Novel immunosuppression method

Recombinant cells expressing MIR1 and MIR2 proteins effectively evade immune rejection by mimicking viral evasion mechanisms, allowing successful cell transplantation without immunosuppressants.

JP2025168977APending Publication Date: 2025-11-12CAKSUS BIO INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024073897
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-04-30
Publication Date
2025-11-12

Smart Images

  • Figure 2025168977000002
    Figure 2025168977000002
  • Figure 2025168977000003
    Figure 2025168977000003
  • Figure 2025168977000004
    Figure 2025168977000004
Patent Text Reader

Abstract

To provide a cell capable of avoiding the immune system of a recipient individual at the time of transplantation of the cell by a simple technique, and more specifically, to provide a technique for producing a cell capable of escaping from the immune system of a recipient individual by mimicking a means by which a virus escapes from the immune system of the recipient individual.SOLUTION: In the present invention, it was shown that the above problems can be solved by providing recombinant cells in which virus-derived MIR1 proteins and MIR2 proteins are produced.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to providing a novel means for suppressing the immune response of a recipient individual to cells for transplantation. [Background technology]

[0002] In recent years, in the fields of cell therapy and regenerative medicine, there has been a gradual increase in the number of treatments that have been shown to be useful in clinical research and trial-level tests, such as cancer lymphocyte therapy and cell sheets made from human-derived cells. One problem with these treatments, including cell transplantation, is the rejection reaction that occurs when the desired cells or tissues are administered or transplanted into a patient. To avoid this problem, methods have been proposed, such as the combined use of immunosuppressants or knocking out and removing HLA on the cell surface.

[0003] However, immunosuppressants not only have the risk of side effects, but also require long-term administration and often pose problems such as the risk of infection due to immunosuppression. Furthermore, while knocking out and completely removing HLA can avoid rejection due to type incompatibility, it also poses the risk of new problems, such as the recipient becoming a target for NK cells in the body. Given these circumstances, the only reliable way to avoid rejection is currently considered to be autologous transplantation, using the patient's own cells or tissues.

[0004] On the other hand, to solve this problem, several research groups both in Japan and overseas are conducting research into creating cells that evade the immune system by knocking out β2 microglobulin, HLA, and other HLA-related molecules in order to avoid immune rejection reactions (Patent Document 1, Patent Document 2).

[0005] However, at present, it has been reported that it is difficult to completely evade the immune system, and that in some cases the cells become targets of NK cells. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] WO2021 / 241658 [Patent Document 2] WO2021 / 251271 Summary of the Invention [Problem to be solved by the invention]

[0007] An objective of the present invention is to provide cells that can evade the immune system of a recipient individual when transplanted using a simple technique. More specifically, an objective of the present invention is to develop a technique for producing cells that can evade the immune system of a host individual by mimicking the means by which viruses evade the immune system of a host individual. [Means for solving the problem]

[0008] The present invention has demonstrated that the above-mentioned problems can be solved by providing recombinant cells in which virus-derived MIR1 and MIR2 proteins are produced.

[0009] More specifically, the present application provides the following aspects to solve the above-mentioned problems: [1]: MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein, and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; a recombinant cell in which [2]: The recombinant cell according to [1], wherein the cell is selected from the group consisting of human pluripotent stem cells, human somatic stem cells, and human somatic cells; [3]: The recombinant cell according to [1] or [2], which, when administered in vivo, is not recognized as a non-self cell by the immune system of a recipient individual; [4]: The recombinant cell according to [1] or [2] for transplantation or administration to a living body; [5]: The recombinant cell according to [1] or [2], which produces in the cell an MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein, thereby suppressing the response of cytotoxic T lymphocytes (CTLs) against the cell by suppressing MHC class I of the recipient's immune system; [6]: The recombinant cell according to [1] or [2], which maintains the expression of HLA-C and HLA-E by producing in the cell an MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein, and further suppresses the NK cell response against the cell by suppressing NK cell-activating molecules; [7]: MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR1 protein, and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein. Recombinant cells for administration to living organisms, which are differentiated or induced from cells in which the above is produced; [8]: MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR1 protein, and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein. a drug that suppresses immune responses in vivo against cells that are produced intracellularly, including recombinant cells for administration to the body, which are differentiated or induced from the cells; [9]: A nucleotide sequence encoding the MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR1 protein; and A nucleotide sequence encoding the MIR2 protein (SEQ ID NO: 4) or a nucleotide sequence encoding a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. an expression vector in which the above has been incorporated into a vector construct in an expressible manner;

[10] : The expression vector according to [9], used for gene therapy;

[11] : The expression vector according to [9] or

[10] , wherein the vector construct is selected from the group consisting of a plasmid vector, an adenovirus vector, an adeno-associated virus vector, and a lentivirus vector;

[12] : An expression vector according to [9] or

[10] , for administration to a living body.

[13] : a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein (SEQ ID NO: 2) or the MIR1 protein; MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; immunosuppressants, including;

[14] : The immunosuppressant according to

[13] , for administration to a living body;

[15] : MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; a cell transplantation method or cell therapy method that suppresses immune responses in vivo, comprising administering recombinant cells for administration to the body that have been differentiated or induced from cells in which the above-mentioned compound is produced;

[16] : A nucleotide sequence encoding the MIR1 protein (SEQ ID NO: 2) or a nucleotide sequence encoding a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; A nucleotide sequence encoding the MIR2 protein (SEQ ID NO: 4) or a nucleotide sequence encoding a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. A method for suppressing immune responses against recombinant cells, comprising administering to the cells an expression vector comprising the above-mentioned vector construct incorporated therein in an expressible manner. [Effects of the Invention]

[0010] In the present invention, by providing recombinant cells in which virus-derived MIR1 and MIR2 proteins are produced, a technology can be provided for producing cells that can evade the immune system of a recipient individual when the cells are transplanted. [Brief explanation of the drawings]

[0011] [Figure 1] FIG. 1 shows a schematic diagram of an MIR1 expression vector into which the MIR1 gene has been introduced, an MIR2 expression vector into which the MIR2 gene has been introduced, and an MIR1+MIR2 expression vector into which both the MIR1 gene and the MIR2 gene have been introduced. [Figure 2] FIG. 2 shows the results of electrophoresis of the PCR products of each gene fragment, demonstrating that recombinant cells into which the target gene was introduced were obtained using each expression vector. [Figure 3] FIG. 3 shows the results of immunostaining with anti-HLA-ABC antibody using cells into which 0.5 μg of each expression vector was introduced. [Figure 4]FIG. 4 shows the results of immunostaining with anti-HLA-ABC antibody using cells into which 1.0 μg of each expression vector was introduced. [Figure 5] FIG. 5 shows the results of immunostaining with anti-ICAM-1 antibody using cells into which 0.5 μg of each expression vector was introduced. [Figure 6] FIG. 6 shows the results of immunostaining with anti-ICAM-1 antibody using cells into which 1.0 μg of each expression vector was introduced. [Figure 7-1] FIG. 7-1 shows the results of confirming the cell surface expression of HLA-ABC by flow cytometry using cells transfected with 2.5 μg or 5.0 μg of MIR1 expression vector or MIR2 expression vector. [Figure 7-2] Figure 7-2 shows the results of confirming cell surface expression of HLA-ABC by flow cytometry using cells transfected with 2.5 μg or 5.0 μg of MIR1+MIR2 expression vector (MIR1+MIR2(1)) or cells co-transfected with 2.5 μg or 5.0 μg each of MIR1 expression vector and MIR2 expression vector (MIR1+MIR2(2)). [Figure 8-1] Figure 8-1 shows the results of confirming cell surface expression of β2 microglobulin (B2M) by flow cytometry using cells transfected with 2.5 μg or 5.0 μg of an MIR1 expression vector or an MIR2 expression vector. [Figure 8-2] Figure 8-2 shows the results of confirming cell surface expression of β2 microglobulin (B2M) by flow cytometry using cells transfected with 2.5 μg or 5.0 μg of MIR1+MIR2 expression vector (MIR1+MIR2(1)) or cells co-transfected with 2.5 μg or 5.0 μg of MIR1 expression vector and MIR2 expression vector (MIR1+MIR2(2)). [Figure 9-1]Figure 9-1 shows the results of confirming the cell surface expression of ICAM-1 by flow cytometry using cells into which 2.5 μg or 5.0 μg of an MIR1 expression vector or an MIR2 expression vector had been introduced. [Figure 9-2] Figure 9-2 shows the results of flow cytometry confirming cell surface expression of ICAM-1 using cells transfected with 2.5 μg or 5.0 μg of MIR1+MIR2 expression vector (MIR1+MIR2(1)) or cells co-transfected with 2.5 μg or 5.0 μg of MIR1 expression vector and MIR2 expression vector (MIR1+MIR2(2)). [Figure 10] Figure 10 shows a schematic diagram of an MIR1-expressing AAV vector into which the MIR1 gene has been introduced, an MIR2-expressing AAV vector into which the MIR2 gene has been introduced, and an MIR1+MIR2-expressing AAV vector into which both the MIR1 gene and the MIR2 gene have been introduced. [Figure 11] Figure 11 shows the relative expression levels of MIR1 gene mRNA relative to GAPDH expression in cells expressing MIR1 protein, MIR2 protein, or both MIR1 and MIR2 proteins using an AAV viral vector. [Figure 12] Figure 12 shows the relative expression levels of MIR2 gene mRNA relative to GAPDH expression in cells expressing MIR1 protein, MIR2 protein, or both MIR1 and MIR2 proteins using an AAV viral vector. [Figure 13] Figure 13 shows the relative expression levels of MIR1 gene mRNA and MIR2 gene mRNA relative to GAPDH expression in cells expressing MIR1 protein, MIR2 protein, or both MIR1 protein and MIR2 protein (two types) using an AAV viral vector. DETAILED DESCRIPTION OF THE INVENTION

[0012] As described above, an objective of the present invention is to provide a simple technique for producing cells that can evade the immune system of a recipient individual when transplanted; more specifically, to develop a technique for producing cells that can evade the immune system of a recipient individual by mimicking the means by which viruses evade the immune system of a recipient individual.

[0013] In order to solve this problem, the inventors of the present invention have investigated the possibility of mimicking the mechanism by which herpesviruses evade the immune system of an infected host, thereby enabling transplant cells to evade the immune system of a transplanted recipient. It has been revealed that after infecting a host, Kaposi's sarcoma-associated herpesvirus expresses MIR1 / MIR2 in host cells and degrades and neutralizes HLA, thereby evading the host's immune response (resulting in latent infection).

[0014] The MIR1 protein and MIR2 protein derived from Kaposi's sarcoma-associated herpesvirus (KSHV) used in the present invention are proteins that have been found to satisfy the requirement of suppressing the function of MHC class I in an infected host, The MIR1 protein is, for example, a protein consisting of 322 amino acids (SEQ ID NO: 2) encoded by a nucleic acid sequence (SEQ ID NO: 1) consisting of 969 nucleotides registered at positions 18574 to 19542 in the coding region of the MIR1 / K3 ORF in the genome sequence (Human herpesvirus 8 strain GK18, complete genome: NC009333.1); On the other hand, the MIR2 protein is a protein consisting of 256 amino acids (SEQ ID NO: 4) encoded by a nucleic acid sequence (SEQ ID NO: 3) consisting of 771 nucleotides registered at positions 25865 to 26635 in the coding region of the MIR2 / K5 ORF in the genome sequence (Human herpesvirus 8 strain GK18, complete genome: NC_009333.1).

[0015] Both of these proteins have a characteristic structure, with two transmembrane domains and a zinc finger domain similar to the PHD domain, and suppress the function of MHC class I in host cells. The MIR1 protein suppresses all HLA-A, HLA-B, HLA-C, and HLA-E allotypes. The MIR2 protein strongly suppresses HLA-A and HLA-B, but weakly suppresses HLA-C and HLA-E. It has been shown that:

[0016] Based on these characteristics, the immune evasion mechanisms of MIR1 and MIR2 proteins in the case of herpes viruses have been reported to date as follows: (A) When only the MIR1 protein is expressed in host cells, infected cells are eliminated because they can avoid CTL (cytotoxic T lymphocytes) by suppressing MHC class I but are impaired by NK cells; (B) When only MIR2 protein is expressed in host cells, the expression of MHC class I allotypes HLA-C and HLA-E is maintained, and NK cell-activating molecules such as ICAM-1 are suppressed, allowing the antigen to escape from NK cells. However, the expression of HLA-A and HLA-B cannot be completely suppressed by MIR2 protein alone, preventing the antigen from escaping from CTLs. (C) When both MIR1 and MIR2 proteins are expressed in host cells, the infected cells can evade both CTL and NK cells and remain latent within the host; This is the hypothesis that has been proposed (Ishido Satoshi, Biochemistry, Vol. 82, No. 8, pp. 702-709, 2010).

[0017] The inventors of the present invention conducted research based on this hypothesis and discovered that by providing recombinant cells in which virus-derived MIR1 and MIR2 proteins are produced, it is possible to evade the immune system of the recipient individual when the recombinant cells are transplanted, leading to the completion of the present invention.

[0018] That is, the present invention provides, as a first aspect, MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; A recombinant cell in which to provide.

[0019] The MIR1 protein used in the present invention may be a protein consisting of 322 amino acids (SEQ ID NO: 2) encoded by a nucleic acid sequence (SEQ ID NO: 1) consisting of 969 nucleotides registered at positions 18574 to 19542 in the coding region of the MIR1 / K3 ORF in the genome sequence (Human herpesvirus 8 strain GK18, complete genome: NC009333.1), or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the amino acid sequence of this MIR1 protein.

[0020] Here, proteins having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein (SEQ ID NO: 2) can be used that have the activity of suppressing all HLA-A, HLA-B, HLA-C, and HLA-E allotypes, similar to the MIR1 protein.

[0021] Therefore, the recombinant cells of the present invention are characterized in that, when transplanted into a recipient individual, they express the MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein, and are able to suppress the cytotoxic T cell (CTL) response against the cells by suppressing MHC class I of the host immune system, thereby avoiding attack by the host's CTLs.

[0022] Meanwhile, the MIR2 protein used in the present invention may be a protein consisting of 256 amino acids (SEQ ID NO: 4) encoded by a nucleic acid sequence (SEQ ID NO: 3) consisting of 771 nucleotides registered at positions 25865 to 26635 in the coding region of the MIR2 / K5 ORF in the genome sequence (Human herpesvirus 8 strain GK18, complete genome: NC_009333.1), or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the amino acid sequence of this MIR2 protein.

[0023] Here, a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein (SEQ ID NO:4) can be used that, like the MIR2 protein, strongly suppresses HLA-A and HLA-B, but weakly suppresses HLA-C and HLA-E.

[0024] Therefore, the recombinant cells of the present invention express the MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein, and when transplanted into a recipient individual, they maintain the expression of HLA-C and HLA-E, and furthermore, by suppressing NK cell-activating molecules such as ICAM-1, they are able to suppress the NK cell response against the cells and avoid attack by the recipient individual's NK cells.

[0025] The present invention is characterized by providing recombinant cells in which both of these two types of proteins are produced. By producing both of these virus-derived proteins in cells, the action of the MIR1 protein suppresses MHC class I of the host immune system, thereby suppressing the cytotoxic T cell (CTL) response against the cells and avoiding attack by the host's CTLs. The action of the MIR2 protein maintains the expression of HLA-C and HLA-E, and further suppresses NK cell-activating molecules, thereby suppressing the NK cell response against the cells and avoiding attack by the recipient's NK cells. As a result, it has been shown for the first time that when the recombinant cells of the present invention are transplanted into a recipient, the recombinant cells can avoid the immune response of the transplanted recipient.

[0026] In the present invention, the term "cells" refers to cells used for transplantation into a recipient individual, and examples include cells commonly used for transplantation, such as human pluripotent stem cells, human somatic stem cells, and human somatic cells. Therefore, the cells of the present invention prepared according to the method of the present invention can be used as materials for administration to a living organism. For example, the cells can be administered to a living organism as they are, or they can be used as a starting material to differentiate and induce cells or tissue materials for transplantation into a living organism in transplantation therapy, and then administered to the living organism.

[0027] In one aspect of the present invention, cells for administration to a living body can be provided that are differentiated and induced from the cells of the present invention described above. The cells of the present invention are prepared using, for example, human pluripotent stem cells, human somatic stem cells, human somatic cells, or other source cells, and can be differentiated and induced appropriately depending on the therapeutic target of the individual to be transplanted. The cells for administration to a living body may be in the form of dispersed cells, a cell sheet, or a tissue with a three-dimensional structure.

[0028] As described above, the recombinant cells of the present invention have been shown to be able to avoid an immune response in an individual when transplanted into the recipient, and therefore, when administered to the body, they are not recognized as non-autologous cells by the immune system of the recipient, and as a result, when transplanted into the recipient in various forms, they can persist in the body without being eliminated by the recipient even without the administration of immunosuppressants. Therefore, the main use of the recombinant cells of the present invention is for transplantation or administration into the body.

[0029] The recombinant cells of the present invention are intended to be transplanted or administered to a living body. The recombinant cells thus produced may be transplanted or administered as they are, or may be differentiated or induced into cells to be transplanted and then transplanted or administered.

[0030] Therefore, in another aspect of the present invention, MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. Recombinant cells for administration to living bodies, which are differentiated and induced from cells that produce can also be provided.

[0031] In addition, by utilizing these effects, in another embodiment of the present invention, MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; A cell transplantation method or cell therapy method that suppresses immune responses in vivo, comprising administering recombinant cells for administration to a living body that have been differentiated or induced from cells that have produced the compound intracellularly. can also be provided.

[0032] In yet another aspect, the present invention can provide a pharmaceutical agent that suppresses an immune response in vivo associated with cell transplantation or cell therapy, comprising recombinant cells for administration to a living body that are differentiated or induced from the recombinant cells of the present invention. MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. A drug that suppresses immune responses to cells in vivo associated with cell transplantation or cell therapy, including recombinant cells for administration to living bodies that are differentiated or induced from recombinant cells that produce the above-mentioned compound in cells. can also be provided.

[0033] In the present invention, by producing both the MIR1 protein (SEQ ID NO: 2) and the MIR2 protein (SEQ ID NO: 4) in recombinant cells, immune responses in recipients can be suppressed when the recombinant cells are transplanted. Based on this, in yet another embodiment, MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; immunosuppressants, including can also be provided.

[0034] When it is desired to suppress both CTL responses and NK cell responses, this immunosuppressant can be administered to a living body and made to function by being present in the blood.

[0035] The present invention has demonstrated that by producing the above-mentioned two types of proteins in cells, when the recombinant cells are transplanted into a recipient individual, it is possible to avoid an immune response in the recipient individual. Therefore, in another aspect of the present invention, an expression vector for expressing these proteins can also be provided. Specifically, A nucleic acid having a base sequence encoding the MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; A nucleic acid having a nucleotide sequence encoding the MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein. an expression vector in which the above-mentioned can be provided.

[0036] The nucleotide sequence encoding the MIR1 protein (SEQ ID NO: 2) may be the 969-nucleotide nucleic acid sequence (SEQ ID NO: 1) registered at 18574 to 19542 in the coding region of the MIR1 / K3 ORF in the genome sequence (Human herpesvirus 8 strain GK18, complete genome: NC009333.1), or it may be a nucleic acid sequence in which bases of degenerate codons within this nucleic acid sequence are substituted without any amino acid mutations specified by the codons. Nucleic acids having such nucleotide sequences can be prepared by any combination of methods commonly used in the technical field to which the present invention pertains, such as a method for obtaining a nucleic acid of a desired nucleotide sequence using artificial synthesis techniques, or a method for preparing a cDNA library from biological tissues or cells and obtaining a desired sequence by PCR.

[0037] A base sequence encoding a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR1 protein (SEQ ID NO: 2) can be prepared by designing the amino acid sequence of the protein to be expressed and then substituting bases in a nucleic acid sequence such as the aforementioned nucleic acid sequence (SEQ ID NO: 1) so that the amino acid sequence can be specified.

[0038] The nucleotide sequence encoding the prepared MIR1 protein (SEQ ID NO: 2) or the nucleotide sequence encoding a protein having an amino acid sequence of the MIR1 protein with one or several amino acid substitutions, insertions, or deletions can be expressed in cells using methods known in the art, for example, using an expression vector construct or a viral vector construct. For example, the nucleic acid sequence encoding the protein of interest can be cloned into a plasmid vector and introduced into cells for transplantation, or cloned into a viral vector construct such as adenovirus, adeno-associated virus, or lentivirus, and introduced into cells for transplantation together with a vector encoding the viral envelope, and the cells can be cultured to allow intracellular expression.

[0039] Furthermore, the nucleotide sequence encoding the MIR2 protein (SEQ ID NO: 4) may be the 771-nucleotide nucleic acid sequence (SEQ ID NO: 3) registered at 25865 to 26635 in the coding region of the MIR2 / K5 ORF in the genome sequence (Human herpesvirus 8 strain GK18, complete genome: NC_009333.1), or a nucleic acid sequence in which bases of degenerate codons within this nucleic acid sequence are substituted without any amino acid mutations specified by the codons. Nucleic acids having such nucleotide sequences can be prepared by any combination of methods commonly used in the technical field to which the present invention pertains, such as a method for obtaining a nucleic acid of a desired nucleotide sequence using artificial synthesis techniques, or a method for preparing a cDNA library from biological tissues or cells and obtaining a desired sequence by PCR.

[0040] A nucleotide sequence encoding a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein (SEQ ID NO: 4) can be prepared by designing the amino acid sequence of the protein to be expressed and then substituting nucleotides in a nucleic acid sequence such as the aforementioned nucleic acid sequence (SEQ ID NO: 3) so that the amino acid sequence can be specified.

[0041] The nucleotide sequence encoding the prepared MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein can be expressed in cells using methods known in the art, for example, using an expression vector construct or a viral vector construct. For example, the nucleic acid sequence encoding the protein of interest can be cloned into a plasmid vector and introduced into cells for transplantation, or cloned into a viral vector construct such as adenovirus, adeno-associated virus, or lentivirus, and introduced into cells for transplantation together with a vector encoding the viral envelope, and the cells can be cultured to allow intracellular expression.

[0042] In the present invention, since it is necessary to produce the two types of proteins described above in cells, two types of nucleic acids having base sequences encoding these two types of proteins can be expressibly incorporated into separate vector constructs and co-transfected as two types of expression vectors, or they can be expressibly incorporated into a single vector construct and transfected as a single expression vector. The method for incorporating the two types of nucleic acids into a single vector construct can be any method known in the art, and the two types of nucleic acids can be incorporated into the vector construct in any order, or the two types of nucleic acids can be linked together and then incorporated into the vector construct.

[0043] Here, "expressibly incorporating" into a vector construct means that when a nucleic acid molecule of interest to be expressed is incorporated downstream of a promoter sequence contained in the vector construct, transcription from the nucleic acid molecule to mRNA occurs based on instructions from the promoter, and as a result, a protein is translated based on that mRNA in the transformed cell.

[0044] The expression vectors thus constructed can be applied to cells in vitro to generate recombinant cells, or can be administered in vivo to target cells present in the living body to generate recombinant cells in the living body, i.e., can be used for gene therapy.

[0045] In the present invention, it is anticipated that the constructed expression vector will be used in gene therapy. Therefore, it is preferable to use a plasmid vector or a viral vector construct that can be used in gene therapy as the vector construct. For example, it is preferable to use a viral vector construct such as an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector.

[0046] Furthermore, since it is envisaged that the constructed expression vector will be used in gene therapy, the expression vector of the present invention can be one that is administered to a living body.

[0047] The present invention has demonstrated that by expressing the above-mentioned two types of proteins in cells, when the cells are used for transplantation, the immune reaction of the recipient individual against the cells can be suppressed. Based on this finding, the present invention provides: A nucleotide sequence encoding the MIR1 protein (SEQ ID NO: 2) or a nucleotide sequence encoding a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; A nucleotide sequence encoding the MIR2 protein (SEQ ID NO: 4) or a nucleotide sequence encoding a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. A method for suppressing immune responses against recombinant cells by administering to the cells an expression vector comprising the compound in a vector construct capable of expressing the compound in the cells. can be provided.

[0048] The present invention will be specifically illustrated by the following examples, which are not intended to limit the present invention in any way. [Example]

[0049] Example 1: Creation of recombinant cells In this example, recombinant cells were prepared in which MIR1 and MIR2 proteins were produced.

[0050] In this example, the MIR1 protein to be expressed was represented by the amino acid sequence of SEQ ID NO: 2, and the nucleotide sequence of SEQ ID NO: 1 was used to encode this. The MIR2 protein to be expressed was represented by the amino acid sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 3 was used to encode this. Furthermore, when the MIR1 protein and the MIR2 protein were expressed in a single vector, the MIR1 protein+MIR2 protein to be expressed was represented by the amino acid sequence of SEQ ID NO: 6, and the nucleotide sequence of SEQ ID NO: 5 was used to encode this.

[0051] Using nucleic acids containing these base sequences, we used Vector Builder's plasmid vector design service (URL: https: / / www.vectorbuilder.jp / design / pRP_Exp.html) to design the following plasmid vectors downstream of the EF1α promoter: a plasmid vector carrying only the MIR1 gene (pRP[Exp]-EF1A>{MIR1 / K3}-CAG>Bsd), a plasmid vector carrying only the MIR2 gene (pRP[Exp]-EF1A>{MIR2 / K5}-CAG>Puro), and a plasmid vector carrying both the MIR1 and MIR2 genes (pRP[Exp]-EF1A>{MIR1}:T2A:{MIR2}-CAG>Bsd). We commissioned Vector Builder to construct each vector (see Figure 1).

[0052] 2 x 10 cells in a 6-well plate4 iPS cells (Cat. No. ATCC-BYS0112, 31-year-old Caucasian male, bone marrow-derived) were seeded at a seeding density of 100 cells / well and cultured at 37°C in 5% CO. Five days after seeding, 2.5 μg of each vector was introduced into the iPS cells using the transfection reagent Lipofectamine 3000 (ThermoFisher Scientific, Cat. No. L3000-008), and the iPS cells were then cultured.

[0053] The day after vector transfection, cells transfected with the MIR1 gene and cells transfected with the MIR1 gene and the MIR2 gene were treated with blasticidin (Bsd) at a final concentration of 10 μg / ml and 50 ng of IFNγ, while cells transfected with the MIR2 gene were treated with puromycin (Puro) at a final concentration of 1 μg / ml and 50 ng of IFNγ. Two days after the addition of Bsd and IFNγ or Puro and IFNγ, the cells were harvested for RNA extraction.

[0054] The collected cells were centrifuged to remove the culture supernatant, washed twice with PBS, and collected using the lysis buffer included in the RNA extraction kit RNA easy 50 (QIAGEN, Cat. No. 74104). RNA was then extracted and purified. Next, cDNA from each cell line was synthesized using the PrimeScript RT-PCR Kit (TaKaRa Bio, Cat. No. RR014A) with the purified RNA as a template.

[0055] RT-PCR was performed using the synthesized cDNA. The following combinations of cDNA and primer pairs were used in the RT-PCR: (1) cDNA derived from cells transfected with the MIR1 gene, and a primer pair for the MIR1 gene (2) cDNA derived from cells transfected with the MIR1 gene and a primer pair for the MIR2 gene (3) cDNA derived from cells transfected with the MIR2 gene and a primer pair for the MIR1 gene (4) cDNA derived from cells transfected with the MIR2 gene, primer pair for the MIR2 gene (5) cDNA derived from cells transfected with the MIR1 gene + MIR2 gene, primer pair for the MIR1 gene (6) cDNA derived from cells transfected with the MIR1 gene + MIR2 gene, primer pair for the MIR2 gene (7) cDNA derived from iPS cells (without transfection), primer pair for the MIR1 gene (8) cDNA derived from iPS cells (without transfection), primer pair for the MIR2 gene This was carried out.

[0056] The PCR reaction was performed according to the protocol of heating at 94°C for 2 minutes, followed by 35 cycles of [98°C for 10 seconds → 68°C for 30 seconds], and then storing at 4°C. The primer pairs used have the following sequences: <Primer pair for the MIR1 gene> MIR1-F: agctccaggcgaccaagatg (SEQ ID NO: 7) MIR1-R: ttggttctcccgcttccttg (SEQ ID NO: 8) <Primer pair for the MIR2 gene> MIR2-F: tcgtccacccgcagtgttta (SEQ ID NO: 9) MIR2-R: tttcttggcgctccatctcc (SEQ ID NO: 10)

[0057] The PCR products were electrophoresed on a 1.5% agarose gel and stained with SYBR Green / TAE (10,000x dilution) to detect the PCR products. The fragment sizes of the PCR products were 104 bp for the MIR1 gene and 138 bp for the MIR2 gene. The electrophoresis results are shown in Figure 2. As a result, the MIR1 gene fragment was detected in sample (1), the MIR2 gene fragment in sample (4), the MIR1 gene fragment in sample (5), and the MIR2 gene fragment in sample (6), indicating that recombinant cells into which the target gene had been introduced had been obtained.

[0058] Example 2: Characterization of recombinant cells by immunostaining In this example, the properties of recombinant cells prepared using the expression vector prepared in Example 1 were confirmed by immunostaining.

[0059] 0.5 x 10 cells in a 24-well plate 4 Human iPS cells (Cat. No. ATCC-BYS0112, derived from bone marrow of a 31-year-old Caucasian male) were seeded at a seeding density of 100 cells / well. Five days after seeding, the following vectors were introduced into the iPS cells using the transfection reagent Lipofectamine 3000 (ThermoFisher Scientific, Cat. No. L3000-008) to generate recombinant cells: MIR1 gene recombinant cells: 0.5μg or 1.0μg of MIR1 gene expression vector was introduced MIR2 gene recombinant cells: 0.5μg or 1.0μg of MIR2 gene expression vector was introduced MIR1 gene + MIR2 gene recombinant cells (1): 0.5 μg or 1.0 μg of both MIR1 gene and MIR2 gene were introduced into one vector. MIR1 gene + MIR2 gene recombinant cells (2): 0.5 μg or 1.0 μg of MIR1 gene expression vector and MIR2 gene expression vector were introduced (co-transfection)

[0060] The day after vector transfection, cells transfected with the MIR1 gene and cells transfected with the MIR1 gene and the MIR2 gene were treated with blasticidin (Bsd) at a final concentration of 10 μg / ml and 50 ng of IFNγ, while cells transfected with the MIR2 gene were treated with puromycin (Puro) at a final concentration of 1 μg / ml and 50 ng of IFNγ. Two days after the addition of Bsd and IFNγ or Puro and IFNγ, the cells were harvested and immunostained.

[0061] Immunostaining was performed as follows. First, iPS cells cultured in 24-well plates were fixed with 4% paraformaldehyde (PFA) for 10 minutes at room temperature. Then, they were permeabilized with 0.1% Triton X-100 / PBS for 10 minutes at room temperature and blocked with blocking solution for 60 minutes at room temperature. The samples were then incubated overnight at 4°C with a primary antibody (mouse anti-human HLA-ABC (purified product, BioRad, Cat. No. MCA81) or mouse anti-human CD54 / ICAM-1 (VF27-516) (Cell Signaling Technology, Cat. No. 62133)). Then, a secondary antibody (goat anti-mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 8000) was used. TM The samples were then incubated at room temperature for 60 minutes using a mounting medium containing DAPI (VECTASHIELD Vibrance Antifade Mounting Medium with DAPI (2 ml); VECTASHIELD, Cat. No. H-1800).

[0062] The results of immunostaining using anti-HLA-ABC antibody on cells transfected with 0.5 μg of each vector are shown in Figure 3, and the results of immunostaining using anti-HLA-ABC antibody on cells transfected with 1.0 μg of each vector are shown in Figure 4. The results of immunostaining using anti-HLA-ABC antibody on cells transfected with 0.5 μg of each vector were shown in Figure 4. The results showed that HLA-ABC was suppressed in the MIR1 protein + MIR2 protein transfection groups ((1) and (2)). Furthermore, increasing the amount of each vector to 1.0 μg did not affect cell viability, and the tendency for HLA-ABC expression was similar to that seen when 0.5 μg of vector was transfected.

[0063] Figure 5 shows the results of immunostaining with anti-ICAM-1 antibody using cells transfected with 0.5 μg of each vector, and Figure 6 shows the results of immunostaining with anti-ICAM-1 antibody using cells transfected with 1.0 μg of each vector. Immunostaining with anti-ICAM-1 antibody after transfection with 0.5 μg of each vector revealed suppression of ICAM-1 expression in the MIR2 protein transfected group and the MIR1 protein + MIR2 protein transfected group ((1) and (2)). Furthermore, increasing the amount of each vector to 1.0 μg did not affect cell viability, and the ICAM-1 expression pattern was similar to that observed when 0.5 μg of vector was transfected.

[0064] Example 3: Flow cytometric characterization of recombinant cells In this example, the properties of recombinant cells prepared using the expression vector prepared in Example 1 were confirmed by flow cytometry (FACS).

[0065] 0.5 x 10 cells in a 6-well plate 4Human iPS cells (Cat. No. ATCC-BYS0112, derived from bone marrow of a 31-year-old Caucasian male) were seeded at a seeding density of 100 cells / well. Five days after seeding, the following vectors were introduced into the iPS cells using the transfection reagent Lipofectamine 3000 (ThermoFisher Scientific, Cat. No. L3000-008) to generate recombinant cells: MIR1 gene recombinant cells: 2.5μg or 5.0μg of MIR1 gene expression vector was introduced MIR2 gene recombinant cells: 2.5μg or 5.0μg of MIR2 gene expression vector was introduced MIR1 gene + MIR2 gene recombinant cells (1): 2.5 μg or 5.0 μg of both MIR1 gene and MIR2 gene were introduced into one vector. MIR1 gene + MIR2 gene recombinant cells (2): 2.5 μg or 5.0 μg of MIR1 gene expression vector and MIR2 gene expression vector were introduced (co-transfection)

[0066] The day after vector transfection, cells transfected with the MIR1 gene and cells transfected with the MIR1 gene and the MIR2 gene were treated with blasticidin (Bsd) at a final concentration of 10 μg / ml and 50 ng of IFNγ, while cells transfected with the MIR2 gene were treated with puromycin (Puro) at a final concentration of 1 μg / ml and 50 ng of IFNγ. Two days after the addition of Bsd and IFNγ or Puro and IFNγ, the cells were harvested and analyzed by flow cytometry.

[0067] Flow cytometry was performed as follows: First, for each transduced iPS cell cultured in a 6-well plate, the iPS cells were detached from the plate using TrypLE Select, the cell number was counted, and each sample was transferred to a 1.5 ml tube at 1 × 10 6 The cells were dispensed into aliquots, centrifuged, the supernatant removed, and the precipitated cells were suspended in 200 μl of 0.1% BSA / PBS. Each sample was treated with various antibodies as follows: IgG control (referred to as "IgG" in Figures 7 to 9): Alexa Fluor® 647-labeled mouse IgG1, κ isotype control (ICFC) antibody (BioLegend, Cat. No. 400155) (Figure 7), or FITC-labeled mouse IgG1, κ isotype control antibody (BioLegend, Cat. No. 400107) (Figures 8 and 9). Positive control (represented as "PC" in Figures 7 to 9): iPSCs without expression vectors stimulated with 50 ng / ml IFNγ were stained with FITC-labeled anti-human β2-microglobulin antibody, ALEXA Fluor (registered trademark) 647-labeled mouse anti-human HLA ABC antibody, and FITC-labeled mouse anti-human CD54 (ICAM-1) antibody. HLA-ABC staining (Figure 7): Alexa Fluor® 647-conjugated mouse anti-human HLA ABC antibody (Mouse Anti-Human HLA ABC: Alexa Fluor® 647, BioRad, Cat. No. MCA81A647) B2M staining (Figure 8): FITC-conjugated anti-human β2-microglobulin antibody (FITC anti-human β2-microglobulin antibody, BioLegend, Cat. No. 395706) ICAM-1 staining (Figure 9): Fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD54 (ICAM-1) antibody, 15.2 (FITC Plus Anti-Human CD54 (ICAM-1) (15.2), Proteintech, Inc., Cat. No. FITC-65075) 2 μl of each solution was added and incubated at room temperature in the dark for 30 minutes. Paraformaldehyde was added to each sample to a final concentration of 1%, and the samples were fixed for 10 minutes. The cells were collected by centrifugation, and the precipitated cells were suspended in 600 μl of 0.1% BSA / PBS and analyzed using a FACS Lyric.

[0068] The results of flow cytometry for HLA-ABC are shown in Figures 7-1 and 7-2, the results of flow cytometry for B2M are shown in Figures 8-1 and 8-2, and the results of flow cytometry for ICAM-1 are shown in Figures 9-1 and 9-2. In each figure, from top to bottom, the negative control sample (labeled "IgG") using mouse IgG1 isotype control antibodies (FITC Mouse IgG1, κ Isotype Ctrl Antibody, Biolegend, Cat. No. 400107, Alexa Fluor® 647 Mouse IgG1, κ Isotype Ctrl (ICFC) Antibody, Biolegend, Cat. No. 400155) is shown. The positive control sample (labeled "PC"; for PC, iPS cells without expression vectors stimulated with 50 ng / ml IFNγ were incubated with FITC-labeled anti-human β2-microglobulin antibody, Alexa Fluor® 647-labeled mouse anti-human HLA The results are shown for cells stained with ABC antibody and FITC-labeled mouse anti-human CD54 (ICAM-1) antibody), cells transfected with 2.5 μg of each expression vector (indicated by the vector name and "2.5 μg"), and cells transfected with 5.0 μg of each expression vector (indicated by the vector name and "5.0 μg").

[0069] Flow cytometry analysis of HLA-ABC revealed reduced HLA-ABC expression in cells transfected with the MIR1 expression vector (MIR1 group), cells transfected with the MIR2 expression vector (MIR2 group), and cells transfected with the MIR1+MIR2 expression vector (MIR1+MIR2(1) group). The reduction in HLA-ABC expression in the MIR2 group was somewhat attenuated, but was less pronounced than in the other groups (Figures 7-1 and 7-2). Furthermore, the group in which MIR1 and MIR2 were individually cotransfected (MIR1+MIR2(2) group) also showed a similar level of suppression of HLA-ABC expression as the MIR1 and MIR1+MIR2(1) groups. This trend was consistent with the immunohistochemistry (Figures 3 and 4).

[0070] Flow cytometry analysis of B2M revealed that B2M expression levels were reduced in cells transfected with the MIR1 expression vector (MIR1 group) and cells transfected with the MIR1+MIR2 expression vector (MIR1+MIR2(1) group). Furthermore, the group in which MIR1 and MIR2 were individually co-transfected (MIR1+MIR2(2) group) also showed a similar level of B2M expression suppression as the MIR1 and MIR1+MIR2(1) groups. On the other hand, B2M expression was not affected in cells transfected with the MIR2 expression vector (MIR2 group). It is believed that B2M expression decreases secondary to a decrease in HLA, and these results support this.

[0071] Flow cytometry analysis of ICAM-1 revealed that ICAM-1 expression levels were reduced in cells transfected with the MIR2 expression vector (MIR2 group) and in cells transfected with the MIR1+MIR2 expression vector (MIR1+MIR2(1) group). Furthermore, the group cotransfected with MIR1 and MIR2 individually (MIR1+MIR2(2) group) also showed a similar level of ICAM-1 expression suppression as the MIR2 and MIR1+MIR2(1) groups. On the other hand, no reduction in ICAM-1 expression was observed in cells transfected with the MIR1 expression vector (MIR1 group). This trend was consistent with the immunohistochemistry results (Figures 5 and 6).

[0072] The results of immunostaining in Example 2 and the FACS results in Example 3 showed that the combined use of MIR1 protein, which has a stronger ability to suppress HLA expression, and MIR2 protein, which strongly suppresses ICAM-1, can effectively suppress both HLA and ICAM-1 molecules.

[0073] Example 4: Generation of recombinant cells using AAV vectors In this example, AAV vectors were used to create recombinant cells in which MIR1 and MIR2 proteins were produced.

[0074] In this example, the same nucleotide sequences as those used in Example 1 were used for encoding the MIR1 protein and the MIR2 protein.

[0075] Using nucleic acids having these base sequences, VectorBuilder's AAV viral vector design service (URL: https: / / www.vectorbuilder.jp / design / pAAV_Exp.html) was used to design an AAV viral vector (pAAV[Exp]-EF1A>{MIR1}:WPRE) in which only the MIR1 gene was introduced downstream of the EF1α promoter, an AAV viral vector (pAAV[Exp]-EF1A>{MIR2}:WPRE) in which only the MIR2 gene was introduced, and an AAV viral vector (g pAAV[Exp]-EF1A>{MIR1}:T2A:{MIR2}:WPRE) in which both the MIR1 gene and the MIR2 gene were introduced, and each was produced by VectorBuilder (see Figure 10). 5' ITR: 5' inverted terminal repeat. A sequence located in inverted orientation at both ends of the viral genome that functions as the origin of replication of the viral genome. WPRE (Woodchuck hepatitis virus posttranscriptional regulatory element): A regulatory factor that stabilizes the virus in packaging cells, increases viral titers, and enhances gene expression; BGH pA: Bovine growth factor polyadenylation signal. Functions to terminate RNA transcription; ·3' ITR:3' inverted terminal repeat; T2A: a factor required for co-expression of multiple genes under one promoter. In this example, it is transcribed and translated by EF1α in the form of MIR1-T2A-MIR2, and after translation, T2A is cleaved, allowing the two genes to be co-expressed in the cell; are shown respectively.

[0076] 2 x 10 cells in a 6-well plate4 iPS cells (Cat. No. ATCC-BYS0112, bone marrow-derived, 31-year-old Caucasian male) were seeded at a seeding density of 100 cells / well and cultured at 37°C in 5% CO2. Five days after seeding, the cultured iPS cells were transfected with various amounts of each AAV viral vector, as indicated in the figure, to achieve the desired MOI (MOI = 10,000-1,000,000). Forty-eight hours after AAV viral vector transfection, the cells were harvested for RNA extraction.

[0077] The collected cells were centrifuged to remove the culture supernatant, washed twice with PBS, and collected using the lysis buffer included in the RNA extraction kit RNA easy 50 (QIAGEN, Cat. No. 74104). RNA was then extracted and purified. Next, cDNA from each cell line was synthesized using the PrimeScript RT-PCR Kit (TaKaRa Bio, Cat. No. RR014A) with the purified RNA as a template.

[0078] Using the synthesized cDNA as a template, quantitative PCR (qPCR) was performed using the THUNDERBIRD SYBR qPCR Mix (TOYOBO, Cat. No. QPS-201) and a SYBR Green detection system by the ΔΔCt method. qPCR was performed using the following combination of cDNA, primer pairs, and reference gene (GAPDH): (1) cDNA derived from cells transfected with the MIR1 gene, and a primer pair for the MIR1 gene (SEQ ID NO: 7 and SEQ ID NO: 8) (2) cDNA derived from cells transfected with the MIR1 gene, and a primer pair for the MIR2 gene (SEQ ID NO: 9 and SEQ ID NO: 10) (3) cDNA derived from cells transfected with the MIR2 gene, and a primer pair for the MIR1 gene (SEQ ID NO: 7 and SEQ ID NO: 8) (4) cDNA derived from cells transfected with the MIR2 gene, a primer pair for the MIR2 gene (SEQ ID NO: 9 and SEQ ID NO: 10), (5) cDNA derived from cells transfected with MIR1 gene + MIR2 gene, a primer pair for MIR1 gene (SEQ ID NO: 7 and SEQ ID NO: 8), (6) cDNA derived from cells transfected with MIR1 gene + MIR2 gene, a primer pair for MIR2 gene (SEQ ID NO: 9 and SEQ ID NO: 10), (7) iPS cell (untransduced) derived cDNA, primer pair for MIR1 gene (SEQ ID NO: 7 and SEQ ID NO: 8), (8) iPS cell (untransduced) derived cDNA, primer pair for MIR2 gene (SEQ ID NO: 9 and SEQ ID NO: 10), (9) Reference gene (GAPDH) primer pair (Human GAPDH-F: CTTTGTCAAGCTCATTTCCTGGTAT (SEQ ID NO: 11), Human GAPDH-R: GTGAGGGTCTCTCTCTTCCTCTTGT (SEQ ID NO: 12)) So, I went there.

[0079] qPCR reactions were performed using QuantStudio TM The PCR was performed using a 3 Real-Time PCR System (ThermoFisher Scientific, Cat. No. A28567) with the following protocol: 94°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, followed by 68°C for 30 seconds, and then storage at 4°C. qPCR detection was performed using a qPCR detection kit with Cyber ​​Green (THUNDERBIRD SYBR qPCR Mix, Toyobo, Cat. No. QPS-201) and the ΔΔCt method with GAPDH as the reference gene.

[0080] The obtained quantitative PCR results are shown in Figures 11 and 12. In Figures 11 and 12, the AAV viral vector was introduced at the MOI shown in the table below.

[0081] [Table 1]

[0082] Here, the relative expression levels of MIR1 gene mRNA relative to GAPDH expression are shown 48 hours after addition of the AAV viral vector in cells expressing MIR1 protein, MIR2 protein, or both MIR1 and MIR2 proteins using an AAV viral vector (Figure 11; samples (1), (3), (5), and (7) above). The relative expression levels of MIR2 gene mRNA relative to GAPDH expression are shown (Figure 12; samples (2), (4), (6), and (8) above). In these figures, recombinant cells transfected with the expression vectors prepared in Example 1 were used as comparative controls (plasmid vectors carrying the MIR1 gene (TF-MIR1), the MIR2 gene (TF-MIR2), and both the MIR1 and MIR2 genes (TF-MIR1+2)).

[0083] These results show that when the MOI of the AAV viral vector was low (top panels of Figures 11 and 12), mRNA expression was significantly lower than when transduced with the control plasmid, and a certain increase in expression level was obtained by increasing the MOI number by about 10-fold (bottom panels of Figures 11 and 12).

[0084] Based on the results obtained so far, the MOI of each AAV viral vector (MIR1 expression, MIR2 expression, and MIR1+MIR2 expression) was adjusted to 100,000, which allows efficient mRNA expression, and the cells were harvested for RNA extraction 48 hours after addition of each AAV viral vector, as described above. Cells expressing both MIR1 and MIR2 proteins were also generated by cotransfection with the MIR1 and MIR2 expression AAV viral vectors, and harvested.

[0085] Quantitative PCR was performed on the recovered cells as described above, and the relative expression level of MIR1 gene mRNA relative to GAPDH expression (Figure 13, left) or the relative expression level of MIR2 gene mRNA relative to GAPDH expression (Figure 13, right) is shown 48 hours after addition of the AAV viral vector.

[0086] When expressing both MIR1 mRNA and MIR2 mRNA, it is possible to achieve higher expression levels by introducing the MIR1 gene and the MIR2 gene separately (cotransfection) than by co-expressing them using a single vector. [Industrial Applicability]

[0087] The present invention provides recombinant cells in which virus-derived MIR1 and MIR2 proteins are produced, thereby providing a technology for producing cells that can evade the immune system of a recipient individual when transplanted.

Claims

1. MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein; A recombinant cell in which the

2. 2. The recombinant cell of claim 1, wherein the cell is selected from the group consisting of a human pluripotent stem cell, a human somatic stem cell, and a human somatic cell.

3. 3. The recombinant cell according to claim 1 or 2, which, when administered in vivo, is not recognized as a non-autologous cell by the immune system of a recipient individual.

4. The recombinant cell according to claim 1 or 2, for transplantation or administration to a living organism.

5. The recombinant cell of claim 1 or 2, which produces MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein within the cell, thereby suppressing MHC class I of the recipient individual's immune system and thereby suppressing cytotoxic T cell (CTL) responses against the cell.

6. The recombinant cell of claim 1 or 2, which produces in the cells an MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein, thereby maintaining the expression of HLA-C and HLA-E, and further suppressing the NK cell response against the cells by suppressing NK cell activating molecules.

7. MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. Recombinant cells for administration to living organisms that are differentiated and induced from cells that produce the above intracellularly.

8. MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR2 protein. A pharmaceutical comprising recombinant cells for administration to a living body, which are differentiated and induced from cells that produce the compound intracellularly, and which suppresses immune responses to the cells in the living body associated with cell transplantation or cell therapy.

9. A nucleotide sequence encoding the MIR1 protein (SEQ ID NO: 2) or a nucleotide sequence encoding a protein having an amino acid sequence containing one or several amino acid substitutions, insertions, or deletions in the MIR1 protein; and An expression vector in which a base sequence encoding the MIR2 protein (SEQ ID NO: 4) or a base sequence encoding a protein having an amino acid sequence containing one or more amino acid substitutions, insertions, or deletions in the MIR2 protein is incorporated into a vector construct in such a way that it can be expressed.

10. The expression vector of claim 9, which is used for gene therapy.

11. 11. The expression vector of claim 9 or 10, wherein the vector construct is selected from the group consisting of a plasmid vector, an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

12. 11. The expression vector according to claim 9 or 10, for administration to a living body.

13. An immunosuppressant comprising MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence in MIR1 protein that includes one or more amino acid substitutions, insertions, or deletions, and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence in MIR2 protein that includes one or more amino acid substitutions, insertions, or deletions.

14. The immunosuppressant according to claim 13, for administration to a living body.

15. A cell transplantation method or cell therapy method that suppresses immune responses in the body, comprising administering recombinant cells for administration to the body that have been differentiated or induced from cells that have produced MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence in the MIR1 protein that includes the substitution, insertion, or deletion of one or more amino acids, and MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence in the MIR2 protein that includes the substitution, insertion, or deletion of one or more amino acids.

16. A method for suppressing an immune response to recombinant cells by administering to the cells an expression vector in which a base sequence encoding the MIR1 protein (SEQ ID NO: 2) or a protein having an amino acid sequence in the MIR1 protein that includes one or more amino acid substitutions, insertions, or deletions, and a base sequence encoding the MIR2 protein (SEQ ID NO: 4) or a protein having an amino acid sequence in the MIR2 protein that includes one or more amino acid substitutions, insertions, or deletions, are incorporated into a vector construct in an expressible manner.

Citation Information

Patent Citations

  • Hypoimmunogenic cells

    WO2021241658A1

  • Cell with suppressed expression of MHC class i

    WO2021251271A1