Detection kit and detection method for aquatica lateralis, and aquatica lateralis habitat survey method
The detection kit and method using a primer set for Heike fireflies' mitochondrial DNA amplification enable efficient and specific detection, addressing the inefficiencies of existing methods and facilitating habitat investigation.
Patent Information
- Application Number
- JP2024030499
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-29
- Publication Date
- 2025-09-10
AI Technical Summary
Existing methods for detecting Heike fireflies are inefficient and lack specificity, and there is a need for a comprehensive method to investigate their habitats.
A detection kit and method using a primer set that amplifies a specific region in the mitochondrial DNA of Heike fireflies, comprising a first primer with SEQ ID NO: 1 and a second primer with SEQ ID NO: 2, along with nucleic acid amplification and analysis steps to detect and quantify Heike fireflies in environmental samples.
Enables efficient and specific detection of Heike fireflies, allowing for habitat investigation and population estimation, overcoming the limitations of previous detection methods.
Smart Images

Figure 2025132736000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to a Heike firefly detection kit, a detection method, and a Heike firefly habitat survey method. [Background technology]
[0002] The Heike firefly (scientific name: Luciola lateralis) is a species of aquatic firefly that lives in various parts of Japan.
[0003] Because fireflies grow in clean water, they are attracting attention as an indicator organism of a rich environment. However, in areas with such a rich environment, road construction or the development of a final disposal site could threaten the habitat of the local organisms. Conserving an environment in which fireflies can thrive would provide a place of relaxation for local residents and lead to the creation of a habitat for the diverse organisms in the surrounding environment, so there is a need to conserve such an environment.
[0004] The most common method for investigating firefly habitats is to observe the nighttime glow of flying fireflies, but this has the drawback of being limited in terms of both the time and duration. Additionally, because fireflies spend a long period as larvae in water, it is possible to conduct a larval survey. However, this would require experts to collect and capture them, which would take time and effort to fully understand.
[0005] Therefore, research is being conducted into a simple and efficient method for investigating whether a specific species of firefly is present in an area by collecting environmental samples (soil, water, etc.) from areas where fireflies are predicted to live, performing a nucleic acid amplification reaction (PCR) using nucleic acid extracted from the collected samples as a template, and analyzing the amplified products.
[0006] As such a method for detecting fireflies, for example, Patent Document 1 discloses a method for detecting fireflies, which includes a primer set for amplifying nucleic acid derived from the Genji firefly, the primer set consisting of a first primer and a second primer capable of specifically amplifying a predetermined region of the cytochrome oxidase subunit I (CO1) sequence in mitochondrial DNA, a nucleic acid amplification step of carrying out a nucleic acid amplification reaction using nucleic acid extracted from any sample as a template using the primer set, and an analysis step of analyzing the amplified product from the nucleic acid amplification reaction. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] Japanese Patent Publication No. 2020-195346 Summary of the Invention [Problem to be solved by the invention]
[0008] However, the technology capable of specifically detecting Heike fireflies has not been fully established.
[0009] An object of the present invention is to provide a detection kit and detection method that can detect Heike fireflies that inhabit Japan, and a method for investigating the habitat of Heike fireflies. [Means for solving the problem]
[0010] The inventors have conducted extensive research and discovered that by using a detection kit containing a primer set that amplifies a specific region in the mitochondrial DNA of Heike fireflies in a nucleic acid amplification reaction, it is possible to comprehensively detect Heike fireflies that inhabit a specific region from an environmental sample, and have completed the present invention.
[0011] (1) A first aspect of the present invention is a kit for detecting Heike fireflies, characterized by including a primer set for amplifying nucleic acid derived from Heike fireflies, the primer set consisting of a first primer containing the base sequence of SEQ ID NO: 1 and a second primer containing the base sequence of SEQ ID NO: 2.
[0012] (2) A second aspect of the present invention is a method for detecting fireflies, characterized by comprising a nucleic acid amplification step of carrying out a nucleic acid amplification reaction using nucleic acids extracted from an environmental sample as a template using the detection kit described in (1), and an analysis step of analyzing the amplification products of the nucleic acid amplification reaction.
[0013] (3) A third aspect of the present invention is a method for investigating the habitat of Heike fireflies, characterized by using the detection method described in (2). [Effects of the Invention]
[0014] According to the present invention, it is possible to provide a detection kit, a detection method, and a method for investigating the habitat of Heike fireflies that can detect Heike fireflies that inhabit Japan. [Brief explanation of the drawings]
[0015] [Figure 1] 1 is a graph showing the quantitative results of a nucleic acid amplification reaction using the detection kit of the present invention. [Figure 2] 1 is a graph showing the quantitative results of a nucleic acid amplification reaction in a control experiment. DETAILED DESCRIPTION OF THE INVENTION
[0016] Hereinafter, a mode for carrying out the present invention (hereinafter simply referred to as "the present embodiment") will be described in detail. The following present embodiment is an example for explaining the present invention, and is not intended to limit the present invention to the following content. The present invention can be carried out by appropriately modifying it within the scope of its gist.
[0017] <Firefly detection kit> The Heike firefly detection kit according to this embodiment is a detection kit including a primer set for amplifying nucleic acid derived from Heike firefly (scientific name: Luciola lateralis).
[0018] The Heike firefly detection kit may contain, in addition to the primer set of the present invention, a DNA extraction reagent, a nucleic acid amplification reaction (PCR etc.) reagent, a nucleic acid amplification reaction product detection reagent, and the like. The primer set will be described in detail below.
[0019] (primer set) The primer set of the present invention is a primer set for amplifying nucleic acid derived from the firefly (scientific name: Luciola lateralis), and consists of the following two primers: (1) a first primer containing the nucleotide sequence of SEQ ID NO: 1 (5'-TCGTGCTGAGTAGGAAACCC-3'); (2) a second primer containing the nucleotide sequence of SEQ ID NO: 2 (5'- AGATAGAGAAGGGGGTAGAAGTCA -3')
[0020] The primer set of the present invention is used in a nucleic acid amplification reaction to specifically amplify a predetermined region of the cytochrome oxidase subunit I (CO1) sequence in the mitochondrial DNA of the firefly. The base sequence length of the amplification product obtained in a nucleic acid amplification reaction using the primer set of the present invention is typically approximately 220 bp. However, this value may vary due to nonspecific base insertions or deletions that occur during the nucleic acid amplification reaction.
[0021] The nucleic acid to be amplified using the primer set of the present invention is DNA. The primers constituting the primer set of the present invention can be synthesized by any known method for synthesizing oligonucleotides.
[0022] (first primer) The first primer containing the nucleotide sequence of SEQ ID NO: 1 (hereinafter also referred to simply as "first primer") corresponds to a forward primer (sense primer) in a nucleic acid amplification reaction. The first primer may consist of the nucleotide sequence of SEQ ID NO: 1, or may have a total of 1 to 30 bases added to the 5'-end and / or 3'-end of the nucleotide sequence of SEQ ID NO: 1, but preferably consists of the nucleotide sequence of SEQ ID NO: 1. The bases added to the nucleotide sequence of SEQ ID NO: 1 can be appropriately designed based on the nucleotide sequence of CO1 of the firefly, the predicted Tm value of the resulting primer, etc.
[0023] (Second primer) The second primer containing the nucleotide sequence of SEQ ID NO: 2 (hereinafter also referred to simply as "second primer") corresponds to a reverse primer (antisense primer) in a nucleic acid amplification reaction. The second primer may consist of the nucleotide sequence of SEQ ID NO: 2, or may have a total of 1 to 30 bases added to the 5'-end and / or 3'-end of the nucleotide sequence of SEQ ID NO: 2, but preferably consists of the nucleotide sequence of SEQ ID NO: 2. The bases added to the nucleotide sequence of SEQ ID NO: 2 can be appropriately designed based on the nucleotide sequence of CO1 of the firefly, the predicted Tm value of the resulting primer, etc.
[0024] <How to detect fireflies> The detection method of the present invention includes a nucleic acid amplification step of performing a nucleic acid amplification reaction using the primer set of the present invention and nucleic acid extracted from an environmental sample as a template, and an analysis step of analyzing the amplified product from the nucleic acid amplification reaction.
[0025] (Nucleic acid amplification step) The nucleic acid amplification step is a step in which nucleic acid extracted from an environmental sample is used as a template to carry out a nucleic acid amplification reaction using the primer set of the present invention to obtain an amplification product of a predetermined region of CO1 of the firefly. The nucleic acid used as a template is usually DNA.
[0026] In the present invention, the "environmental sample" is not particularly limited, and may be a sample collected by any method from any environment (waterside, breeding tank, etc.). Examples of such samples include water, soil, bottom mud, excrement, carcasses (adults, larvae, etc.), molting shells, pupal chambers, eggs, etc.
[0027] The method for extracting nucleic acids from a sample is not particularly limited, and conventionally known nucleic acid extraction methods can be used. For example, nucleic acid extraction can be performed using a phenol / chloroform / isoamyl alcohol (e.g., phenol:chloroform:isoamyl alcohol (mass ratio) = 25:24:1) solution or a commercially available kit. The extracted nucleic acid can also be appropriately concentrated by filtration or other methods.
[0028] As the nucleic acid amplification reaction, a conventionally known nucleic acid amplification method can be used, for example, polymerase chain reaction (PCR). In the nucleic acid amplification reaction, a buffer, four types of bases (dNTPs), an enzyme (such as DNA polymerase), a probe, and the like can be used in addition to the primer set of the present invention and a nucleic acid serving as a template.
[0029] The conditions for the nucleic acid amplification reaction can be appropriately set depending on the type of enzyme used, etc., and are usually performed by appropriately setting the temperature and time, and repeating cycles consisting of denaturation, annealing, and extension. Furthermore, the amplified product obtained by the nucleic acid amplification reaction may be appropriately purified.
[0030] (Analysis process) A specific region of CO1 of Heike fireflies can be specifically amplified by a nucleic acid amplification reaction. For example, even if nucleic acid derived from an organism other than Heike fireflies (such as a Genji firefly) is used, the desired amplification product (usually about 220 bp) cannot be obtained by the nucleic acid amplification reaction. Taking advantage of this fact, Heike fireflies can be detected by analyzing whether the amplification product obtained in the nucleic acid amplification step is an amplification product of the specific region of CO1 of Heike fireflies.
[0031] In the present invention, "detecting Heike fireflies" means determining whether Heike fireflies were present in the area where the sample to be analyzed was collected. For example, if the target amplification product (usually about 220 bp) is obtained in the analysis step, it can be determined that Heike fireflies were present in the area where the sample was collected. Furthermore, by quantifying the amplification product in the analysis step, the population of Heike fireflies in the area where the sample was collected can be estimated.
[0032] The method for analyzing the amplification product can be any method that can determine the presence or absence of the target amplification product, identify the sequence of the amplification product, quantify the amount of nucleic acid (e.g., DNA) in the amplification product, etc. Examples of such methods include electrophoresis, sequence analysis of base sequences, and quantitative PCR.
[0033] Electrophoresis is a method in which the amplified product is electrophoresed on an agarose gel or the like, and then the gel is stained to determine whether or not the target amplified product (usually about 220 bp) is present. Furthermore, sequence analysis is a method for identifying the base sequence of an amplified product. Examples of sequence analysis methods include the Sanger method and a method using a next-generation sequencer. The base sequence thus identified is queried using a base sequence database (e.g., NCBI's BLAST), and if the sequence identity with the base sequence of the Genji firefly is high (e.g., sequence identity is preferably 95 to 100%, more preferably 97 to 100%), it can be determined that the desired amplified product has been obtained.
[0034] Quantitative PCR (such as real-time PCR) is a method of quantifying amplification products by measuring fluorescence intensity simultaneously with a nucleic acid amplification reaction using a fluorescent probe or SYBR Green. This method corresponds to a method in which the nucleic acid amplification step and the analysis step are performed simultaneously. Preferred fluorescent probes used in quantitative PCR include those modified by the Hypercool method (Nihon Gene Research Institute).
[0035] In quantitative PCR, a preferred probe that can be used with the primer set of the present invention includes one containing the base sequence set forth in SEQ ID NO: 3 (5'-GCTCCCGATATAGCTTTCCCACGA -3'). This probe may have a fluorescent substance attached to the 5' end and a quencher attached to the 3' end. An example of such a fluorescent probe is "5'-FAM-CCACTATCCACGGARCCAA-FAM -3'" ("FAM" stands for fluorescein, a fluorescent substance, and "BHQ" stands for black hole quencher).
[0036] It is preferable that the base sequence described in SEQ ID NO: 3 is a so-called double quencher probe, in which another type of quencher is added to the probe between the 9th and 10th nucleotide residues. In double quencher probes, an internal quencher such as a ZEN (trademark) quencher or a TAO (trademark) quencher is added between the base sequences, which increases the quenching effect within the probe, reducing the background level and increasing the sensitivity of signal detection.
[0037] <Method of investigating the habitat of Heike fireflies> Furthermore, as a method for investigating the habitat of fireflies, by detecting fireflies using the detection method of the present invention, it is possible to estimate whether fireflies are present in the area where the sample was collected, where the fireflies have pupated, and whether fireflies have laid eggs. Furthermore, it is also possible to evaluate whether the area where the sample was collected is suitable for the growth of fireflies.
[0038] Although the present invention has been described above using embodiments, it goes without saying that the technical scope of the present invention is not limited to the scope described in the above embodiments. It will be apparent to those skilled in the art that various modifications and improvements can be made to the above embodiments. Furthermore, it is clear from the claims that such modifications and improvements can also be included within the technical scope of the present invention. [Example]
[0039] The present invention will be described in detail below with reference to examples, but the present invention is not limited to the examples shown below.
[0040] (template DNA) The DNA of the firefly was artificially synthesized. As a control experiment, an artificial CO1 gene from the midge insect Chironomidae sp. (MG066867), which is likely to inhabit the same area as the firefly, was used.
[0041] (Primer set design) The primer set used consisted of a forward primer, a reverse primer, and a (forward) probe designed according to the sequences shown in Table 1. In the "Forward probe" listed in Table 1, "FAM" stands for fluorescein, a fluorescent substance, and "ZEN" and "IBFQ" stand for double quencher probes. [Table 1]
[0042] (Quantitative PCR) Quantitative PCR was performed using the template DNA and primer set described above under the reaction conditions shown in Table 3 and the reaction solution composition shown in Table 2. The PCR reagent used was TaqMan® Environmental Master Mix 2.0 (ThermoFisher), as described in the official manual of the Environmental DNA Society. The LightCycler® Uracil-DNA Glycosylase used was a reagent from Roche, and the PCR reaction conditions shown in Table 3 were determined by referring to the instructions for each reagent. [Table 2]
[0043] [Table 3]
[0044] Table 4 shows the Cq values at each concentration as a result of quantitative PCR for DNA derived from Heike firefly. Table 5 also shows the results of quantitative PCR for DNA derived from chironomids. [Table 4]
[0045] [Table 5]
[0046] The quantitative results in Tables 4 and 5 are shown in graph form in Figures 1 and 2, respectively.
[0047] As shown in Table 4 and FIG. 1, DNA derived from Heike firefly was successfully amplified by quantitative PCR using the primer set included in the detection kit of the present invention.
[0048] On the other hand, as shown in Table 5 and Figure 2, DNA derived from chironomids was not amplified by quantitative PCR using the primer set included in the detection kit of the present invention at concentrations used in normal PCR. This demonstrates that DNA derived from Heike firefly can be specifically amplified by quantitative PCR using the primer set included in the detection kit of the present invention.
[0049] From the above examples, it has been confirmed that the present invention can provide a detection kit, a detection method, and a method for investigating the habitat of Heike fireflies that can detect Heike fireflies that inhabit Japan.
Claims
1. A kit for detecting fireflies, characterized by including a primer set for amplifying nucleic acid derived from the Genji firefly, the primer set consisting of a first primer containing the base sequence of SEQ ID NO: 1 and a second primer containing the base sequence of SEQ ID NO:
2.
2. a nucleic acid amplification step of carrying out a nucleic acid amplification reaction using the detection kit according to claim 1 and nucleic acid extracted from an environmental sample as a template; and an analysis step of analyzing the amplification product obtained by the nucleic acid amplification reaction.
3. A method for investigating the habitat of fireflies, comprising using the detection method according to claim 2.
Citation Information
Patent Citations
Primer set, method for detecting luciola cruciata, and kit for detecting luciola cruciata
JP2020195346A