Compositions, systems, and methods for identifying compound that modulates one or more characteristics associated with RBM20 condensate and / or RBM20 polypeptide

Abstract

To provide compositions, systems, and methods for identifying compounds that modulate one or more characteristics associated with an RBM20 condensate and / or an RBM20 polypeptide.SOLUTION: In some aspects, the present disclosure relates to methods for screening and identifying compounds that modulate one or more characteristics associated with a condensate comprising an RBM20 polypeptide and / or the RBM20 polypeptide. In other aspects, the disclosure relates to systems and composition components thereof, such as cellular models useful for the methods described herein. In some embodiments, the disclosure provides methods for identifying compounds that modulate one or more characteristics associated with condensates comprising an RBM20 polypeptide ("RBM20 condensates") and / or the RBM20 polypeptides in the cytoplasm of a cell.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 902,309, filed September 18, 2019, and U.S. Provisional Patent Application No. 63 / 074,985, filed September 4, 2020, the contents of which are incorporated herein by reference in their entirety.

[0002] Submitting a sequence listing as an ASCII text file The contents of the following submission in an ASCII text file are hereby incorporated by reference in their entirety: Sequence Listing Computer Readable Form (CRF) (Filename: 185992000240SEQLIST.TXT, Date Recorded: September 16, 2020, Size: 11 KB).

[0003] In some aspects, the present disclosure relates to methods for screening and identifying compounds that modulate aggregates comprising RBM20 polypeptides and / or one or more properties associated with RBM20 polypeptides. In other aspects, the present disclosure relates to systems, such as cellular models, and compositions thereof, that are useful in the methods described herein. [Background technology]

[0004] There are many challenges associated with screening and identifying compounds useful in modulating cellular processes, especially when the role of the target biomolecule or cellular component in the cellular process is not fully understood. For example, RBM20 is a protein known to be involved in the splicing of titan, a sarcomeric protein that provides structural support and maintains tension during striated muscle elongation. Expression of mutant RBM20 polypeptides is associated with the expression of pathological titan isoforms that cause dilated cardiomyopathy (DCM) (Guo et al., 2014). (Eds. et al., Nat Med, 18, 2012). However, it is unclear how RBM20 is linked to the onset and progression of disease, which has hindered the development of methods to screen and identify compounds useful for regulating RBM20-related cellular processes.

[0005] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety. Summary of the Invention

[0006] In some embodiments, provided herein are methods for identifying a compound that modulates one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell and / or a property associated with the RBM20 polypeptide, the method comprising: (a) combining the compound with a composition comprising the cells, wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; and (b) determining a property associated with the one or more RBM20 aggregates and / or RBM20 polypeptides, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with one or more RBM20 aggregates and / or RBM20 polypeptides.

[0007] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include the following: (i) the location of one or more RBM20 aggregates; (ii) the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides; (iii) the number of one or more RBM20 aggregates; (iv) the size of one or more RBM20 aggregates; (v) the ratio of the amount of one or more RBM20 aggregates to a reference aggregate; (vi) a functional activity associated with one or more RBM20 aggregates; (vii) the composition of one or more RBM20 aggregates; (viii) the co-localization of one or more RBM20 aggregates with a biomolecule; (ix) the diffusion coefficient of a component of one or more RBM20 aggregates; (x) the stability of one or more RBM20 aggregates; (xi) one or more (xii) dissolution or size reduction of one or more RBM20 aggregates; (xiii) sphericity of one or more RBM20 aggregates; (xiv) fluidity of one or more RBM20 aggregates; (xv) solidification of one or more RBM20 aggregates; (xvi) location of an RBM20 polypeptide; (xvii) amount of an RBM20 polypeptide or its precursor; (xviii) aggregate distribution of an RBM20 polypeptide into one or more RBM20 aggregates; (xix) functional activity associated with an RBM20 polypeptide; (xx) aggregation of an RBM20 polypeptide; (xxi) post-translational modification state of an RBM20 polypeptide; and (xxii) amount of degradation products of an RBM20 polypeptide.

[0008] In some embodiments, the modulation of the property is based on a decrease in the number of one or more RBM20 aggregates in the cytoplasm of the cell. In some embodiments, the modulation of the property is based on a decrease in the amount of RBM20 polypeptide or a precursor thereof in the cytoplasm of the cell. In some embodiments, the modulation of the property is based on dissolution or reduction in size of one or more RBM20 aggregates in the cytoplasm of the cell. In some embodiments, the modulation of the property is based on a decrease in functional activity associated with one or more RBM20 aggregates and / or RBM20 polypeptide in the cytoplasm of the cell.

[0009] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include the location of one or more RBM20 aggregates, the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides, the number of one or more RBM20 aggregates, the size of one or more RBM20 aggregates, and the ratio of the amount of one or more RBM20 aggregates to a reference aggregate. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include the composition of one or more RBM20 aggregates and the co-localization of one or more RBM20 aggregates with a biomolecule. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides further include a functional activity associated with one or more RBM20 aggregates.

[0010] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include stability of one or more RBM20 aggregates, dissolution or size reduction of one or more RBM20 aggregates, and surface area of ​​one or more RBM20 aggregates.

[0011] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include sphericity of one or more RBM20 aggregates, fluidity of one or more RBM20 aggregates, and solidification of one or more RBM20 aggregates.

[0012] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include the location of the RBM20 polypeptide and the amount of the RBM20 polypeptide or its precursor. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides further include the post-translational modification state of the RBM20 polypeptide. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides further include a functional activity associated with the RBM20 polypeptide.

[0013] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include co-localization of one or more RBM20 aggregates with biomolecules and diffusion coefficients of components of one or more RBM20 aggregates.

[0014] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include stability of one or more RBM20 aggregates, and dissolution or size reduction of one or more RBM20 aggregates.

[0015] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include the surface area of ​​one or more RBM20 aggregates, the sphericity of one or more RBM20 aggregates, the fluidity of one or more RBM20 aggregates, and the solidification of one or more RBM20 aggregates.

[0016] In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in an intrinsically disordered region (IDR). In some embodiments, the mutant RBM20 polypeptide comprises a mutation in an RS-rich region. In some embodiments, the mutant RBM20 polypeptide comprises a mutation at one or more of the following positions: arginine 634, serine 635, arginine 636, serine 637, and proline 638. In some embodiments, the mutant RBM20 polypeptide comprises one or more of the following mutations: R636S, R636C, R636H, R634Q, S637G, P638L, S635A, S635E, and S637E. In some embodiments, the mutant RBM20 polypeptide comprises one or more of the following mutations: E913K, R716Q, and V535L.

[0017] In some embodiments, the RBM20 polypeptide is heterologously expressed in the cell. In some embodiments, the RBM20 polypeptide is homologously expressed in the cell.

[0018] In some embodiments, the cell is a model of a cardiac cell type. In some embodiments, the cell is a cardiomyocyte. In some embodiments, the cell is a rat H9C2 cell. In some embodiments, the cell is a human AC-16 cell, a patient-derived cardiomyocyte, a human induced pluripotent stem cell differentiated into a cardiomyocyte, or a stem cell differentiated into a cardiomyocyte. In some embodiments, the cell is selected from the group consisting of a HeLa cell, a U2OS cell, a human embryonic kidney cell, a human induced pluripotent stem cell, and a stem cell. In some embodiments, the cell is homozygous for an allele encoding an RBM20 polypeptide. In some embodiments, the cell is heterozygous for an allele encoding an RBM20 polypeptide.

[0019] In some embodiments, the reference comprises an aliquot of a composition comprising cells mixed with a control agent.

[0020] In some embodiments, the methods described herein further comprise imaging at least a portion of the composition or cell.

[0021] In some embodiments, the methods described herein further comprise determining one or more cellular characteristics of the cells.

[0022] In some embodiments, the methods described herein further comprise contacting at least a portion of the composition or cells with a fixative.

[0023] In some embodiments, the methods described herein further comprise contacting at least a portion of the composition or cells with a stain.

[0024] In some embodiments, the methods described herein further comprise evaluating the identified compound using a second cell-based assay.

[0025] In some embodiments, the methods described herein further comprise evaluating the identified compounds using an in vitro assay.

[0026] In another aspect, provided herein is a method for identifying a compound that reduces the size and / or number of aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, the method comprising: (a) determining the size and / or number of RBM20 aggregates in at least a portion of the cytoplasm of a cell exposed to the compound; and (b) comparing the size and / or number of RBM20 aggregates to a reference, thereby identifying a compound that reduces the size and / or number of RBM20 aggregates in the cytoplasm of the cell.

[0027] In some embodiments, the compound reduces the number of RBM20 aggregates. In some embodiments, the compound reduces the size of RBM20 aggregates.

[0028] In another aspect, provided herein is a method for identifying a compound that prevents the formation or growth of one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, the method comprising: (a) combining a compound with a composition comprising cells, wherein i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; (b) obtaining a first measurement of the size and / or number of one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell; and (c) comparing the first measurement with a reference, thereby identifying a compound that prevents the formation or growth of one or more RBM20 aggregates in the cytoplasm of the cell.

[0029] In some embodiments, the reference comprises an aliquot of a composition comprising cells admixed with a control agent. In some embodiments, the reference is a second measurement of the size and / or number of one or more RBM20 aggregates in at least a portion of the cytoplasm of the cells, where the second measurement is taken at a different time than the first measurement.

[0030] In some embodiments, the methods described herein further comprise exposing the cell to conditions that promote the formation of one or more RBM20 aggregates.

[0031] In another aspect, provided herein is a method for identifying a compound that reduces the amount of RBM20 polypeptide in the cytoplasm of a cell, the method comprising: (a) combining the compound with a composition comprising the cell; (b) obtaining a first measurement of the amount of RBM20 polypeptide in at least a portion of the cytoplasm of the cell; and (c) comparing the first measurement to a reference, thereby identifying a compound that reduces the amount of RBM20 polypeptide in the cytoplasm of the cell.

[0032] In some embodiments, the reference comprises an aliquot of a composition comprising cells mixed with a control agent.

[0033] In some embodiments, the reference is a second measurement of the amount of RBM20 polypeptide in at least a portion of the cytoplasm of the cell, where the second measurement is measured at a different time than the first measurement.

[0034] In another aspect, provided herein is a method for identifying a compound that modulates a property associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates"), the method comprising: (a) combining a compound, a solution comprising one or more RBM20 aggregates, and an additional aggregate solution; and (b) determining a property associated with the one or more RBM20 aggregates, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates.

[0035] In another aspect, provided herein is a method for identifying a compound that modulates one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") and / or properties associated with RBM20 polypeptides, the method comprising: (a) combining a specific substance with a solution comprising RBM20 polypeptides in the presence of the compound, wherein the substance is capable of causing the formation of one or more RBM20 aggregates, and wherein one or more RBM20 aggregates are formed after contacting the substance with the solution; and (b) determining a property associated with the one or more RBM20 aggregates and / or RBM20 polypeptides, wherein modulation of the property compared to a reference indicates that the compound modulates one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides.

[0036] In some embodiments, the property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on any one of the following: (i) the number of one or more RBM20 aggregates; (ii) the composition of one or more RBM20 aggregates; (iii) the size of one or more RBM20 aggregates; (iv) the stability of one or more RBM20 aggregates; (v) the dissolution or size reduction of one or more RBM20 aggregates; (vi) the surface area of ​​one or more RBM20 aggregates; (vii) the sphericity of one or more RBM20 aggregates; (viii) the fluidity of one or more RBM20 aggregates; (ix) the solidification of one or more RBM20 aggregates; (x) the amount of RBM20 polypeptide not in one or more RBM20 aggregates; (xi) the distribution of RBM20 polypeptides in one or more RBM20 aggregates; and (xii) the aggregation of RBM20 polypeptides.

[0037] In another aspect, provided herein is a method of identifying a compound useful in treating an RBM20-associated disease, comprising identifying the compound according to any one of the methods described herein. In some embodiments, the RBM20-associated disease is a cardiomyopathy. In some embodiments, the cardiomyopathy is dilated cardiomyopathy.

[0038] In another aspect, provided herein are methods for identifying a compound that modulates the distribution of a biomolecule in an aggregate comprising an RBM20 polypeptide ("RBM20 aggregate"), the method comprising: (a) combining the compound with a composition comprising cells, wherein (i) the cells comprise RBM20 aggregates and / or (ii) RBM20 aggregates are formed intracellularly after contacting the compound with the composition; and (b) determining the distribution of the biomolecule in the RBM20 aggregate. In some embodiments, the biomolecule is a non-RBM20 polypeptide. In some embodiments, the biomolecule is a wild-type RBM20 polypeptide. In some embodiments, the RBM20 aggregate comprising an RBM20 polypeptide comprises a mutant RBM20 polypeptide.

[0039] Those skilled in the art will also recognize that modifications can be made to the embodiments and details described herein without departing from the scope of the present disclosure. Moreover, while various advantages, aspects, and objectives have been described in connection with various implementations, the scope of the present disclosure should not be limited by reference to such advantages, aspects, and objectives. [Brief explanation of the drawings]

[0040] [Figure 1] A and B show fluorescence images of HeLa cells transiently transfected with wild-type RBM20 polypeptide (A) or R636S mutant RBM20 polypeptide (B). [Figure 2] A and B show fluorescence images of U2OS cells transiently transfected with wild-type RBM20 polypeptide (A) or R636S mutant RBM20 polypeptide (B). [Figure 3] A–D show fluorescence images of U2OS cells transiently transfected with wild-type RBM20 polypeptide (A), R636S mutant RBM20 polypeptide (B), R636C mutant RBM20 polypeptide (C), or R636H mutant RBM20 polypeptide (D). [Figure 4A]Fluorescence images of H9C2 cells transiently transfected with wild-type RBM20 polypeptide are shown. [Figure 4B] Fluorescence images of H9C2 cells transiently transfected with the R636S mutant RBM20 polypeptide are shown. [Figure 4C] Fluorescence images of H9C2 cells transiently transfected with the R636C mutant RBM20 polypeptide are shown. [Figure 4D] Fluorescence images of H9C2 cells transiently transfected with the R636H mutant RBM20 polypeptide are shown. [Figure 4E] Fluorescence images of H9C2 cells transiently transfected with the R634Q mutant RBM20 polypeptide are shown. [Figure 4F] Fluorescence images of H9C2 cells transiently transfected with the S635A mutant RBM20 polypeptide are shown. [Figure 4G] Fluorescence images of H9C2 cells transiently transfected with the S637G mutant RBM20 polypeptide are shown. [Figure 4H] Fluorescence images of H9C2 cells transiently transfected with the P638L mutant RBM20 polypeptide are shown. [Figure 5] A and B show fluorescent images of U2OS cells transiently transfected with wild-type RBM20 polypeptide. [Figure 6] Fluorescence images of H9C2 cells transiently transfected with wild-type RBM20 polypeptide and treated with control (DMSO) (A), lipoamide (30 μM) (B), mitoxantrone (20 μM) (C), or JQ1 (10 μM) (D) are shown. [Figure 7] A is a schematic diagram showing selected regions of the RBM20 polypeptide. B shows the results of an analysis of the RBM20 polypeptide sequence for ordered and disordered regions. [Figure 8] A and B show fluorescent images of H9C2 cells transiently transfected to express wild-type RBM20 polypeptide. [Figure 9]Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide with (upper panel) or without (lower panel) a C-terminal NLS fusion are shown. [Figure 10] Shown are fluorescent images of H9C2 cells transiently transfected to express a phosphomimetic mutant RBM20 polypeptide (R636S, S635E, S637E) coupled to a Dendra2 tag, or a mutant R636S RBM20 polypeptide coupled to a Dendra2 tag. [Figure 11] Fluorescence images of H9C2 cells transiently transfected to express different RBM20 polypeptide truncated forms are shown. [Figure 12A] (i) Fluorescence images and analysis of H9C2 cells transiently transfected to express both mutant R636S RBM20 polypeptide and wild-type RBM20 polypeptide. [Figure 12B] (ii) Fluorescence images and analysis of H9C2 cells transiently transfected to express both mutant R636S RBM20 and NEC polypeptides. [Figure 12C] (iii) Fluorescence images and analysis of H9C2 cells transiently transfected to express mutant R636S RBM20 polypeptide. [Figure 12D] (iv) Fluorescence images and analysis of H9C2 cells transiently transfected to express wild-type RBM20 polypeptide. [Figure 13] Fluorescence images of H9C2 cells transiently transfected to express wild-type RBM20 polypeptide (A), E913K mutant RBM20 polypeptide (B), R716Q mutant RBM20 polypeptide (C), and V535L mutant RBM20 polypeptide (D) conjugated to a Dendra2 label are shown. [Figure 14]Fluorescence images of H9C2 cells transiently transfected to express wild-type RBM20 polypeptide (upper panel) or mutant RBM20 polypeptide (lower panel) are shown. Cells were co-stained for DAPI (to show nuclei) and DDX3X protein (using IF). [Figure 15] Fluorescence images of H9C2 cells transiently transfected to express wild-type RBM20 polypeptide (upper panel) or mutant RBM20 polypeptide (lower panel) are shown. Cells were co-stained for DAPI (to show nuclei) and PSPC1 protein (using IF). [Figure 16] Fluorescence images of H9C2 cells transiently transfected to express Dendra-tagged wild-type RBM20 polypeptide or Dendra-tagged R636S mutant RBM20 polypeptide are shown, and cells were stained for the different nuclear proteins PTBP1, SRRM1, U2AF65, and SC35. [Figure 17] Fluorescence images of H9C2 cells transiently transfected to express mCherry-tagged wild-type RBM20 polypeptide or mCherry-tagged R636S mutant RBM20 polypeptide in combination with GFP-tagged DDX3X are shown. Cells were co-stained for DAPI and the stress granule marker G3BP1 protein. [Figure 18] Fluorescence and DIC images of H9C2 cells induced to express either wild-type RBM20 polypeptide linked to a Dendra2 tag, or the mutant R636S variant linked to a Dendra2 tag are shown. [Figure 19A] 1 shows cell growth curves of H9C2 cells induced to express either wild-type or R636S mutant RBM20 polypeptides, stained with Incucyte® NucLightRapid Red reagent. No doxycycline was used as a control. [Figure 19B]1 shows cell growth curves of H9C2 cells induced to express either wild-type or R636S mutant RBM20 polypeptides, stained with Incucyte® NucLightRapid Red reagent. No doxycycline was used as a control. [Figure 19C] 1 shows cell growth curves of H9C2 cells induced to express either wild-type or R636S mutant RBM20 polypeptides, stained with Incucyte® NucLightRapid Red reagent. No doxycycline was used as a control. [Figure 19D] 1 shows cell growth curves of H9C2 cells induced to express either wild-type or R636S mutant RBM20 polypeptides, stained with Incucyte® NucLightRapid Red reagent. No doxycycline was used as a control. [Figure 20A] Figure 1 shows apoptosis analysis of H29C cells expressing either wild-type or R636S mutant RBM20 polypeptides with or without staurosporine (STS) stress. The extent of apoptosis is indicated by the luminescence (RLU) signal. [Figure 20B] Figure 1 shows apoptosis analysis of H29C cells expressing either wild-type or R636S mutant RBM20 polypeptides with or without staurosporine (STS) stress. The extent of apoptosis is indicated by the luminescence (RLU) signal. [Figure 20C] Figure 1 shows apoptosis analysis of H29C cells expressing either wild-type or R636S mutant RBM20 polypeptides with or without staurosporine (STS) stress. The extent of apoptosis is indicated by the luminescence (RLU) signal. [Figure 20D]Figure 1 shows apoptosis analysis of H29C cells expressing either wild-type or R636S mutant RBM20 polypeptides with or without staurosporine (STS) stress. The extent of apoptosis is indicated by the luminescence (RLU) signal. [Figure 20E] Figure 1 shows apoptosis analysis of H29C cells expressing either wild-type or R636S mutant RBM20 polypeptides with or without staurosporine (STS) stress. The extent of apoptosis is indicated by the luminescence (RLU) signal. [Figure 21] Fluorescence and DIC images of H29C cells (not treated with STS stress) induced to express either wild-type or R636S mutant RBM20 polypeptide are shown. [Figure 22] Fluorescence images of H9C2 cells induced to express Dendra2-tagged R636S mutant RBM20 polypeptide, which formed cytoplasmic aggregates and were co-stained with DAPI and the stress granule protein eIF3e, are shown. [Figure 23] Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide are shown. DMSO, lithocholic acid, and quinacrine 2HCl were added to the cells to monitor the behavior of cytoplasmic R636S mutant RBM20 aggregates. Untransfected H9C2 cells served as a control. [Figure 24A] Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide are shown. The compound triptolide (PG490) was added to monitor the behavior of cytoplasmic R636S mutant RBM20 aggregates. [Figure 24B] Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide are shown. BIO was added to monitor the behavior of cytoplasmic R636S mutant RBM20 aggregates. [Figure 24C]Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide were taken. Uprosertib (GSK2141795) was added to monitor the behavior of cytoplasmic R636S mutant RBM20 aggregates. [Figure 24D] Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide are shown. Anisomycin was added to monitor the behavior of cytoplasmic R636S mutant RBM20 aggregates. [Figure 24E] Fluorescence images of H9C2 cells transiently transfected to express the R636S mutant RBM20 polypeptide are shown. WS6 was added to monitor the behavior of cytoplasmic R636S mutant RBM20 aggregates. DETAILED DESCRIPTION OF THE INVENTION

[0041] The present disclosure provides compositions, systems, and methods for identifying compounds that modulate one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") and / or one or more properties associated with RBM20 polypeptides. The disclosure described herein is based, at least in part, on unexpected discoveries and the inventors' unique insights into disease mechanisms associated with dysfunctional and / or substituted RBM20 polypeptides and abnormal RBM20 aggregates, as well as compositions, systems, and methods for screening and identifying compounds useful in modulating cellular pathways associated with RBM20 aggregates and RBM20 polypeptides. Under normal physiological conditions, wild-type RBM20 is produced in the cytoplasm and then transported to the nucleus, where it performs biological functions, such as participating in the splicing of RNAs encoding proteins, including titan. As described herein, expression of certain mutant RBM20 polypeptides and / or overexpression of RBM20 polypeptides (including wild-type RBM20 polypeptides) results in the presence and maintenance of RBM20 polypeptides and RBM20 aggregates in the cytoplasm of cells. Without being bound by theory, the inventors believe that the presence of RBM20 polypeptides and / or RBM20 aggregates in the cytoplasm leads to abnormal molecular processes and the development and symptoms of diseases such as dilated cardiomyopathy (DCM). For example, cytoplasmic RBM20 aggregates, such as those containing mutant RBM20 polypeptides, may function as a sink for certain biomolecules, including proteins and nucleic acids, such as wild-type RBM20 polypeptides. This may lead to a gain of toxic function that affects cell viability, cytotoxicity, and cell proliferation. The approaches described herein are useful for identifying and understanding the characteristics associated with RBM20-related disease mechanisms, and these tools and findings further enable compositions, systems, and methods useful for screening compounds that favorably affect one or more properties of RBM20 aggregates and / or RBM20 polypeptides. Such compositions, systems, and methods can also be incorporated into drug discovery platforms to improve candidate identification and lead optimization.Identification of compounds that modulate properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides in the cytoplasm of a cell may lead to the identification of compounds useful for treating or preventing aberrant molecular processes, diseases, and / or conditions associated with the presence of RBM20 aggregates and / or RBM20 polypeptides in the cytoplasm.

[0042] Those skilled in the art will also recognize that modifications can be made to the embodiments and details described herein without departing from the scope of the present disclosure. Moreover, while various advantages, aspects, and objectives have been described in connection with various implementations, the scope of the present disclosure should not be limited by reference to such advantages, aspects, and objectives.

[0043] I. Definition For purposes of interpreting this specification, the following definitions shall apply, and where appropriate, terms used in the singular shall include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth below shall control.

[0044] As used herein, "aggregate" means a non-membrane-enclosed compartment formed by phase separation (including all stages of phase separation) of one or more proteins and / or other macromolecules.

[0045] As used herein, the terms "polypeptide" and "protein" can be used interchangeably to refer to polymers comprising amino acid residues and are not limited to a minimum length. Such polymers can contain natural or non-natural amino acid residues, or combinations thereof, and can include, but are not limited to, peptides, polypeptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Full-length polypeptides or proteins, as well as fragments thereof, are included within this definition. These terms also include modified species thereof, such as post-translational modifications of one or more residues, such as methylation, phosphorylation, glycosylation, sialylation, or acetylation.

[0046] The terms "comprising," "having," "containing," "including," and other similar forms and their grammatical equivalents used herein are intended to be equivalent in meaning and open-ended in that the item or items following any of these terms are not intended to imply an inclusive list of such items or items, nor are they intended to be limited to only the listed item or items. For example, an article "comprising" elements A, B, and C may consist of (i.e., include only) elements A, B, and C, or may include not only elements A, B, and C, but also one or more other elements. Thus, "comprising" and similar forms and their grammatical equivalents are intended to, and should be understood to, include disclosure of embodiments that "consist essentially of" or "consist of."

[0047] Where a range of values ​​is given, it is understood that, unless the context clearly dictates otherwise, each intervening value between the upper and lower limit of that range, to the tenth of the unit of the lower limit, and every other stated or intervening value within that stated range, except for any specifically excluded limit in a stated range, is encompassed within the disclosure. Where the stated range includes one or both limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0048] When used herein, "about" in reference to a value or parameter includes (and describes) a variation on the value or parameter itself. For example, a statement of "about X" includes a statement of "X."

[0049] As used in this specification, including the appended claims, the singular forms "a," "or," and "the" include plural referents unless the context clearly dictates otherwise.

[0050] II. Methods for identifying compounds In some aspects, the present disclosure provides methods for identifying compounds (or portions thereof) that modulate one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") and / or properties associated with RBM20 polypeptides. In some embodiments, the one or more properties are associated with a cellular mechanism associated with RBM20, and modulation of the one or more properties results in the desired modulation of the cellular mechanism. While certain methods described herein focus on identifying, assessing, or modulating one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides in the cytoplasm, such methods can also be used to identify, assess, or modulate one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides in any part of a cellular system, such as the cytoplasm, nucleus, or other organelles, or in a biochemical system. In some embodiments, RBM20 aggregates and / or RBM20 polypeptides (e.g., wild-type RBM20 polypeptides) are present in the nucleus. In some embodiments, RBM20 aggregates and / or RBM20 polypeptides (e.g., mutant RBM20 polypeptides) are present in the cytoplasm. Certain methods described herein can also be used to identify, assess, or modulate one or more properties associated with non-RBM20 aggregates and / or non-RBM20 polypeptides, for example, to modulate a non-RBM20 biomolecule by releasing the biomolecule from cytoplasmic RBM20 aggregates to its normal location (e.g., the location of the non-RBM20 aggregate, etc., where the biomolecule resided prior to sequestering in the cytoplasmic RBM20 aggregates). Accordingly, certain compounds (or portions thereof) described herein modulate one or more properties associated with non-RBM20 aggregates and / or non-RBM20 polypeptides described herein.

[0051] In some embodiments, the methods described herein can be used to identify, evaluate, screen, and / or design compounds that modulate the distribution of molecules (e.g., biomolecules, including proteins or nucleic acids) in RBM20 aggregates. For example, in some embodiments, RBM20 aggregates sequester molecules (e.g., biomolecules, including wild-type RBM20 or non-RBM20 polypeptides), and the methods described herein can be used to identify, evaluate, screen, and / or design compounds that expel molecules from RBM20 aggregates. In some embodiments, the methods described herein can be used to identify, evaluate, screen, and / or design compounds that expel wild-type RBM20 polypeptides from RBM20 aggregates. In some embodiments, the methods described herein can be used to identify, evaluate, screen, and / or design compounds that expel non-RBM20 polypeptides from RBM20 aggregates. In some embodiments, the molecules (e.g., biomolecules comprising wild-type RBM20 or non-RBM20 polypeptides) function normally (e.g., have normal biological function and / or activity) once they are released from RBM20 aggregates.

[0052] In some embodiments, the methods described herein can be used to identify, evaluate, screen, and / or design compounds that incorporate non-RBM20 polypeptides into RBM20 aggregates. In some embodiments, the methods described herein can be used to identify, evaluate, screen, and / or design compounds that incorporate non-RBM20 polypeptides into RBM20 aggregates.

[0053] In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, the method comprising: (a) combining the compound with a composition comprising the cells, where (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; and (b) determining a property associated with the one or more RBM20 aggregates, where modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates.

[0054] In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with an RBM20 polypeptide in the cytoplasm of a cell, the method comprising: (a) combining the compound with a composition comprising the cell; and (b) determining the property associated with the RBM20 polypeptide, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the RBM20 polypeptide.

[0055] In some embodiments, described herein are methods for identifying one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell and a compound (or portion thereof) that modulates one or more properties associated with the RBM20 polypeptides, the method comprising: (a) combining the compound with a composition comprising the cells, wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; and (b) determining a property associated with the one or more RBM20 aggregates and RBM20 polypeptides, wherein modulation of the property compared to a reference indicates that the compound modulates one or more properties associated with the one or more RBM20 aggregates and RBM20 polypeptides.

[0056] In some embodiments, the present specification describes a method for identifying a compound (or portion thereof) that modulates a property associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, the method comprising determining a property associated with the one or more RBM20 aggregates in a composition comprising the cell and the compound or a derivative thereof, wherein modulation of the property compared to a reference indicates that the compound modulates a property associated with the one or more RBM20 aggregates, and wherein (i) the cell comprises one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after the compound contacts the composition.

[0057] In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with an RBM20 polypeptide in the cytoplasm (or nucleus) of a cell, the method comprising determining a property associated with RBM20 aggregates in a composition comprising the cell and the compound or a derivative thereof, wherein modulation of the property compared to a reference indicates that the compound modulates a property associated with an RBM20 polypeptide.

[0058] In some embodiments, described herein are methods for identifying one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell and a compound (or portion thereof) that modulates one or more properties associated with the RBM20 polypeptides, the method comprising determining one or more properties associated with the one or more RBM20 aggregates and RBM20 polypeptides in a composition comprising the cell and the compound or a derivative thereof, wherein modulation of the properties compared to a reference indicates that the compound modulates one or more properties associated with the one or more RBM20 aggregates and / or RBM20 polypeptides, and wherein (i) the cell comprises one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after the compound is contacted with the composition.

[0059] In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with one or more aggregates comprising RBM20 polypeptides in a cell line ("RBM20 aggregates"), the method comprising: (a) combining the compound with a composition comprising cells, wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; and (b) determining a property associated with the one or more RBM20 aggregates, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates.

[0060] In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with an RBM20 polypeptide in a cell line, the method comprising: (a) combining the compound with a composition comprising the cells; and (b) determining the property associated with the RBM20 polypeptide, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the RBM20 polypeptide.

[0061] In some embodiments, described herein are methods for identifying one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in a cell line and a compound (or portion thereof) that modulates one or more properties associated with the RBM20 polypeptides, the method comprising: (a) combining the compound with a composition comprising the cells, wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; and (b) determining a property associated with the one or more RBM20 aggregates and RBM20 polypeptides, wherein modulation of the property compared to a reference indicates that the compound modulates one or more properties associated with the one or more RBM20 aggregates and RBM20 polypeptides.

[0062] In some embodiments, the present specification describes a method for identifying a compound (or portion thereof) that modulates a property associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in a cell line, the method comprising determining a property associated with the one or more RBM20 aggregates in a composition comprising cells and the compound or a derivative thereof, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates, and wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after the compound is contacted with the composition.

[0063] In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with an RBM20 polypeptide in a cell line, the method comprising determining the property associated with an RBM20 polypeptide in a composition comprising the cell and the compound or a derivative thereof, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with an RBM20 polypeptide.

[0064] In some embodiments, described herein are methods for identifying one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in a cell line and a compound (or portion thereof) that modulates one or more properties associated with the RBM20 polypeptides, the method comprising determining one or more properties associated with the one or more RBM20 aggregates and RBM20 polypeptides in a composition comprising cells and the compound or a derivative thereof, wherein modulation of the properties compared to a reference indicates that the compound modulates one or more properties associated with the one or more RBM20 aggregates and RBM20 polypeptides, and wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after the compound is contacted with the composition. In some embodiments, described herein are methods for identifying a compound (or portion thereof) that modulates a property associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates"), the method comprising: (a) combining a compound with a solution comprising one or more RBM20 aggregates and an additional aggregate solution; and (b) determining a property associated with the one or more RBM20 aggregates, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates.

[0065] In some embodiments, the present specification describes a method for identifying a compound (or portion thereof) that modulates one or more aggregates comprising an RBM20 polypeptide ("RBM20 aggregates") and / or a property associated with an RBM20 polypeptide, the method comprising: (a) combining a specific substance with a solution comprising an RBM20 polypeptide in the presence of the compound, wherein the substance is capable of causing the formation of one or more RBM20 aggregates, and wherein one or more RBM20 aggregates are formed after contacting the substance with the solution; and (b) determining a property associated with the one or more RBM20 aggregates and / or RBM20 polypeptide, wherein modulation of the property compared to a reference indicates that the compound modulates one or more properties associated with an RBM20 aggregate and / or RBM20 polypeptide.

[0066] In some embodiments, the properties associated with one or more RBM20 aggregates include: (i) the location of one or more RBM20 aggregates; (ii) the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides; (iii) the number of one or more RBM20 aggregates; (iv) the size of one or more RBM20 aggregates; (v) the ratio of the amount of one or more RBM20 aggregates to a reference aggregate; (vi) a functional activity associated with one or more RBM20 aggregates; (vii) the composition of one or more RBM20 aggregates; (viii) colocalization of one or more RBM20 aggregates with biomolecules; (ix) diffusion coefficients of components of one or more RBM20 aggregates; (x) stability of one or more RBM20 aggregates; (xi) dissolution or size reduction of one or more RBM20 aggregates; (xii) surface area of ​​one or more RBM20 aggregates; (xiii) sphericity of one or more RBM20 aggregates; (xiv) fluidity of one or more RBM20 aggregates; and (xv) solidification of one or more RBM20 aggregates. In some embodiments, the properties associated with an RBM20 polypeptide are based on any one or more of the following: (i) the location of the RBM20 polypeptide, (ii) the amount of the RBM20 polypeptide or its precursor, (iii) the aggregate partitioning of the RBM20 polypeptide into one or more RBM20 aggregates, (iv) a functional activity associated with the RBM20 polypeptide, (v) the aggregation of the RBM20 polypeptide, (vi) the post-translational modification state of the RBM20 polypeptide, and (vii) the amount of RBM20 polypeptide degradation products.

[0067] The methods described herein can have many forms (e.g., cell-based methods or biochemical methods, e.g., in vitro methods), low-throughput or high-throughput, and the components (e.g., cells or RBM20 polypeptides) used in these methods can be used in a variety of ways, including methods other than those described herein. For example, in some embodiments, the methods described herein can be used to identify compounds that modulate, for example, nuclear translocation of RBM20 polypeptides, cytoplasmic RBM20 polypeptides (e.g., modulating location or function), or cytoplasmic RBM20 aggregates (e.g., modulating location or function). The descriptions of specific embodiments of the methods and their components provided herein are not intended to limit the scope of the disclosure, and those skilled in the art will readily recognize that changes can be made in form and detail of the implementations described herein without departing from the scope of the disclosure.

[0068] A. Cell-Based Methods In some embodiments, the methods described herein are cell-based. Those skilled in the art will readily recognize that cellular processes, including the state of aggregates and their components, are dynamic. Accordingly, the methods described herein include contacting cells with a compound at any time during the life cycle of an RBM20 polypeptide and / or RBM20 aggregate. For example, the methods include contacting cells with a compound when the RBM20 polypeptide is present in any location, in any amount, or has any post-translational modification state, such as the presence or absence of phosphorylated residues. In some embodiments, the methods may include contacting cells with a compound when, for example, RBM20 aggregates are present in any location, in any amount (including absence), have undergone morphological changes, such as changes in size or fluidity, or have undergone changes in composition. In some embodiments, the methods include mixing a compound with a composition comprising cells, wherein (i) the cells contain one or more RBM20 aggregates, and / or (ii) one or more RBM20 aggregates are formed after the compound is contacted with the composition. In some embodiments, the method comprises mixing a compound with a composition comprising cells, wherein the cells comprise one or more RBM20 aggregates. In some embodiments, the method comprises mixing a compound with a composition comprising cells, wherein one or more RBM20 aggregates are formed after the compound contacts the composition. In some embodiments, the method comprises forming one or more RBM20 aggregates before mixing or contacting the compound with the composition comprising cells. In some embodiments, the method comprises forming one or more RBM20 aggregates after mixing or contacting the compound with the composition comprising cells. In some embodiments, mixing the compound with the composition comprising cells forms one or more RBM20 aggregates. In some embodiments of the methods described herein, the formation of RBM20 aggregates can be induced, for example, by inducing expression of a polypeptide, such as an RBM20 polypeptide or an aggregate scaffolding protein, or by adding a crowding agent.In some embodiments of the method described herein, two or more compounds, for example, 2, 3, 4 or 5 compounds, are mixed with the composition comprising cells.In some embodiments of the method described herein, the composition comprising cells is contacted with the compound multiple times, for example, multiple aliquots of the compound are mixed with the composition comprising cells at multiple time points.

[0069] i. Properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides in cell-based methods In some aspects, described herein are methods for identifying compounds (or portions thereof) that modulate one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm (or another component) of a cell and / or properties associated with RBM20 polypeptides (including one or more properties, such as 1, 2, 3, 4, or 5 properties). In some embodiments, the methods identify compounds that modulate one or more properties associated with RBM20 aggregates. In some embodiments, the methods identify compounds that modulate properties associated with RBM20 polypeptides. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides include: (i) the location of one or more RBM20 aggregates; (ii) the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides; (iii) the number of one or more RBM20 aggregates; (iv) the size of one or more RBM20 aggregates; (v) the ratio of the number of one or more RBM20 aggregates to a reference aggregate; (vi) a functional activity associated with one or more RBM20 aggregates; (vii) the composition of one or more RBM20 aggregates; (viii) the co-localization of one or more RBM20 aggregates with a biomolecule; (ix) the diffusion coefficient of a component of one or more RBM20 aggregates; (x) the stability of one or more RBM20 aggregates; (xi) one or more (xii) dissolution or size reduction of one or more RBM20 aggregates; (xiii) sphericity of one or more RBM20 aggregates; (xiv) fluidity of one or more RBM20 aggregates; (xv) solidification of one or more RBM20 aggregates; (xvi) location of an RBM20 polypeptide; (xvii) amount of an RBM20 polypeptide or its precursor; (xviii) aggregate distribution of an RBM20 polypeptide into one or more RBM20 aggregates; (xix) functional activity associated with an RBM20 polypeptide; (xx) aggregation of an RBM20 polypeptide; (xxi) post-translational modification state of an RBM20 polypeptide; and (xxii) amount of degradation products of an RBM20 polypeptide.

[0070] In some embodiments, the location of the one or more RBM20 aggregates is in any aspect of the cytoplasm of the cell. In some embodiments, the location of the one or more RBM20 aggregates is based on association with or within an organelle, a non-membrane-bound cellular compartment (e.g., within or co-localized with stress granules), or a particle in the cytoplasm. In some embodiments, the location of the one or more RBM20 aggregates describes association of the one or more RBM20 aggregates with another cellular element, such as a nucleus or centrosome. In some embodiments, the location of the one or more RBM20 aggregates is relative to another cellular element, such as a nucleus or centrosome. In some embodiments, the location of the one or more RBM20 aggregates is based on the distance to another cellular element, such as a nucleus or centrosome. In some embodiments, the location of the one or more RBM20 aggregates is in any aspect of the nucleus of the cell. In some embodiments, the location of the one or more RBM20 aggregates is within or co-localized with paraspeckles.

[0071] In some embodiments, the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) is the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) in a cellular element of the cytoplasm or a portion of the cytoplasm, such as a field of view. In some embodiments, the distribution of one or more RBM20 aggregates is the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) relative to a cellular element, such as a nucleus, organelle, or particle in the cytoplasm. In some embodiments, the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) is the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) in a portion of the cytoplasm, such as a field of view, relative to a location in the cytoplasm. In some embodiments, the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) is based on the distance of each RBM20 aggregate (and / or RBM20 polypeptide) relative to a reference point. In some embodiments, the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) is the distribution of one or more RBM20 aggregates (and / or RBM20 polypeptides) in a portion of the nucleus, which may or may not be uniform (e.g., uniform RBM20 polypeptides throughout the cytoplasm and / or nucleus).

[0072] In some embodiments, the number of one or more RBM20 aggregates is the total number of RBM20 aggregates in an aspect or region of a cell. In some embodiments, the number of one or more RBM20 aggregates is the total number of RBM20 aggregates in the cytoplasm. In some embodiments, the number of one or more RBM20 aggregates is an estimate of the total number of RBM20 aggregates in the cytoplasm based on measurements less than the total cytoplasm. In some embodiments, the number of one or more RBM20 aggregates is the number of RBM20 aggregates in a portion of the cytoplasm, such as within a field of view or in association with cellular elements. In some embodiments, the number of one or more RBM20 aggregates is the total number of RBM20 aggregates in the nucleus. In some embodiments, the number of one or more RBM20 aggregates is an estimate of the total number of RBM20 aggregates in the nucleus based on measurements less than the total nucleus. In some embodiments, the number of one or more RBM20 aggregates is the number of RBM20 aggregates in a portion of the nucleus, such as within a field of view or in association with cellular elements.

[0073] In some embodiments, the size of the one or more RBM20 aggregates is based on a measurement of the largest dimension across the aggregate, such as, for example, the diameter, of each of the one or more RBM20 aggregates. In some embodiments, the size of the one or more RBM20 aggregates is based on the perimeter of each of the one or more RBM20 aggregates. In some embodiments, the size of the one or more RBM20 aggregates is based on the cross-sectional area of ​​each of the one or more RBM20 aggregates or an imaged representation thereof, such as a plan view. In some embodiments, the size of the one or more RBM20 aggregates is based on the volume of each of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is based on the average size of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is based on the particle size distribution (such as d5, d10, d90, or d95) of the one or more RBM20 aggregates.

[0074] In some embodiments, the property associated with one or more RBM20 aggregates is based on the quantity of one or more RBM20 aggregates. In some embodiments, the quantity of one or more RBM20 aggregates is based on the number and size of one or more RBM20 aggregates. In some embodiments, the quantity of one or more RBM20 aggregates is based on the number and size of one or more RBM20 aggregates in a portion of a cell. In some embodiments, the quantity of one or more RBM20 aggregates is based on the number and size of one or more RBM20 aggregates in a portion of the cytoplasm. In some embodiments, the quantity of one or more RBM20 aggregates is based on the number and size of one or more RBM20 aggregates in a portion of the nucleus.

[0075] In some embodiments, the ratio of the number of one or more RBM20 aggregates to the reference aggregates is the ratio of the number of one or more RBM20 aggregates to another aggregate that does not contain an RBM20 polypeptide. In some embodiments, the ratio of the number of one or more RBM20 aggregates to the reference aggregates is the ratio of the number of one or more RBM20 aggregates in a portion of the cytoplasm to the number of one or more RBM20 aggregates in another portion of the cytoplasm. In some embodiments, the ratio of the number of one or more RBM20 aggregates to the reference aggregates is the ratio of the number of one or more RBM20 aggregates to aggregates that contain an RBM20 polypeptide located in the nucleus. In some embodiments, the property associated with one or more RBM20 aggregates is based on the ratio of the amount of one or more RBM20 aggregates to the amount of a reference aggregate, such as another aggregate that does not contain an RBM20 polypeptide or RBM20 aggregates in the nucleus.

[0076] In some embodiments, the functional activity associated with one or more RBM20 aggregates is a functional activity associated with an RBM20 polypeptide. In some embodiments, the functional activity associated with one or more RBM20 aggregates is based on a functional activity associated with another polypeptide or nucleic acid other than the RBM20 polypeptide. In some embodiments, the functional activity associated with one or more RBM20 aggregates is based on a functional activity associated with another polypeptide or nucleic acid other than the RBM20 polypeptide within or associated with the RBM20 aggregate.

[0077] In some embodiments, the composition of one or more RBM20 aggregates is the amount of an RBM20 polypeptide relative to at least one other component, such as a biomolecule, of the one or more RBM20 aggregates. In some embodiments, the composition of one or more RBM20 aggregates is the presence, level, or absence of at least one component other than an RBM20 polypeptide, such as a polypeptide, nucleic acid, or compound. In some embodiments, the composition of one or more RBM20 aggregates is the amount of a wild-type RBM20 polypeptide relative to a mutant RBM20 polypeptide within the aggregate. In some embodiments, the composition of one or more RBM20 aggregates is the amount of a first mutant RBM20 polypeptide relative to a second mutant RBM20 polypeptide within the aggregate. In some embodiments, the composition of one or more RBM20 aggregates is the amount of a first RBM20 polypeptide relative to a second RBM20 polypeptide, wherein the first and second RBM20 polypeptides have compositional differences, such as differences in post-translational modifications.

[0078] In some embodiments, the co-localization of one or more RBM20 aggregates with a biomolecule is co-localization of one or more RBM20 aggregates with another polypeptide and / or nucleic acid. In some embodiments, the biomolecule comprises a polypeptide. In some embodiments, the biomolecule comprises a nucleic acid, such as DNA or RNA. In some embodiments, the biomolecule is associated with another aggregate that does not contain an RBM20 polypeptide component prior to mixing with the compounds and / or prior to formation of one or more RBM20 aggregates (e.g., cytoplasmic RBM20 aggregates comprising a mutant RBM20 polypeptide).

[0079] In some embodiments, the diffusion coefficient of the one or more components of the RBM20 aggregates is the diffusion coefficient of an RBM20 polypeptide, such as a wild-type or mutant RBM20 polypeptide, diffusing from the one or more RBM20 aggregates. In some embodiments, the diffusion coefficient of the one or more components of the RBM20 aggregates is the diffusion coefficient of a component that is not an RBM20 polypeptide (e.g., another protein, nucleic acid, or compound) diffusing from the one or more RBM20 aggregates.

[0080] In some embodiments, the stability of one or more RBM20 aggregates is the stability of one or more RBM20 aggregates over time in the presence of a cellular activity or in the presence of a compound, e.g., based on the maintenance of the size, number, shape, or quantity of one or more RBM20 aggregates.

[0081] In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on a measurement of the largest dimension across the aggregate, such as, for example, the diameter, of each of the one or more RBM20 aggregates. In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on the circumference of each of the one or more RBM20 aggregates. In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on the average size of the one or more RBM20 aggregates. In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on the particle size distribution (such as d5, d10, d90, or d95) of the one or more RBM20 aggregates.

[0082] In some embodiments, the surface area of ​​one or more RBM20 aggregates is an estimated surface area based on a dimensional characteristic, such as the perimeter, of each of the one or more RBM20 aggregates.

[0083] In some embodiments, the sphericity of the one or more RBM20 aggregates is based on how closely each of the one or more RBM20 aggregates resembles a perfect sphere. In some embodiments, the sphericity of the one or more RBM20 aggregates is an estimated sphericity based on a cross-sectional or top-down view of each of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is based on the shape of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is the portion of the one or more RBM20 aggregates that have a shape type or meet a shape parameter.

[0084] In some embodiments, the fluidity and / or solidification of the one or more RBM20 aggregates is based on how the one or more RBM20 aggregates fuse with one another and / or on changes in the structure, size, shape, sphericity, volume, number, and / or surface area of ​​each of the one or more RBM20 aggregates over time. In some embodiments, the fluidity and / or solidification of the one or more RBM20 aggregates is based on fiber formation.

[0085] In some embodiments, the location of the RBM20 polypeptide is in any aspect of the cytoplasm of a cell. In some embodiments, the location of the RBM20 polypeptide is within or based on association with an organelle or cytoplasmic particle. In some embodiments, the location of the RBM20 polypeptide describes the association of the RBM20 polypeptide with another cellular element, such as the nucleus. In some embodiments, the location of the RBM20 polypeptide is relative to another cellular element, such as the nucleus or one or more RBM20 aggregates.

[0086] In some embodiments, the amount of RBM20 polypeptide or precursor thereof is the amount of precursor of RBM20 polypeptide or RNA, such as mRNA. In some embodiments, the amount of RBM20 polypeptide or precursor thereof is based on the amount of RBM20 polypeptide or precursor thereof in a part of a cell, such as the cytoplasm or nucleus.

[0087] In some embodiments, the aggregation of the RBM20 polypeptide is a non-phase-separated aggregation of the RBM20 polypeptide. In some embodiments, the characteristic associated with the RBM20 polypeptide is the level, such as the amount or relative amount, of aggregation of the RBM20 polypeptide.

[0088] In some embodiments, the functional activity associated with an RBM20 polypeptide is based on the normal activity of an RBM20 polypeptide, such as a wild-type RBM20 polypeptide when located in the nucleus (e.g., RNA splicing). In some embodiments, the functional activity associated with an RBM20 polypeptide is based on the function or characteristics of a cellular process, such as myocyte or cardiac function (e.g., calcium handling, ejection fraction, left ventricular fractional shortening, QT or QTc interval), or a cellular phenotype, such as sarcomere length / integrity.

[0089] In some embodiments, the post-translational modification state of an RBM20 polypeptide is based on the presence, level, or absence of at least one phosphorylation or methylation. In some embodiments, the post-translational modification state of an RBM20 polypeptide is based on the presence or absence of phosphorylation at S635. In some embodiments, the post-translational modification state of an RBM20 polypeptide is based on the presence or absence of phosphorylation at R636S. In some embodiments, the post-translational modification state of an RBM20 polypeptide is based on the presence or absence of phosphorylation at S637. In some embodiments, the post-translational modification state of an RBM20 polypeptide is based on the presence or absence of phosphorylation at S635 and S637. In some embodiments, the post-translational modification state of an RBM20 polypeptide is based on the presence or absence of phosphorylation at S635, R636S, and S637.

[0090] In some embodiments, the amount of RBM20 polypeptide degradation product is the amount of a product, such as a proteolytic product, of an RBM20 polypeptide. In some embodiments, the amount of RBM20 polypeptide degradation product is based on the amount of RBM20 polypeptide degradation product in a portion of a cell, such as the cytoplasm or nucleus.

[0091] In some embodiments, a characteristic (e.g., functional activity) associated with an RBM20 polypeptide is based on the presence or absence, or level, of titan splicing.

[0092] In some embodiments, the methods described herein assess multiple properties associated with one or more RBM20 aggregates in the cytoplasm of a cell and / or an RBM20 polypeptide in the cytoplasm of a cell. For example, in some embodiments, the properties include the location of one or more RBM20 aggregates, the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides, the number of one or more RBM20 aggregates, the size of one or more RBM20 aggregates, and the ratio of the amount of one or more RBM20 aggregates to a reference aggregate. In some embodiments, the properties further include functional activity associated with one or more RBM20 aggregates. In some embodiments, the properties include the composition of one or more RBM20 aggregates and colocalization of one or more RBM20 aggregates with a biomolecule. In some embodiments, the properties further include functional activity associated with one or more RBM20 aggregates. In some embodiments, the properties include the stability of one or more RBM20 aggregates, dissolution or size reduction of one or more RBM20 aggregates, and surface area of ​​one or more RBM20 aggregates. In some embodiments, the properties include sphericity of one or more RBM20 aggregates, fluidity of one or more RBM20 aggregates, and solidification of one or more RBM20 aggregates. In some embodiments, the properties include co-localization of one or more RBM20 aggregates with biomolecules and diffusion coefficients of components of one or more RBM20 aggregates. In some embodiments, the properties include stability of one or more RBM20 aggregates and dissolution or size reduction of one or more RBM20 aggregates. In some embodiments, the properties include surface area of ​​one or more RBM20 aggregates, sphericity of one or more RBM20 aggregates, fluidity of one or more RBM20 aggregates, and solidification of one or more RBM20 aggregates.

[0093] In some embodiments, the characteristics include the location of the RBM20 polypeptide and the amount of the RBM20 polypeptide or its precursor. In some embodiments, the characteristics include the location of the RBM20 polypeptide, the amount of the RBM20 polypeptide or its precursor, and the post-translational modification state of the RBM20 polypeptide. In some embodiments, the characteristics include the location of the RBM20 polypeptide, the amount of the RBM20 polypeptide or its precursor, and a functional activity associated with the RBM20 polypeptide. In some embodiments, the characteristics include the location of the RBM20 polypeptide, the amount of the RBM20 polypeptide or its precursor, the post-translational modification state of the RBM20 polypeptide, and a functional activity associated with the RBM20 polypeptide.

[0094] ii. Determining properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides in a cell-based method Properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides in the cytoplasm of a cell can, in some embodiments, be determined based on one or more of, for example, evaluation of one or more RBM20 aggregates and / or RBM20 polypeptides in the cytoplasm or portions thereof, evaluation of one or more RBM20 aggregates and / or RBM20 polypeptides inside, outside, or any other location associated with the cell, such as the nucleus, or evaluation of another biomolecule, such as another RBM20 aggregate component.

[0095] In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on evaluation of at least one cell or at least one portion thereof. In some embodiments, the evaluation is performed on a plurality of cells. In some embodiments, the portion of the cell is a field, such as a microscopic field, or a portion thereof. In some embodiments, the portion of the cell is a defined region of an image of the cell, or a portion thereof. In some embodiments, the defined region is based on one or more cellular elements (e.g., by expression of a fluorescent fusion protein, a nuclear dye, or IF staining), such as the boundary of the nucleus or cell membrane. In some embodiments, the defined region is arbitrarily defined, such as manually or by software. In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on iterative evaluation. In some embodiments, the iterative evaluation is based on multiple portions of an image or multiple images. In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on an average or distribution obtained from two or more portions of an image, two or more images, or two or more portions obtained from at least two or more images.

[0096] In some embodiments, determining properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on an imaging method. In some embodiments, the imaging method provides data for assessing properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the imaging method includes obtaining one or more images of a composition comprising a cell or portion thereof. In some embodiments, the image is a two-dimensional image. In some embodiments, the image is a three-dimensional image or rendering thereof. In some embodiments, the imaging method is combined with features of another method useful in the methods described herein, such as a fluorescence-activated cell sorter (FACS) method or a fluorescence-activated particle sorting (FAPS) method.

[0097] In some embodiments, the methods described herein include imaging a sample, such as a composition containing cells, or a portion thereof, by an imaging method. In some embodiments, the imaging method is a fluorescent imaging method. In some embodiments, the imaging method includes a fluorescent imaging method. In some embodiments, the imaging method includes colorimetric and fluorescent imaging methods. In some embodiments, the detected light is due to direct labeling of the target, such as incorporation or binding of a label into a compound or an RBM20 polypeptide. In some embodiments, the direct label includes Dendra2, GFP, or mCherry. In some embodiments, the detected light is due to indirect labeling of the target, such as a labeled probe that specifically binds to the RBM20 polypeptide, e.g., a labeled anti-RBM20 antibody or fragment thereof, a nuclear dye, or Annexin V luciferase that binds to phosphatidylserine (PS) exposed on the outer leaflet of the cell membrane during apoptosis. In some embodiments, characterizing includes immunofluorescence techniques. In some embodiments, the methods described herein include the use of direct and indirect labeling techniques.

[0098] In some embodiments, the method further comprises determining one or more cellular characteristics of the cells, such as RBM20 aggregates and / or RBM20 polypeptides, if present, or other biomolecules, if present. Those skilled in the art will readily recognize that cellular characteristics can be determined in many ways. In some embodiments, the method further comprises contacting at least a portion of the composition or cells with a stain. In some embodiments, the stain is a fluorescent stain. In some embodiments, the stain is a histochemical stain. In some embodiments, the stain is an immune-based stain, such as those used in immunohistochemistry or immunocytochemistry techniques. In some embodiments, the stain allows visualization of cellular elements, such as at least a portion of any one or more of the following, if present: plasma membrane or cell membrane, cytoplasm, cytoskeleton, nucleus, endoplasmic reticulum (rough and / or smooth), ribosomes, Golgi apparatus, lysosomes, mitochondria, vacuoles, or centrosomes. In some embodiments, the methods described herein further comprise contacting at least a portion of the composition or cells with a fixative.

[0099] In some embodiments, the method includes analyzing one or more images to evaluate properties associated with one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell and / or RBM20 polypeptides in the cytoplasm (or nucleus) of the cell. In some embodiments, analyzing includes mapping cell boundaries or boundaries of portions of the cell, such as organelles. In some embodiments, analyzing includes mapping boundaries of aggregates, such as RBM20 aggregates. In some embodiments, analyzing the images is completed and / or facilitated by analysis software. In some embodiments, one or more images are compared, such as over a time course. In some embodiments, analyzing includes measuring signal (e.g., fluorescent fusion protein, IF staining, or luminescence signal) intensity of one or more RBM20 aggregates, RBM20 polypeptides, biomolecules (e.g., co-localized polypeptides that are not RBM20 polypeptides), aggregates that do not contain RBM20 polypeptides, and / or compounds (e.g., compounds co-localized with aggregates). For example, in some embodiments, analyzing includes measuring an mCherry signal of a mutant R636S RBM20 polypeptide bound to an mCherry label and a Dendra2 signal of a Nestin polypeptide bound to a Dendra2 label within the boundaries of an RBM20 aggregate marked by mCherry. In some embodiments, analyzing further includes calculating an enrichment of the measured signals, such as the measured signals within the boundaries of the aggregate.

[0100] In some embodiments, a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined based on the ratio of the number of cells having RBM20 aggregates and / or RBM20 polypeptides with that property to the number of cells not having RBM20 aggregates and / or RBM20 polypeptides with that property. In some embodiments, a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined based on the number of cells having RBM20 aggregates and / or RBM20 polypeptides with that property. In some embodiments, a property associated with one or more RBM20 aggregates is determined based on the ratio of the number of RBM20 aggregates with that property in a cell (or field of view), e.g., the ratio of the number of RBM20 aggregates that include a biomolecule that is not an RBM20 polypeptide.

[0101] In some embodiments, a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined over a period of time, e.g., at two or more time points. In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides comprises assessing a change in the property over a period of time. For example, in some embodiments, cell proliferation, apoptosis, or necrosis is monitored over a period of time, e.g., by monitoring cell morphology, staining for a cellular marker such as an apoptotic marker (e.g., exposed PS), or propidium iodide (PI) staining. In some embodiments, the size, amount, location (e.g., cytoplasm or nucleus), and / or distribution (e.g., uniform throughout the cytoplasm or nucleus) of one or more RBM20 aggregates and / or RBM20 polypeptides is determined over a period of time after RBM20 polypeptides are expressed in cells (e.g., by transient transfection or by doxycycline induction of expression via the TetOn system).

[0102] In some embodiments, one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides are determined using one or more measurements and / or techniques. In some embodiments, multiple properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using one or more measurements and / or techniques.

[0103] In some embodiments, the methods described herein include techniques for, for example, visualization, analysis, and / or quantification of aggregates, polypeptides, and / or their precursors. Such techniques are well known to those of skill in the art. For example, the present invention includes microscopy techniques for visualizing polypeptides, such as fluorescently labeled polypeptides, including those compatible with cell lines. Also included herein are mass spectrometry (MS) techniques for analyzing polypeptide composition, including post-translational modifications, polypeptide quantification, and testing the composition of RBM20 aggregates (e.g., by crosslinking MS techniques, or "XL-MS"). Also included herein are functional assays for assessing cellular processes, cell viability, cytotoxicity, and cell proliferation. Also included herein are enrichment and / or isolation techniques, such as centrifugation techniques for isolating cellular fractions or affinity-based techniques for isolating polypeptides or nucleic acids. In some embodiments, the techniques evaluate properties within one or more cells or defined region(s) of one or more cells. In some embodiments, the techniques evaluate one or more of the intensity, area, and number of aggregates within one or more cells or defined region(s) of one or more cells. In some embodiments, the technique assesses the number of cells that do or do not have the characteristic. In some embodiments, the technique assesses the number of aggregates within cells that do or do not have the characteristic. In some embodiments, the method includes using z-scores to evaluate the assay and results therefrom. Z-scores and their uses are well known in the art. See, e.g., Zhang et al., J Biomol Screen, 1999.

[0104] In some embodiments, the location of the one or more RBM20 aggregates is determined by assessing the presence, absence, or level of one or more RBM20 aggregates in at least a portion of a cell, such as a cellular element, e.g., the cytoplasm or nucleus, or associated with a portion of a cell. In some embodiments, determining the location of the one or more RBM20 aggregates comprises determining a cellular element.

[0105] In some embodiments, the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides is determined by assessing the presence or absence, or level, of one or more RBM20 aggregates relative to a cellular element or within a portion of a cell, such as a field of view. In some embodiments, determining the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides comprises determining the distribution of one or more RBM20 aggregates and / or RBM20 polypeptides relative to an arbitrarily determined point in a cell or image thereof.

[0106] In some embodiments, the number of one or more RBM20 aggregates is determined by assessing the total number of RBM20 aggregates in a cell, such as the cytoplasm or nucleus. In some embodiments, the number of one or more RBM20 aggregates is determined by assessing the number of RBM20 aggregates in a portion, such as a field of view, of a cell, e.g., the cytoplasm or nucleus. In some embodiments, the number of one or more RBM20 aggregates is determined by estimating the total number of RBM20 aggregates in a cell or portion thereof, such as the cytoplasm or nucleus, based on measurements of fewer than the total number of cells.

[0107] In some embodiments, the size of one or more RBM20 aggregates is determined by assessing a measurement of the largest dimension across the aggregate, e.g., diameter, of each of the one or more RBM20 aggregates. In some embodiments, the size of one or more RBM20 aggregates is determined by assessing the perimeter of each of the one or more RBM20 aggregates. In some embodiments, the size of one or more RBM20 aggregates is determined by assessing the cross-sectional area of ​​each of the one or more RBM20 aggregates or an imaged representation thereof, such as a plan view. In some embodiments, the size of one or more RBM20 aggregates is determined by a particle size measurement technique, such as dynamic light scattering.

[0108] In some embodiments, the ratio of the number of one or more RBM20 aggregates to the reference aggregates is determined by assessing the number of RBM20 aggregates in the cytoplasm of a cell to the number of reference aggregates, where the reference aggregates do not comprise an RBM20 polypeptide. In some embodiments, the reference aggregates are in the cytoplasm of the cell. In some embodiments, the reference aggregates are in the nucleus of the cell. In some embodiments, the ratio of the number of one or more RBM20 aggregates to the reference aggregates is determined by assessing the number of RBM20 aggregates in the cytoplasm of the cell to the number of reference aggregates in the nucleus, such as nuclear aggregates comprising an RBM20 polypeptide. In some embodiments, the ratio of the number of one or more RBM20 aggregates to the number of reference aggregates is determined by assessing the number of RBM20 aggregates comprising a first RBM20 polypeptide to the number of reference aggregates, where the reference aggregates are aggregates comprising a second RBM20 polypeptide.

[0109] In some embodiments, the amount of one or more RBM20 aggregates is determined by assessing the number and size of one or more RBM20 aggregates, hi some embodiments, the amount of one or more RBM20 aggregates is determined in a portion of a cell, such as the cytoplasm or nucleus, or in a portion of an image of a cell.

[0110] In some embodiments, functional activity associated with one or more RBM20 aggregates is determined by assessing precursors, intermediates, or products of cellular processes associated with one or more RBM20 aggregates. For example, in some embodiments, functional activity associated with one or more RBM20 aggregates is determined by assessing the presence or level of an enzymatic activity or its product. In some embodiments, functional activity associated with one or more RBM20 aggregates is determined by assessing the presence or level of a Titan isoform or its precursor. In some embodiments, functional activity associated with one or more RBM20 aggregates is determined by assessing the presence or level of one or more of a polypeptide or a nucleic acid, such as DNA or RNA.

[0111] In some embodiments, the composition of one or more RBM20 aggregates is determined by assessing the presence or absence, or level, of at least one other component of or associated with one or more RBM20 aggregates. In some embodiments, determining the composition of one or more RBM20 aggregates comprises determining the presence or absence, or level, of at least one other component of or associated with one or more RBM20 aggregates relative to an RBM20 polypeptide. In some embodiments, the other component is assessed, such as by direct or indirect measurement. In some embodiments, the other component is assessed using a mass spectrometry technique, such as APEX or XL-MS. In some embodiments, the other component (e.g., its presence or absence) is assessed using a FAPS technique. In some embodiments, the other component is assessed using a labeling technique, such as directly attaching a label to the other component or using immunolabeling. In some embodiments, the one or more RBM20 aggregates are isolated and / or enriched from other cellular components. In some embodiments, the one or more RBM20 aggregates are not isolated and / or enriched from other cellular components, e.g., assessed in situ. The composition of one or more RBM20 aggregates may or may not be fixed before being determined.

[0112] In some embodiments, colocalization of one or more RBM20 aggregates with a biomolecule, e.g., a protein such as RNA or actin, or a compound is determined by assessing the presence or level of the biomolecule (or compound) in or associated with one or more RBM20 aggregates. In some embodiments, the biomolecule (or compound) is assessed, e.g., by direct or indirect measurement. In some embodiments, the biomolecule is assessed using a mass spectrometry technique, e.g., APEX or XL-MS. In some embodiments, the biomolecule (e.g., its presence or absence) is assessed using a FAPS technique. In some embodiments, the biomolecule is assessed using a labeling technique, e.g., by directly binding a label to another component or using immunolabeling, such as in IF techniques. In some embodiments, one or more RBM20 aggregates are isolated and / or enriched from other cellular components before the presence or level of the biomolecule in or associated with one or more RBM20 aggregates is assessed. In some embodiments, one or more RBM20 aggregates are not isolated and / or enriched from other cellular components, e.g., assessed in situ. The one or more RBM20 aggregates, or the cells containing one or more RBM20 aggregates, may or may not be fixed prior to making the determination.

[0113] In some embodiments, the diffusion coefficients of components, such as RBM20 polypeptides, of one or more RBM20 aggregates are determined based on fluorescence correlation spectroscopy.

[0114] In some embodiments, the stability of one or more RBM20 aggregates is determined based on a fusion or fission method. In some embodiments, the stability of one or more RBM20 aggregates is determined based on a change in the structural stability of each of the one or more RBM20 aggregates over time in the presence of cellular activity or a compound. In some embodiments, the stability of one or more RBM20 aggregates is determined based on evaluating any one or more of the size, shape, sphericity, volume, or surface area of ​​each of the one or more RBM20 aggregates.

[0115] In some embodiments, the dissolution or reduction in size of one or more RBM20 aggregates is determined based on a change in the structure of each of the one or more RBM20 aggregates over time in the presence of cellular activity or in the presence of a compound, hi some embodiments, the dissolution or reduction in size of one or more RBM20 aggregates is determined based on assessing any one or more of the size, shape, sphericity, volume, number (including absence), or surface area of ​​each of the one or more RBM20 aggregates.

[0116] In some embodiments, the surface area of ​​one or more RBM20 aggregates is determined based on estimating the surface area using a measured parameter of each of the one or more RBM20 aggregates (e.g., perimeter, a measurement of the largest dimension across the aggregate).

[0117] In some embodiments, the sphericity of one or more RBM20 aggregates is determined based on a 3D lattice light sheet method. In some embodiments, the sphericity of one or more RBM20 aggregates is determined based on a 2D imaging method. In some embodiments, the sphericity of one or more RBM20 aggregates is determined based on a cross-sectional view or a top view of each of the one or more RBM20 aggregates.

[0118] In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on fusion or fission methods. In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on changes in the structure of each of the one or more RBM20 aggregates over time. In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on evaluating changes in any one or more of the size, shape, sphericity, volume, number, or surface area of ​​each of the one or more RBM20 aggregates. In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on fiber formation and the extent thereof.

[0119] In some embodiments, the location of the RBM20 polypeptide is determined by an imaging method, such as a fluorescent imaging method. In some embodiments, the location of the RBM20 polypeptide is determined directly (e.g., using a labeled RBM20 polypeptide) or indirectly (e.g., using a labeled probe, e.g., a labeled anti-RBM20 antibody or fragment thereof). In some embodiments, the RBM20 polypeptide is isolated from a fraction of a cell, such as the cytoplasm or nucleus, and the fraction of the cell is then evaluated for the presence or level of the RBM20 polypeptide.

[0120] In some embodiments, the amount of RBM20 polypeptide or its precursor, such as RNA, is determined by imaging, such as fluorescent imaging. In some embodiments, the amount of RBM20 polypeptide is determined directly (e.g., using a labeled RBM20 polypeptide) or indirectly (e.g., using a labeled probe, e.g., a labeled anti-RBM20 polypeptide). In some embodiments, RBM20 polypeptide or its precursor is isolated from a cellular fraction, such as the cytoplasm or nucleus, and then the cellular fraction is evaluated for the amount of RBM20 polypeptide or its precursor. The amount of RBM20 polypeptide or its precursor can be quantified using any method known in the art, such as Western blot, immunoprecipitation (IP), in situ immunofluorescence (IF) staining, FISH, Northern blot, or qPCR.

[0121] In some embodiments, aggregate distribution of an RBM20 polypeptide into one or more RBM20 aggregates is determined based on the amount of RBM20 polypeptide diffused from one or more RBM20 aggregates compared to the amount of RBM20 polypeptide in or associated with one or more RBM20 aggregates. In some embodiments, aggregate distribution into one or more RBM20 aggregates is determined for one or more other biomolecules (e.g., other polypeptides or nucleic acids) or compounds that are not RBM20 polypeptides. In some embodiments, aggregate distribution can be determined by imaging methods, such as fluorescent imaging methods, by directly labeling the biomolecule (e.g., RBM20 polypeptide) or compound, or indirectly labeling it, such as by using a labeled probe (e.g., antibody staining).

[0122] In some embodiments, the functional activity associated with the RBM20 polypeptide is based on the normal activity of the RBM20 polypeptide when located in the nucleus, such as the titan splicing state. In some embodiments, the functional activity associated with the RBM20 polypeptide is determined by a titan splicing assay.

[0123] In some embodiments, aggregation of an RBM20 polypeptide is determined based on the presence or absence, or level, of non-phase-separated RBM20 polypeptide aggregation.

[0124] In some embodiments, the post-translational modification status of the RBM20 polypeptide is determined based on the presence or absence, or level, of one or more RBM20 polypeptide PTMs, such as phosphorylation or methylation. In some embodiments, determining the PTM status of the RBM20 polypeptide comprises enriching for one or more species of modified RBM20 polypeptide. In some embodiments, the presence or absence, or level, of the post-translational modification can be determined by IF staining, such as using an anti-phospho antibody.

[0125] In some embodiments, the amount of RBM20 polypeptide degradation products is determined based on a protein assay, such as the protein assays described herein. In some embodiments, the amount of RBM20 polypeptide degradation products is determined based on mass spectrometry or Western blotting. In some embodiments, the protein assay is quantitative.

[0126] In some embodiments, properties (e.g., composition) associated with one or more RBM20 aggregates and RBM20 polypeptides are determined based on immunofluorescence, fluorescence in situ hybridization (FISH), mass spectrometry (MS), RNA-seq, or NMR spectroscopy, etc.

[0127] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides (e.g., fluidity and / or solidification) are determined based on fluorescence recovery after photobleaching (FRAP). In some embodiments, FRAP is performed to assess whole aggregates, e.g., to measure the exchange of one or more RBM20 aggregate components with the cytoplasm or nucleus. In some embodiments, FRAP is performed to assess half-aggregates, e.g., to measure internal dynamics within one or more RBM20 aggregates.

[0128] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on photoconversion of a fluorophore, such as Dendra2.

[0129] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on fluorescence correlation spectroscopy (FCS).

[0130] In some embodiments, the property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined based on the temperature responsiveness of one or more RBM20 aggregates and / or RBM20 polypeptides.

[0131] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on tracking aggregate fusion and / or fission, such as fusion and / or fission within a cell.

[0132] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on 3D lattice light sheet methods.

[0133] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on super-resolution imaging techniques such as stimulated emission depletion (STED) microscopy, stochastic optical reconstruction microscopy (STORM), photoactivated localization microscopy (PALM), or hybrids thereof.

[0134] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on ultraviolet-visible (UV-Vis) spectroscopy, small-angle X-ray scattering, or static and dynamic light scattering (SLS / DLS). For example, light scattering methods such as dynamic light scattering (DLS), static light scattering (STS), and small-angle light scattering (SLS) can be used to determine the size and shape of condensates. See also Basturea, GN (“Biological Condensates,” MATER METHODS 2019;9:2794) for various in vitro and intracellular aggregate analysis methods.

[0135] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined in the presence of cellular stress. For example, in some embodiments, the cellular stress is one or more of hypoxia, oxidative stress, apoptotic stress (e.g., staurosporine), energy stress (OXPHOS or glycolysis), ATP depletion, temperature, such as heat, or mechanical stress, such as occurs in irregular or excessive heartbeats.

[0136] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined in the presence of beating / contraction in cells, such as cardiomyocytes. In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on calcium handling, ejection fraction, left ventricular fractional shortening, QT or QTc interval of cardiomyocytes. In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on sarcomere length / integrity. In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined in the presence of an external mechanical force, such as that applied using atomic force microscopy.

[0137] In some embodiments, the modulation of the property is based on the presence, absence, or altered level of one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the modulation of the property is based on a decrease in the number of one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on an increase in the number of one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on the formation of one or more RBM20 aggregates, such as the formation of one or more RBM20 aggregates in the cytoplasm or nucleus of the cell. In some embodiments, the modulation of the property is based on a decrease in the size of one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on an increase in the size of one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell.

[0138] In some embodiments, the modulation of the property is based on a decrease in the amount of RBM20 polypeptide or its precursor in the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on an increase in the amount of RBM20 polypeptide or its precursor in the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on an increase in the presence of one or more post-translational modifications on the RBM20 polypeptide. In some embodiments, the modulation of the property is based on a decrease in the presence of one or more post-translational modifications on the RBM20 polypeptide.

[0139] In some embodiments, the modulation of the property is based on an increase in the amount of one or more RBM20 aggregates in the nucleus of the cell. In some embodiments, the modulation of the property is based on an increase in the amount of RBM20 polypeptide in the nucleus of the cell.

[0140] In some embodiments, the modulation of the property is based on a decrease in functional activity associated with one or more RBM20 aggregates and / or RBM20 polypeptides in a portion of the cell, such as the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on an increase in functional activity associated with one or more RBM20 aggregates and / or RBM20 polypeptides in a portion of the cell, such as the cytoplasm (or nucleus) of the cell.

[0141] In some embodiments, the modulation of the property is based on the presence, absence, or altered level of a biomolecule (e.g., another polypeptide or nucleic acid) that is not an RBM20 polypeptide within one or more RBM20 aggregates. In some embodiments, the modulation of the property is based on a decrease in the amount of a biomolecule within one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell. In some embodiments, the modulation of the property is based on an increase in the amount of a biomolecule within one or more RBM20 aggregates in the cytoplasm (or nucleus) of the cell.

[0142] In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on properties related to the heart or cardiac tissue, such as heart size or characteristics thereof, and muscle contraction (e.g., ejection fraction, left ventricular fractional shortening, QT or QTc interval). In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on titan splicing.

[0143] In some embodiments, the methods described herein include determining the specificity of a compound for modulating a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides. For example, in some embodiments, the methods include determining modulation of a property associated with a first RBM20 aggregate and a second RBM20 aggregate, wherein the compound modulates the property of the first RBM20 aggregate but not the property of the second RBM20 aggregate. In some embodiments, the first RBM20 aggregate comprises a wild-type RBM20 polypeptide and the second RBM20 aggregate comprises a mutant RBM20 polypeptide. In some embodiments, the first RBM20 aggregate comprises a mutant RBM20 polypeptide and the second RBM20 aggregate comprises a wild-type RBM20 polypeptide. In some embodiments, the first RBM20 aggregate is in the nucleus and the second RBM20 aggregate is in the cytoplasm. In some embodiments, the first RBM20 aggregate is in the cytoplasm and the second RBM20 aggregate is in the nucleus. In some embodiments, the first RBM20 aggregate comprises a first mutant RBM20 polypeptide and the second RBM20 aggregate comprises a second mutant RBM20 polypeptide, and the first and second mutant RBM20 polypeptides are different.

[0144] In some embodiments, the methods involve determining modulation of properties associated with RBM20 aggregates and non-RBM20 aggregates (aggregates that do not contain the RBM20 polypeptide), where the compound modulates the properties of RBM20 aggregates but not the properties of non-RBM20 aggregates. In some embodiments, the methods involve determining modulation of properties associated with RBM20 aggregates and non-RBM20 aggregates (aggregates that do not contain the RBM20 polypeptide), where the compound modulates the properties of RBM20 aggregates but not the properties of non-RBM20 aggregates. For example, in some embodiments, the compound relocates non-RBM20 polypeptide biomolecules that are sequestered in RBM20 aggregates under disease or stress conditions to non-RBM20 aggregates or cellular locations (e.g., the cytoplasm or nucleus) where the biomolecules should be present under healthy or non-stress conditions. In some embodiments, the compound relocates RBM20 polypeptides from RBM20 aggregates in the cytoplasm (e.g., under disease or stress conditions) to aggregates in the nucleus where the biomolecules should be present under healthy or non-stress conditions.

[0145] In some embodiments, the method includes determining modulation of a property associated with a first RBM20 aggregate and a second RBM20 aggregate, wherein the compound modulates the property of the first RBM20 aggregate and the second aggregate. In some embodiments, the first RBM20 aggregate comprises a wild-type RBM20 polypeptide and the second RBM20 aggregate comprises a mutant RBM20 polypeptide. In some embodiments, the first RBM20 aggregate comprises a first mutant RBM20 polypeptide and the second RBM20 aggregate comprises a second mutant RBM20 polypeptide, wherein the first and second mutant RBM20 polypeptides are different. In some embodiments, the first RBM20 aggregate is in the cytoplasm and the second RBM20 aggregate is in the nucleus. In some embodiments, both RBM20 aggregates are in the nucleus. In some embodiments, both RBM20 aggregates are in the cytoplasm.

[0146] In some embodiments, the method includes determining one or more of cell viability, cytotoxicity, and cell proliferation. In some embodiments, cell viability is assessed by a marker that correlates with the number of viable cells and / or cell function. In some embodiments, cell viability is assessed by ATP levels, such as using the Titer glo assay. In some embodiments, cell viability is assessed by cell metabolism, such as using the RealTime-Glo® MT assay. In some embodiments, cytotoxicity (e.g., apoptosis or necrosis) is assessed by PS exposure or loss of membrane integrity, such as using the RealTime-Glo® Annexin V Apoptosis and Necrosis Assay. In some embodiments, cell viability is assessed translationally, such as using puromycin uptake. In some embodiments, cytotoxicity is assessed by a marker that correlates with the number of dead and / or dying cells. In some embodiments, cytotoxicity is assessed by membrane integrity, such as using a cell-permeable dye. In some embodiments, cytotoxicity is assessed by apoptosis or necrosis markers, such as using Annexin V or TUNEL, or by propidium iodide (PI) staining. Any apoptosis assay known in the art can be used herein, such as DNA laddering, DNA fragmentation analysis by TUNEL, enzyme-linked immunosorbent assay for histone / DNA fragments, poly(ADP-ribose) polymerase cleavage assay, and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling assay. Several apoptosis markers can be assessed. For example, cleavage of anti-apoptotic Bcl-2 family proteins can be assessed by Western blot of protein cleavage.Caspase activation can be assessed by colorimetric / fluorometric substrate-based assays in microtiter plates, by detecting cleavage of a fluorescent substrate in flow cytometry / microscopy, or by microtiter plate analysis using Western blot analysis of procaspases and active caspases, flow cytometry / microscopy using antibodies specifically recognizing the activated form of caspases, or microplate spectrophotometry using antibodies specifically recognizing the activated form of caspases. Cleavage of caspase substrates (PARP) can be assessed by microplate spectrophotometry using antibodies specific for cleaved PARP or by Western blot analysis of cleaved PARP. Activation of non-caspase proteases (cathepsins and calpains) can be assessed by colorimetric / fluorometric substrate-based assays in microtiter plates. The decrease in mitochondrial membrane potential (Δψm) can be assessed by flow cytometry / microscopy / microplate spectrophotometry using a Δψm sensitive probe, or by oxygen consumption assays. Cytochrome C release can be assessed by Western blot or antibody-based microscopic analysis of the presence of cytochrome C in the cytosol. An increase in the sub-G1 population can be assessed by flow cytometry analysis of the sub-G1 peak. Nuclear condensation can be assessed by flow cytometry or microscopic analysis of chromatin condensation. Membrane blebbing can be assessed by light microscopy or Western blot analysis of cleaved substrates (gelsolin, ROCK1). In some embodiments, cell proliferation is assessed by cell confluency. In some embodiments, cell proliferation is assessed by proliferation markers, such as markers for measuring Ki67, eFluorescent dyes, and / or nuclear dyes.

[0147] iii. Cells and compositions containing cells In some embodiments, a composition comprising a cell described herein comprises a plurality of cells. In some embodiments, a composition comprising a cell described herein comprises a plurality of cells, wherein the plurality of cells are selected based on their expression level of an RBM20 polypeptide, such as being selected based on having similar expression levels of an RBM20 polypeptide. In some embodiments, a composition comprising a cell described herein comprises a plurality of cells, wherein the plurality of cells are clones derived from a single cell.

[0148] In some embodiments, the cells contain one or more RBM20 aggregates, e.g., they contain one or more RBM20 aggregates before contact with a compound, as described in the methods herein. In some embodiments, after the compound contacts the composition, one or more RBM20 aggregates are formed in the cells. In some embodiments, one or more RBM20 aggregates can be formed in the cells in the absence of the compound, such as when the cells are contacted with the compound after initiation of expression of an RBM20 polypeptide that forms cytoplasmic RBM20 aggregates in the absence of the compound. In some embodiments, one or more RBM20 aggregates are formed in the cells under stress.

[0149] In some embodiments, the cells express an RBM20 polypeptide, such as a labeled RBM20 polypeptide, at approximately the expression level of the endogenous RBM20 polypeptide. In some embodiments, the cells express an RBM20 polypeptide, such as a labeled RBM20 polypeptide, at approximately the expression level of the RBM20 polypeptide in a reference cell. In some embodiments, the cells express an RBM20 polypeptide, such as a labeled RBM20 polypeptide, at a level higher than the expression level of the endogenous RBM20 polypeptide. In some embodiments, the cells express an RBM20 polypeptide, such as a labeled RBM20 polypeptide, at approximately the expression level of the endogenous RBM20 polypeptide, provided that the cells have been modified to reduce the level of degradation of the RBM20 polypeptide. In some embodiments, the cells express an RBM20 polypeptide, such as a labeled RBM20 polypeptide, at a level lower than the expression level of the endogenous RBM20 polypeptide. In some embodiments, the cells used in the methods described herein are sorted based on the expression level of the RBM20 polypeptide. In some embodiments, the cells express a first RBM20 polypeptide and a second RBM20 polypeptide, but the first and second RBM20 polypeptides are different, e.g., the first RBM20 polypeptide is a wild-type RBM20 polypeptide and the second RBM20 polypeptide is a mutant RBM20 polypeptide, or the first RBM20 polypeptide is a first mutant RBM20 polypeptide and the second RBM20 polypeptide is a second mutant RBM20 polypeptide, which are different from the first and second mutant RBM20 polypeptides. In some embodiments, the cells express a wild-type RBM20 polypeptide and a mutant RBM20 polypeptide.

[0150] In some embodiments, the cell comprises a construct comprising a nucleic acid sequence of an RBM20 polypeptide. In some embodiments, the vector comprises a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the promoter is an inducible promoter, such as a promoter controlled by the presence of tetracycline or doxycycline. In some embodiments, the cell comprises one or more constructs encoding a wild-type RBM20 polypeptide and a mutant RBM20 polypeptide. In some embodiments, the nucleic acids encoding the first RBM20 polypeptide and the second RBM20 polypeptide are on the same vector and are under the control of the same promoter or under the control of different promoters. In some embodiments, the nucleic acids encoding the first RBM20 polypeptide and the second RBM20 polypeptide are on different vectors. The first RBM20 polypeptide and the second RBM20 polypeptide can be expressed in the same amount or in different amounts.

[0151] In some embodiments, the cells have endogenous RBM20 polypeptide knocked down or knocked out, such as by CRISPR, and the cells express a heterologous RBM20 polypeptide, such as a labeled RBM20 polypeptide and / or a mutant RBM20 polypeptide. In some embodiments, the cells comprise an engineered endogenous locus for an RBM20 polypeptide. In some embodiments, the endogenous locus for an RBM20 polypeptide is engineered to modulate the expressed RBM20 polypeptide, e.g., to create a mutant RBM20 polypeptide. In some embodiments, the endogenous locus for an RBM20 polypeptide is engineered to insert a tag.

[0152] In some embodiments, cells are engineered to knock down or knock out endogenous RBM20 polypeptides using the dTAG system for immediate, targeted protein degradation (Nabet et al., Nature Chemical Biology, 2018). Briefly, this system combines expression of FKBP degraders in-frame with RBM20, allowing the presence of dTAG to recruit E3 ubiquitin ligase to RBM20, marking it for proteasomal degradation. Such cell lines can be constructed by CRISPR-mediated locus-specific knock-in.

[0153] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a primate cell. In some embodiments, the cell is a primate cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a rat cell. In some embodiments, the cell is a mouse cell.

[0154] In some embodiments, the cells are models of cardiac cell types, such as models of features or characteristics of cardiac cell types. In some embodiments, the cells are cardiomyocytes. In some embodiments, the cardiomyocytes are H9C2 cells. In some embodiments, the cardiomyocytes are patient-derived cardiomyocytes. In some embodiments, the cardiomyocytes are induced pluripotent stem (iPS) cells, such as human iPS, e.g., KOLF cells or WTC-11 cells, that have been differentiated into cardiomyocytes. In some embodiments, the cardiomyocytes are stem cells, such as human stem cells that have been differentiated into cardiomyocytes. In some embodiments, the cardiomyocytes are patient-derived cardiomyocytes, such as AC-16 cells.

[0155] In some embodiments, the cell is a HeLa cell. In some embodiments, the cell is a U2OS (human osteosarcoma epithelial) cell. In some embodiments, the cell is an induced pluripotent stem (iPS) cell. In some embodiments, the cell is a human iPS cell, such as a KOLF cell or a WTC-11 cell. In some embodiments, the cell is a stem cell, such as a human stem cell.

[0156] In some embodiments, the cells are homozygous for the allele encoding the RBM20 polypeptide. In some embodiments, the cells are heterozygous for the allele encoding the RBM20 polypeptide.

[0157] iv. Cell-based references In some embodiments, the methods described herein determine modulation of one or more RBM20 aggregate and / or RBM20 polypeptide associated properties relative to a reference.

[0158] In some embodiments, the reference is an established value for a property. In some embodiments, the reference comprises a composition comprising cells admixed with a solvent control. In some embodiments, the reference comprises a composition comprising cells admixed with a reference compound, such as a negative control or positive control reference compound. In some embodiments, the reference comprises a composition comprising cells admixed with a compound, wherein one or more RBM20 aggregate- and / or RBM20 polypeptide-related properties are determined for the reference at different time points. In some embodiments, the reference is cells comprising a different RBM20 polypeptide, such as a wild-type or mutant RBM20 polypeptide. In some embodiments, the reference is cells comprising different levels of RBM20 polypeptide. In some embodiments, the reference is cells comprising RBM20 polypeptides with different post-translational modification states. In some embodiments, the reference is cells that are not induced to express RBM20 polypeptides or do not express RBM20 polypeptides. In some embodiments, the reference is cells under stress or in a disease state. In some embodiments, the reference is cells under non-stress or in a healthy state. In some embodiments, the reference is cells comprising an RBM20 polypeptide tagged with a cellular location tag, such as a nuclear localization signal.

[0159] In some embodiments, modulation is assessed by a change in the degree of a characteristic described herein, such as an increase, decrease, or no change. In some embodiments, multiple reference values ​​or replicate experiments are analyzed to determine modulation of a characteristic. In some embodiments, the modulation measurement is normalized to a reference measurement. In some embodiments, statistical methods are used to assess the significance of modulation, such as p-values.

[0160] v. Exemplary Cell-Based Methods In some embodiments, described herein are methods for identifying a compound that reduces the size and / or number of RBM20 aggregates in the cytoplasm of a cell, the methods comprising: (a) determining the size and / or number of RBM20 aggregates in at least a portion of the cytoplasm of a cell exposed to the compound; and (b) comparing the size and / or number of RBM20 aggregates to a reference, thereby identifying a compound that reduces the size and / or number of RBM20 aggregates in the cytoplasm of the cell. In some embodiments, the compound reduces the number of RBM20 aggregates. In some embodiments, the compound reduces the size of RBM20 aggregates. In some embodiments, cells are engineered using CRISPR to knock out the endogenous RBM20 gene and engineered to express a heterologous RBM20 polypeptide comprising a fluorescent label. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide, such as an R636S RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the reference is cells containing a mutant RBM20 polypeptide contacted with a solvent control. In some embodiments, the reference is a cell comprising a wild-type RBM20 polypeptide that has been contacted with the compound. In some embodiments, the size and / or number of RBM20 aggregates is determined using an imaging method, such as a fluorescent imaging method.

[0161] In some embodiments, described herein are methods for identifying a compound that prevents the formation or proliferation of one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, the method comprising: (a) combining a compound with a composition comprising cells, wherein (i) the cells comprise one or more RBM20 aggregates and / or (ii) one or more RBM20 aggregates are formed after contacting the compound with the composition; (b) obtaining a first measurement of the size and / or number of one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell; and (c) comparing the first measurement to a reference, thereby identifying a compound that prevents the formation or proliferation of one or more RBM20 aggregates in the cytoplasm of the cell. In some embodiments, the reference comprises an aliquot of a composition comprising cells mixed with a control agent. In some embodiments, the reference is a second measurement of the size and / or number of one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell, the second measurement being taken at a different time than the first measurement. In some embodiments, the method further includes exposing the cells to conditions that promote the formation of one or more RBM20 aggregates. In some embodiments, the conditions that promote the formation of one or more RBM20 aggregates are one or more of an increased expression level or amount of an RBM20 polypeptide, an increased expression level or amount of a scaffolding molecule for RBM20 aggregates, or an increased level of a PTM. In some embodiments, the cells are engineered using CRISPR to knock out the endogenous RBM20 gene and engineered to express a heterologous RBM20 polypeptide comprising a fluorescent label. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide, such as an R636S RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the reference is a cell containing a mutant RBM20 polypeptide contacted with a solvent control. In some embodiments, the reference is a cell containing a wild-type RBM20 polypeptide contacted with a compound.In some embodiments, the size and / or number of RBM20 aggregates are determined using imaging techniques, such as fluorescent imaging techniques.

[0162] In some embodiments, the present disclosure describes a method for identifying a compound that reduces the amount of RBM20 polypeptide in the cytoplasm of a cell, the method comprising: (a) combining the compound with a composition comprising the cells; (b) obtaining a first measurement of the amount of RBM20 polypeptide in at least a portion of the cytoplasm of the cells; and (c) comparing the first measurement to a reference, thereby identifying the compound that reduces the amount of RBM20 polypeptide in the cytoplasm of the cell. In some embodiments, the reference comprises an aliquot of a composition comprising the cells mixed with a control agent. In some embodiments, the reference is a second measurement of the amount of RBM20 polypeptide in at least a portion of the cytoplasm of the cells, the second measurement being measured at a different time point than the first measurement. In some embodiments, the cells are modified using CRISPR to knock out the endogenous RBM20 gene and to express a heterologous RBM20 polypeptide comprising a fluorescent label. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide, such as an R636S RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the reference is cells comprising a mutant RBM20 polypeptide contacted with a solvent control. In some embodiments, the reference is cells comprising a wild-type RBM20 polypeptide contacted with a compound. In some embodiments, the size and / or number of RBM20 aggregates are determined using an imaging method, such as a fluorescent imaging method.

[0163] In some embodiments, the cell-based methods described herein are designed to identify compounds or portions thereof that modulate one or more properties associated with one or more RBM20 aggregates in the cytoplasm of a cell and / or RBM20 polypeptides in the cytoplasm of a cell, wherein the one or more properties are identified as being associated with disease onset and / or progression. For example, in some embodiments, it may be desirable to dissipate one or more RBM20 aggregates in the cytoplasm of a cell; therefore, one or more properties assessed using the methods described herein may include one or more of: location of one or more RBM20 aggregates; distribution of one or more RBM20 aggregates and / or RBM20 polypeptides; number of one or more RBM20 aggregates; size of one or more RBM20 aggregates; ratio of the amount of one or more RBM20 aggregates to a reference aggregate; functional activity associated with one or more RBM20 aggregates; composition of one or more RBM20 aggregates; co-localization of one or more RBM20 aggregates with biomolecules; diffusion coefficient of components of one or more RBM20 aggregates; stability of one or more RBM20 aggregates; dissolution or size reduction of one or more RBM20 aggregates; surface area of ​​one or more RBM20 aggregates; sphericity of one or more RBM20 aggregates; fluidity of one or more RBM20 aggregates; and solidification of one or more RBM20 aggregates.In some embodiments, it is desirable to restore the localization of components of RBM20 aggregates in the cytoplasm of a cell, such as returning wild-type RBM20 aggregates to the nucleus or returning non-RBM20 polypeptides to their normal location (e.g., the location prior to sequestration within cytoplasmic RBM20 aggregates). Accordingly, one or more properties assessed using the methods described herein include functional activity associated with one or more RBM20 aggregates, composition of one or more RBM20 aggregates, co-localization of one or more RBM20 aggregates with biomolecules, diffusion coefficient of components of one or more RBM20 aggregates, stability of one or more RBM20 aggregates, dissolution or size reduction of one or more RBM20 aggregates, location of the RBM20 polypeptide, amount of RBM20 polypeptide or its precursor, aggregate partitioning of RBM20 polypeptide into one or more RBM20 aggregates, functional activity associated with the RBM20 polypeptide, aggregation of the RBM20 polypeptide, post-translational modification state of the RBM20 polypeptide, and amount of RBM20 polypeptide degradation products.

[0164] In some embodiments, the cell-based methods described herein involve establishing a cell line (a stable cell line with transient, constitutive, or inducible expression) expressing an RBM20 polypeptide (wild-type or mutant). For example, a plasmid encoding an RBM20 polypeptide (wild-type or mutant) can be transiently transfected (e.g., by electroporation) into cells (e.g., H9C2), resulting in expression of the RBM20 polypeptide at a desired level and / or with a desired phenotype (e.g., greater than 90% of cells do not form mutant RBM20 condensates in the cytoplasm), for example, about 16-18 hours after transfection. In some embodiments, a stable cell line harboring a TetOn-controlled construct encoding an RBM20 polypeptide (wild-type or mutant) can be induced with doxycycline, resulting in expression of the RBM20 polypeptide at a desired level and / or with a desired phenotype (e.g., greater than 90% of cells do not form mutant RBM20 condensates in the cytoplasm), for example, about 24 hours after induction. The cells can then be plated in plates (e.g., 96-well or 384-well) and live cell imaging can be performed, for example, 24 hours after transfection or induction. In some embodiments, the cells are stained with a nuclear dye to indicate cell viability. Test compounds can be simultaneously mixed with the cells, and desired markers (e.g., RBM20 polypeptide, other biomolecules, or fluorescent labeling of the compound, cell morphology, cell proliferation, or cytotoxicity) can then be monitored over a period of time (e.g., 1-3 days after compound application) or analyzed at the end of the assay. In some embodiments, such methods include fixing the cells, staining with desired markers (e.g., IF staining or DAPI), and / or analyzing by microscopy. In some embodiments, the methods include comparing one or more RBM20 aggregate- and / or RBM20 polypeptide-associated properties between cell samples treated with the test compound and untreated cell samples.In some embodiments, the methods involve comparing one or more RBM20 aggregate- and / or RBM20 polypeptide-associated properties between a cell line expressing a wild-type RBM20 polypeptide and a cell line expressing a mutant RBM20 polypeptide, in some embodiments, non-transduced or non-induced cells are used as a control.

[0165] B. Biochemical methods In some embodiments, the methods disclosed herein are biochemical methods. Those skilled in the art will readily recognize that polypeptides, such as RBM20 polypeptides, and aggregates, such as RBM20 aggregates, are dynamic. Accordingly, the methods described herein include contacting a system with a compound at any time during the life cycle of an RBM20 polypeptide and / or RBM20 aggregate. For example, the methods include contacting a cell with a system when an RBM20 polypeptide is present in any amount or has any post-translational modification state, such as the presence or absence of phosphorylated residues. In some embodiments, the methods may include contacting a cell with a system when, for example, RBM20 aggregates are present in any amount (including the absence thereof), have undergone a morphological change, such as a change in size or fluidity, or have a change in composition. In some embodiments, the compound is contacted with the system before one or more RBM20 aggregates are formed. In some embodiments, the compound is contacted with the system after one or more RBM20 aggregates are formed. In some embodiments, the presence, absence, or amount of one or more RBM20 aggregates is adjusted after the system is contacted with the compound, e.g., one or more RBM20 aggregates are present in the system before mixing with the compound, and the amount of one or more RBM20 aggregates increases or decreases after the compound is mixed with the system. In some embodiments of the methods described herein, the system is contacted with the compound multiple times, e.g., multiple aliquots of the compound are mixed with the system at multiple time points.

[0166] In some embodiments, described herein are methods for identifying a compound that modulates a property associated with one or more aggregates comprising an RBM20 polypeptide ("RBM20 aggregates"), the method comprising: (a) combining a compound, a solution comprising one or more RBM20 aggregates, and an additional aggregate solution; and (b) determining a property associated with the one or more RBM20 aggregates, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates. In some embodiments, the additional aggregate solution comprises an RBM20 polypeptide. In some embodiments, the method further comprises identifying a compound that modulates a property associated with an RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide. In some embodiments, the RBM20 polypeptide comprises a detectable label, such as a fluorescent label.

[0167] In some embodiments, the present disclosure describes methods for identifying a compound that modulates one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") and / or properties associated with RBM20 polypeptides, the methods comprising: (a) combining a specific substance with a solution comprising RBM20 polypeptides in the presence of the compound, wherein the substance can cause the formation of one or more RBM20 aggregates, and wherein one or more RBM20 aggregates are formed after contact of the substance with the solution; and (b) determining a property associated with the one or more RBM20 aggregates and / or RBM20 polypeptides, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the substance and the compound are mixed before combining the substance with the solution comprising RBM20 polypeptides. In some embodiments, the substance is a solvent or buffer, and the substance modulates, for example, by increasing or decreasing, the ionic strength of the solution comprising RBM20 polypeptides. In some embodiments, the substance is a nucleic acid, such as RNA. In some embodiments, the substance is a molecular crowding agent such as PEG, dextran, ficoll, or a combination thereof. In some embodiments, before the substance is added to the solution containing the RBM20 polypeptide, the solution further contains one or more RBM20 aggregates. In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide. In some embodiments, the RBM20 polypeptide comprises a detectable label, such as a fluorescent label.

[0168] Methods for forming aggregates are well known and can vary, for example, based on the composition of the aggregate. For example, in some embodiments, aggregates are formed by changing, adding, or removing one or more of the following: the temperature of the system; the salt content of the system; the concentration of a component of the aggregate, such as a scaffold polypeptide, a nucleic acid, or an RBM20 polypeptide; the buffer of the system; the ionic strength of the system; pH; or a crowding agent, such as PEG or dextran. Some exemplary methods for forming aggregates are also disclosed in Alberti et al., J Mol Biol, 430, 2018, which is incorporated herein by reference in its entirety.

[0169] i. Properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides in a biochemical method In some aspects, described herein are methods for identifying compounds that modulate a property (including one or more properties, such as one, two, three, four, or five properties) associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") and / or RBM20 polypeptides in an assay system comprising one or more RBM20 aggregates and / or RBM20 polypeptides, such as a solution comprising one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the methods identify compounds that modulate a property associated with one or more RBM20 aggregates. In some embodiments, the methods identify compounds that modulate a property associated with an RBM20 polypeptide.

[0170] In some embodiments, the property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on any one of the following: (i) the number of one or more RBM20 aggregates; (ii) the composition of one or more RBM20 aggregates; (iii) the size of one or more RBM20 aggregates; (iv) the stability of one or more RBM20 aggregates; (v) the dissolution or size reduction of one or more RBM20 aggregates; (vi) the surface area of ​​one or more RBM20 aggregates; (vii) the sphericity of one or more RBM20 aggregates; (viii) the fluidity of one or more RBM20 aggregates; (ix) the solidification of one or more RBM20 aggregates; (x) the amount of RBM20 polypeptide not in one or more RBM20 aggregates; (xi) the distribution of RBM20 polypeptides in one or more RBM20 aggregates; and (xii) the aggregation of RBM20 polypeptides. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are as described in any section herein, such as the cell-based methods section. In some embodiments, the properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are further based on a functional activity associated with one or more RBM20 aggregates and / or RBM20 polypeptides, such as RNA splicing or the ability of an RBM20 polypeptide to bind (e.g., binding affinity) to a biomolecule (e.g., a non-RBM20 polypeptide, or a nucleic acid) or compound (or portion thereof).

[0171] In some embodiments, the number of one or more RBM20 aggregates is the total number of RBM20 aggregates. In some embodiments, the number of one or more RBM20 aggregates is an estimate of the total number of RBM20 aggregates in a system. In some embodiments, the number of one or more RBM20 aggregates is the number of RBM20 aggregates in a portion of a system, such as a solution containing one or more RBM20 aggregates, e.g., a field of view.

[0172] In some embodiments, the composition of one or more RBM20 aggregates is the amount of an RBM20 polypeptide relative to at least one other component of the one or more RBM20 aggregates. In some embodiments, the composition of one or more RBM20 aggregates is the presence, level, or absence of at least one component other than an RBM20 polypeptide, such as a polypeptide, nucleic acid, or compound. In some embodiments, the composition of one or more RBM20 aggregates is the amount of a wild-type RBM20 polypeptide relative to a mutant RBM20 polypeptide. In some embodiments, the composition of one or more RBM20 aggregates is the amount of a first mutant RBM20 polypeptide relative to a second mutant RBM20 polypeptide. In some embodiments, the composition of one or more RBM20 aggregates is the amount of a first RBM20 polypeptide relative to a second RBM20 polypeptide, where the first and second RBM20 polypeptides have compositional differences, such as differences in post-translational modifications.

[0173] In some embodiments, the size of the one or more RBM20 aggregates is based on a measurement of the largest dimension across the aggregate, such as, for example, the diameter, of each of the one or more RBM20 aggregates. In some embodiments, the size of the one or more RBM20 aggregates is based on the perimeter of each of the one or more RBM20 aggregates. In some embodiments, the size of the one or more RBM20 aggregates is based on the cross-sectional area of ​​each of the one or more RBM20 aggregates or an imaged representation thereof, such as a plan view. In some embodiments, the size of the one or more RBM20 aggregates is based on the volume of each of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is based on the average size of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is based on the particle size distribution (such as d5, d10, d90, or d95) of the one or more RBM20 aggregates.

[0174] In some embodiments, the property associated with the one or more RBM20 aggregates is based on the amount of the one or more RBM20 aggregates. In some embodiments, the amount of the one or more RBM20 aggregates is based on the number and size of the one or more RBM20 aggregates. In some embodiments, the amount of the one or more RBM20 aggregates is based on the number and size of the one or more RBM20 aggregates in a portion of the cytoplasm. In some embodiments, the number and size of the one or more RBM20 aggregates are as described herein.

[0175] In some embodiments, the stability of one or more RBM20 aggregates is the stability of one or more RBM20 aggregates over time in the presence of a stressor, such as a compound that reduces the size of one or more RBM20 aggregates, or in the presence of a particular compound. In some embodiments, the stability is the maintenance of the size or number of one or more RBM20 aggregates.

[0176] In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on a measurement of the largest dimension across the aggregate, such as, for example, the diameter, of each of the one or more RBM20 aggregates. In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on the circumference of each of the one or more RBM20 aggregates. In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on the average size of the one or more RBM20 aggregates. In some embodiments, the dissolution or size reduction of one or more RBM20 aggregates is based on the particle size distribution (such as d5, d10, d90, or d95) of the one or more RBM20 aggregates.

[0177] In some embodiments, the surface area of ​​one or more RBM20 aggregates is an estimated surface area based on the perimeter of each of the one or more RBM20 aggregates.

[0178] In some embodiments, the sphericity of the one or more RBM20 aggregates is based on how closely each of the one or more RBM20 aggregates resembles a perfect sphere. In some embodiments, the sphericity of the one or more RBM20 aggregates is an estimated sphericity based on a cross-sectional or top-down view of each of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is based on the shape of the one or more RBM20 aggregates. In some embodiments, the property associated with the one or more RBM20 aggregates is the portion of the one or more RBM20 aggregates that have a shape type or meet a shape parameter.

[0179] In some embodiments, the fluidity and / or solidification of the one or more RBM20 aggregates is based on how the one or more RBM20 aggregates fuse with one another and / or on changes in the structure, size, shape, sphericity, volume, number, and / or surface area of ​​each of the one or more RBM20 aggregates over time. In some embodiments, the fluidity and / or solidification of the one or more RBM20 aggregates is based on fiber formation.

[0180] In some embodiments, the aggregation of RBM20 polypeptides is a non-phase-separated aggregation of RBM20 polypeptides.

[0181] ii. Determining one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides using biochemical methods. In some embodiments, a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides in an assay system, such as a solution containing one or more RBM20 aggregates, can be determined based on, for example, one or more of the evaluation of one or more RBM20 aggregates and / or RBM20 polypeptides in the system or portion thereof, or an evaluation of another biomolecule, such as another RBM20 aggregate component. In some embodiments, a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined as described in any section herein, such as the cell-based methods section.

[0182] In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on evaluation of at least a portion of an assay system. In some embodiments, the portion is a field of view, such as a microscope field, or a portion thereof. In some embodiments, the portion is a defined region of an image. In some embodiments, the defined region is arbitrarily defined. In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on replicate evaluation. In some embodiments, the replicate evaluation is based on multiple portions of an image or multiple images. In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on an average or distribution obtained from two or more portions of an image, two or more images, or two or more portions obtained from at least two or more images.

[0183] In some embodiments, determining properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides is based on an imaging method. In some embodiments, the imaging method provides data for assessing properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the imaging method includes acquiring an image of a system or portion thereof. In some embodiments, the image is a two-dimensional image. In some embodiments, the image is a three-dimensional image or a rendering thereof. In some embodiments, the imaging method is combined with features of another method useful in the methods described herein, such as a fluorescence-activated cell sorter (FACS) or FAPS method.

[0184] In some embodiments, the methods described herein include imaging a sample, such as a solution, or a portion thereof, containing one or more RBM20 aggregates by an imaging method. In some embodiments, the imaging method is a fluorescent imaging method. In some embodiments, the imaging method includes a fluorescent imaging method. In some embodiments, the imaging method includes a colorimetric and fluorescent imaging method. In some embodiments, the detected light is due to direct labeling of the target, such as incorporation or binding of a label into a compound or RBM20 polypeptide. In some embodiments, the detected light is due to indirect labeling of the target, such as a labeled probe that specifically binds to the RBM20 polypeptide, e.g., a labeled anti-RBM20 antibody or fragment thereof.

[0185] In some embodiments, a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined over a period of time, e.g., at two or more time points. In some embodiments, determining a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides comprises assessing a change in the property over a period of time.

[0186] In some embodiments, one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides are determined using one or more measurements and / or techniques. In some embodiments, multiple properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using one or more measurements and / or techniques.

[0187] In some embodiments, the methods described herein include techniques for, for example, visualization, analysis, and / or quantification of polypeptides and / or their precursors. Such techniques are well known to those of skill in the art. For example, included herein are microscopy techniques for visualizing polypeptides, such as fluorescently labeled polypeptides. Also included herein are mass spectrometry techniques for analyzing polypeptide composition, including post-translational modifications, polypeptide quantification, and testing the composition of RBM20 aggregates. Also included herein are functional assays for assessing cellular processes. Also included herein are enrichment and / or isolation techniques, such as centrifugation techniques for isolating polypeptides and / or RBM20 aggregates, or affinity-based techniques for isolating polypeptides or nucleic acids.

[0188] In some embodiments, the number of one or more RBM20 aggregates is determined by assessing the total number of RBM20 aggregates in a system, such as a solution containing one or more RBM20 aggregates. In some embodiments, the number of one or more RBM20 aggregates is determined by assessing the number of RBM20 aggregates in a portion, such as a field of view, of the system. In some embodiments, the number of one or more RBM20 aggregates is determined by estimating the total number of RBM20 aggregates in the system based on fewer than the total number of measurements of the system.

[0189] In some embodiments, the composition of one or more RBM20 aggregates is determined by assessing the amount of RBM20 polypeptide in one or more RBM20 aggregates. In some embodiments, the composition of one or more RBM20 aggregates is determined by assessing the presence or absence or level of at least one other component of or associated with one or more RBM20 aggregates. In some embodiments, determining the composition of one or more RBM20 aggregates comprises determining the relative abundance of at least one other component of or associated with one or more RBM20 aggregates relative to the RBM20 polypeptide. In some embodiments, the other component is assessed, such as by direct or indirect measurement. In some embodiments, the other component is assessed using mass spectrometry techniques, such as APEX or XL-MS. In some embodiments, the other component is assessed using labeling techniques, such as directly attaching a label to the other component or using immunolabeling. In some embodiments, one or more RBM20 aggregates are isolated and / or enriched.

[0190] In some embodiments, the size of one or more RBM20 aggregates is determined by assessing a measurement of the largest dimension across the aggregate, e.g., diameter, of each of the one or more RBM20 aggregates. In some embodiments, the size of one or more RBM20 aggregates is determined by assessing the perimeter of each of the one or more RBM20 aggregates. In some embodiments, the size of one or more RBM20 aggregates is determined by assessing the cross-sectional area of ​​each of the one or more RBM20 aggregates or an imaged representation thereof, such as a plan view. In some embodiments, the size of one or more RBM20 aggregates is determined by a particle size measurement technique, such as dynamic light scattering.

[0191] In some embodiments, the stability of one or more RBM20 aggregates is determined based on a fusion or fission method. In some embodiments, the stability of one or more RBM20 aggregates is determined based on a change in the structural stability of each of the one or more RBM20 aggregates over time in the presence of cellular activity or a compound. In some embodiments, the stability of one or more RBM20 aggregates is determined based on evaluating any one or more of the size, shape, sphericity, volume, or surface area of ​​each of the one or more RBM20 aggregates.

[0192] In some embodiments, the dissolution or reduction in size of one or more RBM20 aggregates is determined based on a change in the structure of each of the one or more RBM20 aggregates over time in the presence of cellular activity or in the presence of a compound, hi some embodiments, the dissolution or reduction in size of one or more RBM20 aggregates is determined based on assessing any one or more of the size, shape, sphericity, volume, number (including absence), or surface area of ​​each of the one or more RBM20 aggregates.

[0193] In some embodiments, the surface area of ​​one or more RBM20 aggregates is determined based on estimating the surface area using a measured parameter of each of the one or more RBM20 aggregates (e.g., perimeter, a measurement of the largest dimension across the aggregate).

[0194] In some embodiments, the sphericity of one or more RBM20 aggregates is determined based on a 3D lattice light sheet method. In some embodiments, the sphericity of one or more RBM20 aggregates is determined based on a 2D imaging method. In some embodiments, the sphericity of one or more RBM20 aggregates is determined based on a cross-sectional view or a top view of each of the one or more RBM20 aggregates.

[0195] In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on a fusion or fission method. In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on changes in the structure of each of the one or more RBM20 aggregates over time. In some embodiments, the fluidity and / or solidification of one or more RBM20 aggregates is determined based on evaluating changes in any one or more of the size, shape, sphericity, volume, number, or surface area of ​​each of the one or more RBM20 aggregates.

[0196] In some embodiments, the amount of RBM20 polypeptide that is not in one or more RBM20 aggregates is determined based on assessing the amount of RBM20 polypeptide in one or more RBM20 aggregates. In some embodiments, the amount of RBM20 polypeptide that is not in one or more RBM20 aggregates is determined based on assessing the amount of RBM20 polypeptide in an additional aggregate solution.

[0197] In some embodiments, aggregate distribution of an RBM20 polypeptide into one or more RBM20 aggregates is determined based on the amount of RBM20 polypeptide that diffuses out of one or more RBM20 aggregates compared to the amount of RBM20 polypeptide in or associated with one or more RBM20 polypeptides.

[0198] In some embodiments, aggregation of an RBM20 polypeptide is determined based on the presence or absence, or level, of non-phase-separated RBM20 polypeptide aggregation.

[0199] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on fluorescence recovery after photobleaching (FRAP). In some embodiments, FRAP is performed to assess intact aggregates, e.g., to measure the exchange of one or more RBM20 aggregate components with the cytoplasm. In some embodiments, FRAP is performed to assess half-aggregates, e.g., to measure the internal dynamics within one or more RBM20 aggregates.

[0200] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on photoconversion of a fluorophore, such as Dendra2.

[0201] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on fluorescence correlation spectroscopy.

[0202] In some embodiments, the property associated with one or more RBM20 aggregates and / or RBM20 polypeptides is determined based on the temperature responsiveness of one or more RBM20 aggregates and / or RBM20 polypeptides.

[0203] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on tracking aggregate fusion and / or fission, such as fusion and / or fission within cells. In some embodiments, aggregate fusion and / or fission are determined based on optical tweezers. In some embodiments, optical tweezers are used to measure the surface tension of RBM20 aggregates.

[0204] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on 3D lattice light sheet methods.

[0205] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on super-resolution imaging techniques such as stimulated emission depletion (STED) microscopy, stochastic optical reconstruction microscopy (STORM), photoactivated localization microscopy (PALM), or hybrids thereof.

[0206] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined based on ultraviolet-visible (UV-Vis) spectroscopy, small-angle X-ray scattering, or static and dynamic light scattering (SLS / DLS). For example, light scattering methods such as dynamic light scattering (DLS), static light scattering (STS), and small-angle light scattering (SLS) can be used to determine the size and shape of the aggregates. See also Basturea, GN (“Biological Condensates,” MATER METHODS 2019;9:2794) for various in vitro aggregate analysis methods.

[0207] In some embodiments, one or more properties associated with RBM20 aggregates and / or RBM20 polypeptides are determined in the presence of a stressor. For example, in some embodiments, the stressor is one or more of oxidative stress, depletion or presence of ATP, an aggregate-dissolving compound, temperature such as heat, or mechanical stress, e.g., as in irregular or excessive heartbeat.

[0208] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined in the presence of an external mechanical force, such as that applied using atomic force microscopy.

[0209] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using one or more RBM20 polypeptides expressed and purified from a baculovirus system.

[0210] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using reconstitution of one or more RBM20 aggregates in the presence of a molecular crowding agent, such as PEG or dextran. In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using reconstitution of one or more RBM20 aggregates in the absence of a molecular crowding agent, such as PEG or dextran. In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using reconstitution of one or more RBM20 aggregates in the presence of a biopolymer, such as RNA, DNA, or actin. In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined using reconstitution of one or more RBM20 aggregates in the presence of a salt or buffer.

[0211] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined by obtaining phase diagram data obtained by varying two variables, such as, for example, one selected from salt concentration, protein concentration, RNA concentration, DNA concentration, biomolecule concentration, pH, and temperature.

[0212] In some embodiments, properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined by assessing the dissolution of one or more RBM20 aggregates in response to different buffer conditions, such as buffers with different salts and concentrations, pH, hydrotropes and concentrations, ATP concentrations, nucleotides and concentrations, metabolites and concentrations, etc.

[0213] In some embodiments, the modulation of the property is based on the presence, absence, or alteration of the level of one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the modulation of the property is based on a decrease in the number of one or more RBM20 aggregates. In some embodiments, the modulation of the property is based on an increase in the number of one or more RBM20 aggregates. In some embodiments, the modulation of the property is based on the formation of one or more RBM20 aggregates, such as the formation of one or more RBM20. In some embodiments, the modulation of the property is based on a decrease in the size of one or more RBM20 aggregates. In some embodiments, the modulation of the property is based on an increase in the size of one or more RBM20 aggregates.

[0214] In some embodiments, the methods described herein involve determining the specificity of a compound for modulating a property associated with one or more RBM20 aggregates and / or RBM20 polypeptides. For example, in some embodiments, the methods involve determining modulation of a property associated with a first RBM20 aggregate and a second RBM20 aggregate, where the compound modulates the property of the first RBM20 aggregate but not the property of the second RBM20 aggregate. In some embodiments, the first RBM20 aggregate comprises a wild-type RBM20 polypeptide and the second RBM20 aggregate comprises a mutant RBM20 polypeptide. In some embodiments, the first RBM20 aggregate comprises a first mutant RBM20 polypeptide and the second RBM20 aggregate comprises a second mutant RBM20 polypeptide, and the first and second mutant RBM20 polypeptides are different.

[0215] In some embodiments, the method includes determining modulation of a property associated with a first RBM20 aggregate and a second RBM20 aggregate, wherein the compound modulates the property of the first RBM20 aggregate and the second aggregate. In some embodiments, the first RBM20 aggregate comprises a wild-type RBM20 polypeptide and the second RBM20 aggregate comprises a mutant RBM20 polypeptide. In some embodiments, the first RBM20 aggregate comprises a first mutant RBM20 polypeptide and the second RBM20 aggregate comprises a second mutant RBM20 polypeptide, wherein the first and second mutant RBM20 polypeptides are different.

[0216] iii.Biochemical reference In some embodiments, the methods described herein determine modulation of one or more RBM20 aggregate and / or RBM20 polypeptide associated properties relative to a reference.

[0217] In some embodiments, the reference is an established value for a property. In some embodiments, the reference is a system, such as a solution, containing one or more RBM20 aggregates contacted with a vehicle control. In some embodiments, the reference is a system, such as a solution, containing one or more RBM20 aggregates contacted with a reference compound, such as a negative control or positive control reference compound. In some embodiments, the reference is a system, such as a solution, containing one or more RBM20 aggregates contacted with a compound, and properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides are determined for the reference at different time points. In some embodiments, the reference is a system, such as a solution, containing one or more RBM20 aggregates containing different RBM20 polypeptides, such as wild-type or mutant RBM20 polypeptides. In some embodiments, the reference is a system, such as a solution, containing one or more RBM20 aggregates containing different levels of RBM20 polypeptides. In some embodiments, the reference is a system, such as a solution, containing one or more RBM20 aggregates containing RBM20 polypeptides with different post-translational modification states.

[0218] C. RBM20 polypeptide In some aspects of the present disclosure, the present specification describes (RNA binding protein 20) RBM20 polypeptides. In some embodiments, the RBM20 polypeptide is a full-length RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a modified RBM20 polypeptide, such as a portion of a full-length RBM20 polypeptide.

[0219] An exemplary amino acid sequence of an RBM20 polypeptide, i.e., human RBM20 (Uniprot entry Q5T481), is provided below in SEQ ID NO: 1. As shown in SEQ ID NO: 1, an asterisk (*) above a residue indicates residue R636, residues in italics indicate the RS region spanning I613 to R673, double underlining indicates an exemplary disordered region (the region includes residues V2 to N64, P174 to G220, Y628 to Q937, and E975 to K1150), and residues in bold and italics indicate the RSRSP region spanning R634 to P638. Figure 7A is a schematic diagram illustrating selected regions of the RBM20 polypeptide. Figure 7B shows the results of an analysis of the RBM20 polypeptide sequence for ordered and disordered regions. [Table 1]

[0220] In some embodiments, the RBM20 polypeptide is a mammalian RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a primate RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a human RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a rat RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a mouse RBM20 polypeptide.

[0221] In some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a mutant RBM20 polypeptide. In some embodiments, the mutant RBM20 polypeptide comprises one or more of a substitution, addition, or deletion of one or more amino acid residues. In some embodiments, the mutant RBM20 polypeptide comprises a deletion of one or more of the leucine-rich domain, the glutamic acid-rich domain, the zinc finger(s), the RPM domain, and the SR-rich domain. In some embodiments, the mutant RBM20 polypeptide comprises a familial mutation associated with a disease or disorder (e.g., DCM or sudden cardiac arrest).

[0222] In some embodiments, the mutant RBM20 polypeptide comprises a mutation in an intrinsically disordered region (IDR). In some embodiments, the mutant RBM20 polypeptide comprises a mutation in an RS-rich region. In some embodiments, the mutant RBM20 polypeptide comprises a mutation at one or more of the following positions: arginine 634, serine 635, arginine 636, serine 637, and proline 638. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the arginine at position 634. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the serine at position 635. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the arginine at position 636. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the serine at position 637. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the proline at position 638.

[0223] In some embodiments, the mutant RBM20 polypeptide comprises one or more of the following mutations: R636S, R636C, R636H, R634Q, S637G, P638L, S635A, S635E, and S637E. In some embodiments, the mutant RBM20 polypeptide has an R636S mutation. In some embodiments, the mutant RBM20 polypeptide has an R636C mutation. In some embodiments, the mutant RBM20 polypeptide has an R636H mutation. In some embodiments, the mutant RBM20 polypeptide has an R634Q mutation. In some embodiments, the mutant RBM20 polypeptide has an S637G mutation. In some embodiments, the mutant RBM20 polypeptide has a P638L mutation. In some embodiments, the mutant RBM20 polypeptide has an S635A mutation. In some embodiments, the mutant RBM20 polypeptide has an S635E mutation. In some embodiments, the mutant RBM20 polypeptide has a S637E mutation. In some embodiments, the mutant RBM20 polypeptide has S635E, R636S, and S637E mutations.

[0224] In some embodiments, the mutant RBM20 polypeptide comprises a mutation outside the RS-rich region. In some embodiments, the mutant RBM20 polypeptide comprises a mutation between the RS-rich region and the E-rich region. In some embodiments, the mutant RBM20 polypeptide comprises a mutation at arginine at position 716. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the RPM domain. In some embodiments, the mutant RBM20 polypeptide comprises a mutation at valine at position 535. In some embodiments, the mutant RBM20 polypeptide comprises a mutation in the E-rich domain. In some embodiments, the mutant RBM20 polypeptide comprises a mutation at glutamic acid at position 913. In some embodiments, the mutant RBM20 polypeptide comprises one or more of the following mutations: E913K, R716Q, and V535L. In some embodiments, the mutant RBM20 polypeptide comprises an E913K mutation. In some embodiments, the mutant RBM20 polypeptide comprises an R716Q mutation. In some embodiments, the mutant RBM20 polypeptide comprises a V535L mutation.

[0225] In some embodiments, the RBM20 polypeptide, such as a wild-type RBM20 polypeptide or a mutant polypeptide, is a modified RBM20 polypeptide, such as a labeled RBM20 polypeptide, a portion of a full-length RBM20 polypeptide, or a derivative of an RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a derivative or analog. In some embodiments, the RBM20 polypeptide is labeled. In some embodiments, the RBM20 polypeptide is bound to a label, for example, by a covalent bond. In some embodiments, the label is a detectable label. In some embodiments, the RBM20 polypeptide comprises a fluorescent label. In some embodiments, the RBM20 polypeptide comprises a fluorescent protein derived from an octocoral, e.g., Dendronethya sp., such as Dendra2.

[0226] In some embodiments, the RBM20 polypeptide is heterologously expressed in the cell. In some embodiments, the RBM20 polypeptide is homologously expressed in the cell.

[0227] In some embodiments where two or more different RBM20 polypeptides are used, such as cells expressing a wild-type RBM20 polypeptide and a mutant RBM20 polypeptide, or cells expressing two different mutant RBM20 polypeptides, the two or more different RBM20 polypeptides can be simultaneously labeled with distinguishable agents.

[0228] D. Compound In some aspects of the present disclosure, the present specification describes compounds that are tested and identified using the methods disclosed herein. Compounds included in the description of the present disclosure include, but are not limited to, compounds suitable for administration to an individual for therapeutic or prophylactic purposes, or precursors thereof. In some embodiments, the compound is a regulatory approved compound, such as a compound approved for medical treatment by the U.S. Food and Drug Administration. In some embodiments, the compound is a novel compound. In some embodiments, the compound has a molecular weight of less than 1,000 Da, such as 500 Da or less. In some embodiments, the compound satisfies Lipinski's Rule of Five. In some embodiments, the compound is a small molecule (e.g., a therapeutic small molecule that is 1,000 Da or less and / or satisfies Lipinski's Rule of Five).

[0229] In some embodiments, the compound comprises one or more of a small molecule, a polypeptide, a lipid, or a nucleic acid, or components thereof. In some embodiments, the compound is a small molecule, and the compound has a molecular weight of less than about 900 daltons or equal to or less than about 900 daltons. In some embodiments, the compound, or a portion thereof, is charged. In some embodiments, the compound, or a portion thereof, is hydrophobic. In some embodiments, the compound, or a portion thereof, is hydrophilic. In some embodiments, the compound comprises an antibody. In some embodiments, the compound comprises a nucleic acid, or a portion thereof. In some embodiments, the compound comprises RNA, such as siRNA, miRNA, mRNA, or lnRNA. In some embodiments, the compound comprises siRNA, miRNA, or mRNA. In some embodiments, the compound is a non-naturally occurring compound.

[0230] In some embodiments, the compound is a precursor or prodrug. In some embodiments, the compound is metabolized in a composition comprising cells. In some embodiments, a metabolite of the compound is an active agent that modulates one or more "RBM20 aggregates" and / or properties associated with the RBM20 polypeptide.

[0231] In some embodiments, the compound comprises a label. In some embodiments, the label is a radioactive label, a colorimetric label, a luminescent label, or a fluorescent label. In some embodiments, the compound is a small molecule comprising a label. In some embodiments, the compound is a small molecule comprising a fluorophore. In some embodiments, the compound is a polypeptide comprising a label. In some embodiments, the compound is a polypeptide comprising a fluorophore. In some embodiments, the compound is a nucleic acid comprising a label. In some embodiments, the compound is a nucleic acid comprising a fluorophore. In some embodiments, the compound is covalently or non-covalently bound to the compound.

[0232] In some embodiments in which a labeled RBM20 polypeptide is used, the compound comprises a label that is simultaneously distinguishable from the label of the labeled RBM20 polypeptide.

[0233] In some embodiments of the methods described herein, the compound is present in a solvent. In some embodiments, the solvent contains another substance that can cause the formation of aggregates, such as a nucleic acid, for example, RNA, or a molecular crowding agent, for example, REG, dextran, or Ficoll. In some embodiments, the solvent is such that, when mixed with a composition comprising a cell or solution containing one or more RBM20 aggregates described herein and an additional aggregate solution, the solvent causes the formation of one or more RBM20 aggregates.

[0234] In some embodiments, the compound interacts or associates directly with an RBM20 polypeptide. In some embodiments, the compound interacts or associates indirectly with an RBM20 polypeptide. In some embodiments, the compound interacts or associates with an RBM20 aggregate. In some embodiments, the compound interacts or associates with a component of an RBM20 aggregate other than the RBM20 polypeptide. In some embodiments, the compound interacts or associates with a biomolecule, and the biomolecule interacts or associates with a component of an RBM20 aggregate.

[0235] E. Additional Uses and Further Method Steps of the Methods Described Herein In some embodiments, the methods described herein can be used in a variety of formats, for a variety of purposes, and with additional method steps.

[0236] In some embodiments, the methods described herein are used in screening to assay a library of compounds. In some embodiments, the methods described herein are used in screening to assay a library of compounds, where the screening comprises cell-based methods. In some embodiments, the methods described herein are used in screening to assay a library of compounds, where the screening comprises cells with a single RBM20 expression profile, e.g., cells that all express mutant RBM20 polypeptides and / or cells that express substantially similar levels of RBM20 polypeptides. In some embodiments, the methods described herein are used in screening to assay a library of compounds, where the screening comprises biochemical methods. In some embodiments, the methods described herein are used in screening to assay a library of cells. In some embodiments, the methods described herein are used in screening to assay a library of cells, where the library of cells has different RBM20 expression profiles, e.g., different RBM20 mutations, different combinations of RBM20 mutations, and combinations of RBM20 mutations and wild-type RBM20. In some embodiments, the methods described herein comprise evaluating two or more compounds within a single system, such as a composition comprising cells.

[0237] In some embodiments, the methods described herein are formatted for any level of throughput, such as high throughput, medium throughput, or low throughput.

[0238] In some embodiments, the methods described herein further include evaluating the identified compound using a second cell-based assay. In some embodiments, the methods described herein further include evaluating the identified compound using an in vitro assay. For example, the methods further include evaluating the in vitro binding affinity of the identified compound to one or more components of RBM20 aggregates in a non-aggregated state (e.g., light phase). The binding affinity of a compound or portion thereof to a component of a non-aggregated aggregate can be measured by any suitable method known in the art, such as, for example, microscale thermophoresis (MST), isothermal titration calorimetry (ITC), surface plasmon resonance (SPR), nuclear magnetic resonance (NMR), fluorescence polarization (FP), or fluorescence resonance energy transfer (FRET) methods. For exemplary methods, see Vuignier et al., "Drug-protein binding: a critical review of See also “Analytical tools” (Anal Bioanal Chem, 2010) and Basturea, GN (“Biological Condensates,” MATER METHODS 2019;9:2794).

[0239] In some embodiments, the methods described herein further include determining the amount of the compound or portion thereof, or RBM20 aggregates in the cell. In some embodiments, determining the amount of the compound includes quantitatively detecting the compound. In some embodiments, determining the amount of the compound includes quantitatively detecting a label of the compound. In some embodiments, determining the amount of the compound includes detecting an activity of the compound and calculating the amount of compound required to cause the detected amount of activity. In some embodiments, the amount of the compound is determined by mass spectrometry, liquid chromatography, and / or UV-visible spectroscopy. In some embodiments, the amount of the compound is determined by fluorescence microscopy. A standard curve can be used to aid in determining the amount of the compound.

[0240] In some embodiments, provided herein is a method of identifying a compound useful in treating an RBM20-associated disease, comprising identifying the compound according to any one of the methods described herein. In some embodiments, the RBM20-associated disease is a cardiomyopathy. In some embodiments, the cardiomyopathy is dilated cardiomyopathy (DCM).

[0241] The methods described herein can be used for intelligent screening and / or design of compounds based on desired compound activity and / or desired properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides. In some embodiments, the desired behavior of the compound or portion thereof is based on considerations for modulating disease-associated RBM20 aggregates to alleviate one or more causes or symptoms of the disease.

[0242] In some aspects, provided herein are methods for screening candidate compounds or portions thereof from among a plurality of test compounds based on identifying modulation of one or more properties of RBM20 aggregates and / or RBM20 polypeptides with each compound using any of the methods described herein. In some embodiments, candidate compounds or portions thereof are selected based on having a desired modulation of at least one property associated with one or more RBM20 aggregates and / or RBM20 polypeptides, such as by comparison to a set of screened compounds or portions thereof.

[0243] In some embodiments, the desired compound activity is selected from one or more of: (i) preferential association of the test compound (or portion thereof) with RBM20 aggregates in the cytoplasm compared to RBM20 aggregates in the nucleus; (ii) preferential distribution of the test compound (or portion thereof) into RBM20 aggregates (e.g., in the cytoplasm) compared to aggregates not containing the RBM20 polypeptide; (iii) preferential binding of the test compound (or portion thereof) to an RBM20 polypeptide compared to a non-RBM20 polypeptide; (iv) preferential binding of the test compound (or portion thereof) to a component of an RBM20 aggregate, such as a biomolecule that is not an RBM20 polypeptide; and (v) preferential binding of the test compound (or portion thereof) to a mutant RBM20 polypeptide compared to a wild-type RBM20 polypeptide.

[0244] In some embodiments, the desired modulation of one or more properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides is achieved by (i) translocating one or more RBM20 aggregates and / or RBM20 polypeptides from the cytoplasm to the nucleus, (ii) decreasing the amount of RBM20 aggregates in the cytoplasm, (iii) increasing the amount of RBM20 aggregates in the nucleus, (iv) reducing the size of one or more RBM20 aggregates in the cytoplasm, or (v) increasing the size of nuclear aggregates comprising RBM20 polypeptides compared to cytoplasmic aggregates comprising RBM20 polypeptides. (vi) restoring and / or increasing a functional activity associated with one or more RBM20 aggregates and / or RBM20 polypeptides, such as RNA splicing in the nucleus; (vii) excluding biomolecules from one or more RBM20 aggregates, e.g., biomolecules that are not normally associated with cytoplasmic RBM20 aggregates under healthy or non-stress conditions; (viii) relocating biomolecules from one or more RBM20 aggregates to locations where the biomolecules would be located under healthy or non-stress conditions; (ix) (x) decreasing the stability of one or more cytoplasmic RBM20 aggregates; (x) increasing the stability of one or more nuclear RBM20 aggregates; (xi) dissolving one or more RBM20 aggregates in the cytoplasm; (xii) decreasing the surface area of ​​one or more RBM20 aggregates in the cytoplasm; (xiii) restoring the sphericity of one or more RBM20 aggregates in the nucleus; (xiv) increasing the fluidity of one or more RBM20 aggregates in the nucleus and / or cytoplasm; (xv) decreasing the solidification of one or more RBM20 aggregates in the nucleus and / or cytoplasm; (xvi) R (xvii) translocating RBM20 polypeptide from one or more RBM20 aggregates in the cytoplasm to the nucleus; (xvii) decreasing the amount of RBM20 polypeptide or its precursor (e.g., when RBM20 is overexpressed or overactive); (xviii) increasing the amount of RBM20 polypeptide or its precursor in the nucleus; (xix) promoting distribution of RBM20 polypeptide to one or more RBM20 aggregates in the nucleus (e.g., compared to those in the cytoplasm); (xx) decreasing aggregation of RBM20 polypeptide in the cytoplasm.(xxi) promoting or inhibiting post-translational modification of the RBM20 polypeptide in the cytoplasm (e.g., ubiquitination or phosphorylation), and (xxii) increasing the amount of RBM20 polypeptide degradation products in the cytoplasm.

[0245] In some aspects, provided herein are methods for designing candidate compounds with desired modulation of one or more properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides described herein. In some embodiments, the design method involves incorporating one or more moieties into the candidate compound, each moiety effecting, in whole or in part, the desired modulation of one or more properties. For example, in some embodiments, a candidate compound can be designed having a first moiety that reduces the size of one or more RBM20 aggregates and a second moiety that translocates RBM20 polypeptides from one or more RBM20 aggregates in the cytoplasm to the nucleus. In some embodiments, a candidate compound can be designed having a first moiety that distributes RBM20 aggregates in the cytoplasm and a second moiety that performs another function, such as activating or inhibiting the function of another biomolecule or selectively blocking the distribution of another biomolecule to RBM20 aggregates. In some embodiments, candidate compounds can be designed having a first moiety that reduces the stability of one or more RBM20 aggregates in the cytoplasm and dissolves one or more RBM20 aggregates in the cytoplasm, and a second moiety that excludes biomolecules from one or more RBM20 aggregates in the cytoplasm, where the biomolecules are not associated with cytoplasmic RBM20 aggregates under healthy or non-stress conditions. In some embodiments, candidate compounds can be designed having a moiety that modulates the presence or absence of RBM20 polypeptide, promotes post-translational modifications, etc. In some embodiments, the design method includes replacing, removing, or adding a moiety associated with one or more desired compound activities and / or modulating one or more properties associated with one or more RBM20 aggregates and / or RBM20 polypeptides described herein. In some embodiments, the design method further includes iterating the designing and testing steps until a desired need / feature is achieved. In some embodiments, the design method includes synthesizing the candidate compound.

[0246] In some aspects, provided herein are methods for designing candidate compounds, comprising combining two or more moieties, each moiety associated with the desired modulation of one or more characteristics described herein. In some embodiments, the design method comprises combining moieties having the desired properties identified by the methods described herein in any number of positions and / or stereochemical orientations. In some embodiments, the resulting candidate compound has a combination of desired compound activity and / or desired modulation of one or more properties described herein. In some embodiments, the design method further comprises iterating the designing and testing steps until the desired need / feature is achieved. In some embodiments, the design method comprises synthesizing the candidate compound.

[0247] In some embodiments, the methods described herein can be used to develop one or more rule sets based on the desired modulation of one or more properties described herein that have been achieved. In some embodiments, the one or more rule sets can be used as the basis for identifying and / or designing one or more compounds using approaches including modeling, computer and / or computational-based methods, e.g., bioinformatics, chemoinformatics, and / or artificial intelligence (AI)-based identification of compounds that have the desired modulation of one or more properties described herein. Computer software for determining and / or applying the one or more rule sets is also provided.

[0248] In some aspects, provided herein are methods for identifying candidate compounds for treating diseases or disorders associated with RBM20 aggregate activity. In some embodiments, a disease or disorder associated with RBM20 aggregate activity refers to a disease or disorder in which any one or more of the following occurs: 1) one or more RBM20 aggregates form in the cytoplasm; 2) one or more RBM20 aggregates disappear (e.g., dissolve) in the nucleus; 3) one or more RBM20 aggregates or components thereof distribute to locations where RBM20 aggregates or components thereof are not normally located in a healthy state (e.g., translocate to the cytoplasm in a disease state); 4) the number of RBM20 aggregates increases or decreases (e.g., in the nucleus and / or cytoplasm); 5) a component (e.g., an RBM20 polypeptide or one or more other biological components that become components of RBM20 aggregates) is lost. 1) an increase or decrease in the number of RBM20 aggregates with and / or without RBM20 polypeptide molecules (associated with RBM20 protein molecules), 2) a change in the size, shape, surface area, and / or sphericity of one or more RBM20 aggregates, 3) a change in the aggregate composition of one or more RBM20 aggregates, 4) a change in the fluidity (or dynamics) of one or more RBM20 aggregates, 5) a change in the solidification of one or more RBM20 aggregates, 6) an increase or decrease in the number of RBM20 aggregates with and / or without RBM20 polypeptide molecules (associated with RBM20 protein molecules), 7) a change in the aggregate composition of one or more RBM20 aggregates, 8) a change in the fluidity (or dynamics) of one or more RBM20 aggregates, 9) a change in the solidification of one or more RBM20 aggregates, 10) a change in the presence and / or amount of RBM20 fibril formation, 11) a change in the distribution of RBM20 aggregate components into RBM20 aggregates, and 12) aggregation of RBM20 polypeptides. Based on one or more properties in the diseased state (and compared to one or more properties in the healthy state), any of the methods described herein can be used to identify / screen / modify / design candidate compounds with one or more desired compound activities and / or desired modulation of one or more properties described herein.

[0249] Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the disclosure of this application. The disclosure is further illustrated by the following examples, which should not be construed as limiting the scope or spirit of the disclosure to the specific techniques described therein.

[0250] III. Compositions of the Present Disclosure In some embodiments, the present disclosure provides compositions, such as kits, as described in various aspects of the methods disclosed herein.

[0251] In some embodiments, provided herein are cells comprising an RBM20 polypeptide, as described throughout this application. For example, in some embodiments, cells expressing a level of wild-type RBM20 polypeptide are provided. In some embodiments, cells expressing a level of mutant RBM20 polypeptide are provided. In some embodiments, cells that do not express endogenous RBM20 polypeptide, such as knockout cells, are provided. In some embodiments, cells having a heterologous RBM20 polypeptide are provided. In some embodiments, the RBM20 polypeptide is a labeled RBM20 polypeptide.

[0252] In some embodiments, provided herein are compositions comprising an RBM20 polypeptide, such as an enriched or isolated RBM20 polypeptide, as described throughout this application. For example, in some embodiments, the RBM20 polypeptide is a wild-type RBM20 polypeptide. In some embodiments, the RBM20 polypeptide is a mutant polypeptide. In some embodiments, the RBM20 polypeptide is a labeled RBM20 polypeptide.

[0253] IV. Illustrative Embodiments Embodiment 1. A method for identifying a compound that modulates one or more aggregates comprising RBM20 polypeptide in the cytoplasm of a cell ("RBM20 aggregates") and / or a property associated with said RBM20 polypeptide in the cytoplasm of a cell, the method comprising: (a) combining said compound with a composition comprising said cell, wherein (i) said cell comprises said one or more RBM20 aggregates and / or (ii) said one or more RBM20 aggregates are formed in said cell after said compound is contacted with said composition; and (b) determining said property associated with said one or more RBM20 aggregates and / or said RBM20 polypeptide, wherein modulation of said property compared to a reference indicates that said compound modulates said property associated with said one or more RBM20 aggregates and / or said RBM20 polypeptide.

[0254] Embodiment 2. The property associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide is one of the following: (i) the location of the one or more RBM20 aggregates, (ii) the distribution of the one or more RBM20 aggregates and / or the RBM20 polypeptide, (iii) the number of the one or more RBM20 aggregates, (iv) the size of the one or more RBM20 aggregates, (v) the ratio of the amount of the one or more RBM20 aggregates to a reference aggregate, (vi) a functional activity associated with the one or more RBM20 aggregates, (vii) the composition of the one or more RBM20 aggregates, (viii) the co-localization of the one or more RBM20 aggregates with a biomolecule, (ix) the diffusion coefficient of a component of the one or more RBM20 aggregates, (x) the stability of the one or more RBM20 aggregates, (xi) the amount of the one or more RBM20 aggregates. (xii) aggregate dissolution or size reduction, (xii) surface area of ​​the one or more RBM20 aggregates, (xiii) sphericity of the one or more RBM20 aggregates, (xiv) fluidity of the one or more RBM20 aggregates, and (xv) solidification of the one or more RBM20 aggregates, (xvi) location of the RBM20 polypeptide, (xvii) amount of the RBM20 polypeptide or its precursor, (xviii) aggregate partitioning of the RBM20 polypeptide into the one or more RBM20 aggregates, (xix) functional activity associated with the RBM20 polypeptide, (xx) aggregation of the RBM20 polypeptide, (xxi) post-translational modification state of the RBM20 polypeptide, and (xxii) amount of degradation products of the RBM20 polypeptide.

[0255] Embodiment 3. The method of embodiment 2, wherein said modulation of said property is based on a decrease in the number of said one or more RBM20 aggregates in the cytoplasm of said cell.

[0256] Embodiment 4. The method of embodiment 2 or 3, wherein the modulation of the property is based on a decrease in the amount of the RBM20 polypeptide or a precursor thereof in the cytoplasm of the cell.

[0257] Embodiment 5. The method of any one of embodiments 2 to 4, wherein the modulation of the property is based on dissolution or reduction in size of the one or more RBM20 aggregates in the cytoplasm of the cell.

[0258] Embodiment 6. The method of any one of embodiments 2 to 5, wherein the modulation of the property is based on a decrease in the functional activity associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide in the cytoplasm of the cell.

[0259] Embodiment 7. The method of embodiment 1, wherein the characteristics associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the location of the one or more RBM20 aggregates, the distribution of the one or more RBM20 aggregates and / or the RBM20 polypeptide, the number of the one or more RBM20 aggregates, the size of the one or more RBM20 aggregates, and the ratio of the amount of the one or more RBM20 aggregates to a reference aggregate.

[0260] Embodiment 8. The method of embodiment 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the composition of the one or more RBM20 aggregates and co-localization of the one or more RBM20 aggregates with a biomolecule.

[0261] Embodiment 9. The method of embodiment 7 or 8, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide further comprise functional activity associated with the one or more RBM20 aggregates.

[0262] Embodiment 10. The method of embodiment 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include stability of the one or more RBM20 aggregates, dissolution or size reduction of the one or more RBM20 aggregates, and surface area of ​​the one or more RBM20 aggregates.

[0263] Embodiment 11. The method of embodiment 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptides include sphericity of the one or more RBM20 aggregates, flowability of the one or more RBM20 aggregates, and solidification of the one or more RBM20 aggregates.

[0264] Embodiment 12. The method of embodiment 1, wherein the characteristics associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the location of the RBM20 polypeptide and the amount of the RBM20 polypeptide or a precursor thereof.

[0265] Embodiment 13. The method of embodiment 12, wherein the characteristics associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide further comprise the post-translational modification state of the RBM20 polypeptide.

[0266] Embodiment 14. The method of embodiment 12 or 13, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide further comprise a functional activity associated with the RBM20 polypeptide.

[0267] Embodiment 15. The method of embodiment 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptides include co-localization of the one or more RBM20 aggregates with a biomolecule and diffusion coefficients of components of the one or more RBM20 aggregates.

[0268] Embodiment 16. The method of embodiment 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include stability of the one or more RBM20 aggregates, and dissolution or size reduction of the one or more RBM20 aggregates.

[0269] Embodiment 17. The method of embodiment 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptides include the surface area of ​​the one or more RBM20 aggregates, the sphericity of the one or more RBM20 aggregates, the flowability of the one or more RBM20 aggregates, and the solidification of the one or more RBM20 aggregates.

[0270] Embodiment 18. The method of any one of embodiments 1 to 17, wherein the RBM20 polypeptide is a wild-type RBM20 polypeptide.

[0271] Embodiment 19. The method of any one of embodiments 1 to 17, wherein the RBM20 polypeptide is a mutant RBM20 polypeptide.

[0272] Embodiment 20. The method of embodiment 19, wherein the mutant RBM20 polypeptide comprises a mutation in an intrinsically disordered region (IDR).

[0273] Embodiment 21 The method of embodiment 19 or 20, wherein the mutant RBM20 polypeptide comprises a mutation in an RS-rich region.

[0274] Embodiment 22. The method of any one of embodiments 19 to 21, wherein the mutant RBM20 polypeptide comprises a mutation at one or more of the following positions: arginine 634, serine 635, arginine 636, serine 637, and proline 638.

[0275] Embodiment 23. The method of embodiment 22, wherein the mutant RBM20 polypeptide comprises one or more of the following mutations: R636S, R636C, R636H, R634Q, S637G, P638L, S635A, S635E, and S637E.

[0276] Embodiment 24. The method of embodiment 19, wherein the mutant RBM20 polypeptide comprises one or more of the following mutations: E913K, R716Q, and V535L.

[0277] Embodiment 25 The method of any one of embodiments 1 to 24, wherein the one or more RBM20 aggregates are heterologously expressed in the cell.

[0278] Embodiment 26 The method of any one of embodiments 1 to 24, wherein the one or more RBM20 aggregates are homogenously expressed in the cell.

[0279] Embodiment 27. The method of any one of embodiments 1 to 26, wherein the cells are models of cardiac cell types.

[0280] Embodiment 28. The method of any one of embodiments 1 to 27, wherein the cells are cardiomyocytes.

[0281] Embodiment 29. The method of embodiment 27 or 28, wherein the cells are rat H9C2 cells.

[0282] Embodiment 30. The method of embodiment 27 or 28, wherein the cells are human AC-16 cells, patient-derived cardiomyocytes, human induced pluripotent stem cells differentiated into cardiomyocytes, or stem cells differentiated into cardiomyocytes.

[0283] Embodiment 31. The method of any one of embodiments 1 to 26, wherein the cells are selected from the group consisting of HeLa cells, U2OS cells, human fetal kidney cells, human induced pluripotent stem cells, and stem cells.

[0284] Embodiment 32 The method of any one of embodiments 1 to 31, wherein the cell is homozygous for the allele encoding the RBM20 polypeptide.

[0285] Embodiment 33 The method of any one of embodiments 1 to 31, wherein the cell is heterozygous for the allele encoding the RBM20 polypeptide.

[0286] Embodiment 34. The method of any one of embodiments 1 to 33, wherein the reference comprises an aliquot of the composition comprising the cells mixed with a control agent.

[0287] Embodiment 35. The method of any one of embodiments 1 to 34, further comprising imaging the composition or at least a portion of the cells.

[0288] Embodiment 36. The method of any one of embodiments 1 to 35, further comprising determining one or more cellular characteristics of the cells.

[0289] Embodiment 37. The method of any one of embodiments 1 to 36, further comprising contacting the composition or at least a portion of the cells with a fixative.

[0290] Embodiment 38 The method of any one of embodiments 1 to 37, further comprising contacting the composition or at least a portion of the cells with a stain.

[0291] Embodiment 39. The method of any one of embodiments 1 to 38, further comprising evaluating the identified cassette sequence using a second cell-based assay.

[0292] Embodiment 40. The method of any one of embodiments 1 to 39, further comprising evaluating the identified cassette sequence using an in vitro assay.

[0293] Embodiment 41. A method for identifying a compound that reduces the size and / or number of aggregates comprising an RBM20 polypeptide ("RBM20 aggregates") in the cytoplasm of a cell, comprising: (a) determining the size and / or number of the RBM20 aggregates in at least a portion of the cytoplasm of the cell exposed to the compound; and (b) comparing the size and / or number of the RBM20 aggregates to a reference, thereby identifying the compound that reduces the size and / or number of the RBM20 aggregates in the cytoplasm of the cell.

[0294] Embodiment 42 The method of embodiment 41, wherein the compound reduces the number of RBM20 aggregates.

[0295] Embodiment 43 The method of embodiment 41 or 42, wherein the compound reduces the size of the RBM20 aggregates.

[0296] Embodiment 44. A method for identifying a compound that prevents the formation or growth of one or more aggregates comprising RBM20 polypeptide ("RBM20 aggregates") in the cytoplasm of a cell, comprising: (a) combining the compound with a composition comprising the cell, wherein i) the cell comprises the one or more RBM20 aggregates and / or (ii) the one or more RBM20 aggregates are formed after contacting the compound with the composition; (b) obtaining a first measurement of the size and / or number of the one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell; and (c) comparing the first measurement with a reference, thereby identifying a compound that prevents the formation or growth of the one or more RBM20 aggregates in the cytoplasm of the cell.

[0297] Embodiment 45. The method of embodiment 44, wherein the reference comprises an aliquot of the composition comprising the cells mixed with a control agent.

[0298] Embodiment 46. The method of embodiment 44, wherein the reference is a second measurement of the size and / or number of the one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell, the second measurement being measured at a different time than the first measurement.

[0299] Embodiment 47 The method of any one of embodiments 44 to 46, further comprising exposing the cell to conditions that promote the formation of the one or more RBM20 aggregates.

[0300] Embodiment 48. A method for identifying a compound that reduces the amount of RBM20 polypeptide in the cytoplasm of a cell, comprising: (a) combining the compound with a composition comprising the cell; (b) obtaining a first measurement of the amount of RBM20 polypeptide in at least a portion of the cytoplasm of the cell; and (c) comparing the first measurement to a reference, thereby identifying a compound that reduces the amount of RBM20 polypeptide in the cytoplasm of the cell.

[0301] Embodiment 49. The method of embodiment 48, wherein the reference comprises an aliquot of the composition comprising the cells mixed with a control agent.

[0302] Embodiment 50. The method of embodiment 49, wherein the reference is a second measurement of the amount of the RBM20 polypeptide in at least a portion of the cytoplasm of the cell, the second measurement being measured at a different time than the first measurement.

[0303] Embodiment 51. A method for identifying a compound that modulates a property associated with one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates"), the method comprising: (a) combining the compound with a solution comprising the one or more RBM20 aggregates and an additional aggregate solution; and (b) determining a property associated with the one or more RBM20 aggregates, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates.

[0304] Embodiment 52. A method for identifying a compound that modulates one or more aggregates comprising an RBM20 polypeptide ("RBM20 aggregates") and / or a property associated with an RBM20 polypeptide, the method comprising: (a) combining a specific substance with a solution comprising the RBM20 polypeptide in the presence of the compound, wherein the substance is capable of causing the formation of the one or more RBM20 aggregates, and wherein the one or more RBM20 aggregates are formed after contact of the substance with the solution; and (b) determining the property associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide, wherein modulation of the property compared to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide.

[0305] Embodiment 53. The method of embodiment 51 or 52, wherein the property associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide is based on any one of the following: (i) the number of the one or more RBM20 aggregates; (ii) the composition of the one or more RBM20 aggregates; (iii) the size of the one or more RBM20 aggregates; (iv) the stability of the one or more RBM20 aggregates; (v) the dissolution or size reduction of the one or more RBM20 aggregates; (vi) the surface area of ​​the one or more RBM20 aggregates; (vii) the sphericity of the one or more RBM20 aggregates; (viii) the fluidity of the one or more RBM20 aggregates; (ix) the solidification of the one or more RBM20 aggregates; (x) the amount of the RBM20 polypeptide that is not in the one or more RBM20 aggregates; (xi) the distribution of the RBM20 polypeptide in the one or more RBM20 aggregates; and (xii) the aggregation of the RBM20 polypeptide.

[0306] Embodiment 54. A method for identifying a compound that modulates the distribution of a biomolecule in an aggregate comprising an RBM20 polypeptide ("RBM20 aggregate"), the method comprising: (a) mixing the compound with a composition comprising cells, wherein (i) the cells comprise the RBM20 aggregate and / or (ii) the RBM20 aggregate is formed within the cells after the compound contacts the composition; and (b) determining the distribution of the biomolecule in the RBM20 aggregate.

[0307] Embodiment 55. The method of claim 54, wherein the biomolecule is a non-RBM20 polypeptide.

[0308] Embodiment 56. The method of claim 54, wherein the biomolecule is a wild-type RBM20 polypeptide.

[0309] Embodiment 57. The method of any one of claims 54 to 56, wherein the RBM20 aggregates comprising the RBM20 polypeptide comprise a mutant RBM20 polypeptide.

[0310] Embodiment 58. A method for identifying a compound useful in treating an RBM20-associated disease, comprising identifying the compound according to any one of the methods described in embodiments 1 to 57.

[0311] Embodiment 59 The method of embodiment 58, wherein the RBM20-associated disease is a cardiomyopathy.

[0312] Embodiment 60. The method of embodiment 59, wherein the cardiomyopathy is dilated cardiomyopathy. [Example]

[0313] Example 1 This example demonstrates fluorescence imaging analysis of cells engineered to express fluorescently labeled wild-type RBM20 or a fluorescently labeled RBM20 mutant with a single point mutation. HeLa and U2OS (human osteosarcoma epithelial cells) cells were engineered using transient transfection to express wild-type human RBM20 polypeptide or mutant RBM20 linked to a Dendra2 tag. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide. Fluorescence images of cells and / or portions of cells were captured using a DeltaVision wide-field deconvolution system equipped with a 60x oil objective.

[0314] In HeLa cells transfected with wild-type RBM20 polypeptide, RBM20 aggregates were observed in the nucleus (Fig. 1A). In HeLa cells transfected with R636S RBM20 polypeptide, RBM20 aggregates were observed only in the cytoplasm (Fig. 1B). The images within the dashed boxes in Fig. 1A and Fig. 1B correspond to enlarged views showing the aggregates.

[0315] In U2OS cells transfected with wild-type RBM20 polypeptide, RBM20 aggregates were observed in the nucleus (Figure 2A). In U2OS cells transfected with R636S RBM20 polypeptide, RBM20 aggregates were observed only in the cytoplasm (Figure 2B). The images within the dashed boxes in Figures 2A and 2B correspond to enlarged views showing the condensates.

[0316] Additional RBM20 polypeptide mutants, namely R636C and R636H, were expressed in U2OS cells and evaluated as described above. As shown in Figures 3A-3B, in U2OS cells transfected with wild-type RBM20 polypeptide, RBM20 aggregates were observed primarily in the nucleus (Figure 3A), whereas in U2OS cells transfected with RBM20 mutant polypeptides, RBM20 aggregates were observed exclusively in the cytoplasm (Figure 3B: R636S RBM20, Figure 3C: R636C RBM20, Figure 3D: R636H RBM20). The images within the dashed boxes in Figures 3A-3C correspond to enlarged views showing the aggregates.

[0317] Example 2 This example demonstrates fluorescence imaging analysis of cardiomyocytes, namely H9C2 (rat myoblasts derived from fetal hearts), engineered to express fluorescently labeled wild-type RBM20 polypeptide or different fluorescently labeled RBM20 mutant polypeptides with single point mutations in the RS-rich domain. H9C2 cells were engineered using transient transfection to express wild-type RBM20 polypeptide conjugated to a Dendra2 tag or mutant RBM20 polypeptides (R636S, R636C, R636H, R634Q, S635A, S637G, P638L) conjugated to a Dendra2 tag. After transfection, cells were incubated to allow expression of the RBM20 polypeptide. Fluorescence images of cells and / or portions of cells were captured using a DeltaVision wide-field deconvolution system equipped with a 60x oil objective.

[0318] As shown in Figures 4A-4H, in H9C2 cells transfected with wild-type RBM20 polypeptide, RBM20 aggregates were observed primarily in the nucleus (Figure 4A), whereas in H9C2 cells transfected with RBM20 mutant polypeptides, RBM20 aggregates were observed exclusively in the cytoplasm (Figure 4B: R636S RBM20, Figure 4C: R636C RBM20, Figure 4D: R636H RBM20, Figure 4E: R634Q RBM20, Figure 4F: S635A RBM20, Figure 4G: S637G RBM20, Figure 4H: P638L RBM20).

[0319] Example 3 This example demonstrates fluorescence imaging analysis of different U2OS cells engineered to express fluorescently labeled wild-type RBM20. U2OS cells were engineered to express wild-type human RBM20 polypeptide linked to a Dendra2 tag using transient transfection. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide. Fluorescence images of cells and / or cell portions were captured using a DeltaVision wide-field deconvolution system equipped with a 60x oil objective.

[0320] In U2OS cells, we observed that continuous expression of wild-type RBM20 polypeptide can lead to the formation of RBM20 condensates in both the nucleus and cytoplasm. As shown in Figures 5A and 5B, some U2OS cells had RBM20 condensates located primarily in the nucleus (Figure 5A), while some U2OS cells had RBM20 condensates located in both the nucleus and cytoplasm (Figure 5B). The image within the dashed box in Figure 5A corresponds to a magnified view showing the condensates.

[0321] Example 4 This example demonstrates an assay for identifying compounds that modulate one or more properties associated with RBM20 aggregates and / or the RBM20 polypeptide. H9C2 cells were engineered using transient transfection to express the mutant R636S RBM20 polypeptide conjugated to a Dendra2 tag. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide. H9C2 cells were mixed with a compound selected from control (DMSO), lipoamide (30 μM), mitoxantrone (20 μM), or JQ1 (10 μM), and fluorescence images were taken after 2 hours of incubation. Fluorescence images of cells and / or portions of cells were captured using a DeltaVision widefield deconvolution system equipped with a 60x oil objective.

[0322] Images of H9C2 cells treated with compounds and reference substances are shown in Figures 6A to 6D. The images can be used to determine modulation of one or more RBM20 aggregate and / or RBM20 polypeptide associated properties relative to a reference substance.

[0323] Example 5 This example demonstrates fluorescence imaging analysis of H9C2 cells engineered to express fluorescently labeled wild-type RBM20. H9C2 cells were engineered using transient transfection to express wild-type human RBM20 polypeptide linked to a Dendra2 tag. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide, and fluorescence images were captured over time. Fluorescence images of cells and / or portions of cells were captured using a DeltaVision wide-field deconvolution system equipped with a 40x oil objective.

[0324] In H9C2 cells, expression of wild-type RBM20 polypeptide at early time points was observed to result in the formation of RBM20 condensates in the nucleus (Figure 8A). At later time points, the amount of RBM20 aggregates in the nucleus increased, and continued expression of RBM20 polypeptide led to the formation of RBM20 aggregates in the cytoplasm (Figure 8B). This time course study suggests that increased expression of wild-type RBM20 polypeptide may lead to saturation in the nucleus, thereby resulting in the formation of wild-type RBM20 aggregates in the cytoplasm.

[0325] Example 6 This example demonstrates different cellular model systems useful for further evaluating the RBM20 cellular system, including assessing RBM20 polypeptide localization, aggregate formation, and aggregate properties.

[0326] H9C2 cells were engineered using transient transfection to express a mutant R636S RBM20 polypeptide linked to a Dendra2 tag and a nuclear localization signal (NLS) at the C-terminus, or a mutant R636S RBM20 polypeptide linked to a Dendra2 tag without an NLS. After transfection, cells were incubated to allow expression of the RBM20 polypeptide. Cells were then fixed and stained with DAPI to visualize nuclei. Fluorescent images of cells and / or cell sections were captured using a DeltaVision wide-field deconvolution system equipped with a 60x oil objective.

[0327] As shown in Figure 9, the mutant R636 RBM20 polypeptide without the NLS was present only in the cytoplasm (lower panel), whereas adding an NLS to the mutant R636S RBM20 polypeptide (upper panel) restored nuclear localization of the mutant R636S RBM20 polypeptide.

[0328] H9C2 cells were engineered using transient transfection to express a phosphomimetic mutant RBM20 polypeptide (R636S, S635E, S637E) conjugated to a Dendra2 tag. As in Example 4, H9C2 cells were engineered using transient transfection to express the mutant R636S RBM20 polypeptide conjugated to a Dendra2 tag. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide. Fluorescent images of cells and / or cell portions were captured using a DeltaVision wide-field deconvolution system equipped with a 40x oil objective.

[0329] As shown in Figure 10, the phosphomimetic mutants (R636S, S635E, S637E) did not restore nuclear localization of the mutant R636S RBM20 polypeptide.

[0330] H9C2 cells were engineered to express truncated forms of wild-type RBM20 polypeptide conjugated to a Dendra2 tag using transient transfection. Specifically, the RBM20 polypeptide forms tested were leucine-rich domain deleted (domain spanning amino acids 56-151), glutamic acid-rich domain deleted (domain spanning amino acids 839-945), zinc finger 1 and zinc finger 2 deleted (zinc finger 1 spanning amino acids 394-440, zinc finger 2 spanning amino acids 1133-1200), RNA recognition motif deleted (RRM, domain spanning amino acids 517-598), and serine-arginine-rich domain deleted (SR, domain spanning amino acids 613-673). After transfection, cells were incubated to allow expression of the RBM20 polypeptide. Fluorescent images of cells and / or cell portions were taken using a DeltaVision wide-field deconvolution system equipped with a 60x oil objective.

[0331] As shown in Figure 11, deletion of the zinc finger domain resulted in increased diffusion of the polypeptide within the nucleus, deletion of the RRM domain resulted in significantly larger and more spherical nuclear RBM20 aggregates, and deletion of the SR domain resulted in the formation of RBM20 aggregates exclusively in the cytoplasm. The findings from the deletion of the SR-rich domain suggest a role for the SR-rich domain in RBM20 nuclear transport. The findings from the deletion of zinc finger 1 and zinc finger 2 suggest a role for the zinc finger in regulating RBM20 nuclear aggregation. The findings from the RRM deletion suggest a role for RNA binding in inhibiting nuclear aggregation. To further explore the RRM deletion model, we measured the fusion of RRM-deleted RBM20 aggregates and observed that fusion occurred in less than 50 ms, indicating the liquid-like nature of the aggregates (data not shown).

[0332] Example 7 This example demonstrates heterozygous wild-type / mutant RBM20 polypeptide cell lines and the effects on RBM20 aggregate formation and composition.

[0333] The first H9C2 cell line was engineered using transient transfection to express a copy of the mutant R636S RBM20 polypeptide linked to an mCherry tag and a copy of the wild-type RBM20 polypeptide linked to a Dendra2 tag (double transfection). The second H9C2 cell line was engineered using transient transfection to express a copy of the mutant R636S RBM20 polypeptide linked to an mCherry tag and a copy of the HIV-1 nuclear export signal sequence (NES, nucleic acid sequence ctgccccccctggagcgcctgaccctg (SEQ ID NO:2), amino acid sequence LPPLERLTL (SEQ ID NO:3)). A third H9C2 cell line was engineered using transient transfection (double transfection). A polypeptide conjugated to a Dendra2 tag was used as a control. A third H9C2 cell line was engineered using transient transfection to express a copy of the mutant R636S RBM20 polypeptide conjugated to an mCherry tag. A fourth H9C2 cell line was engineered using transient transfection to express a copy of the wild-type RBM20 polypeptide conjugated to a Dendra2 tag. Single-transfected cell lines were used as controls for mutant and wild-type RBM20 polypeptide localization and for channel bleaching. After transfection, cells were incubated to allow expression of the RBM20 polypeptide. Fluorescent images of cells and / or cell sections were captured using a DeltaVision wide-field deconvolution system equipped with a 40x oil objective.

[0334] As shown in Figures 12A-12D, H9C2 cells heterozygous for the RBM20 polypeptide were shown to form cytoplasmic RMB20 condensates containing both mutant and wild-type RBM20 polypeptides, indicating that the presence of mutant RBM20 polypeptides may lead to the mislocalization of wild-type RBM20 polypeptides. As a control, the mutant R636S RBM20 polypeptide did not sequester NES into cytoplasmic RMB20 condensates (Figure 12A, lower panel). The inset for the image in Figure 12A is shown in Figure 12B, and the inset for the image in Figure 12C is shown in Figure 12D.

[0335] Example 8 This example demonstrates fluorescence imaging analysis of cardiomyocytes, namely H9C2 (rat myoblasts derived from fetal hearts), engineered to express fluorescently labeled wild-type RBM20 polypeptide or different fluorescently labeled RBM20 mutant polypeptides with single point mutations in domains outside the RS-rich domain. Specifically, H9C2 cells were engineered using transient transfection to express wild-type RBM20 polypeptide or mutant RBM20 polypeptides (E913K, R716Q, or V535L) linked to a Dendra2 tag. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide. Fluorescence images of cells and / or portions of cells were captured using a DeltaVision wide-field deconvolution system equipped with a 60x oil objective.

[0336] Both E913K (located in the E-rich domain) and R716Q (located between the RS-rich and E-rich domains) represent familial RBM20 polypeptide mutations. The V535L mutation, located in the RPM domain, represents a sporadic RBM20 polypeptide mutation. As shown in Figures 13A-13D, in H9C2 cells transfected with wild-type RBM20 polypeptide, RBM20 aggregates were primarily observed in the nucleus (Figure 13A), whereas in H9C2 cells transfected with the above RBM20 mutant polypeptides, a mixed phenotype of nuclear and cytoplasmic aggregates was observed (Figure 13B: E913K RBM20, Figure 13C: R716Q RBM20, Figure 13D: V535L RBM20).

[0337] Example 9 This example demonstrates fluorescence imaging analysis to assess molecular components colocalized in RBM20 aggregates. Cells were engineered to express either fluorescently labeled wild-type RBM20 polypeptide or fluorescently labeled RBM20 R636S mutant polypeptide. After transfection, cells were incubated to allow RBM20 polypeptide expression. Specific cells were stained with DAPI to visualize nuclei. Cells were then subjected to immunofluorescence (IF) analysis for targets such as DDX3X (a protein involved in stress granules). Fluorescent images of cells and / or portions of cells were captured using a DeltaVision wide-field deconvolution system. For both wild-type and mutant RBM20, images containing cells were captured in the channel for the RBM20 label and, for IF analysis, in the channel for the labeled antibody.

[0338] As shown in Figure 14, DDX3X did not colocalize with RBM20 aggregates in wild-type cell lines, whereas DDX3X colocalized with cytoplasmic RBM20 aggregates in mutant RBM20 cell lines. Similar experiments were performed on IF staining of DDX5 and TDP43, which showed similar results, showing that both colocalized with cytoplasmic RBM20 condensates in mutant RBM20 cell lines, but not in wild-type cell lines. However, their distribution into mutant RBM20 aggregates was significantly lower than that of DDX3X (data not shown).

[0339] Similar experiments were also performed with IF staining of the paraspeckle proteins PSPC1, SFPQ, and NONO. As can be seen in Figure 15, only wild-type RBM20 polypeptide was distributed into paraspeckles marked by PSPC1, whereas mutant RBM20 polypeptides were not. Wild-type RBM20 polypeptides were also distributed into paraspeckles marked by SFPQ and NONO, whereas mutant RBM20 polypeptides were not (data not shown).

[0340] Similar experiments were also performed for IF staining of the nuclear proteins PTBP1, SRRM1, U2AF65, and SC35. As can be seen in Figure 16, each of the nuclear proteins tested colocalized with RBM20 aggregates only in the wild-type cell line, but not in the R636S mutant RBM20 cell line.

[0341] Similar assay systems were developed using labeled protein components other than RBM20. Specifically, one cell line was engineered to express wild-type RBM20 polypeptide tagged with mCherry and DDX3X tagged with GFP. The second cell line was engineered to express R636S mutant RBM20 polypeptide tagged with mCherry and DDX3X tagged with GFP. After transfection, the cells were incubated to allow expression of the RBM20 polypeptide. Specific cells were stained with DAPI. The cells were then subjected to immunofluorescence (IF) for additional targets, such as G3BP1 (a protein involved in stress granules). Fluorescent images of cells and / or portions of cells were captured using a DeltaVision wide-field deconvolution system. For both wild-type and mutant RBM20, images containing cells were captured in a channel for the RBM20 label, a channel for the DDX3X label, and a channel for a labeled antibody specific for G3BP1.

[0342] As shown in Figure 17, DDX3X co-localized with cytoplasmic RBM20 aggregates in mutant RBM20 cell lines. Furthermore, the stress granule marker G3BP1 co-localized with cytoplasmic RBM20 aggregates in mutant RBM20 cell lines.

[0343] Example 10 This example demonstrates cytotoxicity analysis of H9C2 cells (rat myoblasts derived from fetal heart) transfected with inducible wild-type and R636S mutant RBM20 polypeptides.

[0344] H9C2 cells were engineered to inducibly express either wild-type RBM20 polypeptide or the R636S mutant RBM20 polypeptide conjugated to a Dendra2 tag under the control of TetON. Fluorescence and DIC images of cells and / or cell portions were captured using a DeltaVision wide-field deconvolution system. As can be seen in Figure 18, approximately 24 hours after induction, approximately 90% of H9C2 cells induced to express wild-type RBM20 polypeptide exhibited nuclear aggregates, while cells induced to express the R636S mutant RBM20 polypeptide exhibited cytoplasmic aggregates. RBM20 expression was also confirmed by Western blot using H9C2 cell lysates (data not shown).

[0345] For cytotoxicity analysis, uninduced cells were seeded into 96-well plates at approximately 1500 cells per well. Red reagent (a cell-permeable DNA stain) was added to each well to label the nuclei of live cells (T0). The day after adding the nuclear dye, doxycycline was added at a final concentration of 6 μg / mL to induce protein expression, while no doxycycline was added as a control. Real-time quantification of live cells was performed using the Incucyte® Live-Cell Analysis System starting at T0 and then every 2 hours until the end of day 3 (T3). The nuclear dye signal over time was normalized to the signal at T0.

[0346] As can be seen in Figure 19A, uninduced H9C2 cells carrying wild-type or R636S mutant RBM20 plasmids showed no significant difference in cell proliferation over time. Expression of wild-type RBM20 polypeptide in H9C2 cells also significantly increased cell proliferation compared to uninduced cells. Expression of the R636 mutant RBM20 polypeptide did not affect cell proliferation (Figure 19B). Expression of the R636 mutant RBM20 polypeptide affected cell proliferation (Figure 19C), and these H9C2 cells showed slower proliferation than H9C2 cells expressing wild-type RBM20 polypeptide (Figure 19D).

[0347] Cytotoxicity was also tested by real-time apoptosis monitoring using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay (Promega). During apoptosis, phosphatidylserine (PS) is exposed on the outer leaflet of the cell membrane, where it can be bound by Annexin V luciferase fusion proteins to generate a luminescent (RLU) signal.

[0348] Uninduced H29C cells were seeded into 96-well plates. Doxycycline was added immediately to induce protein expression or not added as a control. 24 hours after doxycycline induction (or no induction), the apoptosis assay reagent was added to each well with or without the apoptosis inducer staurosporine (STS) (TO). Luminescence was then monitored over a 40-hour period. As can be seen in Figures 20A-20E, expression of the R636S mutant RBM20 polypeptide increased basal apoptosis in H9C2 cells (with or without low STS stress, see Figures 20A-20C), whereas further induction of R636S mutant RBM20 expression did not result in increased apoptosis compared to cells expressing wild-type RBM20 under high STS stress (see Figures 20D and 20E).

[0349] Cell apoptosis was further confirmed by fluorescence and DIC images of H29C cells (not treated with STS stress) captured using a DeltaVision wide-field deconvolution system. As can be seen in Figure 21, H29C cells induced to express either wild-type or R636S mutant RBM20 polypeptides both showed induced apoptosis over time. However, H29C cells induced to express R636S mutant RBM20 polypeptides showed more floating cells (i.e., apoptotic cells) than those expressing wild-type RBM20 polypeptides.

[0350] Example 11 This example demonstrates an assay for mapping the components of mutant RBM20 aggregates in H29C cells.

[0351] H9C2 cells were engineered to inducibly express either wild-type RBM20 polypeptide (used as a control) or the R636S mutant RBM20 polypeptide conjugated to a Dendra2 tag under the control of TetON. Cells were induced with doxycycline at a final concentration of 4 μg / mL. One day after induction, cells were fixed, and antibodies (approximately 200 antibodies) against test proteins (approximately 100 test proteins) were added for IF staining. Cells were also stained with DAPI. Fluorescent images of cells and / or cell sections were captured using a DeltaVision wide-field deconvolution system.

[0352] Figure 22 shows that the stress granule protein eIF3e colocalizes with cytoplasmic R636S mutant RBM20 aggregates, suggesting that eIF3e partitions to R636S mutant RBM20 aggregates in the cytoplasm. Of all proteins evaluated, 30 showed partitioning to R636S mutant RBM20 aggregates, many of which were stress granule proteins.

[0353] Example 12 This example demonstrates an assay for screening compounds that modulate one or more properties associated with RBM20 aggregates and / or the RBM20 polypeptide. H9C2 cells were engineered using transient transfection to express a mutant R636S RBM20 polypeptide linked to a Dendra2 tag. After transfection, the cells were incubated for approximately 16 hours to allow expression of the RBM20 polypeptide. H9C2 cells were seeded into 384-well plates and mixed with control (DMSO) or 20 μM test compound. After 24 hours of incubation, the cells were fixed, stained (e.g., with DAPI), and fluorescent images were taken. H9C2 cells not transfected with the mutant R636S RBM20 polypeptide were used as a control. Triplicate experiments were performed for each compound. Fluorescent images of cells and / or portions of cells were taken using a DeltaVision wide-field deconvolution system.

[0354] Images of H9C2 cells treated with lithocholic acid, quinacrine 2HCl, and a reference compound (DMSO) are shown in Figure 23. Untransfected H9C2 cells were used as a control. Figure 23 shows that lithocholic acid was able to reduce cytoplasmic mutant R636S RBM20 aggregates, whereas quinacrine 2HCl reduced cytoplasmic mutant R636S RBM20 aggregates. Figures 24A-24E show that triptolide (PG490) (Figure 24A), BIO (Figure 24B), uprosertib (GSK2141795) (Figure 24C), anisomycin (Figure 24D), and WS6 (Figure 24E) all reduced cytoplasmic mutant R636SRBM20 aggregates. The levels of reduction are shown as Z-scores below each panel. In certain embodiments, for example, the following are provided: (Item 1) 1. A method for identifying a compound that modulates one or more aggregates comprising RBM20 polypeptides in the cytoplasm of a cell ("RBM20 aggregates") and / or a property associated with RBM20 polypeptides in the cytoplasm of a cell, comprising: (a) mixing the compound with a composition comprising the cells, (i) the cells contain the one or more RBM20 aggregates, and / or (ii) after the compound contacts the composition, the one or more RBM20 aggregates are formed in the cells; (b) determining the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide, determining that modulation of said property relative to a reference indicates that said compound modulates said property associated with said one or more RBM20 aggregates and / or said RBM20 polypeptide. (Item 2) The properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide are: (i) the location of the one or more RBM20 aggregates; (ii) the distribution of the one or more RBM20 aggregates and / or the RBM20 polypeptide; (iii) the number of the one or more RBM20 aggregates; (iv) the size of the one or more RBM20 aggregates; (v) the ratio of the amount of the one or more RBM20 aggregates to the amount of a reference aggregate; (vi) a functional activity associated with the one or more RBM20 aggregates; (vii) the composition of the one or more RBM20 aggregates; (viii) co-localization of the one or more RBM20 aggregates with a biomolecule; (ix) the diffusion coefficient of the one or more RBM20 aggregate components; (x) the stability of the one or more RBM20 aggregates; (xi) dissolving or reducing the size of the one or more RBM20 aggregates; (xii) the surface area of ​​the one or more RBM20 aggregates; (xiii) the sphericity of the one or more RBM20 aggregates; (xiv) the fluidity of the one or more RBM20 aggregates; (xv) solidifying the one or more RBM20 aggregates; (xvi) the position of the RBM20 polypeptide; (xvii) the amount of the RBM20 polypeptide or a precursor thereof; (xviii) aggregate partitioning of the RBM20 polypeptide into the one or more RBM20 aggregates; (xix) a functional activity associated with the RBM20 polypeptide; (xx) aggregation of the RBM20 polypeptide; (xxi) the post-translational modification state of the RBM20 polypeptide, and (xxii) The method of item 1, wherein the amount of the RBM20 polypeptide degradation product is based on any one or more of the amounts. (Item 3) 3. The method of claim 2, wherein the modulation of the property is based on a decrease in the number of the one or more RBM20 aggregates in the cytoplasm of the cell. (Item 4) 4. The method of claim 2 or 3, wherein the modulation of the property is based on a decrease in the amount of the RBM20 polypeptide or a precursor thereof in the cytoplasm of the cell. (Item 5) 5. The method of any one of items 2 to 4, wherein the modulation of the property is based on dissolution or reduction in size of the one or more RBM20 aggregates in the cytoplasm of the cell. (Item 6) 6. The method of any one of items 2 to 5, wherein the modulation of the property is based on a decrease in functional activity associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide in the cytoplasm of the cell. (Item 7) 2. The method of claim 1, wherein the characteristics associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the location of the one or more RBM20 aggregates, the distribution of the one or more RBM20 aggregates and / or the RBM20 polypeptide, the number of the one or more RBM20 aggregates, the size of the one or more RBM20 aggregates, and the ratio of the amount of the one or more RBM20 aggregates to a reference aggregate. (Item 8) 2. The method of claim 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the composition of the one or more RBM20 aggregates and co-localization of the one or more RBM20 aggregates with a biological molecule. (Item 9) 9. The method of claim 7 or 8, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide further comprise a functional activity associated with the one or more RBM20 aggregates. (Item 10) 2. The method of claim 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include stability of the one or more RBM20 aggregates, dissolution or size reduction of the one or more RBM20 aggregates, and surface area of ​​the one or more RBM20 aggregates. (Item 11) 12. The method of claim 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include sphericity of the one or more RBM20 aggregates, fluidity of the one or more RBM20 aggregates, and solidification of the one or more RBM20 aggregates. 2. The method of claim 1, wherein the characteristics associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the location of the RBM20 polypeptide and the amount of the RBM20 polypeptide or a precursor thereof. (Item 13) 13. The method of claim 12, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide further include a post-translational modification state of the RBM20 polypeptide. (Item 14) 14. The method of claim 12 or 13, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide further comprise a functional activity associated with the RBM20 polypeptide. (Item 15) 2. The method of claim 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include co-localization of the one or more RBM20 aggregates with a biomolecule and diffusion coefficients of components of the one or more RBM20 aggregates. (Item 16) 2. The method of claim 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include stability of the one or more RBM20 aggregates, and dissolution or size reduction of the one or more RBM20 aggregates. (Item 17) 2. The method of claim 1, wherein the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide include the surface area of ​​the one or more RBM20 aggregates, the sphericity of the one or more RBM20 aggregates, the fluidity of the one or more RBM20 aggregates, and the solidification of the one or more RBM20 aggregates. (Item 18) 18. The method of any one of items 1 to 17, wherein the RBM20 polypeptide is a wild-type RBM20 polypeptide. (Item 19) 18. The method of any one of items 1 to 17, wherein the RBM20 polypeptide is a mutant RBM20 polypeptide. (Item 20) 20. The method of claim 19, wherein the mutant RBM20 polypeptide comprises a mutation in an intrinsically disordered region (IDR). (Item 21) 21. The method of claim 19 or 20, wherein the mutant RBM20 polypeptide comprises a mutation in an RS-rich region. (Item 22) 22. The method of any one of items 19 to 21, wherein the mutant RBM20 polypeptide comprises a mutation at one or more of the following positions: arginine 634, serine 635, arginine 636, serine 637, and proline 638. (Item 23) 23. The method of claim 22, wherein the mutant RBM20 polypeptide comprises one or more of the following mutations: R636S, R636C, R636H, R634Q, S637G, P638L, S635A, S635E, and S637E. (Item 24) 20. The method of claim 19, wherein the mutant RBM20 polypeptide comprises one or more of the following mutations: E913K, R716Q, and V535L. (Item 25) 25. The method of any one of items 1 to 24, wherein the one or more RBM20 aggregates are heterologously expressed in the cell. (Item 26) 25. The method of any one of items 1 to 24, wherein the one or more RBM20 aggregates are homogeneously expressed in the cell. (Item 27) 27. The method of any one of items 1 to 26, wherein the cells are models of cardiac cell types. (Item 28) 28. The method according to any one of items 1 to 27, wherein the cells are cardiomyocytes. (Item 29) 29. The method of claim 27 or 28, wherein the cells are rat H9C2 cells. (Item 30) 29. The method of item 27 or 28, wherein the cells are human AC-16 cells, patient-derived cardiomyocytes, human induced pluripotent stem cells differentiated into cardiomyocytes, or stem cells differentiated into cardiomyocytes. (Item 31) 27. The method according to any one of items 1 to 26, wherein the cells are selected from the group consisting of HeLa cells, U2OS cells, human fetal kidney cells, human induced pluripotent stem cells, and stem cells. (Item 32) 32. The method of any one of items 1 to 31, wherein the cell is homozygous for the allele encoding the RBM20 polypeptide. (Item 33) 32. The method of any one of items 1 to 31, wherein the cell is heterozygous for an allele encoding the RBM20 polypeptide. (Item 34) 34. The method of any one of items 1 to 33, wherein the reference comprises an aliquot of the composition comprising the cells mixed with a control agent. (Item 35) 35. The method of any one of items 1 to 34, further comprising imaging the composition or at least a portion of the cells. (Item 36) 36. The method of any one of items 1 to 35, further comprising determining one or more cellular characteristics of said cells. (Item 37) 37. The method of any one of items 1 to 36, further comprising contacting the composition or at least a portion of the cells with a fixative. (Item 38) 38. The method of any one of items 1 to 37, further comprising contacting the composition or at least a portion of the cells with a stain. (Item 39) 39. The method of any one of items 1 to 38, further comprising evaluating the identified cassette sequence using a second cell-based assay. (Item 40) 40. The method of any one of items 1 to 39, further comprising evaluating the identified cassette sequence using an in vitro assay. (Item 41) 1. A method for identifying a compound that reduces the size and / or number of aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, comprising: (a) detecting the R in at least a portion of the cytoplasm of the cell exposed to the compound; determining the size and / or number of BM20 aggregates; (b) comparing the size and / or number of the RBM20 aggregates with a reference; thereby identifying a compound that reduces the size and / or number of the RBM20 aggregates in the cytoplasm of the cell. (Item 42) 42. The method of claim 41, wherein the compound reduces the number of RBM20 aggregates. (Item 43) 43. The method of claim 41 or 42, wherein the compound reduces the size of the RBM20 aggregates. (Item 44) 1. A method for identifying a compound that prevents the formation or growth of one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") in the cytoplasm of a cell, comprising: (a) combining the compound with a composition comprising the cells, (i) the cells contain the one or more RBM20 aggregates, and / or (ii) the one or more RBM20 aggregates are formed after the compound is contacted with the composition; (b) obtaining a first measurement of the size and / or number of the one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell; and (c) comparing the first measurement with a reference, thereby identifying a compound that prevents the formation or growth of the one or more RBM20 aggregates in the cytoplasm of the cell. (Item 45) 45. The method of claim 44, wherein the reference comprises an aliquot of the composition comprising the cells mixed with a control agent. (Item 46) 45. The method of claim 44, wherein the reference is a second measurement of the size and / or number of the one or more RBM20 aggregates in at least a portion of the cytoplasm of the cell, the second measurement being measured at a different time point than the first measurement. (Item 47) 47. The method of any one of items 44 to 46, further comprising exposing the cell to conditions that promote the formation of the one or more RBM20 aggregates. (Item 48) 1. A method for identifying a compound that decreases the amount of RBM20 polypeptide in the cytoplasm of a cell, comprising: (a) combining the compound with a composition comprising the cells; (b) obtaining a first measurement of the amount of the RBM20 polypeptide in at least a portion of the cytoplasm of the cell; (c) comparing the first measurement value with a reference, thereby identifying a compound that decreases the amount of the RBM20 polypeptide in the cytoplasm of the cell. (Item 49) 49. The method of claim 48, wherein the reference comprises an aliquot of the composition comprising the cells mixed with a control agent. (Item 50) 50. The method of claim 49, wherein the reference is a second measurement of the amount of the RBM20 polypeptide in at least a portion of the cytoplasm of the cell, the second measurement being measured at a different time point than the first measurement. (Item 51) 1. A method for identifying a compound that modulates a property associated with one or more aggregates comprising an RBM20 polypeptide ("RBM20 aggregates"), comprising: (a) mixing the compound, the solution containing one or more RBM20 aggregates, and an additional aggregate solution; (b) determining said properties associated with said one or more RBM20 aggregate peptides, determining that modulation of the property relative to a reference indicates that the compound modulates the property associated with the one or more RBM20 aggregates. (Item 52) 1. A method for identifying a compound that modulates one or more aggregates comprising RBM20 polypeptides ("RBM20 aggregates") and / or properties associated with RBM20 polypeptides, comprising: (a) adding a specific substance to a solution containing the RBM20 polypeptide in the presence of the compound, the adding step, wherein the substance is capable of causing the formation of the one or more RBM20 aggregates, and the one or more RBM20 aggregates are formed after the substance is contacted with the solution; and (b) determining the properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide, determining that modulation of said property relative to a reference indicates that said compound modulates said property associated with said one or more RBM20 aggregates and / or said RBM20 polypeptide. (Item 53) The properties associated with the one or more RBM20 aggregates and / or the RBM20 polypeptide are: (i) the number of the one or more RBM20 aggregates; (ii) the composition of the one or more RBM20 aggregates; (iii) the size of the one or more RBM20 aggregates; (iv) the stability of the one or more RBM20 aggregates; (v) dissolving or reducing the size of the one or more RBM20 aggregates; (vi) the surface area of ​​the one or more RBM20 aggregates; (vii) the sphericity of the one or more RBM20 aggregates; (viii) the fluidity of the one or more RBM20 aggregates; (ix) solidifying the one or more RBM20 aggregates; (x) the amount of the RBM20 polypeptide that is not in the one or more RBM20 aggregates; (xi) partitioning the RBM20 polypeptide into the one or more RBM20 aggregates; and (xii) The method of any one of items 51 and 52, wherein the method is based on aggregation of the RBM20 polypeptide. (Item 54) 1. A method for identifying a compound that modulates the partitioning of a biomolecule in an aggregate comprising an RBM20 polypeptide ("RBM20 aggregate"), comprising: (a) mixing the compound with a composition comprising cells, (i) the cells contain the RBM20 aggregates, and / or (ii) the RBM20 aggregates are formed in the cells after the compound contacts the composition; (b) determining the distribution of the biomolecules in the RBM20 aggregates. Hmm, the above method. (Item 55) 55. The method of claim 54, wherein the biomolecule is a non-RBM20 polypeptide. (Item 56) 55. The method of claim 54, wherein the biological molecule is a wild-type RBM20 polypeptide. (Item 57) 57. The method of any one of items 54 to 56, wherein the RBM20 aggregates comprising the RBM20 polypeptide comprise a mutant RBM20 polypeptide. (Item 58) 58. A method for identifying a compound useful in treating an RBM20-associated disease, the method comprising identifying the compound according to any one of the methods described in items 1 to 57. (Item 59) Item 59. The method of item 58, wherein the RBM20-related disease is cardiomyopathy. (Item 60) Item 59. The method of item 59, wherein the cardiomyopathy is dilated cardiomyopathy.

Claims

[Claim 1] The invention described in the present specification.

Images