Analysis system for orthogonal access to and tagging of biomolecules in cellular compartments

By employing a nuclear permeability enhancer to deliver transposome complexes into the nucleus, the method addresses the challenges of cross-contamination and limited diffusion, enabling efficient generation of sequencing-ready DNA or RNA libraries from intact cellular compartments.

JP2025157397APending Publication Date: 2025-10-15ILLUMINA INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025119642
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2016-12-29
Filing Date
2025-07-16
Publication Date
2025-10-15

AI Technical Summary

Technical Problem

Current methods for analyzing nucleic acids and proteins in cells disrupt cellular compartments, leading to cross-contamination and require additional purification steps due to enzymatic degradation and limited diffusion across the nuclear membrane, making it difficult to generate fragmented DNA or RNA libraries suitable for sequencing.

Method used

The method involves using a nuclear permeability enhancer to deliver analytical biomolecules, such as transposome complexes, into the nucleus, allowing for the fragmentation and tagging of nuclear genetic material while maintaining cytoplasmic and nuclear compartments intact, enabling independent analysis of both compartments.

Benefits of technology

This approach facilitates efficient access to nuclear genetic material, allowing for the generation of fragmented DNA or RNA libraries suitable for sequencing, while preserving compartmental integrity and reducing the need for additional purification steps.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025157397000006
    Figure 2025157397000006
  • Figure 2025157397000007
    Figure 2025157397000007
  • Figure 2025157397000008
    Figure 2025157397000008
Patent Text Reader

Abstract

To provide methods of reacting a cell nucleus informational molecule with an analytical biomolecule.SOLUTION: The invention relates to a system and methods of enhancing access to nuclear informational molecules, such as DNA, RNA, and proteins, by analytical biomolecules, such as transposome complexes, by treating nuclei with a nuclear permeability enhancer, and to methods of using nuclear membranes, cell membranes, and external compartmentalization approaches as contiguity preserving elements. The present invention provides, for example, a method of reacting a cell nucleus informational molecule with an analytical biomolecule, comprising contacting the cell nucleus with a nuclear permeability enhancer and reacting the informational molecule with the analytical biomolecule.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] The detection of nucleic acids and proteins in biological samples is useful for identifying and classifying microorganisms, diagnosing infectious diseases, detecting and characterizing genetic abnormalities, identifying genetic changes associated with disease onset or progression, studying genetic susceptibility to disease, and measuring response to disease treatment.

[0002] The analysis of single cell or single nucleus allows separate analysis of cytoplasmic compartment and nuclear compartment, and provides broad insight into cell type, cell differentiation, cell state, protein synthesis and regulation, evolution, disease progression and diagnosis, and evaluation of response to disease treatment.In particular, the analysis of DNA and RNA and histones and other nuclear proteins at the nuclear level can be used to perform genome-wide sequencing, reveal information about the quiescent state and open chromatin state of cells, or provide real-time information about protein regulation.This information is useful for applications such as gene editing, cell type conversion, analysis of protein regulation, and disease therapy.

[0003] Current techniques for accessing the nucleic acid and protein contents of cells for subsequent analysis generally use cell lysis methods that disrupt cellular compartments. Some methods use lysis media, such as ionic detergents, which result in a mixture of cytoplasmic and nuclear contents, preventing resolution of molecular information between compartments (e.g., due to cross-contamination between mitochondrial DNA in the cytoplasm and nuclear DNA). Alternative lysis methods use mild non-ionic detergents to disrupt cell membranes while keeping nuclei intact. In another approach, isolated nuclei can be disrupted with digestive enzymes, such as proteases.

[0004] Next-generation sequencing (NGS) techniques routinely use a sample or library preparation step in which genomic DNA or RNA is converted into a library of fragmented, sequenceable templates. Genomic DNA fragmentation is a crucial step in DNA sample preparation for high-throughput sequencing. In one approach, transposome complexes are used to fragment and tag target nucleic acids. A transposase mediates fragmentation of double-stranded DNA, and synthetic oligonucleotides are ligated to both ends. The attached oligonucleotides enable subsequent amplification and sequencing steps. The cell and nuclear lysis methods described above are incompatible with this approach because they degrade the enzymes (e.g., ionic detergents, digestive enzymes) or because the enzymes cannot sufficiently penetrate intact nuclei. For example, transposome complexes, such as Nextera Tn5 (dimer, approximately 106 kDa) used in current tagmentation protocols, are unable to efficiently access nuclear material due to the complexity of the nuclear envelope (see Figure 1). The nuclear envelope is composed of an outer nuclear membrane and an inner nuclear membrane, which together form a lipid bilayer that restricts the diffusion of biomolecules from the cytoplasm into the nucleus. Nuclear pore complexes (NPCs) span the nuclear membrane and tightly regulate the transport of biomolecules into and out of the nucleus, typically allowing only molecules smaller than 40 kDa to pass through. The inner nuclear membrane is adjacent to the nuclear lamina, which contains protein filaments such as scaffolding / matrix attachment elements, clathrin, and other proteins that create a supportive framework to maintain the rigidity of the nucleus and regulate size-selective entry of molecules into the nucleus. Due to these issues of enzymatic degradation and limited diffusion across the nuclear membrane, cell lysis methods will require additional purification and isolation steps to isolate the target nucleic acid or protein before further sample preparation can be performed.

[0005] Analysis of single-cell contents can be achieved by isolating single cells in separate compartments. In one technique, cells are distributed in aqueous droplets in an oil-based medium. However, because the oil interferes with the migration of materials and sample preparation enzymes into and out of the aqueous droplets, all such reagents must be present in the initial aqueous medium. Furthermore, proximity information can be preserved using compartmentalization methods such as the contiguity preserving element (CE) described in PCT Publication No. WO 2016 / 013704. However, such techniques do not address the limitations described above regarding separate access to nuclear and cytoplasmic elements. There is a need for sample preparation methods for analyzing cellular components, e.g., by next-generation sequencing, that provide efficient access to nuclear genetic material while maintaining cytoplasmic and nuclear compartments and / or nuclear proximity, allow for independent detection of nuclear and cytoplasmic contents, and generate fragmented DNA or RNA libraries suitable for sequencing. Described herein are methods that provide sample preparation methods to be performed within an intact nucleus, essentially using the nuclear envelope as the CE. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2016 / 013704 Summary of the Invention [Means for solving the problem]

[0007] The present disclosure is directed to methods for delivering an analytical biomolecule to a cell nucleus by contacting the cell and / or cell nucleus with a nuclear permeability enhancer, allowing the analytical biomolecule to react with a nuclear information molecule (e.g., a nucleic acid or a protein). In some embodiments, the method includes reacting a second analytical biomolecule with a cytoplasmic information molecule (e.g., a nucleic acid or a protein). In some embodiments, the method includes facilitating analysis of individual cells and / or individual nuclei. In some embodiments, single cells and / or nuclear contents are localized by proximity storage elements. In some embodiments, multiple proximity storage elements are used, allowing for independent analysis of analytes from different cellular compartments. In some embodiments, the nuclear membrane functions as the proximity storage element or as one of multiple proximity storage elements. Such processing also allows for the removal of large biomolecules, such as analytical complexes, from the nucleus, facilitating their isolation and / or analysis.

[0008] Described herein is a method for reacting a cell nucleus information molecule with an analytical biomolecule, the method comprising the steps of contacting the cell nucleus with a nuclear permeability enhancer and reacting the information molecule with the analytical biomolecule.

[0009] A method for analyzing nuclear information molecules, comprising: (a) contacting a cell nucleus containing a cell nuclear information molecule with a nuclear permeability enhancer and a biomolecule for analysis; (b) reacting the analytical biomolecule with the nuclear information molecule to produce an analytical complex; (c) analyzing the analysis complex, thereby detecting the nuclear information molecule; Described herein are methods including:

[0010] Such a method may include a step of analyzing a cytoplasmic information molecule. Thus, the present disclosure provides a method for analyzing a nuclear information molecule and a cytoplasmic information molecule, the method comprising: (a) contacting a cell containing a nuclear information molecule and a cytoplasmic information molecule with a nuclear permeability enhancer, a first analytical biomolecule, and a second analytical biomolecule; (b) reacting the first analytical biomolecule with the nuclear information molecule to form a first analytical complex; and reacting the second analytical biomolecule with the cytoplasmic information molecule to form a second analytical complex. (c) analyzing the first analysis complex, thereby detecting the nuclear information molecule; and, if necessary, (d) analyzing the second analysis complex, thereby detecting the cytoplasmic information molecule; The present invention covers methods including:

[0011] The methods described herein can utilize contiguous conserved elements. The present disclosure therefore provides a method for analyzing nuclear information molecules, comprising: (a) providing a contiguous storage element comprising a nucleus, the nucleus comprising a nuclear information molecule; (b) contacting the proximity storage elements with a nuclear permeability enhancer and an analytical biomolecule; (c) reacting the analytical biomolecule with the nuclear information molecule to produce an analytical complex; (d) analyzing the analysis complex, thereby detecting the nuclear information molecule; The present invention covers methods including:

[0012] The present disclosure further provides a method for analyzing nuclear and cytoplasmic information molecules, comprising: (a) providing a proximal storage element comprising a cell, the cell comprising a nuclear information molecule and a cytoplasmic information molecule; (b) contacting the proximity storage element with a nuclear permeability enhancer, a first analytical biomolecule, and a second analytical biomolecule; (c) reacting the first analytical biomolecule with the nuclear information molecule to form a first analytical complex; and reacting the second analytical biomolecule with the cytoplasmic information molecule to form a second analytical complex. (d) analyzing the first analysis complex, thereby detecting the nuclear information molecule; and, if necessary, (e) analyzing the second analysis complex, thereby detecting the cytoplasmic information molecule; The present invention covers methods including:

[0013] In the above method, the biomolecule to be analyzed can be a transposome complex. Thus, a method for fragmenting and tagging a target nucleic acid in a nucleus using a transposome complex and a nuclear permeability enhancer is described herein. Treating a cell or a cell nucleus with a nuclear permeability enhancer allows for efficient delivery of the transposome complex into the nuclear space. The present disclosure is directed to a method for delivering a transposase or a transposome complex into a cell nucleus by treating a cell or a nucleus with a nuclear permeability enhancer. In this manner, translocation of nuclear genetic material within the nucleus can be achieved.

[0014] 1. A method for preparing a library of tagged nucleic acid fragments from a cell nucleus target nucleic acid, comprising: (a) contacting a cell nucleus containing the target nucleic acid with a nuclear permeabilization enhancer and a plurality of transposome complexes, each transposome complex comprising a transposase and two transposon end compositions comprising transposon end sequences; (b) reacting the target nucleic acid with the plurality of transposome complexes, whereby the target nucleic acid is fragmented into double-stranded nucleic acid fragments and tagged with the transferred strand from the transposon end composition to form tagged analysis complexes; (c) analyzing the tagged analysis complexes, thereby detecting the tagged nucleic acid fragments; Described herein are methods including:

[0015] 1. A method for preparing a library of tagged nucleic acid fragments from a cell nucleus target nucleic acid, comprising: (a) providing a contiguous storage element comprising a single nucleus, the single nucleus comprising the target nucleic acid; (b) contacting the adjacent storage elements and the single nucleus with a nuclear permeability enhancer and an analytical biomolecule; (c) reacting the analytical biomolecule with a nuclear information molecule to produce an analytical complex; (d) analyzing the analysis complex, thereby detecting the nuclear information molecule; Also described herein are methods comprising:

[0016] In some methods, the adjacent storage element comprises the cell nucleus (isolated or intracellular) containing the target nucleic acid. The method can further comprise preparing and analyzing the cytoplasmic information molecule described above.

[0017] In some embodiments, differential access to cells, cytoplasmic and nuclear cellular components allows for analysis of RNA, DNA, protein, or any combination thereof, from one or more cells or one or more cytoplasmic and nuclear cellular components.

[0018] In some methods, compounds or biomolecules (eg, nuclear pore blockers) are used to block access to certain cytoplasmic and nuclear compartments.

[0019] The methods described herein are useful in multi-analyte assays (DNA, RNA, protein, etc.) derived from the same single cell.

[0020] Also described herein are compositions comprising a cell and / or a cell nucleus, a nuclear permeability enhancer, and a transposase or transposome complex. The present invention provides, for example, the following items. (Item 1) A method for reacting a cell nucleus information molecule with an analytical biomolecule, the method comprising the steps of contacting the cell nucleus with a nuclear permeability enhancer and reacting the information molecule with the analytical biomolecule. (Item 2) A method for analyzing nuclear information molecules, comprising: (a) contacting a cell nucleus containing a cell nuclear information molecule with a nuclear permeability enhancer and a biomolecule for analysis; (b) reacting the analytical biomolecule with the nuclear information molecule to produce an analytical complex; (c) analyzing the analysis complex, thereby detecting the nuclear information molecule; A method comprising: (Item 3) 3. The method of claim 2, wherein the adjacent conserved elements comprise the cell nucleus. (Item 4) 26. The method of any one of items 1 to 3 or 25, wherein the nuclear information molecule is DNA, RNA, protein, or a mixture thereof. (Item 5) 5. The method according to item 4, wherein the nuclear information molecule is DNA. (Item 6) 6. The method according to any one of items 1 to 5, wherein the biomolecule for analysis is a transposase or a transposome complex, or an antibody, or an oligonucleotide, or a nucleotide, or a reverse transcription primer, or an enzyme. (Item 7) 7. The method of claim 6, wherein the oligonucleotide or nucleotide comprises at least one labeled nucleotide. (Item 8) The enzyme is an amplification enzyme, a polymerase, a DNA polymerase, an RNA polymerase, a PCR enzyme, a ligase, Taq DNA polymerase, Pfu DNA polymerase, 7. The method according to item 6, wherein the enzyme is an enzyme that mediates in vitro transcription, an integrase, or a nicking enzyme. (Item 9) 7. The method according to item 6, wherein the biomolecule to be analyzed is a transposome complex. (Item 10) 10. The method of item 9, wherein each transposome complex comprises a transposase and two transposon end compositions comprising transposon end sequences. (Item 11) Item 11. The method according to item 10, wherein the nuclear information molecule is a target nucleic acid, and the reacting step comprises the steps of fragmenting the target nucleic acid into double-stranded nucleic acid fragments and tagging the transferred strand from the transposon end composition to form a tagged analysis complex. (Item 12) 1. A method for preparing a library of tagged nucleic acid fragments from a cell nucleus target nucleic acid, comprising: (a) providing a contiguous storage element comprising a single nucleus, the single nucleus comprising the target nucleic acid; (b) contacting the adjacent storage elements and the single nucleus with a nuclear permeability enhancer and an analytical biomolecule; (c) reacting the analytical biomolecule with a nuclear information molecule to produce an analytical complex; (d) analyzing the analysis complex, thereby detecting the nuclear information molecule; A method comprising: (Item 13) The method according to any one of the preceding items, further comprising, prior to the contacting step, a step of reacting the cytoplasmic information molecule with a second analytical biomolecule in the presence of a nuclear pore blocker and in the absence of a nuclear permeability enhancer, wherein the reacting step of the method introduces a first tag into the cytoplasmic information molecule and a second tag into the nuclear information molecule. (Item 14) 10. The method of any one of the preceding items, wherein at least one informational molecule is a protein. (Item 15) The method according to any one of the preceding items, further comprising the steps of contacting the cell with a second analytical biomolecule, reacting the second analytical biomolecule with the cytoplasmic information molecule to form a second analytical complex, thereby analyzing the cytoplasmic information molecule, and, if necessary, analyzing the second analytical complex, thereby detecting the cytoplasmic information molecule. (Item 16) 10. The method of any one of the preceding items, wherein the analytical biomolecule is a transposome complex, and the method further comprises treating the analytical complex with a polymerase, optionally a strand-displacing polymerase. (Item 17) 10. The method of any one of the preceding items, wherein the analyzing step comprises sequencing the fragmented, tagged nucleic acids or amplicons thereof or copies thereof. (Item 18) The method of any one of the preceding items, wherein the nuclear permeability enhancer is selected from the group consisting of a compound that disrupts NPC hydrophobic interactions, a compound that binds to and / or inhibits nuclear filament proteins, a compound that binds to and / or inhibits clathrin, and a nuclear localization signal peptide (NLS). (Item 19) Item 19. The method of item 18, wherein the nuclear permeability enhancer is a clathrin inhibitor, or Pitstop-2 (also known as N-[5-(4-bromobenzylidene)-4-oxo-4,5-dihydro-1,3-thiazol-2-yl]naphthalene-1-sulfonamide), methyl-b-cyclodextrin, phenothiazine, monodansylcadaverine, chloroquine, monensin, hyperosmotic sucrose or Dynasoa or a synthetic analogue thereof, or Pitstop-2. (Item 20) The nuclear permeability enhancer is a hydrophobic disrupting agent, or an aliphatic alcohol, or C 4~1019. The method according to item 18, wherein the diol is a -alkyl-diol, or a cyclic diol, or a cycloalkane-diol, or a vicinal diol, or trans-1,2-cyclohexanediol, n-hexane-1,2-diol or 1,6-hexane-diol. (Item 21) Item 19. The method of item 18, wherein the nuclear permeability enhancer is a nuclear localization signal peptide (NLS), or is SV40 large T antigen (PKKKRKV), the NLS of nucleoplasmin (KR[PAATKKAGQA]KKKK or AVKRPAATKKAGQAKKKLD), KK / RXK / R, EGL-13 (MSRRRKANPTKLSENAKKLAKEVEN), c-Myc (PAAKRVKLD), TUS protein (KLKIKRPVK), the acidic M9 domain of hnRNP A1, KIPIK from yeast transcriptional repressor Matα2, a PY-NLS sequence, or an inhibitor of importin β2, or is SV40 large T antigen. (Item 22) 22. The method of claim 21, wherein the NLS is covalently linked to the analytical biomolecule. (Item 23) 22. The method of claim 21, wherein the NLS is not covalently linked to the analytical biomolecule. (Item 24) A composition comprising one or more cells and / or one or more cell nuclei, a nuclear permeability enhancer, and a biomolecule for analysis. (Item 25) 25. The composition according to item 24, wherein the analytical biomolecule is a transposase or transposome complex, or an antibody, or an oligonucleotide optionally comprising at least one labeled nucleotide, or an optionally labeled nucleotide, or a reverse transcription primer, or an enzyme. (Item 26) 25. The composition according to item 24, wherein the biomolecule for analysis is a transposome complex. (Item 27) 25. The method according to item 24, wherein the analytical biomolecule is an enzyme, and the enzyme is an amplification enzyme, a polymerase, a DNA polymerase, an RNA polymerase, a PCR enzyme, Taq DNA polymerase, Pfu DNA polymerase, an enzyme that mediates in vitro transcription, an integrase, or a nicking enzyme. (Item 28) The nuclear permeability enhancer is selected from the group consisting of PitStop-2, aliphatic alcohol, C 4~10 28. The composition according to any one of items 24 to 27, wherein the diol is a 1,2-cyclohexanediol, n-hexane-1,2-diol, 1,6-hexane-diol, or digitonin. (Item 29) 29. The composition of claim 28, wherein the nuclear permeability enhancer is Pitstop-2, cyclohexanediol, or digitonin. (Item 30) (a) contacting a cell nucleus containing a cell nuclear information molecule with a nuclear permeability enhancer and a biomolecule for analysis; (b) reacting the analytical biomolecule with the nuclear information molecule to produce a modified nuclear information molecule; (c) detecting the modified nuclear signaling molecule; Item 1. The method according to item 1, comprising: (Item 31) Item 31. The method according to Item 30, wherein the nuclear information molecule is a target nucleic acid, the analytical biomolecule is a transposome complex, the reacting step comprises a step of forming a complex between the transposome complex and the nuclear information molecule, and the transposome complex does not fragment the target nucleic acid. (Item 32) 1. A method for differentially tagging informational molecules in cells, comprising: Selectively delivering a first analytical biomolecule comprising a first tag to a first cellular compartment selected from the group consisting of a cell nucleus, a cytoplasm, and a mitochondria, wherein the first cellular compartment comprises the first informational biomolecule; reacting the first analytical biomolecule with the first information molecule to provide a tagged first information molecule; Selectively delivering a second analytical biomolecule comprising a second tag to a second cellular compartment selected from the group consisting of a cell nucleus, a cytoplasm, and a mitochondria, the second cellular compartment comprising a second information molecule and different from the first cellular compartment; reacting the second analytical biomolecule with the second information molecule to provide a tagged second information molecule, wherein the first and second tags are different; A method comprising: (Item 33) 33. The method of claim 32, wherein the selective delivery of the first analytical biomolecule to the first cellular compartment comprises treating the cells with a permeability enhancer for the first cellular compartment. (Item 34) 34. The method of claim 32 or 33, wherein the selective delivery of the first analytical biomolecule to the first cellular compartment comprises treating the cells with a permeability blocking agent for the second cellular compartment. (Item 35) 35. The method of any one of items 32 to 34, wherein the selective delivery of the second analytical biomolecule to the second cellular compartment comprises treating the cells with a permeability enhancer for the second cellular compartment. (Item 36) 36. The method of any one of items 32 to 35, wherein the selective delivery of the first analytical biomolecule occurs without substantial delivery of the first analytical biomolecule to the second cellular compartment. (Item 37) 37. The method according to any one of Items 32 to 36, wherein the first cellular compartment is the cytoplasm and the first information molecule is a cytoplasmic information molecule, and (a) the second cellular compartment is the nucleus and the second information molecule is a nuclear information molecule, or (b) the second cellular compartment is the mitochondria and the second information molecule is a mitochondrial information molecule. (Item 38) 38. The method of claim 37, wherein the selective delivery of the first biomolecule for analysis to the cytoplasm is performed in the presence of a nuclear pore blocker and / or a mitochondrial pore blocker. (Item 39) 38. The method of claim 37, wherein the delivery of the second analytical biomolecule is performed in the presence of a nuclear permeability enhancer or a mitochondrial permeability enhancer. (Item 40) Item 41. The method according to any one of Items 37 to 39, wherein the cytoplasmic signaling molecule is RNA. 40. The method according to any one of Items 37 to 39, wherein the nuclear information molecule is DNA or genomic DNA (gDNA). (Item 42) the step of selectively delivering the first analytical biomolecule comprises reacting the first analytical biomolecule with a mitochondrial information molecule to produce a tagged mitochondrial information molecule; The step of selectively delivering the second analytical biomolecule includes a step of reacting the second analytical biomolecule with a nuclear information molecule to produce a tagged nuclear information molecule. 37. The method according to any one of Items 32 to 36. (Item 43) 43. The method according to any one of items 37 to 42, wherein the mitochondrial information molecule is DNA. (Item 44) 44. The method according to any one of Items 37 to 43, wherein the nuclear information molecule is DNA or genomic DNA (gDNA). (Item 45) 45. The method according to any one of items 32 to 44, further comprising the step of lysing the cells to release the tagged informational molecule. (Item 46) The method according to any one of the preceding method sections, wherein the biological molecule to be analyzed is a transposase or transposome complex, or an antibody, or an oligonucleotide optionally comprising at least one labeled nucleotide, or an optionally labeled nucleotide, or a reverse transcription primer, or an enzyme. (Item 47) 46. ​​The method of claim 45, wherein the enzyme is an amplification enzyme, a polymerase, a DNA polymerase, an RNA polymerase, a PCR enzyme, Taq DNA polymerase, Pfu DNA polymerase, an enzyme that mediates in vitro transcription, an integrase, or a nicking enzyme. (Item 48) 47. The method according to any one of Items 32 to 46, wherein the biomolecule for analysis is a transposome complex. (Item 49) 49. The method according to any one of Items 32 to 48, further comprising a step of detecting the tagged informational molecule or an amplicon thereof, wherein the detecting step optionally comprises a step of detecting a sequence of the tagged informational molecule or amplicon. (Item 50) Item 11. The method or composition of any one of the preceding items, wherein the nuclear permeability enhancer is digitonin. [Brief explanation of the drawings]

[0021] [Figure 1] Figures 1A and 1B show the architecture of a cell (Figure 1A) and nucleus (Figure 1B). The cytoplasm is densely packed with proteins, RNA, mitochondrial DNA, and other biomolecules. The nucleus of a cell is densely packed with DNA, RNA, nuclear proteins, and other biomolecules.

[0022] [Figure 2]Figures 2A, 2B, and 2C show different mechanisms of access to cellular and nuclear components. Figure 2A shows access to only the cytoplasmic components of the cell by blocking the nuclear pores. Figure 2B shows access to the nucleus by permeabilizing the cell membrane using a cell-permeable biomolecule and / or by permeabilizing the nuclear membrane. Figure 2C shows isolated nuclei maintained individually as adjacent elements by the use of a nuclear permeabilizing agent.

[0023] [Figure 3] FIG. 3 shows visualization of isolated nuclei treated with FAM-labeled transposome complexes in the presence of various concentrations of Pitstop-2, as described in Example 3.

[0024] [Figure 4] Figures 4A, 4B, and 4C show sequencing results for ATAC-seq libraries generated with and without treatment with Pitstop-2, as described in Example 5. Figure 4A shows the ATAC-seq profile across a portion of chromosome 12. Figure 4B reports the diversity and uniqueness results of whole-genome sequencing coverage. Figure 4C shows normalized coverage across promoter and coding regions of the human genome.

[0025] [Figure 5] FIG. 5 shows agarose gel images of transposed DNA libraries generated in the presence and absence of PitStop-2.

[0026] [Figure 6] FIG. 6 shows an agarose gel image of ATAC-seq library generation with unpurified tagged fragmented nuclei after treatment with strand-displacing polymerase, as described in Example 7.

[0027] [Figure 7A]Figures 7A and 7B show the results described in Example 8. Figure 7A reports the concentration of the ATAC-seq libraries based on BioAnalyzer data. Figure 7B shows the ATAC-seq profiles of two libraries spanning portions of chromosome 6. [Figure 7B] Figures 7A and 7B show the results described in Example 8. Figure 7A reports the concentration of the ATAC-seq libraries based on BioAnalyzer data. Figure 7B shows the ATAC-seq profiles of two libraries spanning portions of chromosome 6.

[0028] [Figure 8] Figures 8A and 8B illustrate the indexed primer generation described in Example 11. Figure 8A is a schematic representation of bead-bound seeding oligonucleotides with regions complementary to indexed PCR primers. Figure 8B reports the amplification efficiency obtained using the seeding oligonucleotide approach.

[0029] [Figure 9] FIG. 9 shows agarose gel data from experiments with Bst and Phi29 strand-displacing polymerases, as described in Example 13.

[0030] [Figure 10] FIG. 10 is a schematic representation of the use of nuclear membranes as CEs for transposition, along with yet another method of exposing transposed nuclei to deionized water or high salt conditions.

[0031] [Figure 11A]Figure 11 shows single-cell sequencing data for mouse (3T3) ATAC-seq libraries prepared with 0 μM, 30 μM, and 60 μM PitStop-2 added during cell lysis and nuclear translocation. Figure 11A shows the effect of PitStop-2 concentration on the total number of unique reads for three sets of barcodes, grouped by the different number of unique reads (>1k, >10k, and >100k). Figure 11B shows the percentage of fragments within 1 kb of the transcription start site for ATAC-seq samples treated with 0 μM, 30 μM, or 60 μM PitStop-2. Figure 11C shows the ATAC-seq peak overlap as defined by the MACS-2 peak finding program for samples treated with 0 μM, 30 μM, and 60 μM PitStop-2. [Figure 11B] Figure 11 shows single-cell sequencing data for mouse (3T3) ATAC-seq libraries prepared with 0 μM, 30 μM, and 60 μM PitStop-2 added during cell lysis and nuclear translocation. Figure 11A shows the effect of PitStop-2 concentration on the total number of unique reads for three sets of barcodes, grouped by the different number of unique reads (>1k, >10k, and >100k). Figure 11B shows the percentage of fragments within 1 kb of the transcription start site for ATAC-seq samples treated with 0 μM, 30 μM, or 60 μM PitStop-2. Figure 11C shows the ATAC-seq peak overlap as defined by the MACS-2 peak finding program for samples treated with 0 μM, 30 μM, and 60 μM PitStop-2. [Figure 11C]Figure 11 shows single-cell sequencing data for mouse (3T3) ATAC-seq libraries prepared with 0 μM, 30 μM, and 60 μM PitStop-2 added during cell lysis and nuclear translocation. Figure 11A shows the effect of PitStop-2 concentration on the total number of unique reads for three sets of barcodes, grouped by the different number of unique reads (>1k, >10k, and >100k). Figure 11B shows the percentage of fragments within 1 kb of the transcription start site for ATAC-seq samples treated with 0 μM, 30 μM, or 60 μM PitStop-2. Figure 11C shows the ATAC-seq peak overlap as defined by the MACS-2 peak finding program for samples treated with 0 μM, 30 μM, and 60 μM PitStop-2. DETAILED DESCRIPTION OF THE INVENTION

[0032] In some embodiments, the nuclear information molecule is DNA, RNA, or protein. In some embodiments, it is DNA or mRNA. In some aspects, it is DNA. In some embodiments, it is RNA. In some embodiments, it is DNA and RNA. In some embodiments, it is cDNA or cDNA and DNA. In some embodiments, the DNA can represent an open chromatin context of DNA. In some embodiments, the DNA can represent total genomic DNA, a fraction of total genomic DNA, or mitochondrial DNA.

[0033] In some embodiments, the cytoplasmic information molecule is mRNA, DNA, or a protein. In some embodiments, it is mRNA or DNA.

[0034] In some embodiments, the biomolecule to be analyzed is a transposase or a transposome complex, an antibody, an oligonucleotide, a nucleotide, a reverse transcription primer, or an enzyme. In some examples, the oligonucleotide or nucleotide comprises at least one labeled nucleotide. In some examples, the enzyme is an amplification enzyme, a polymerase, a DNA polymerase, a ligase, an RNA polymerase, a PCR enzyme, Taq DNA polymerase, Pfu DNA polymerase, an enzyme that mediates in vitro transcription, an integrase, or a nicking enzyme.

[0035] In some embodiments, the analytical biomolecule is indexed or barcoded. In some embodiments, the analytical biomolecule is a transposase. In other embodiments, it is a transposome complex. In some embodiments, the transposome complex comprises a transposase and two transposon end compositions comprising transposon end sequences. Suitable transposition methods are known in the art and are described, for example, in U.S. Patent Application Publication Nos. 2010 / 0120098 and 2014 / 0194324 and PCT Publication No. WO2016 / 130704.

[0036] In some embodiments, the transposon end composition comprises an end sequence and an oligonucleotide adaptor, hi some embodiments, the particular transposon end sequence comprises a double-stranded region that binds to a recognition site for the transposase.

[0037] In some embodiments, the analytical biomolecule is an antibody, particularly an antibody that specifically binds to a target information molecule that is a protein, a protein fragment, or a peptide.Optionally, the antibody also includes a pendant oligonucleotide or other tag that allows subsequent isolation and / or analysis.The binding of the antibody to the target protein produces an analytical complex.

[0038] An "analysis complex" is the product of the reaction between an analytical biomolecule and a target information molecule. Such a complex can be formed by covalent or non-covalent bonds, or both covalent and non-covalent bonds. For example, a transposase complex can fragment a target nucleic acid and tag the transferred strand, resulting in a complex of the tagged nucleic acid, transposase, and the non-transferred strand. The resulting analysis complex is formed by covalent binding and hybridization. In another example, the analysis complex can be an antibody-target protein complex or an antibody-target peptide complex.

[0039] The present invention describes a method and composition for improving the accessibility of transposome to DNA in the nucleus.This application is not limited to transposome, because various other molecules can be selectively inserted or removed into the nucleus.For example, polyT capture probes can be transported into the nucleus for RNA capture and downstream assay (e.g., sequencing) and analysis.Alternatively, other pores, such as NPC, can be targeted to transport molecules into and out of the nucleus.

[0040] Examples of cytoplasmic and nuclear compartments include, but are not limited to, mitochondria, nuclei, chloroplasts, peroxisomes, endoplasmic reticulum, microtubules, Golgi apparatus, carboxysomes, and metabolosomes. Nuclear permeability enhancers

[0041] In some aspects, a nuclear permeabilization enhancer is a compound (e.g., a small molecule or peptide) that increases the permeability of the nuclear envelope without disrupting the nuclear membrane. In such embodiments, the nuclear membrane is not removed but becomes more porous. Such treatment improves access of analytical biomolecules, such as transposome complexes or antibodies, to nuclear genetic material. Thus, in some embodiments, access of analytical biomolecules, such as transposome complexes, to nuclear genetic material is increased by contacting the nucleus with a nuclear permeabilization enhancer. Suitable enhancers include compounds that disrupt NPC hydrophobic interactions, compounds that bind to and / or inhibit nuclear filament proteins such as clathrin, and nuclear localization signal peptides.

[0042] In some embodiments, the enhancer is a clathrin inhibitor. Inhibitors of clathrin coat assembly have been shown to inhibit the uptake of classical substrates of clathrin-mediated endocytosis (see Liashkovich, I. et al., "Clathrin inhibitor Pitstop-2 disrupts the nuclear pore complex permeability barrier," Sci. Rep. 2015, vol. 5, p. 9994). Such compounds can function to create and / or increase the size of the cavity through the nuclear pore complex. Suitable clathrin inhibitors include Pitstop-2 (also known as N-[5-(4-bromobenzylidene)-4-oxo-4,5-dihydro-1,3-thiazol-2-yl]naphthalene-1-sulfonamide), methyl-β-cyclodextrin, phenothiazine, monodansylcadaverine, chloroquine, monensin, hyperosmotic sucrose, and Dynasor, as well as synthetic analogs thereof (see Chen, C.-L. et al., "Inhibitor sofclathrin-dependent endocytosis enhances TGFβ signaling and responses," J. Cell. Sci. 2009, vol. 122, pp. 1863-1871, and references cited therein). As shown by the data presented herein, clathrin inhibitors have been found to mediate the transport of transpososome complexes into the nucleus, thereby improving access of the transpososome complex to nuclear genetic material and improving the transposition efficiency of the material.

[0043] An exemplary enhancer is C 4~10Hydrophobic disrupting agents are also included, such as aliphatic alcohols, including alkyl-diols, cyclic diols, cycloalkane-diols, or vicinal diols (e.g., trans-1,2-cyclohexanediol, n-hexane-1,2-diol, 1,6-hexane-diol; see Ribbeck, K. et al., "The permeability barrier of nuclear pore complexes appear to operate via hydrophobic exclusion," The EMBO J. 2002, 21(11), 2664-2671). In some embodiments, the nuclear permeability enhancer is cyclohexanediol, or 1,2-cyclohexanediol, or trans-1,2-cyclohexanediol. Further hydrophobic disrupting agents include surfactants such as digitonin (see, e.g., Hagstrom et al., J. Cell Sci. 1997, 110, 2323-2331; Tissera et al., "Nuclearenvelopes show cell-type-specific sensitivity for permeabilization with digitonin," Nature (Protocol Exchange), 2010 (available at https: / / www.nature.com / protocolexchange / protocols / 1994)).

[0044] Exemplary enhancers also include nuclear localization signals (NLS), which are amino acid sequences typically used to tag proteins for import into the cell nucleus via nuclear transport. In some embodiments, the NLS is covalently or non-covalently linked to the biomolecule under analysis (e.g., applied as a complex or formed as a complex in situ). In some methods, the NLS is not covalently linked to the biomolecule under analysis (e.g., transposase or transpososome complex), but is used as an additive to a mixture of the biomolecule under analysis and cells or cell nuclei (e.g., transposition reaction). In some embodiments, the NLS is an NLS from SV40 large T antigen (PKKKRKV; Creative Peptides, Shirley, NY, Cat#GR1405), nucleoplasmin (KR[PAATKKAGQA]KKKK or AVKRPAATKKAGQAKKKLD) (see Rotello et al., Bioconj. Chem. 26(6):1004-7), KK / RXK / R (see Chelsky et al., Mol. Cell Biol. 1989, 9(6):2487-2492; Dingwall et al., J. Cell. Biol. 1988, 107(3):841), EGL-13 (MSRRRKANPTKLSENAKKLAKEVEN), c-Myc (PAAKRVKLD), TUS-protein (KLKIKRPVK), hnRNP In some embodiments, the NLS is the SV40 large T antigen. Preparation of template nucleic acid

[0045] Some embodiments include methods for preparing a template nucleic acid. As used herein, "template nucleic acid" can refer to a substrate for obtaining sequence information. Some template nucleic acid preparation methods include inserting a transposon sequence into a target nucleic acid, thereby preparing a template nucleic acid. Some insertion methods include contacting a transposon sequence provided herein with a target nucleic acid in the presence of an enzyme, such as a transposase or integrase, under conditions sufficient for the integration of the transposon sequence(s) into the target nucleic acid. In some embodiments, the template nucleic acid can include a target nucleic acid, a fragment thereof, or any copy thereof, comprising at least one transposon sequence, a fragment thereof, or any copy thereof. In some embodiments, the template nucleic acid can include a target nucleic acid comprising an adapter containing a tag suitable for sequencing, such as a primer site.

[0046] In some embodiments, the cells may be fixed. In some embodiments, the methods described herein use intact cells, and fix the cells by treatment with a surfactant. In such methods, the analytical biomolecule can enter the cells without disrupting the cell membrane. In an exemplary method, the cells are treated with a surfactant (e.g., NP-40, SDS, etc.), a nuclear permeabilizing agent, and the analytical biomolecule.

[0047] In some embodiments, analytical biomolecules are designed for specific target DNA, mRNA, cDNA, DNA, or any combination thereof (e.g., DNA and cDNA). For example, a specific analytical biomolecule can include an indicator probe designed to distinguish between DNA and mRNA. In some embodiments, a first analytical biomolecule and a second analytical biomolecule are used, for example, a first transposome complex and a second transposome complex are used, where the first transposome complex contains a transposon end sequence (e.g., an A14 / B15 primer sequence) for tagging DNA, and the second transposome complex contains a transposon end sequence (e.g., an adapter containing a poly-T region specific to the mRNA poly-A tail) for tagging mRNA.

[0048] In some embodiments, artificial pores can be inserted into cellular or nuclear compartments to facilitate the translocation of biomolecules for analysis into or out of the compartment.

[0049] In some embodiments, the method includes isolating cell nuclei. Isolation of cell nuclei can be achieved using standard methods known in the art, provided that the method maintains the integrity of the cell nuclei. In some instances, cell lysis methods can be used. Cell nuclei can be isolated or purified from cytoplasmic components prior to exposure to the nuclear permeabilizing agent. In some embodiments, the cytoplasmic fraction is maintained and analyzed separately.

[0050] For nucleic acid analysis, sample preparation typically involves fragmenting genomic nucleic acid to sequenceable lengths and ligating adapters to the fragments to provide templates for subsequent purification and, if necessary, amplification. The templates are converted using primers into "seed" templates that are amplified and subjected to the sequencing protocol.

[0051] The number of steps required for the transformation of DNA and / or RNA into adapter-modified templates in solution, ready for amplification and sequencing, can be minimized by the use of transposase-mediated fragmentation and tagging. This process, referred to herein as "tagged fragmentation," often involves modification of DNA or mRNA with a transposome complex containing a transposase enzyme complexed with adapters containing transposon end sequences. Tagged fragmentation results in simultaneous fragmentation of the DNA and ligation of adapters to the 5' ends of both strands of the double-stranded fragments. A purification step can be used to remove the transposase enzyme. Any gaps in the double-stranded product can be filled, and additional sequences can be added to the ends of the adapted fragments by PCR.

[0052] In some embodiments, a plurality of transposon sequences provided herein are inserted into a target nucleic acid. Some embodiments involve selecting conditions sufficient to achieve integration of the plurality of transposon sequences into the target nucleic acid such that the average distance between each integrated transposon sequence comprises a certain number of consecutive nucleotides in the target nucleic acid.

[0053] Some embodiments of preparing a template nucleic acid may include copying a sequence comprising the target nucleic acid. For example, some embodiments may include hybridizing a primer to a primer site of a transposon sequence incorporated into the target nucleic acid. In some such embodiments, the primer may be hybridized to the primer site and extended. The copied sequence may include at least one barcode sequence and at least a portion of the target nucleic acid. In some embodiments, the copied sequence may include a first barcode sequence, a second barcode sequence, and at least a portion of the target nucleic acid disposed therebetween. In some embodiments, at least one copied nucleic acid may include at least a first barcode sequence of a first copied nucleic acid that may be identified or designated as paired with a second barcode sequence of a second copied nucleic acid. In some embodiments, the primer may include a sequencing primer. In some embodiments, sequencing data is obtained using the sequencing primer. In more embodiments, adapters comprising primer sites may be ligated to each end of a nucleic acid, and the nucleic acid may be amplified from the primer sites.

[0054] Some embodiments of template nucleic acid preparation can include amplifying a sequence comprising at least a portion of one or more transposon sequences and at least a portion of a target nucleic acid. In some embodiments, at least a portion of the target nucleic acid can be amplified using a primer that hybridizes to a primer site of the integrated transposon sequence incorporated into the target nucleic acid. In some such embodiments, the amplified nucleic acid can comprise a first barcode sequence and a second barcode sequence with at least a portion of the target nucleic acid disposed therebetween. In some embodiments, at least one amplified nucleic acid can comprise at least a first barcode sequence of a first amplified nucleic acid that can be identified as paired with a second barcode sequence of a second amplified sequence.

[0055] In some embodiments, it may be advantageous to incorporate at least one universal primer site into each template nucleic acid. For example, the template nucleic acid may include a first terminal sequence containing a first universal primer site and a second terminal sequence containing a second universal primer site. The universal primer site may have various applications, such as use in amplifying, sequencing, and / or identifying one or more template nucleic acids. The first and second universal primer sites may be the same, substantially similar, similar, or different. The universal primer site may be introduced into a nucleic acid by various methods well known in the art, such as ligating a primer site to a nucleic acid, amplifying a nucleic acid using a tailed primer, and inserting a transposon sequence containing a universal primer site. Transposome

[0056] As used herein, the term "transposome complex" generally refers to a double-stranded nucleic acid comprising a transposase (e.g., an integrase or transposase) and an integration recognition site, such as a transposase recognition site. In embodiments provided herein, the transposase can form a functional complex with the transposase recognition site that can catalyze a transposition reaction. The transposase can bind to the transposase recognition site and insert the transposase recognition site into a target nucleic acid by "tagged fragmentation." In some such insertion events, one strand of the transposase recognition site can be transferred to the target nucleic acid. In one example, a transposome comprises a dimeric transposase comprising two subunits and two non-adjacent transposon sequences. In another example, the transposase comprises a dimeric transposase comprising two subunits and adjacent transposon sequences. In some embodiments, the complex is formed by incubating the transposase with double-stranded transposon DNA under conditions that support non-covalent complex formation.

[0057] The double-stranded transposon DNA can include, without limitation, Tn5 DNA, portions of Tn5 DNA, transposon end compositions, mixtures of transposon end compositions, or other double-stranded DNA that can interact with a transposase, such as a hyperactive Tn5 transposase.

[0058] "Transposase" refers to an enzyme that can form a functional complex with a transposon end-containing composition (e.g., a transposon, a transposon end, a transposon end composition) and catalyze the insertion or transposition of the transposon end-containing composition into double-stranded target DNA that is incubated therewith, for example, in an in vitro transposition reaction. Transposases as described herein can also include integrases from retrotransposons and retroviruses.

[0059] Transposases, transposomes, and transposome complexes are generally known to those skilled in the art, as exemplified by the disclosures of U.S. Patent Application Publication No. 2010 / 0120098 and PCT Publication No. 2016 / 130704, which are incorporated herein by reference. Transposase enzymes include, but are not limited to, Tn5 transposase, Mu transposase, and Vibrio harveyi transposase, as well as variants thereof, such as hyperactive Tn5 transposase. Transposase enzymes can be multimers, such as dimers, trimers, or tetramers, such as Tn5 dimers. Any transposition system capable of inserting transposon ends with sufficient efficiency to tag and fragment target DNA for its intended purpose can be used in the methods described herein. In certain embodiments, preferred transposition systems can insert the transposon ends in a random or near-random manner, resulting in 5'-tagging and fragmentation of the target DNA. Specific embodiments are hyperactive Tn5 transposase and Tn5-type transposase recognition sites (Goryshin and Reznikoff, J. Biol. Chem. 1983, 273:7367), or MuA transposase and Mu transposase recognition sites including R1 and R2 end sequences (Mizuuchi, K., Cell 1983, 35:785; Savilahti, H. et al., EMBO J. 1995, 14:4893). Mosaic end (ME) sequences can also be used, as optimized by those skilled in the art. The above references are incorporated herein by reference. Further exemplary transposition systems are described in WO2016 / 130704, such as S. aureus Tn552, Ty1, transposons Tn7, Tn / O and IS10, Mariner transposase, Tc1, P element, Tn3, bacterial insertion sequences, retroviruses, retroviral integrases (such as integrases from HIV-1, HIV-2, SIV, PFV-1 and RSV), yeast retrotransposons IS5, Tn10, Tn903 or IS911, and engineered variants thereof.

[0060] In some embodiments, the transposase is a Tn5 transposase, a Mu transposase, or a Vibrio (e.g., Vibrio harveyi) transposase. In some embodiments, the transposase is a Tn5 transposase. In some embodiments, the transposase is a hyperactive Tn5 transposase. In some embodiments, the transposase is a dimer. In some embodiments, the transposase is a Tn5 dimer. In some embodiments, the Tn5 dimer is hyperactive. Transposon sequence

[0061] The term "transposon end" refers to double-stranded nucleic acid DNA containing at least one transposition recognition site ("transposon end sequence") that forms a complex with a transposase or integrase enzyme to provide a transposome complex for an in vitro transposition reaction. Transposon sequences useful in the methods and compositions provided herein are provided in U.S. Patent Application Publication Nos. 2012 / 0208705 and 2012 / 0208724 and PCT Publication No. WO2012 / 061832, each of which is incorporated by reference in its entirety. In some embodiments, the transposon end is capable of forming a functional complex with a transposase in a transposition reaction. As non-limiting examples, transposon ends can include 19 bp outside end ("OE"), inside end ("IE"), or "mosaic end" ("ME") transposon ends recognized by wild-type or mutant Tn5 transposase, or the R1 and R2 transposon ends as described in U.S. Patent Application Publication No. 2010 / 0120098. Transposon ends can include any nucleic acid or nucleic acid analog suitable for forming a functional complex with a transposase or integrase enzyme in an in vitro transposition reaction. For example, the transposon ends can include DNA, RNA, modified bases, unnatural bases, and / or modified backbones, and can include nicks in one or both strands. While the term "DNA" is used throughout this disclosure in reference to the composition of the transposon ends, it should be understood that any suitable nucleic acid or nucleic acid analog may be utilized in the transposon ends.

[0062] The term "transferred strand" refers to the transferred portion of both transposon ends. Similarly, the term "non-transferred strand" refers to the non-transferred portion of both "transposon ends." The 3' end of the transferred strand is ligated or transferred to the target DNA in an in vitro transposition reaction. The non-transferred strand, which exhibits a transposon end sequence complementary to the transferred transposon end sequence, is not ligated or transferred to the target DNA in an in vitro transposition reaction.

[0063] The term "adapter" as used herein refers to a polynucleotide region that comprises at least one tag.Some embodiments include a transposome complex that includes a polynucleotide having a 3' portion that comprises a transposon end sequence and an adapter region that comprises at least one tag.The adapter sequence can include a linker region.

[0064] The term "tag," as used herein, refers to an oligonucleotide region having a sequence suitable for a desired intended purpose or application. A tag can include one or more sequences useful when inserted into a target nucleic acid, such as a fragmentation site (a sequence that can be cleaved chemically, biochemically, or photochemically at a determined time), a primer site, a barcode (used to identify one or more specific analytes), an affinity tag, a recognition site, and / or a reporter moiety (a moiety capable of emitting a signal, e.g., fluorescent, chemiluminescent, bioluminescent, phosphorescent, radioactive, calorific, electronic, or other signal). It is understood that any other suitable feature can be incorporated into a tag. In some embodiments, the tag comprises a sequence having a length between 5 and 200 bp, between 10 and 100 bp, or between 20 and 50 bp, or having a length of about 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 bp.

[0065] In some embodiments, the tag comprises one or more primer sites suitable for hybridization with primers (which may be attached to a solid surface, such as a bead or flow cell) for an amplification reaction, such as a cluster amplification and / or sequencing reaction. Exemplary sequences of primer binding sites include, but are not limited to, the following: AATGATACGGCGACCACCGAGATCTACAC (P5 sequence) and CAAGCAGAAGACGGCATACGAGAT (P7 sequence) and their complements. In some instances, the primer sequences include modified bases, such as vicinal diols or 8-oxo-guanine, that allow for subsequent enzymatic or chemical cleavage. In some embodiments, the tag comprises a barcode used in preparing template nucleic acid.As can be understood, the vast number of available barcodes allows each template nucleic acid molecule to comprise a unique identification.The unique identification of each molecule in a mixture of template nucleic acids can be used in several applications.For example, the uniquely identified molecule can be used to identify individual nucleic acid molecules in samples with multiple chromosomes, in genomes, in cell types, in cell disease conditions, and in species, for example, in haplotype sequencing, parental allele identification, metagenomic sequencing, and genome sample sequencing.Exemplary barcode sequences include but are not limited to TATAGCCT, ATAGAGGC, CCTATCCT, GGCTCTGA, AGGCGAAG, TAATCTTA, CAGGACGT, and GTACTGAC.

[0066] Methods for preparing transposon end sequences, transposons and transposome complexes are known in the art.

[0067] As used herein, the terms "nucleic acid" and "oligonucleotide" refer to at least two nucleotide monomers covalently linked together. Nucleic acids generally contain phosphodiester bonds and natural bases, but in some embodiments can include non-natural backbones and / or bases, as described, for example, in PCT Publication No. WO2016 / 130704. The nucleic acid can be DNA, e.g., genomic DNA or cDNA, RNA, or a hybrid, derived from a single cell, a single nucleus, multiple cells, multiple nuclei, or from multiple species, such as in metagenomic samples, e.g., from environmental samples, as well as from mixed samples, e.g., mixed tissue or mixed samples of different individuals of the same species, disease samples, e.g., cancer-related nucleic acids, etc. Nucleic acids can contain any combination of deoxyribonucleotides and ribonucleotides, and any combination of bases, including natural or non-natural, analog, or synthetic bases.

[0068] As used herein, the term "detection" and / or its grammatical equivalents can refer to identifying the presence or existence of an analyte, identifying individual components of the analyte, e.g., sequence information, and / or quantifying the amount of such an analyte. In some embodiments, detecting includes detecting the sequence of a tagged information molecule or amplicon produced by the methods described herein.

[0069] In some embodiments, target information molecules, cells, and / or nuclei can be obtained from any biological specimen containing DNA and / or mRNA, including, but not limited to, biological samples or patient samples. The source of the cells and / or cell nuclei can be, for example, bacteria, plants, parasites, insects, animals or mammals (e.g., rats, mice, monkeys, non-human primates, humans), or mixtures thereof. The terms "biological sample" or "patient sample" as used herein include samples of one or more cells, tissues, or bodily fluids. Samples can include natural or processed samples, such as macerated tissue or lysates. "Body fluids" can include, but are not limited to, blood, serum, plasma, saliva, cerebrospinal fluid, bronchial aspirate, pleural effusion, bursal fluid, synovial fluid, tears, lactal duct fluid, lymph, mucus, sputum, urine, feces, amniotic fluid, or semen, or mixtures thereof. Tissues can include biopsy samples, tumor samples, or skin. A sample can include a bodily fluid containing less than about 1% (w / w) total cellular material, such as plasma or serum. A sample can include specimens of natural or synthetic origin (i.e., cell samples that have been rendered acellular).

[0070] In some embodiments, the method further comprises treating the tagged fragmented nucleic acids with a polymerase, such as a strand-displacing polymerase (e.g., Bst polymerase or Phi29 polymerase), to remove the transposase from the tagged fragmented material. In such embodiments, the tagged fragmented nucleic acids within the nucleus can be treated with a polymerase (e.g., a strand-displacing polymerase) and sodium dodecyl sulfate to enable PCR amplification. In other embodiments, the tagged information molecule can be treated with a polymerase, such as a strand-displacing polymerase, to enable PCR amplification.

[0071] In some embodiments, the method further comprises contacting the translocated cell nuclei with deionized water. Thus, the method can further comprise removing analytical complexes, such as tagged nucleic acids or antibody-protein / peptide complexes, from the treated cells or nuclei by treating the cells or nuclei with deionized water. Such treatment results in an osmotic influx of water, thereby swelling the nuclear body. In some embodiments, treating the cells or nuclei with a nuclear permeability enhancer comprises treatment with deionized water. Such swelling serves to further increase the size of nuclear pores, allowing further influx of transposome complexes into the nuclear space (see FIG. 10 ).

[0072] In some embodiments, treatment with a nuclear permeabilizing agent is performed in the presence of a high-salt buffer, which creates an osmotic pressure difference across the nuclear membrane such that nuclear material is expelled from the nuclear structure. Such treatment may allow for temporal control over the disruption of the nuclear membrane (see Figure 10).

[0073] Even without treating the nucleus with a permeabilizing agent, a small amount of the transposome complex gains access to nuclear material. Thus, in some embodiments, the method includes reacting a cytoplasmic information molecule with a first analytical biomolecule in the presence of a nuclear pore blocker but in the absence of a nuclear permeabilizing agent. In a subsequent step, the nuclear pore blocker and / or the cytoplasmic material is optionally removed, and the remaining cellular material is treated with a second analytical biomolecule in the presence of a nuclear permeabilizing agent. In this way, the cytoplasmic and nuclear components are orthogonally tagged. Suitable nuclear pore blockers include wheat germ agglutinin, leptomycin B, antibodies specific for the NPC (see, e.g., Adam, SA et al., J. Cell Biol. 1990, 111(3), 807-816; Moore et al., Cell 1992, 69(6), 939-950), or agents such as other ligands, enzymes, or biomolecules that bind to NPCs or gated ion channels. Contiguous conserved elements

[0074] In some embodiments, proximity storage elements (CEs) are used to store single cell and / or single nucleus information. In some embodiments, proximity information of single nuclei is stored by compartmentalization of individual nuclei or individual cells. In some embodiments, such compartmentalization is achieved by localizing single nuclei or cells in physical compartments such as microwells, microdroplets, or microcapsules, or by using hydrogels or by immobilizing genetic material on or within microbeads. Such processes effectively maintain the cell proximity and / or nucleus proximity during translocation while providing more direct access to the nuclear material. Such approaches also reduce cross-contamination of nuclear material from separate nuclei. In some embodiments, CEs can contain target nucleic acids.

[0075] In some embodiments, the method includes sequencing the nucleic acid stored, embedded, or contained within the contiguous storage element. In particular, embodiments of the methods and compositions provided herein relate to preparing a nucleic acid template and obtaining sequence data therefrom. The methods and compositions provided herein are related to the methods and compositions provided in U.S. Patent Application Publication Nos. 2012 / 0208705 and 2012 / 0208724 and PCT Publication No. WO2012 / 061832, each of which is incorporated by reference in its entirety. Some embodiments described herein relate to preparing DNA within a contiguous storage element(s) to obtain phase and sequence assembly information from a target nucleic acid, and obtaining phase and sequence assembly sequence information from such a template. Certain embodiments provided herein relate to the use of an integrase, such as a transposase, to maintain the physical proximity of the associated ends of fragmented nucleic acids; and the use of combinatorial indexing to create individual libraries from each contiguous storage element. Obtaining haplotype information involves distinguishing between different alleles (e.g., SNPs, genetic abnormalities, etc.) in a target nucleic acid. Such methods are useful for characterizing different alleles in a target nucleic acid and reducing the error rate in sequence information.

[0076] In some embodiments, the CE comprises a cell or a single cell. In some embodiments, the CE comprises nucleic acids from the cell or single cell, such as DNA, mRNA, or cDNA; macromolecules from the cell or single cell, including proteins, polysaccharides, lipids, and nucleic acids; and small molecules from the cell or single cell, such as primary metabolites, secondary metabolites, and natural products. In some embodiments, the nucleic acids are amplified, such as by PCR or whole genome amplification, before forming the CE comprising the nucleic acids. In some embodiments, analysis of the DNA and mRNA can be performed in parallel. In some embodiments, the cell membrane is a CE.

[0077] In some embodiments, the CE comprises a nucleus or a single nucleus. In some embodiments, the CE comprises nucleic acid from a nucleus or a single nucleus. In some embodiments, the nuclear membrane is a CE.

[0078] As shown in FIG. 2, the present disclosure contemplates various mechanisms for accessing cellular and nuclear compartments that maintain proximity information. In some embodiments, the cell is a CE element in which the nucleus (e.g., nuclear pore complex) is blocked from the entry of analytical biomolecules or reagents required to enable the interaction of analytical biomolecules with nuclear information molecules (FIG. 2A). The nuclear membrane is thus a CE that allows for differential reaction of cytoplasmic versus nuclear contents. In such instances, the cell membrane can be used as a second CE, or the cell can be compartmentalized in an additional CE. In some embodiments, nuclear contents are accessed by permeabilizing the cell membrane, using cell-permeable biomolecules, and / or permeabilizing the nuclear membrane (FIG. 2B). In other embodiments, the nuclear membrane of an isolated nucleus can function as a CE when treated with a nuclear permeabilizing agent (FIG. 2C). All of these methods can be used in conjunction with additional CEs, such as microdroplets, microbeads (hydrogels), microwells, and other types of compartments, to maintain information proximity.

[0079] Some embodiments are methods for preparing libraries from RNA, DNA, or a mixture thereof, and obtaining single cell data for RNA, DNA, or both RNA and DNA. Some embodiments are methods for preparing libraries from RNA, DNA, protein, or any combination thereof.

[0080] In some embodiments, the cell is lysed in the CE so that multiple target information molecules within the single cell are released within the CE. In some instances, the cell is lysed, but the nucleus is not lysed, so that cytoplasmic components are released within the CE and the nucleus remains intact.

[0081] In some embodiments, multiple CEs are used in conjunction with a combinatorial tagging approach so that nucleic acids or other information molecules are physically partitioned and / or orthogonally tagged.

[0082] In one embodiment, the target can be diluted into a CE, such as a droplet. Optional whole genome amplification can be used to obtain sequence information from an amount of template nucleic acid equivalent to approximately a haploid equivalent of the target nucleic acid.

[0083] In some embodiments, multiple combinatorial labeling schemes can be used for components within a single cell, such as proteins, organelles, lipids, or cell membranes, in addition to the nucleic acids, so that components within a single cell or nucleus can be distinguished from components from different single cells or nuclei. In some embodiments, a CE can contain the components within a single cell or a single nucleus. In some embodiments, the components of a single cell and / or a single nucleus within a CE have a unique, identifiable label(s) that are different from the components of a single cell and / or a nucleus within a different CE.

[0084] In some embodiments, multiple combinatorial barcoding schemes can be used. In some embodiments, such combinatorial barcoding and combinatorial labeling can be performed within a CE containing a single cell. In some embodiments, such combinatorial barcoding and combinatorial labeling can be performed in parallel on multiple CEs containing single cells or nuclei.

[0085] A proximity storage element (CE) is a physical entity that stores at least two or more or all analytes in close proximity (or close proximity) throughout one or more assay steps, provides access to assay reagents, and can be pooled and divided multiple times without losing the proximity of the analytes.

[0086] In some embodiments, the CE can be a solid support. In one embodiment, the CE can be an emulsion or a droplet. In some embodiments, the CE is a gel, a hydrogel, or gel beads. In some embodiments, the CE can include a solid support such as beads. In some embodiments, the beads can further include antibodies, oligonucleotides, and / or barcodes. In another embodiment, the CE can comprise DNA nanoballs created by WGA, RCA, or condensation of any nucleic acid reagent.

[0087] In some embodiments, CEs can be created by embedding nucleic acids from cells or single cells or their amplification products (e.g., by WGA) in a polymer matrix, such as agarose, polyacrylamide, or alginate. In some embodiments, the proximity of the contents of the cells or single cells within a CE is maintained by preserving the physical proximity of the components to each other through encapsulation (e.g., within a polymer matrix), immobilization on beads, or encapsulation, effectively maintaining proximity information within the CE through repeated rounds of pooling and redistribution. Features such as the ability for a group of CEs to be independently pooled and divided, reacted with assay reagents, and pooled and divided again, while still maintaining the proximity of the analytes that make up the individual CEs, enable combinatorial indexing through different division and pooling steps.

[0088] In some embodiments, the analytes in the proximal storage elements are accessible to assay reagents including aqueous solutions, enzymes (e.g., fragmentases, polymerases, ligases, transposases, kinases, restriction endonucleases, proteases, phosphatases, or lipases), nucleic acid adapters, nucleic acid barcodes, and / or labels.

[0089] In some embodiments, one or more analytes of the CE are labeled with one or more labels. Exemplary labels include, but are not limited to, DNA barcodes or indicators, fluorescent labels, chemiluminescent labels, RNA barcodes or indicators, radioactive labels, antibodies containing labels, and beads containing labels.

[0090] In some embodiments, the method can include the steps of: (a) compartmentalizing a CE containing a target nucleic acid into a plurality of first containers; (b) providing a first index to the target nucleic acid in each first container, thereby obtaining a first indexed nucleic acid; (c) combining the first indexed nucleic acids; (d) compartmentalizing the first indexed template nucleic acid into a plurality of second containers; and (e) providing a second index to the first indexed template nucleic acid in each second container, thereby obtaining a second indexed nucleic acid. Steps a-e above can be continued with additional cycles of one or more steps in the a-e series to obtain additional virtual compartments. This method of combinatorial indexing can be used to effectively generate a large number of virtual compartments from a limited number of physical compartments.

[0091] In some embodiments, a method can include (a) providing a CE containing a non-nucleic acid analyte (e.g., a protein) with an attached nucleic acid reporter; (b) compartmentalizing the CE into a plurality of first containers; (c) providing a first index to the target nucleic acid reporter in each first container, thereby obtaining a first indexed target nucleic acid reporter; (d) combining the first indexed nucleic acid reporters; (e) compartmentalizing the first indexed CE into a plurality of second containers; and (f) providing a second index to the first indexed nucleic acid reporter in each second container, thereby obtaining a second indexed nucleic acid reporter. Steps a-f above can be continued with additional cycles of one or more steps in the a-f series to obtain additional virtual compartments. The compartmentalization step can further include a nucleic acid amplification or capture step, such as PLA, PEA, or other techniques for capturing or amplifying nucleic acids.

[0092] In some embodiments, the nucleic acid(s) can be embedded in a matrix that confines the nucleic acid to a defined space but allows reagent access to perform steps including, but not limited to, amplification (PCR, whole genome amplification, random primer extension, etc.), ligation, transposition, hybridization, restriction digestion, and DNA mutagenesis. Examples of mutagenesis include, but are not limited to, error-prone extension, alkylation, bisulfite conversion, and activation-induced (cytidine) deaminase.

[0093] In some embodiments, the analyte of interest in CE is a protein. The protein can be labeled with a barcode or surrogate label. The barcode or label can be read using conventional array or sequence-based methods. Proteins can be detected using a proximity ligation approach and antibody-target sequences, along with detection of the barcode sequence to establish the identity and abundance of the protein in each individual cell (Fredriksson et al., Nature Biotechnology 20:473-477 (2002)), which is incorporated herein by reference). Proteins can be labeled by a variety of methods known to those skilled in the art (www.piercenet.com / cat / protein-antibody-labeling), including in vivo and in vitro site-specific chemical labeling strategies.

[0094] In some embodiments, the adjacent storage elements can contain a single cell, and nucleic acids from this cell can be amplified. Each adjacent storage element can then be uniquely indexed using a combinatorial indexing scheme. In some embodiments, a combinatorial indexing approach can be used. For example, initial indexes are attached to genomic DNA or cDNA by standard library preparation techniques using fragmentation (enzymatic) and adapter ligation, or by tagged fragmentation using a transposase complex. Subsequent indexes are attached to the library via ligation or PCR. Ligation is preferred because it is easy to add indexed adapters in a sequential manner. The final step can involve simple indexing PCR or ligation and PCR.

[0095] Differential indexing of cellular biomolecules: Cells and subcellular compartments containing biomolecules such as DNA, RNA, mitochondrial DNA, and proteins can be specifically and orthogonally indexed for genomic assays by preserving cellular proximity. This can be achieved by differential targeting of membrane proteins of subcellular compartments (plasma membrane, nuclear membrane, and mitochondrial membrane), which allows selective transport of ions or other proteins to certain compartments but not others. For example, nuclear membrane proteins or mitochondrial proteins can be blocked by blocking molecules such as wheat germ agglutinin, leptomycin B, and antibodies specific for NPC, while cyclosporin A, oligomycin, and other compounds block mitochondrial membrane proteins. This approach enables indexing of genetic material within subcellular compartments of cells (including but not limited to translocations, splice ligation, etc.), resulting in better and more precise sequencing readouts that are specifically targeted within the cell.

[0096] In some aspects, described herein are methods for differentially indexing informational molecules from different compartments of a cell. In some aspects, such methods include: Selectively delivering a first analytical biomolecule comprising a first tag to a first cellular compartment selected from the group consisting of a cell nucleus, a cytoplasm, and a mitochondria, wherein the first cellular compartment comprises the first informational biomolecule; reacting the first analytical biomolecule with the first information molecule to provide a tagged first information molecule; selectively delivering a second analytical biomolecule comprising a second tag to a second cellular compartment selected from the group consisting of a cell nucleus, a cytoplasm, and a mitochondria, the second cellular compartment comprising a second informational molecule and distinct from the first cellular compartment; reacting the second analytical biomolecule with the second information molecule to provide a tagged second information molecule, wherein the first and second tags are different; Includes:

[0097] Some embodiments are methods for differentially indexing cytoplasmic information molecules and nuclear information molecules, the method comprising: (a) delivering a first analytical biomolecule comprising a first tag to the cytoplasm of a cell without substantial delivery of the first analytical biomolecule to the nucleus of the cell; (b) reacting the first analytical biomolecule with the cytoplasmic information molecule, thereby attaching the first tag or its complement to the cytoplasmic information molecule to provide a tagged cytoplasmic information molecule; (c) treating the cell with a second analytical biomolecule comprising a nuclear permeability enhancer and a second tag, thereby delivering the second analytical biomolecule to the nucleus of the cell; and (d) reacting the second analytical biomolecule with a nuclear information molecule, thereby attaching the second tag or its complement to the nuclear information molecule to provide a tagged nuclear information molecule. In some embodiments, the delivery to the cytoplasm further comprises treating the cells with a nuclear pore blocker and / or a mitochondrial pore blocker. In some embodiments, the method further comprises lysing the cells to release the tagged molecules. In some embodiments, the first and second tags are orthogonal or can be separately targeted in a subsequent manipulation step, such as amplification, so that they are distinguishable when detected. In some embodiments, the cytoplasmic information molecule is RNA. In some embodiments, the nuclear information molecule is DNA or genomic DNA (gDNA). In some embodiments, the analytical biomolecule is a transposome. In some embodiments, the method further comprises detecting the tagged molecule or an amplicon thereof. In some embodiments, the method further comprises selective amplification of the tagged molecule (e.g., the first tagged molecule exceeds the second tagged molecule, or vice versa).

[0098] In other aspects, the method includes: (a) reacting a first analytical biomolecule comprising a first tag with a mitochondrial information molecule to produce a tagged mitochondrial information molecule; and (b) reacting a second analytical biomolecule comprising a second tag with a nuclear information molecule to produce a tagged nuclear information molecule. In some embodiments, the method further includes delivering the first analytical biomolecule to the mitochondria by treating cells with a mitochondrial membrane permeability enhancer and the first analytical biomolecule. In some embodiments, the delivery to the mitochondria further includes treating the cells with a nuclear pore blocker. In some embodiments, the delivery to the mitochondria does not include substantial delivery of the first analytical biomolecule to the nucleus of the cell. In some aspects, the mitochondrial information molecule is DNA. In some aspects, the nuclear information molecule is DNA or genomic DNA (gDNA). In some embodiments, the first and second tags are orthogonal or can be separately targeted in subsequent manipulation steps, such as amplification, so as to be distinguishable when detected. In some embodiments, the analytical biomolecule is a transposome. In some embodiments, the method further comprises detecting the tagged molecule or an amplicon thereof.

[0099] In some aspects, selective delivery of the first analytical biomolecule to the first cellular compartment comprises treating the cells with a permeability enhancer for the first cellular compartment. In some embodiments, selective delivery of the first analytical biomolecule to the first cellular compartment comprises treating the cells with a permeability blocker for the second cellular compartment. In some embodiments, selective delivery of the second analytical biomolecule to the second cellular compartment comprises treating the cells with a permeability enhancer for the second cellular compartment. In some embodiments, selective delivery of the first analytical biomolecule occurs without substantial delivery of the first analytical biomolecule to the second cellular compartment.

[0100] In some embodiments, the first cellular compartment is the cytoplasm, and the first information molecule is a cytoplasmic information molecule; (a) the second cellular compartment is the nucleus, and the second information molecule is a nuclear information molecule; or (b) the second cellular compartment is the mitochondria, and the second information molecule is a mitochondrial information molecule. In some embodiments, the selective delivery of the first analytical biomolecule to the cytoplasm is achieved in the presence of a nuclear pore blocker and / or a mitochondrial pore blocker. In some embodiments, the delivery of the second analytical biomolecule is achieved in the presence of a nuclear permeabilization enhancer or a mitochondrial permeabilization enhancer.

[0101] As used herein, a "mitochondrial permeability enhancer" increases the permeability of mitochondria to reagents such as enzymes. Such an enhancer does not lyse the mitochondria. Exemplary mitochondrial permeability enhancers include agents that increase flux through the mitochondrial pore. Examples include inorganic polyphosphates (see, e.g., Seidlmayer et al., J. Gen. Physiol. 2012, 139(5), 321-331).

[0102] As used herein, the term "selective delivery" or its grammatical variants refer to the enhanced delivery of an agent to one cellular compartment over another.Selective delivery can be achieved by increasing the permeability of a compartment or blocking the permeability of a compartment compared to the permeability of the compartment in the untreated state.Selective delivery does not need to be 100% selective, but can include an increase in the relative proportion of tagged information molecules from different compartments in the resulting library. Analysis and sequencing

[0103] Some of the methods provided herein include methods for analyzing nucleic acids, including preparing a library of template nucleic acids for a target nucleic acid, obtaining sequence data from the library of template nucleic acids, and assembling a sequence representation of the target nucleic acid from the sequence data.

[0104] Target nucleic acid and template nucleic acid can be enriched for specific sequences of interest using various methods well known in the art.Examples of such methods are provided in PCT Publication No. WO2012 / 108864, the entire contents of which are incorporated herein by reference.In some embodiments, nucleic acid can be further enriched in the method of preparing template library.For example, nucleic acid can be enriched for specific sequences before tagged fragmentation of nucleic acid, after tagged fragmentation, and / or after amplification.

[0105] Some embodiments of the technology described herein include methods of analyzing a template nucleic acid, in which sequencing information can be obtained from the template nucleic acid and used to generate a sequence representation of one or more target nucleic acids.

[0106] Some embodiments of the sequencing methods described herein may use a linked read data strategy. The linked read data strategy may include identifying sequencing data that link at least two sequencing read data. For example, a first sequencing read data may contain a first marker, and a second sequencing read data may contain a second marker. When the first and second markers are adjacent in the sequence representation of the target nucleic acid, sequencing data can be identified from each sequencing read data. In some embodiments of the compositions and methods described herein, the marker may include a first barcode sequence and a second barcode sequence, and the first barcode sequence may be paired with the second barcode sequence. In other embodiments, the marker may include a first host tag and a second host tag. In more embodiments, the marker may include a first barcode sequence with a first host tag and a second barcode sequence with a second host tag.

[0107] An exemplary embodiment of a method for sequencing a template nucleic acid can include the following steps: (a) sequencing a first barcode sequence using a sequencing primer that hybridizes to a first primer site; and (b) sequencing a second barcode sequence using a sequencing primer that hybridizes to a second primer site. The result is two sequence reads that serve to link the template nucleic acid to its genomic neighbors. Given sufficiently long reads and sufficiently short library fragments, these two reads can be merged informatically to form a , one long read can be generated that covers the entire fragment. Using the barcode sequence reads and the 9-nucleotide overlapping sequence present from the insertion, the reads can now be concatenated to their genomic neighbors to form a much longer "concatenated read" in silico.

[0108] As will be appreciated, a library containing template nucleic acids can contain overlapping nucleic acid fragments. Sequencing the overlapping nucleic acid fragments is advantageous in methods that include creating a consensus sequence for the overlapping fragments. Such methods can increase the accuracy of providing a consensus sequence for the template nucleic acid and / or a library of template nucleic acids.

[0109] In some embodiments, the analysis may involve DNA or RNA or protein, or any combination thereof, from a single cell, or from one or more cells and / or nuclear compartments, hi some embodiments, the analysis is performed across 10, 100, 1000, 10,000, 100,000, 1,000,000, 10,000,000, 100,000,000, 1,000,000,000 or more cells, or cell and / or nuclear compartments.

[0110] In some embodiments of the sequencing technology described herein, sequence analysis is carried out in real time.For example, real-time sequencing can be carried out by simultaneously acquiring and analyzing sequencing data.In some embodiments, the sequencing process for obtaining sequencing data can be terminated at various points, including after at least a portion of target nucleic acid sequence data is obtained or before the entire nucleic acid reading data is sequenced.Exemplary methods, systems and further embodiments are provided in International Patent Publication No. WO2010 / 062913, the disclosure of which is incorporated herein by reference in its entirety.

[0111] In an exemplary embodiment of the method for assembling short sequencing read data using a linked read data strategy, a transposon sequence containing a barcode is inserted into genomic DNA, a library is prepared, and sequencing data for a library of template nucleic acids is obtained. Template blocks can be assembled by identifying paired barcodes, and then larger contigs are assembled. In one embodiment, the assembled read data can be further assembled into larger contigs by code pairing using overlapping read data.

[0112] Some embodiments of the sequencing techniques described herein include error detection and correction features. Examples of errors can include errors in base calling during the sequencing process and errors in assembling fragments into larger contigs. As will be understood, error detection can include detecting the presence or likelihood of errors in a dataset, and therefore, detecting the location or number of errors may not be required. For error correction, information about the location and / or number of errors in a dataset is useful. Methods for error correction are well known in the art. Examples include the use of Hamming distance and checksum algorithms (see, e.g., U.S. Patent Application Publication No. 2010 / 0323348; U.S. Patent No. 7,574,305; and U.S. Patent No. 6,654,696, the disclosures of which are incorporated herein by reference in their entirety).

[0113] In some embodiments, cellular proteins and / or nuclear proteins can be analyzed, detected, and / or sequenced. In some embodiments, such proteins are uniquely labeled. In some embodiments, the proteins are stored, embedded, fixed, or contained in one or more CEs. Identification and sequencing can be performed using methods known in the art. In some embodiments, identification and / or sequencing of the proteins can be performed in conjunction with collecting sequence information of the nucleic acids.

[0114] In some embodiments, indexing can be achieved by generating indexing primers from oligonucleotides on beads containing the reverse complement sequence of the common library adapter during PCR (see Example 3 below). During PCR, for example, a P7 primer hybridizes to its complementary sequence at the 3' end of the oligonucleotide on the bead, and its extension results in the generation of fully functional indexed oligonucleotides. The amount of indexed oligonucleotide can be specifically controlled by the number of PCR cycles at an appropriate annealing temperature. The synthesized PCR primer then hybridizes to the B15 region of the library fragment introduced by transposition, allowing amplification to occur. The P7 primer can be biotinylated to enrich for ATAC-seq fragments after PCR for sequencing. solid support

[0115] The solid supports described herein can be used for sequencing and analysis. They can also be used as proximity storage elements. Solid supports can be two-dimensional or three-dimensional, and can include a planar surface (e.g., a glass slide), or can be shaped. Solid supports can include glass (e.g., controlled pore glass (CPG)), quartz, plastics (such as polystyrene (low-crosslinked and high-crosslinked polystyrene), polycarbonate, polypropylene, and poly(methyl methacrylate)), acrylic copolymers, polyamides, silicon, metals (e.g., alkanethiolate-derivatized gold), cellulose, nylon, latex, dextran, gel matrices (e.g., silica gel), polyacrolein, or composite materials.

[0116] Suitable three-dimensional solid supports include, for example, spheres, microparticles, beads, nanoparticles, polymer matrices such as agarose, polyacrylamide, and alginate, membranes, slides, plates, microfabricated chips, tubes (e.g., capillary tubes), microwells, microfluidic devices, channels, filters, flow cells, and structures suitable for immobilizing nucleic acids, proteins, or cells. Solid supports can also include planar arrays or matrices that can have regions containing populations of template nucleic acids or primers. Examples include nucleoside-derivatized CPG and polystyrene slides; derivatized magnetic slides; polyethylene glycol-grafted polystyrene, and the like.

[0117] In some embodiments, the solid support comprises a microsphere or bead. By "microsphere" or "bead" or "particle" or grammatical equivalents herein is meant a small, discrete particle that may be spherical, non-spherical, or irregularly shaped. Suitable bead compositions include, but are not limited to, plastic, ceramic, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoriasol, carbon graphite, titanium dioxide, latex, or cross-linked dextran such as Sepharose, cellulose, nylon, cross-linked micelles, and Teflon®, as well as any other material outlined herein for solid supports. In certain embodiments, the microspheres or beads are magnetically and / or color-coated to enable separation and manipulation. The beads or microspheres may be solid or hollow and may be porous. The porosity of the beads or microspheres can be tailored, if desired, by appropriate selection of materials and formation methods. Bead sizes range from nanometers, i.e., 100 nm, to millimeters, i.e., 1 mm, with beads of about 0.2 microns to about 200 microns being preferred, and beads of about 0.5 to about 5 microns being particularly preferred, although smaller or larger beads can be used in some embodiments.

[0118] In some embodiments, the beads may comprise antibodies or other affinity probes (for exemplary attachment protocols, see Immobilized Biomolecules in Analysis. A Practical Approach, Cass T, Ligler F S (eds.), Oxford University Press, New York, 1998, pp. 1-14, incorporated herein by reference). In some embodiments, the antibodies may be monoclonal; in other embodiments, the antibodies may be polyclonal. In some embodiments, the antibodies may be specific for cell surface epitopes. In some embodiments, the antibodies may be specific for proteins inside the cells.

[0119] In some embodiments, the nucleic acid templates provided herein can be attached to a solid support, and various methods well known in the art can be used to attach, tether, or immobilize nucleic acids to the surface of the solid support.

[0120] In some embodiments, the solid support is capable of encapsulating the cell, the cell and a cellular and nuclear compartment of the cell, the cellular and nuclear compartment of the cell, or the nuclear compartment of the cell. [Example]

[0121] The following examples are offered to illustrate, but not to limit, the disclosure provided herein. Example 1 Tagged fragmentation of nuclear DNA by cell-permeable clathrin inhibitors

[0122] Using standard cell culture protocols, extract 1 x 10 cells from a tissue culture flask for the tagged fragmentation reaction. 6K562 cells (human lymphoma cell line) were harvested. All cell pelleting / centrifugation steps were performed at 300 × g for 3 minutes at 4 °C. Freshly isolated cells were centrifuged and resuspended in ice-cold PBS (phosphate-buffered saline). The cells were pelleted again, suspended in 200 μL ice-cold cell lysis buffer (Tris / NaCl / octylphenoxypolyethoxyethanol (IGEPAL CA-630 detergent)), and incubated on ice for 5 minutes. Following this, nuclei were spun down at 300 × g for 3 minutes, washed once with 200 μL lysis buffer, and pelleted nuclei were transposed with Nextera Tn5 transposase (TDE1) for 30 minutes at 55 °C in 1× Tagment DNA buffer (PN: 15027866) supplemented with (a) PitStop-2 in DMSO to obtain a 30 μM final PitStop-2 concentration (test nuclei) or (b) 2% DMSO (control nuclei). Nuclei from each sample were pelleted and most of the supernatant was carefully removed. Example 2 Removal of transposase from tagged fragmented DNA by strand-displacing polymerase

[0123] Tagged fragmented nuclei (test and control pools) from the previous examples were resuspended in a Phi29 reaction mixture containing 50 mM Tris-HCl pH 7.5, 10 mM MgCl, 10 mM (NH)SO, 4 mM DTT, 0.005% SDS, 200 μM each dNTP, and 10 units of Phi29 DNA polymerase (New England BioLabs), and the resulting mixture was incubated in a thermocycler for 30 minutes at 30° C. Nuclei were then pelleted by gentle centrifugation in a benchtop strip tube centrifuge and resuspended in a final volume of 30 μL of 30% Optiprep (Sigma-Aldrich) in Tris buffer. Example 3 Visualization of transposome access to the nucleus by FAM-labeled complexes

[0124] FAM-labeled transposome complexes were imported into nuclear compartments using the method described in Example 1. Nuclei were isolated and treated as described in Example 1 using Nextera Tn5 transposase complexed with transposon sequences labeled at the 5' end with FAM (6-FAM, Integrated DNA Technologies) during oligonucleotide synthesis, as well as a 2% DMSO control and various concentrations of PitStop-2 (10 μM, 30 μM, and 60 μM). As shown in Figure 3, treatment with PitStop-2 increased the influx of FAM-labeled transposomes into the nuclear space, particularly the nuclear periphery (indicated by arrows). Example 4 Effect of PitStop-2 treatment on DNA library generation

[0125] Isolated nuclei (50,000) were transposed using the Nextera Tn5 kit in the presence of different concentrations of PitStop-2 (0–80 μM) as described in the previous example. Excess transposomes were removed by brief centrifugation, and the resulting nuclear pellet was treated with Qiagen protease (ID 19155) for 1 h at 50°C, followed by 10 min at 80°C. The resulting lysate was analyzed by 25 cycles (cy) of qPCR performed in a Bio-Rad thermocycler using KAPA SYBR Fast master mix and primers annealing to the mosaic end (ME) portion of the transposon. Cq values ​​corresponding to different PitStop-2 concentrations, as well as the delta Cq between PitStop-2 samples and control samples (without PitStop-2), are displayed in Table 1. A Cq value of 1 roughly corresponds to a two-fold difference in DNA input. As shown in the table, treatment of intact nuclei with PitStop-2 increases library yield compared to untreated controls. A Cq value of 1 roughly corresponds to a 2-fold difference in DNA input. [Table 1A]

[0126] Additional experiments were performed using various concentrations of PitStop-2 and Tn5 and TsTn5 transposases. Data from these experiments are shown in Table 1B. [Table 1B] Example 5 Sequencing of transposition libraries

[0127] Using the methods described in the preceding Examples, DNA libraries were generated from K562 (human lymphoma cell line) nuclear contents. The libraries were sequenced, and the results demonstrated that PitStop-2 treatment enhanced access to intergenic and open chromatin regions accessible to transposases. As shown in Figure 4A for the ATAC-seq profile across a portion of chromosome 12, the library predominantly targeted intergenic regions at all PitStop-2 concentrations. As shown in Figure 4B, a more detailed analysis of the sequencing data, showing basic metrics of whole-genome sequencing coverage, demonstrated greater diversity and specificity in PitStop-2-treated samples over controls, consistent with improved library yields from PitStop-2. Figure 4C shows normalized coverage across promoter and coding regions of the human genome. The data indicate that treatment with 30 and 60 μM PitStop-2 improved the ATAC-seq profile over controls, demonstrating increased coverage across intergenic regions. These results demonstrate that pitstop-2 treatment enhances the access of the transposome complex into the nucleus and improves the efficiency of nuclear translocation. Example 6 Indexing translocated nuclear DNA in the presence of PitStop-2

[0128] Genomic DNA transposed using the Nextera Tn5 kit in the presence of Pitstop-2 (at concentrations of 0, 10, 30, and 60 μM) as described above was released from nuclei and captured on indexed beads containing oligonucleotide capture sequences. The bead-captured DNA was further gap-fill ligated to covalently link both strands of genomic DNA to a common sequence (containing a unique index) and amplified by PCR. When analyzed by agarose gel electrophoresis, the amplified libraries showed a clear increase in transposition yield with the use of Pitstop-2 (Figure 5). The increase in band intensity correlated with increasing Pitstop-2 concentration. Corresponding DNA fragments encompassed by a distinct number of nucleosomes in the resulting libraries contained "nucleosome banding," indicating successful ATAC-seq-tagged fragmentation in nucleosome-free regions.

[0129] In separate experiments, FAM-labeled transposition material obtained from treatment with PitStop-2 (at concentrations of 0, 10, 30, and 60 μM) using the method described above was enriched on beads bearing capture oligonucleotides, and the beads were analyzed by flow cytometry to assess capture efficiency. Consistent with previous results, the FAM-labeled transposition library prepared by PitStop-2 treatment showed enhanced bead capture rates over the control pool (Table 2). [Table 2] Example 7 Removal of transposase by strand-displacing polymerase

[0130] In certain transposition library preparation methods, removal of the transposase from the DNA causes further fragmentation of the tagged fragmented DNA. In contrast, removal of the transposase using strand displacement amplification maintains the proximity of transposed nuclei and the individual libraries of all nuclei associated with a single cell.

[0131] As an alternative to purifying gDNA after the tagged fragmentation step and before amplification, transposase removal and amplification can be achieved in a single step using a strand-displacing polymerase. Unpurified nuclear tagged fragmentation products from intact nuclei (24 ng), prepared as described in the previous example in the presence of 30 μM PitStop-2, were treated with Illumina NPM PCR Master Mix, strand-displacing polymerase (Bst), and low concentrations of SDS (0.0025%–0.04%). As shown in Figure 6, the addition of Bst improved the amplification efficiency of tagged fragmented DNA.

[0132] In a further experiment, a strand-displacement polymerase was used to generate a sequencing library from transposed pelleted nuclei, removing the transposase from the tagged fragmented DNA. No sequencing library was observed in the supernatant after strand-displacement amplification, demonstrating that DNA fragments had not "leaked" from the nuclei into the supernatant. Nuclei can be used as "compartments" to perform reactions and assay steps without losing proximity information about the proximity or direct contact of components of a single cell. Example 8 ATAC-seq library yield from unpurified nuclei

[0133] Treatment of nuclei with PitStop-2 (10 and 100 μM) as described in the preceding examples increased the yield of ATAC-seq libraries generated from crude nuclear samples, as shown by analysis of 1 μL of each ATAC-seq library on a high-sensitivity chip in a BioAnalyzer instrument. The concentration of each library was determined on the BioAnalyzer over a library range of 150 to 1,000 bp, plotted against each PitStop-2 concentration (Figure 7A). Additional experiments performed with various PitStop-2 concentrations (5, 10, 30, 50, 100, and 200 μM) produced enhanced library yields over libraries produced in the absence of PitStop-2, as shown by spectrophotometric analysis (Table 3). [Table 3]

[0134] Figure 7B shows the ATAC-seq profile across a portion of chromosome 6 for studies using 0 and 100 μM PitStop-2. Example 9 RNA output from the nucleus

[0135] PitStop-2 treatment increases RNA output by improving cDNA synthesis from nuclear mRNA. K562 cells were lysed with 0.1% NP40. Nuclei and cytoplasm were separated, and nuclei were washed twice. Then, reverse transcription / quantitative PCR protocols were performed using (a) no additives, (b) 0.1% SDS, or (c) 30 μM PitStop-2 (ThermoFisher Maxima HT RT Kit, Kapa qPCR Kit, RPLP0 PCR primers). Relative cDNA synthesis efficiency was reported using the delta Ct between without and with reverse transcription as a metric. PitStop-2 treatment increased cDNA synthesis from nuclei by 4-5-fold compared to untreated nuclei (Table 4). [Table 4] Example 10 Preparation of indexed beads

[0136] 30 μm diameter and 1 × 10 7 Beads with surface functionalization to allow oligonucleotide coupling (e.g., hydrazine-aldehyde, epoxide-amine, etc.) at a density of 1 x 10 beads were washed in deionized HO. The washed beads were then diluted to 1 x 10 5The beads were added to each well of a 96-well plate at a concentration of 50 μL per well. Subsequently, 500 pmoles of a unique 5' aldehyde-indexed oligo_1 ( / 5FormInd / CCGAGCCCACGAGAC INDEX1 GACTTGTC) was added to each well, resulting in a final reaction mixture volume of 50 μL per well. The plate was sealed to avoid evaporation and incubated overnight at 37°C in a rotary incubator. The beads were pooled and washed three times with 0.1x TE / 0.1% Tween-20. The washed beads were distributed to individual wells of a 96-well plate in the same manner as previously described, and a unique 5' phosphorylated indicator oligo_2 ( / 5Phos / TAGAGCAT INDEX2 ATCTCGTATGCCGTCTTCTGCTTG), a splint oligo, was added along with T4 DNA ligase suspended in T4 DNA ligase buffer. The ligation reaction was allowed to proceed overnight at room temperature, then the beads from all wells were finally pooled together and washed three times with 0.1x TE / 0.1% Tween-20. Example 11 "On-the-fly" index primer generation

[0137] Indexing during PCR using either a mixture of nuclei or droplets requires a panel of individually indexed PCR primers displayed on combinatorially synthesized beads. These primers can be cleaved from the beads before use in PCR, or they can be oligonucleotides ("seeding oligos") with reverse-complementary sequences to the actual PCR primers. In the latter case, a common primer in the PCR mixture (e.g., P5 or P7) will hybridize to the indexed "seeding oligo" on the bead, producing the indexed primer used in PCR. The density of the "seeding oligos" can be adjusted to optimize PCR, with each round of PCR generating additional amounts of indexed PCR primers. As shown in Figure 8A, seeding oligos with reverse-complementary sequences to the indexed PCR primers are coupled to the beads. The PCR mixture is replenished with common primers that anneal to the "seeding oligos" and, by extension in each PCR cycle, generate the primers used for library amplification.

[0138] In one experiment, conjugated beads containing an indexing oligo (B15', nuclei index, P7') with the reverse complement of P7 at its 3' end were added to a PCR master mix at 250 beads / μL. A master mix composed of Nextera PCR Master Mix (NPM), 0.01% SDS, 0.5 μM sample indexing primers (P5, sample index and A14'), 0.5 μM P7 primer, and 30% Optiprep was added to well 1 on a drop generator chip. Nuclei (6 × 10 4(1000 pieces) were added to well 2 along with 250 beads / µL suspended in 30% Optiprep. An indexing primer was generated from the oligo on the bead during PCR by hybridization of P7 to its 3' end, extension, and denaturation removal from the bead. The P7 primer can also be biotinylated to enrich for ATAC-seq fragments after PCR for sequencing. The synthesized PCR primer then hybridizes to the B15 region of the library fragments generated by transposition, thereby allowing amplification. The PCR parameters are as follows: 73°C for 3 minutes, initial extension at 98°C for 30 seconds, 25 cycles of 98°C for 10 seconds, 56°C for 30 seconds, and 73°C for 30 seconds.

[0139] In other experiments, seeding oligonucleotides were attached to beads at different concentrations, and these beads were used in PCR as a source of one of the PCR primers, alongside a positive control containing both PCR primers and a negative control with only one PCR primer. As shown in Figure 8B, libraries generated with beads coupled with a "seeding oligo" provide a sufficient amount of the second PCR primer to support efficient amplification. Figure 6B shows the amplification of libraries with beads bearing either two PCR oligonucleotides (+ control) or one PCR oligonucleotide and a seeding oligonucleotide (5, 50, and 500 pmol beads) and the reagents used in this experiment. Example 12 Droplet generation

[0140] Droplets were generated using a QX200 Bio-Rad droplet generator containing cell, bead, and oil inlets. Briefly, 10 μL of priming solution (such as aqueous buffer or cell culture medium) was added to the cell and bead inlets, allowed to fill the channels for 1 minute, and then removed. Nuclei and bead solutions (30 μL each) were added to their respective wells. Approximately 70 μL of oil was added to each oil inlet, and the cartridge was then inserted into the droplet generator. After droplet generation, droplets from both outlets were pooled together and subjected to PCR. After PCR, the water-in-oil emulsion was broken by treatment with an emulsifier, and the aqueous phase was used for sequencing. Example 13 The nucleus as a physical compartment for enzymatic reactions

[0141] Living cells have multiple organelles with different mechanisms for carrying out separate enzymatic reactions, such as genome maintenance in the nucleus, energy production in mitochondria, catabolic processes in lysosomes, etc. To take advantage of the natural compartmentalization provided by living cells, experiments were performed to demonstrate that the nucleus can provide a physical barrier for isolated in vitro reactions of genomic DNA.

[0142] Nuclei (150,000) were extracted with standard nuclear isolation buffer containing 0.1% IGEPAL CA-630, and the nuclear pellet was transposed with Tn5 transposomes at 55°C for 30 minutes, with and without 30 μM PitStop-2. The integrity of the nuclei at the completion of this step was monitored by light microscopy (data not shown). Nuclei were pelleted by gentle centrifugation to remove excess unused transposomes. Nuclei were resuspended in a reaction mixture containing a strong strand-displacing DNA polymerase (Bst or Phi29) and incubated for 30 minutes at the appropriate temperature (65°C, Bst; 30°C, Phi29) to remove Tn5 from the tagged, fragmented chromatin and generate DNA fragments available for PCR amplification. After the reaction was completed, nuclei were separated from the supernatant by gentle centrifugation and resuspended in PCR master mix.

[0143] Both nuclei and supernatants were amplified (25 cycles) with Nextera Index Kit primers, and the products of the reactions were analyzed by agarose gel electrophoresis, as shown in Figure 9. No libraries were generated from the supernatants under either set of conditions, suggesting that DNA fragments did not diffuse from the nuclei during the tagged fragmentation and Tn5 replacement reactions.

[0144] These data demonstrate the successful use of nuclei as physical compartments for tagged fragmentation and other enzymatic processes (see Figures 1, 2, and 10). Thus, this method results in compartment-specific amplification of nuclear translocation products. Enzymes, such as the Tn5 transposome complex and polymerase, as well as other reaction mixture components, can enter and function within nuclei treated with PitStop-2. DNA and library elements remain in the nuclei during and after the reaction. Therefore, multiple enzymatic reactions can be achieved within the nuclei without disrupting the integrity of the nuclear membrane, and nuclei can be subjected to multiple reagent exchanges, multiple processes, and / or various manipulations (e.g., enzymatic reactions, staining, sorting, etc.) without DNA leakage from the nuclear space. Example 14 Effect of PitStop-2 on single-cell ATAC-seq metrics in droplets

[0145] Mouse (3T3) nuclei were treated with 0 μM, 30 μM, and 60 μM PitStop-2 during cell lysis and nuclear translocation. PitStop-2 was used to widen the nuclear pores, allowing for increased translocation of open chromatin. A defined number of translocated nuclei, set to ensure single-nuclear occupancy, was loaded into a QX200 Bio-Rad droplet generator along with indexed beads designed to produce single-cell ATAC-seq libraries. The single-cell libraries were PCR-amplified in the droplets, then purified and sequenced on a NextSeq® 550 sequencing system. Figure 11 shows single-cell sequencing data for each set of treated cells (0 μM, 30 μM, and 60 μM PitStop-2). As shown in Figure 11A, increasing concentrations of PitStop-2 resulted in an increase in the total number of unique reads for all three sets of barcodes, grouped by different numbers of unique reads (>1k, >10k, and >100k).

[0146] Treatment of nuclei with PitStop-2 allows for more efficient translocation of open chromatin and increased specific coverage. In the presence of PitStop-2, the transposase targets additional open chromatin regions outside the transcription start site (TSS) (see Figure 11B). Figure 11B shows the percentage of fragments within 1 kb of the transcription start site for ATAC-seq samples treated with 0 μM, 30 μM, or 60 μM PitStop-2. Detailed examination of read alignments at two genomic sites (the GAPDH and RPL10 genes) indicated library generation in regions with potential open chromatin structures, such as enhancers and open reading frames, suggesting a higher sensitivity of the assay (data not shown). Figure 11C shows the more conservative ATAC-seq peak overlap as defined by the MACS-2 peak-finding software program for samples treated with 0 μM, 30 μM, and 60 μM PitStop-2. Very strong peak overlap was detected for samples with and without PitStop-2, indicating that PitStop-2 did not alter the overall integrity of the assay (see Figure 11C). Alignment of pooled ATAC-seq read data generated with 0 μM, 30 μM, and 60 μM PitStop-2 around the GAPDH gene on chromosome 6 and around the RPL10 gene on the X chromosome was also observed (data not shown).

Claims

[Claim 1] The invention as described in the drawings.

Citation Information

Patent Citations

  • Method for manufacturing anode for thermally activated reserve batteries employing thin film-type metal foam and cup

    WO2016013704A1