RNA molecules encoding RSV-f and vaccines containing same

Abstract

To provide compositions for treating and / or preventing RSV infection-induced acute respiratory tract illness including pneumonia and bronchitis.SOLUTION: The disclosure provides a composition for inducing immune response to RSV, the composition comprising an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) fusion protein F (F) polypeptide. The disclosure further relates to a composition comprising the RNA molecule formulated in a lipid nanoparticle (RNA-LNP). The disclosure further relates to the use of the RNA molecule, RNA-LNP, and composition for treating and / or preventing RSV infection-induced acute respiratory tract illness including pneumonia and bronchitis.SELECTED DRAWING: None

Description

[Background technology]

[0001] Respiratory syncytial virus (RSV) is a respiratory virus that infects the lungs and respiratory tract. RSV is a leading cause of severe viral lower respiratory tract illness in infants worldwide and an important cause of respiratory illness in the elderly. Two RSV protein subunit vaccines, ABRYSVO (Pfizer) and AREXVY (GSK), were approved in 2023. However, no RNA vaccines have been approved to prevent RSV infection.

[0002] RSV is a member of the Pneumoviridae family. Its genome consists of a single-stranded, negative-sense RNA molecule encoding 11 proteins, including nine structural proteins (three glycoproteins and six internal proteins) and two nonstructural proteins. The structural proteins include three transmembrane surface glycoproteins: the attachment protein G, the fusion protein F, and a small hydrophobic SH protein. There are two subtypes of RSV, A and B. They differ primarily in the G glycoprotein, while the sequence of the F glycoprotein is more conserved between the two subtypes.

[0003] The mature F glycoprotein has three general domains: the ectodomain (ED), the transmembrane domain (TM), and the cytoplasmic tail (CT), which contains a single palmitoylated cysteine ​​residue.

[0004] The human RSV F glycoprotein is initially translated from mRNA as a single 574 amino acid polypeptide precursor (referred to as "F0" or "F0 precursor") containing a signal peptide sequence (amino acids 1-25) at its N-terminus. During translation, the signal peptide is removed by signal peptidase in the endoplasmic reticulum. The remaining portion of the F0 precursor (i.e., residues 26-574) can be further cleaved by cellular proteases (particularly furin) at two polybasic sites (aa 109 / 110 and 136 / 137), removing the 27 amino acid intervening sequence designated pep27 (amino acids 110-136) and generating two linked fragments designated as F1 (C-terminal portion; amino acids 137-574) and F2 (N-terminal portion; amino acids 26-109). F1 contains a hydrophobic fusion peptide at its N-terminus and two heptad repeat regions (HRA and HRB). HRA is near the fusion peptide, and HRB is near the TM domain. The F1 and F2 fragments are linked to each other through two disulfide bonds. Either the uncleaved F0 protein without the signal peptide sequence or the F1-F2 heterodimer can form the RSV F promoter. Three such promoters assemble to form the final RSV F protein complex, which is a homotrimer of three promoters.

[0005] Subtypes A and B of the F protein are approximately 90 percent identical in amino acid sequence. An example of the F precursor polypeptide sequence for the A subtype is provided in SEQ ID NO:1 (strain A2; GenBank GI:138251; Swiss Prot P03420), and an example for the B subtype is provided in SEQ ID NO:2 (strain 18537; GenBank GI:138250; Swiss Prot P13843). SEQ ID NO:1 and SEQ ID NO:2 are both 574 amino acid sequences. The signal peptide sequence for SEQ ID NO:1 and SEQ ID NO:2 is also reported as amino acids 1-25 (GenBank and UniProt). In both sequences, the TM domain is approximately amino acids 530-550, but is alternatively reported as 525-548. The cytoplasmic tail begins at either amino acid 548 or 550 and ends at amino acid 574, with a palmitoylated cysteine ​​residue located at amino acid 550.

[0006] The RSV F protein is the primary antigen under consideration for RSV vaccines. The RSV F protein trimer mediates fusion between the virion membrane and the host cell membrane and also promotes syncytium formation. In the virion prior to fusion with the host cell membrane, the largest population of F molecules forms a lollipop-shaped structure, with the TM domain anchored to the viral envelope [Dormitzer, PR, Grandi, G., Rappuoli, R., Nature Reviews Microbiol, 10, 807, 2012]. This conformation is referred to as the prefusion conformation. Prefusion RSV F is recognized by monoclonal antibodies (mAbs) D25, AM22, and MPE8 without distinguishing between oligomeric states. The prefusion F trimer is specifically recognized by mAb AM14 [Gilman MS, Moin SM, Mas V, et al., PLoS Pathogens, 11(7), 2015]. During RSV cell entry, the F protein rearranges from the pre-fusion state (also referred to herein as "pre-F") to the post-fusion state ("post-F") through an intermediate unfolded structure. During this rearrangement, the C-terminal coiled coil of the pre-fusion molecule dissociates into its three component strands, then wraps around the globular head and combines with three additional helices to form a post-fusion six-helix bundle. When the pre-fusion RSV F trimer is subjected to increasingly harsh chemical or physical conditions, such as elevated temperatures, it undergoes structural changes. First, there is a loss of trimer structure (at least locally within the molecule), followed by rearrangement to the post-fusion form, and then domain denaturation.

[0007] To prevent virus entry, F-specific neutralizing antibodies must bind to the prefusion conformation of F on the virion, or potentially to a spread intermediate, before the viral envelope fuses with the cellular membrane. Therefore, the prefusion form of the F protein is considered to be the preferred conformation for desired vaccine antigens [Ngwuta, JO, Chen, M., Modjarrad, K., Joyce, MG, Kanekiyo, M., Kumar, A., Yassine, HM, Moin, SM, Killelikelly, AM, Chuang, GY, Druz, A., Georgiev, IS, Rundlet, EJ, Sastry, M., Stewart-Jones, GB, Yang, Y., Zhang, B., Nason, MC, Capella, C., Peeples, M., Ledgerwood, JE, McLellan, JS, Kwong, PD, Graham, BS, Science Translat. Med., 14, 7, 309 (2015)].The F glycoprotein is readily converted to its post-fusion form upon extraction from membranes with detergents such as Triton X-100, Triton X-114, NP-40, Brij-35, Brij-58, Tween 20, Tween 80, octylglucoside, octylthioglucoside, SDS, CHAPS, and CHAPSO, or upon expression as an ectodomain, physical or chemical stress, or storage [McLellan JS, Chen M, Leung S, et al., Structure of RSV fusion glycoprotein trimer bound to a pre-fusion-specific neutralizing antibody. Science 340, 1113-1117 (2013); Chaiwatpongsakorn, S., Epand, RF, Collins, PL, Epand RM, Peeples, ME, J Virol. 85(8):3968-77 (2011); Yunus, AS, Jackson TP, Crisafi, K., Burimski, I., Kilgore, NR, Zoumplis, D., Allaway, GP, Wild, CT, Salzwedel, K. Virology. 2010 Jan 20;396(2):226-37. Therefore, the preparation of pre-fusion F as a vaccine antigen remains challenging. Because neutralizing and protective antibodies function by blocking viral entry, F antigens that do not induce pre-fusion-specific antibodies are not expected to be as effective as F antigens that do. Therefore, it would be more desirable to utilize an F protein vaccine containing an F protein immunogen in pre-fusion form. Mutants of the RSV F protein have been proposed to increase the stability of the pre-fusion protein (see, for example, PCT Application No. 2017 / 109629) and are promising vaccine candidates.

[0008] RSV vaccines incorporating the F protein antigen are under development, and clinical studies have shown that some F protein subunit-based vaccine candidates are safe and immunogenic, although improvements in protective efficacy and durability of protection are desirable. Summary of the Invention [Problem to be solved by the invention]

[0009] Thus, there is a need for improved immunogenic compositions to protect against RSV infection.

[0010] [Means for solving the problem]

[0011] The present disclosure, as provided herein, provides, among other things, an unmet need for improved immunogenic compositions for RSV infection.In one embodiment, the present disclosure provides immunogenic compositions and methods for preventing, treating, or alleviating infections, diseases, or conditions in a subject, comprising administering an RNA molecule, e.g., an immunogenic RNA polynucleotide, encoding an amino acid sequence, e.g., an immunogenic antigen, comprising a respiratory syncytial virus (RSV) protein, its immunogenic variant, or an immunogenic fragment of a RSV protein or its immunogenic variant, e.g., an antigenic peptide or protein.Therefore, the immunogenic antigen comprises an epitope of a RSV protein for inducing an immune response against RSV in a subject.The RNA polynucleotide encoding the immunogenic antigen is administered to provide an antigen (after expression of the polynucleotide by appropriate target cells) for the induction, e.g., stimulation, priming, and / or expansion of an immune response, e.g., antibodies and / or immune effector cells. In one embodiment, the immune response induced according to the present disclosure is both a B cell-mediated immune response, e.g., an antibody-mediated immune response, and a T cell-mediated immune response. In one embodiment, the immune response is an anti-RSV immune response.

[0012] The immunogenic compositions described herein comprise RNA molecules (as active ingredients) containing RNA that can be translated into one or more proteins in the recipient's cells. In addition to a wild-type, codon-optimized, or mutant sequence encoding an antigen sequence, the RNA molecule may contain one or more structural elements (5' cap, 5' UTR, subgenomic promoter, 3' UTR, polyA tail) optimized for maximum RNA efficacy in terms of stability and translation efficiency. In one embodiment, the RNA molecule contains all of these elements. The RNA molecules described herein may be complexed with lipids and / or proteins to generate RNA-particles (e.g., lipid nanoparticles (LNPs)) for administration. In one embodiment, the RNA molecules described herein are complexed with lipids to generate RNA-lipid nanoparticles (e.g., RNA-LNPs) for administration. In one embodiment, the RNA molecules described herein are complexed with proteins for administration. In one embodiment, the RNA molecules described herein are complexed with lipids and proteins for administration. When a combination of different RNA molecules is used, the RNA molecules may be complexed together with lipids and / or proteins to produce RNA-particles for administration, or may be complexed separately from lipids and / or proteins.

[0013] The present disclosure provides RNA molecules and RNA-LNPs comprising at least one open reading frame (ORF) encoding a RSV antigen. In some embodiments, the RSV antigen is a RSV polypeptide. In some embodiments, the RSV polypeptide is a RSV F protein. In some embodiments, the RSV F protein is a full-length, truncated, fragment, or variant thereof. In some embodiments, the RSV F protein comprises at least one mutation.

[0014] The present disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF encoding a RSV polypeptide of Table 1. In some embodiments, the RSV polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 1-6 or 71-74. In some embodiments, the RSV polypeptide has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity to any of the amino acid sequences of Table 1, for example, any of SEQ ID NOs: 1-6 or 71-74, or has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity, or has up to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity. In some embodiments, the RSV polypeptide consists of any of the amino acid sequences in Table 1, eg, any of SEQ ID NOs: 1-6 or 71-74.

[0015] The present disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF transcribed from at least one DNA nucleic acid of Table 2. In some embodiments, the RNA molecule is transcribed from a nucleic acid sequence selected from SEQ ID NOs: 7-10 or 59-62. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to any of the nucleic acid sequences of Table 2, e.g., any of SEQ ID NOs: 7-10 or 59-62. In some embodiments, the RNA molecule comprises an ORF transcribed from any of the nucleic acid sequences in Table 2, eg, any of SEQ ID NOs: 7-10 or 59-62.

[0016] The present disclosure further provides RNA molecules and RNA-LNPs comprising at least one ORF comprising an RNA nucleic acid sequence of Table 3. In some embodiments, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NOs: 11-16 or 63-70. In some embodiments, the RNA molecule comprises a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs: 11-16 or 63-70. In some embodiments, the RNA molecule comprises any of the nucleic acid sequences in Table 3, e.g., any of SEQ ID NOs: 11-16 or 63-70. In some embodiments, each uridine in any of SEQ ID NOs: 11-16 is replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA).

[0017] The present disclosure further provides RNA molecules and RNA-LNPs comprising a 5' untranslated region (5'-UTR) and / or a 3' untranslated region (3'-UTR). In some embodiments, the RNA molecule comprises a 5' untranslated region (5'-UTR). In some embodiments, the 5' UTR comprises a sequence selected from any of SEQ ID NOs: 17-19. In some embodiments, the 5' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity to any of SEQ ID NOs: 17-19. In some embodiments, the 5' UTR comprises a sequence selected from any of SEQ ID NOs: 17-19. In some embodiments, the 5' UTR comprises a sequence consisting of any of SEQ ID NOs: 17-19.

[0018] In some embodiments, the RNA molecules and RNA-LNPs comprise a 3' untranslated region (3'-UTR). In some embodiments, the 3'UTR comprises a sequence selected from any of SEQ ID NOs: 20-25. In some embodiments, the 3'UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to any of SEQ ID NOs: 20-25. In some embodiments, the 3'UTR comprises a sequence selected from any of SEQ ID NOs: 20-25. In some embodiments, the 3'UTR comprises a sequence consisting of any of SEQ ID NOs: 20-25.

[0019] The present disclosure further provides RNA molecules and RNA-LNPs comprising a 5' cap portion. In some embodiments, the 5' cap portion is (3'OMe)-m2 7,3’-O Gppp(m1 2’-O ) ApG. The present disclosure further provides RNA molecules and RNA-LNPs comprising a 3' polyA tail. In some embodiments, the polyA tail comprises a sequence having SEQ ID NO: 26.

[0020] In some embodiments, the RNA molecule comprises a 5'UTR and a 3'UTR. In some embodiments, the RNA molecule comprises a 5' cap, a 5'UTR, and a 3'UTR. In some embodiments, the RNA molecule comprises a 5' cap, a 5'UTR, a 3'UTR, and a poly-A tail. In some embodiments, the RNA molecule comprises a 5' cap, a 3'UTR, and a poly-A tail. In some embodiments, the RNA molecule comprises a 5'UTR, a 3'UTR, and a poly-A tail. In some embodiments, one, two, three, or more of the above elements can be omitted from the RNA molecule. In some embodiments, each uridine in any of the 5'UTR, 3'UTR, and poly-A tail is replaced with N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA).

[0021] In some embodiments, the length of the poly-A tail may contain +1 / -1 A. In some embodiments, the uridine is N1-methylpseudouridine (Ψ).

[0022] The present disclosure provides RNA molecules set forth in Table 5. In some embodiments, the RNA molecule comprises a 5' UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 11, a 3' UTR of SEQ ID NO: 21, and / or a poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises a 5' UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 12, a 3' UTR of SEQ ID NO: 21, and / or a poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises a 5' UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 63, a 3' UTR of SEQ ID NO: 21, and / or a poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises a 5' UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 65, a 3' UTR of SEQ ID NO: 21, and / or a poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises a 5' UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 67, a 3' UTR of SEQ ID NO: 21, and / or a poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises a 5'UTR of SEQ ID NO: 18, an RSV ORF of SEQ ID NO: 69, a 3'UTR of SEQ ID NO: 21, and / or a polyA tail of SEQ ID NO: 26. In some embodiments, the RSV ORF further comprises a stop codon as described herein. In some embodiments, the length of the polyA tail may contain +1 / -1 A or +2 / -2 A. In some embodiments, each uridine in the RNA molecule is replaced with N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA).

[0023] The present disclosure further provides RNA molecules comprising at least one open reading frame generated from codon-optimized DNA. In some embodiments, the open reading frame is at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, and up to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% codon-optimized. , 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, exactly 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63% %, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, or 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%. The G / C content may be between any two of (inclusive or exclusive) 4%, 4%, or 75%, e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75% is 50%-75%, or about 50%-75%, or 55%-70%, or about 55%-70%. In some embodiments, the G / C content is 58%, or about 58%, 66%, or about 66%, or 62%, or about 62%.

[0024] The present disclosure further provides RNA molecules, including stabilized RNA. The present disclosure further provides RNA molecules, including RNA with at least one modified nucleotide (e.g., modified RNA; modRNA). In some embodiments, the modified nucleotide is pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modified nucleotide is N1-methylpseudouridine (Ψ). In some embodiments, 1, 2, 3, 4, 5, or more of the above modified nucleotides may be omitted from the RNA molecule.

[0025] The present disclosure further provides RNA molecules that are messenger RNA (mRNA) or self-replicating RNA. In some embodiments, the RNA is mRNA.

[0026] The present disclosure further provides immunogenic compositions comprising the RNA molecules described herein.The RNA molecules may be formulated in, encapsulated in, complexed with, bound to, or adsorbed to lipid nanoparticles (LNPs) (e.g., RSV RNA-LNPs) in such immunogenic compositions.In some embodiments, the lipid nanoparticles comprise at least one of a cationic lipid, a lipid conjugated to a polymer (e.g., a PEGylated lipid), and at least one structural lipid (e.g., a neutral lipid and a steroid or steroid analog).In some embodiments, one, two, three, or more of the above lipids may be excluded from the lipid nanoparticles.

[0027] In some embodiments, the lipid nanoparticles comprise a cationic lipid. In some embodiments, the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

[0028] In some embodiments, the lipid nanoparticles comprise a lipid conjugated to a polymer. In some embodiments, the lipid nanoparticles comprise a PEGylated lipid, also referred to as a PEG lipid. In some embodiments, the PEGylated lipid is a glycol lipid including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamoyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEGylated The PEGylated lipid may be phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or a PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate. In some embodiments, one, two, three, four, five, or more of the above PEGylated lipids may be omitted from the RNA molecule. In some embodiments, the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0029] In some embodiments, the lipid nanoparticles comprise at least one structural lipid, such as a neutral lipid. In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyl-oleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyl-oleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyl-oleoyl-phosphatidylethanolamine (P ... The neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE).In some embodiments, one, two, three, four, five, or more of the above structural lipids can be omitted from the RNA molecule.In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0030] In some embodiments, the lipid nanoparticles comprise a second structural lipid, such as a steroid or steroid analog. In some embodiments, the steroid or steroid analog is cholesterol.

[0031] In some embodiments, the lipid nanoparticles are from about 1 to about 500 nm, e.g., at least 1 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 370 nm, 380 nm, 390 nm, 400 nm, 410 nm, 420 nm, 430 nm, 440 nm, 450 nm, 460 nm, 470 nm, 480 nm, 490 nm, 500 nm, 510 nm, 520 nm, 530 nm, 540 nm, 550 nm, 560 nm, 570 nm, 580 nm, 590 nm, 600 nm, 610 nm, 620 nm, 630 nm, 640 nm, 650 nm, 660 nm, 670 nm, 680 nm, 690 nm, 700 nm, 710 nm, 720 nm, 730 nm, 740 nm, 750 nm, 760 nm, 770 nm, 780 nm, 790 nm, 800 nm, 810 nm, 70nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm, up to 1nm, 10nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280nm nm, 290nm, 300nm, 310nm, 320nm, 330nm, 340nm, 350nm, 360nm, 370nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm, exactly 1nm, 10nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm m, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280nm, 290nm, 300nm, 310nm, 320nm, 330nm, 340nm, 350nm, 360nm, 370nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm, or 1nm, 10nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm,and having an average diameter between any two of (inclusive or exclusive) 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 370 nm, 380 nm, 390 nm, 400 nm, 410 nm, 420 nm, 430 nm, 440 nm, 450 nm, 460 nm, 470 nm, 480 nm, 490 nm, or 500 nm.

[0032] In some embodiments, the RNA-LNP immunogenic composition has a concentration of 0.8-0.95 mg / mL or about 0.8-0.95 mg / mL (e.g., at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, up to 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or cationic lipid at a concentration of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive), 0.05-0.15 mg / mL or about 0.05-0.15 mg / mL ( For example, at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, at most 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, PEGylated lipids at a concentration of 0.13, 0.14, or between any two of 0.15 mg / mL (inclusive or exclusive), 0.1 to 0.25 mg / mL or about 0.1 to 0.25 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL and up to 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL).21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or between any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL (inclusive or exclusive) a first structural lipid at a concentration of 0.3 to 0.45 mg / mL or about 0.3 to 0.45 mg / mL (e.g., at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, but not more than 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, but not more than exactly 0. encapsulated in LNPs having a lipid composition comprising a second structural lipid at a concentration of 30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or between any two of (inclusive or exclusive) 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL Also 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.A liquid RNA-LNP composition comprising a polynucleotide encoding an RNA molecule / RSV polypeptide disclosed herein at a concentration of 0.09 mg / mL. In some embodiments, the liquid composition is 0.1 to 0.3 mg / mL or about 0.1 to 0.3 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, but not more than 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21). , 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, or exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, or 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0. a first buffering agent at a concentration of 1.25 to 1.4 mg / mL or at or about 1.25 to 1.4 mg / mL (e.g., at least 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, but not more than ...); , 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, or exactly 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, or 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.a second buffering agent at a concentration of 95-110 mg / mL or about 95-110 mg / mL (e.g., at least 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL and at most 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, ... The liquid RNA-LNP composition further includes a buffer composition comprising a stabilizer at a concentration of 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, or between any two of 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL (inclusive or exclusive). In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the liquid RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the liquid RNA-LNP composition.

[0033] In specific embodiments, the liquid RNA-LNP immunogenic composition has a concentration of 0.8-0.95 mg / mL or about 0.8-0.95 mg / mL (e.g., at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, up to 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hydroxybenzoyl)benzoate at a concentration of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL or between any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive). -hexyldecanoate) (ALC-0315), 0.05 to 0.15 mg / mL or about 0.05 to 0.15 mg / mL (e.g., at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, up to 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, even exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL) or 0.15 mg / mL, or between any two of 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL (inclusive or exclusive), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159), 0.1 to 0.25 mg / mL or about 0.1 to 0.25 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 020, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, up to 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or 0.10, 0.11, 0.12, 0.13, 0.14, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at a concentration of 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or between any two of 0.25 mg / mL (inclusive or exclusive), and 0.3 to 0.45 mg / mL or about 0.3 to 0.45 mg / mL (e.g., at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL). 45 mg / mL, up to 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, exactly 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL , 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL), at most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, encapsulated in an LNP having a lipid composition comprising cholesterol at a concentration between any two of (inclusive or exclusive) 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL.The polynucleotide encoding the RNA molecule / RSV polypeptide disclosed herein comprises a concentration of between any two of the following (inclusive or exclusive): 30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably between or about 0.01-0.09 mg / mL. In some embodiments, the liquid composition has a concentration of 0.1-0.3 mg / mL or about 0.1-0.3 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL and up to 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, and up to 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, or 0.30 mg / mL). 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, or exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, or 0.10, 0.11, 0.12, 0.13, Tromethamine at concentrations between any two of 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL (inclusive or exclusive), and at or about 1.25 to 1.4 mg / mL (e.g., at least 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.40, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.50, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.60, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.70, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.80, 1.81, 1.82, 1.83, 1.84, 1.85, 33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, up to 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, exactly 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.Tris hydrochloride (HCl) at a concentration of 1.39, or 1.40 mg / mL, or between any two of 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL (inclusive or exclusive), and at or about 95-110 mg / mL (e.g., at least 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, up to 106, 107, 108, 109, or 110 mg / mL, or exactly 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, or between any two of 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL (inclusive or exclusive). In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the liquid RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the liquid RNA-LNP composition.

[0034] In some embodiments, the liquid RNA-LNP immunogenic composition has a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01-0.09 mg / mL or about 0.01-0.09 mg / mL. 9 mg / mL, and comprising a polynucleotide encoding an RNA molecule / RSV polypeptide disclosed herein, and having a pH of 7.0 to 8.0 or about 7.0 to 8.0 (e.g., at least 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, up to 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or exactly 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0).5-15 mM or about 5-15 mM Tris buffer (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM), at a pH between any two of (inclusive or exclusive) 0 5 mM, or between any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM (inclusive or exclusive)), and 200-400 mM or about 200-400 mM sucrose (e.g., at least 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 103 0, 360, 370, 380, 390, or 400 mM, up to 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM, exactly 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM. Further, the liquid RNA-LNP composition may further include concentrations of 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM, or between any two of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM (inclusive or exclusive). In some embodiments, one, two, three, or more of the above elements may be excluded from the liquid RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the liquid RNA-LNP composition.

[0035] In some embodiments, the RNA-LNP immunogenic composition has a concentration of 0.8-0.95 mg / mL or about 0.8-0.95 mg / mL (e.g., at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, up to 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or cationic lipid at a concentration of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive), 0.05-0.15 mg / mL or about 0.05-0.15 mg / mL ( For example, at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, at most 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, PEGylated lipids at a concentration of 0.13, 0.14, or between any two of 0.15 mg / mL (inclusive or exclusive), 0.1 to 0.25 mg / mL or about 0.1 to 0.25 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL and up to 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL).21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or between any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL (inclusive or exclusive) a first structural lipid at a concentration of 0.3 to 0.45 mg / mL or about 0.3 to 0.45 mg / mL (e.g., at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, but not more than 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, but not more than exactly 0. encapsulated in LNPs having a lipid composition comprising a second structural lipid at a concentration of 30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or between any two of (inclusive or exclusive) 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL Also 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.A lyophilized (reconstituted) RNA-LNP composition comprising a polynucleotide encoding an RNA molecule / RSV polypeptide disclosed herein at a concentration of 0.01 to 0.15 mg / mL or about 0.01 to 0.15 mg / mL (e.g., at least 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, but not more than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL). , 0.13, 0.14, or 0.15 mg / mL, exactly 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or between any two of 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL a first buffering agent at a concentration of 0.5-0.65 mg / mL or about 0.5-0.65 mg / mL (e.g., at least 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, but not more than 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, exactly 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, or 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.a second buffering agent at a concentration of 35-50 mg / mL or about 35-50 mg / mL (e.g., at least 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, up to 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, or exactly 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, or 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL) and a stabilizer at a concentration of 6, 47, 48, 49, or 50 mg / mL (inclusive or exclusive), and a salt diluent at a concentration of 5-15 mg / mL or about 5-15 mg / mL for reconstitution (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, or between any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL (inclusive or exclusive)). In specific embodiments, the lyophilized composition comprises at or about 0.6 to 0.75 mL of salt diluent (e.g., at least 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, but not more than 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL). , 0.71, 0.72, 0.73, 0.74, or 0.75 mL, exactly 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, or 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.The lyophilized RNA-LNP composition is reconstituted in any two of 75 mL (inclusive or exclusive). The concentrations in the lyophilized RNA-LNP composition are determined after reconstitution. In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the lyophilized RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the lyophilized RNA-LNP composition.

[0036] In specific embodiments, the lyophilized (reconstituted) RNA-LNP composition has a concentration of 0.8-0.95 mg / mL or about 0.8-0.95 mg / mL (e.g., at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL and up to 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL). ALC-0315 at a concentration of 0.05 to 0.15 mg / mL or approximately 0.05 mg / mL, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of the following (inclusive or exclusive): 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL ~0.15 mg / mL (e.g., at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, at most 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL) , 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL (inclusive or exclusive)), 0.1 to 0.25 mg / mL or about 0.1 to 0.25 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL but not more than 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL).19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or between any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL (inclusive) or exclusively)), and DSPC at a concentration of 0.3 to 0.45 mg / mL or about 0.3 to 0.45 mg / mL (e.g., at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL and at most 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, and a small amount of cholesterol encapsulated in an LNP having a lipid composition of cholesterol at a concentration of exactly 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL or between any two of 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL (inclusive or exclusive). at most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, at most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.and / or a RNA polynucleotide encoding a RSV polypeptide disclosed herein at a concentration of 0.01 to 0.15 mg / mL or about 0.01 to 0.15 mg / mL (e.g., at least 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, up to ...). 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL) and tromethamine at or about 0.5-0.65 mg / mL (e.g., at least 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL but not more than 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, but not more than 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.69, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, or exactly 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, or 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.Tris at a concentration between any two of 65mg / mL (inclusive or exclusive) HCl, 35-50 mg / mL or about 35-50 mg / mL (e.g., at least 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, up to 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, exactly 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, or any two of 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL) and a Tris buffer composition comprising sucrose at a concentration of 5-15 mg / mL or about 5-15 mg / mL (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, or between any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL (inclusive or exclusive)). In specific embodiments, the lyophilized composition contains 0.6 to 0.75 mL or about 0.6 to 0.75 mL of sodium chloride (e.g., at least 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, but not more than ... 8, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, or exactly 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, or 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.The lyophilized RNA-LNP composition is reconstituted in a volume between any two of 0.72, 0.73, 0.74, or 0.75 mL (inclusive or exclusive). The concentration in the lyophilized RNA-LNP composition is determined after reconstitution. In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the lyophilized RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the lyophilized RNA-LNP composition.

[0037] The present disclosure provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered to a subject at a dose per administration of at least 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg, or more, up to 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg, or more, or between any two of 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg, or more (inclusive or exclusive) of RSV RNA encapsulated in the LNP. In some embodiments, one, two, three, four, five, or more of the concentrations of RSV RNA encapsulated in the above LNPs can be excluded.

[0038] The present disclosure provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered in a single dose. The present disclosure also provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered twice (e.g., on or about days 0 and 7, 0 and 14, 0 and 21, 0 and 28, 0 and 60, 0 and 90, 0 and 120, 0 and 150, 0 and 180, 0 and 1 month later ... The present disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that may be administered twice, at day 0 and 2 months or about 2 months later, at day 0 and 3 months or about 3 months later, at day 0 and 6 months or about 6 months later, at day 0 and 9 months or about 9 months later, at day 0 and 12 months or about 12 months later, at day 0 and 18 months or about 18 months later, at day 0 and 2 years or about 2 years later, at day 0 and 5 years or about 5 years later, or at day 0 and 10 years or about 10 years later. The present disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that may be administered twice, at day 0 and 2 months or about 2 months later. The present disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that may be administered twice, at day 0 and 6 months or about 6 months later. The present disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more times. In some embodiments, periodic boosters at intervals of 1 to 5 years may be desired to maintain protective levels of antibodies. The present disclosure further provides for the administration of at least one booster dose. In some embodiments, one, two, three, four, five, or more of the above dosing regimens may be omitted.

[0039] The present disclosure provides a method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP and / or immunogenic composition described herein. The present disclosure further provides the use of the RNA molecule, RNA-LNP and / or immunogenic composition described herein in the production of a medicament for use in inducing an immune response to RSV in a subject.

[0040] The present disclosure provides a method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a RSV polypeptide as described herein.The present disclosure also provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a RSV polypeptide as described herein in the production of a medicament for use in inducing an immune response to RSV in a subject.

[0041] The present disclosure provides a method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or composition comprising at least one open reading frame encoding a polypeptide of the gene of interest described herein.The present disclosure also provides the use of an RNA molecule and / or RNA-LNP or composition comprising at least one open reading frame encoding a polypeptide of the gene of interest described herein in the production of a medicament for use in inducing an immune response to RSV in a subject.

[0042] The present disclosure provides a method for preventing, treating, and / or ameliorating an infection, disease, or condition in a subject, comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP, and / or immunogenic composition described herein. The present disclosure further provides the use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein in the production of a medicament for use in preventing, treating, and / or ameliorating an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition is associated with RSV. In some embodiments, the infection, disease, or condition is an acute lower respiratory tract infection (ALRI), including pneumonia and bronchitis. In some embodiments, the infection, disease, or condition is an acute lower respiratory tract infection (ALRI), including pneumonia and bronchitis.

[0043] The present disclosure provides a method for preventing, treating, and / or alleviating an infection, disease, or condition in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a RSV polypeptide as described herein. The present disclosure further provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a RSV polypeptide as described herein in the production of a medicament for use in preventing, treating, and / or alleviating an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition is associated with RSV. In some embodiments, the infection, disease, or condition is an acute lower respiratory tract infection (ALRI), including pneumonia and bronchitis.

[0044] The present disclosure further provides a method for preventing, treating, and / or alleviating an infectious disease, disease, or condition in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a polypeptide of a gene of interest described herein.The present disclosure further provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a polypeptide of a gene of interest described herein in the production of a medicament for use in preventing, treating, and / or alleviating an infectious disease, disease, or condition in a subject.In some embodiments, the infectious disease, disease, or condition is associated with a gene of interest.

[0045] In some embodiments, the subject is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or older, or between any two (inclusive or exclusive) of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or older.In some embodiments, the subject is less than 1 year old, 1 or older, 5 or older, 10 or older, 20 or older, 30 or older, 40 or older, 50 or older, 60 or older, 70 or older, or older, or at least less than 1 year old, 1 or older, 5 or older, 10 or older, 20 or older, 30 or older, 40 or older, 50 or older, 60 or older, 70 or older, or older. The subject may be 50 years old or less than 1 year old, 1 year or older, 5 years or older, 10 years or older, 20 years or older, 30 years or older, 40 years or older, 50 years or older, 60 years or older, 70 years or older, or older, or less than about 1 year old, 1 year or older, 5 years or older, 10 years or older, 20 years or older, 30 years or older, 40 years or older, 50 years or older, 60 years or older, 70 years or older, or older. In some embodiments, the subject is 50 years old or less than 50 years old or older. In some embodiments, 1, 2, 3, 4, 5, or more of the above age groups are not administered RNA molecules and / or RNA-LNPs.

[0046] In some embodiments, the subject is immunocompetent. In some embodiments, the subject is immunocompromised.

[0047] The present disclosure provides a method or use described herein, wherein the RNA molecule, RNA-LNP, and / or immunogenic composition is administered as a vaccine. The present disclosure provides a method or use described herein, wherein the RNA molecule, RNA-LNP, and / or immunogenic composition is administered by intradermal, intramuscular, or intranasal injection.

[0048] It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, a composition of the present disclosure can be used to achieve a method of the present disclosure.

[0049] Any method in the context of a therapeutic, diagnostic, or physiological purpose or effect may also be described in "use" claim language, such as the "use of" any compound, composition, or agent discussed herein to achieve or carry out the described therapeutic, diagnostic, or physiological purpose or effect. The use of one or more compositions may be used in accordance with any of the methods described herein.

[0050] Other objects, features, and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating particular embodiments of the present disclosure, are given by way of illustration only, and that various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description. [Brief explanation of the drawings]

[0051] [Figure 1A]Figure 1A shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were intramuscularly immunized on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assays). Figure 1A shows the neutralization assay results for RSV A, expressed as 50% neutralization titers (each symbol represents the titer from an individual animal; the bar represents the geometric mean titer (GMT)). [Figure 1B] Figure 1B shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assays). Figure 1B shows the neutralization assay results for RSV B, expressed as 50% neutralization titers (each symbol represents a titer from an individual animal; bars represent geometric mean titers (GMT)). [Figure 1C]Figure 1C shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assay). Figure 1C shows the results of an ELISpot assay measuring the number of RSV A+BF-specific cells secreting IFN-γ, expressed as spot-forming cells (SFC) per million cells. Bars and error bars depict the median and interquartile range. NA: not analyzed. [Figure 1D] Figure 1D shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assay). Figure 1D shows the results of an ICS assay measuring RSV A+BF-specific IFN-γ-expressing cells within CD4+ T cells, expressed as a percentage of IFN-γ+ cells. Bars and error bars depict the median and interquartile range. NA: not analyzed. [Figure 1E]Figure 1E shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assay). Figure 1E shows the results of an ICS assay measuring RSV A+BF-specific IFN-γ-expressing cells within CD8+ T cells, expressed as a percentage of IFN-γ+ cells. Bars and error bars depict the median and interquartile range. NA: not analyzed. [Figure 2] Figure 2 shows the immunogenicity of modRNA-LNP formulations encoding different RSV A pre-fusion F (preF) designs in mice. Female BALB / c mice (10 per group) were intramuscularly immunized with a 0.5 μg dose of modRNA-LNP formulations encoding the RSV A pre-fusion F (preF) designs described herein on days 0 and 21. On day 35 (2W PD2), serum was analyzed for RSV A neutralization responses, expressed as 50% neutralization titers. Each symbol represents the titer from an individual animal. Bars represent geometric mean titers (GMT). [Figure 3A]Figure 3A shows the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV pre-fusion F (preF) in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B) or RSV preF constructs as bivalent modRNA-LNP or bivalent saRNA-LNP formulations. Serum was collected for RSV neutralization assays on days 21 (3W PD1) and 35 (2W PD2), and spleens were harvested for T cell assays (intracellular cytokine staining, ICS assay) on day 35. Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers at either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. Bars represent geometric mean titers (GMT). [Figure 3B] Figure 3B shows the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV pre-fusion F (preF) in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B) or RSV preF constructs as bivalent modRNA-LNP or bivalent saRNA-LNP formulations. Serum was collected for RSV neutralization assays on days 21 (3W PD1) and 35 (2W PD2), and spleens were harvested for T cell assays (intracellular cytokine staining, ICS assay) on day 35. Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers at either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. Bars represent geometric mean titers (GMT). [Figure 3C]Figure 3C shows the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV pre-fusion F (preF) in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B) or RSV preF constructs as bivalent modRNA-LNP or bivalent saRNA-LNP formulations. Serum was collected for RSV neutralization assays on days 21 (3W PD1) and 35 (2W PD2), and spleens were harvested on day 35 for T cell assays (intracellular cytokine staining, ICS assay). Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers at either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. Bars represent geometric mean titers (GMT). [Figure 3D] Figure 3D shows the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV pre-fusion F (preF) in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B) or RSV preF constructs as bivalent modRNA-LNP or bivalent saRNA-LNP formulations. Serum was collected for RSV neutralization assays on days 21 (3W PD1) and 35 (2W PD2), and spleens were harvested on day 35 for T cell assays (intracellular cytokine staining, ICS assay). Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers at either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. Bars represent geometric mean titers (GMT). [Figure 3E]Figure 3E shows the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV pre-fusion F (preF) in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B) or RSV preF constructs as bivalent modRNA-LNP or bivalent saRNA-LNP formulations. Serum was collected for RSV neutralization assays on days 21 (3-week PD1) and 35 (2-week PD2), and spleens were harvested for T cell assays (intracellular cytokine staining, ICS assay) on day 35. Figure 3E shows the results of an ICS assay measuring RSV preF A+BF-specific IFN-γ-expressing cells in CD4+ T cells. Bars and error bars depict the median and interquartile range. NT: not tested. [Figure 3F] Figure 3F shows the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV pre-fusion F (preF) in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B) or RSV preF constructs as bivalent modRNA-LNP or bivalent saRNA-LNP formulations. Serum was collected for RSV neutralization assays on days 21 (3-week PD1) and 35 (2-week PD2), and spleens were harvested for T cell assays (intracellular cytokine staining, ICS assay) on day 35. Figure 3F shows the results of an ICS assay measuring RSV preF A+BF-specific IFN-γ-expressing cells in CD8+ T cells. Bars and error bars depict the median and interquartile range. NT: not tested. [Figure 4]4 shows a schematic representation of the wild-type (WT) RSV F protein (RSV WT) and variant RSV F protein constructs, where "SP" refers to the signal peptide sequence (amino acid residues 1-25 of each construct), "TM" refers to the transmembrane peptide sequence corresponding to the portion of the protein spanning the cytoplasmic membrane, "CT" refers to the cytoplasmic tail peptide sequence corresponding to the portion of the protein extending into the cytoplasm, and "ectodomain" refers to the peptide sequence corresponding to the portion of the protein extending into the extracellular space, where the ectodomain comprises amino acid residues 1-513 (represented by "ΔTM & CT" without TM and CT). The amino acid positions of each portion (i.e., SP, F2, pep27, F1) or mutants for each construct are indicated therein, for example, SP of each construct extends from amino acid residues 1-25 of each construct. DETAILED DESCRIPTION OF THE INVENTION

[0052] Detailed Description The present disclosure provides RNA molecules (e.g., RNA polynucleotides) comprising at least one open reading frame (ORF) encoding a respiratory syncytial virus (RSV) antigen. In some embodiments, the RSV antigen is a RSV polypeptide. In some embodiments, the RSV polypeptide is a RSV F polypeptide. In some embodiments, the RSV polypeptide comprises an amino acid sequence set forth in Table 1. In some embodiments, the RNA molecule comprises an ORF transcribed from at least one DNA nucleic acid sequence in Table 2. In some embodiments, the RNA molecule comprises an ORF comprising an RNA nucleic acid sequence in Table 3. In some embodiments, the RNA molecule comprises at least one of a 5' cap, a 5' UTR, a 3' UTR, and a polyA tail. In other embodiments, the RNA molecule comprises at least one of a 5' cap, a 3' UTR, and a polyA tail. The present disclosure provides RNA molecules comprising modified nucleotides (e.g., modified RNA; modRNA).

[0053] The present disclosure provides immunogenic compositions comprising any one of the RNA molecules encoding RSV polypeptides described herein, complexed with one or more lipids, encapsulated in one or more lipids, or formulated with one or more lipids, forming lipid nanoparticles (RNA-LNPs). The present disclosure further provides immunogenic compositions comprising any one of the RNA molecules comprising at least one RNA nucleic acid described herein, complexed with one or more lipids, encapsulated in one or more lipids, or formulated with one or more lipids, forming RNA-LNPs. The present disclosure further provides a method for preventing, treating, or ameliorating an infection, disease, or condition (e.g., respiratory tract illness associated with RSV infection, including pneumonia and bronchitis) in a subject by administering to the subject an effective amount of the RNA molecule, RNA-LNP, or immunogenic composition described herein. The present disclosure further provides the use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein as a vaccine.

[0054] The present invention can be more readily understood by referring to the following detailed description of the embodiments of the present invention and the examples contained herein. It should be understood that the present invention is not limited to specific manufacturing methods, which may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting.

[0055] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0056] All references referred to herein, including patent applications, patent publications, and UniProtKB accession numbers, are hereby incorporated by reference to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference in its entirety.

[0057] I. Definition Examples Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those skilled in the art.

[0058] Throughout this application, the terms "about," "approximately," and "substantially" are used in accordance with their plain and ordinary meaning in the field of cell and molecular biology to indicate a deviation of ±10% of the value to which they are placed. Thus, in any disclosed embodiment, the term can be substituted with "within [a percentage]" of that which is specified. In one non-limiting embodiment, the percentage includes 0.1, 0.5, 1, 5, and 10 percent.

[0059] Recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated herein as if it were individually recited herein.

[0060] The use of the words "a" or "an," when used in conjunction with the term "comprise," can mean "one," but is also consistent with the meanings of "one or more," "at least one," and "one or more."

[0061] The phrase "and / or" means "and" or "or." Illustratively, A, B, and / or C includes A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination, or A, B, and C in combination. In other words, "and / or" functions as an inclusive or.

[0062] The phrase "essentially all" is defined as "at least 95%; if essentially all members of a group have a particular property, then at least 95% of the members of the group have that property. In some embodiments, essentially all means that equal to, at least any one of, or between any two of 95, 96, 97, 98, 99, or 100% of the members of the group have that property.

[0063] The compositions and methods for their use may "comprise," "consist essentially of," or "consist" of any of the components or steps disclosed throughout this specification. Throughout this specification, unless the context requires otherwise, the words "comprising" (and any form of comprising, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing" (and any form of containing, e.g., "contains" and "contain") are understood to be inclusive or open-ended, implying the inclusion of the stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements. It is contemplated that embodiments described herein in the context of the term "comprising" can also be implemented in the context of the terms "consisting of" or "consisting essentially of." Compositions and methods "consisting essentially of" any of the disclosed components or steps limit the scope of the claim to the specified materials or steps that do not materially affect the basic and novel characteristics of the claimed disclosure. The word "consisting of" (and any forms of "consisting of," such as "consist of" and "consists of") is meant to include and be limited to everything preceding the word "consisting of." Thus, the word "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present.

[0064] References throughout this specification to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "a particular embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, mean that the particular feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of these phrases in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0065] The terms "inhibit," "reduce," or "reduce" or any variation of these terms includes any measurable decrease (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease) or complete inhibition to achieve the desired result. The terms "enhance," "promote," or "increase," or any variation of these terms, include any measurable increase (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% increase) to achieve a desired result or production of a protein or molecule.

[0066] As used herein, the term " reference ", " standard " or " control " describes the value that is compared to.For example, the agent, subject, population, sample or value of interest is compared with the agent, subject, population, sample or value of interest that is reference, standard or control.Reference, standard or control can be tested and / or determined substantially simultaneously and / or together with the test or determination of the agent, subject, population, sample or value of interest, and / or can be determined or characterized under the same conditions or circumstances as the agent, subject, population, sample or value of interest that is being evaluated.

[0067] The term "isolated" can refer to a nucleic acid or polypeptide that is substantially free from cellular material, bacterial material, viral material, or culture medium (if produced by recombinant DNA technology) from the source of its origin, or from chemical precursors or other chemicals (if chemically synthesized). Furthermore, an isolated compound refers to a compound that can be administered to a subject as an isolated compound; in other words, a compound may not simply be considered "isolated" when attached to a column or embedded in an agarose gel. Furthermore, an "isolated nucleic acid fragment" or "isolated peptide" is a nucleic acid or protein fragment that does not naturally occur as a fragment and / or is not typically in a functional state and / or has been altered or removed from its natural state through human intervention. For example, DNA naturally occurring in a living animal is not "isolated," but synthetic DNA, or DNA partially or completely separated from materials with which it occurs in its natural state, is "isolated." Isolated nucleic acids may exist in a substantially purified form or may exist in a non-native environment, such as in the cells to which the nucleic acid was delivered.

[0068] As used herein, "nucleic acid" refers to a molecule containing a nucleic acid component, and refers to a DNA or RNA molecule. It may be used interchangeably with the term "polynucleotide." A nucleic acid molecule is a polymer containing or consisting of nucleotide monomers covalently linked to each other by sugar / phosphate backbone phosphodiester bonds. Nucleic acids can also include modified nucleic acid molecules, such as DNA or RNA molecules with base, sugar, or backbone modifications. Nucleic acids can exist in various forms, such as isolated segments and integrated sequences encoding one or both chains of a polypeptide, such as an antigen or antibody, or fragments, derivatives, muteins, or variants thereof, or recombinant vectors of recombinant polynucleotides; polynucleotides sufficient for use as hybridization probes, PCR primers, or sequencing primers for identifying, analyzing, mutating, or amplifying polynucleotides encoding polypeptides; polynucleotides such as those described herein, mRNA, saRNA, modRNA, and antisense nucleic acids for inhibiting expression of complementary sequences. The nucleic acid may also encode an epitope to which an antibody can bind.

[0069] The term "epitope" refers to a portion that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding entity. In some embodiments, an epitope is composed of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface-exposed when the antigen adopts a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically close to each other in space when the antigen adopts such a conformation. In some embodiments, at least some of such chemical atoms are physically separated from each other when the antigen adopts an alternative conformation (e.g., linearized).

[0070] Nucleic acids may be single-stranded or double-stranded and may comprise RNA and / or DNA nucleotides, as well as artificial variants thereof (e.g., peptide nucleic acids). In some cases, nucleic acid sequences may encode polypeptide sequences with additional heterologous coding sequences, for example, to enable purification, transport, secretion, post-translational modification, or therapeutic benefit, such as targeting or efficacy, of the polypeptide. Tags or other heterologous polypeptides may be added to the modified polypeptide coding sequence, where "heterologous" refers to a polypeptide that is not the same as the modified polypeptide.

[0071] The term "polynucleotide" refers to a nucleic acid molecule that may be recombinant or that has been isolated from total genomic nucleic acid. Recombinant vectors, including oligonucleotides (nucleic acids of 100 residues or fewer) such as plasmids, cosmids, phages, and viruses, are included in the term "polynucleotide." In certain embodiments, polynucleotides contain regulatory sequences that are substantially isolated from their naturally occurring gene or protein-coding sequences. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide.

[0072] In certain embodiments, polynucleotide variants having substantial identity to the sequences disclosed herein; at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher percent sequence identity compared to the polynucleotide sequences provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). %, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, or at most 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, or polynucleotide variants comprising a sequence identity between any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity. In certain embodiments, the isolated polynucleotide comprises a nucleotide sequence encoding a polypeptide having at least 90% identity to the amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence complementary to the isolated polynucleotide. In some embodiments, the isolated polynucleotide comprises a nucleotide sequence that encodes a polypeptide having at least 95% identity to an amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence that is complementary to the isolated polynucleotide.

[0073] Regardless of the length of the coding sequence itself, nucleic acid segments may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, and other coding segments, so that their overall length may vary considerably. Nucleic acids may be of any length. They may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length, or may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length. 0, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, or up to 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length or a length of 5, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides, , 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, and / or may include one or more additional sequences, e.g., regulatory sequences, and / or may be part of a larger nucleic acid, e.g., a vector.It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol.

[0074] In this regard, the term "gene" is used to refer to a nucleic acid (including any sequences required for proper transcription, post-translational modification, or localization) that encodes a protein, polypeptide, or peptide. As will be understood by those skilled in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or can be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence that encodes all or part of such a polypeptide. It is also envisioned that a particular polypeptide may be encoded by a nucleic acid containing variations having slightly different nucleic acid sequences, but nonetheless encoding the same or a substantially similar polypeptide.

[0075] As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from a nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) the production of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of an RNA transcript (e.g., by splicing, editing, etc.); (3) the translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0076] Generally, the term "engineered" refers to an aspect that has been manipulated by the hand of man. For example, a polynucleotide is considered to be "engineered" when it has been manipulated by the hand of man so that two or more sequences that are not naturally linked in that order are directly linked to each other in the engineered polynucleotide, and / or when certain residues in the polynucleotide are caused through the action of the hand of man to be linked to entities or moieties that do not occur in nature and / or are not naturally linked.

[0077] The term "DNA," as used herein, refers to a nucleic acid molecule comprising nucleotides, such as deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate monomers, composed of a sugar moiety (deoxyribose), a base moiety, and a phosphate moiety, polymerized with a characteristic backbone structure. The backbone structure is typically formed by a phosphodiester bond between the sugar moiety, e.g., deoxyribose, of a first nucleotide monomer and the phosphate moiety of a second, adjacent monomer. The specific order of the monomers, e.g., the order of the bases linked to the sugar / phosphate backbone, is referred to as the DNA sequence. DNA may be single-stranded or double-stranded. In the double-stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g., by A / T and G / C base pairing. DNA may contain all or mostly deoxyribonucleotide residues. As used herein, the term "deoxyribonucleotide" refers to a nucleotide lacking a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. Without any limitation, DNA may include double-stranded DNA, antisense DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinantly produced DNA, and modified DNA.

[0078] The term "RNA" as used herein refers to a nucleic acid molecule comprising nucleotides, such as adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate monomers, connected to one another along a so-called backbone. The backbone is formed by a phosphodiester bond between the sugar, e.g., ribose, of a first monomer and the phosphate moiety of a second adjacent monomer. RNA may be obtained, for example, by transcription of a DNA sequence inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or mitochondria. In vivo, transcription of DNA can result in a premature RNA that is processed into messenger RNA (mRNA). For example, in eukaryotes, premature RNA processing involves various post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The mature messenger RNA is processed to provide a nucleotide sequence that can be translated into the amino acid sequence of a peptide or protein. Mature mRNA may include a 5' cap, a 5' UTR, an open reading frame, a 3' UTR, and a poly-A tail sequence. The RNA may contain all or most of ribonucleotide residues. As used herein, the term "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. In one embodiment, the RNA may be messenger RNA (mRNA) for an RNA transcript encoding a peptide or protein. As known to those skilled in the art, mRNA generally contains a 5' untranslated region (5' UTR), a polypeptide coding region, and a 3' untranslated region (3' UTR). Without any limitation, RNA may include double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinantly produced RNA, and modified RNA (modRNA).

[0079] "Isolated RNA" is defined as an RNA molecule that may be recombinant or that has been isolated from total genomic nucleic acid. Isolated RNA molecules or proteins may exist in a substantially purified form or may exist in a non-native environment, such as in a host cell.

[0080] "Modified RNA" or "modRNA" refers to an RNA molecule that has at least one addition, deletion, substitution, and / or alteration of one or more nucleotides compared to naturally occurring RNA. Such alterations can refer to the addition of non-nucleotide material to internal RNA nucleotides or to the 5' and / or 3' ends of the RNA. In one embodiment, such modRNA contains at least one modified nucleotide, e.g., a change to the base of a nucleotide. For example, modified nucleotides may replace one or more uridine and / or cytidine nucleotides. For example, these substitutions may occur for every instance of uridine and / or cytidine in the RNA sequence, or may occur only for select uridine and / or cytidine nucleotides. Such alterations to standard nucleotides in the RNA may include non-standard nucleotides, e.g., chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide may be replaced with N1-methylpseudouridine in the RNA sequence. Other such altered nucleotides are known to those skilled in the art. Such altered RNA molecules are considered analogs of naturally occurring RNA. In some embodiments, RNA is produced by in vitro transcription using DNA template, where DNA refers to the nucleic acid that contains deoxyribonucleotides.In some embodiments, RNA can be replicon RNA (replicon), particularly self-replicating RNA, or self-amplifying RNA (saRNA).

[0081] As envisioned herein, without any limitation, RNA may be used as a therapeutic modality for treating and / or preventing a number of conditions in mammals, including humans. The methods described herein include administering the RNA described herein to a mammal, such as a human. For example, in one embodiment, the method of using such RNA includes an antigen-encoding RNA vaccine to induce robust neutralizing antibodies and concomitant / concomitant T cell responses to achieve protective immunization. In some embodiments, a minimal vaccine dose is administered to induce robust neutralizing antibodies and concomitant / concomitant T cell responses to achieve protective immunization. In one embodiment, the administered RNA is in vitro transcribed RNA. For example, such RNA may be used to encode at least one antigen intended to generate an immune response in the mammal. The pathogenic antigen is a peptide or protein antigen derived from a pathogen associated with an infectious disease. In a specific embodiment, the pathogenic antigen is a peptide or protein antigen derived from RSV. Conditions and / or diseases that can be treated using the RNA disclosed herein include, but are not limited to, those caused and / or affected by viral infections, including, but not limited to, RSV.

[0082] "Prevent" or "prevention," as used herein in the context of the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing a disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is delayed for a predefined period of time.

[0083] As understood from the context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is, at least, or at most 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%. In some embodiments, risk is expressed as a risk relative to the risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is from an individual comparable to the particular individual. In some embodiments, risk may reflect one or more genetic attributes, for example, one or more genetic attributes that may predispose an individual to developing (or not developing) a particular disease, disorder, and / or condition. In some embodiments, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Susceptibility: An individual who is "susceptible to" a disease, disorder, and / or condition is an individual who has a higher risk of developing the disease, disorder, and / or condition than members of the general public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition develops the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition does not develop the disease, disorder, and / or condition.

[0084] The terms "protein," "polypeptide," or "peptide" are used synonymously herein and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. Polypeptides may be single molecules or multimolecular complexes, such as dimers, trimers, or tetramers. Proteins may comprise one or more peptides or polypeptides and may be folded into a three-dimensional form that may be required for the protein to perform its biological function.

[0085] As used herein, the term "wild-type" or "WT" or "native" refers to the endogenous version of a molecule that occurs naturally in an organism. In some embodiments, wild-type versions of proteins or polypeptides are used, while in other embodiments of the present disclosure, modified proteins or polypeptides are used to generate an immune response. The above terms may be used interchangeably.

[0086] A "modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, has been altered relative to a wild-type protein or polypeptide. In some embodiments, the modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function but retain wild-type activity or function in other respects, e.g., immunogenicity. When a protein is specifically referred to herein, it generally refers to a native (wild-type) or recombinant (modified) protein. The protein may be isolated directly from its native organism, produced by recombinant DNA / exogenous expression methods, solid-phase peptide synthesis (SPPS), or other in vitro methods. In certain embodiments, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding a polypeptide (e.g., an antigen or fragment thereof). The term "recombinant" may be used in conjunction with the name of a polypeptide or a specific polypeptide and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or from the replication products of such a molecule.

[0087] The term "fragment", in reference to an amino acid sequence (peptide or protein), refers to a portion of the amino acid sequence, for example, a sequence representing an amino acid sequence truncated at the N-terminus and / or C-terminus. A fragment truncated at the C-terminus (N-terminal fragment) can be obtained, for example, by translating a truncated open reading frame lacking the 3' end of the open reading frame. A fragment truncated at the N-terminus (C-terminal fragment) can be obtained, for example, by translating a truncated open reading frame lacking the 5' end of the open reading frame, as long as the truncated open reading frame contains an initiation codon that serves to initiate translation. A fragment of an amino acid sequence contains, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the amino acid residues from the amino acid sequence. In this disclosure, a fragment of a polypeptide, DNA, nucleic acid, or RNA nucleic acid sequence is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, and at most 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or 99% identical to, the polypeptide, DNA, nucleic acid, or RNA nucleic acid sequence from which it is derived. "A" refers to a sequence having a sequence identity of 96%, 97%, 98%, or 99%, or exactly 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or between any two of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0088] In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 70% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 80% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 85% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 90% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 95% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 97% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 99% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0089] As used herein in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term "variant" refers to a molecule that exhibits significant structural identity with a reference molecule but structurally differs from the reference molecule, e.g., in the presence or absence or level of one or more chemical moieties compared to the reference entity. In some embodiments, a variant also differs functionally from its reference molecule. Generally, whether a particular molecule is properly considered a "variant" of a reference molecule is based on the degree of structural identity with the reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs from the reference molecule in at least one aspect. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently attached to the polypeptide or nucleic acid backbone (e.g., attached to the polypeptide or nucleic acid backbone). In some embodiments, the variant polypeptide or nucleic acid is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, up to 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or exactly 85% , 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or between any two of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid. In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities.In some embodiments, a variant polypeptide or nucleic acid shares one or more biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid exhibits a reduced level of one or more biological activities compared to a reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence identical to the reference amino acid or nucleotide sequence except for a small number of sequence changes at specific positions. Preferably, a variant polypeptide or nucleic acid sequence has at least one modification, e.g., 1 to about 20 modifications, compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 10 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 5 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 4 modifications compared to a reference polypeptide or nucleic acid sequence. Typically, less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in the variant are substituted, inserted, or deleted compared to the reference.In many cases, the variant polypeptide or nucleic acid comprises a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of functional residues (e.g., residues participating in a specific biological activity) substituted, inserted, or deleted compared to the reference.In some embodiments, the variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 residue substitution compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically less than about 5, about 4, about 3, or about 2 additions or deletions compared to the reference.In some embodiments, the variant polypeptide or nucleic acid contains no more than about 5, about 4, about 3, about 2, or about 1 additions or deletions compared to the reference, and in some embodiments, no additions or deletions.

[0090] In some embodiments, the reference polypeptide or nucleic acid is a "wild-type" or "WT" or "native" sequence found in nature, including allelic variations. A wild-type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For purposes of this disclosure, a "variant" of an amino acid sequence (peptide, protein, or polypeptide) includes an amino acid insertion variant, an amino acid addition variant, an amino acid deletion variant, and / or an amino acid substitution variant. A "variant" of a nucleotide sequence includes a nucleotide insertion variant, a nucleotide addition variant, a nucleotide deletion variant, and / or a nucleotide substitution variant. The term "variant" includes all mutants, splice variants, post-translational modification variants, conformations, isoforms, allelic variants, species variants, and species homologs, particularly those that occur naturally. The term "variant" particularly includes fragments of an amino acid or nucleic acid sequence.

[0091] Changes may be introduced into a nucleic acid by mutation, which may lead to a change in the amino acid sequence of a polypeptide (e.g., an antigen or an antibody or antibody derivative) that the nucleic acid encodes. Mutations may be introduced using any technique known in the art. In one embodiment, one or more specific amino acid residues are changed, for example, using a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues are changed, for example, using a random mutagenesis protocol. In some embodiments, however made, the mutant polypeptide may be expressed and screened for desired properties.

[0092] Mutations can be introduced into nucleic acids without significantly altering the biological activity of the polypeptides encoded by the nucleic acids. For example, nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues can be made. Alternatively, one or more mutations that selectively alter the biological activity of the polypeptides encoded by the nucleic acids can be introduced into the nucleic acids. For example, mutations can change the biological activity quantitatively or qualitatively. Examples of quantitative changes include increasing, reducing, or eliminating the activity. Examples of qualitative changes include changing the antigen specificity of an antibody.

[0093] "Sequence similarity" refers to the percentage of amino acids that are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences refers to the percentage of nucleotides that are identical between the sequences.

[0094] The terms "% identical," "% identity," or similar terms are intended to specifically refer to the percentage of nucleotides or amino acids that are identical in optimal alignment between the compared sequences. The percentage is purely statistical; the differences between the two sequences may, but need not, be randomly distributed over the entire length of the compared sequences. Comparison of two sequences is usually performed by comparing the sequences after optimal alignment over a segment or "window of comparison" to identify local regions of corresponding sequence. The optimal alignment for comparison can be performed manually or with the aid of the local homology algorithm of Smith and Waterman, 1981, Ads App.Math.2, 482, with the aid of the local homology algorithm of Neddleman and Wunsch, 1970, J.Mol.Biol.48, 443, with the aid of the similarity search algorithm of Pearson and Lipman, 1988, Proc.Natl Acad.Sci.USA 88, 2444, or with the aid of a computer program using the above algorithm (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). In some embodiments, the percent identity of two sequences is determined using the BLASTN or BLASTP algorithm available on the website of the United States National Center for Biotechnology Information (NCBI).

[0095] The percentage identity is obtained by determining the number of corresponding identical positions in the compared sequences, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

[0096] In some embodiments, the degree of similarity or identity is given for at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, up to about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, exactly about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, or for a region that is between any two of about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is provided for at least about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, up to about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or exactly about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or between any two of about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, in some embodiments, consecutive nucleotides. In some embodiments, the degree of similarity or identity is provided for the entire length of the reference sequence.

[0097] Homologous amino acid sequences may exhibit at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of amino acid residues, up to 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or exactly 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or between any two of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 95% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 98% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 99% identity of amino acid residues.

[0098] A fragment or variant of an amino acid sequence (peptide or protein) may be a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence refers to any fragment or variant that exhibits one or more functional properties identical to or similar to one or more functional properties of the amino acid sequence from which it is derived, e.g., functionally equivalent. With respect to an antigen or antigen sequence, one specific function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. The term "functional fragment" or "functional variant," as used herein, specifically refers to a variant molecule or sequence that contains an amino acid sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and still retains one or more functions of the parent molecule or sequence, such as the ability to induce an immune response. In one embodiment, the alteration in the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the characteristics of the molecule or sequence. The terms "mutant" of a wild-type RSV F protein, "mutant" of a RSV F protein, "RSV F protein mutant" or "modified RSV F protein" refer to a polypeptide that exhibits the introduction of mutations compared to the wild-type F protein and is immunogenic relative to the wild-type F protein.

[0099] An amino acid sequence (peptide, protein, or polypeptide) "derived from" a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence identical to, essentially identical to, or homologous to the particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of the particular sequence or a fragment thereof. For example, it will be understood by those skilled in the art that antigens suitable for use herein may be altered in sequence to vary from the naturally occurring or native sequence from which they are derived while retaining the desired activity of the native sequence.

[0100] In this disclosure, a vector refers to a nucleic acid molecule, e.g., an artificial nucleic acid molecule. A vector may be used to incorporate a nucleic acid sequence, e.g., a nucleic acid sequence containing an open reading frame. Vectors include, but are not limited to, storage vectors, expression vectors, cloning vectors, and transfer vectors. A vector may be an RNA vector or a DNA vector. In some embodiments, a vector is a DNA molecule. In some embodiments, a vector is a plasmid vector. In some embodiments, a vector is a viral vector. Typically, an expression vector contains a desired coding sequence and appropriate other sequences necessary for expression of an operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify a specific desired fragment (typically a DNA fragment) and may lack functional sequences required for expression of the desired fragment.

[0101] As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers.The pharmaceutical composition may be an immunogenic composition.In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population.In some embodiments, the pharmaceutical composition may be specially formulated for parenteral administration, for example, as a sterile solution or suspension, or as a sustained-release formulation, for example, by subcutaneous, intramuscular, intravenous or epidural injection.

[0102] As used herein, the term "vaccination" refers to the administration of an immunogenic composition intended to generate an immune response, for example, against a disease-associated (e.g., disease-causing) agent (e.g., a virus). In some embodiments, vaccination may be administered before, during, and / or after exposure to the disease-associated agent, and in certain embodiments, before, during, and / or immediately after exposure to the agent. In some embodiments, vaccination involves multiple administrations of a vaccine composition, appropriately spaced in time. In some embodiments, vaccination generates an immune response against an infectious agent. In some embodiments, vaccination generates an immune response against a tumor; in some such embodiments, vaccination is "personalized" in that it is directed, in part or in whole, to epitopes (which may be, for example, or include, one or more neoepitopes) determined to be present in a particular individual's tumor.

[0103] Immune response refers to a humoral response, a cellular response, or both humoral and cellular responses in an organism. Immune response may be measured by assays including, but not limited to, assays that measure the presence or amount of antibodies that specifically recognize proteins or cell surface proteins, assays that measure T cell activation or proliferation, and / or assays that measure modulation in terms of activity or expression of one or more cytokines.

[0104] As used herein, the term "combination therapy" refers to a situation in which a subject is exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered prior to any dose of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, the "administration" of a combination therapy may involve the administration of one or more agents or modalities to a subject receiving other agents or modalities in combination. For clarity, combination therapy does not require that individual agents be administered together (or necessarily simultaneously) in a single composition, although in some embodiments, two or more agents, or active portions thereof, may be administered together in a combination composition or even in a combination compound (e.g., as part of a single chemical complex or covalent entity).

[0105] Those skilled in the art will understand that the term "dosing regimen" can be used to refer to a set of unit doses (typically more than one) that are typically separated by a time period and individually administered to a subject. In some embodiments, a given therapeutic agent has a recommended dosing regimen, and the dosing regimen may involve one or more doses. In some embodiments, the dosing regimen comprises multiple doses, each of which is separated in time from other doses. In some embodiments, the individual doses are separated from each other by the same length of time period; in some embodiments, the dosing regimen comprises multiple doses and at least two different time periods separating the individual doses. In some embodiments, all doses in the dosing regimen are the same unit dose amount. In some embodiments, different doses in the dosing regimen are different amounts. In some embodiments, the dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is different from the amount of the first dose. In some embodiments, the dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is the same as the first dose amount. In some embodiments, the dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (e.g., is a therapeutic dosing regimen).

[0106] II. Respiratory syncytial virus (RSV) The present disclosure provides an RNA molecule (e.g., an RNA polynucleotide) comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. The present disclosure also provides an immunogenic composition comprising at least one RNA molecule encoding a RSV polypeptide, which is complexed with one or more lipids, encapsulated in one or more lipids, or formulated with one or more lipids and forms a lipid nanoparticle (LNP). The RSV polypeptide included in the immunogenic composition disclosed herein can be any RSV F protein in a pre-fusion conformation.

[0107] The term "pre-fusion conformation" refers to a structural conformation adopted by a RSV F protein or mutant thereof that can specifically bind to (i) antibody D25 or AM22 when the RSV F protein or mutant is in the form of a monomer or trimer, or (ii) antibody AM14 when the RSV F protein mutant is in the form of a trimer. The pre-fusion trimer conformation is a subset of the pre-fusion conformation. As used herein, a pre-fusion conformation RSV F protein or polypeptide or mutant thereof can be referred to as "RSV preF".

[0108] The term "post-fusion conformation" refers to a structural conformation adopted by the RSV F protein that does not specifically bind to D25, AM22, or AM14. Native F proteins adopt a post-fusion conformation after fusion of the viral envelope with the host cell membrane. RSV F proteins may also be considered to be in a post-fusion conformation outside the context of a fusion event, for example, when extracted from the membrane under stress conditions such as heat and hypotonicity, when expressed as an ectodomain, or during storage. The term "AM14" refers to the antibody described in International Publication No. WO 2008 / 147196A2, which is incorporated herein by reference in its entirety. The term "AM22" refers to the antibody described in International Publication No. WO 2011 / 043643A1, which is incorporated herein by reference in its entirety. The term "D25" refers to the antibody described in International Publication No. WO 2008 / 147196A2, which is incorporated herein by reference in its entirety.

[0109] In some embodiments, the RSV F protein is a subtype A RSV F protein. In some embodiments, the RSV F protein is a subtype B RSV F protein. As used herein, the terms "subtype" and "subgroup" are used interchangeably. As used herein, the term "strain" refers to a specific isolate within each subtype or subgroup. In some embodiments, the RSV F protein is a mutant of the wild-type RSV F protein. In some embodiments, the RSV F protein is a mutant of subtype A wild-type RSV F protein. In some embodiments, the RSV F protein is a mutant of subtype B wild-type RSV F protein. In some embodiments, the mutants represent the introduction of amino acid sequence mutations compared to the amino acid sequence of the corresponding wild-type RSV F protein and are immunogenic against the wild-type RSV F protein in a pre-fusion conformation or against viruses containing the wild-type F protein. The amino acid mutations in the mutants include amino acid substitutions, deletions, or additions compared to the wild-type RSV F protein.

[0110] In some embodiments, the RSV F protein is a RSV protein mutant described in International Publication No. WO 2017 / 109629, the entire contents of which are incorporated herein by reference.

[0111] In some embodiments, the RSV F protein is a mutant of the wild-type RSV F protein, wherein the introduced amino acid mutation is a mutation of a pair of amino acid residues in the wild-type RSV F protein to a pair of cysteines ("engineered disulfide mutations"). Introduction of a pair of cysteine ​​residues allows for the formation of disulfide bonds between cysteine ​​residues, which stabilizes the conformation or oligomeric state of the protein, for example, the pre-fusion conformation. Examples of specific pairs of such mutations include 55C and 188C; 155C and 290C; 103C and 148C; and 142C and 371C, such as S55C and L188C; S155C and S290C; A103C and I148C; and L142C and N371C.

[0112] In yet another embodiment, the RSV F protein mutant comprises an amino acid mutation that is a mutation that fills one or more cavities. Examples of amino acids that can be replaced with cavity-filling targets include small aliphatic amino acids (e.g., Gly, Ala, and Val) or small polar amino acids (e.g., Ser and Thr), and amino acids that are exposed to the solvent in the post-fusion conformation but buried in the pre-fusion conformation. Examples of replacing amino acids include large aliphatic amino acids (Ile, Leu, and Met) or large aromatic amino acids (His, Phe, Tyr, and Trp). In some specific embodiments, the RSV F protein mutant comprises (1) substitution of S at positions 55, 62, 155, 190, or 290 with I, Y, L, H, or M; (2) substitution of T with I, Y, L, H, or M at positions 54, 58, 189, 219, or 397; (3) substitution of G at position 151 with A or H; (4) substitution of A at position 147 or 298 with I, L, H, or M; (5) substitution of V with I, Y, or H at positions 164, 187, 192, 207, 220, 296, 300, or 495; and (6) Substitution of R at position 106 with W and a mutation that fills a cavity selected from the group consisting of:

[0113] In some embodiments, the RSV F protein mutant comprises at least one cavity-filling mutation selected from the group consisting of T54H, S190I, and V296I.

[0114] In yet another embodiment, the RSV F protein mutant comprises an electrostatic mutation that reduces ionic repulsion or increases ionic attraction between residues in the protein that are adjacent to each other in the folded structure. In some embodiments, the RSV F protein mutant comprises an electrostatic substitution that reduces repulsive ionic interactions or increases attractive ionic interactions with the acidic residues Glu487 and Asp489 from another promoter of the RSV F trimer. In some specific embodiments, the RSV F protein mutant comprises (1) substitution of E at position 82, 92, or 487 with D, F, Q, T, S, L, or H; (2) substitution of K at position 315, 394, or 399 with F, M, R, S, L, I, Q, or T; (3) substitution of D at position 392, 486, or 489 with H, S, N, T, or P; and (4) Substitution of R at position 106 or 339 with F, Q, N, or W The electrostatic mutations are selected from the group consisting of:

[0115] In yet another embodiment, the RSV F protein mutant comprises a combination of two or more different types of mutations selected from engineered disulfide mutations, cavity-filling mutations, and electrostatic mutations. In some embodiments, the RSV F protein mutant comprises a combination of mutations compared to the corresponding wild-type RSV F protein, wherein the combination of mutations is: (1) combination of A103C, I148C, S190I, and D486S; (2) Combination of T54H, S55C, L188C, and D486S; (3) combination of T54H, A103C, I148C, S190I, V296I, and D486S; (4) combination of T54H, S55C, L142C, L188C, V296I, and N371C; (5) combination of S55C, L188C, and D486S; (6) combination of T54H, S55C, L188C, and S190I; (7) combination of S55C, L188C, S190I, and D486S; (8) combination of T54H, S55C, L188C, S190I, and D486S; (9) combination of S155C, S190I, S290C, and D486S; (10) combination of T54H, S55C, L142C, L188C, V296I, N371C, D486S, E487Q, and D489S; (11) A combination of T54H, S155C, S190I, S290C, and V296I, and (12) Combination of S155C, S190F, S290C, and V207L is selected from the group consisting of:

[0116] In some embodiments, the RSV F protein is of subtype A and includes the mutations S155C, S190F, S290C, and V207L.

[0117] In some embodiments, the RSV F protein is of subtype B and includes the mutations S155C, S190F, S290C, and V207L.

[0118] In some embodiments, the RSV F protein is of subtype A and includes the mutations S155C, S190F, and S290C.

[0119] In some embodiments, the RSV F protein is of subtype B and includes the mutations S155C, S190F, and S290C.

[0120] In some embodiments, the RSV F protein is of subtype A and includes the mutations A103C, I148C, S190I, and D486S.

[0121] In some embodiments, the RSV F protein is of subtype B and includes the mutations A103C, I148C, S190I, and D486S.

[0122] In some embodiments, the RSV F protein is of subtype A and includes the mutations T54H, A103C, I148C, S190I, and D486S.

[0123] In some embodiments, the RSV F protein is of subtype B and includes the mutations T54H, A103C, I148C, S190I, and D486S.

[0124] In some embodiments, the RSV F protein is of subtype A and includes the mutations T54H, S55C, L188C, and D486S.

[0125] In some embodiments, the RSV F protein is of subtype B and includes the mutations T54H, S55C, L188C, and D486S.

[0126] Given the substantial conservation of the RSV F sequence, those skilled in the art can easily compare the amino acid positions between different native RSV F sequences to identify corresponding RSV F amino acid positions between different RSV strains and subtypes. For example, the furin cleavage site is at the same amino acid position across almost all identified native RSV F0 precursor proteins. Therefore, the conservation of native RSV F protein sequences across strains and subtypes allows the use of reference RSV F sequences for comparison of amino acids at specific positions of the RSV F protein. For purposes of this disclosure (unless otherwise indicated by the context), the RSV F protein amino acid positions are given relative to the amino acid sequence of the full-length native F precursor polypeptide of the RSV A2 strain, corresponding to GenInfo Identifier GI 138251 and SwissProt Identifier P03420 (SEQ ID NO: 1).

[0127] In some embodiments, the RSV F protein is a mature form of the RSV F protein comprising two separate polypeptide chains, i.e., an F1 polypeptide and an F2 polypeptide. In some other embodiments, the F2 polypeptide is linked to the F1 polypeptide by one or two disulfide bonds to form an F2 / F1 heterodimer. In yet other embodiments, the RSV F mutant is in the form of a single-chain protein, in which the F2 polypeptide is linked to the F1 polypeptide by a peptide bond or peptide linker. Any suitable peptide linker for joining the two polypeptide chains together may be used. Examples of such linkers include G, GG, GGG, GS, and SAIG ​​linker sequences. The linker may also be the full-length pep27 sequence or a fragment thereof, which corresponds to amino acids 110-136 of SEQ ID NO: 1.

[0128] The F1 polypeptide chain of the mutant may be the same length as the full-length F1 polypeptide of the corresponding wild-type RSV F protein, but may also have deletions, such as deletions of 1 to up to 60 amino acid residues from the C-terminus of the full-length F1 polypeptide. The full-length F1 polypeptide of the RSV F mutant corresponds to amino acids 137-574 of the native RSV F0 precursor (SEQ ID NO: 1) and includes (N- to C-terminally) the extracellular domain (residues 137-524), the transmembrane domain ("TM") (residues 525-550), and the cytoplasmic domain ("CT") (residues 551-574). It should be noted that the first amino acid residue 514 in the native F1 polypeptide sequence is an optional sequence in the F1 polypeptide of the RSV F protein included in the immunogenic compositions provided herein and therefore may not be present in the mutant F1 polypeptide.

[0129] In some embodiments, the F1 polypeptide of the RSV F mutant lacks the entire cytoplasmic domain. In other embodiments, the F1 polypeptide lacks the cytoplasmic domain and part or all of the transmembrane domain. In some specific embodiments, the mutant comprises an F1 polypeptide in which amino acid residues 510, 511, 512, 513, 514, 515, 520, 525, or 530-574 are absent. Typically, for mutants linked to a trimerization domain, e.g., Foldon, amino acids 514-574 may be absent. Thus, in some specific embodiments, amino acid residues 514-574 are absent in the mutant F1 polypeptide. In yet another specific embodiment, the F1 polypeptide of the RSV F mutant comprises or consists of amino acid residues 137-513 of a native F0 polypeptide sequence (SEQ ID NO: 1), such as the RSV 847A-Foldon polypeptide (SEQ ID NO: 74) or an alternative F0 precursor sequence, such as those disclosed in SEQ ID NOs: 1, 2, 4, 6, and 81-270 of WO 2017109629, the entire contents of which are incorporated herein by reference.

[0130] The F1 and F2 polypeptides of the RSV F protein mutant into which one or more mutations have been introduced can be derived from any wild-type RSV F protein known in the art or discovered in the future, including, without limitation, the F protein amino acid sequences of RSV subtype A and subtype B strains, including A2 Ontario and Buenos Aires, or any other subtype. In some embodiments, the RSV F mutant comprises an F1 and / or F2 polypeptide from a RSV A virus into which one or more mutations have been introduced, for example, an F1 and / or F2 polypeptide from the RSV F0 precursor protein set forth in any one of SEQ ID NOS: 1, 2, 4, 6, and 81-270 of WO 2017109629, which sequences are incorporated herein by reference in their entirety. In some other embodiments, the RSV F mutant comprises an F1 and / or F2 polypeptide from a RSV B virus, for example, an F1 and / or F2 polypeptide from the RSV F0 precursor protein described in any one of SEQ ID NOs: 2 and 211-263 of WO 2017 / 109629, having one or more mutations introduced therein. In yet another embodiment, the RSV F mutant comprises an F1 and / or F2 polypeptide from a RSV bovine virus, for example, an F1 and / or F2 polypeptide from the RSV F0 precursor protein described in any one of SEQ ID NOs: 264-270 of WO 2017109629, having one or more mutations introduced therein.

[0131] The term "F0 polypeptide" (F0) refers to the precursor polypeptide of the RSV F protein, which is composed of a signal polypeptide sequence, an F1 polypeptide sequence, a pep27 polypeptide sequence, and an F2 polypeptide sequence. With rare exceptions, the F0 polypeptide of known RSV strains consists of 574 amino acids.

[0132] The term "F1 polypeptide" (F1) refers to the polypeptide chain of the mature RSV F protein. Native F1 contains approximately residues 137-574 of the RSV F0 precursor and is composed (N- to C-terminally) of an extracellular region (approximately residues 137-524), a transmembrane domain ("TM") (approximately residues 525-550), and a cytoplasmic tail ("CT") (approximately residues 551-574). As used herein, this term encompasses both native F1 polypeptides and F1 polypeptides containing modifications (e.g., amino acid substitutions, insertions, or deletions) from the native sequence, such as modifications designed to stabilize or enhance the immunogenicity of RSV F protein mutants.

[0133] The term "F2 polypeptide" (F2) refers to the polypeptide chain of the mature RSV F protein. Native F2 comprises approximately residues 26-109 of the RSV F0 precursor. As used herein, this term encompasses both native F2 polypeptides and F2 polypeptides containing modifications (e.g., amino acid substitutions, insertions, or deletions) from the native sequence, such as modifications designed to stabilize RSV F protein mutants in the pre-fusion conformation or enhance the immunogenicity of RSV F protein mutants. In the native RSV F protein, the F2 polypeptide is linked to the F1 polypeptide by two disulfide bonds to form an F2-F1 heterodimer. The term "Foldon" or "Foldon domain" refers to an amino acid sequence capable of forming a trimer. One example of such a Foldon domain is a peptide sequence derived from bacteriophage T4 fibritin having the sequence GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO: 45).

[0134] In some embodiments, the RNA molecule encodes an RSV F protein mutant as disclosed in WO 2009 / 079796, WO 2010 / 149745, WO 2011 / 008974, WO 2014 / 160463, WO 2014 / 174018, WO 2014 / 202570, WO 2015 / 013551, WO 2015 / 177312, WO 2017 / 005848, WO 2017 / 174564, WO 2017 / 005844 and WO 2018 / 109220. The RSV F proteins disclosed in these references are incorporated herein by reference in their entireties.

[0135] Antibodies against the RSV F protein are widespread after natural infection and vaccination and have been shown to neutralize viral activity in vitro. As used herein, the term "respiratory syncytial virus" or "RSV" is not limited to any particular strain or variant.

[0136] In some embodiments, the RNA molecule comprises an open reading frame encoding a RSV antigen. In some embodiments, the RSV antigen is a RSV polypeptide. In some embodiments, the RSV polypeptide is a RSV glycoprotein, or a fragment or variant thereof. In some embodiments, the RNA molecule encodes the RSV F protein.

[0137] In some embodiments, the RSV polypeptide is a full-length RSV polypeptide. In some embodiments, the RSV polypeptide is a truncated RSV polypeptide. In some embodiments, the RSV polypeptide is a variant of a RSV polypeptide. In some embodiments, the RSV polypeptide is a fragment of a RSV polypeptide.

[0138] In some embodiments, the RSV polypeptide is a full-length RSV F protein. In some embodiments, the RSV polypeptide is a truncated RSV F protein. In some embodiments, the RSV polypeptide is a variant of the RSV F protein. In some embodiments, the RSV polypeptide is a fragment of the RSV F protein.

[0139] In some embodiments, the RSV F protein includes at least one mutation. In some embodiments, the RSV F protein includes at least two mutations. In some embodiments, the RSV F protein includes at least three mutations. In some embodiments, the RSV F protein includes at least four mutations. In some embodiments, the RSV F protein includes four mutations. In some embodiments, the RSV F protein includes at least five mutations.

[0140] In some embodiments, the RNA molecule encodes a RSV F protein set forth in Table 1 (see Example 6). In some embodiments, the RNA molecule encodes a RSV F protein, or a fragment or variant thereof, including any of the amino acid sequences of SEQ ID NOs: 1-6 and 71-74. In some embodiments, the RSV F polypeptide is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% %, 98%, or 99% identity; exact 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity; or between any two of the following: 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some embodiments, the RSV F protein consists of any of the amino acid sequences in Table 1, for example, any of SEQ ID NOs: 1-6 and 71-74.

[0141] In some embodiments, the RNA molecule sequence is transcribed from a DNA nucleic acid sequence (DNA polynucleotide) in Table 2 (see Example 6). In some embodiments, the RNA molecule comprises an ORF transcribed from the nucleic acid sequence of any of SEQ ID NOS: 7-10 and 59-62, or a fragment or variant thereof. In some embodiments, the RNA molecule has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, , 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , or 99% identity, exact 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or 70%, 71%, In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that may have between any two of the following identity: 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any of the nucleic acid sequences in Table 2, e.g., any of SEQ ID NOs: 7-10 and 59-62.

[0142] In some embodiments, the RNA molecule comprises an ORF comprising an RNA nucleic acid sequence (RNA polynucleotide) of Table 3 (see Example 6). In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 11-16 and 63-70, or a fragment or variant thereof. In some embodiments, the RNA molecule has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91% similarity to any of the RNA nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs: 11-16 and 63-70. , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, or 99% identity, exact 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or 70%, In some embodiments, the RNA molecule comprises an ORF comprising a nucleic acid sequence that may have between 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some embodiments, the RNA molecule comprises an ORF comprising a nucleic acid sequence consisting of any of the RNA nucleic acid sequences in Table 3, e.g., any of SEQ ID NOs: 11-16 and 63-70.

[0143] In some embodiments, the RNA molecule comprises stabilized RNA. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by N1-methylpseudouridine. In some embodiments, the RNA molecule comprises a sequence in which all uridines are replaced by N1-methylpseudouridine (referred to as "Ψ"). In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 11-16 and 63-70, in which all uridines are replaced by N1-methylpseudouridine (referred to as "Ψ").

[0144] In some embodiments, the RNA molecule is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the RSV F protein sequences of SEQ ID NOS: 1-6 and 71-74 (Table 1) or other RSV pre-fusion F proteins described herein, or up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, the RNA molecule comprises an open reading frame encoding a RSV F protein amino acid sequence consisting of any of SEQ ID NOS: 1-6 and 71-74 (Table 1), or the RSV F protein sequence of any other RSV pre-fusion F protein described herein.

[0145] In some embodiments, the RNA molecule has a sequence identity of at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, and up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, to any of the nucleic acid sequences of SEQ ID NOs: 7-10 and 59-62 (Table 2) or other nucleic acids described herein. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or between any two of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence consisting of any of the nucleic acid sequences of SEQ ID NOS: 7-10 and 59-62 (Table 2) or other nucleic acids described herein.

[0146] In some embodiments, the RNA molecule is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the nucleic acid sequences of SEQ ID NOs: 11-16 and 63-70 (Table 3) or other nucleic acids described herein, and up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the nucleic acid sequences of SEQ ID NOs: 11-16 and 63-70 (Table 3) or other nucleic acids described herein. The open reading frame includes an RNA nucleic acid sequence that may be 8%, or 99%, or exactly 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or between any two of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, the RNA molecule includes an open reading frame that includes an RNA nucleic acid sequence consisting of any of the nucleic acid sequences of SEQ ID NOs: 11-16 and 63-70 (Table 3) or other nucleic acids described herein. In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 11-16 and 63-70 (Table 3), in which all uridines are replaced by N1-methylpseudouridine (referred to as "Ψ").

[0147] III.RNA molecule In some embodiments, the RNA molecule described herein is a coding RNA molecule. Coding RNA includes functional RNA molecules that can be translated into peptides or polypeptides. In some embodiments, coding RNA molecules include at least one open reading frame (ORF) that encodes at least one peptide or polypeptide. Open reading frame includes the sequence of codons that can be translated into peptides or proteins. Coding RNA molecules can include one (monocistronic), two (bicistronic) or more (multicistronic) ORFs, which can be the sequence of codons that can be translated into polypeptides or proteins of interest.

[0148] The coding RNA molecule may be a messenger RNA (mRNA) molecule, a viral RNA molecule, or a self-amplifying RNA molecule (saRNA, also referred to as a replicon). In some embodiments, the RNA molecule is mRNA. Preferably, the RNA molecule of the present disclosure is mRNA. In some embodiments, the RNA molecule is modRNA. In some embodiments, the RNA molecule is saRNA. In some embodiments, the saRNA molecule may be a coding RNA molecule.

[0149] An RNA molecule may encode one or more polypeptides of interest, e.g., one or more antigens, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides. Alternatively, or additionally, a single RNA molecule may also encode more than one polypeptide of interest, e.g., antigen, and may be, for example, a bicistronic or tricistronic RNA molecule encoding different or the same antigens.

[0150] The sequence of the RNA molecule may be codon-optimized or deoptimized for expression in a desired host, such as a human cell. In some embodiments, the gene of interest (e.g., antigen) described herein is encoded by a coding sequence that is codon-optimized and / or has an increased guanosine / cytidine (G / C) content compared to a wild-type coding sequence. In some embodiments, one or more sequence regions of the coding sequence are codon-optimized and / or have an increased G / C content compared to the corresponding sequence region of a wild-type coding sequence. In some embodiments, codon optimization and / or increased G / C content do not change the sequence of the encoded amino acid sequence.

[0151] The term "codon-optimized" is understood by those skilled in the art to refer to changing the codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without changing the amino acid sequence encoded by the nucleic acid molecule.In the context of the present disclosure, in some embodiments, the coding region is codon-optimized for optimal expression in a subject treated with the RNA polynucleotide described herein.Codon optimization is based on the discovery that translation efficiency is also determined by the different frequencies of tRNA molecules present in cells.Therefore, the sequence of RNA may be modified so that codons that are available for frequently occurring tRNA molecules are inserted instead of "rare codons".

[0152] In some embodiments, the G / C content of the coding region of the RNA (e.g., the sequence of the gene of interest; open reading frame (ORF)) is increased compared to the G / C content of the corresponding coding sequence of the wild-type RNA encoding the gene of interest, and in some embodiments, the amino acid sequence encoded by the RNA is not modified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for the efficient translation of that mRNA. A sequence with an increased G (guanosine) / C (cytidine) content is more stable than a sequence with an increased A (adenosine) / U (uridine) content. In view of the fact that several codons encode the same amino acid (the so-called degeneracy of the genetic code), the most favorable codon for stability can be determined (the so-called alternative codon usage). Depending on the amino acid encoded by the RNA, there are various possibilities for modifying the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleosides may be altered by replacing these codons with other codons that encode the same amino acids but that do not contain A and / or U, or that contain a lower content of A and / or U nucleosides. Thus, in some embodiments, the G / C content of the coding region of the RNA described herein is increased by at least 10%, 20%, 30%, 40%, 50%, 55%, up to 10%, 20%, 30%, 40%, 50%, 55%, exactly 10%, 20%, 30%, 40%, 50%, 55%, or between any two of 10%, 20%, 30%, 40%, 50%, 55%, or even higher percentages compared to the G / C content of the coding region of the wild-type RNA. In some embodiments, the coding region of the RSV RNA described herein comprises at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or about 80% G / C content.In some embodiments, the coding region of the RSV RNA described herein comprises a G / C content of about 50% to 75%, about 55% to 70%, about 50% to 60%, about 60% to 70%, about 70% to 80%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 70% to 75%, or about 75% to 80%. In some embodiments, the coding region of the RSV RNA described herein comprises a G / C content of about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, or about 75%. In some embodiments, the coding region of the RSV RNA described herein comprises a G / C content of about 58%, about 66%, or about 62%.

[0153] In some embodiments, the RNA molecule is from about 20 to about 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-70,000, 100-250, 100-500, 100-1,000, 100- 1,500, 100-3,000, 100-5,000, 100-7,000, 100-10,000, 100-25,000, 100-50,000, 100-70,000, 100-100,000, 500-1,000, 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000, 500-25,000, 500-50,000 , 500~70,000, 500~100,000, 1,000~1,500, 1,000~2,000, 1,000~3,000, 1,000~5,000, 1,000~7,000, 1,000~10,000, 1,000~25,000, 1,000~50,000, 1,000~70,000, 1,000~100,000, 1,500~3,000, 1,500~5,000, 1,500~7,000 0, 1,500–10,000, 1,500–25,000, 1,500–50,000, 1,500–70,000, 1,500–100,000, 2,000–3,000, 2,000–5,000, 2,000–7,000, 2,000–10,000, 2,000–25,000, 2,000–50,000, 2,000–70,000, and 2,000–100,000 nucleotides).

[0154] In some embodiments, the RNA molecule comprises at least 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1200, 1400, 1 400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7 400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 3 0000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000 pieces, up to 20, 40, 60, 80, 100, 120, 140, 16 0, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780 ,800,820,840,860,880,900,920,940,960,980,1000,1000,1200,1400,1600,1800,2000,2200,2400,2600,2800,3000,3200,3400,3600,3800,4000,4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000 , 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42 000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000, exactly 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 34 0, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 96 0, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400 ,5600,5800,6000,6200,6400,6600,6800,7000,7200,7400,7600,7800,8000,8200,8400,8600,8800,9000,9200,9400,9600,9800,10000,10000,1 2000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000,54,000, 56,000, 58,000, 60,000, 62,000, 64,000, 66,000, 68,000, 70,000, 72,000, 74,000, 76,000, 78,000, 80,000, 82,000, 84,000, 86,000, 88,000, 90,000, 92,000, 94,000, 96,000, 98,000, or 100,000, or about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600 , 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 3 The number of nucleotides may be between any two of 8000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000.

[0155] In some embodiments, the RNA molecule comprises at least 100 nucleotides. For example, in some embodiments, the RNA has a length of 100 to 15,000 nucleotides; 7,000 to 16,000 nucleotides; 8,000 to 15,000 nucleotides; 9,000 to 12,500 nucleotides; 11,000 to 15,000 nucleotides; 13,000 to 16,000 nucleotides; or 7,000 to 25,000 nucleotides. In some embodiments, the RNA molecule comprises at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 200 0, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 59 50, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900,7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 103 50, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11 400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 1 2450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500 , 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, up to 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050,2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300、11350、11400、11450、11500、11550、11600、11650、11700、11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750 , 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 1380 0, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 148 50, 14900, 14950, or 15000 pieces, exactly 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200 , 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450 , 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700 , 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950 , 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200,6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450 , 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700 , 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950 , 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 1100 0, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12 050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 1 3100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, or about 100, 150,200、250、300、350、400、450、500、550、600、650、700、750、800、850、900、950、1000、1050、1100、1150、1200、1250、1300、1350、1400、1450、1500、155、 0、1600、1650、1700、1750、1800、1850、1900、1950、2000、2050、2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, The number of nucleotides may be between any two of 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000.

[0156] The RNA molecules of the present disclosure may be prepared by any method known in the art, including chemical synthesis and in vitro methods, such as RNA in vitro transcription. In some embodiments, the RNA of the present disclosure is prepared using in vitro transcription.

[0157] In some embodiments, the RNA molecules of the present disclosure are purified by, for example, filtration, which can be performed, for example, via ultrafiltration, diafiltration, or tangential flow ultrafiltration / diafiltration.

[0158] In some embodiments, the RNA molecules of the present disclosure are lyophilized so that they are temperature stable.

[0159] In some embodiments of the present disclosure, the RNA is or comprises a messenger RNA (mRNA) associated with an RNA transcript encoding a polypeptide. In some embodiments, the RNA disclosed herein comprises a 5' cap comprising a 5' cap disclosed herein; a 5' untranslated region (5'UTR) comprising a cap-proximal sequence; a sequence encoding a protein (e.g., a polypeptide) (e.g., a RSV pre-fusion F protein); a 3' untranslated region (3'UTR); and / or a polyadenylation (polyA) sequence.

[0160] In some embodiments, the RNA disclosed herein comprises, in a 5' to 3' direction, the following components: a 5' cap comprising a 5' cap disclosed herein; a 5' untranslated region (5'UTR) comprising a cap-proximal sequence, a sequence encoding a protein (e.g., a polypeptide) (e.g., an RSV pre-fusion F protein); a 3' untranslated region (3'UTR); and a polyA sequence.

[0161] In some embodiments, the RNA disclosed herein further comprises a signal peptide.Non-limiting examples of signal peptides and amino acids, and nucleic acid sequences encoding such peptides can be found, for example, in International Publication No. WO 2017 / 109629, the disclosure of which is incorporated herein by reference in its entirety.

[0162] In some embodiments, the RNA disclosed herein encodes an antigenic fusion protein. Thus, the encoded antigen or antigens may comprise two or more proteins (e.g., proteins and / or protein fragments) joined together. Alternatively, the protein to which the protein antigen is fused does not promote a strong immune response against itself, but against the antigen. In some embodiments, the antigenic fusion protein retains the functional properties of each original protein. In some embodiments, the RNA disclosed herein encodes a fusion protein comprising an antigen linked to a scaffold moiety. In some embodiments, the RNA further encodes a linker positioned between at least one or each domain of the fusion protein. Non-limiting examples of such scaffold moieties and linkers can be found, for example, in International Publication No. WO 2022 / 067010, the disclosure of which is incorporated herein by reference in its entirety.

[0163] A. Modified Nucleobases In some embodiments of the present disclosure, the RNA molecule is not chemically modified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine.In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues, such as those present in transcribed RNA (e.g., A, G, C, and / or U).In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides, such as those present in DNA (e.g., dA, dG, dC, and / or dT).

[0164] In other embodiments of the present disclosure, RNA molecules can comprise modified nucleosides and modified nucleic acid bases that can be incorporated into nucleotides.In some embodiments, RNA molecules can comprise one or more modified nucleotides.Naturally occurring nucleotide modifications are known in the art.In some embodiments, RNA molecules can comprise modified nucleotides. Non-limiting examples of modified nucleotides that can be included in an RNA molecule include pseudouridine, N1-methylpseudouridine, 5-methyluridine, 3-methyluridine, 5-methoxyuridine, 5-azauridine, 6-azauridine, 2-thio-5-azauridine, 2-thiouridine, 4-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 5-aminoallyl-uridine, 5-halouridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-amino ... -thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl thi-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-1-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine,Dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'- Modified uridines include O-methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine]uridine, and any other modified uridine known in the art, or combinations thereof. In some embodiments, one, two, three, four, five, or more of these modified nucleotides may be excluded from the RNA molecules disclosed herein.

[0165] Modifications that may be present in RNA molecules include, for example, the following: ms2io6A (2-methylthio-(N6-(cis-hydroxyisopentenyl)adenosine); ms2m6A (2-methylthio-N6-methyladenosine); ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine; g6A (N6-glycinylcarbamoyladenosine); i6A (N6-isopentenyladenosine); m6A (N6-methyladenosine); t6A (N6-threonylcarbamoyladenosine); m'Am (1,2'-O-dimethyladenosine); m1A (1-methyladenosine); 2'-O-methyladenosine; A r(p)(2'-O-ribosyladenosine (phosphate)); 2-methyladenosine; 2-methylthio-N6-isopentenyladenosine; ms2hn6A(2-methylthio-N6-hydroxynorvalylcarbamoyladenosine); 2-O-methyladenosine; Am(2-1-O-methyladenosine); 2'-O-ribosyladenosine (phosphate); isopentenyladenosine; io6A N6-(cis-hydroxyisopentenyl)adenosine; m6Am (N6,2'-O-dimethyladenosine); m62Am (N6,N6,2'-O-trimethyladenosine); m62A (N6,N6-dimethyladenosine); ac6A (N6-acetyladenosine); hn6A (N6-hydroxynorvalylcarbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); m2A (2-methyladenosine); ms2i6A (2-methylthio-N6-isopentenyladenosine); 7-deaza-adenosine; N1-methyl-adenosine; N6,N6(dimethyl)adenine; N6 -cis-Hydroxy-isopentenyl-adenosine;α-thio-adenosine;2(amino)adenine;2(aminopropyl)adenine;2(methylthio)N6(isopentenyl)adenine;2-(alkyl)adenines;2-(aminoalkyl)adenines;2-(aminopropyl)adenine;2-(halo)adenines;2-(propyl)adenine;2'-amino-2'-deoxy-ATP;2'-azido-2'-deoxy-ATP;2'-deoxy-2'-α-aminoadenosine TP;2'-deoxy-2'-α-azidoadenosine TP;6(alkyl)adenines;6(methyl)adenine;6-(alkyl)adenines;6-(Methyl)adenine;7(Deaza)adenine;8(Alkenyl)adenine;8(Alkynyl)adenine;8(Amino)adenine;8(Thioalkyl)adenine;8-(Alkenyl)adenine;8-(Alkyl)adenine;8-(Alkynyl)adenine;8-(Amino)adenine;8-(Halo)adenine;8-(Hydroxyl)adenine;8-(Thioalkyl)adenine;8-(Thioyl)adenine;8-Azido-adenosine;8-Oxo-adenine;Azaadenine;Deazaadenine;N6(Methyl)adenine;N6-(Isopentyl)adenine; 7-Deaza-8-aza-adenosine;7-Methyladenine;1-Deazaadenosine TP;2'Fluoro-N6-Bz-deoxyadenosine TP;2'-OMe-2-amino-ATP;2'O-Methyl-N6-Bz-deoxyadenosine TP;2'-α-Ethynyladenosine TP;2-Aminoadenine;2-Aminoadenosine TP;2-Amino-ATP;2'-α-Trifluoromethyladenosine TP;2-Azidoadenosine TP;2'-β-Ethynyladenosine TP;2-Bromoadenosine TP;2'-β-Trifluoromethyladenosine TP;2- 2'-Deoxy-2',2'-difluoroadenosine TP;2'-Deoxy-2'-a-mercaptoadenosine TP;2'-Deoxy-2'-a-thiomethoxyadenosine TP;2'-Deoxy-2'-b-aminoadenosine TP;2'-Deoxy-2'-b-azidoadenosine TP;2'-Deoxy-2'-b-bromoadenosine TP;2'-Deoxy-2'-b-chloroadenosine TP;2'-Deoxy-2'-b-fluoroadenosine TP;2'-Deoxy-2'-b-iodoadenosine TP;2'-Deoxy-2'- b-Mercaptadenosine TP;2'-Deoxy-2'-b-thiomethoxyadenosine TP;2-Fluoroadenosine TP;2-Iodoadenosine TP;2-Mercaptadenosine TP;2-Methoxy-adenine;2-Methylthio-adenine;2-Trifluoromethyladenosine TP;3-Deaza-3-bromoadenosine TP;3-Deaza-3-chloroadenosine TP;3-Deaza-3-fluoroadenosine TP;3-Deaza-3-iodoadenosine TP;3-Deazaadenosine TP;4'-Azidoadenosine TP;4'-Carbocyclic adenosine TP;4'-Ethynyladenosine TP;5'-Homo-adenosine TP;8-Aza-ATP;8-Bromo-adenosine TP;8-Trifluoromethyladenosine TP;9-Deazaadenosine TP;2-Aminopurine;Substituted 7-deazapurines;7-Deaza-7-substituted purines;7-Deaza-8-substituted purines;7-Deaza-2,6-diaminopurine;7-Deaza-8-aza-2,6-diaminopurine;7-Deaza-8-aza-2-aminopurine;2,4-Diaminopurine;2,6-Diaminopurine;7-Deaza-8-aza-adenine;7-Deaza-2-aminopurine;8 -Azapurine; s2C (2-thiocytidine); m3C (3-methylcytidine); f5C (5-formylcytidine); hm5C (5-hydroxymethylcytidine); m5C (5-methylcytidine); ac4C (N4-acetylcytidine); Cm (2'-O-methylcytidine); m5Cm (5,2'-O-dimethylcytidine); f5Cm (5-formyl-2'-O-methylcytidine); k2C (lysidine); m4Cm (N4,2'-O-dimethylcytidine); ac4Cm (N4-acetyl-2'-O-methylcytidine); m4C (N4-methylcytidine); N 4,N4-Dimethyl-2'-OMe-cytidine TP;4-Methylcytidine;5-Aza-cytidine;Pseudo-iso-cytidine;Pyrrolo-cytidine;α-Thio-cytidine;2-(Thio)cytosine;2'-Amino-2'-deoxy-CTP;2'-Azido-2'-deoxy-CTP;2'-Deoxy-2'-α-aminocytidine TP;2'-Deoxy-2'-α-azidocytidine TP;3(Deaza)5(Aza)cytosine;3(Methyl)cytosine;3-(Alkyl)cytosine;3-(Deaza)5(Aza)cytosine;3-(Methyl)cytidine;4,2'-O-Dimethyl Cytidine; 5(halo)cytosine; 5(methyl)cytosine; 5(propynyl)cytosine; 5(trifluoromethyl)cytosine; 5-chlorocytosine; 5-fluorocytosine; 5-bromocytosine; 5-hydroxycytosine; 5-methylcytosine; 5-(alkyl)cytosine; 5-(alkenyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-bromo-cytidine; 5-iodo-cytidine; 5-propynylcytosine; 6-(azo)cytosine; 6-aza-cytidine;Azacytosine;Deazacytosine;N4(acetyl)cytosine;1-methyl-1-deaza-pseudoisocytidine;1-methyl-pseudoisocytidine;2-methoxy-5-methyl-cytidine;2-methoxy-cytidine;2-thio-5-methyl-cytidine;4-methoxy-1-methyl-pseudoisocytidine;4-methoxy-pseudoisocytidine;4-thio-1-methyl-1-deaza-pseudoisocytidine;4-thio-1-methyl-pseudoisocytidine;4-thio-pseudoisocytidine;5-aza-zebularine;5-methyl-zebularine;Pyrrolo- Pseudoisocytidine; Zebularine; (E)-5-(2-Bromo-vinyl)cytidine TP; 2,2'-Anhydro-cytidine TP Hydrochloride; 2'Fluoro-N4-Bz-cytidine TP; 2'Fluoro-N4-acetyl-cytidine TP; 2'-O-Methyl-N4-acetyl-cytidine TP; 2'O-Methyl-N4-Bz-cytidine TP; 2'-a-Ethynylcytidine TP; 2'-a-Trifluoromethylcytidine TP; 2'-b-Ethynylcytidine TP; 2'-b-Trifluoromethylcytidine TP; 2'-Deoxy-2',2'-difluorocytidine 2'-Deoxy-2'-α-mercaptocytidine TP; 2'-Deoxy-2'-α-thiomethoxycytidine TP; 2'-Deoxy-2'-β-aminocytidine TP; 2'-Deoxy-2'-β-azidocytidine TP; 2'-Deoxy-2'-β-bromocytidine TP; 2'-Deoxy-2'-β-chlorocytidine TP; 2'-Deoxy-2'-β-fluorocytidine TP; 2'-Deoxy-2'-β-iodocytidine TP; 2'-Deoxy-2'-β-mercaptocytidine TP; 2'-Deoxy-2'-β-thiomethoxycytidine TP; 2'-O -Methyl-5-(1-propynyl)cytidine TP; 3'-ethynylcytidine TP; 4'-azidocytidine TP; 4'-carbocyclic cytidine TP; 4'-ethynylcytidine TP; 5-(1-propynyl)ara-cytidine TP; 5-(2-chloro-phenyl)-2-thiocytidine TP; 5-(4-amino-phenyl)-2-thiocytidine TP; 5-aminoallyl-CTP; 5-cyanocytidine TP; 5-ethynylara-cytidine TP; 5-ethynylcytidine TP; 5'-homocytidine TP; 5-methoxycytidine TP; 5-trifluoromethyl-cytidine TP;N4-amino-cytidine TP; N4-benzoyl-cytidine TP; pseudoisocytidine; mimG (methylguanosine); m7G (7-methylguanosine); m2Gm (N2,2'-O-dimethylguanosine); m2G (N2-methylguanosine); imG (wiosine); m1Gm (1,2'-O-dimethylguanosine); m1G (1-methylguanosine); 2'-O-methylguanosine; 2'-O-ribosylguanosine(phosphate); Gm (2'-O-methylguanosine); Gr(p) (2'-O-ribosylguanosine(phosphate)); preQi (7-aminomethyl-7-deazaguanosine); preQo (7-cyano-7-deazaguanosine); G; *(Archaeosine);Methylwiosine;m2'7G(N2,7-dimethylguanosine);m22Gm(N2,N2,2'-O-trimethylguanosine);m2'2'7G(N2,N2,7-trimethylguanosine);m22G(N2,N2-dimethylguanosine);N2,7,2'-O-trimethylguanosine;6-Thio-guanosine;7-Deaza-guanosine;8-Oxo-guanosine;N1-Methyl-guanosine;a-Thio-guanosine;2(Propyl)guanosine 2-(Alkyl)guanine;2'-Amino-2'-deoxy-GTP;2'-Azido-2'-deoxy-GTP;2'-Deoxy-2'-α-aminoguanosine TP;2'-Deoxy-2'-α-azidoguanosine TP;N2-Dimethylguanine;6-(Methyl)guanine;6-(Alkyl)guanine;6-(Methyl)guanine;6-Methyl-guanosine;6-Thioguanine;7(Alkyl)guanine;7-Deaza-7-substituted guanine;7-Deaza-7-(C2-C 6) Alkynylguanine; 7-Deaza-8-substituted guanines; 7(Methyl)guanine; 7-(Alkyl)guanine; 7-(Deaza)guanine; 7-(Methyl)guanine; 8-Azaguanine; 8-Hydroxyguanine; 8-Oxoguanine; 8(Alkyl)guanine; 8(Alkynyl)guanine; 8(Halo)guanine; 8(Thioalkyl)guanine; 8-(Alkenyl)guanine; 8-(Alkyl)guanine; 8-(Alkynyl)guanine; 8-(Amino)guanine; 8- (Halo)guanine;8-(hydroxyl)guanine;8-(thioalkyl)guanine;8-(thiol)guanine;Azaguanine;Deazaguanine;N(methyl)guanine;N-(methyl)guanine;1-methyl-6-thio-guanosine;6-methoxy-guanosine;6-thio-7-deaza-8-aza-guanosine;6-thio-7-deaza-guanosine;6-thio-7-methyl-guanosine;7-deaza-8-aza-guanosine;7-methyl-8-oxo-guanosine; N2,N2-Dimethyl-6-thio-guanosine;N2-Methyl-6-thio-guanosine;1-me-GTP;2'Fluoro-N2-isobutyl-guanosine TP;2'0-Methyl-N2-isobutyl-guanosine TP;2'-α-Ethynylguanosine TP;2'-α-Trifluoromethylguanosine TP;2'-β-Ethynylguanosine TP;2'-β-Trifluoromethylguanosine TP;2'-Deoxy-2',2'-difluoroguanosine TP;2'-Deoxy-2'-α-mercaptoguanosine TP;2'-Deoxy-2'-α-thiomethoxyguanosine TP 2'-Deoxy-2'-b-aminoguanosine TP; 2'-Deoxy-2'-b-azidoguanosine TP; 2'-Deoxy-2'-b-bromoguanosine TP; 2'-Deoxy-2'-b-chloroguanosine TP; 2'-Deoxy-2'-b-fluoroguanosine TP; 2'-Deoxy-2'-b-iodoguanosine TP; 2'-Deoxy-2'-b-mercaptoguanosine TP; 2'-Deoxy-2'-b-thiomethoxyguanosine TP; 4'-Azidoguanosine TP; 4'-Carbocyclic guanosine TP; 4'-Ethynylguanosine TP; 5' -Homo-guanosine TP; 8-bromo-guanosine TP; 9-deazaguanosine TP; N2-isobutyl-guanosine TP; miI (1-methylinosine); I (inosine); m'lm (1,2'-O-dimethylinosine); 2'-O-methylinosine; 7-methylinosine; Tm (2'-O-methylinosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosylqueuosine); Q (queuosine); allylamino-thymidine; azathymidine; deazathymidine; deoxy-thymidine; Um (2'-O-methyl-queuosine); Thiuridine; s2U (2-thiouridine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); ho5U (5-hydroxyuridine); m5U (5-methyluridine); tm5s2U (5-taurinomethyl-2-thiouridine); 5-taurinomethyluridine; D (dihydrouridine); pseudouridine; acp3U (3-(3-amino-3-carboxypropyl)uridine); 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1-methylpseudouridine; 1-ethyl-pseudouridine;2'-O-methyluridine; 2'-O-methylpseudouridine; 2'-O-methyluridine; s2Um (2-thio-2'-O-methyluridine); 3-(3-amino-3-carboxypropyl)uridine; m3Um (3,2'-O-dimethyluridine); 3-methyl-pseudo-uridine TP; s4U (4-thiouridine); chm5U (5-(carboxyhydroxymethyl)uridine); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); m5Um (5,2'-O-dimethyluridine); 5,6-dihydro-uridine ncm5Um(5-carbamoylmethyl-2'-O-methyluridine); ncm5U(5-carbamoylmethyluridine); 5-carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester; cnmm5Um(5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm5s2U(5-carboxymethylaminomethyl-2-thiouridine); 5-carboxymethylaminomethyluridine; cmnm5U(5-carboxymethylamino Methyluridine; 5-carbamoylmethyluridine TP; mcm5Um (5-methoxycarbonylmethyl-2'-O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); mcm5U (5-methoxycarbonylmethyluridine); mo5U (5-methoxyuridine); m5s2U (5-methyl-2-thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); mnm5s2U (5-methylaminomethyl-2-thiouridine); mnm5U (5-methylaminomethyluridine); m 5D (5-methyldihydrouridine); 5-hydroxyacetic acid-uridine TP; 5-hydroxyacetic acid-methyl ester-uridine TP; dihydrouracil; pseudouracil; N1-methyl-pseudouracil; N1-ethyl-pseudouracil; cmo5U (uridine 5-hydroxyacetic acid); mcmo5U (uridine 5-hydroxyacetic acid methyl ester); 3-(3-amino-3-carboxypropyl)-uridine TP; 5-(isopentenylaminomethyl)-2-thiouridine TP; 5-(isopentenylaminomethyl)-2'-O-methyluridine TP;5-(Iso-pentenylaminomethyl)uridine TP;5-Propynyluracil;α-Thio-uridine;1(aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil;1(aminoalkylamino-carbonylethylenyl)-2,4-(dithio)pseudouracil;1(aminoalkylamino-carbonylethylenyl)-4(thio)pseudouracil;1(aminoalkylamino-carbonylethylenyl)-pseudouracil;1(aminocarbonylethylenyl)-2(thio)-pseudouracil;1(aminocarbonylethylenyl) 1-(aminocarbonylethylenyl)-2,4-(dithio)pseudouracil;1-(aminocarbonylethylenyl)-4(thio)pseudouracil;1-(aminocarbonylethylenyl)-pseudouracil;1-substituted 2(thio)-pseudouracil;1-substituted 2,4-(dithio)pseudouracil;1-substituted 4(thio)pseudouracil;1-substituted pseudouracil;1-(aminoalkylaminocarbonylethylenyl)-2-(thio)-pseudouracil;1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine TP;1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine TP 2'-Amino-2'-deoxy-UTP;2'-Azido-2'-deoxy-UTP;2'-Azido-2'-deoxy-UTP;2'-Azido-2'-deoxy-Uridine TP;2'-O-Methylpseudo-Uridine;2'-Deoxyuridine;2'-Fluorouridine;2'-O-Phenylpseudo-Uridine;2'-O-Phenylpseudo-Uridine;2'-Fluorouridine;2'-Deoxy-2'-α-Azido-2'-deoxy-Uridine;2'-O-Methylpseudo-Uridine;2'-O-Methylpseudo-Uridine;2'-Fluorouridine;2'-Deoxy-2'-α-Azido-2'-deoxy-Uridine Minouridine TP;2'-Deoxy-2'-α-azidouridine TP;2-Methylpseudouridine;3(3-amino-3-carboxypropyl)uracil;4(thio)pseudouracil;4-(thio)pseudouracil;4-(thio)uracil;4-Thiouracil;5-Aminouracil;5(1,3-Diazol-1-alkyl)uracil;5(2-aminopropyl)uracil;5(Aminoalkyl)uracil;5(Dimethylaminoalkyl)uracil;5(Guanidiniumalkyl)uracil;5(Methoxycarbonylmethyl)-2-(thio)uracil;5-(Methoxycarbonyl-methyl)uracil;5-(Methyl)2(thio)uracil;5-(Methyl)2,4(dithio)uracil;5-(Methyl)4(thio)uracil;5-(Methylaminomethyl)-2(thio)uracil;5-(Methylaminomethyl)-2,4(dithio)uracil;5-(Methylaminomethyl)-4(thio)uracil;5-(Propynyl)uracil;5-(Trifluoromethyl)uracil;5-(2-Aminopropyl)uracil;5-(Alkyl)-2-(thio)pseudouracil;5-(Alkyl)-2,4(dithio)pseudouracil;5-(Alkyl)-2,4(dithio)pseudouracil 5-(Alkyl)-4(thio)pseudouracil;5-(Alkyl)pseudouracil;5-(Alkyl)uracil;5-(Alkenyl)uracil;5-(Alkynyl)uracil;5-(Allylamino)uracil;5-(Cyanoalkyl)uracil;5-(Dialkylaminoalkyl)uracil;5-(Dimethylaminoalkyl)uracil;5-(Guanidiniumalkyl)uracil;5-(Halo)uracil;5-(1,3-Diazol-1-alkyl)uracil;5-(Methoxy)uracil;5-(Methoxycarbonylmethyl)-2-(thio)uracil;5-(Methoxy 5-(methylaminomethyl)-2(thio)uracil;5-(methyl)2,4(dithio)uracil;5-(methyl)4(thio)uracil;5-(methyl)-2-(thio)pseudouracil;5-(methyl)-2,4(dithio)pseudouracil;5-(methyl)-4(thio)pseudouracil;5-(methyl)pseudouracil;5-(methylaminomethyl)-2(thio)uracil;5-(methylaminomethyl)-2,4(dithio)uracil;5-(methylaminomethyl)-4-(thio)uracil;5-(propynyl)uracil;5 -(Trifluoromethyl)uracil;5-aminoallyl-uridine;5-bromo-uridine;5-iodo-uridine;5-uracil;6(azo)uracil;6-(azo)uracil;6-aza-uridine;allylamino-uracil;azauracil;deazauracil;5-methyluracil;5-(hydroxymethyl)uracil;5-chlorouracil;5-fluorouracil;5-bromouracil;N3(methyl)uracil;Pseudo-UTP-1-2-ethanoic acid;Pseudouracil;4-thio-pseudo-UTP;1-carboxymethyl-pseudouridine;1-Methyl-1-deaza-pseudouridine;1-Propynyl-uridine;1-Taurinomethyl-1-methyl-uridine;1-Taurinomethyl-4-thio-uridine;1-Taurinomethyl-pseudouridine;2-Methoxy-4-thio-pseudouridine;2-Thio-1-methyl-1-deaza-pseudouridine;2-Thio-1-methyl-pseudouridine;2-Thio-5-aza-uridine;2-Thio-dihydropseudouridine;2-Thio-dihydrouridine;2-Thio-pseudouridine;4-Methoxy-2-thio-pseudouridine;4-Methoxy Pseudouridine;4-Thio-1-methyl-pseudouridine;4-Thio-pseudouridine;5-Aza-uridine;Dihydropseudouridine;(±)1-(2-Hydroxypropyl)pseudouridine TP;(2R)-1-(2-Hydroxypropyl)pseudouridine TP;(2S)-1-(2-Hydroxypropyl)pseudouridine TP;(E)-5-(2-Bromo-vinyl)ara-uridine TP;(E)-5-(2-Bromo-vinyl)ara-uridine TP;(Z)-5-(2-Bromo-vinyl)ara-uridine TP;(Z)-5-(2-Bromo 1-(2,2,2-trifluoroethyl)pseudo-UTP;1-(2,2,3,3,3-pentafluoropropyl)pseudouridine TP;1-(2,2-diethoxyethyl)pseudouridine TP;1-(2,4,6-trimethylbenzyl)pseudouridine TP;1-(2,4,6-trimethylbenzyl)pseudo-UTP;1-(2,4,6-trimethylphenyl)pseudo-UTP;1-(2-amino-2-carboxyethyl)pseudo-UTP;1-(2-aminoethyl)pseudo-UTP;1-(2 -hydroxyethyl)pseudouridine TP; 1-(2-methoxyethyl)pseudouridine TP; 1-(3,4-bis-trifluoromethoxybenzyl)pseudouridine TP; 1-(3,4-dimethoxybenzyl)pseudouridine TP; 1-(3-amino-3-carboxypropyl)pseudouridine TP; 1-(3-amino-propyl)pseudouridine TP; 1-(3-cyclopropyl-prop-2-ynyl)pseudouridine TP; 1-(4-amino-4-carboxybutyl)pseudouridine TP; 1-(4-amino-benzyl)pseudouridine TP;1-(4-amino-butyl)pseudo-UTP; 11(4-amino-phenyl)pseudo-UTP; 1-(4-azidobenzyl)pseudouridine TP; 1-(4-bromobenzyl)pseudouridine TP; 1-(4-chlorobenzyl)pseudouridine TP; 1-(4-fluorobenzyl)pseudouridine TP; 1-(4-iodobenzyl)pseudouridine TP; 1-(4-METHYLBENZYL)PSEUDO-UTP;1-(4-METHOXYBENZYL)PSEUDO-UTP;1-(4-METHOXYBENZYL)PSEUDO-UTP;1-(4-METHOXYBENZYL)PSEUDO-UTP;1-(4-METHOXYBENZYL)PSEUDO-UTP;1-(4-METHYLBENZYL)PSEUDO-UTP;1-(4-METHYLBENZYL)PSEUDO-UTP;1-(4-NITROBENZYL)PSEUDO-UTP;1-(4-NITROBENZYL)PSEUDO-UTP;1-(4-THIOMETHOXYBENZYL)PSEUDO-UTP 1-(4-trifluoromethoxybenzyl)pseudouridine TP;1-(4-trifluoromethylbenzyl)pseudouridine TP;1-(5-aminopentyl)pseudo-UTP;1-(6-aminohexyl)pseudo-UTP;1,6-dimethyl-pseudo-UTP;1-[3-(2-{2-[2-(2-aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudouridine TP;1-{3-[2-(2-aminoethoxy)-ethoxy]-propionyl}pseudouridine TP;1 -Acetylpseudouridine TP; 1-Alkyl-6-(1-propynyl)-pseudo-UTP; 1-Alkyl-6-(2-propynyl)-pseudo-UTP; 1-Alkyl-6-allyl-pseudo-UTP; 1-Alkyl-6-ethynyl-pseudo-UTP; 1-Alkyl-6-homoallyl-pseudo-UTP; 1-Alkyl-6-vinyl-pseudo-UTP; 1-Allylpseudouridine TP; 1-Aminomethyl-pseudo-UTP; 1-Benzylpseudouridine TP; 1-Benzyloxymethylpseudouridine TP; 1-Benzyl- pseudo-UTP;1-biotinyl-PEG2-pseudouridine TP;1-biotinylpseudouridine TP;1-butyl-pseudo-UTP;1-cyanomethylpseudouridine TP;1-cyclobutylmethyl-pseudo-UTP;1-cyclobutyl-pseudo-UTP;1-cycloheptylmethyl-pseudo-UTP;1-cycloheptyl-pseudo-UTP;1-cyclohexylmethyl-pseudo-UTP;1-cyclohexyl-pseudo-UTP;1-cyclooctylmethyl-pseudo-UTP;1-cyclooctyl-pseudo-UTP;1-Cyclopentylmethyl-pseudo-UTP;1-Cyclopentyl-pseudo-UTP;1-Cyclopropylmethyl-pseudo-UTP;1-Cyclopropyl-pseudo-UTP;1-Ethyl-pseudo-UTP;1-Hexyl-pseudo-UTP;1-Homoallylpseudouridine TP;1-Hydroxymethylpseudouridine TP;1-Isopropyl-pseudo-UTP;1-me-2-thio-pseudo-UTP;1-me-4-thio-pseudo-UTP;1-me-alpha-thio-pseudo-UTP;1-Methanesulfonylmethylpseudo Uridine TP; 1-Methoxymethylpseudouridine TP; 1-Methyl-6-(2,2,2-trifluoroethyl)pseudo-UTP; 1-Methyl-6-(4-morpholino)-pseudo-UTP; 1-Methyl-6-(4-thiomorpholino)-pseudo-UTP; 1-Methyl-6-(substituted phenyl)pseudo-UTP; 1-Methyl-6-amino-pseudo-UTP; 1-Methyl-6-azido-pseudo-UTP; 1-Methyl-6-bromo-pseudo-UTP; 1-Methyl-6-butyl-pseudo-UTP; 1-Methyl-6-chloro-pseudo-UTP; 1- Methyl-6-cyano-pseudo-UTP;1-methyl-6-dimethylamino-pseudo-UTP;1-methyl-6-ethoxy-pseudo-UTP;1-methyl-6-ethylcarboxylate-pseudo-UTP;1-methyl-6-ethyl-pseudo-UTP;1-methyl-6-fluoro-pseudo-UTP;1-methyl-6-formyl-pseudo-UTP;1-methyl-6-hydroxyamino-pseudo-UTP;1-methyl-6-hydroxy-pseudo-UTP;1-methyl-6-iodo-pseudo-UTP;1-methyl-6-isopropyl-pseudo-UTP pseudo-UTP;1-methyl-6-methoxy-pseudo-UTP;1-methyl-6-methylamino-pseudo-UTP;1-methyl-6-phenyl-pseudo-UTP;1-methyl-6-propyl-pseudo-UTP;1-methyl-6-tert-butyl-pseudo-UTP;1-methyl-6-trifluoromethoxy-pseudo-UTP;1-methyl-6-trifluoromethyl-pseudo-UTP;1-morpholinomethylpseudouridine TP;1-pentyl-pseudo-UTP;1-phenyl-pseudo-UTP;1-pivaloylpseudouridine TP;1-Propargylpseudouridine TP;1-Propyl-pseudouridine TP;1-Propynyl-pseudouridine;1-p-Tolyl-pseudouridine TP;1-tert-Butyl-pseudouridine TP;1-Thiomethoxymethylpseudouridine TP;1-Thiomorpholinomethylpseudouridine TP;1-Trifluoroacetylpseudouridine TP;1-Trifluoromethyl-pseudouridine TP;1-Vinylpseudouridine TP;2,2'-Anhydro-uridine TP;2'-Bromo-deoxyuridine TP;2'-F-5-methyl-2'-deoxy -UTP;2'-OMe-5-me-UTP;2'-OMe-pseudo-UTP;2'-a-ethynyluridine TP;2'-a-trifluoromethyluridine TP;2'-b-ethynyluridine TP;2'-b-trifluoromethyluridine TP;2'-deoxy-2',2'-difluorouridine TP;2'-deoxy-2'-a-mercaptouridine TP;2'-deoxy-2'-a-thiomethoxyuridine TP;2'-deoxy-2'-b-aminouridine TP;2'-deoxy-2'-b-azidouridine TP;2'-deoxy-2'-b-bu Bromouridine TP; 2'-Deoxy-2'-b-chlorouridine TP; 2'-Deoxy-2'-b-fluorouridine TP; 2'-Deoxy-2'-b-iodouridine TP; 2'-Deoxy-2'-b-mercaptouridine TP; 2'-Deoxy-2'-b-thiomethoxyuridine TP; 2-Methoxy-4-thiouridine; 2-Methoxyuridine; 2'-O-Methyl-5-(1-propynyl)uridine TP; 3-Alkyl-pseudo-UTP; 4'-Azidouridine TP; 4'-Carbocyclic uridine TP; 4'-Ethynyluridine TP; 5-(1-propynyl)uridine TP 5-(2-furanyl)uridine TP; 5-cyanouridine TP; 5-dimethylaminouridine TP; 5'-homouridine TP; 5-iodo-2'-fluoro-deoxyuridine TP; 5-phenylethynyluridine TP; 5-trideuteromethyl-6-deuterouridine TP; 5-trifluoromethyl-uridine TP; 5-vinylaruridine TP; 6-(2,2,2-trifluoroethyl)-pseudo-UTP; 6-(4-morpholino)-pseudo-UTP; 6-(4-thiomorpholino)-pseudo-UTP;6-(Substituted-phenyl)-pseudo-UTP;6-Amino-pseudo-UTP;6-Azido-pseudo-UTP;6-Bromo-pseudo-UTP;6-Butyl-pseudo-UTP;6-Chloro-pseudo-UTP;6-Cyano-pseudo-UTP;6-Dimethylamino-pseudo-UTP;6-Ethoxy-pseudo-UTP;6-Ethylcarboxylate-pseudo-UTP;6-Ethyl-pseudo-UTP;6-Fluoro-pseudo-UTP;6-Formyl-pseudo-UTP;6-Hydroxyamino-pseudo-UTP;6-Hydroxy-pseudo-UTP;6-Iodo-pseudo-UTP -UTP;6-Isopropyl-pseudo-UTP;6-Methoxy-pseudo-UTP;6-Methylamino-pseudo-UTP;6-Methyl-pseudo-UTP;6-Phenyl-pseudo-UTP;6-Phenyl-pseudo-UTP;6-Propyl-pseudo-UTP;6-tert-Butyl-pseudo-UTP;6-Trifluoromethoxy-pseudo-UTP;6-Trifluoromethyl-pseudo-UTP;Alpha-Thio-pseudo-UTP;Pseudouridine 1-(4-methylbenzenesulfonic acid) TP;Pseudouridine 1-(4-methylbenzoic acid) TP;Pseudouridine TP 1-[3-(2-ethoxy)]propionic acid;Pseudouridine TP 1-[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}]propionic acid;Pseudouridine TP 1-[3-{2-(2-[2-{2(2-ethoxy)-ethoxy}-ethoxy]-ethoxy)-ethoxy}]propionic acid;Pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid;Pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid;Pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid;Pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid;Pseudouridine TP 1-methylphosphonic acid 1-Methylphosphonic acid diethyl ester; pseudo-UTP-N1-3-propionic acid; pseudo-UTP-N1-4-butanoic acid; pseudo-UTP-N1-5-pentanoic acid; pseudo-UTP-N1-6-hexanoic acid; pseudo-UTP-N1-7-heptanoic acid; pseudo-UTP-N1-methyl-p-benzoic acid; pseudo-UTP-N1-p-benzoic acid; yW (wybutosine); OHyW (hydroxywybutosine);imG2 (isowiotsine); o2yW (peroxywibutosine); OHyW; *(Unmodified hydroxywybutosin); imG-14 (4-demethylwybutosin); 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 1,3,5-(triaza)-2,6-(dioxa-naphthalene; 2(amino)purine; 2,4,5-(trimethyl)phenyl; 2'methyl, 2'amino, 2'azido, 2'fluoro-cytidine; 2'methyl, 2 'Amino, 2'azido, 2'fluoro-adenine; 2'methyl, 2'amino, 2'azido, 2'fluoro-uridine; 2'-amino-2'-deoxyribose; 2-amino-6-chloro-purine; 2-aza-inosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidin-3-yl; 2-pyridinone; 3-nitropyrrole; 3-(methyl)-7-(propynyl)isocyanide Isocarbostyrilyl;3-(Methyl)isocarbostyrilyl;4-(Fluoro)-6-(methyl)benzimidazole;4-(Methyl)benzimidazole;4-(Methyl)indolyl;4,6-(Dimethyl)indolyl;5-Nitroindole;5-Substituted pyrimidines;5-(Methyl)isocarbostyrilyl;5-Nitroindole;6-(Aza)pyrimidine;6-(Azo)thymine;6-(Methyl)-7-(aza)indolyl;6-Chloro-purine;6-Phenyl-pyrrolo-pyrimidin-2-one-3-yl;7-(Aminoalkylhydroxy )-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl;7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl;7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;7-(aza)indolyl;7-(Guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(Guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(Guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza); )-phenoxazin-1-yl;7-(Guanidinium alkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;7-(Guanidinium alkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl;7-(Guanidinium alkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;7-(Guanidinium alkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;7-(Propynyl)isocarbostyrilyl;7-(Propynyl)isocarbostyrilyl;Propynyl-7-(aza)indolyl;7-Deaza-inosinyl;7-Substituted 1-(aza) 7-Substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;9-(Methyl)-imidizopyridinyl;Aminoindolyl;Anthracenyl;Bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl;Bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl;Difluorotolyl;Hypoxanthine;Imidizopyridinyl;Inosinyl;Isocarbostyrilyl;Isoguanisine;N2-Substituted purines;N6- Methyl-2-amino-purine;N6-substituted purines;N-Alkylated derivatives;Naphthalenyl;Nitrobenzimidazolyl;Nitroimidazolyl;Nitroindazolyl;Nitropyrazolyl;Nubularine;O6-substituted purines;O-Alkylated derivatives;ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl;ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl;Oxoformycin TP;para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl;para-substituted Substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl; Pentacenyl; Phenanthracenyl; Phenyl; Propynyl-7-(aza)indolyl; Pyrenyl; Pyridopyrimidin-3-yl; Pyridopyrimidin-3-yl; 2-Oxo-7-amino-pyridopyrimidin-3-yl; Pyrrolo-pyrimidin-2-one-3-yl; Pyrrolopyrimidinyl; Pyrrolopyridinyl; Stilbenzyl; Substituted 1,2,4-triazoles; Tetracenyl; Tubercidin; Xanthine; Xanthosine-5'-TP; 2-Thio-zebularine; 5-Aza-2-thio-zebularine;Modified nucleobases include, but are not limited to, 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-amino-riboside-TP; formycin A TP; formycin B TP; pyrrolosine TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; N6-(19-amino-pentaoxanonadecyl)adenosine TP; hydrogen (non-basic residue); and 2'-O-methyl-U. In some embodiments, the RNA molecule contains a combination of at least two (e.g., two, three, four, or more) of the above-mentioned modified nucleobases. In some embodiments, one, two, three, four, five, or more of the above modifications can be excluded from the RNA molecules disclosed herein.

[0166] In some embodiments, the modified nucleobase in the RNA molecule is pseudouridine (ψ), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl 1-Cytidine (m5C), α-thio-guanosine, α-thio-adenosine, 5-cyanouridine, 4'-thiouridine, 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2,6-diaminopurine, inosine (I), 1-methyl-inosine (m1I), wiosine (imG), methylwiosine (mimG), 7-deaza-guanosine uridine, 7-cyano-7-deaza-guanosine (preQO), 7-aminomethyl-7-deaza-guanosine (preQl), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3-amino-3-carboxypropyl)-5,6-Dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3-methylpseudouridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethyl-2-geranylthiouridine , 7-aminocarboxypropyl-demethylwiosin, 7-aminocarboxypropylwiosin, 7-aminocarboxypropylwiosin methyl ester, 8-methyladenosine, N4,N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6-threonylcarbamoyladenosine, glutamyl-queusin, methylated unmodified hydroxywiosin, N4,N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Qbase, preQObase, preQlbase, and combinations of two or more thereof. In some embodiments, the RNA molecule comprises a combination of at least two (e.g., two, three, four, or more) of the above-mentioned modified nucleic acid bases, including but not limited to chemical modifications. In some embodiments, one, two, three, four, five, or more of the above modified nucleobases may be excluded from the RNA molecules disclosed herein.

[0167] Exemplary nucleobases and nucleosides having modified cytosines are 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-his(2-methyl-2-cytidine), 5-amino-2-cytidine (5-amino ... Hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine cytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), a-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-di Modified cytosines include methyl-cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, and 2'-OH-ara-cytidine. In some embodiments, one, two, three, four, five, or more of the above modified cytosines can be excluded from the RNA molecules disclosed herein.

[0168] In some embodiments, the modified nucleobase is a modified uridine. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 5-cyanoruridine, 3-amino-uridine, 5-isopropyl ... 1-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mc m5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnmVU), 5-propynyl-uridine, 1-propynyl-pseudouridine uridine, 5-taurinomethyl-uridine (xm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine (xmVu), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, e.g., with the nucleobase deoxythymine), 1-methyl-pseudouridine (m1Ψ), 1-ethyl-pseudouridine (e1ψ), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4Ψ), 4-thio-1-methyl-pseudouridine,3-methyl-pseudouridine (m3Ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3 ψ), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (Ψm), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl- Modified uridines include uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thiouridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uracil, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, and 5-[3-(lE-propenylamino)]uridine. In some embodiments, one, two, three, four, five, or more of these modified uridines may be excluded from the RNA molecules disclosed herein.

[0169] In some embodiments of the present disclosure, the modified nucleotide comprises any one of N1-methylpseudouridine and / or pseudouridine.

[0170] In some embodiments, the RNA molecule comprises N1-methylpseudouridine modified nucleotides. In some embodiments, the RNA molecule comprises pseudouridine modified nucleotides.

[0171] In some embodiments, the RNA contains a modified nucleoside in place of at least one uridine. In some embodiments, the RNA contains a modified nucleoside in place of each uridine. In some embodiments, the RNA molecule contains a sequence in which at least one uridine is replaced with N1-methylpseudouridine. In some embodiments, the RNA molecule contains a sequence in which all uridines are replaced with N1-methylpseudouridine. N1-methylpseudouridine is referred to as "Ψ" in the sequence. The term "uracil" as used herein describes one of the nucleobases that can be present in RNA nucleic acids. The term "uridine" as used herein describes one of the nucleosides that can be present in RNA. "Pseudouridine" is an example of a modified nucleoside that is an isomer of uridine, in which uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0172] In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by N1-methylpseudouridine and / or pseudouridine. In some embodiments, the RNA molecules are at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122 5%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% at most 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 8 4%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71% ,72%,73%,74%,75%,76%,77%,78%,79%,80%,81%,82%,83%,84%,85%,86%,87%,88%,89%,90%,91%,92%,93%,94%,95%,96%,97%,98%,or 99%,exactly 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77% , 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% , 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (inclusive or exclusive) of the uridines are replaced by N1-methylpseudouridine and / or pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which all uridines are replaced by N1-methylpseudouridine and / or pseudouridine.

[0173] In some embodiments, the modified nucleobase is a modified adenine.Exemplary nucleobases and nucleosides having modified adenines are 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine , 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio- Includes adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine.In some embodiments, 1, 2, 3, 4, 5, or more of the above modified adenines may be excluded from the RNA molecules disclosed herein.

[0174] In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wiosine (imG), methylwiosine (mimG), 4-demethyl-wiosine (imG-14), isowyosine (imG2), wibutosine (yW), peroxywibutosine (o2yW), hydroxywibutosine (OhyW), unmodified hydroxywibutosine (OhyW). *), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQo), 7-aminomethyl-7-deaza-guanosine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazaguanosine Inosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2'7G), N2,N2,7-dimethyl-guanosine N-methyl-2'-O-methyl-guanosine (m2'2'7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m 2'-O-methyl-guanosine (m2'7Gm), 1-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine (m2'7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 2'-O-ribosylguanosine(phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ara-guanosine, and 2'-F-guanosine. In some embodiments, one, two, three, four, five, or more of the above modified guanosines may be excluded from the RNA molecules disclosed herein.

[0175] In some embodiments, the RNA molecule is uniformly modified (e.g., completely modified, modified throughout the entire sequence) for a particular modification. In some embodiments, the RNA molecule may be partially or completely (e.g., uniformly) modified along the entire length of the molecule. For example, one or more or all of the nucleotides or a given type (e.g., purines and / or pyrimidines, or one or more or all of A, G, U, C) may be uniformly modified in the polynucleotide of the present disclosure or in a given predetermined sequence region thereof. In some embodiments, all nucleotides X in the polynucleotide of the present disclosure (or in a given sequence region thereof) are modified nucleotides, and X can be any one of the nucleotides A, G, U, C, and / or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, and / or A+G+C. For example, a polynucleotide can be uniformly modified with pseudouridine, meaning that all uridine residues in the RNA sequence are replaced with pseudouridine. Similarly, a polynucleotide can be uniformly modified with any type of nucleoside residue present in the sequence by replacing it with a modified residue, such as those described above. The modified nucleotides can be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0176] The RNA molecule may be 1% to 100% or about 1% to 100% (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 5 2, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 7, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,99, or 100%, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or any intervening percentage (inclusive or exclusive) between any two of these (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 10%-95%, 10%-100%, 20%-25%, 20%-50%, 20%-60%, 20%-70%, 20%-80%, 20%- The nucleic acid sequence may contain 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100% modified nucleotides, with any remaining percentage being understood to account for the presence of unmodified A, G, U, and / or C.

[0177] In some embodiments, the RNA molecule may include phosphoramidate, phosphorothioate, and / or methylphosphonate linkages.

[0178] In some embodiments, an RNA molecule may contain one or more structural and / or chemical modifications and / or alterations that confer useful properties to the polynucleotide, including, in some embodiments, reduced degradation in a cell or organism and / or a lack of substantial induction of an innate immune response in a cell into which the RNA molecule is introduced. As used herein, a "structural" feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, and / or randomized in an RNA molecule without significant chemical modification to the nucleotides themselves. Because chemical bonds are inevitably broken and reformed to affect the structural modification, the structural modification is chemical in nature and is therefore a chemical modification. However, the structural modification may result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" may be chemically modified to "AT-5meC-G." The same polynucleotide may be structurally modified from "ATCG" to "ATCCCG," where the dinucleotide "CC" is inserted, resulting in a structural modification to the polynucleotide.

[0179] In some embodiments, the modified RNA molecules introduced into cells or organisms exhibit reduced degradation in cells or organisms, respectively, compared to unmodified nucleic acids that contain standard nucleotides and nucleosides. In some embodiments, the modified RNA molecules introduced into cells or organisms may exhibit reduced immunogenicity (e.g., reduced natural response) in cells or organisms, respectively, compared to unmodified nucleic acids that contain standard nucleotides and nucleosides.

[0180] In some embodiments, the RNA molecule may contain one or more modified nucleotides in addition to any 5' cap structure. In some embodiments, the RNA molecule does not contain modified nucleotides, e.g., does not contain modified nucleic acid bases, and all of the nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G, and C, except for the optional 5' cap, which may contain, for example, 7-methylguanosine, as further described below. In some embodiments, the RNA may contain a 5' cap containing 7'-methylguanosine, and the first one, two, or three 5' ribonucleotides may be methylated at the 2' position of the ribose.

[0181] B.5'CAP In some embodiments, the RNA molecules described herein generally comprise a 5' cap, which "caps" the 5' end of the RNA and stabilizes the RNA molecule.

[0182] In some embodiments, the 5' cap moiety is a natural 5' cap. A "natural 5' cap" is defined as a cap comprising a 7-methylguanosine attached to the 5' end of an mRNA molecule through a 5'-5' triphosphate linkage. In some embodiments, the guanosine nucleoside contained in the 5' cap may be modified, for example, by methylation at one or more positions (e.g., position 7) on the base (guanine) and / or by methylation at one or more positions on the ribose. In some embodiments, the guanosine nucleoside contained in the 5' cap comprises a 3'O-methylation at the ribose (3'OMeG). In some embodiments, the guanosine nucleoside contained in the 5' cap comprises a methylation at position 7 of the guanine (m7G). In some embodiments, the guanosine nucleoside contained in the 5' cap comprises a methylation at position 7 of the guanine and a 3'O-methylation at the ribose (m7(3'OMeG)). The 5' cap may be incorporated during RNA synthesis (e.g., co-transcriptional capping) or may be enzymatically engineered after RNA transcription (e.g., post-transcriptional capping). In some embodiments, co-transcriptional capping with a cap disclosed herein improves the capping efficiency of the RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving capping efficiency may increase the translation efficiency and / or translation rate of the RNA and / or increase expression of the encoded polypeptide. In some embodiments, capping is performed after purification of the RNA molecule, e.g., after tangential flow filtration.

[0183] In some embodiments, the RNA described herein includes a 5' cap or a 5' cap analog, such as Cap0, Cap1, or Cap2. In some embodiments, the provided RNA does not have an uncapped 5'-triphosphate. In some embodiments, the 5' end of the RNA is capped with a modified ribonucleotide. In some embodiments, the 5' cap moiety is a 5' cap analog. In some embodiments, the RNA may be capped with a 5' cap analog. The cap structure may be 7 mG(5')ppp(5')N1pN2p(Cap 0), 7 mG(5')ppp(5')N1 m pNp(Cap1), and 7 mG(5')ppp(5')N1 m pN2 m p(cap2). In some embodiments, one, two, three, four, five, or more of the above cap structures may be omitted from the RNA molecules disclosed herein.

[0184] In some embodiments, the RNA described herein comprises Cap 0. In some embodiments, Cap 0 is N7-methylguanosine, and the Cap 0 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G). In some embodiments, the Cap 0 structure is connected to the RNA via a 5'-5'-triphosphate linkage, also referred to herein as m7G, m7Gppp, and / or m7G(5')ppp(5'). The 5' cap has the structure 7The cap may be methylated with mG(5')ppp(5')N1pN2p (Cap 0) or its derivatives, where N is the terminal 5' nucleotide of a nucleic acid bearing a 5' cap, typically the 5' end of an mRNA. An exemplary enzymatic reaction for capping may involve the use of vaccinia virus capping enzyme (VCE), which includes mRNA triphosphatase, guanylyltransferase, and guanine-7-methyltransferase, to catalyze the construction of the N7-monomethylated Cap 0 structure. The Cap 0 structure plays an important role in maintaining the stability and translation efficiency of RNA molecules. In cells, the Cap 0 structure is essential for efficient translation of capped mRNA.

[0185] In some embodiments, the RNA described herein includes a Cap 1, such as those described herein. The 5' cap of an RNA molecule may be further modified at the 2'O position by a 2'-O-methyltransferase, resulting in the generation of a Cap 1 structure (m7Gppp[m2'-O]N), which may further increase translation efficiency. In some embodiments, the Cap 1 structure includes a guanosine nucleoside methylated at the 7-position of guanine (m7G) and a 2'O-methylated first nucleotide in the RNA (2'OMeN1). In some embodiments, the Cap 1 structure is connected to the RNA via a 5'-5'-triphosphate linkage, referred to herein as m7GpppN m (where N m represents any nucleotide with 2'O methylation), 7 mG(5')ppp(5')N1 mAlso referred to as pNp, m7Gppp(2'OMeN1), and / or m7G(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7G(5')ppp(5')(2'OMeN1) Cap 1 structure comprises a second nucleotide, N2, which is the second cap-proximal nucleotide and is selected from A, G, C, or U (m7G(5')ppp(5')(2'OMeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0186] In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G), and one or more additional modifications, such as a methylation on the ribose, and a 2'O-methylated first nucleotide in the RNA. In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine, a 3'O-methylation on the ribose (m7(3'OMeG)), and a 2'O-methylated first nucleotide in the RNA (2'OMeN1). In some embodiments, the Cap 1 structure is connected to the RNA via a 5'-5'-triphosphate linkage, also referred to herein as m7(3'OMeG)ppp(2'OMeN1) and / or m7(3'OMeG)(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7(3'OMeG)(5')ppp(5')(2'OMeN1) Cap 1 structure includes a second nucleotide, N2, which is the second cap-proximal nucleotide and is selected from A, G, C, or U (m7(3'OMeG)(5')ppp(5')(2'OmeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, one, two, three, four, five, or more of the above Cap 1 structures can be excluded from the RNA molecules disclosed herein.

[0187] In some embodiments, the second nucleotide in the Cap 1 structure may comprise one or more modifications, e.g., methylation. In some embodiments, the RNAs described herein comprise Cap 2. In some embodiments, the Cap 1 structure comprising a second nucleotide comprising a 2'O methylation is a Cap 2 structure.

[0188] In some embodiments, RNA molecules may be enzymatically capped at the 5' end using vaccinia guanylyltransferase, guanosine triphosphate, and S-adenosyl-L-methionine to produce a Cap 0 structure. An inverted 7-methylguanosine cap is added via a 5'-5' triphosphate bridge. Alternatively, the use of 2'O-methyltransferase and vaccinia guanylyltransferase produces a Cap 1 structure, in which, in addition to the Cap 0 structure, the 2'OH group is methylated at the penultimate nucleotide. S-adenosyl-L-methionine (SAM) is a cofactor utilized as a methyl transfer reagent. Non-limiting examples of 5' cap structures are those that have, among other things, enhanced binding of cap-binding polypeptides, increased half-life, reduced susceptibility to 5'-endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures known in the art (or wild-type, natural, or physiological 5' cap structures).

[0189] For example, recombinant vaccinia virus capping enzyme and recombinant 2'O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of an mRNA and a guanine cap nucleotide, where the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is called a Cap 1 structure. This cap results in greater translational competence and cellular stability, and reduced activation of cellular pro-inflammatory cytokines, for example, compared to other 5'-cap analog structures known in the art.

[0190] The cap species may include one or more modified nucleosides and / or linker moieties. For example, the cap may include a guanine nucleotide and a guanine (G) nucleotide methylated at the 7-position joined by a triphosphate linkage at its 5'-position, such as m7G(5')ppp(5')G, commonly written as m7GpppG. The cap species may also be an anti-reverse cap analog. A non-limiting list of possible cap species includes m7GpppG, m7Gpppm7G, m73'dGpppG, m27,03'GpppG, m27,03'GppppG, m27,02'GppppG, m7Gpppm7G, m73'dGpppG, m27,03'GpppG, m27,03'GppppG, and m27,02'GppppG. In some embodiments, one, two, three, four, five, or more of the above cap species may be excluded from the RNA molecules disclosed herein.

[0191] In some embodiments, the 5'-end cap can include a cap analog, for example, the 5'-end cap can include a guanine analog. Exemplary guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. In some embodiments, one, two, three, four, five, or more of the above guanine analogs can be excluded from the cap structures disclosed herein.

[0192] In some embodiments, the capping region may comprise a single cap or a series of nucleotide-forming caps. In this embodiment, the capping region may be 1 to 10, e.g., 2 to 9, 3 to 8, 4 to 7, 1 to 5, 5 to 10, or at least 2 or 10 or fewer nucleotides in length. In this embodiment, the capping region is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or between any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 (inclusive or exclusive) nucleotides in length. In some embodiments, no cap is present. In some embodiments, the first and second operable regions may range in length from 3 to 40, e.g., 5 to 30, 10 to 20, 15, or at least 4, or 30, or fewer nucleotides, and may include one or more signal and / or restriction sequences in addition to a start and / or stop codon.In some embodiments, the first and second operable regions are at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, or more. Large: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, exactly 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, or between any two of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 (inclusive or exclusive), and may include one or more signal and / or restriction sequences in addition to a start codon and / or a stop codon.

[0193] Further examples of 5' cap structures include glyceryl, inverted deoxy abasic residues (moieties), 4',5' methylene nucleotides, 1-(beta-D-erythrofuranosyl) nucleotides, 4'-thionucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol nucleotides, L-nucleotides, alpha-nucleotides, modified base nucleotides, threo-pentofuranosyl nucleotides, acyclic 3',4'-seconucleotides, acyclic 3,4-dihydroxybutyl nucleotides. , acyclic 3,5 dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, and / or bridged or non-bridged methylphosphonate moiety. In some embodiments, one, two, three, four, five, or more of the above 5' cap structures may be excluded from the RNA molecules disclosed herein.

[0194] In some embodiments, the RNA molecules of the present disclosure comprise at least one 5' cap structure. In some embodiments, the RNA molecules of the present disclosure do not comprise a 5' cap structure.

[0195] Numerous synthetic 5' cap analogs have been developed and are known in the art to enhance mRNA stability and translatability (see, e.g., Grudzien-Nogalska, E., Kowalska, J., Su, W., Kuhn, AN, Slepenkov, SV, Darynkiewicz, E., Sahin, U., Jemielity, J., and Rhoads, RE, Synthetic mRNAs with superior translation and stability properties in Synthetic Messenger RNA and Cell Metabolism Modulation in Methods in Molecular Biology 69 (ed. Rabinovich, PH), 2013). In one embodiment, the 5' capping structure is a modified 5' cap 1 structure (m 7 G + In one embodiment, the 5' capping structure comprises (3'OMe)-m2 7, 3' -O Gppp(m1 2’-O ) ApG (TRiLink BioTechnologies). This molecule is identical to the natural RNA cap structure in that it begins with a guanosine methylated at N7, linked to the first encoded nucleotide of the transcribed RNA (in this case, adenosine) by a 5'-5' triphosphate linkage. This guanosine is also methylated at the 3' hydroxyl of the ribose to mitigate possible back-incorporation of the cap molecule. The 2' hydroxyl of the ribose at the adenosine is methylated, conferring the Cap 1 structure.

[0196] C. Untranslated region (UTR) A 5'UTR is a regulatory region located at the 5' end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence, and / or the corresponding region in an RNA polynucleotide, e.g., an mRNA molecule. Untranslated regions (UTRs) may be present 5' (upstream) of an open reading frame (5'UTR) and / or 3' (downstream) of an open reading frame (3'UTR).

[0197] In some embodiments, UTRs are derived from mRNAs that are naturally abundant in the specific tissues (e.g., lymphoid tissues) where mRNA expression is targeted. In some embodiments, UTRs increase protein synthesis. Without being bound by mechanism or theory, UTRs may increase protein synthesis by increasing the time that mRNA remains in translation polysomes (message stability) and / or the rate at which ribosomes begin translation on messages (message translation efficiency). Thus, UTR sequences may prolong protein synthesis in a tissue-specific manner.

[0198] In some embodiments, UTR regulatory features can be incorporated into the RNA of the present disclosure to enhance the stability of the molecule among other things.Specific features can also be incorporated to ensure the controlled down-regulation of transcripts when they are misdirected to undesirable organ sites.A variety of 5'UTR and 3'UTR sequences are known and available in the art.

[0199] It should be understood that any UTR from any gene may be incorporated into the region of the RNA of the present disclosure. Furthermore, multiple wild-type UTRs from any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs that are not variants of the wild-type region. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected, or their orientation and / or location may be changed. Thus, the 5' and / or 3' UTRs may be inverted, shortened, lengthened, and / or made with one or more other 5' or 3' UTRs. As used herein, the term "altered," when referring to a UTR sequence, means that the UTR has been altered in some way relative to the reference sequence. For example, the 5' and / or 3' UTR may be altered compared to the wild-type or native UTR by changing the orientation and / or location as taught above, and / or by including additional nucleotides, deleting nucleotides, swapping, and / or rearranging nucleotides. Any of these changes will generate an "altered" UTR (whether 5' and / or 3'), including a variant UTR.

[0200] In some embodiments, double, triple or quadruple UTRs may be used, such as 5' and / or 3'UTRs. As used herein, a "double" UTR refers to two copies of the same UTR encoded in tandem or substantially tandem. For example, a double beta-globin 3'UTR may be used. It is also within the scope of the present disclosure to have a patterned UTR. As used herein, a "patterned UTR" refers to a UTR that reflects a repeating or alternating pattern, such as AB AB AB or AABBABBAABB or ABCABCABC, or its variants that are repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a UTR that differs at the nucleotide level.

[0201] RNA may encode the polypeptide of interest that belongs to the protein family that is expressed in specific cell, tissue, and / or at a certain time during development.In some embodiments, the UTR from any of these genes can be swapped with any other UTR from the same or different protein family to create new RNA molecule.As used herein, " protein family " is used in the broadest sense to refer to a group of two or more polypeptides of interest that share at least one function, structure, feature, localization, origin and / or expression pattern.

[0202] In some embodiments, the 5'UTR and 3'UTR sequences are derived by computer. In some embodiments, the 5'UTR and 3'UTR are derived from mRNA that is naturally abundant in tissue. The tissue may be, for example, liver, stem cell and / or lymphoid tissue. The lymphoid tissue may include, for example, any one of lymphocytes (e.g., B lymphocytes, helper T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, and / or natural killer cells), macrophages, monocytes, dendritic cells, neutrophils, eosinophils and reticulocytes. In some embodiments, the 5'UTR and 3'UTR are derived from an alphavirus. In some embodiments, the 5'UTR and 3'UTR are from a wild-type alphavirus.

[0203] In some embodiments, the untranslated region may also include a translational enhancer element (TEE). By way of non-limiting example, the TEE may include those described in U.S. Application No. 20090226470, which is incorporated herein by reference in its entirety, and those known in the art.

[0204] i.5'UTR In some embodiments, the RNA disclosed herein comprises a 5'UTR. If present, the 5'UTR is located at the 5' end and starts with the transcription start site upstream of the start codon of the protein coding region. The 5'UTR is downstream of the 5'cap (if present), for example, directly adjacent to the 5'cap. The 5'UTR may contain various regulatory elements, such as a 5'cap structure, a stem-loop structure, and an internal ribosome entry site (IRES), which may play a role in regulating translation initiation. The 5'UTR may also have a signature such as a Kozak sequence, which is also involved in the process by which ribosomes initiate the translation of many genes. The 5'UTR may also form a secondary structure involved in elongation factor binding.

[0205] In some embodiments, the 5'UTR disclosed herein comprises a cap-proximal sequence, e.g., as disclosed herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap. In some embodiments, the cap-proximal sequence comprises nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0206] In some embodiments, the cap structure comprises one or more polynucleotides of a cap-proximal sequence. In some embodiments, the cap structure comprises an m7 guanosine cap and nucleotide +1 (N1) of an RNA polynucleotide. In some embodiments, the cap structure comprises an m7 guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, the cap structure comprises an m7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of an RNA polynucleotide.

[0207] Those of skill in the art reading this disclosure will understand that in some embodiments, one or more residues of the cap-proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by virtue of being included in the cap entity (e.g., the cap 1 structure, etc.); alternatively, in some embodiments, at least some of the residues in the cap-proximal sequence may be enzymatically added (e.g., by a polymerase, e.g., T7 polymerase). For example, (m2 7,3’-O )Gppp(m 2’-O In certain exemplary embodiments in which an ApG cap is utilized, the +1 and +2 residues are (m2 7,3’-O ) A and G residues, and the +3, +4, and +5 residues are added by a polymerase (e.g., T7 polymerase).

[0208] In some embodiments, the cap-proximal sequence comprises cap structures N1 and / or N2, where N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, the cap-proximal sequence comprises cap structures N1 and N2, and N3, N4, and N5, where N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, e.g., A, C, G, or U. In some embodiments, N1N2 comprises any one of the following: AA, AC, AG, AU, CA, CC, CG, CU, GA, GC, GG, GU, UA, UC, UG, or UU. In some embodiments, N1N2 comprises AG and N3N4N5 comprises any one of the following: AAA, ACA, AGA, AUA, AAG, AGG, ACG, AUG, AAC, ACC, AGC, AUC, AAU, ACU, AGU, AUU, CAA, CCA, CGA, CUA, CAG, CGG, CCG, CUG, CAC, CCC, CGC, CUC, CAU, CCU, CGU, CUU, GAA, GCA, GGA, GUA, GAG, GGG, GCG, GUG, GAC, GCC, GGC, GUC, GAU, GCU, GGU, GUU, UAA, UCA, UGA, UUA, UAG, UGG, UCG, UUG, UAC, UCC, UGC, UUC, UAU, UCU, UGU, or UUU.

[0209] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3A4X5 (SEQ ID NO: 46; where X5 is A, G, C, or U), where N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0210] In some embodiments, the cap-proximal sequence comprises cap structure N1 and N2, and a sequence comprising C3A4X5 (SEQ ID NO:47; where X5 is A, G, C, or U), where N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0211] In some embodiments, the cap-proximal sequence comprises a sequence comprising the cap structure N1 and N2, and X3Y4X5 (SEQ ID NO:48; wherein X3 or X5 are each independently selected from A, G, C, or U; and Y4 is not C). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are each independently selected from A, C, G, or U. In some embodiments, X3 and / or X5 are A. In some embodiments, X3 and / or X5 are C. In some embodiments, X3 and / or X5 are G. In some embodiments, X3 and / or X5 are U. In some embodiments, Y4 is C. In other embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In other embodiments, Y4 is not G. In some embodiments, Y4 is U.

[0212] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3C4A5 (SEQ ID NO: 49). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0213] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3U4G5 (SEQ ID NO: 50). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0214] In some embodiments, one, two, three, four, five, or more of the above cap-proximal sequences may be excluded from the 5'UTR of an RNA molecule disclosed herein.

[0215] In some embodiments of the present disclosure, 5'UTR is heterologous UTR, for example, the naturally occurring UTR associated with different ORF.In another embodiment, 5'UTR is synthetic UTR, for example, not naturally occurring.Synthetic UTR comprises mutated or synthetic UTR to improve its properties, for example, to increase gene expression.In some embodiments, 5'UTR is functionally linked to ORF, for example, associated with ORF, so that it can exhibit functions such as increasing, enhancing, stabilizing, and / or extending protein production from RNA molecule, and / or increasing protein expression and / or total protein production from RNA molecule, compared with reference 5'UTR or reference RNA molecule that lacks 5'UTR.In some embodiments, 1, 2, 3, 4, 5, or more of the above 5'UTR functions can be excluded.

[0216] Exemplary 5'UTRs include those derived from Xenopus or human alpha globin or beta globin, human cytochrome b-245a, hydroxysteroid (17b) dehydrogenase, tobacco etch virus, CMV immediate early 1 (IE1) gene, TEV, HSP705', c-Jun, or a homolog, fragment, or variant of any of the foregoing. In some embodiments, the 5'UTR is a fragment, homolog, or variant of the 5'UTR of a TOP gene lacking the 5'TOP motif (oligopyrimidine tract), the 5'UTR from the ribosomal protein large 32 (L32) gene, the 5'UTR from the 5'UTR of the hydroxysteroid (17p) dehydrogenase 4 gene (HSD17B4), or the 5'UTR from the 5'UTR of ATP5A1. In some embodiments, the 5'UTR is derived from SEQ ID NOs: 1-1363, 1395, 1421, and 1422 of International Patent Application Publication No. WO 2013 / 143700, the disclosure of which is incorporated herein by reference in its entirety, or a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive). The sequence GGGAUCCUACC may also be used. In some embodiments, one, two, three, four, five, or more of the above 5'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0217] In some embodiments, the 5'UTR is selected from the group consisting of RPSA, RPS2, RPS3, RPS3A, RPS4, RPS5, RPS6, RPS7, RPS8, RPS9, RPS10, RPS11, RPS12, RPS13, RPS14, RPS15, RPS15A, RPS16, RPS17, RPS18, RPS19, RPS20, RPS21, RPS23, RPS24, RPS25, RPS26, RPS27, RPS27A, RPS28, RPS29, RPS30, RPL3, RPL4, RPL5, RPL6, RPL7, RPL7 A, RPL8, RPL9, RPL10, RPL10A, RPL11, RPL12, RPL13, RPL13A, RPL14, RPL15, RPL17, RPL18, RPL18A, RPL19, RPL21, RPL22, RPL23, RPL23A, RPL2 4, RPL26, RPL27, RPL27A, RPL28, RPL29, RPL30, RPL31, RPL32, RPL34, RPL35, RPL35A, RPL36, RPL36A, RPL37, RPL37A, RPL38, RPL39, RPL40, RP the 5'UTR region of a gene encoding L41, RPLPO, RPLP1, RPLP2, RPLP3, RPLPO, RPLP1, RPLP2, EEF1A1, EEF1B2, EEF1D, EEF1G, EEF2, EIF3E, EIF3F, EIF3H, EIF2S3, EIF3C, EIF3K, EIF3EIP, EIF4A2, PABPC1, HNRNPA1, TPT1, TUBB1, UBA52, NPM1, ATP5G2, GNB2L1, NME2, UQCRB, or a homolog, fragment, or variant thereof; Alternatively, the 5'UTR sequences may be derived from a gene sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) with any of the above gene sequences. In some embodiments, one, two, three, four, five, or more of the above 5'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0218] In one embodiment, the DNA encoding the 5'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to SEQ ID NO: 17. In one embodiment, the DNA encoding the 5'UTR comprises the sequence of SEQ ID NO: 17. In one embodiment, the RNA disclosed herein comprises a 5'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 5'UTR provided in either SEQ ID NO: 18 or 19, with the transcribed 5'cap structure underlined. In one embodiment, the 5'UTR comprises the sequence of either SEQ ID NO: 18 or 19, with the transcribed 5'cap structure underlined. SEQ ID NO: 17 (DNA) AG AATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCC SEQ ID NO: 18 (RNA) AG AAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC SEQ ID NO: 19 (RNA) AG AAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCC

[0219] In one embodiment, the DNA encoding the 5'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to SEQ ID NO: 51. In one embodiment, the DNA encoding the 5'UTR comprises the sequence of SEQ ID NO: 51. In one embodiment, the RNA disclosed herein comprises a 5'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 5'UTR provided in either SEQ ID NO: 52 or 53. In one embodiment, the 5'UTR comprises the sequence of either SEQ ID NO: 52 or 53, with the transcribed 5' cap structure underlined. SEQ ID NO: 51 (DNA) G ATAGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA SEQ ID NO: 52 (RNA) G AUAGGCGGCGCAUGAGAGAAGCCCAGACCAAUUACCUACCCAAA SEQ ID NO: 53 (RNA) G AΨAGGCGGCGCAΨGAGAGAAGCCCAGACCAAΨΨACCΨACCCAAA

[0220] In some embodiments, one, two, three, or more of the above 5'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0221] ii.3'UTR In some embodiments, the RNA disclosed herein comprises a 3'UTR. If present, the 3'UTR is located downstream of the protein coding sequence open reading frame, for example, downstream of the stop codon of the protein coding region. The 3'UTR is typically the part of the mRNA located between the protein coding sequence and the polyA tail of the mRNA. Therefore, in some embodiments, the 3'UTR is located upstream of the polyA sequence (if present), for example, directly adjacent to the polyA sequence. The 3'UTR may be involved in regulatory processes, including transcript cleavage, stability and polyadenylation, translation, and mRNA localization.

[0222] Native or wild-type 3'UTRs contain stretches of adenosines and uridines. These AU-rich signatures are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be divided into three classes. Class I AREs contain several dispersed copies of the AUUUA motif within the U-rich region. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III AREs do not contain the AUUUA motif. Most proteins that bind to AREs are known to destabilize the molecule. Therefore, the introduction, removal, and / or modification of 3'UTR AREs can be used to modulate the stability of nucleic acids (e.g., RNA) of the present disclosure. When engineering a specific nucleic acid, in some embodiments, one or more copies of an ARE can be introduced to create a less stable RNA, thereby suppressing translation and reducing production of the resulting protein. Similarly, in some embodiments, ARE can be identified and removed and / or mutated to increase intracellular stability, thus increasing the translation and production of the resulting protein.Transfection experiments can be carried out in relevant cell lines using the nucleic acid of the present disclosure, and protein production can be assayed at various times after transfection.For example, cells can be transfected with different ARE-manipulated molecules by using an ELISA kit for relevant proteins, and assaying the protein produced 6 hours, 12 hours, 24 hours, 48 ​​hours, and 7 days after transfection.In some embodiments, 3'UTR can have one or more AU-rich sequences removed.Alternatively, AU-rich sequences can remain in 3'UTR.

[0223] The 3'UTR may also contain elements that are not encoded in the template from which the RNA is transcribed, but are added during post-transcriptional maturation, such as a polyA tail. The 3'UTR of an mRNA is not translated into an amino acid sequence. In some embodiments, the RNA disclosed herein comprises a 3'UTR that includes an F element and / or an I element. In some embodiments, the 3'UTR or a proximal sequence thereof comprises a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.

[0224] In some embodiments of the present disclosure, 3'UTR is heterologous UTR, for example, the naturally occurring UTR associated with different ORF.In another embodiment, 3'UTR is synthetic UTR, for example, not naturally occurring.In some embodiments, 3'UTR is functionally linked to ORF, for example, associated with ORF, so that it can exhibit functions such as increasing, enhancing, stabilizing, and / or extending the protein production from RNA molecule, and / or increasing protein expression and / or total protein production from RNA molecule, compared with reference 3'UTR or reference RNA molecule that lacks 3'UTR.In some embodiments, 1, 2, 3, 4, 5, or more of the above 3'UTR functions can be excluded.

[0225] Exemplary 3'UTRs include those of the albumin gene, the α-globin gene, the β-globin gene, the ribosomal protein gene, the tyrosine hydroxylase gene, the lipoxygenase gene, and the collagen alpha gene, e.g., the collagen alpha 1(1) gene, or those of the albumin gene, the α-globin gene, the β-globin gene, the ribosomal protein gene, the tyrosine hydroxylase gene, the lipoxygenase gene, and / or the collagen alpha gene, as set forth in SEQ ID NOs: 1369-1390 of patent application WO 2013 / 143700, the disclosure of which is incorporated herein by reference in its entirety. The present invention also includes a homolog, fragment, or variant of the 3'UTR of a gene, including, for example, the collagen alpha 1(1) gene, or a 3'UTR derived from a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to any of the above sequences. In some embodiments, the sequence UUUGAAUU is used. In some embodiments, one, two, three, four, five, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0226] In some embodiments, the 3’UTR is NM_000661.4, NM_001024921.2, NM_000967.3, NM_001033853.1, NMJD00968.3, NM_000969.3, NM_001024662.1, NM_000970.3, NM_000971.3, NMJD00972.2, NM_000975.3, NM_001199802.1, NM_000976.3, NM__000977.3, NM_033251.2, NMJ01243130.1, NM_001243131, NM_000978.3, NM_000979.3, NM_001270490.1, NMJD00980.3, NM_000981.3, NM_000982.3, NM_000983.3, NM_000984.5, NM_000985.4, NM_001035006.2, NM_001199340.1, NM_001199341.1, NMJD01199342.1, NM_001199343.1, NM_001199344.1, NM_001199345.1, NM_000986.3, NM_000987.3, NM_000988.3, NM_000989.3, NM_000990.4, NM_001136134.1, NMJD00991.4, NM_001136135.1, NM_001136136.1, NM_001136137.1, NM_000992.2, NM_000993.4, NM_001098577.2, NM_001099693.1, NM_000994.3, NM_001007073.1, NM_001007074.1, NM_000996.2, M_000997.4, NM_000998.4, NM_000999.3, NM_001035258.1, NM_001000.3, NM_001002.3, NM_053275.3, NM_001003.2, NM_213725.1, NM_001004.3, NM_001005.4, NM_001256802.1, NM_001260506.1, NM_001260507.1, NM_001006.4, NM_001267699.1, NM_001007.4, NM_001008.3, N_001009.3, NM_001010.2, NM_001011.3, NM_001012.1, NM_001013.3, NM_001203245.2、NM_001014.4、NM_001204091.1、NM_001015.4、NM_001016.3、NM_001017.2、NM_001018.3、NM_001030009.1、NM_001019.4、NM_001020.4、NM_001022.3、NM_001146227.1、NM_001023.3、NM_001024.3、NM_001025.4、NM_001028.2、NM_001029.3、NM_001030.4、NM_002954、NM_001135592.2、NM_001177 413.1, NM_001031.4, NM_001032.4, NM_001030001.2, NM_002948.3, NM_001253379.1, NM_001253380.1, NM_001253382.1, NM_001253383.1, NM_001253384.1, NM_002952.3, NM_001034996.2, NM_001025071.1, NM_001025070.1, NM_005617.3, NM_006013.3, NM_001256577.1, NM_001256580.1, NM_007 104.4, NM_007209.3, NM_012423.3, NM_001270491.1, NM_033643.2, NM_015414.3, NM_021029.5, NM_001199972.1, NM_021104.1, NM_022551.2, NM_033022.3, NM_001142284.1, NM_001026.4, NM_001142285.1, NM_001142283.1, NM_001142282.1, NM_000973.3, NM_033301.1, NM_000995.3, NM_033625 .2、NM_001021.3、NM_002295.4、NM_001012321.1、NM_001033930.1、NM_003333.3、NM_001997.4、NM_001099645.1、NM_001021.3、NM_052969.1、NM_08 0746.2、NM_001001.4、NM_005061.2、NM_015920.3、NM_016093.2、NM_198486.2、NG_011172.1、NG_011253.1、NG_000952.4、NR_002309.1、NG_010827.NG_009952.2, NG_009952.2, or NG_009517.1, or the sequence of a transcript having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to any of the above transcripts. In some embodiments, one, two, three, four, five, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0227] In some embodiments, the 3'UTR is selected from the group consisting of ribosomal proteins, e.g., ribosomal protein L9 (RPL9), ribosomal protein L3 (RPL3), ribosomal protein L4 (RPL4), ribosomal protein L5 (RPL5), ribosomal protein L6 (RPL6), ribosomal protein L7 (RPL7), ribosomal protein L7a (RPL7A), ribosomal protein L11 (RPL11), ribosomal protein L12 (RPL12), ribosomal protein L13 (RPL13), ribosomal protein L23 (RPL23), and the like. , ribosomal protein L18 (RPL18), ribosomal protein L18a (RPL18A), ribosomal protein L19 (RPL19), ribosomal protein L21 (RPL21), ribosomal protein L22 (RPL22), ribosomal protein L23a (RPL23A), ribosomal protein L17 (RPL17), ribosomal protein L24 (RPL24), ribosomal protein L26 (RPL26), ribosomal protein L27 (RPL27), ribosomal protein L30 (RPL30), ribosomal protein L27a (RPL27A), ribosomal protein L28 (RPL28), ribosomal protein L29 (RPL29), ribosomal protein L31 (RPL31), ribosomal protein L32 (RPL32), ribosomal protein L35a (RPL35A), ribosomal protein L37 (RPL37), ribosomal protein L37a (RPL37A), ribosomal protein L38 (RPL38), ribosomal protein L39 (RPL39), ribosomal protein large P0 (RPLP0), ribosomal protein large P1 (RPLP1), ribosomal protein L28 (RPLP2), ribosomal protein L29 (RPLP3), ribosomal protein L31 (RPL31), ribosomal protein L32 (RPL32), ribosomal protein L35a (RPL35A), ribosomal protein L37 (RPL37), ribosomal protein L37a (RPL37A), ribosomal protein L38 (RPL38), ribosomal protein L39 (RPL39), ribosomal protein large P0 (RPLP0), ribosomal protein large P1 (RPLP1), ribosomal protein L28 (RPLP2), ribosomal protein L29 ... Ribosomal protein large P2 (RPLP2), ribosomal protein S3 (RPS3), ribosomal protein S3A (RPS3A), ribosomal protein S4, X-linked (RPS4X), ribosomal protein S4, Y-linked 1 (RPS4Y1), ribosomal protein S5 (RPS5), ribosomal protein S6 (RPS6), ribosomal protein S7 (RPS7), ribosomal protein S8 (RPS8), ribosomal protein S9 (RPS9), ribosomal protein S10 (RPS10), ribosomal protein S11 (RPS11),Ribosomal protein S12 (RPS12), ribosomal protein S13 (RPS13), ribosomal protein S15 (RPS15), ribosomal protein S15a (RPS15A), ribosomal protein S16 (RPS16), ribosomal protein S19 (RPS19), ribosomal protein S20 (RPS20), ribosomal protein S21 (RPS21), ribosomal protein S23 (RPS23), ribosomal protein S25 (RPS25), ribosomal protein S26 (RPS26), ribosomal protein S27 (RPS27), ribosomal protein S27a (RPS27a), ribosomal protein S28 (RPS28), ribosomal protein S29 (RPS29), ribosomal protein L15 (RPL15), ribosomal protein S2 (RPS2), ribosomal protein L14 (RPL14), ribosomal protein S14 (RPS14), ribosomal protein L10 (RPL10), ribosomal protein L10a (RPL10A), ribosomal protein L35 (RPL35), ribosomal protein L13a (RPL13A) ), ribosomal protein L36 (RPL36), ribosomal protein L36a (RPL36A), ribosomal protein L41 (RPL41), ribosomal protein S18 (RPS18), ribosomal protein S24 (RPS24), ribosomal protein L8 (RPL8), ribosomal protein L34 (RPL34), ribosomal protein S17 (RPS17), ribosomal protein SA (RPSA), or ribosomal protein S17 (RPS17), or a sequence derived from the 3'UTR region of a gene encoding any of these ribosomal proteins. In some embodiments, the 3'UTR sequences include sequences of genes encoding ribosomal proteins that have at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to any one of the above 3'UTR sequences.Two, three, four, five, or more may be excluded from the RNA molecules disclosed herein.

[0228] In some embodiments, the 3'UTR comprises a sequence derived from the 3'UTR region of a gene encoding a ribosomal protein, or a sequence derived from a gene encoding a ribosomal protein, such as ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), ubiquitously expressed Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) (FAU), ribosomal protein L22-like 1 (RPL22L1), ribosomal protein L39-like (RPL39L), ribosomal protein L 10-like (RPL10L), ribosomal protein L36a-like (RPL36AL), ribosomal protein L3-like (RPL3L), ribosomal protein S27-like (RPS27L), ribosomal protein L26-like 1 (RPL26L1), ribosomal protein L7-like 1 (RPL7L1), ribosomal protein L13a pseudogene (RPL13AP), ribosomal protein L37a pseudogene 8 (RPL37AP8), ribosomal protein S Sequences derived from genes including ribosomal protein S26 pseudogene 5 (RPS10P5), ribosomal protein S26 pseudogene 11 (RPS26P11), ribosomal protein L39 pseudogene 5 (RPL39P5), ribosomal protein large PO pseudogene 6 (RPLP0P6), and ribosomal protein L36 pseudogene 14 (RPL36P14), and / or sequences that are identical to any of the above gene protein sequences by at least 99%, 98%, 97%, 96%, 98%, 9 ... The 3'UTR sequences include sequences of genes encoding proteins with 5%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive). In some embodiments, one, two, three, four, five, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0229] Those skilled in the art will understand that heterologous and / or synthetic 5'UTRs may be used with any desired 3'UTR sequence, and vice versa, for example, heterologous 5'UTRs may be used with synthetic and / or heterologous 3'UTRs.

[0230] In one embodiment, the DNA encoding the 3'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to SEQ ID NO: 20. In one embodiment, the DNA encoding the 3'UTR comprises the sequence of SEQ ID NO: 20. In some embodiments, the RNA disclosed herein comprises a 3'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to the 3'UTR provided in either SEQ ID NO: 21 or 22. In one embodiment, the 3'UTR comprises the sequence of either SEQ ID NO: 21 or 22. SEQ ID NO: 20 (DNA) CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC SEQ ID NO: 21 (RNA) CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC SEQ ID NO: 22 (RNA) CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGC

[0231] In one embodiment, the DNA encoding the 3'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to SEQ ID NO: 23. In one embodiment, the DNA encoding the 3'UTR comprises the sequence of SEQ ID NO: 23. In one embodiment, the RNA disclosed herein comprises a 3'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 3'UTR provided in either SEQ ID NO: 24 or 25. In one embodiment, the 3'UTR comprises the sequence of either SEQ ID NO: 24 or 25. SEQ ID NO: 23 (DNA) ATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC SEQ ID NO: 24 (RNA) AUACAGCAGCAAUUGGCAAGCUGCUUACAUAGAACUCGCGGCGAUUGGCAUGCCGCCUUAAAAUUUUUUAUUUUUUUUUUCUUUUUUUUCCGAAUCGGAUUUUGUUUUUAAUAUUUC SEQ ID NO: 25 (RNA) AΨACAGCAGCAAΨΨGGCAAGCΨGCΨΨACAΨAGAACΨCGCGGCGAΨΨGGCAΨGCCGCCΨ ΨAAAAΨΨΨΨΨAΨΨΨΨAΨΨΨΨΨCΨΨΨΨCΨΨΨΨΨCCGAAΨCGGAΨΨΨΨGΨΨΨΨΨAAΨAΨΨΨC

[0232] In some embodiments, one, two, three, four, five, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0233] D. Open Reading Frame (ORF) The 5' and 3' UTRs may be operably linked to an open reading frame (ORF), and the ORF may be a sequence of codons capable of being translated into a polypeptide of interest. The open reading frame may be a sequence of several DNA or RNA nucleotide triplets that can be translated into a peptide or protein. The ORF may begin with an initiation codon at its 5' end, for example, a combination of three consecutive nucleotides (ATG or AUG) that usually encodes the amino acid methionine, and a subsequent region that usually has a length of several 3 nucleotides. The open reading frame may end with at least one stop codon, including but not limited to TAA, TAG, TGA or UAA, UAG or UGA, or any combination thereof. In some embodiments, an open reading frame may terminate with one, two, three, four, or more stop codons, including, but not limited to, TAATAA (SEQ ID NO:27), TAATAG (SEQ ID NO:28), TAATGA (SEQ ID NO:29), TAGTGA (SEQ ID NO:30), TAGTAA (SEQ ID NO:31), TAGTAG (SEQ ID NO:32), TGATGA (SEQ ID NO:33), TGATAG (SEQ ID NO:34), TGATAA (SEQ ID NO:35), or UAAUAA (SEQ ID NO:36), UAAUAG (SEQ ID NO:37), UAAUGA (SEQ ID NO:38), UAGUGA (SEQ ID NO:39), UAGUAA (SEQ ID NO:40), UAGUAG (SEQ ID NO:41), UGAUGA (SEQ ID NO:42), UGAUAG (SEQ ID NO:43), UGAUAA (SEQ ID NO:44), or any combination thereof. An open reading frame may be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame may also be referred to as a "(protein) coding region" or "coding sequence."

[0234] As described herein, an RNA molecule may contain one (monocistronic), two (bicistronic) or more (multicistronic) open reading frames.

[0235] In some embodiments, the ORF encodes a non-structural viral gene. In some embodiments, the ORF further comprises one or more subgenomic promoters. In some embodiments, the RNA molecule comprises a subgenomic promoter operably linked to the ORF. In some embodiments, the first RNA molecule does not comprise an ORF encoding any polypeptide of interest, while the second RNA molecule comprises an ORF encoding a polypeptide of interest. In some embodiments, the first RNA molecule does not comprise a subgenomic promoter.

[0236] The present disclosure provides an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. In some embodiments, the RNA molecule comprises at least one open reading frame encoding a RSV F protein. In a preferred embodiment, the RNA molecule comprises at least one open reading frame encoding a respiratory syncytial virus (RSV) pre-fusion F protein (preF) polypeptide.

[0237] E. Gene of Interest The RNA molecule described herein may contain a gene of interest. The gene of interest encodes a polypeptide of interest. Non-limiting examples of polypeptides of interest include, for example, biologics, antibodies, vaccines, therapeutic polypeptides or peptides, cell-penetrating peptides, secreted polypeptides, plasma membrane polypeptides, cytoplasmic or cytoskeletal polypeptides, intracellular membrane-bound polypeptides, nuclear polypeptides, polypeptides associated with human diseases, targeting moieties, polypeptides encoded by the human genome that have not yet been identified as therapeutic targets but are nevertheless useful in the fields of research and drug discovery, or combinations thereof. In some embodiments, one, two, three, four, five, or more of the above polypeptides of interest may be excluded. The sequence of a particular gene of interest can be easily identified by those skilled in the art using public and private databases, such as GENBANK®.

[0238] In some embodiments, the RNA molecule comprises a coding region for a gene of interest. In some embodiments, the gene of interest is or comprises an antigen polypeptide or its immunogenic variant or immunogenic fragment. In some embodiments, the antigen polypeptide comprises one epitope from an antigen. In some embodiments, the antigen polypeptide comprises multiple distinct epitopes from an antigen. In some embodiments, the antigen polypeptide comprising multiple distinct epitopes from an antigen is a polyepitope. In some embodiments, the antigen polypeptide comprises an antigen polypeptide from an allergen, a viral antigen polypeptide, a bacterial antigen polypeptide, a fungal antigen polypeptide, a parasite antigen polypeptide, an antigen polypeptide from an infectious agent, an antigen polypeptide from a pathogen, a tumor antigen polypeptide, or an autoantigen polypeptide. In some embodiments, one, two, three, four, five, or more of the above antigen polypeptides may be excluded.

[0239] The term "antigen" can refer to a substance capable of being recognized by the immune system, e.g., the adaptive immune system, and capable of eliciting an antigen-specific immune response, e.g., by the formation of antibodies and / or antigen-specific T cells as part of the adaptive immune response. An antigen may be or include a peptide or protein that can be presented to T cells by MHC. An antigen may also be the product of translation of a provided nucleic acid molecule, e.g., an RNA molecule comprising at least one coding sequence described herein. Additionally, fragments, variants, and derivatives of an antigen, e.g., a peptide or protein, comprising at least one epitope, are understood as antigens.

[0240] In some embodiments, RNA encoding the gene of interest (for example, antigen) is expressed in the cells of the subject to be treated to provide the gene of interest (for example, antigen).In some embodiments, RNA is transiently expressed in the cells of the subject.In some embodiments, the gene of interest (for example, antigen) is expressed on the cell surface.In some embodiments, the gene of interest (for example, antigen) is expressed and presented in the context of MHC.In some embodiments, the gene of interest (for example, antigen) is expressed in the extracellular space, for example, the antigen is secreted.

[0241] In some embodiments, the RNA molecule comprises a coding region for a gene of interest, such as an antigen. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, such as an antigen, derived from a pathogen associated with an infectious disease. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, such as an antigen derived from RSV.

[0242] In some embodiments, the RNA molecule encodes a RSV preF protein, or a fragment or variant thereof.

[0243] In some embodiments, the RNA polynucleotide described herein or a composition or pharmaceutical preparation comprising the same comprises a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence having at least 80% identity to a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence encoding a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some embodiments, the RNA polynucleotide described herein or a composition or pharmaceutical preparation comprising the same is transcribed from a DNA template. In some embodiments, the DNA template used to transcribe the RNA polynucleotide described herein comprises a sequence complementary to the RNA polynucleotide. In some embodiments, the gene of interest described herein is encoded by the RNA polynucleotide described herein comprising a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide encodes a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some embodiments, the polypeptide described herein is encoded by an RNA polynucleotide transcribed from a DNA template comprising a sequence complementary to the RNA polynucleotide.

[0244] In some embodiments, the RNA molecule encodes a RSV preF protein comprising any one of SEQ ID NOs: 1-6 and 71-74, or a fragment or variant thereof.

[0245] In some embodiments, the RNA molecule encodes a RSV preF protein synthesized from a nucleic acid sequence comprising any one of SEQ ID NOs: 7-10 and 59-62, or a fragment or variant thereof.

[0246] F. Poly A tail In some embodiments, the RNA molecules disclosed herein include a polyadenylate (polyA) sequence, e.g., as described herein. In some embodiments, the polyA sequence is located downstream of the 3' UTR, e.g., adjacent to the 3' UTR. A "polyA tail" or "polyA sequence" refers to a stretch of consecutive adenine residues, e.g., up to 400 or up to about 400 adenosine nucleotides, e.g., 20 to 400 or about 20 to about 400, preferably 50 to 400 or about 50 to about 400, more preferably 50 to 300 or about 50 to about 300, even more preferably 50 to 250 or about 50 to about 250, and most preferably 60 to 250 or about 60 to about 250 adenosine nucleotides, that may be attached to the 3' end of an RNA molecule. PolyA sequences are known to those of skill in the art and may follow the 3' UTR in the RNA molecules described herein. The polyA tail may increase the stability, half-life, and / or translation efficiency of the RNA molecule.

[0247] After cleavage, most pre-mRNAs acquire a polyadenylated tail, except for replication-dependent histone transcripts, which terminate with a histone stem loop instead of a poly(A) sequence. In this context, 3'-end processing is a nuclear co-transcriptional process that facilitates mRNA transport from the nucleus to the cytoplasm and influences mRNA stability and translation. The formation of this 3' end occurs in a two-step reaction directed by the cleavage / polyadenylation machinery and depends on the presence of two sequence elements in the pre-mRNA (pre-mRNA): a hexanucleotide polyadenylation signal and a downstream G / U-rich sequence. In the first step, the pre-mRNA is cleaved between these two elements to yield a free 3' hydroxyl. In the second step, the newly formed 3' end is extended by polyadenylation or the addition of a poly(A) sequence.

[0248] Polyadenylation refers to the addition of a polyA sequence to an RNA molecule, for example, to a premature mRNA. Polyadenylation may be induced by a so-called polyadenylation signal. This signal may be located near or within a stretch of nucleotides at the 3' end of the RNA molecule to be polyadenylated. A polyadenylation signal may also be included in the 3' UTR of an artificial nucleic acid molecule. A polyadenylation signal typically comprises a hexamer consisting of adenine and uracil / thymine nucleotides, preferably the hexamer sequence AAUAAA, although other sequences, preferably hexamer sequences, are also contemplated. Polyadenylation typically occurs during processing of pre-mRNA (also called premature mRNA). RNA maturation (from pre-mRNA to mature mRNA) typically includes a polyadenylation step. PolyA tailing of in vitro transcribed mRNA can be achieved using various approaches, including, but not limited to, cloning a polyT tract into a DNA template or post-transcriptional addition using polyA polymerase. The term may relate to the polyadenylation of RNA as a cellular process, or to polyadenylation carried out in vitro by an enzymatic reaction with a suitable enzyme, for example E. coli polyA polymerase, or by chemical synthesis.

[0249] The RNA molecules disclosed herein may have a polyA sequence attached to the free 3' end of the RNA after transcription by a template-independent RNA polymerase, or a polyA sequence encoded by DNA and transcribed by a template-dependent RNA polymerase. In some embodiments, the polyA sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template containing repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand.

[0250] A DNA sequence (coding strand) that encodes a polyA sequence is referred to as a polyA cassette. In some embodiments, the polyA cassette present in the coding strand of the DNA consists essentially of dA nucleotides, but is interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such random sequences may be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. length, at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or 5, 6, 7, 8, 9, 10, 11, The length of the polyA cassette may be between any two of (inclusive or exclusive) 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. Such cassettes are disclosed, for example, in WO 2016 / 005324 A1, which is incorporated herein by reference. Any of the polyA cassettes disclosed in WO 2016 / 005324 A1 may be used in the present disclosure.PolyA cassettes consisting essentially of dA nucleotides but interrupted by random sequences with an equal distribution of the four nucleotides (dA, dC, dG, dT), e.g., 5-50 nucleotides in length, have been shown at the DNA level to promote consistent propagation of plasmid DNA in E. coli, and at the RNA level are further associated with beneficial properties related to supporting RNA stability and translation efficiency. In some embodiments, the polyA sequences contained in the RNA polynucleotides described herein consist essentially of adenosine nucleotides but are interrupted by random sequences of the four nucleotides (A, C, G, U). Such random sequences may be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. length, at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or 5, 6, 7, 8, 9, 10, 11, It may also be between any two (inclusive or exclusive) of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0251] The polyA sequence may be located at any position within 3'UTR. In some embodiments, nucleotides other than adenosine nucleotides are not adjacent to the polyA sequence at its 3' end, for example, the polyA sequence is not masked by nucleotides other than adenosine or is not followed by nucleotides other than adenosine at its 3' end. In some embodiments, the polyA sequence may be located at the 3' end of the 3'UTR, for example, the 3'UTR does not contain 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 or more nucleotides located at the 3' end of the polyA sequence, and more preferably, the 3'UTR does not contain any additional elements located at the 3' end of the polyA sequence. In some embodiments, the polyA sequence is located at the 3' end of the RNA molecule, for example, the artificial nucleic acid molecule does not contain 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 or more nucleotides located at the 3' end of the polyA sequence. Alternatively, the polyA sequence may be located at the 5' end of the 3'UTR, for example, immediately 3' from the ORF of the artificial nucleic acid molecule, or may be located within the 3'UTR, for example, adjacent to other 3'UTR elements on the 5' and 3' sides. In some embodiments, the polyA sequence is adjacent to the 3' side by a polyC sequence and / or a histone stem loop sequence. Additionally or alternatively, the polyA sequence may be adjacent to the 5' side by a 3'UTR element, for example, from a human albumin or globin gene.

[0252] In some embodiments, the RNA molecule may further comprise an endonuclease recognition site sequence immediately downstream of the poly-A tail sequence. The RNA molecule may further comprise a poly-A polymerase recognition sequence (e.g., a polyadenylation signal) (e.g., AAUAAA) near its 3' end. In some embodiments, the polyadenylation signal is located 3' of the poly-A sequence contained in the 3'UTR. In some embodiments, the poly-A sequence is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, and up to 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, , 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120 , 125, 130, 135, 140, 145, or 150 nucleotides (inclusive or exclusive), wherein the nucleotide sequence preferably does not contain more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive adenine nucleotides.In some embodiments, the nucleotide sequence separating the polyA sequence and the polyadenylation signal comprises 1 to 200 or about 1 to about 200 nucleotides, e.g., 10 to 90, 20 to 85, 30 to 80, 40 to 80, 50 to 75 or 55 to 85 nucleotides, more preferably 55 to 80 nucleotides, and the nucleotide sequence does not comprise more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive adenine nucleotides.

[0253] In some embodiments, the polyadenylation signal comprises the consensus sequence NN(U / T)ANA (where N=A or U), preferably AA(U / T)AAA or A(U / T)(U / T)AAA. Such consensus sequences can be recognized by most animal and bacterial cell systems, for example, by polyadenylation factors, such as cleavage / polyadenylation specificity factor (CPSF) in cooperation with CstF, PAP, PAB2, CFI and / or CFII. In some embodiments, the polyadenylation signal (e.g., the consensus sequence NNUANA) is located less than or less than about 50 nucleotides downstream of the 3' end of the 3'UTR element defined herein, e.g., at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, at most 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, exactly 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, or between any two of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides (inclusive or exclusive), such that transcription of the RNA molecule results in a premature RNA containing a polyadenylation signal downstream of its 3'UTR and subsequent attachment of a polyA sequence to the premature RNA. Thus, the resulting RNA may comprise a 3'UTR comprising at least one polyA sequence, where the 3'UTR is followed by an additional polyA sequence.

[0254] The poly-A sequence may be of any length. In some embodiments, the poly-A tail may be 5 to 300 nucleotides in length. In some embodiments, the RNA molecule comprises a poly-A tail that comprises, consists essentially of, or consists of a sequence of 25 to 400 or about 25 to 400 adenosine nucleotides, a sequence of 50 to 400 or about 50 to 400 adenosine nucleotides, a sequence of 50 to 300 or about 50 to 300 adenosine nucleotides, a sequence of 50 to 250 or about 50 to 250 adenosine nucleotides, a sequence of 60 to 250 or about 60 to 250 adenosine nucleotides, or a sequence of 40 to 100 or about 40 to 100 adenosine nucleotides. In some embodiments, the poly-A tail is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825,830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides, up to a maximum of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 11 0, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265 , 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 5 80, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 73 5, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides, exactly 5, 10, 15, 20, 25, 30,35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 171 75, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 33 0, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485 , 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 9 55, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides, or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235,240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 4 50, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660 , 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 8 or 1000 adenosine nucleotides. In this context, "consisting essentially of" means that most of the nucleotides in the polyA sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number in the polyA sequence, are adenosine nucleotides, while allowing the remaining nucleotides to be nucleotides other than adenosine nucleotides, e.g., uridine, guanosine, and / or cytosine. In this context, "consisting essentially of" means that all nucleotides in the polyA sequence, i.e.,This means that 100% of the nucleotides in the polyA sequence are adenosine nucleotides.

[0255] In some embodiments, the RNA molecule comprises a poly-A tail comprising a sequence of more than 30 adenosine nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail comprising 40 adenosine nucleotides or about 40 adenosine nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail comprising 80 adenosine nucleotides or about 80 adenosine nucleotides. In some embodiments, the 3' poly-A tail has a stretch of at least 10 consecutive adenosine residues and up to 300 consecutive adenosine residues. In some specific embodiments, the RNA molecule comprises 40 consecutive adenosine residues or about 40 consecutive adenosine residues. In some embodiments, the RNA molecule comprises 80 consecutive adenosine residues or about 80 consecutive adenosine residues. The poly-A tail may play an important regulatory role in enhancing translation efficiency and regulating the efficiency and degradation of mRNA quality control. Short sequences or hyperpolyadenylation may indicate RNA degradation.

[0256] In some embodiments, a poly-A tail may be located within an RNA molecule or other nucleic acid molecule, such as in a vector, e.g., in a vector that serves as a template for the production of an RNA, e.g., an mRNA, e.g., by transcription of the vector. In some embodiments, an RNA molecule may not include a poly-A tail.

[0257] In some embodiments, a poly-A tail may be located within an RNA molecule or other nucleic acid molecule, such as in a vector, e.g., in a vector that serves as a template for the production of an RNA, e.g., an mRNA, e.g., by transcription of the vector. In some embodiments, an RNA molecule may not include a poly-A tail.

[0258] In one embodiment, the DNA encoding the poly-A tail disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to SEQ ID NO: 26. In one embodiment, the DNA encoding the poly-A tail comprises the sequence of SEQ ID NO: 26. In one embodiment, the RNA disclosed herein comprises a poly-A tail comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity (inclusive or exclusive) to SEQ ID NO: 26. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO: 26. In one embodiment, the poly-A tail comprises a sequence of SEQ ID NO: 26 + / - 2 adenosine (A) nucleotides. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO:26 + / - 1 adenosine (A) nucleotide. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO:26. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO:26 + / - 2 adenosine (A) nucleotides. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO:26 + / - 1 adenosine (A) nucleotide. In some embodiments, the poly-A tail comprises the sequence of SEQ ID NO:26.

[0259] In some embodiments, one, two, three, four, five, or more of the above polyA sequences may be excluded from the RNA molecules disclosed herein. SEQ ID NO: 26 (DNA, RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0260] G. Other Elements In some embodiments of the present disclosure, the RNA molecule additionally comprises a chain-terminating nucleoside. For example, the chain-terminating nucleoside may include a nucleoside deoxygenated at the 2' and / or 3' positions of its sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine. In some embodiments, one, two, three, four, five, or more of the above chain-terminating nucleosides may be excluded from the RNA molecules disclosed herein. In some embodiments, the incorporation of strand-terminating nucleotides into mRNA, for example at the 3' end, can result in stabilization of the mRNA, as described, for example, in WO 2013 / 103659.

[0261] In some embodiments of the present disclosure, the RNA molecule additionally comprises a stem-loop, e.g., a histone stem-loop. The stem-loop may comprise 2, 3, 4, 5, 6, 7, 8, or more nucleotide base pairs. For example, the stem-loop may comprise 4, 5, 6, 7, or 8 nucleotide base pairs. The stem-loop may be located in any region in the mRNA. For example, the stem-loop may be located in, before, or after the untranslated region (5'UTR or 3'UTR), the coding region, or the polyA sequence or tail. In some embodiments, the stem-loop may affect one or more functions of the mRNA, such as translation initiation, translation efficiency, and / or transcription termination. Such a histone stem-loop sequence may be the histone stem-loop sequence disclosed in International Publication No. WO 2012 / 019780, the disclosure of which is incorporated herein by reference in its entirety. Other non-limiting examples of histone stem-loop structures and nucleic acid sequences encoding such structures can be found, for example, in WO 2016 / 091391, the disclosure of which is incorporated herein by reference in its entirety.

[0262] In some embodiments, the combination of a polyA sequence or polyadenylation signal and at least one histone stem loop acts synergistically to increase protein expression above levels observed with either of the individual elements, even though both represent alternative mechanisms in nature. In some embodiments, the synergistic effect of the combination of polyA and at least one histone stem loop is independent of the order and / or length of the elements of the polyA sequence.

[0263] In some embodiments, the RNA does not contain a histone downstream element (HDE), which comprises a purine-rich polynucleotide stretch of approximately 15-20 nucleotides 3' of the naturally occurring stem-loop that represents a binding site for U7 snRNA, where it is involved in processing the histone pre-mRNA into mature histone mRNA.

[0264] In some embodiments, histone stem-loops are generally derived from histone genes and comprise intramolecular base pairing of two neighboring, partially or fully reverse-complementary sequences separated by a spacer consisting of a short sequence that forms the loop of the structure. The unpaired loop region typically cannot base pair with any of the stem-loop elements. The stability of the stem-loop structure generally depends on the length of the paired region, the number of mismatches or bulges, and / or the base composition. In some embodiments, wobble base pairing (non-Watson-Crick base pairing) may result. In some embodiments, at least one histone stem-loop sequence comprises a length of 15 to 45 nucleotides.

[0265] In some embodiments, the RNA molecule comprises a poly(C) sequence (e.g., within the 3'UTR). In some embodiments, the poly(C) sequence is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines, up to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines, or exactly 1 In some embodiments, the poly-C sequence has 0, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines, or between any two of (inclusive or exclusive) 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines. In some embodiments, the poly-C sequence has 30 cytidines or has about 30 cytidines.

[0266] In some embodiments, RNA molecule comprises internal ribosome entry site (IRES) sequence or IRES motif.In some embodiments, for example, when RNA encodes two or more peptides or proteins, IRES sequence separates ORF.Therefore, when RNA molecule is bicistronic or multicistronic nucleic acid molecule, IRES sequence can be useful.

[0267] In some embodiments, the RNA does not contain an intron. In some embodiments, the RNA alternatively or additionally contains a microRNA binding site.

[0268] Representative RNA molecules containing a combination of elements disclosed herein comprise, in the 5' to 3' direction: ORF-polyA sequence; ORF-IRES-ORF-polyA sequence; ORF-3'UTR-polyA sequence; ORF-polyA sequence-3'UTR; ORF-3'UTR-poly(A) sequence-poly(C) sequence-histone stem loop; ORF-3'UTR-polyA sequence-poly(C) sequence-polyA sequence; ORF-3'UTR-polyA sequence-histone stem loop-polyA sequence; 5'UTR-ORF-3'UTR; 5'UTR-ORF-polyA sequence; 5'UTR-ORF-polyA sequence-poly(C) sequence-histone stem loop; 5'UTR-ORF-polyA sequence-poly(C) sequence-polyA sequence; 5'UTR-ORF-polyA sequence-histone stem loop-polyA sequence; 5'UTR-ORF-3'UTR-polyA sequence; 5'UTR-ORF-3'UTR-poly(A) sequence-poly(C) sequence 5'UTR-ORF-3'UTR-poly(A) sequence-poly(C) sequence-histone stem loop; 5′-cap-5′UTR-ORF-3′UTR; 5'-cap-5'UTR-ORF-polyA sequence; 5'-cap-5'UTR-ORF-3'UTR-polyA sequence; 5'-cap-5'UTR-ORF-3'UTR-poly(A) sequence-poly(C) sequence; or 5'-cap-5'UTR-ORF-3'UTR-poly(A) sequence-poly(C) sequence-histone stem loop may include, but is not limited to:

[0269] In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the RNA molecules disclosed herein.

[0270] H. Self-amplifying RNA (saRNA) In some embodiments, the RNA molecule may be saRNA. "Self-amplifying RNA," "saRNA," and "replicon" refer to RNA capable of replicating itself. Self-amplifying RNA molecules may be generated by using replication elements, for example, from alphaviruses, to replace structural viral polypeptides with nucleoti...

Claims

1. A composition for inducing an immune response to RSV in a subject, the composition comprising an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) fusion protein F (F) polypeptide.

2. 10. The composition of claim 1, wherein the RSV polypeptide is a full-length, truncated, fragment, or variant thereof.

3. The composition of claim 1 , wherein the RSV polypeptide comprises at least one mutation.

4. 2. The composition of claim 1, wherein the RSV polypeptide has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence selected from SEQ ID NOs: 1-6 and 71-74.

5. 2. The composition of claim 1, wherein the open reading frame is transcribed from a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences of SEQ ID NOs: 7-10 and 59-62.

6. 2. The composition of claim 1, wherein the open reading frame comprises a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences of SEQ ID NOs: 11-16 and 63-70.

7. The composition of claim 1, wherein the open reading frame comprises a nucleic acid sequence of any one of SEQ ID NOs: 11-16 and 63-70.

8. The composition of claim 1 , wherein the RNA molecule further comprises a 5′ untranslated region (5′ UTR).

9. The composition of claim 8, wherein the 5'UTR comprises a sequence selected from any of SEQ ID NOs: 17-19.

10. The composition of claim 1 , wherein the RNA molecule further comprises a 3′ untranslated region (3′ UTR).

11. The composition of claim 10, wherein the 3'UTR comprises the sequence of any one of SEQ ID NOs: 20 to 25.

12. The composition of claim 1 , wherein the RNA molecule further comprises a 5′ cap portion or a 3′ polyA tail.

13. 13. The composition of claim 12, wherein the poly-A tail comprises a sequence having SEQ ID NO:

26.

14. 2. The composition of claim 1, wherein the open reading frame comprises a G / C content of at least 55%, 60%, 65%, 70%, or 75%, or 50% to 75%, or 55% to 70%, or about 50% to 75%, or 55% to 70%.

15. 10. The composition of claim 1, wherein the encoded RSV polypeptide is localized to the plasma membrane, localized to the Golgi, and / or secreted.

16. The composition of claim 1 , wherein the RNA comprises at least one modified nucleotide.

17. 17. The composition of claim 16, wherein the modified nucleotide is pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine.

18. 18. The composition of claim 17, wherein the modified nucleotide is N1-methylpseudouridine (Ψ).

19. The composition of claim 1 , wherein the RNA is mRNA.

20. 20. The composition of claim 19, wherein the RNA is modRNA or saRNA.

21. The composition of claim 1, wherein the RNA molecule is formulated in a lipid nanoparticle (LNP).

22. 22. The composition of claim 21, wherein the lipid nanoparticles comprise at least one of a cationic lipid, a PEGylated lipid, a neutral lipid, and a steroid or steroid analog.

23. 23. The composition of claim 22, wherein the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

24. PEGylated lipids include PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, glycol lipids including 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerols (PEG-DAG), such as 1-( 23. The composition of claim 22, which is monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or a PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate.

25. 25. The composition of claim 24, wherein the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

26. Neutral lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimide).

23. The composition of claim 22, wherein the hydroxybenzoate is selected from the group consisting of 1-methyl-2-hydroxybenzoyl cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (trans DOPE).

27. 27. The composition of claim 26, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

28. 23. The composition of claim 22, wherein the steroid or steroid analog is cholesterol.

29. A composition for preventing, treating, or ameliorating an infection, disease, or condition associated with RSV in a subject, the composition comprising an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) fusion protein F (F) polypeptide.

30. 30. The composition of claim 29, wherein the infection, disease or condition is an RSV infection-induced acute respiratory tract illness, including pneumonia and bronchitis.

31. 30. The composition of claim 29, wherein the subject is less than about 1 year old, about 1 year old or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older, or older.

32. 30. The composition of claim 29, wherein the composition is administered as a vaccine.

Images