleotides share the same backbone chiral center pattern (bond phosphorus stereochemistry). In some embodiments, the backbone chiral center pattern is as described in this disclosure. In some embodiments, the oligonucleotides share the same configuration. In some embodiments, the oligonucleotides are structurally identical. As will be understood by those skilled in the art, various forms of oligonucleotides, e.g., salt forms of various oligonucleotides, can be considered to have the same configuration and / or structure unless otherwise specified.

[0239] In some embodiments, the oligonucleotide composition comprises a plurality of oligonucleotides. a chiral controlled oligonucleotide composition comprising: 1) common base sequence, 2) common skeletal bond patterns and 3) The same bond phosphorus stereochemistry in one or more (1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) chiral internucleotide linkages (chiral controlled internucleotide linkages). Share The compositions are concentrated for multiple oligonucleotides as compared to substantially racemic preparations of oligonucleotides sharing a common base sequence and backbone linkage pattern.

[0240] In some embodiments, the oligonucleotide composition is a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are 1) common base sequence, 2) common skeletal bond patterns and 3) A pattern of common backbone chiral centers containing at least one Sp Share The compositions are concentrated for multiple oligonucleotides as compared to substantially racemic preparations of oligonucleotides sharing a common base sequence and backbone linkage pattern.

[0241] In some embodiments, the oligonucleotide composition is a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are 1) common base sequence, 2) common skeletal bond patterns and 3) A pattern of common backbone chiral centers containing at least one Rp Share The compositions are concentrated for multiple oligonucleotides as compared to substantially racemic preparations of oligonucleotides sharing a common base sequence and backbone linkage pattern.

[0242] In some embodiments, the multiple oligonucleotides are of the same composition.

[0243] In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein the oligonucleotides are 1) Common structure and 2) sharing the same bond phosphorus stereochemistry at one or more (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chiral internucleotide linkages (chiral controlled internucleotide linkages); The compositions are enriched for multiple oligonucleotides compared to substantially racemic preparations of oligonucleotides of a common constitution.

[0244] In some embodiments, the plurality of oligonucleotides are structurally identical. In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein the oligonucleotides are structurally identical and the composition comprises substantially the same composition of oligonucleotides as the plurality of oligonucleotides. Compared to racemic formulations, there is accumulation for several oligonucleotides.

[0245] In some embodiments, they independently share the same stereochemistry at 5 to 50 or more, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more, chiral internucleotide linkages. In some embodiments, multiple oligonucleotides share the same stereochemistry at each phosphorothioate internucleotide linkage.

[0246] In some embodiments, enrichment for a formulation of substantially chiral bodies is such that at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all oligonucleotides in the composition are multiple oligonucleotides. In some embodiments, enrichment for a formulation of substantially chiral bodies is such that at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all oligonucleotides in the composition that share a common base sequence are multiple oligonucleotides. In some embodiments, enrichment for a formulation of substantially chiral objects is such that at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all oligonucleotides in the composition sharing the same configuration are oligonucleotides. In some embodiments, the percentage is at least about 10%. In some embodiments, the percentage is at least about 20%. In some embodiments, the percentage is at least about 30%. In some embodiments, the percentage is at least about 40%. In some embodiments, the percentage is at least about 50%. In some embodiments, the percentage is at least about 60%. In some embodiments, the percentage is at least about 70%. In some embodiments, the percentage is at least about 75%. In some embodiments, the percentage is at least about 80%. In some embodiments, the percentage is at least about 85%. In some embodiments, the percentage is at least about 90%. In some embodiments, the percentage is at least about 91%. In some embodiments, the percentage is at least about 92%. In some embodiments, the percentage is at least about 93%. In some embodiments, the percentage is at least about 94%.In some embodiments, the percentage is at least about 95%. In some embodiments, the percentage is at least about 96%. In some embodiments, the percentage is at least about 97%. In some embodiments, the percentage is at least about 98%. In some embodiments, the percentage is at least about 99%. As will be understood by those skilled in the art, various forms of oligonucleotides can properly be considered to have the same composition and / or structure, and various forms of oligonucleotides that share the same composition can properly be considered to have the same composition.

[0247] The level of the plurality of oligonucleotides in a chiral controlled oligonucleotide composition is controlled. In contrast, in a non-chiral controlled (or stereorandom, racemic) oligonucleotide composition (or formulation), the level of the oligonucleotides is random and not controlled. In some embodiments, the level of the plurality of oligonucleotides in a chiral controlled oligonucleotide composition is controlled by the level of all oligonucleotides in the chiral controlled oligonucleotide composition, or all oligonucleotides in a chiral controlled oligonucleotide composition that share a common base sequence with the plurality of oligonucleotides, or all oligonucleotides in a chiral controlled oligonucleotide composition that share a common base sequence and backbone bond pattern with the plurality of oligonucleotides. or about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%) of all oligonucleotides in a chiral controlled oligonucleotide composition that share a common base sequence, backbone bond pattern, and backbone phosphorus modification pattern with a plurality of oligonucleotides, or about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%) of all oligonucleotides in a chiral controlled oligonucleotide composition that share the same configuration as a plurality of oligonucleotides. 0%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the enrichment of the substantially chiral object in the formulation is at a level described herein.

[0248] In some embodiments, the level (e.g., control level, predetermined level, accumulation) as a percentage is (DS) nc or at least (DS) ncwhere DS is 90% to 100% and nc is the number of chiral-controlled internucleotide linkages as described herein (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more). In some embodiments, each chiral internucleotide linkage is chiral, and nc is the number of chiral internucleotide linkages. In some embodiments, DS is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% or more. In some embodiments, DS is 90% or at least 90%. In some embodiments, DS is 91% or at least 91%. In some embodiments, DS is 92% or at least 92%. In some embodiments, DS is 93% or at least 93%. In some embodiments, the DS is 94% or at least 94%. In some embodiments, the DS is 95% or at least 95%. In some embodiments, the DS is 96% or at least 96%. In some embodiments, the DS is 97% or at least 97%. In some embodiments, the DS is 98% or at least 98%. In some embodiments, the DS is 99% or at least 99%. In some embodiments, the level (e.g., control level, predetermined level, enrichment) is the percentage of all oligonucleotides in the composition that share the same construct, where the percentage is (DS) nc or at least (DS) nc For example, if DS is 99% and nc is 10, the percentage is 90% or at least 90% (99%). 10 ≈0.90=90%). As will be appreciated by those skilled in the art, in stereorandom formulations, the percentage is typically about 1 / 2 nc and when nc is 10, the percentage is about 1 / 2 10 ≒0.001=0.1%.

[0249] In some embodiments, the oligonucleotide composition is a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are 1) common base sequence, 2) common skeletal bond patterns and 3) The same bond phosphorus stereochemistry in one or more (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) chiral internucleotide linkages (chiral controlled internucleotide linkages). Share The percentage of oligonucleotides among all oligonucleotides in the composition that share a common base sequence and backbone linkage pattern is at least (DS) nc where DS is 90% to 100% and nc is the number of chiral controlled internucleotide linkages.

[0250] In some embodiments, the oligonucleotide composition is a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are 1) common base sequence, 2) Common skeletal bond patterns and 3) A pattern of common backbone chiral centers containing at least one Sp Share The percentage of oligonucleotides among all oligonucleotides in the composition that share a common base sequence and backbone linkage pattern is at least (DS) nc where DS is 90% to 100% and nc is the number of chiral controlled internucleotide linkages.

[0251] In some embodiments, the oligonucleotide composition is a chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are 1) common base sequence, 2) Common skeletal bond patterns and 3) A pattern of common backbone chiral centers containing at least one Rp Share The percentage of oligonucleotides among all oligonucleotides in the composition that share a common base sequence and backbone linkage pattern is at least (DS) nc where DS is 90% to 100% and nc is the number of chiral controlled internucleotide linkages.

[0252] In some embodiments, the disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein the oligonucleotides are of a common configuration and share the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) chiral internucleotide linkages (chiral controlled internucleotide linkages), and wherein a percentage of the plurality of oligonucleotides within all oligonucleotides of the same configuration in the composition are at least (DS) nc where DS is 90% to 100% and nc is the number of chiral controlled internucleotide linkages.

[0253] In some embodiments, the plurality of oligonucleotides are of different salt forms.In some embodiments, the plurality of oligonucleotides comprises one or more forms of a single oligonucleotide, for example, various pharmaceutically acceptable salt forms.In some embodiments, the plurality of oligonucleotides comprises one or more forms of two or more oligonucleotides, for example, various pharmaceutically acceptable salt forms.In some embodiments, the plurality of oligonucleotides comprises two or more oligonucleotides. NCC The oligonucleotide may be in one or more forms, such as various pharmaceutically acceptable salt forms, where NCC is the number of chiral internucleotide linkages that are not chiral controlled. NCC Oligonucleotides may be used, for example, if they are not specifically assembled using chiral-controlled oligonucleotide synthesis. , have relatively similar levels within the composition.

[0254] In some embodiments, the present disclosure provides chiral controlled oligonucleotide compositions comprising a plurality of oligonucleotides, wherein the oligonucleotides are structurally identical and a percentage of the plurality of oligonucleotides within all oligonucleotides of the same configuration as the plurality of oligonucleotides in the composition is at least (DS) nc where DS is 90% to 100% and nc is the number of chiral controlled internucleotide linkages.

[0255] In some embodiments, the level of multiple oligonucleotides in a composition can be determined as the product of the diastereopurities of each chiral internucleotide bond in the oligonucleotide. In some embodiments, the diastereopurity of an internucleotide bond linking two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereopurity of the internucleotide bond of a dimer linking the same two nucleosides, where the dimer is prepared using equivalent conditions, in some cases, identical synthesis cycle conditions (e.g., for a bond between Nx and Ny in an oligonucleotide...NxNy..., the dimer is NxNy).

[0256] In some embodiments, all chiral internucleotide linkages are chiral controlled, and the composition is a fully chiral controlled oligonucleotide composition. In some embodiments, not all chiral internucleotide linkages are chiral controlled, and the composition is a partially chiral controlled oligonucleotide composition. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all chiral internucleotide linkages are chiral controlled. In some embodiments, at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all chiral internucleotide linkages are chiral controlled. In some embodiments, each phosphorothioate internucleotide linkage is chiral controlled.

[0257] Oligonucleotides can comprise or consist of various backbone chiral center patterns (patterns of chiral bonded phosphorus stereochemistry). Particular useful backbone chiral center patterns are described in the present disclosure. In some embodiments, multiple oligonucleotides share a common backbone chiral center pattern, which is or includes a pattern described in the present disclosure (e.g., the backbone chiral center patterns of the chiral-controlled oligonucleotides in Table A1, as in "bonded phosphorus stereochemistry and its pattern").

[0258] Chirality-controlled oligonucleotide compositions may demonstrate numerous advantages over stereorandom oligonucleotide compositions. Among other things, chirality-controlled oligonucleotide compositions are more uniform with respect to oligonucleotide structure than corresponding stereorandom oligonucleotide compositions. By controlling stereochemistry, compositions of individual stereoisomers can be prepared and evaluated, thereby enabling the development of stereoisomeric chirality-controlled oligonucleotide compositions with desired properties and / or activity. In some embodiments, chirality-controlled oligonucleotide compositions provide, for example, better delivery, stability, clearance, activity, selectivity, and / or toxicity profiles compared to corresponding stereorandom oligonucleotide compositions. In some embodiments, chirality-controlled oligonucleotide compositions provide better efficacy, fewer side effects, and / or more convenient and effective dosing regimens. Among other things, the patterns of backbone chiral centers described herein can be utilized to control the cleavage of oligonucleotide targets (e.g., transcripts such as pre-mRNA, mature mRNA, etc.; cleavage sites, the rate of cleavage at the cleavage sites, and the like). In some embodiments, chiral controlled oligonucleotide compositions of oligonucleotides containing specific patterns of backbone chiral centers can discriminate between sequences with nucleobase differences at very few positions, and in some embodiments, at a single position (e.g., at a SNP site, point mutation site, etc.).

[0259] As will be understood by those skilled in the art, stereorandom or (substantially) racemic preparations / chiral non-controlled oligonucleotide compositions are typically prepared without chiral control, e.g., without the use of chiral auxiliaries, chiral modifying reagents and / or chiral catalysts that can provide high stereoselectivity at the bound phosphorus during oligonucleotide synthesis (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more; in some embodiments, 95%, 96%, 97%, 98%, 99% or 99.5% or more; in some embodiments, 97%, 98%, 99% or 99.5% or more; in some embodiments, 98%, 99% or 99.5% or more). In some embodiments, in substantially racemic (or chiral non-controlled) preparations of oligonucleotides, the coupling step is not chiral controlled in that the coupling step is not specifically performed to provide enhanced stereoselectivity. One example of a substantially racemic preparation of oligonucleotide / non-chiral oligonucleotide compositions is the preparation of phosphorothioate oligonucleotides via conventional phosphoramidite oligonucleotide synthesis and sulfurization using non-chiral sulfurizing reagents such as tetraethylthiuram disulfide (TETD) or 3H-1,2-benzodithiol-3-one 1,1-dioxide (BDTD), which are methods known in the art. Methods for making substantially racemic formulations of stereorandom oligonucleotide compositions / oligonucleotides are widely known and practiced in the art and can be utilized to prepare such compositions and formulations of the present disclosure.

[0260] Specific data demonstrating the properties and / or activity of chiral controlled oligonucleotide compositions, e.g., chiral controlled C9orf72 oligonucleotide compositions in reducing the level, activity and / or expression of a C9orf72 target gene or its gene product, are provided, e.g., in the Examples.

[0261] In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, e.g., chirality-controlled C9orf72 oligonucleotide compositions, wherein the linking phosphorus of at least one chirality-controlled internucleotide linkage is Sp. In some embodiments, the present disclosure provides chirality-controlled oligonucleotide compositions, e.g., chirality-controlled C9orf72 oligonucleotide compositions, wherein the linking phosphorus of a majority of the chirality-controlled internucleotide linkages is Sp. In some embodiments, about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95%, 65% to 95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chiral controlled internucleotide linkages (or all chiral internucleotide linkages or all internucleotide linkages) of an oligonucleotide or a portion thereof (e.g., 5'-wing, 3'-wing, core, etc.) are Sp. In some embodiments, about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95%, 65% to 95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chiral-controlled phosphorothioate internucleotide linkages in an oligonucleotide or a portion thereof (e.g., 5'-wing, 3'-wing, core, etc.) are Sp. In some embodiments, the percentage is 60% or greater. In some embodiments, the percentage is 67% or greater. In some embodiments, the percentage is 70% or greater. In some embodiments, the percentage is 75% or greater. In some embodiments, the percentage is 80% or greater. In some embodiments, the percentage is 85% or greater. In some embodiments, the percentage is 90% or greater. In some embodiments, the percentage is 95% or greater. In some embodiments, the oligonucleotide or a portion thereof (e.g., the 5'-wing, the 3'-wing, the core, etc.) comprises one or more Rp chirality-controlled internucleotide linkages. In some embodiments, the oligonucleotide or a portion thereof (e.g., the 5'-wing, the 3'-wing, the core, etc.) comprises one or more Rp chirality-controlled non-negatively charged internucleotide linkages (e.g., a neutral internucleotide linkage such as n001). In some embodiments, an oligonucleotide or portion thereof (e.g., 5'-wing, 3'-wing, core, etc.) comprises one or more Rp chiral-controlled phosphorothioate internucleotide linkages. In some embodiments, the core comprises one or more Rp phosphorothioate internucleotide linkages in a pattern of backbone chiral centers, including, for example, RpSpSp, as described herein.

[0262] Stereochemistry and patterns of skeletal chiral centers In contrast to natural phosphate linkages, the linking phosphorus of chirally modified internucleotide linkages, e.g., phosphorothioate internucleotide linkages, is chiral. Among other things, the present disclosure provides technologies (e.g., oligonucleotides, compositions, methods, etc.) that involve controlling the stereochemistry of the chiral linking phosphorus in a chiral internucleotide linkage. In some embodiments, as demonstrated herein, controlling the stereochemistry can provide improved properties and / or activity, including desired stability, reduced toxicity, improved target nucleic acid reduction, etc. In some embodiments, the present disclosure provides patterns of backbone chiral centers useful in oligonucleotides and / or regions thereof, the patterns being a combination of the stereochemistry of each chiral linking phosphorus (Rp or Sp) from 5' to 3', and the index of each achiral linking phosphorus (Op, if present). In some embodiments, the pattern of backbone chiral centers can control the cleavage pattern of a target nucleic acid when contacted with a provided oligonucleotide or composition thereof in a cleavage system (e.g., an in vitro assay, a cell, a tissue, an organ, an organism, a subject, etc.). In some embodiments, the pattern of backbone chiral centers improves the efficiency and / or selectivity of cleavage of a target nucleic acid when contacted with the oligonucleotide or composition thereof in which they are provided in a cleavage system.

[0263] In some embodiments, the pattern of backbone chiral centers of an oligonucleotide, e.g., a C9orf72 oligonucleotide, or a region thereof (e.g., core), is (Sp)m(Rp / Op)n, (Rp / Op)n(Sp)m, (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t[(Rp / Op)n(Sp)m]y, [(Rp / Op)n(Sp)m]y(Np)t, (Np)t[(Rp)n(Sp)m]y, [(Rp)n(Sp)m]y(Np)t, [(Op n(Sp)m]y(Rp)k, [(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y(Rp)k, [(Rp)n(Sp)m]y(Rp)k, [(Rp)n(Sp)m]y, (Sp)t[(Rp)n(Sp)m]y or (Sp)t[(Rp)n(Sp)m]y(Rp)k, where each Np is independently Sp or Rp, and each of m, n, t, y, and k is independently 1 to 50. In some embodiments, the pattern of backbone chiral centers of an oligonucleotide, e.g., a C9orf72 oligonucleotide, or a region (e.g., core) thereof, comprises or is Rp(Sp)m. In some embodiments, the pattern of backbone chiral centers of an oligonucleotide, e.g., a C9orf72 oligonucleotide, or a region thereof (e.g., the core), comprises or is (Sp)tRp(Sp)m. The pattern of backbone chiral centers of an oligonucleotide, or a region thereof (e.g., core), comprises or is [Rp(Sp)m]y. In some embodiments, the pattern of backbone chiral centers of an oligonucleotide, e.g., a C9orf72 oligonucleotide, or a region thereof (e.g., core), comprises or is (Np)t[Rp(Sp)m]y. In some embodiments, the pattern of backbone chiral centers of an oligonucleotide, e.g., a C9orf72 oligonucleotide, or a region thereof (e.g., core), comprises or is (Sp)t[Rp(Sp)m]y. In some embodiments, at least one n is 1. In some embodiments, each n is 1. In some embodiments, at least one m is 2 or greater. In some embodiments, each m is independently 2 or greater. In some embodiments, y is 1. In some embodiments, y is 2. In some embodiments, y is 3. In some embodiments, t is 1. In some embodiments, t is 2 or greater. In some embodiments, t is 2 or greater. In some embodiments, y is 4 or greater. In some embodiments, at least one Rp / Op is Rp. In some embodiments, each of Np, Rp, and Sp is independently a phosphorothioate internucleotide linkage. In some embodiments, Op represents a natural phosphate linkage.

[0264] In some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, in the pattern of backbone chiral centers, each m is independently 2 or greater. In some embodiments, each m is independently 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, each m is independently 2 to 3, 2 to 5, 2 to 6, or 2 to 10. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9. In some embodiments, m is 10. In some embodiments, when there are two or more occurrences of m, they may be the same or different, and each of them is independently as described in this disclosure.

[0265] In some embodiments, y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, y is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, y is 1. In some embodiments, y is 2. In some embodiments, y is 3. In some embodiments, y is 4. In some embodiments, y is 5. In some embodiments, y is 6. In some embodiments, y is 7. In some embodiments, y is 8. In some embodiments, y is 9. In some embodiments, y is 10.

[0266] In some embodiments, t is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, t is 2 or greater. In some embodiments, t is 3 or greater. In some embodiments, t is 4 or greater. In some embodiments, t is 1. In some embodiments, t is 2. In some embodiments, t is 3. In some embodiments, t is 4. In some embodiments, t is 5. In some embodiments, t is 6. In some embodiments, t is 7. In some embodiments, t is 8. In some embodiments, t is 9. In some embodiments, t is 10. In some embodiments, t is 2 or greater. When there are more than one occurrence, they may be the same or different, and each of them is independently as described in this disclosure.

[0267] In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10. In some embodiments, when there is more than one occurrence of n, they may be the same or different, and each of them is independently as described in this disclosure. In many embodiments, in the pattern of backbone chiral centers, at least one occurrence of n is 1; in some cases, each n is 1.

[0268] In some embodiments, k is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, k is 1. In some embodiments, k is 2. In some embodiments, k is 3. In some embodiments, k is 4. In some embodiments, k is 5. In some embodiments, k is 6. In some embodiments, k is 7. In some embodiments, k is 8. In some embodiments, k is 9. In some embodiments, k is 10.

[0269] In some embodiments, at least one n is 1 and at least one m is 2 or greater. In some embodiments, at least one n is 1, at least one t is 2 or greater, and at least one m is 3 or greater. In some embodiments, each n is 1. In some embodiments, t is 1. In some embodiments, at least one t > 1. In some embodiments, at least one t > 2. In some embodiments, at least one t > 3. In some embodiments, at least one t > 4. In some embodiments, at least one m > 1. In some embodiments, at least one m > 2. In some embodiments, at least one m > 3. In some embodiments, at least one m > 4. In some embodiments, the pattern of backbone chiral centers comprises one or more achiral natural phosphate linkages. In some embodiments, the sum of m, t, and n (or m and n if there is no t in the pattern) is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more. In some embodiments, the sum is 5. In some embodiments, the sum is 6. In some embodiments, the sum is 7. In some embodiments, the sum is 8. In some embodiments, the sum is 9. In some embodiments, the sum is 10. In some embodiments, the sum is 11. In some embodiments, the sum is 12. In some embodiments, the sum is 13. In some embodiments, the sum is 14. In some embodiments, the sum is 15.

[0270] In some embodiments, some of the linked phosphorus in the chiral-controlled internucleotide linkages is Sp. In some embodiments, at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the chiral-controlled internucleotide linkages have an Sp linked phosphorus. In some embodiments, at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the chiral-controlled phosphorothioate internucleotide linkages are Sp. In some embodiments, at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all chiral internucleotide linkages are chiral-controlled internucleotide linkages having Sp-linked phosphorus. In some embodiments, at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all chiral internucleotide linkages are chiral-controlled phosphorothioate internucleotide linkages having Sp-linked phosphorus. In some embodiments, at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all internucleotide linkages are chiral-controlled internucleotide linkages having Sp-linked phosphorus. In some embodiments, the percentage is at least 20%. In some embodiments, the percentage is at least 30%. In some embodiments, the percentage is at least 40%. In some embodiments, the percentage is at least 50%. In some embodiments, the percentage is at least 60%. In some embodiments, the percentage is at least 65%. In some embodiments, the percentage is at least 70%. In some embodiments, the percentage is at least 75%. In some embodiments, the percentage is at least 80%. In some embodiments, the percentage is at least 90%. In some embodiments, the percentage is at least 95%. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus, hi some embodiments, at least 5 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus.In some embodiments, at least 6 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 7 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 8 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 9 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 10 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 11 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 12 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 13 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 14 internucleotide linkages are chiral controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 15 internucleotide linkages are chiral-controlled internucleotide linkages having an Sp-binding phosphorus. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotide linkages are chiral-controlled internucleotide linkages having an Rp-binding phosphorus. In some embodiments, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotide linkages are chiral-controlled internucleotide linkages having an Rp-binding phosphorus. In some embodiments, no more than one internucleotide linkage in the oligonucleotide is a chiral-controlled internucleotide linkage having an Rp-binding phosphorus.In some embodiments, no more than two internucleotide linkages in the oligonucleotide are chiral controlled internucleotide linkages having an Rp-linked phosphorus. In some embodiments, no more than four internucleotide linkages in the oligonucleotide are chiral controlled internucleotide linkages with Rp-binding phosphorus. In some embodiments, no more than four internucleotide linkages in the oligonucleotide are chiral controlled internucleotide linkages with Rp-binding phosphorus. In some embodiments, no more than five internucleotide linkages in the oligonucleotide are chiral controlled internucleotide linkages with Rp-binding phosphorus.

[0271] In some embodiments, all, essentially all, or most of the internucleotide linkages in the oligonucleotide are in the Sp configuration (e.g., about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95%, or about 50% to 100%, of all chiral controlled internucleotide linkages or of all chiral internucleotide linkages or of all internucleotide linkages in the oligonucleotide). 65% to 95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more), provided that one or a small number of the internucleotide linkages (e.g., less than 1, 2, 3, 4, or 5 and / or all of the chiral controlled internucleotide linkages or all of the chiral internucleotide linkages or all of the internucleotide linkages in the oligonucleotide) are in the Rp configuration. In some embodiments, all, essentially all, or most of the internucleotide linkages in the core are in the Sp configuration (e.g., about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95 ... 95% or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more), provided that one or a small number of the internucleotide linkages (e.g., less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of 1, 2, 3, 4, or 5 and / or all of the chiral controlled internucleotide linkages or of all of the chiral internucleotide linkages or of all internucleotide linkages in the core) are in the Rp configuration.In some embodiments, all, essentially all, or most of the internucleotide linkages in the core are phosphorothioate in the Sp configuration (e.g., about 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 55% to 95%, 60% to 95%, 65% to 95%, or about 50% to 100%, 55% to 95%, 60% to 95%, 65% to 95%, or about 50% to 100%, 55% to 100%, 60% to 10 ...100%, or about 50% to 100%, 55% to 100%, 60% to 10 In some embodiments, up to 95% or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of the internucleotide linkages are phosphorothioates in the Rp configuration, provided that one or a small number of the internucleotide linkages (e.g., less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of 1, 2, 3, 4, or 5 and / or all of the chiral internucleotide linkages or all of the chiral internucleotide linkages or all of the internucleotide linkages in the core) are phosphorothioates in the Rp configuration. In some embodiments, each internucleotide linkage in the core is phosphorothioate in the Sp configuration, provided that one phosphorothioate is in the Rp configuration. In some embodiments, each internucleotide linkage in the core is phosphorothioate in the Sp configuration, provided that one phosphorothioate is in the Rp configuration.

[0272] In some embodiments, the oligonucleotide comprises one or more Rp internucleotide linkages. In some embodiments, the oligonucleotide comprises one or less Rp internucleotide linkages. In some embodiments, the oligonucleotide comprises two or more Rp internucleotide linkages. In some embodiments, the oligonucleotide comprises three or more Rp internucleotide linkages. In some embodiments, the oligonucleotide comprises four or more Rp internucleotide linkages. In some embodiments, the oligonucleotide comprises five or more Rp internucleotide linkages. In some embodiments, about 5% to 50% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 5% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 10% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 15% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 20% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 25% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 30% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp. In some embodiments, about 35% to 40% of all chirality-controlled internucleotide linkages in the oligonucleotide are Rp.

[0273] In some embodiments, the base sequence comprises or is a sequence complementary to a distinctive sequence element in the target nucleic acid, which distinctive sequence element can distinguish the target nucleic acid (e.g., a transcript from a particular allele or a type of transcript from a nucleic acid (e.g., V3 in FIG. 1 ), which is often associated with a pathology, disorder, or disease) from other nucleic acids (e.g., a transcript from a different allele or a different type(s) of transcript from a nucleic acid (e.g., V2 in FIG. 1 ), which is often not associated or less associated with a pathology, disorder, or disease). In some embodiments, the common base sequence comprises a sequence complementary to the distinctive sequence element. In some embodiments, the common base sequence is a sequence complementary to the distinctive sequence element. In some embodiments, the common base sequence comprises or is a sequence that is 100% complementary to the distinctive sequence element. In some embodiments, the common base sequence comprises a sequence that is 100% complementary to the distinctive sequence element. In some embodiments, the common base sequence is a sequence that is 100% complementary to the distinctive sequence element. In some embodiments, the Rp internucleotide linkage (e.g., an Rp phosphorothioate internucleotide linkage) is at position +5, +4, +3, +2, +1, -1, -2, -3, -4, or -5 relative to the characteristic sequence element. In some embodiments, such Rp is of an RpSpSp motif (e.g., comprising or consisting of (Rp)n(Sp)m, (Np)t[(Rp)n(Sp)m]y, (Sp)t[(Rp)n(Sp)m]y, Rp(Sp)m, (Sp)tRp(Sp)m, [Rp(Sp)m]y, (Np)t[Rp(Sp)m]y, or (Sp)t[Rp(Sp)m]y, as described herein) in the pattern of backbone chiral centers.Unless otherwise indicated, for the positioning of Rp internucleotide linkages, "-" refers to counting from the 5'-terminal nucleoside of the sequence complementary to the distinctive sequence element toward the 5'-end of the oligonucleotide, with the internucleotide linkage at position -1 being the internucleotide linkage attached to the 5'-carbon of the 5'-terminal nucleoside of the sequence complementary to the distinctive sequence element, and "+" refers to counting from the 3'-terminal nucleoside of the sequence complementary to the distinctive sequence element toward the 3'-end of the oligonucleotide, with the internucleotide linkage at position +1 being the internucleotide linkage attached to the 3'-carbon of the 3'-terminal nucleoside of the sequence complementary to the distinctive sequence element. In some embodiments, the distinctive sequence element comprises a single discriminator position (e.g., a point mutation). In some embodiments, the distinctive sequence element is a point mutation or a SNP. As will be understood by those skilled in the art, when a characteristic sequence element contains only one nucleoside, the 5'-terminal nucleoside of the sequence complementary to the characteristic sequence element and the 3'-terminal nucleoside of the sequence complementary to the characteristic sequence element are the same. In some embodiments, Rp is at -5. In some embodiments, Rp is at -4. In some embodiments, Rp is at -3. In some embodiments, Rp is at -2. In some embodiments, Rp is at -1. In some embodiments, Rp is at +1. In some embodiments, Rp is at +2. In some embodiments, Rp is +. In some embodiments, Rp is at +3. In some embodiments, Rp is at +4. In some embodiments, Rp is at +5. In some embodiments, such Rp is a chiral controlled phosphorothioate internucleotide linkage configuration. In some embodiments, such Rp is present in the core region.

[0274] In some embodiments, the internucleotide linkage in the Sp configuration (having an Sp-bound phosphorus) is a phosphorothioate internucleotide linkage. In some embodiments, the achiral internucleotide linkage is a natural phosphate linkage. In some embodiments, the internucleotide linkage in the Rp configuration (having an Rp-bound phosphorus) is a phosphorothioate internucleotide linkage. In some embodiments, each internucleotide linkage in the Sp configuration is a phosphorothioate internucleotide linkage. In some embodiments, each achiral internucleotide linkage is a natural phosphate linkage. In some embodiments, each internucleotide linkage in the Rp configuration is a phosphorothioate internucleotide linkage. In some embodiments, each internucleotide linkage in the Sp configuration is a phosphorothioate internucleotide linkage, each achiral internucleotide linkage is a natural phosphate linkage, and each internucleotide linkage in the Rp configuration is a phosphorothioate internucleotide linkage. In some embodiments, the internucleotide linkage in the Rp configuration is a non-negatively charged internucleotide linkage (e.g., a neutral internucleotide linkage such as n001). In some embodiments, each chiral, non-negatively charged internucleotide linkage (e.g., a neutral internucleotide linkage such as n001) is Rp. In some embodiments, each n001 is Rp.

[0275] In some embodiments, an internucleotide linkage bonded to a wing nucleoside and a core nucleoside is considered to be one of the core internucleotide linkages, e.g., when describing the type, modification, number, and / or pattern of the core internucleotide linkages. In some embodiments, each internucleotide linkage bonded to a wing nucleoside and a core nucleoside is considered to be one of the core internucleotide linkages, e.g., when describing the type, modification, number, and / or pattern of the core internucleotide linkages. For example, in some embodiments, a core internucleotide linkage is bonded to two core nucleosides. In some embodiments, a core internucleotide linkage is bonded to a core nucleoside and a wing nucleoside. In some embodiments, each core internucleotide linkage is independently bonded to two core nucleosides or a core nucleoside and a wing nucleoside. In some embodiments, each wing internucleotide linkage is independently bonded to two wing nucleosides.

[0276] In some embodiments, the provided oligonucleotides in the chiral-controlled oligonucleotide composition, e.g., C9orf72 oligonucleotides, each contain a different type of internucleotide linkage. In some embodiments, the provided oligonucleotides contain at least one natural phosphate linkage and at least one modified internucleotide linkage. In some embodiments, the provided oligonucleotides contain at least one natural phosphate linkage and at least two modified internucleotide linkages. In some embodiments, the provided oligonucleotides contain at least one natural phosphate linkage and at least three modified internucleotide linkages. In some embodiments, the provided oligonucleotides contain at least one natural phosphate linkage and at least four modified internucleotide linkages. In some embodiments, the provided oligonucleotides contain at least one natural phosphate linkage and at least five modified internucleotide linkages. In some embodiments, the provided oligonucleotides contain at least one natural phosphate linkage and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more modified internucleotide linkages. In some embodiments, the modified internucleotide linkage is a phosphorothioate internucleotide linkage. In some embodiments, the modified internucleotide linkage is a phosphorothioate internucleotide linkage. In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the modified internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the modified internucleotide linkage is n001. In some embodiments, each modified internucleotide linkage is independently a phosphorothioate or a neutral internucleotide linkage. In some embodiments, each modified internucleotide linkage is independently a phosphorothioate or n001. In some embodiments, provided oligonucleotides comprise at least one natural phosphate linkage and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive modified internucleotide linkages. In some embodiments, provided oligonucleotides contain at least one natural phosphate linkage and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive phosphorothioate internucleotide linkages.

[0277] In some embodiments, the modified linkage comprises a chiral auxiliary, which is used, for example, to control the stereoselectivity of a reaction, for example, a coupling reaction in an oligonucleotide synthesis cycle.

[0278] internucleotide bond In some embodiments, the oligonucleotide comprises a base modification, a sugar modification, and / or an internucleotide linkage modification. Various internucleotide linkages can be utilized in accordance with the present disclosure to link nucleobase-containing units, e.g., nucleosides. In some embodiments, a C9orf72 oligonucleotide comprises both one or more modified internucleotide linkages and one or more natural phosphate linkages. As is well known by those skilled in the art, natural phosphate linkages are widely found in natural DNA and RNA molecules; they have the structure -OP(O)(OH)O-, link sugars in nucleosides in DNA and RNA, and can exist in various salt forms; for example, at physiological pH (about 7.4), natural phosphate linkages exist primarily in the salt form, with the anion being -OP(O)(O - )O-. A modified internucleotide linkage or non-natural phosphate linkage is an internucleotide linkage that is neither a natural phosphate linkage nor a salt form thereof. A modified internucleotide linkage can also be in its salt form depending on its structure. For example, as will be understood by those skilled in the art, a phosphorothioate internucleotide linkage having the structure -OP(O)(SH)O- can be in various salt forms, for example, at physiological pH (about 7.4), and the anion is -OP(O)(S - )O-.

[0279] In some embodiments, the oligonucleotide comprises a modified internucleotide linkage, for example, an internucleotide linkage that is a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-thiophosphate, or 5'-thiophosphate.

[0280] In some embodiments, the modified internucleotide linkage is a chiral internucleotide linkage comprising a chiral linking phosphorus. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage. In some embodiments, the chiral internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the chiral internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the chiral internucleotide linkage is chiral controlled with respect to its chiral linking phosphorus. In some embodiments, the chiral internucleotide linkage is stereochemically pure with respect to its chiral linking phosphorus. In some embodiments, the chiral internucleotide linkage is not chiral controlled. In some embodiments, the pattern of backbone chiral centers comprises or consists of chiral controlled internucleotide linkage (Rp or Sp) positions and linking phosphorus configurations and achiral internucleotide linkage (e.g., natural phosphate) positions.

[0281] In some embodiments, the oligonucleotide is a compound of the formula (I) or (II) as described in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,598,458, U.S. Patent No. 9,982,257, U.S. Patent No. 10,160,969, U.S. Patent No. 10,479,995, U.S. Patent Application Publication No. 2020 / 0056173, U.S. Patent Application Publication No. 2018 / 0216107, U.S. Patent Application Publication No. 2019 / 012 7733, U.S. Patent No. 10,450,568, U.S. Patent Application Publication No. 2019 / 0077817, U.S. Patent Application Publication No. 2019 / 0249173, U.S. Patent Application Publication No. 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2018 / 223082, WO 2018 / 223084, WO 2018 / 223086, WO 2018 / 223088, WO 2018 / 223089, WO 2018 / 223090, WO 2018 / 223091, WO 2018 / 223092, WO 2018 / 223094, WO 2018 / 223096, WO 2018 / 223098, WO 2018 / 223099, WO 2018 / 223099, WO 2018 / 223091, WO 2018 / 223096, WO 2018 / 223097, WO 2018 / 22309 ...1, WO 2018 / 2230 Modified internucleotide linkages (e.g., Formula I, Ia, Ib or Ic, In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-c-3, II-c-4, II-c-5, II-c-6, II-c-7, II-c-8, II-c-9, II-c-10, II-c-11, II-c-12, II-c-13, II-c-14, II-c-15, II-c-16, II-c-17, II-c-18, II-c-19, II-c-21, II-c-19, II-c-22, II-c-19, II-c-19, II-c-23, II-c-19, II-c-24, II-c-19, II-c-25, II-c-19, II-c-26, II-c-19, II-c-27, II-c-19, II-c-28, II-c-19, II-c-29, II-c-19, II-c-29, II-c-19, II-c-21, II-c-22, II-c-19, II-c-23, II-c-19, II-c-24, II-c-19, II-c-25, II-c-19, II-c-26, II-c-19, II-c-27, II-c-19, II-c-28, II-c-19, II-c-29 ... In some embodiments, the oligonucleotide comprises a modified internucleotide linkage having the structure II-d-1, II-d-2, II-d-1, II-d-2, etc., or a salt form thereof, each of which internucleotide linkages (e.g., those of Formula I, Ia, Ib or Ic, In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc.) is independently incorporated herein by reference. In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the provided oligonucleotide comprises one or more non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage is a positively charged internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the present disclosure provides oligonucleotides comprising one or more neutral internucleotide linkages.In some embodiments, the non-negatively charged internucleotide linkage or neutral internucleotide linkage (e.g., one of the formulas In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc.) may be any of the following: U.S. Pat. No. 9,394,333; U.S. Pat. No. 9,744,183; U.S. Pat. No. 9,605,019; U.S. Pat. No. 9,598,458; U.S. Pat. No. 9,982,257; U.S. Pat. No. 10,160,969; U.S. Pat. No. 10,479,995; U.S. Patent Application Publication No. 2020 / 0056173; U.S. Patent Application Publication No. 2018 / 0216107; U.S. Patent Application Publication No. 2019 / 02 ... No. 10,450,568, U.S. Patent Application Publication No. 2019 / 0077817, U.S. Patent Application Publication No. 2019 / 0249173, U.S. Patent Application Publication No. 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612. In some embodiments, the non-negatively charged or neutral internucleotide linkage is one of formulas In-1, In-2, In-3, In-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc., as described in WO 2018 / 223056, WO 2019 / 032607, WO 2019 / 075357, WO 2019 / 032607, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, and / or WO 2019 / 032612, each such internucleotide linkage being independently incorporated herein by reference.

[0282] In some embodiments, non-negatively charged internucleotide linkages may improve the delivery and / or activity (e.g., ability to reduce the level, activity and / or expression of a target gene or its gene product, selectivity, etc.) of the oligonucleotide.

[0283] In some embodiments, the non-negatively charged internucleotide linkage has the structure -OP(=W)(-N=C(R'')2)-O- or -OP(=W)(-N(R'')2)-O-, wherein: W is O or S; each R″ is independently R′ or —N(R′)2; each R' is independently -R, -C(O)R, -C(O)OR, or -S(O)R; Each R is independently -H or C 1~30 Aliphatic, C with 1-10 heteroatoms 1~30 Heteroaliphatic, C 6~30 Aryl, C 6~30 Arylaliphatic, C with 1-10 heteroatoms 6~30 an optionally substituted group selected from arylheteroaliphatic, 5-30 membered heteroaryl having 1-10 heteroatoms, and 3-30 membered heterocyclyl having 1-10 heteroatoms, or: The two R groups optionally and independently combine to form a covalent bond or: Two or more R groups on the same atom optionally and independently, together with that atom, form an optionally substituted 3-30 membered monocyclic, bicyclic, or polycyclic ring having 0-10 heteroatoms in addition to that atom, or: Two or more R groups on two or more atoms optionally and independently, together with their intervening atoms, form an optionally substituted 3-30 membered monocyclic, bicyclic, or polycyclic ring having 0-10 heteroatoms in addition to the intervening atoms.

[0284] In some embodiments, W is O. In some embodiments, W is S.

[0285] In some embodiments, R" is R'. In some embodiments, R" is -N(R')2.

[0286] In some embodiments, the non-negatively charged internucleotide linkage has the structure -OP(=O)(-N=C(N(R')2)2-O-. In some embodiments, the R' group of one N(R')2 is R and the R' group of the other N(R')2 is R, and the two R groups together with their intervening atoms form an optionally substituted ring, e.g., a 5-membered ring as in n001. In some embodiments, each R' is independently R, where each R is independently an optionally substituted C 1~6 It is aliphatic.

[0287] In some embodiments, the non-negatively charged internucleotide linkage has the structure -OP(=W)(-N(R')2)-O-.

[0288] In some embodiments, R' is R. In some embodiments, R' is H. In some embodiments, R' is -C(O)R. In some embodiments, R' is -C(O)OR. In some embodiments, R' is -S(O)R.

[0289] In some embodiments, R'' is -NHR'. In some embodiments, -N(R')2 is -NHR'.

[0290] As described herein, in some embodiments, R is H. In some embodiments, R is optionally substituted C 1~6 In some embodiments, R is an optionally substituted C 1~6 In some embodiments, R is alkyl. In some embodiments, R is methyl. In some embodiments, R is substituted methyl. In some embodiments, R is ethyl. In some embodiments, R is substituted ethyl. .

[0291] In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage, as described herein.

[0292] In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the modified internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the provided oligonucleotide comprises one or more non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage is a positively charged internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an optionally substituted triazolyl. In some embodiments, the modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an optionally substituted alkynyl. In some embodiments, the modified internucleotide linkage comprises a triazole or alkyne moiety. In some embodiments, the triazole moiety (e.g., a triazolyl group) is optionally substituted. In some embodiments, the triazole moiety (e.g., a triazolyl group) is substituted. In some embodiments, the triazole moiety is unsubstituted. In some embodiments, the modified internucleotide linkage comprises an optionally substituted cyclic guanidine moiety. In some embodiments, the modified internucleotide linkage comprises an optionally substituted cyclic guanidine moiety, and [ka] wherein W is O or S. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, the non-negatively charged internucleotide linkage is stereochemically controlled.

[0293] In some embodiments, the internucleotide linkage, e.g., a non-negatively charged internucleotide linkage, a neutral internucleotide linkage, comprises a cyclic guanidine moiety. In some embodiments, the internucleotide linkage comprising a cyclic guanidine moiety is [ka] In some embodiments, the non-negatively charged or neutral internucleotide linkage has the structure: [ka] wherein W is O or S.

[0294] In some embodiments, the internucleotide linkage is [ka] In some embodiments, the internucleotide linkage comprises a Tmg group, and [ka] ("Tmg internucleotide linkage") In some embodiments, neutral internucleotide linkages include PNA and PMO internucleotide linkages and Tmg internucleotide linkages.

[0295] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1-10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1-10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the heterocyclyl or heteroaryl group is a 5-membered ring. In some embodiments, the heterocyclyl or heteroaryl group is a 6-membered ring.

[0296] In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heteroaryl group having 1 to 10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heteroaryl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 6-membered heteroaryl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heteroaryl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the heteroaryl group is directly bonded to the linking phosphorus. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heterocyclyl group having 1 to 10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 20-membered heterocyclyl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5- to 6-membered heterocyclyl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises an optionally substituted 5-membered heterocyclyl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, At least two heteroatoms are nitrogen. In some embodiments, the heterocyclyl group is directly bonded to the phosphorus linkage. In some embodiments, the heterocyclyl group is bonded to the phosphorus linkage via a linker, for example, via =N- in the case of a heterocyclyl group that is part of a guanidine moiety directly bonded to the phosphorus linkage at its =N-. In some embodiments, the non-negatively charged internucleotide linkage is optionally substituted. [ka] In some embodiments, the non-negatively charged internucleotide linkage comprises a substituted [ka] In some embodiments, the non-negatively charged internucleotide linkage comprises a group: [ka] In some embodiments, each R 1 are independently optionally substituted C 1~6 In some embodiments, each R 1 is independently methyl.

[0297] In some embodiments, the oligonucleotides contain different types of internucleotide phosphorus linkages. In some embodiments, chiral controlled oligonucleotides contain at least one natural phosphate linkage and at least one modified (non-natural) internucleotide linkage. In some embodiments, the oligonucleotides contain at least one natural phosphate linkage and at least one phosphorothioate. In some embodiments, the oligonucleotides contain at least one non-negatively charged internucleotide linkage. In some embodiments, the oligonucleotides contain at least one natural phosphate linkage and at least one non-negatively charged internucleotide linkage. In some embodiments, the oligonucleotides contain at least one phosphorothioate internucleotide linkage and at least one non-negatively charged internucleotide linkage. In some embodiments, the oligonucleotides contain at least one phosphorothioate internucleotide linkage, at least one natural phosphate linkage, and at least one non-negatively charged internucleotide linkage. In some embodiments, the oligonucleotide comprises one or more, e.g., 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more, non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkages are not negatively charged in that less than 50%, 40%, 40%, 30%, 20%, 10%, 5%, or 1% of the internucleotide linkages are present in negatively charged salt form in aqueous solution at a given pH. In some embodiments, the pH is about pH 7.4. In some embodiments, the pH is about pH 4-9. In some embodiments, the percentage is less than 10%. In some embodiments, the percentage is less than 5%. In some embodiments, the percentage is less than 1%. In some embodiments, the internucleotide bond is a non-negatively charged internucleotide bond in that the neutral form of the internucleotide bond has a pKa in water of not more than about 1, 2, 3, 4, 5, 6, or 7. In some embodiments, the pKa is not more than 7. In some embodiments, the pKa is not more than 6. In some embodiments, the pKa is not more than 5. In some embodiments, the pKa is not more than 4. In some embodiments, the pKa is not more than 3. In some embodiments, the pKa is not more than 2. In some embodiments, the pKa is not more than 1. In some embodiments, the pKa of the neutral form of the internucleotide bond can be represented by the pKa of a compound having the structure CH3-internucleotide bond-CH3 in its neutral form. For example, [ka] pKa of [ka] In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage is a positively charged internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage comprises a guanidine moiety. In some embodiments, the non-negatively charged internucleotide linkage comprises a heteroaryl base moiety. In some embodiments, the non-negatively charged internucleotide linkage comprises a triazole moiety. In some embodiments, the non-negatively charged internucleotide linkage comprises an alkynyl moiety.

[0298] In some embodiments, the oligonucleotide comprises different types of internucleotide phosphorus linkages. In some embodiments, the chiral controlled oligonucleotide comprises at least one natural phosphate linkage and at least one modified (non-natural) internucleotide linkage. In some embodiments, the oligonucleotide comprises at least one natural phosphate linkage and at least one phosphorothioate. In some embodiments, the oligonucleotide comprises at least one non-negatively charged internucleotide linkage. In some embodiments, the oligonucleotide comprises at least one natural phosphate linkage and at least one non-negatively charged internucleotide linkage.

[0299] Without wishing to be bound by any particular theory, the present disclosure points out that neutral internucleotide linkages can be more hydrophobic than phosphorothioate internucleotide linkages (PS), which are more hydrophobic than natural phosphate linkages (PO). Typically, unlike PS or PO, neutral internucleotide linkages have a low charge. Without wishing to be bound by any particular theory, the present disclosure points out that the incorporation of one or more neutral internucleotide linkages into an oligonucleotide can increase the ability of the oligonucleotide to be taken up by cells and / or escape from endosomes. Without wishing to be bound by any particular theory, the present disclosure points out that the incorporation of one or more neutral internucleotide linkages can be used to enhance the ability of an oligonucleotide to be taken up by cells and / or escape from endosomes. It should be noted that the melting temperature of the duplex formed with the target nucleic acid can be adjusted.

[0300] Without wishing to be bound by any particular theory, the present disclosure points out that incorporating one or more non-negatively charged internucleotide linkages, e.g., neutral internucleotide linkages, into an oligonucleotide may increase the ability of the oligonucleotide to mediate a function such as gene knockdown. In some embodiments, an oligonucleotide capable of mediating knockdown of the level of a nucleic acid or a product encoded thereby, e.g., a C9orf72 oligonucleotide, comprises one or more non-negatively charged internucleotide linkages. In some embodiments, an oligonucleotide capable of mediating knockdown of expression of a target gene comprises one or more non-negatively charged internucleotide linkages.

[0301] In some embodiments, the non-negatively charged internucleotide bond, for example, the neutral internucleotide bond, is not chiral controlled. In some embodiments, the non-negatively charged internucleotide bond is chiral controlled. In some embodiments, the non-negatively charged internucleotide bond is chiral controlled, and the linking phosphorus is Rp. In some embodiments, the non-negatively charged internucleotide bond is chiral controlled, and the linking phosphorus is Sp.

[0302] In many embodiments, as will be demonstrated in detail, the oligonucleotides of the present disclosure comprise two or more different internucleotide linkages. In some embodiments, the oligonucleotides comprise phosphorothioate internucleotide linkages and non-negatively charged internucleotide linkages. In some embodiments, the oligonucleotides comprise phosphorothioate internucleotide linkages, non-negatively charged internucleotide linkages, and natural phosphate linkages. In some embodiments, the non-negatively charged internucleotide linkages are neutral internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkages are n001. In some embodiments, each phosphorothioate internucleotide linkage is independently chiral controlled. In some embodiments, each chirally modified internucleotide linkage is independently chiral controlled.

[0303] In some embodiments, the non-negatively charged internucleotide linkage, e.g., the neutral internucleotide linkage, is not chiral controlled. In some embodiments, the non-negatively charged internucleotide linkage is chiral controlled. In some embodiments, the non-negatively charged internucleotide linkage is chiral controlled, and the linking phosphorus is Rp. In some embodiments, the non-negatively charged internucleotide linkage is chiral controlled, and the linking phosphorus is Sp.

[0304] A typical linkage, as in natural DNA and RNA, is an internucleotide bond forming a bond between two sugars (which can be either unmodified or modified as described herein). In many embodiments, as exemplified herein, the internucleotide bond forms a bond through its oxygen atom or heteroatom between one optionally modified ribose or deoxyribose at its 5' carbon and another optionally modified ribose or deoxyribose at its 3' carbon. In some embodiments, each nucleoside unit linked by an internucleotide bond independently comprises a nucleobase, which is independently an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.

[0305] As will be appreciated by those of skill in the art, many other types of internucleotide linkages can be utilized in accordance with the present disclosure, including, for example, those described in U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141 No. 5,235,033; No. 5,264,423; No. 5,264,564; No. 5,276,019; No. 5,278,302; No. 5,286,717; No. 5,321,131; No. 5,399 , No. 5,405,938; No. 5,405,939; No. 5,434,257; No. 5,453,496; No. 5,455,233; No. 5,466,677; No. 5,466,677; No. 5, No. 470,967; No. 5,476,925; No. 5,489,677; No. 5,519,126; No. 5,536,821; No. 5,541,307; No. 5,541,316; No. 5,550,111; Same No. 5,561,225; Same No. 5,563,253; Same No. 5,571,799; Same No. 5,587,361; Same No. 5,596,086; Same No. 5,602,240; Same No. 5,608,046; Same No. 5,610,28 No. 9; No. 5,618,704; No. 5,623,070; No. 5,625,050; No. 5,633,360; No. 5,64,562; No. 5,663,312; No. 5,677,437; No. 5,677 , No. 6,160,109; No. 6,239,265; No. 6,028,188; No. 6,124,445; No. 6,169,170; No. 6,172,209; No. 6,277,603; No. 6, 326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; or RE39464.In some embodiments, the modified internucleotide linkages are those described in U.S. Patent Nos. 9,394,333, 9,744,183, 9,605,019, 9,598,458, 9,982,257, 10,160,969, 10,479,995, U.S. Patent Application Publication No. 2020 / 0056173, 2018 / 0216107, 2019 / 0127733, 10,450,568, 2019 / 0077817, 2019 / 0249173, 2019 / 0375774, and / or WO 2019 / 032612, each of which is independently incorporated by reference in its entirety for purposes of describing nucleobases, sugars, internucleotide linkages, chiral auxiliaries / reagents, and techniques for oligonucleotide synthesis (reagents, conditions, cycles, etc.).

[0306] Various types of internucleotide linkages can be utilized in combination with other structural elements, e.g., sugars, to achieve desired oligonucleotide properties and / or activity. For example, the present disclosure routinely utilizes modified internucleotide linkages and modified sugars, optionally along with natural phosphate linkages and natural sugars, in designing oligonucleotides. In some embodiments, the present disclosure provides oligonucleotides comprising one or more modified sugars. In some embodiments, the present disclosure provides oligonucleotides comprising one or more modified sugars and one or more modified internucleotide linkages, at least one of which is a natural phosphate linkage.

[0307] Nucleic acid bases A variety of nucleobases can be utilized in the oligonucleotides provided according to the present disclosure. In some embodiments, the nucleobase is a natural nucleobase, the most commonly occurring of which are A, T, C, G, and U. In some embodiments, the nucleobase is a modified nucleobase that is not A, T, C, G, or U. In some embodiments, the nucleobase is an optionally substituted A, T, C, G, or U, or an A, T, C, G, or U. It is a substituted tautomer. In some embodiments, the nucleobase is optionally substituted A, T, C, G, or U, such as 5mC, 5-hydroxymethyl C, etc. In some embodiments, the nucleobase is alkyl-substituted A, T, C, G, or U. In some embodiments, the nucleobase is A. In some embodiments, the nucleobase is T. In some embodiments, the nucleobase is C. In some embodiments, the nucleobase is G. In some embodiments, the nucleobase is U. In some embodiments, the nucleobase is 5mC. In some embodiments, the nucleobase is a substituted A, T, C, G, or U. In some embodiments, the nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, the substitution protects certain functional groups in the nucleobase to minimize undesired reactions during oligonucleotide synthesis. Suitable techniques for nucleobase protection in oligonucleotide synthesis are widely known in the art and can be utilized in accordance with the present disclosure. In some embodiments, modified nucleobases improve the properties and / or activity of the oligonucleotide. For example, 5mC can often be utilized in place of C to modulate a particular undesired biological effect, e.g., immune response. In some embodiments, when determining sequence identity, substituted nucleobases having the same hydrogen bonding pattern are treated as the same as unsubstituted nucleobases, e.g., 5mC can be treated as the same as C (e.g., an oligonucleotide having 5mC in place of C (e.g., AT5mCG) is considered to have the same base sequence as an oligonucleotide having C at the corresponding position(s) (e.g., ATCG)).

[0308] In some embodiments, the oligonucleotide comprises one or more A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more optionally substituted A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxycytosine. In some embodiments, the oligonucleotide comprises one or more 5-methylcytidine. In some embodiments, each nucleobase in the oligonucleotide is selected from the group consisting of optionally substituted A, T, C, G, and U, and optionally substituted tautomers of A, T, C, G, and U. In some embodiments, each nucleobase in the oligonucleotide is optionally protected A, T, C, G, and U. In some embodiments, each nucleobase in the oligonucleotide is optionally substituted A, T, C, G, or U. In some embodiments, each nucleobase in the oligonucleotide is selected from the group consisting of A, T, C, G, U, and 5mC. In some embodiments, the nucleobase is hypoxanthine.

[0309] In some embodiments, the nucleobase is optionally substituted 2AP or DAP. In some embodiments, the nucleobase is optionally substituted 2AP. In some embodiments, the nucleobase is optionally substituted DAP. In some embodiments, the nucleobase is 2AP. In some embodiments, the nucleobase is DAP.

[0310] In some embodiments, the nucleobase is a natural nucleobase or a modified nucleobase derived from a natural nucleobase. Examples include uracil, thymine, adenine, cytosine and guanine, each of which optionally has its amino group protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine and pseudouracil, and other modified nucleobases, such as 8-substituted purine, xanthine or hypoxanthine (the latter two are natural degradation products). Specific examples of modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313. In some embodiments, the modified nucleobase is a substituted uracil, thymine, adenine, cytosine, or guanine. In some embodiments, the modified nucleobase is a substituted uracil, thymine, adenine, cytosine, or guanine. In some embodiments, the nucleic acid base is an optionally substituted uracil, thymine, adenine, cytosine, 5-methylcytosine, or guanine, for example, in hydrogen bonding and / or base pairing. In some embodiments, the nucleic acid base is an optionally substituted uracil, thymine, adenine, cytosine, 5-methylcytosine, or guanine. In some embodiments, the nucleic acid base is an optionally substituted uracil, thymine, adenine, cytosine, 5-methylcytosine, or guanine.

[0311] In some embodiments, the provided oligonucleotides contain one or more 5-methylcytosines. In some embodiments, the present disclosure provides oligonucleotides whose base sequences are disclosed herein, for example, in Table A1, wherein each T can be independently replaced with U, and vice versa. In some embodiments, in the provided oligonucleotides, one or more Cs are independently modified to 5mC. As will be understood by those skilled in the art, in some embodiments, 5mC can be treated as C in terms of the base sequence of the oligonucleotide, and such oligonucleotides contain nucleobase modifications at C positions (see, for example, various oligonucleotides in Table A1).

[0312] In some embodiments, the nucleobase is selected from the group consisting of U.S. Patent Nos. 9,394,333, 9,744,183, 9,605,019, 9,598,458, 9,982,257, 10,160,969, 10,479,995, U.S. Patent Application Publication No. 2020 / 0056173, 2018 / 0216107, 2019 / 0127733, 10,450,568, 2019 / 0077817, and 2019 / 0249173. , U.S. Patent Application Publication No. 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, each of which nucleobases is incorporated herein by reference.

[0313] sugar A variety of sugars, including modified sugars, can be utilized in accordance with the present disclosure. In some embodiments, the present disclosure provides sugar modifications and patterns thereof, optionally in combination with other structural elements (e.g., internucleotide linkage modifications and patterns thereof, patterns of backbone chiral centers thereof, etc.) that may provide improved properties and / or activity when incorporated into an oligonucleotide.

[0314] The most common naturally occurring nucleosides comprise a ribose sugar (e.g., in RNA) or a deoxyribose sugar (e.g., in DNA) linked to the nucleobases adenosine (A), cytosine (C), guanine (G), and thymine (T) or uracil (U). In some embodiments, the sugar, e.g., the various sugars in many of the oligonucleotides of Table A1 (unless otherwise noted), are: [ka] In a DNA nucleic acid or oligonucleotide, the nucleobase is attached at the 1' position, and the 3' and 5' positions are linked to internucleotide linkages (as will be understood by those skilled in the art, in the case of the 5' end of an oligonucleotide, the 5' position is In some embodiments, the sugar may be linked to a 3' terminal group (e.g., -OH), and in the case of the 3' end of the oligonucleotide, the 3' position may be linked to a 3' terminal group (e.g., -OH). [ka] in an RNA nucleic acid or oligonucleotide, wherein the nucleobase is attached at the 1' position and the 3' and 5' positions are linked to an internucleotide linkage (as will be understood by one of skill in the art, in the case of the 5' end of an oligonucleotide, the 5' position can be linked to the 5' terminal group (e.g., -OH), and in the case of the 3' end of an oligonucleotide, the 3' position can be linked to the 3' terminal group (e.g., -OH). In some embodiments, the sugar is a modified sugar that is not a natural...

Claims

1. 1. An oligonucleotide comprising at least one modification of a sugar, a base, or an internucleotide linkage, wherein the base sequence of said oligonucleotide is or comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is at least 80% identical to or complementary to a base sequence of a C9orf72 gene or a transcript thereof, and wherein a nucleobase on the 3' end of said oligonucleotide is optionally replaced by a replacement nucleobase selected from I, A, T, U, G, and C.

2. 2. The oligonucleotide of claim 1, comprising at least one modification of the sugar, base, or internucleotide bond, wherein the base sequence of the oligonucleotide comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is identical to or complementary to the base sequence of the C9orf72 gene or a transcript thereof.

3. 3. The oligonucleotide according to claim 2, wherein the base sequence of the oligonucleotide is ACTCACCCACTCGCCACCGC.

4. 4. The oligonucleotide of claim 3, wherein when administered to a system containing the C9orf72 transcript, the oligonucleotide reduces the level of a repeat expansion-containing C9orf72 transcript, wherein the repeat expansion-containing C9orf72 transcript contains at least 30, 50, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 GGGGCC repeats.

5. 5. The oligonucleotide of claim 4, wherein the reduction in the level of the repeat expansion-containing C9orf72 transcript, as measured by percentage, is at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5, 3, 4, 5, 6, 7, 8, 9 or 10 times greater than the reduction in the level of the non-repeat expansion-containing C9orf72 transcript, as measured by percentage.

6. 4. The oligonucleotide of claim 3, comprising or consisting of a 5'-wing-core-wing-3' structure, wherein each wing sugar independently comprises a 2'-OR modification, wherein R is an optionally substituted C 1~6 An oligonucleotide characterized in that it is aliphatic.

7. 7. The oligonucleotide of claim 6, wherein the 5'-wing comprises one or more phosphorothioate internucleotide linkages and one or more non-negatively charged internucleotide linkages.

8. 8. The oligonucleotide of claim 7, wherein the 3'-wing comprises one or more phosphorothioate internucleotide linkages and one or more non-negatively charged internucleotide linkages.

9. 9. The oligonucleotide of claim 8, wherein the 5'-wing and the 3'-wing each independently comprise 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases.

10. 10. The oligonucleotide of claim 9, wherein each core sugar independently contains two 2'-H.

11. 11. The oligonucleotide of claim 10, wherein the oligonucleotide or the core comprises: (Np)t[(Op / Rp)n(Sp)m]y (In the formula, t is 1 to 50; n is 1 to 10; m is 1 to 50; y is 1 to 10; Np is either Rp or Sp; Sp represents the S configuration of the chiral linking phosphorus of the chiral modified internucleotide linkage; Op represents the achiral linking phosphorus of the natural phosphate bond, and Rp represents the S configuration of the chiral linking phosphorus of the chiral modified internucleotide linkage; and y is 1 to 10. An oligonucleotide characterized in that it contains a pattern of backbone chiral centers (linked phosphorus) of:

12. 12. The oligonucleotide of claim 11, wherein each Np is an Sp.

13. 13. The oligonucleotide of claim 12, wherein the pattern is (Np)t[(Rp)n(Sp)m]y.

14. 14. The oligonucleotide of claim 13, wherein each n is 1.

15. 15. The oligonucleotide of claim 14, wherein y is 1.

16. 15. The oligonucleotide of claim 14, wherein y is 2.

17. 15. The oligonucleotide according to claim 14, wherein t is 2 or greater.

18. 15. The oligonucleotide according to claim 14, wherein t is 3 or greater.

19. 15. The oligonucleotide according to claim 14, wherein each m is independently 2 to 20.

20. mA * Sm5Ceo n001R Teo m5Ceo n001R mA * S C * S C * S C * R A * S C * S T * S m5C * S G * R m5C * S C * S mA * S mC n001R m5Ceo * S mG * S mC or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; n001R represents an Rp n001 bond, and the n001 bond is 【Chemical 1】 having the structure eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R represents an Rp phosphorothioate bond, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

21. mA * S m5Ceo n001R Teo m5Ceo n001R mA * S C * S C * S C * R A * S C * S T * S m5C * S G * R m5C * S C * S mA * S mC * S m5Ceo n001R mG * S mC or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; n001R represents an Rp n001 bond, and the n001 bond is 【Chemistry 2】 having the structure eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R has an Rp phosphorothioate linkage, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

22. mA * S m5Ceo n001R Teo m5Ceo n001R mA * S C * S C * S C * R A * S C * S T * S m5C * S G * R m5C * S C * S mA * S mC * S m5Ceo * S mG n001R mC or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; n001R represents an Rp n001 bond, and the n001 bond is 【Chemistry 3】 having the structure eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R represents an Rp phosphorothioate bond, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

23. mC * S m5Ceo Teo m5Ceo mA * S C * S T * S C * R A * S C * S C * R C * S A * S C * S T * S m5mC * S mG * S mC * S m5mC * S mG or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R represents an Rp phosphorothioate bond, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

24. mA * S m5Ceo Teo m5Ceo mA * S C * S C * S C * R A * S C * S T * S m5C * S G * R m5C * S C * S mA * S mC * S m5mC * S mG * S mC or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R represents an Rp phosphorothioate bond, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

25. mC * S m5Ceo Teo m5Ceo mA * S C * S T * S C * R A * S C * S C * R C * S A * S C * S T * S m5Ceo * S mG * S mC * S m5Ceo * S mG or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R represents an Rp phosphorothioate bond, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

26. mA * S m5Ceo Teo m5Ceo mA * S C * S C * S C * R A * S C * S T * S m5C * S G * R m5C * S C * S mA * S mC * S m5Ceo * S mG * S mC or a pharmaceutically acceptable salt thereof, wherein m represents a 2'-OMe modification to the nucleoside; * S represents an Sp phosphorothioate bond; m5Ceo represents 5-methyl 2'-O-methoxyethyl C; eo is 2'-OCH to nucleoside 2 CH 2 OCH 3 represents a modification, * R represents an Rp phosphorothioate bond, and An oligonucleotide or a pharmaceutically acceptable salt thereof, wherein m5 represents methyl at the 5-position of C.

27. The oligonucleotide according to any one of claims 1 to 26, which is in the form of a pharmaceutically acceptable salt.

28. 28. The oligonucleotide of any one of claims 1 to 27, wherein the nucleobase on the 3' end of the oligonucleotide is optionally replaced by a different nucleobase selected from I, A, T, U, G and C.

29. 29. The oligonucleotide of any one of claims 1 to 28, wherein each phosphorothioate internucleotide linkage in the oligonucleotide independently has a diastereomeric purity of at least 90%, 95%, 96%, 97%, 98% or 99%.

30. a) a common base sequence; b) common backbone bonding patterns; c) Pattern of common skeletal chiral centers In an oligonucleotide composition comprising a plurality of oligonucleotides having the levels of the plurality of oligonucleotides in the composition are non-random; and A composition, wherein each of the plurality of oligonucleotides is independently an oligonucleotide according to any one of claims 1 to 28 or a salt form thereof. In an oligonucleotide composition comprising a plurality of oligonucleotides, the plurality of oligonucleotides have the same composition, said plurality of oligonucleotides share the same linkage phosphorus stereochemistry at one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) chiral-controlled internucleotide linkages; the composition is enriched for oligonucleotides of a particular oligonucleotide type compared to a substantially racemic preparation of oligonucleotides having the same common base sequence; and A composition characterized in that the plurality of oligonucleotides are each independently an oligonucleotide or a salt form thereof according to any one of claims 1 to 28. In an oligonucleotide composition comprising a plurality of oligonucleotides, the plurality of oligonucleotides have the same composition, said plurality of oligonucleotides share the same linkage phosphorus stereochemistry at one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) chiral-controlled internucleotide linkages; At each chiral controlled internucleotide linkage, at least 90%, 95%, 96%, 97%, 98%, or 99% of all nucleotides in the composition sharing the same configuration share the same bond phosphorus stereochemistry; and A composition, wherein the plurality of oligonucleotides are each independently an oligonucleotide or a salt form thereof according to any one of claims 1 to 28.

31. 31. The composition of claim 30, wherein 1-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of all oligonucleotides in the composition that share the same base sequence as the particular type of oligonucleotide or the plurality of oligonucleotides. or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) of the specific type of oligonucleotide or the plurality of oligonucleotides are accumulated.

32. 32. The composition of claim 30 or 31, wherein the plurality of oligonucleotides share the same bond phosphorus stereochemistry at at least five internucleotide linkages.

33. 33. The composition of claim 32, wherein said plurality of oligonucleotides independently share the same linkage phosphorus stereochemistry at each phosphorothioate internucleotide linkage.

34. 34. The composition of claim 33, wherein the plurality of oligonucleotides independently share the same linkage phosphorus stereochemistry at each chiral internucleotide linkage.

35. 35. The composition of claim 34, wherein the plurality or types of oligonucleotides share the same structure.

36. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently an oligonucleotide of claim 20.

37. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently the oligonucleotide of claim 21.

38. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently an oligonucleotide of claim 22.

39. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently an oligonucleotide of claim 23.

40. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently an oligonucleotide of claim 24.

41. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently an oligonucleotide of claim 25.

42. 32. The composition of claim 31, wherein the plurality of oligonucleotides are each independently an oligonucleotide of claim 26.

43. 43. The composition of any one of claims 35 to 42, wherein each oligonucleotide is independently in a salt form.

44. A pharmaceutical composition comprising or delivering an oligonucleotide or composition according to any one of claims 1 to 43, and comprising a pharmaceutically acceptable carrier.

45. 45. A method comprising administering to a subject suffering from or susceptible to a condition, disorder and / or disease associated with a C9orf72 expanded repeat an effective amount of the oligonucleotide or composition of any one of claims 1 to 44.

46. 46. ​​The method of claim 45, wherein the condition, disorder and / or disease is amyotrophic lateral sclerosis (ALS).

47. 46. ​​The method of claim 45, wherein the condition, disorder and / or disease is frontotemporal dementia (FTD).

48. A method for reducing the activity, expression and / or level of a C9orf72 target gene or its gene product in a cell, comprising introducing into said cell an oligonucleotide or composition according to any one of claims 1 to 44.

49. 45. A method for reducing foci in a population of cells, comprising contacting said cells with an oligonucleotide or composition according to any one of claims 1 to 44.

50. 50. The method of claim 49, wherein the percentage of cells having foci is reduced.

51. 51. The method of claim 49 or 50, wherein the number of foci per cell is reduced.

52. 45. A method for preferentially knocking down repeat-expansion-containing C9orf72 RNA transcripts relative to non-repeat-expansion-containing C9orf72 RNA transcripts in a cell, comprising contacting a cell containing the repeat-expansion-containing C9orf72 RNA transcript and the non-repeat-expansion-containing C9orf72 RNA transcript with the oligonucleotide or composition of any one of claims 1 to 44, the oligonucleotide comprises a sequence that is present in or complementary to a sequence within the repeat-expansion-containing C9orf72 RNA transcript; The method, wherein the oligonucleotide directs preferential knockdown of repeat expansion-containing C9orf72 RNA transcripts relative to non-repeat expansion-containing C9orf72 RNA transcripts in a cell.

53. 149. A compound, oligonucleotide, composition or method according to any one of embodiments 1 to 148.