NUCLEIC ACID APTAMER HAVING BINDING ABILITY TO SARS-CoV-2

Abstract

To provide an aptamer that binds to an S protein of SARS-CoV-2 omicron variant.SOLUTION: Provided is a nucleic acid aptamer having binding ability to SARS-CoV-2, where the nucleic acid aptamer includes a single strand oligonucleotide having a nucleotide as a constitutional unit, the single strand oligonucleotide includes a loop region, a 3' stem region bonded to a 3' terminal of the loop region, and a 5' stem region bonded to a 5' terminal of the loop region, the base number of the loop region is 16 to 50 mer, the base number of the 3' stem region is 5 mer or more, the base number of the 5' stem region is 5 mer or more, and the 3' stem region and the 5' stem region have mutually complementary base sequences.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to a nucleic acid aptamer capable of binding to SARS-CoV-2. [Background technology]

[0002] Emerging infectious diseases caused by novel viruses tend to be difficult to diagnose and treat due to a lack of knowledge about the causative virus and its symptoms. COVID-19, caused by SARS-CoV-2 (the novel coronavirus), rapidly spread from an outbreak in Wuhan, China, to a pandemic. SARS-CoV-2 uses spike proteins on the surface of the virus particle to bind to ACE2 on the surface of human cells as a viral receptor, invading and destroying the cells. This cell destruction causes symptoms such as fever, dry cough, and fatigue, and in severe cases, pneumonia and even death. Even after recovery, it has been reported that there is a certain frequency of aftereffects, resulting in significant limitations on social activities. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] International Publication No. 2022 / 038521 Summary of the Invention [Problem to be solved by the invention]

[0004] In order to prevent the spread of SARS-CoV-2 infection, development of virus detection agents is underway. For example, International Publication No. 2022 / 038521 (Patent Document 1) discloses a composition comprising nanoparticles detachably bound to a DNA aptamer capable of binding to the spike protein (hereinafter sometimes referred to as "S protein") of SARS-CoV-2, wherein the DNA aptamer has a predetermined base sequence (Claim 1).

[0005] However, while the DNA aptamer disclosed in Patent Document 1 can specifically detect the S protein of the novel coronavirus, it has the problem of being difficult to distinguish between mutant strains. In particular, there has been a demand for the development of an aptamer that can bind to the S protein of the Omicron strain.

[0006] The present invention has been made in consideration of the above circumstances, and aims to provide a nucleic acid aptamer that binds to the S protein of the novel coronavirus Omicron strain. [Means for solving the problem]

[0007] As a result of intensive research, the inventors discovered that a nucleic acid aptamer having a specific base sequence can bind to the S protein of the novel coronavirus Omicron strain, and thus completed the present invention.

[0008] A first aspect of the present invention is a nucleic acid aptamer capable of binding to SARS-CoV-2, comprising: The nucleic acid aptamer comprises a single-stranded oligonucleotide having nucleotides as building blocks, the single-stranded oligonucleotide comprises a loop region, a 3' stem region linked to the 3' end of the loop region, and a 5' stem region linked to the 5' end of the loop region; the number of bases in the loop region is 16 to 50 mer, the number of bases in the 3' stem region is 5 mer or more, the number of bases in the 5' stem region is 5 mer or more, the 3' stem region and the 5' stem region have complementary base sequences, The base sequence of the loop region is a nucleotide sequence having 80% or more and 100% or less sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156; A base sequence comprising at least a 15-mer consecutive base sequence in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, or These functional sequences, Includes.

[0009] A second aspect of the present invention is a kit for detecting SARS-CoV-2, comprising: The nucleic acid aptamer of the first aspect is included.

[0010] A third aspect of the present invention is a detection agent for SARS-CoV-2, comprising: The nucleic acid aptamer of the first aspect is included.

[0011] A fourth aspect of the present invention is a kit for diagnosing infection with SARS-CoV-2, comprising: The nucleic acid aptamer of the first aspect is included.

[0012] A fifth aspect of the present invention is a method for detecting SARS-CoV-2, comprising: applying the nucleic acid aptamer of the first aspect to a test sample; detecting the nucleic acid aptamer bound to the test sample; Includes. [Effects of the Invention]

[0013] According to the present invention, it is possible to provide a nucleic acid aptamer that binds to the S protein of the novel coronavirus Omicron strain. [Brief explanation of the drawings]

[0014] [Figure 1] 1 is a schematic diagram showing an example of the structure of a nucleic acid aptamer according to this embodiment, in which white circles indicate nucleotides in the loop region and hatched circles indicate nucleotides in the stem region. [Figure 2] FIG. 2 is a schematic diagram showing the procedure of the SELEX method. [Figure 3] 3 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. [Figure 4] 4 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. [Figure 5A] 5A is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by FACS. [Figure 5B] Figure 5B is a graph showing the binding ability of each nucleic acid aptamer to S protein. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the relative fluorescence intensity value determined by FACS. The relative fluorescence intensity value is relative to the fluorescence intensity for S protein used in selection from the nucleic acid aptamer library, which is set to 100. [Figure 6] 6 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. [Figure 7] FIG. 7 is a schematic diagram showing the procedure of the SELEX method. [Figure 8] 8 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. [Figure 9] 9 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. [Figure 10] FIG. 10 is a photograph showing the results of the dot blotting method. [Figure 11]11 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. [Figure 12] 12 is a schematic diagram showing an example of a motif in the loop region of a nucleic acid aptamer according to this embodiment. The larger the alphabet representing the base, the more highly conserved the base is. [Figure 13] 13 is a graph showing the binding ability of each nucleic acid aptamer to protein S. The horizontal axis shows the name of the nucleic acid aptamer sample, and the vertical axis shows the average fluorescence intensity determined by the FACS method. DETAILED DESCRIPTION OF THE INVENTION

[0015] An embodiment of the present invention (hereinafter referred to as "this embodiment") will be described below. However, this embodiment is not limited to this. In this specification, the notation in the format "A to Z" means the upper and lower limits of a range (i.e., A or more and Z or less), and when no unit is specified for A and a unit is specified only for Z, the unit of A and the unit of Z are the same.

[0016] <Nucleic acid aptamer capable of binding to SARS-CoV-2> The first aspect of this embodiment is A nucleic acid aptamer having binding ability to SARS-CoV-2, The nucleic acid aptamer comprises a single-stranded oligonucleotide having nucleotides as building blocks, the single-stranded oligonucleotide comprises a loop region, a 3' stem region linked to the 3' end of the loop region, and a 5' stem region linked to the 5' end of the loop region; the number of bases in the loop region is 16 to 50 mer, the number of bases in the 3' stem region is 5 mer or more, the number of bases in the 5' stem region is 5 mer or more, the 3' stem region and the 5' stem region have complementary base sequences, The base sequence of the loop region is a nucleotide sequence having 80% or more and 100% or less sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156; A base sequence comprising at least a 15-mer consecutive base sequence in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, or These functional sequences, Includes:

[0017] In this embodiment, "nucleic acid aptamer" refers to a nucleic acid molecule that can specifically bind to a target molecule (e.g., the S protein of SARS-CoV-2) with high affinity. A nucleic acid aptamer can detect a target molecule by specifically binding to the target molecule. The nucleic acid that constitutes the nucleic acid aptamer is not particularly limited and may be, for example, DNA, RNA, modified nucleic acid, etc., and the nucleic acid aptamer can be constituted by only one type of these or a combination of two or more types. Therefore, the nucleic acid aptamer in this embodiment may be a DNA aptamer, an RNA aptamer, a DNA / RNA chimeric nucleic acid aptamer, or an aptamer that contains a modified nucleic acid as a part of these. Preferably, the nucleic acid aptamer is a DNA aptamer.

[0018] <Single-stranded oligonucleotide> The single-stranded oligonucleotide according to this embodiment has nucleotides as its constituent units. Here, "oligonucleotide" refers to a nucleotide polymer in which approximately 2 to 40 identical or different nucleotides are linked together via phosphodiester bonds. Examples of nucleic acid bases contained in the nucleotides include adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). The nucleotides may include not only natural nucleotides but also non-natural nucleotides. The single-stranded oligonucleotide according to this embodiment is usually in the form of a single strand.

[0019] As used herein, modified nucleic acid refers to a nucleic acid composed of non-natural nucleotides or a non-natural nucleic acid. Here, "non-natural nucleotide" refers to a nucleotide containing a base or sugar that has been subjected to an artificial chemical modification that does not occur in nature, and that has properties / structures similar to those of natural nucleotides. Various non-natural nucleotides are known, including, for example, abasic nucleosides, arabinonucleosides, 2'-deoxyuridine, α-deoxyribonucleosides, β-L-deoxyribonucleosides, and non-natural nucleotides containing nucleosides with other sugar modifications (e.g., substituted pentasaccharides (2'-O-methylribose, 2'-deoxy-2'-fluororibose, 3'-O-methylribose, 1',2'-deoxyribose), arabinose, substituted arabinose sugars, substituted hexose sugars, α-anomeric sugars, etc.). Furthermore, the non-natural nucleotide referred to herein may be a nucleotide containing a base analog or a modified base. Examples of base analogs include 2-oxo(1H)-pyridin-3-yl groups, 5-substituted-2-oxo(1H)-pyridin-3-yl groups, 2-amino-6-(2-thiazolyl)purin-9-yl groups, 2-amino-6-(2-thiazolyl)purin-9-yl groups, and 2-amino-6-(2-oxazolyl)purin-9-yl groups. Examples of modified bases include modified pyrimidines (e.g., 5-hydroxycytosine, 5-fluorouracil, 4-thiouracil), modified purines (e.g., 6-methyladenine, 6-thioguanosine), and other heterocyclic bases. As used herein, the term "non-natural nucleic acid" refers to a nucleic acid analog having a non-naturally occurring artificial chemical modification introduced into its backbone, which has properties / structures similar to those of natural nucleic acids. Examples of non-natural nucleic acids include peptide nucleic acids (PNAs), peptide nucleic acids with phosphate groups (PHONAs), cross-linked nucleic acids, morpholino nucleic acids, triazole-linked nucleic acids, etc. Examples include methylphosphonate-type DNA / RNA, phosphorothioate-type DNA / RNA, phosphoramidate-type DNA / RNA, 2'-O-methyl-type DNA / RNA, etc.

[0020] In one aspect of this embodiment, the single-stranded oligonucleotide may contain a phosphorothioate-modified nucleic acid as a building block.

[0021] The single-stranded oligonucleotide comprises a loop region, a 3' stem region linked to the 3' end of the loop region, and a 5' stem region linked to the 5' end of the loop region (top panel of Figure 1).

[0022] The 3' stem region and the 5' stem region have complementary base sequences. Therefore, the single-stranded oligonucleotide forms a double helix structure in the 3' stem region and the 5' stem region, forming a so-called hairpin loop structure (sometimes referred to as a "hairpin structure" or a "stem-loop structure") (lower part of Figure 1). In one aspect of this embodiment, the base sequence of the loop region is preferably not complementary to the base sequences of the 3' stem region and the 5' stem region. Whether the single-stranded oligonucleotide forms a hairpin loop structure can be determined by calculating the free energy change using, for example, mfold and estimating the secondary structure.

[0023] In one aspect of this embodiment, the loop region may contain a cross-linked nucleic acid as a building block. Bridged nucleic acids include BNA (Bridged Nucleic Acid) and 2',4'-BNA (also known as LNA (Locked Nucleic Acid)) and their analogs (e.g., amino-LNA, thio-LNA, α-L-oxy-LNA, ENA (2'-O,4'-C-Ethylene-bridged Nucleic Acid), AmNA (Amido-bridged Nucleic Acid), GuNA (Guanidine-bridged Nucleic Acid), scpBNA (2'-O,4'-C-spirocyclopropylene-bridged Nucleic Acid), cEt-BNA (Constrained Ethyl-bridged Nucleic Acid), 3'-amino-2',4'-BNA, 5'-amino-2',4'-BNA, PrNA (2'-O,4'-C-Propylene-bridged Nucleic Acid), 2',4'-BNA C (2'-O,4'-C-aminomethylene-bridged nucleic acid), 2',4'-BNAC OC (2'-O,4'-C-methyleneoxymethylene-bridged nucleic acid), etc.) can be used. The proportion of the bridged nucleic acid contained in the loop region is not particularly limited, and may be, for example, 50% or more, 70% or more, 80% or more, 90% or more, or 100% based on the number of bases in the loop region.

[0024] The number of bases in the loop region is 16 to 50 mer, preferably 19 to 41 mer, and more preferably 21 to 31 mer.

[0025] The number of bases in the 3' stem region is 5 mer or more, preferably 5 to 20 mer, and more preferably 7 to 14 mer.

[0026] The number of bases in the 5' stem region is 5 mer or more, preferably 5 to 20 mer, and more preferably 7 to 14 mer.

[0027] The 3' stem region and the 5' stem region may be the same length or may be different lengths.

[0028] Examples of the nucleotide sequence of the 3' stem region include the nucleotide sequences set forth in SEQ ID NO: 2, SEQ ID NO: 167, and SEQ ID NO: 169. Examples of the 5' stem region include the nucleotide sequences set forth in SEQ ID NO: 1, SEQ ID NO: 166, and SEQ ID NO: 168.

[0029] In one aspect of this embodiment, the total number of bases in the single-stranded oligonucleotide is preferably 26 to 90 mer, and more preferably 30 to 41 mer.

[0030] In one aspect of this embodiment, the 3' stem region and the 5' stem region have complementary base sequences. In this case, the base sequence of the 3' stem region is preferably 100% complementary to the base sequence of the 5' stem region, but may contain mismatches or bulges, as long as the 3' stem region and the 5' stem region can form a double strand. That is, the 3' stem region and the 5' stem region may contain mismatches or bulges.

[0031] In one aspect of this embodiment, the base sequence of the loop region is (A) a nucleotide sequence having 80% or more and 100% or less sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156; (B) a nucleotide sequence comprising at least a 15-mer consecutive nucleotide sequence in any one of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156; or (C) These functional base sequences, Includes:

[0032] In this embodiment, "sequence identity" refers to the percentage (%) of identical bases relative to the total overlapping base sequence in the optimal alignment when two base sequences are aligned using a mathematical algorithm known in the art. The algorithm preferably takes into account the introduction of gaps into one or both of the sequences for optimal alignment. The "sequence identity" of a base sequence can be easily confirmed by those skilled in the art. For example, NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) can be used.

[0033] The base sequence of the loop region may have 90% or more and 100% or less sequence identity, 95% or more and 100% or less sequence identity, 96% or more and 100% or less sequence identity, 97% or more and 100% or less sequence identity, 98% or more and 100% or less sequence identity, 99% or more and 100% or less sequence identity, or 100% sequence identity, to the base sequence set forth in any of SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156.

[0034] In this embodiment, the base sequence of the loop region may comprise a contiguous base sequence of 13-mer and 18-mer in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, or may comprise a contiguous base sequence of 15-mer and 17-mer in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156.

[0035] In this embodiment, a "functional base sequence" refers to a base sequence that is conserved among multiple similar base sequences and is presumed to be functional. Examples of functional base sequences include base sequences having the following motifs (e.g., Figure 12). In the base sequences of the following motifs, "N" indicates any nucleotide (e.g., A, G, T, or C). "(T / C)" indicates T or C. Motif sequence ANCGGNTTGTNC(T / C)CTCNNNNN (SEQ ID NO: 157) NAATCGNNTGTTCNNTCAGN (SEQ ID NO: 158) AATCGNNTTGTTCNNTCAG (SEQ ID NO: 159) CGGNTTGTNCNCTCGNNNAAC (SEQ ID NO: 160) NNNNNCGNNTTGTNCNNTCAN (SEQ ID NO: 161) NNNNNNNGGNTTGTTCNCNCN (SEQ ID NO: 162) NNNCGNNTTGTTCNNTCNNNN (SEQ ID NO: 163)

[0036] The nucleic acid aptamer has the ability to bind to SARS-CoV-2, preferably the spike protein (S protein) of SARS-CoV-2. In one aspect of this embodiment, the nucleic acid aptamer can also be understood to have the ability to bind to the Omicron strain of SARS-CoV-2. Examples of the Omicron strain include the Omicron BA.2 strain, the Omicron BA.5 strain, the XBB.1.5 strain, and the BQ.1 strain.

[0037] In one aspect of this embodiment, the nucleic acid aptamer may have the ability to bind to the S protein of the BA.2 strain of SARS-CoV-2. The nucleic acid aptamer may have the ability to bind to the S protein of the BA.5 strain of SARS-CoV-2. Furthermore, the nucleic acid aptamer may have the ability to bind to the S protein of the BA.2 strain and the S protein of the BA.5 strain of SARS-CoV-2.

[0038] "Binding ability to SARS-CoV-2" can be evaluated, for example, by the method described in the Examples. If a nucleic acid aptamer to be evaluated has a significantly higher affinity for SARS-CoV-2 compared to its affinity for a negative control (e.g., BSA), the nucleic acid aptamer can be determined to have binding ability to SARS-CoV-2.

[0039] In one aspect of this embodiment, the nucleic acid aptamer may have the ability to bind to the Omicron strain of SARS-CoV-2 and may also have the ability to bind to other variants of SARS-CoV-2, such as the Wuhan strain, alpha strain, beta strain, gamma strain, and delta strain.

[0040] The nucleic acid aptamer may have a labeling molecule bound to its 5'-end or 3'-end. Examples of labeling molecules include fluorescent molecules, gold nanoparticles, and quantum dots. Examples of fluorescent molecules include 5-carboxyfluorescein (5-FAM), 6-carboxyfluorescein (6-FAM), Fluorescein, Alexa Fluor (registered trademark), Cy2, Cy3, Cy5, and TAMRA. Examples of gold nanoparticles include Gold Nanoparticles (product name) manufactured by Cytodiagnostics. Examples of quantum dots include CdSe / CdS core-shell type quantum rods (product name) manufactured by Merck.

[0041] In one aspect of this embodiment, the base sequence of the loop region is a nucleotide sequence having 80% or more and 100% or less sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, 150 to 152, 155, and 156; A base sequence comprising at least a 15-mer consecutive base sequence in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, 150 to 152, 155, and 156, or These functional sequences, Including, It is preferable that the antibody has the ability to bind to the S protein of the BA.2 strain of SARS-CoV-2.

[0042] In another aspect of this embodiment, the base sequence of the loop region is A base sequence having 80% to 100% sequence identity to any of the base sequences set forth in SEQ ID NOs: 153 to 156; A base sequence comprising at least a 15-mer continuous base sequence in any of the base sequences set forth in SEQ ID NOs: 153 to 156, or These functional sequences, Including, It is preferable that the antibody has the ability to bind to the S protein of the BA.5 strain of SARS-CoV-2.

[0043] In another aspect of this embodiment, the base sequence of the loop region is A nucleotide sequence having 80% to 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 155 or SEQ ID NO: 156; A base sequence comprising at least a 15-mer continuous base sequence in the base sequence set forth in SEQ ID NO: 155 or SEQ ID NO: 156, or These functional sequences, Including, It is preferable that the antibody has the ability to bind to the S protein of the BA.2 strain and the S protein of the BA.5 strain of SARS-CoV-2.

[0044] The base sequence of the loop region may have 90% or more and 100% or less sequence identity, 95% or more and 100% or less sequence identity, 96% or more and 100% or less sequence identity, 97% or more and 100% or less sequence identity, 98% or more and 100% or less sequence identity, 99% or more and 100% or less sequence identity, or 100% sequence identity, to the base sequence set forth in any of SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156.

[0045] In this embodiment, the base sequence of the loop region may comprise a contiguous base sequence of 13-mer and 18-mer in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, or may comprise a contiguous base sequence of 15-mer and 17-mer in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156.

[0046] <Method for producing nucleic acid aptamer> The nucleic acid aptamer according to this embodiment can be produced by known methods. The single-stranded oligonucleotide can be produced, for example, by solid-phase synthesis using the phosphoramidite method. Specifically, a single-stranded oligonucleotide having a predetermined base sequence is first synthesized on a solid support using a commercially available automated nucleic acid synthesizer. Next, the synthesized single-stranded oligonucleotide is cleaved from the solid support using a basic substance or the like, and deprotected to obtain a crude single-stranded oligonucleotide. The crude single-stranded oligonucleotide obtained is then purified using HPLC or the like.

[0047] Thereafter, if necessary, the labeling molecule may be bound to the obtained single-stranded oligonucleotide using a known chemical modification method. Chemical modification with a labeling molecule can be performed appropriately by those skilled in the art. Examples of the chemical modification method include a carboxy group-amino group crosslinking method and a click reaction crosslinking method. In this manner, the nucleic acid aptamer is synthesized.

[0048] SARS-CoV-2 detection kit A second aspect of this embodiment is A kit for detecting SARS-CoV-2, comprising: The nucleic acid aptamer of the first aspect is included. The embodiment of the nucleic acid aptamer is as described above.

[0049] The above-mentioned SARS-CoV-2 detection kit may further include one or more items selected from the group consisting of a buffer solution, magnetic beads bound to S protein, a sample tube, a microplate, a sensor chip, and an instruction manual for the user of the kit.

[0050] <SARS-CoV-2 detection agent> A third aspect of this embodiment is A detection agent for SARS-CoV-2, The nucleic acid aptamer of the first aspect is included. The embodiment of the nucleic acid aptamer is as described above.

[0051] The detection agent may be in a solid state or a liquid state, and may further include a buffer solution.

[0052] <SARS-CoV-2 infection diagnostic kit> A fourth aspect of this embodiment is A diagnostic kit for SARS-CoV-2 infection, The nucleic acid aptamer of the first aspect is included. The embodiment of the nucleic acid aptamer is as described above.

[0053] The above-mentioned SARS-CoV-2 infection diagnosis kit may further comprise one or more items selected from the group consisting of a buffer solution, magnetic beads bound to S protein, a sample tube, a microplate, a sensor chip, and an instruction manual for the user of the kit.

[0054] <<How to detect SARS-CoV-2>> A fifth aspect of this embodiment is A method for detecting SARS-CoV-2, comprising: applying the nucleic acid aptamer of the first aspect to a test sample; detecting the nucleic acid aptamer bound to the test sample; Includes: The embodiment of the nucleic acid aptamer is as described above.

[0055] <Step of applying nucleic acid aptamer to test sample> In this step, the nucleic acid aptamer of the first embodiment is applied to a test sample. The method for applying the nucleic acid aptamer is not particularly limited, but it is preferably applied to the test sample in the form of a solution (for example, dissolved in PBS). The concentration of the nucleic acid aptamer is not particularly limited, but may be, for example, 0.1 nM to 200 nM, or 1 nM to 10 nM. The time for applying the nucleic acid aptamer is not particularly limited, but may be, for example, 5 to 120 minutes, or 30 to 60 minutes. The temperature at which the nucleic acid aptamer is applied is not particularly limited, but may be, for example, 20°C to 33°C, 20°C to 25°C, or 25°C to 30°C.

[0056] <Step of detecting nucleic acid aptamers> In this step, the nucleic acid aptamer bound to the test sample is detected. The method of applying the nucleic acid aptamer is not particularly limited, and for example, FACS method, ELISA method, etc. can be used. For example, the nucleic acid aptamer can be detected by the method described in the Examples.

[0057] In one aspect of this embodiment, multiple types of nucleic acid aptamers may be applied to the test sample and each of the nucleic acid aptamers may be detected. By comparing the binding levels (detection amounts) of the multiple types of aptamers, it becomes possible to estimate the subspecies of the Omicron strain.

[0058] In this case, the combination of nucleic acid aptamers may be, for example, the combination of four types of nucleic acid aptamers shown as omi-41, BA2-3, BA5-7 and XBB15-3 in the Examples described below.

[0059] In one aspect of this embodiment, the detection method can estimate the subspecies of the Omicron strain based on the binding ratio of each of multiple types of nucleic acid aptamers. [Example]

[0060] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0061] <Experiment 1: Identification of nucleic acid aptamers capable of binding to SARS-CoV-2> A nucleic acid aptamer for the SARS-CoV-2 Wuhan strain S protein (aa14-1213) (hereinafter referred to as the "Wuhan S protein") was obtained using the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method (Figure 2). Details are as follows.

[0062] His-tagged Wuhan S protein (Thermofisher) (hereinafter sometimes referred to as "His-Wuhan S protein") was bound to His-binding magnetic beads (Thermo Fisher Scientific, 10103D) and washed with binding buffer (10 mM Tris / HCl pH 7.4, 150 mM NaCl, 1 mM MgCl, tRNA). Then, a chemically synthesized nucleic acid library (N17, N18, N19, N20, N21, N21, N23, N25, N27, N29, or N31) was incubated with the His-Wuhan S protein-bound magnetic beads in binding buffer at room temperature (25°C) for 1 hour. The magnetic beads were then washed three times with binding buffer and eluted at 98°C for 3 minutes to recover the nucleic acids bound to the His-Wuhan S protein. N-Rev and NF primers were used in the amplification step, and five cycles of selection were performed. After selection, the base sequences of the amplified aptamers were analyzed using an Illumina MiSeq. From the resulting sequences of 5 to 10 million reads (several hundred thousand sequences per sample), the base sequences of arbitrary candidate aptamers (hereinafter sometimes referred to as "candidate aptamer sequences") were selected based on the selection criteria of "base sequences in clusters with similar sequences" and "highly abundant base sequences." The candidate aptamer sequences were chemically synthesized, and the binding ability of the candidate aptamers to the Wuhan S protein was examined in Experiment 2 below. The base sequences of the nucleic acid library and primer sequences are shown below. The base sequences of the loop regions of the selected candidate aptamers are shown in Tables 2-1, 2-2, 3-1, and 3-2. Note that Apt5-s1 in Table 2-1 is a minimized aptamer derived from a conventionally known nucleic acid aptamer (Apt5) (Anal. Chem. 2020, 92, 14, 9895) and corresponds to a comparative example.

[0063] Nucleic acid library sequence (5' stem region - loop region - 3' stem region) 5' stem region: Pair 1 sequence shown in Table 1 Loop region: Random base sequence of 19mer to 23mer 3' stem region: Pair 1 sequence shown in Table 1 Primer sequence N-Rev: (GCGGAGAGGCTCTCACACGCCAGCAGAAGA) (SEQ ID NO: 164) NF: (GTGGAGAGGTTCTTACACGTCGGCGGAAGA) (SEQ ID NO: 165)

[0064] [Table 1]

[0065] [Table 2-1]

[0066] [Table 2-2]

[0067] [Table 3-1]

[0068] [Table 3-2]

[0069] <Experiment 2: Evaluation of the binding ability of candidate aptamers> The binding ability of the candidate aptamers obtained in Experiment 1 was evaluated using FACS. Specifically, first, candidate aptamers (final concentration 200 nM) conjugated with the fluorescent molecule FAM (5-Carboxyfluorescein) were added to magnetic beads bound to His-Wuhan S protein and incubated for 1 hour at room temperature. The magnetic beads were then washed three times with the above binding buffer and measured using a flow cytometer (BD Accuri C6 plus, manufactured by Beckman Coulter). The amount of aptamer bound per magnetic bead was calculated from the detected fluorescence intensity. The results are shown in Figures 3 and 4. Figure 3 is a graph showing the binding ability of candidate aptamers obtained from libraries N17 to N21, and Figure 4 is a graph showing the binding ability of candidate aptamers obtained from libraries N21 to N31. Here, the "N21 library" refers to a library of nucleic acid aptamers with a 21-mer loop region. The same applies to the N31 library. In FIG. 3, "Beads" shows the results when magnetic beads to which S protein is not bound were used, and corresponds to the negative control.

[0070] The results in Figure 3 indicate that nucleic acid aptamers with binding affinities equal to or greater than Apt5S were obtained from the N21-N31 library (Sp2302-12, Sp2302-28, Sp2302-31, Sp2302-33, Sp2302-36, and Sp2302-41). In particular, Sp2302-33 (hereinafter sometimes referred to as "Sp-33") was the nucleic acid aptamer with the highest binding affinities. The results in Figure 4 indicate that repeated screening yielded nucleic acid aptamers with binding affinities higher than Sp-33 (Sp2301-15, Sp2301-26, Sp2301-44, Sp2301-46, and Sp2301-47). In particular, Sp2301-15 (hereinafter sometimes referred to as "Sp-15") was the nucleic acid aptamer with the highest binding ability.

[0071] <Experiment 3: Verification of the binding specificity of Sp-33 and Sp-15> To verify the binding specificity of Sp-33 and Sp-15, their binding ability to various proteins was evaluated. The evaluation method was the same as in Experiment 2, except that the proteins listed below were each bound to magnetic beads. The base sequences of the nucleic acid aptamers used in Experiment 3 are shown in Table 4.

[0072] [Table 4]

[0073] Protein bound to magnetic beads Negative control proteins: trypsin (Fujifilm Wako Pure Chemical Corporation), RNase A (Fujifilm Wako Pure Chemical Corporation), Vhh antibody (VHH), casein (Fujifilm Wako Pure Chemical Corporation), bovine serum albumin (BSA) (Fujifilm Wako Pure Chemical Corporation), streptavidin (SA) (Roche Diagnostics), influenza HA protein (flu) (Sino Biological Co., Ltd., 40702-V08H), EGFR (Sino Biological Co., Ltd., 10001-H08H), protein A (Fujifilm Wako Pure Chemical Corporation). Here, proteins without His-tags were bound to magnetic beads using NHS-Beads (Thermo Fisher). Positive control proteins: Wuhan S protein (Wuhan) (Thermofisher), Omicron BA.2 strain S protein (Omicron or BA.2) (Acro Biosystems, S1N-C52Hx), Delta strain S protein (delta) (Acro Biosystems, S1N-C52Hu) (hereinafter sometimes referred to as "delta S protein").

[0074] The results of Experiment 3 are shown in Figures 5A, 5B, and 6. In Figures 5A, 5B, and 6, Apt5 and MSA52 are conventionally known nucleic acid aptamers (Anal. Chem. 2020, 92, 14, 9895-9900; Chemistry. 2022, 28(15):e202200078.) and correspond to comparative examples.

[0075] The results in Figures 5A and 5B show that Sp-15 specifically binds to the Wuhan S protein. The results in Figure 6 show that Sp-15 and Sp-33 specifically bind not only to the Wuhan S protein, but also to the omicron S protein and delta S protein.

[0076] <Experiment 4: Identification of nucleic acid aptamers capable of binding to SARS-CoV-2> A nucleic acid aptamer for the S protein of the Omicron strain of SARS-CoV-2 (hereinafter sometimes referred to as "Omicron-type S protein") was obtained by the SELEX method (Figure 7). The procedure was the same as in Experiment 1, except that the Wuhan-type S protein was replaced with the Omicron-type S protein (Acro Biosystems, product name: SARS-CoV-2, Spike S1, His Tag (BA.2.12.1 / Omicron) (S1N-C52Hx)) and the libraries of N21, N23, N25, and N27 were used. The base sequences of the loop regions of the candidate aptamers obtained in Experiment 4 are shown in Tables 5-1 and 5-2.

[0077] [Table 5-1]

[0078] [Table 5-2]

[0079] <Experiment 5: Evaluation of the binding ability of candidate aptamers> The binding ability of the candidate aptamers obtained in Experiment 1 was evaluated using FACS. The procedure was the same as in Experiment 2, except that the Wuhan S protein was replaced with the Omicron S protein (Acro Biosystems, product name: SARS-CoV-2, Spike S1, His Tag (BA.2.12.1 / Omicron) (S1N-C52Hx)). The results are shown in Figure 8. The results in Figure 8 indicate that nucleic acid aptamers with high binding ability to the Omicron S protein were obtained from the N21, N23, N25, and N27 libraries (omi-5, omi-8, omi-11, omi-16, omi-22, omi-39 to omi-43, omi-45, omi-47, and omi-48). In particular, omi-41 was the nucleic acid aptamer with the highest binding ability.

[0080] <Experiment 6: Verification of binding specificity of Omi-8, etc.> To verify the binding specificity of omi-8, omi-16, omi-22, omi-39 to omi-43, omi-47, and omi-48, we evaluated their binding ability to various proteins. The evaluation method was the same as in Experiment 2, except that the proteins listed below were each bound to magnetic beads. The results are shown in Figure 9.

[0081] Protein bound to magnetic beads Negative control proteins: influenza HA protein (flu) (Sino Biological Co., Ltd., 40702-V08H), human EGFR (EGFR) (Sino Biological Co., Ltd., 10001-H08H) Positive control proteins: Wuhan strain S protein (Wuhan), Omicron BA.2 strain S protein (Omicron) (Acro Biosystems, S1N-C52Hx), Delta strain S protein (delta) (Acro Biosystems, S1N-C52Hu)

[0082] The results in Figure 9 indicate that omi-8, omi-16, omi-22, omi-39 to omi-43, omi-47, and omi-48 specifically bind to the S protein of SARS-CoV-2 (Omicron BA.2 strain).

[0083] <Experiment 7: Evaluation of binding by dot blot> The binding activity of Sp-15 and Omi-41 was evaluated by dot blotting. The specific procedure is as follows: 2 μl (7 μM) of each protein was dot blotted onto a nitrocellulose membrane, air-dried, and then blocked for 1 hour with the following binding buffer: Binding buffer (HEPES pH 6.5-pH 7.5, 150 mM NaCl, 10 mM MgCl2, 5 mM KCl, 0.01% Tween-20) + 1% BSA + 100 μg / ml tRNA). Aptamer was added to a final concentration of 200 nM and allowed to stand for 1 hour. The membrane was washed three times with binding buffer (BSA and tRNA-free), air-dried, and then UV cross-linked. Next, the cells were blocked with PBS-T (PBS with 0.1% Tween-20) + 5% skim milk for 30 minutes, then HRP-Streptavidin (1 / 4000) was added and left to stand for 1 hour. After washing three times with PBS-T, the cells were irradiated with ECL-plus and detected with an image analyzer.

[0084] The results are shown in Figure 10. From the results in Figure 10, it was found that Sp-15 was weakly positive for the Wuhan S protein and positive for the delta S protein and omicron S protein. In addition, it was found that omi-41 was positive only for the omicron S protein.

[0085] <Experiment 8: Identification of nucleic acid aptamers capable of binding to SARS-CoV-2 Omicron strains (BA.2, BA.5, XBB.1.5)> We obtained nucleic acid aptamers for the S protein of the SARS-CoV-2 Omicron strain (hereafter referred to as "Omicron-type S protein") using the SELEX method. The procedure was the same as in Experiment 1, except that the Wuhan-type S protein was replaced with three Omicron-type S proteins (Acro Biosystems, product names: SARS-CoV-2, Spike S1, His Tag (BA.2.12.1 / Omicron) (S1N-C52Hx), SARS-CoV-2, Spike S1, His Tag (BA.4 & BA.5 / Omicron) (S1N-C52Hy), and SARS-CoV-2, Spike RDB protein, His Tag (XBB.1.5 / Omicron) (SPD-C5242)). The libraries used were N21, N23, N25, and N27.

[0086] [Table 6]

[0087] <Experiment 9: Verification of binding specificity of BA2-3 etc.> To verify the binding specificity of BA2-3, BA2-4, BA2-5, BA5-7, BA5-9, XBB15-3, and XBB15-5, their binding ability to various proteins was evaluated. The evaluation method was the same as in Experiment 2, except that the proteins listed below were each bound to magnetic beads. The results are shown in Figure 11.

[0088] Protein bound to magnetic beads Negative control proteins: influenza HA protein (flu) (Sino Biological Co., Ltd., 40702-V08H), human EGFR (EGFR) (Sino Biological Co., Ltd., 10001-H08H) Positive control proteins: Wuhan strain S protein (Sp), Omicron BA.2 strain S protein (Omicron) (Acro Biosystems, S1N-C52Hx), Delta strain S protein (delta) (Acro Biosystems, S1N-C52Hu), Omicron BA.5 strain S protein (BA.5), Omicron XBB.1.5 strain S protein (XBB.1.5)

[0089] The results in Figure 11 show that omi-41 and the three aptamers BA2-4 and BA2-5 specifically bind to BA.2. The BA2-3 aptamer binds to three strains (Wuhan, Delta, and BA.2) but not to BA.5 or XBB.1.5. The BA5-7 aptamer specifically binds to BA.5, and the BA5-9 aptamer binds to two strains (Delta and BA.5). The XBB.15-3 and XBB15-5 aptamers recognized all coronavirus variants tested, and their reactivity to influenza and EGFR was reduced compared to Apt5, MSA52, Sp-15, and Sp-33 (Figure 6), demonstrating their higher coronavirus spike protein binding specificity.

[0090] <Experiment 10: Examination of a method for predicting subspecies using multiple types of nucleic acid aptamers> We investigated whether subspecies of the Omicron strain could be predicted using multiple types of nucleic acid aptamers. The method of investigation was the same as in Experiment 2, except that the following viral proteins were each bound to magnetic beads, and the following eight types of nucleic acid aptamers were used. The results are shown in Figure 13.

[0091] Viral proteins bound to magnetic beads and nucleic acid aptamers used Negative control proteins: influenza HA protein (flu) (Sino Biological Co., Ltd., 40702-V08H), human EGFR (EGFR) (Sino Biological Co., Ltd., 10001-H08H) Positive control proteins: Wuhan strain S protein (Wuhan), Omicron BA.2 strain S protein (BA.2) (Acro Biosystems, S1N-C52Hx), Delta strain S protein (delta) (Acro Biosystems, S1N-C52Hu), Omicron BA.5 strain S protein (BA.5), Omicron XBB.1.5 strain S protein (XBB.1.5) Nucleic acid aptamers used: BA5-4, BA5-7, BA5-9, XBB15-3, BA2-3, BA2-4, BA2-5, omi-41

[0092] The results in Figure 13 show that the binding patterns of the eight types of nucleic acid aptamers differ for each S protein. These results suggest that it is possible to estimate the subspecies of Omicron strains based on the binding ratios of multiple types of nucleic acid aptamers.

[0093] [Aspect] It will be appreciated by those skilled in the art that the exemplary embodiments and examples described above are examples of the following aspects.

[0094] (Item 1) In one embodiment, a nucleic acid aptamer capable of binding to SARS-CoV-2 comprises a single-stranded oligonucleotide having nucleotides as building blocks, the single-stranded oligonucleotide comprising a loop region, a 3' stem region bound to the 3' end of the loop region, and a 5' stem region bound to the 5' end of the loop region, the number of bases in the loop region being 16 to 50 mer, the number of bases in the 3' stem region being 5 mer or more, the number of bases in the 5' stem region being 5 mer or more, and the 3' stem region and the 5' stem region being 5 mer or more. The loop region has complementary nucleotide sequences, and the nucleotide sequence of the loop region includes a nucleotide sequence having 80% or more and 100% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, a nucleotide sequence containing at least a 15-mer consecutive nucleotide sequence in any of the nucleotide sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, or a functional nucleotide sequence thereof. The nucleic acid aptamer set forth in paragraph 1 can provide a nucleic acid aptamer that binds to the spike protein (S protein) of the novel coronavirus Omicron strain.

[0095] (Item 2) In the nucleic acid aptamer described in Item 1, the base sequence of the loop region comprises a base sequence having 80% to 100% sequence identity to any of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, 150 to 152, 155, and 156, a base sequence containing at least a 15-mer contiguous base sequence from any of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, 150 to 152, 155, and 156, or a functional version thereof, and has the ability to bind to the spike protein of the BA.2 strain of SARS-CoV-2. The nucleic acid aptamer described in Item 2 can provide a nucleic acid aptamer that binds to the S protein of the BA.2 strain.

[0096] (Item 3) In the nucleic acid aptamer described in Item 1, the base sequence of the loop region comprises a base sequence having 80% to 100% sequence identity with the base sequence set forth in any one of SEQ ID NOs: 153 to 156, a base sequence containing at least a 15-mer consecutive base sequence in the base sequence set forth in any one of SEQ ID NOs: 153 to 156, or a functional base sequence thereof, and has the ability to bind to the spike protein of the BA.5 strain of SARS-CoV-2. The nucleic acid aptamer described in Item 3 can provide a nucleic acid aptamer that binds to the S protein of the BA.5 strain.

[0097] (Item 4) In the nucleic acid aptamer described in Item 1, the base sequence of the loop region comprises a base sequence having 80% to 100% sequence identity to the base sequence set forth in SEQ ID NO: 155 or SEQ ID NO: 156, a base sequence containing at least a 15-mer consecutive base sequence in the base sequence set forth in either SEQ ID NO: 155 or SEQ ID NO: 156, or a functional base sequence thereof, and has the ability to bind to the spike protein of the BA.2 strain and the BA.5 strain of SARS-CoV-2. The nucleic acid aptamer described in Item 4 can provide a nucleic acid aptamer that binds to the S protein of the BA.2 strain and the S protein of the BA.5 strain.

[0098] (Item 5) In the nucleic acid aptamer according to any one of Items 1 to 4, the 3' stem region and the 5' stem region contain a mismatch or a bulge. The nucleic acid aptamer according to Item 5 can bind to the S protein of the novel coronavirus Omicron strain even when a mismatch or a bulge is present in the 3' stem region and the 5' stem region.

[0099] (Item 6) In the nucleic acid aptamer according to any one of Items 1 to 5, the single-stranded oligonucleotide contains a phosphorothioate-modified nucleic acid as a constituent unit. The nucleic acid aptamer according to Item 6 has improved stability (resistance to biodegradation) of the nucleic acid aptamer.

[0100] (Item 7) A SARS-CoV-2 detection kit according to one embodiment includes the nucleic acid aptamer described in any one of Items 1 to 6. The detection kit described in Item 7 can detect the novel coronavirus Omicron strain.

[0101] (Item 8) A detection agent for SARS-CoV-2 according to one embodiment comprises the nucleic acid aptamer described in any one of Items 1 to 6. The detection agent described in Item 8 can detect the novel coronavirus Omicron strain.

[0102] (Item 9) A kit for diagnosing SARS-CoV-2 infection according to one embodiment includes the nucleic acid aptamer described in any one of items 1 to 6. The kit for diagnosing infection described in item 9 can diagnose the presence or absence of infection with the novel coronavirus Omicron strain.

[0103] (Item 10) A method for detecting SARS-CoV-2 according to one embodiment includes the steps of applying the nucleic acid aptamer described in any one of Items 1 to 6 to a test sample, and detecting the nucleic acid aptamer bound to the test sample. The detection method described in Item 10 allows the detection of the novel coronavirus Omicron strain.

[0104] Although the embodiments and examples of the present invention have been described above, it is also planned from the beginning that the configurations of the above-described embodiments and examples may be appropriately combined.

[0105] The embodiments and examples disclosed herein are illustrative in all respects and should not be considered limiting. The scope of the present invention is defined by the claims rather than the above-described embodiments and examples, and it is intended to include any modifications within the scope of the claims that are equivalent to the claims.

Claims

1. A nucleic acid aptamer having binding ability to SARS-CoV-2, The nucleic acid aptamer comprises a single-stranded oligonucleotide having nucleotides as building blocks, the single-stranded oligonucleotide comprises a loop region, a 3' stem region linked to the 3' end of the loop region, and a 5' stem region linked to the 5' end of the loop region; the number of bases in the loop region is 16 to 50 mer, the number of bases in the 3' stem region is 5 mer or more, the number of bases in the 5' stem region is 5mer or more, the 3' stem region and the 5' stem region have complementary base sequences, The base sequence of the loop region is A base sequence having 80% or more and 100% or less sequence identity to any of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156; A base sequence comprising at least a 15-mer consecutive base sequence in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, and 150 to 156, or These functional sequences, A nucleic acid aptamer comprising:

2. The base sequence of the loop region is A base sequence having 80% or more and 100% or less sequence identity to any of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, 150 to 152, 155, and 156; A base sequence comprising at least a 15-mer consecutive base sequence in any one of the base sequences set forth in SEQ ID NOs: 36, 59, 105, 108, 111, 116, 122, 139 to 143, 145, 147, 148, 150 to 152, 155 and 156, or These functional sequences, Including, The nucleic acid aptamer of claim 1, which has the ability to bind to the spike protein of the BA.2 strain of SARS-CoV-2.

3. The base sequence of the loop region is A base sequence having 80% to 100% sequence identity to the base sequence set forth in any one of SEQ ID NOs: 153 to 156; A base sequence comprising at least a 15-mer consecutive base sequence in the base sequence set forth in any one of SEQ ID NOs: 153 to 156, or These functional sequences, Including, The nucleic acid aptamer of claim 1, which has the ability to bind to the spike protein of the BA.5 strain of SARS-CoV-2.

4. The base sequence of the loop region is A base sequence having 80% to 100% sequence identity to the base sequence set forth in SEQ ID NO: 155 or SEQ ID NO: 156; A base sequence comprising at least a 15-mer consecutive base sequence in the base sequence set forth in either SEQ ID NO: 155 or SEQ ID NO: 156, or These functional sequences, Including, The nucleic acid aptamer of claim 1, which has the ability to bind to the spike protein of the SARS-CoV-2 BA.2 strain and the spike protein of the SARS-CoV-2 BA.5 strain.

5. The nucleic acid aptamer of claim 1 , wherein the 3′ stem region and the 5′ stem region contain a mismatch or a bulge.

6. The nucleic acid aptamer according to any one of claims 1 to 4, wherein the single-stranded oligonucleotide comprises a phosphorothioate-modified nucleic acid as a building block.

7. A kit for detecting SARS-CoV-2, comprising: A detection kit comprising the nucleic acid aptamer according to any one of claims 1 to 4.

8. A detection agent for SARS-CoV-2, comprising: A detection agent comprising the nucleic acid aptamer according to any one of claims 1 to 4.

9. A kit for diagnosing SARS-CoV-2 infection, A kit for diagnosing an infectious disease, comprising the nucleic acid aptamer according to any one of claims 1 to 4.

10. A method for detecting SARS-CoV-2, comprising: A step of applying the nucleic acid aptamer according to any one of claims 1 to 4 to a test sample; detecting the nucleic acid aptamer bound to the test sample; A detection method comprising:

Images