Bacillus genus bacterium having polylactic acid decomposing ability, polylactic acid decomposing agent, and method for decomposing polylactic acid

Abstract

To provide a novel advantageous microorganism having polylactic acid decomposing ability, a polylactic acid decomposing agent including the microorganism, and a method for decomposing polylactic acid employing the microorganism.SOLUTION: Provided is a Bacillus genus bacterium having a polylactic acid decomposing ability, the bacterium being capable of growing at 20°C to 45°C and decomposing polylactic acid within 6 days at 30°C to 45°C.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a Bacillus bacterium having the ability to decompose polylactic acid, a polylactic acid decomposing agent, and a method for decomposing polylactic acid. [Background technology]

[0002] Demand for polylactic acid is expected to grow as a bioplastic that can be made from plants and decomposed by microorganisms. Polylactic acid is a carbon-neutral material that can be decomposed into water and carbon dioxide by secondary decomposition by microorganisms after primary decomposition by hydrolysis in a 60°C environment such as compost. Even when incinerated, it has the advantage of placing less strain on incinerators due to its low calorific value.

[0003] As a microorganism having polylactic acid decomposition ability, for example, a specific microorganism of the genus Streptomyces is reported in Patent Document 1. When the Streptomyces microorganism of Patent Document 1 was brought into contact with polylactic acid and cultured for two weeks, a clear region was confirmed, but it is desired to obtain a microorganism that is more capable of decomposing polylactic acid. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Publication No. 10-108669 Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide a useful novel microorganism having polylactic acid decomposition ability, a polylactic acid decomposing agent containing said microorganism, and a method for decomposing polylactic acid using said microorganism. [Means for solving the problem]

[0006] The present inventors have discovered a novel bacterium belonging to the genus Bacillus that has excellent polylactic acid decomposition ability, and have completed the present invention.

[0007] The present invention relates to, for example, the following inventions. [1] A bacterium belonging to the genus Bacillus having polylactic acid decomposition ability, It can grow at temperatures between 20°C and 45°C. A bacterium that can decompose polylactic acid within six days at temperatures between 30°C and 45°C. [2] The Bacillus bacterium is a bacterium belonging to the species Bacillus subtilis, having a 16S rRNA gene consisting of a nucleotide sequence having 95% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 1. A bacterium belonging to the species Bacillus pumilus having a 16S rRNA gene consisting of a base sequence having 95% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or The bacterium according to [1], which is a Bacillus bacterium having a 16S rRNA gene consisting of a base sequence having 95% or more sequence identity to the base sequence shown in SEQ ID NO:3. [3] A bacterium belonging to the species Bacillus subtilis, which is the Bacillus subtilis strain deposited under accession number NITE P-04057 or a mutant thereof. [4] Bacillus pumilus bacteria, which are the Bacillus pumilus strain deposited under accession number NITE P-04058 or a mutant thereof. [5] A Bacillus bacterium, which is the Bacillus strain deposited under accession number NITE P-04059 or a mutant thereof. [6] A polylactic acid decomposing agent comprising the bacterium according to any one of [1] to [5] or a combination thereof. [7] A method for producing the polylactic acid decomposing agent according to [6]. [8] A method for decomposing polylactic acid, comprising decomposing polylactic acid using the bacterium according to any one of [1] to [5] or a combination thereof, or the polylactic acid decomposing agent according to [6]. [9] The method according to [8], wherein the decomposition of polylactic acid is carried out under conditions of 30°C to 45°C. [Effects of the Invention]

[0008] According to the present invention, it is possible to provide a Bacillus bacterium having excellent polylactic acid decomposition ability, a polylactic acid decomposing agent containing said microorganism, and a method for decomposing polylactic acid using said microorganism. [Brief explanation of the drawings]

[0009] [Figure 1] Photographs of polylactic acid agar plates on which polylactic acid-degrading bacteria formed halos are shown. (a) shows the results for No. 26, (b) for No. 29, and (c) for No. 31. [Figure 2] 1 is a graph showing the results of a heat resistance test, where (a) is the result for Bacillus subtilis, (b) is the result for Bacillus pumilus, and (c) is the result for Bacillus sp. [Figure 3] 10 is a graph showing the results of a growth temperature range survey. (a) shows the results for Bacillus subtilis, (b) shows the results for Bacillus pumilus, and (c) shows the results for Bacillus sp. [Figure 4] 1 is a graph showing the results of a growth pH zone survey. (a) shows the results for Bacillus subtilis, (b) shows the results for Bacillus pumilus, and (c) shows the results for Bacillus sp. DETAILED DESCRIPTION OF THE INVENTION

[0010] Hereinafter, embodiments of the present invention will be described in detail, but the present invention is not limited to the following embodiments.

[0011] [Bacillus bacteria with polylactic acid decomposition ability] A Bacillus bacterium having polylactic acid decomposition ability in one embodiment of the present invention can grow at 20°C to 45°C and can decompose polylactic acid at 30°C to 45°C within six days.

[0012] (Polylactic acid) Polylactic acid (PLA) is a polymer obtained by polymerizing lactic acid through ester bonds. Its chemical formula is (C3H4O2)n or [-C(CH3)HC(=O)O-]. n This can be expressed as:

[0013] The polylactic acid degraded by the Bacillus bacteria of this embodiment may be poly-L-lactic acid (PLLA) containing L-lactic acid units or poly-D-lactic acid (PDLA) containing D-lactic acid units, or poly-D,L-lactide (PDLLA) containing racemic D,L-lactic acid units, or poly(D,L-lactide) with CAS number 202832-99-3. The molecular weight of the polylactic acid is not particularly limited, and may be, for example, an average molecular weight of 10,000 to 100,000, 10,000 to 50,000, 10,000 to 30,000, or 10,000 to 20,000. The polylactic acid may also be, for example, Sigma-Aldrich lactide polymer (719951, molecular weight 10,000 to 18,000).

[0014] (culture) In this embodiment, the optimum growth temperature for Bacillus bacteria is the mesophilic range of 20°C to 45°C. Therefore, the culture temperature is preferably 20°C to 45°C. The culture time is not particularly limited as long as a sufficient number of bacteria for use in decomposing polylactic acid can be ensured, and may be, for example, 20 to 48 hours, 20 to 30 hours, or 20 to 24 hours, or even 24 hours. The Bacillus bacteria of this embodiment may not grow at temperatures above 65°C, above 60°C, above 55°C, or above 50°C.

[0015] The Bacillus bacterium of this embodiment may be a bacterium that can grow at pH 4-10, pH 5-10, or pH 7-10.

[0016] The medium for culturing the Bacillus bacteria of this embodiment is not particularly limited, and examples thereof include a basal medium containing a nitrogen source (e.g., ammonium nitrate, ammonium sulfate, ammonium phosphate, ammonium carbonate, L-alanine, etc.), inorganic salts (e.g., iron sulfate, magnesium sulfate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, disodium hydrogen phosphate, sodium dihydrogen phosphate, potassium chloride, calcium chloride, sodium chloride, manganese chloride, calcium nitrate, etc.), and extracts (e.g., yeast extract, etc.). Commercially available media include, for example, SCD bouillon (e.g., GranuCult® prime for microbiology, manufactured by Merck), dried bouillon (e.g., Acudia® for microbiology, manufactured by Shimadzu Diagnostics), etc. TM Dry bouillon (nutrient broth) or the like can be used. Alternatively, the basal medium described below can also be used. The pH of the medium for culturing the Bacillus bacteria of this embodiment may be pH 4 to 10, pH 5 to 10, or pH 7 to 10.

[0017] (Heat resistance) The Bacillus bacteria of this embodiment may be heat-resistant. Spores of Bacillus bacteria after heat treatment are cultured, and the viable cell count after culture is compared with the viable cell count after culture of Bacillus bacteria cultured under the same conditions except for not being heat-treated. If there is no significant difference in the viable cell count before and after heating, the Bacillus bacteria can be determined to be heat-resistant. For example, if the heat treatment temperature is 80°C and the treatment time is 30 minutes, the Bacillus bacteria can be said to have heat resistance at 80°C for 30 minutes. The spores of each bacterium during heat treatment can be measured by, for example, sterilizing 10 5 It may also be used after adjusting the concentration to CFU / ml.

[0018] The Bacillus bacterium of this embodiment may have heat resistance, for example, at 50°C to 80°C, 60°C to 80°C, or 70°C to 80°C for 20 to 60 minutes, at 80°C for 20 to 40 minutes, or at 80°C for 30 minutes.

[0019] (Polylactic acid decomposition / Polylactic acid decomposition activity) The ability of Bacillus bacteria to decompose polylactic acid can be confirmed by the formation of a transparent zone called a halo around the colony when cultured on an agar medium containing polylactic acid. The halo is also called a clear zone.

[0020] In one embodiment of the present invention, the Bacillus bacterium may degrade polylactic acid at 30 to 45°C within 2 to 6 days, 2 to 5 days, 2 to 4 days, 2 to 3 days, or within 6 days, 5 days, 4 days, 3 days, or 2 days; at 40 to 45°C within 3 days, at 45°C within 3 days, at 45°C within 3 days, at 40°C within 3 days or 2 days; at 30 to 35°C within 6 days, 5 days, 4 days, or 3 days; at 30 to 40°C within 6 days, 5 days, 4 days, or 3 days; at 34 to 36°C or 35°C within 3 days or 2 days; or at 30°C within 6 days, 5 days, 4 days, or 3 days.

[0021] The above number of days is determined by dividing the sample into 10 pieces on an agar medium containing 0.18 to 0.20 g of polylactic acid (for example, 18 to 20 mL for one 90 mm diameter petri dish). 4 The term "temperature" refers to the number of days required for a halo to form when CFU of Bacillus bacteria are contacted, and the temperature refers to the temperature at which the agar medium contacted with Bacillus bacteria is cultured.

[0022] The size of the halo is not particularly limited, and it may be determined that a halo has been formed when its formation can be confirmed visually. However, for example, it may also be determined that a halo has been formed when the distance between the outer periphery of the colony and the outer periphery of the halo is 1 mm or more, 2 mm or more, or 3 mm or more.

[0023] The agar medium containing the above-mentioned polylactic acid is not particularly limited as long as it allows the Bacillus bacteria to grow appropriately, but examples thereof include basal media having the following compositions. (1) Composition of basal medium (mg / L) Yeast extract 250 Iron sulfate heptahydrate 10 Magnesium sulfate heptahydrate 200 Ammonium sulfate 1,000 Calcium chloride dihydrate 20 Sodium Chloride 100 Potassium dihydrogen phosphate 1,000 Dipotassium hydrogen phosphate 1,000 (2) Composition of basal medium (mg / L) Yeast extract 250 Iron sulfate heptahydrate 10 Magnesium sulfate heptahydrate 200 Ammonium sulfate 1,000 Calcium chloride dihydrate 20 Sodium Chloride 100 Potassium dihydrogen phosphate 1,000 Dipotassium hydrogen phosphate 1,000 L-Alanine 5,000 For example, 15 to 20 g / L, preferably 15 g / L, of agar can be added to these basal media to prepare an agar medium.

[0024] The type and amount of polylactic acid contained in the basal medium can be set as appropriate, but for example, the following reagent can be mixed with 10 ml of distilled water and dispersed in a homogenizer at 15,000 rpm for 2 minutes to produce a polylactic acid emulsion. Poly(D,L-lactide) (Sigma-Aldrich, 719951, Mw=10,000-18,000) 1.0 g Hitenol NF-13 (Daiichi Kogyo Seiyaku) 0.1g

[0025] For example, 10 mL of polylactic acid emulsion can be added to 90 mL of basal medium and dispersed, and then 15 g / L of agar can be added to prepare an agar medium.

[0026] (Bacillus bacteria) The Bacillus bacterium may be a bacterium of the species Bacillus subtilis or Bacillus pumilus.

[0027] The bacterium belonging to the genus Bacillus is a bacterium belonging to the species Bacillus subtilis having a 16S rRNA gene consisting of a nucleotide sequence having 95% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 1; A bacterium belonging to the species Bacillus pumilus having a 16S rRNA gene consisting of a nucleotide sequence having 95% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 2, or The bacterium may be a Bacillus bacterium having a 16S rRNA gene consisting of a base sequence having 95% or more sequence identity with the base sequence shown in SEQ ID NO:3.

[0028] Furthermore, the Bacillus bacterium may be a Bacillus bacterium selected from the Bacillus subtilis strain deposited under accession number NITE P-04057 or a mutant thereof, the Bacillus pumilus strain deposited under accession number NITE P-04058 or a mutant thereof, and the Bacillus strain deposited under accession number NITE P-04059 or a mutant thereof.

[0029] The Bacillus bacterium may be a bacterium belonging to the species Bacillus subtilis, which is the Bacillus subtilis strain deposited under accession number NITE P-04057 or a mutant thereof. The 16S rRNA gene of the bacterium has the nucleotide sequence shown in SEQ ID NO: 1.

[0030] The Bacillus bacterium may be a Bacillus pumilus strain deposited under accession number NITE P-04058 or a mutant thereof. The 16S rRNA gene of the bacterium has the nucleotide sequence shown in SEQ ID NO:2.

[0031] The Bacillus bacterium may be a Bacillus strain deposited under accession number NITE P-04059 or a mutant thereof. The 16S rRNA gene of the bacterium has the nucleotide sequence shown in SEQ ID NO:3.

[0032] The Bacillus subtilis strain deposited under accession number NITE P-04057, the Bacillus pumilus strain deposited under accession number NITE P-04058, and the Bacillus strain deposited under accession number NITE P-04059 are newly discovered bacterial strains by the present inventors. They are capable of degrading polylactic acid at moderate temperatures of approximately 30 to 45°C, and their polylactic acid degradation rate is faster than that of previously reported Bacillus bacteria, reaching as fast as two days. These strains have been deposited at the National Institute of Technology and Evaluation (NITE) Biotechnology Center, Patent Microorganisms Depositary (NPMD) (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) (Deposit date: January 11, 2024).

[0033] The bacterial mutant strains described above include those that have spontaneously mutated or morphologically changed in each bacterial strain, those obtained by screening for mutations induced in each bacterial strain using radiation such as gamma rays or X-rays or chemical agents such as ethyl methanesulfonate (EMS), or those obtained by genetic engineering techniques such as transposon introduction or CRISPR-Cas9. These mutant strains have altered characteristics but retain the taxonomic characteristics of each bacterial strain as a new species. For example, the mutant strains may have 99% or more sequence identity as determined by 16S rRNA gene analysis, and (i) be able to degrade polylactic acid at 30-45°C within 6 days, (ii) have an optimal growth temperature of 20-45°C, (iii) grow at pH 4-10, and / or (vi) be heat-resistant at 80°C for 30 minutes.

[0034] As used herein, "sequence identity" refers to the percentage (%) of identical DNA bases relative to the total overlapping DNA sequence in the optimal alignment of two DNA sequences, as determined by a mathematical algorithm known in the art. For example, CLUSTAL X can be used to create the alignment, and CLUSTAL X can be used to calculate sequence identity.

[0035] In this specification, the sequence identity to the base sequences shown in SEQ ID NOs: 1 to 7 may be, for example, 98.7% or more, 99% or more, 99.5% or more, 99.7% or more, 99.8% or more, 99.9% or more, 99.96% or more, 99.97% or more, 99.98% or more, or 100%.

[0036] In the present specification, the 16S rRNA gene may contain 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 5, 1 to 4, 1 to 3, 1 or 2, or 2 or 3 nucleotide sequence differences with respect to the nucleotide sequences shown in SEQ ID NOs: 1 to 7. The nucleotide sequence differences may be insertions, substitutions, deletions, or combinations thereof, when the nucleotide sequences shown in SEQ ID NOs: 1 to 7 are used as a reference.

[0037] [Polylactic acid decomposer] As one embodiment, the present invention also provides a polylactic acid decomposition agent comprising the above-mentioned Bacillus bacteria or a combination thereof. The Bacillus bacteria are as described above. All descriptions of the polylactic acid decomposition agent in this specification can be interpreted as descriptions of a composition for decomposing polylactic acid.

[0038] The decomposition agent of this embodiment may contain, for example, one or more Bacillus bacteria selected from the Bacillus subtilis strain deposited under accession number NITE P-04057, the Bacillus pumilus strain deposited under accession number NITE P-04058, and the Bacillus strain deposited under accession number NITE P-04059.

[0039] The Bacillus bacteria contained in the decomposition agent of this embodiment may be viable or dead. They may also be used in the form of spores. For example, a bacterial culture may be used as is, or the bacteria may be isolated after cultivation and used as is, or may be dried and then used, for example, after being pulverized.

[0040] (form) The form of the decomposition agent of this embodiment may be liquid, solid, gel, paste, or the like, and can be appropriately set depending on the form of polylactic acid, the conditions of use, and the like. When the form is liquid, for example, the decomposition agent may contain a culture solution in which Bacillus bacteria have been cultured, or may be a dispersion of Bacillus bacteria in some kind of solvent (e.g., water). When the form is solid, for example, a culture solution in which Bacillus bacteria have been cultured can be powdered by natural drying, freeze-drying, spray drying, or the like.

[0041] When the form is liquid, the bacteria can be brought into contact with the polylactic acid by coating, sprinkling (spraying), dropping, immersion, etc. When the form is solid (including powder), gel, paste, etc., the solid, gel, paste, etc. can be brought into contact with the polylactic acid, or the bacteria can be brought into contact with the polylactic acid by dispersing it in a solvent (e.g., water) and then coating, sprinkling, dropping, or immersion.

[0042] The amount of Bacillus bacteria contained in the decomposition agent of this embodiment can be appropriately set depending on the form of polylactic acid, the usage conditions, etc. The bacterial concentration in the decomposition agent is not particularly limited, but for example, it can be 10 4 ~10 12 CFU / ml, 10 8 ~10 12 CFU / ml, or 10 10 ~10 12 The bacterial concentration may be expressed in CFU / ml, and a high bacterial concentration is preferred. When two or more species of Bacillus bacteria having the ability to decompose polylactic acid are used, the bacterial concentration refers to the total concentration of all the Bacillus bacteria.

[0043] The decomposition agent of this embodiment may be in the form of a concentrate. In this case, the concentration ratio is not particularly limited and can be, for example, 2 to 1000 times, 5 to 500 times, 1 to 100 times, or 10 to 50 times. When the decomposition agent of this embodiment is a concentrate, it is appropriately diluted with a solvent such as water, and the diluted solution can be treated to produce polylactic acid. The content of bacteria in the decomposition agent of this embodiment can be set according to the concentration ratio.

[0044] (Method of producing polylactic acid decomposing agent) As one embodiment, the present invention also provides a method for producing the above-mentioned polylactic acid decomposing agent. The Bacillus bacterium and the polylactic acid decomposing agent are as described above.

[0045] The method of this embodiment may include a step of culturing a Bacillus bacterium having the ability to decompose polylactic acid. The culturing is as described above.

[0046] The method of this embodiment may also include recovering the cultured Bacillus bacteria, which can be recovered, for example, by separating the supernatant (medium) from the precipitate (bacteria) by centrifugation and removing the supernatant.

[0047] As the polylactic acid decomposing agent, a culture medium in which Bacillus bacteria have been cultured may be used as is, or the culture medium may be used after adding, for example, a pH adjuster, a preservative, an antioxidant, a stabilizer, a buffering agent, etc., or recovered Bacillus bacteria dispersed in a solvent (e.g., water) may be used. Furthermore, if the Bacillus bacteria are in powder form, they may be used after adding, for example, calcium carbonate, lactose, dextrin, wheat flour, starch, cellulose, etc. as an excipient.

[0048] [Method for decomposing polylactic acid] As one embodiment, the present invention also provides a method for decomposing polylactic acid, which comprises decomposing polylactic acid using the above-mentioned Bacillus bacteria or a combination thereof, or the above-mentioned polylactic acid decomposing agent. The Bacillus bacteria and the polylactic acid decomposing agent are as described above.

[0049] The decomposition method of the present embodiment may include a step of contacting polylactic acid with a Bacillus bacterium or a polylactic acid decomposing agent.

[0050] The form of the polylactic acid to be degraded may be, for example, a molded body, a film, a suspension, or a powder.

[0051] The decomposition of polylactic acid in the decomposition method of this embodiment may be carried out under conditions of 25°C to 50°C, 28°C to 48°C, 30°C to 45°C, 30°C to 35°C, 30°C to 40°C, 34°C to 36°C, 30°C, 35°C, 40°C, or 45°C. The Bacillus bacteria described above have a particularly high decomposition efficiency for polylactic acid under conditions of 30°C to 45°C. The length of the decomposition treatment is not particularly limited, and can be, for example, 2 days or more, 3 days or more, 4 days or less, 5 days or less, 6 days or less, 7 days or less, 8 days or less, 2 to 14 days, 2 to 10 days, 2 to 6 days, or 2 to 3 days.

[0052] The amounts of Bacillus bacteria and polylactic acid decomposing agent used can be appropriately determined depending on the form of polylactic acid, the conditions of use, etc. For example, 10 4 ~10 12 CFU of Bacillus bacteria can be used.

[0053] The contact method can be appropriately determined depending on the type of Bacillus bacteria or polylactic acid decomposing agent. For example, Bacillus bacteria can be contacted with polylactic acid by the method described above for the type of decomposing agent. [Example]

[0054] 1. Isolation of polylactic acid-degrading bacteria 1) Sampling and measuring the number of bacteria A total of 46 samples, including soil, sludge, compost, and seawater, were collected from one prefecture and five prefectures: Ibaraki, Tokyo, Tochigi, Yamanashi, Chiba, and Kanagawa. Three to five grams of each sample was weighed, diluted 10-fold with nine times its weight of sterile saline, and then stirred in a vortex mixer to prepare the sample solution. The sample solution was pour-cultured on standard agar medium (Shimadzu Diagnostics), and the colonies were counted to calculate the total viable bacterial count. The incubation conditions were 35°C and 48 hours. Table 1 shows the results of the total viable bacterial count calculations.

[0055] [Table 1]

[0056] 2) Preparation of polylactic acid agar medium A basal medium was prepared using the following reagents and distilled water. Composition of basal medium (mg / L) Yeast extract 250 Iron sulfate heptahydrate 10 Magnesium sulfate heptahydrate 200 Ammonium sulfate 1,000 Calcium chloride dihydrate 20 Sodium Chloride 100 Potassium dihydrogen phosphate 1,000 Dipotassium hydrogen phosphate 1,000

[0057] The following reagents were mixed with 10 ml of distilled water and dispersed in a homogenizer at 15,000 rpm for 2 minutes to prepare a polylactic acid emulsion. Poly(D,L-lactide) (Sigma-Aldrich, 719951, Mw=10,000-18,000) 1.0 g Hitenol NF-13 (Daiichi Kogyo Seiyaku) 0.1g

[0058] 10 mL of polylactic acid emulsion was added to 90 mL of basal medium, and the mixture was again dispersed using a homogenizer at 15,000 rpm for 2 minutes. Agar was added at a concentration of 15 g / L, dissolved by heating, and then sterilized under high pressure at 121°C for 15 minutes. The mixture was poured into a sterilized dish and solidified to form polylactic acid agar medium. The pH of the medium was 6.75.

[0059] 3) Isolation of polylactic acid-degrading bacteria Sterile saline solution was used to measure the general viable bacterial count of 10 3 0.1 ml of sample solution adjusted to CFU / ml was dropped onto a polylactic acid agar medium and evenly smeared with a Conn. rod. The incubation conditions were 35°C for one month. Microorganisms that decompose polylactic acid form halos around the colonies. Microorganisms that formed these halos were identified as polylactic acid-degrading bacteria, and 35 candidate strains were streaked and purified on standard agar medium.

[0060] 4) Selection of polylactic acid-degrading bacteria The 35 purified candidate strains were streaked individually onto polylactic acid agar medium and cultured at 35°C for one month. Three strains of microorganisms that formed halos around the colonies were confirmed as polylactic acid-degrading bacteria, designated No. 26, No. 29, and No. 31, respectively. The polylactic acid-degrading bacteria were isolated from the same sludge sample. Figure 1 shows the halos of the polylactic acid-degrading bacteria.

[0061] 5) Identification of strains The polylactic acid-degrading bacteria were identified by MALDI-TOF MS analysis of total protein mass spectra and comparison with the MBT Compass Library Ver. V11.0.0.0 database. No. 26 was identified as Bacillus subtilis, No. 29 as Bacillus pumilus, and No. 31, due to the existence of multiple candidate species, was designated Bacillus sp. Furthermore, the 16S rRNA sequence was determined by 16S rRNA gene analysis, and a homology search was performed using the National Center for Biotechnology Information's BLAST. For gene analysis, the PCR product was amplified with PCR primers 27F / 1492R, and sequence data was obtained by sequencing with sequencing primers 518F / 800R.

[0062] The sequence information of each primer (all written in the 5' to 3' direction) is shown below. 27F: AGAGTTTGATCMTGGCTCAG (SEQ ID NO: 4) 1492R: TACGGYTACCTTGTTACGACTT (SEQ ID NO: 5) 518F: CCAGCAGCCGCGGTAATACG (SEQ ID NO: 6) 800R: TACCAGGGTATCTAATCC (SEQ ID NO: 7)

[0063] A Blast search of the 16S rRNA gene sequence revealed that the same species as those identified by MALDI-TOF MS were highly compatible with each other, ranking highly in the search results. Furthermore, the homology with known microorganisms was 99%, with no perfect matches, suggesting that these strains are novel. Note that No. 26 Bacillus subtilis, No. 29 Bacillus pumilus, and No. 31 Bacillus sp. are deposited at the Patent Microorganisms Depositary, Biotechnology Center, National Institute of Technology and Evaluation, under accession numbers NITE P-04057, NITE P-04058, and NITE P-04059, respectively. Hereinafter, No. 26 will be referred to as Bacillus subtilis, No. 29 as Bacillus pumilus, and No. 31 as Bacillus sp., respectively.

[0064] 6) Preservation of strains Polylactic acid-degrading bacteria were streaked onto standard agar medium and cultured at 35°C. Each single colony was suspended in 10 ml of SCD broth (Shimadzu Diagnostics) that had been autoclaved at 121°C for 15 minutes and cultured again at 35°C for 24 hours to prepare a preculture solution. 0.1 ml of the preculture solution was added dropwise to standard agar medium, smeared evenly with a Conlarger stick, and cultured at 35°C. 10 ml of 10% skim milk solution was added dropwise to the bacterial cells, which were then suspended with a Conlarger stick and collected in a 1.5 ml tube. The cells were stored overnight at 4°C and then transferred to -80°C to prepare a stock culture of the strain.

[0065] 2. Investigation of the characteristics of polylactic acid-degrading bacteria 2-1 Heat resistance test 1) Preparation of spore suspension After thawing a stock culture of polylactic acid-degrading bacteria, it was suspended in 10 ml of SCD broth that had been autoclaved using a platinum loop at 121°C for 15 minutes, and pre-cultured at 35°C for 24 hours. 0.5 ml of the pre-cultured bacterial solution was smeared uniformly with a cone rod onto Schaeffer medium of the following composition. Composition of Schaeffer medium ( / L) Nutrient broth (Shimadzu Diagnostics) 8.0 g 10% potassium chloride 10.0 ml 1.2% magnesium sulfate 10.0 ml Agar 30.0 g pH 7.0 The above reagents were mixed and sterilized at high pressure at 121°C for 15 minutes, and then the following reagents, which had been sterilized by filtration, were added. 1 M calcium nitrate 1.0 ml 10 mM manganese chloride 1.0 ml 1mM iron sulfate 1.0ml

[0066] The medium was shielded from light with aluminum foil and cultured at 35°C. After confirming that more than 80% of the cells were mature spores using a phase-contrast microscope, the cells were collected in 10 ml of sterile water using a cone rod. This procedure was repeated twice, and the cell suspension was collected in a centrifuge tube. The mixture was centrifuged at 8,000 rpm at 4°C for 20 minutes, and the supernatant was removed. The cells were suspended in 10 ml of sterile water, vortexed, and centrifuged again under the same conditions. After removing the supernatant, the cells were again suspended in 10 ml of sterile water and vortexed. The mixture was heated in a water bath at 80°C for 30 minutes and rapidly cooled under running water to obtain the spore suspension. The spore suspension was stored at 2°C. 1 ml of the spore suspension was pour-cultured on standard agar medium, and the colonies were counted to calculate the viable cell count. The culture conditions were 35°C and 48 hours. The viable cell count results for each strain are shown in Table 2. All experiments shown below used spore fluid.

[0067] [Table 2]

[0068] 2) Heat resistance test The spore suspension of each strain was diluted with sterile saline for 10 min. 5The spore solution was adjusted to CFU / ml, and 5 ml was carefully collected into a test tube that had been autoclaved at 121°C for 15 minutes, taking care not to allow the spore solution to adhere to the wall. The tubes were heated in water baths set at 50°C, 60°C, 70°C, and 80°C for 30 minutes, and then rapidly cooled under running water. One ml of the spore solution before and after heating was appropriately diluted with sterile saline and pour-cultured on standard agar medium. Colonies were counted and the viable cell count was calculated. Culture conditions were 35°C for 48 hours. The results are shown in Figure 2. There was no difference in the viable cell count before and after heating for any of the strains, and they were heat-resistant up to 80°C for 30 minutes.

[0069] 2-2 Breeding temperature range survey The medium was made of SCD broth as a base medium, and the pH was adjusted to 7 with 2N NaOH. After autoclaving at 121°C for 15 minutes, 10 ml of the adjusted SCD broth was added to the medium. 4 0.1 ml of spore suspension of each strain, adjusted to CFU / ml with sterile saline, was inoculated. Culture temperatures were 10°C, 20°C, 30°C, 40°C, 45°C, 50°C, and 60°C, and the culture was continued for 16 days. Periodically, 1 ml of the culture was sampled and mixed with standard agar medium. After incubation, colonies were counted and the viable cell count was calculated. Culture conditions were 35°C for 48 hours. The results are shown in Figure 3. Bacillus subtilis grew between 20°C and 50°C, with a decrease in viable cell count at 10°C and 60°C. Bacillus pumilus grew between 20°C and 45°C, with viable cell counts maintained at 10°C and decreasing at 50°C. Bacillus sp. grew between 20°C and 45°C, with a decrease in viable cell count at 10°C and 50°C. All strains were confirmed to be mesophilic bacteria that prefer mesophilic temperatures (20°C to 45°C).

[0070] 2-3 Growth pH range survey The medium was SCD broth as the base medium, and the pH was adjusted to 4, 5, 6, 7, and 10 with 2N NaOH and HCl. After autoclaving at 121°C for 15 minutes, 10 spore suspensions of each strain were added. 4The concentration was adjusted to CFU / ml with sterile saline, and 0.1 ml was inoculated into 10 ml of adjusted SCD broth. The incubation temperature was 30°C and the incubation period was 16 days. 1 ml of the bacterial solution was periodically sampled and pour plated onto standard agar medium. The colonies were counted and the viable cell count was calculated. The results are shown in Figure 4. Bacillus subtilis grew vigorously at pH 5 and 10, with a decrease in viable cell count at pH 4. Bacillus pumilus grew vigorously at pH 7 and 10, with growth slowing at pH 4. Bacillus sp., like Bacillus pumilus, grew vigorously at pH 7 and 10, with growth slowing at pH 4. Both strains were confirmed to be capable of growth over a wide pH range.

[0071] 3. Investigation of polylactic acid degradation activity 1) Preparation of polylactic acid agar medium A basal medium was prepared using the following reagents and distilled water. Composition of basal medium (mg / L) Yeast extract 250 Iron sulfate heptahydrate 10 Magnesium sulfate heptahydrate 200 Ammonium sulfate 1,000 Calcium chloride dihydrate 20 Sodium Chloride 100 Potassium dihydrogen phosphate 1,000 Dipotassium hydrogen phosphate 1,000 L-Alanine 5,000

[0072] L-alanine was added as a nitrogen source to aid in microbial colony formation. The polylactic acid emulsion was prepared as described in 1.2). After mixing the basal medium and polylactic acid emulsion, the mixture was again dispersed using a homogenizer at 15,000 rpm for 2 minutes. Agar was added at a concentration of 15 g / L, dissolved by heating, and then sterilized under high pressure at 121°C for 15 minutes. The mixture was poured into a sterilized petri dish and allowed to solidify, forming a polylactic acid agar medium. The pH of the medium was 6.24.

[0073] 2) Polylactic acid decomposition test Two paper discs that had been sterilized at 121°C for 15 minutes were placed on each polylactic acid agar medium. 6 A drop of 30 μl of spore suspension of each strain, adjusted to CFU / ml, was added. Because all strains had been confirmed to have polylactic acid degrading activity at 35°C in 1.4), 35°C was used as the control. Based on the results of the growth temperature range survey in 2-2, the test groups were cultured at temperatures of 20°C, 25°C, 30°C, 40°C, 45°C, and 50°C. The culture period was a maximum of two weeks. Test groups in which halos formed around the colonies were scored as +, and test groups in which no halos formed were scored as -. Additionally, the number of days required for halo formation was recorded. The results for the control group are shown in Table 3, and the results for the test groups are shown in Table 4. All strains formed halos between 25°C and 45°C, demonstrating their broad degrading activity in the mesothermal range. Comparing the number of days required for halo formation by culture temperature, halo formation was fastest at 35°C and 40°C for all strains. This suggests that the optimum temperature range for polylactic acid degradation for the newly isolated Bacillus polylactic acid-degrading bacteria is 35°C to 40°C. Furthermore, the time required for polylactic acid degradation at temperatures between 30°C and 45°C was as short as two days and as long as six days, with both strains forming halos within one week. Previously reported polylactic acid degradation rates have been as short as five days. The polylactic acid-degrading bacteria isolated in this study are considered to be microorganisms capable of degrading polylactic acid more quickly than conventional polylactic acid-degrading bacteria.

[0074] [Table 3]

[0075] [Table 4]

Claims

1. A bacterium of the genus Bacillus having polylactic acid decomposition ability, It can be grown at temperatures between 20°C and 45°C. A bacterium that can decompose polylactic acid at 30 to 45°C within six days.

2. the Bacillus bacterium is a bacterium of the species Bacillus subtilis having a 16S rRNA gene consisting of a base sequence having 95% or more sequence identity to the base sequence shown in SEQ ID NO: 1; A bacterium belonging to the species Bacillus pumilus having a 16S rRNA gene consisting of a base sequence having 95% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or 2. The bacterium according to claim 1, which is a Bacillus bacterium having a 16S rRNA gene consisting of a base sequence having 95% or more sequence identity to the base sequence shown in SEQ ID NO:

3.

3. A bacterium belonging to the species Bacillus subtilis, which is the Bacillus subtilis strain deposited under accession number NITE P-04057 or a mutant thereof.

4. A bacterium belonging to the species Bacillus pumilus, which is the Bacillus pumilus strain deposited under accession number NITE P-04058 or a mutant thereof.

5. A Bacillus bacterium, which is a Bacillus strain deposited under accession number NITE P-04059 or a mutant thereof.

6. A polylactic acid decomposing agent comprising the bacterium according to any one of claims 1 to 5 or a combination thereof.

7. The method for producing the polylactic acid decomposing agent according to claim 6.

8. A method for decomposing polylactic acid, comprising decomposing polylactic acid using the bacterium according to any one of claims 1 to 5 or a combination thereof.

9. The method according to claim 8, wherein the decomposition of polylactic acid is carried out under conditions of 30°C to 45°C.

Images