Treatment of mitochondrial diseases

Deoxyribonucleosides are administered to enhance POLG enzyme activity, addressing defects in mtDNA replication and deletion disorders, effectively restoring mtDNA levels and improving enzyme function across various mitochondrial diseases.

JP2025172733APending Publication Date: 2025-11-26FUNDACIÓ HOSPITAL UNIVERSITARI VALL D HEBRON - INSTITUT DE RECERCA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025124734
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2015-06-05
Filing Date
2025-07-25
Publication Date
2025-11-26

AI Technical Summary

Technical Problem

Current therapies are ineffective for mitochondrial diseases caused by defects in mitochondrial DNA (mtDNA) replication or depletion, leading to severe disorders with high variability and no known effective pharmacological approaches.

Method used

Administration of deoxyribonucleosides to restore mitochondrial DNA (mtDNA) levels by enhancing polymerase gamma (POLG) enzyme activity, independent of specific mutations, thereby overcoming defects in mtDNA replication and deletion disorders.

Benefits of technology

Restoration of mtDNA levels to normal levels, improving enzyme activity and reducing cytotoxicity, applicable to a wide range of mitochondrial diseases regardless of the underlying mutation, with potential for fast onset and reduced side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025172733000003
    Figure 2025172733000003
  • Figure 2025172733000004
    Figure 2025172733000004
  • Figure 2025172733000005
    Figure 2025172733000005
Patent Text Reader

Abstract

To provide a composition for use in the treatment of mitochondrial DNA depletion and / or multiple deletions syndrome.SOLUTION: Provided is a composition for use in the treatment of mitochondrial DNA depletion and / or deletion syndrome caused by a defect in DNA polymerase gamma subunit 1 (POLG1), the composition comprising more than one canonical deoxyribonucleoside selected from the group consisting of deoxyadenosine, deoxyguanosine, deoxycytidine, and deoxythymidine, wherein the deoxyribonucleosides are present in an equimolar ratio.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of medicine, in particular to the treatment of mitochondrial diseases, and more particularly to the treatment of mitochondrial diseases. This concerns mitochondrial diseases caused by deletion / depletion of mitochondrial DNA (mtDNA). [Background technology]

[0002] The mitochondrial genome (mtDNA) is contained in multiple copies in each mitochondrion. It is a 16.5 kb DNA molecule that is normally present in the

[0003] An important group of Mendelian mitochondrial diseases are those whose products are involved in mtDNA replication or These rare disorders are caused by mutations in nuclear genes involved in the maintenance of inter-genome Defective transmission of mtDNA, mtDNA depletion disorders, multiple mtDNA deletion disorders, or mitochondrial depletion These are also known as orphan codes (o rphan code: For mitochondrial DNA depletion syndrome, A35698, and ORPHA254807 for multiple mitochondrial DNA deletion syndrome For more information on mitochondrial DNA depletion, please see http: / / www.omim. org / phenotypicSeries / PS603041, Multiple Mitochondrial D For NA deletions, see http: / / www.omim.org / phenotypicS These diseases are recognized in the OMIM database under ser / PS157640. is characterized by mtDNA mutations in one or a combination of affected tissues (e.g., skeletal muscle, liver, brain). It is a complex group of genetically and clinically heterogeneous disorders characterized by the constant presence of

[0004] The severity and progression of these disorders also vary, from mild symptoms (e.g., progressive external ophthalmoplegia) to severe, life-threatening conditions (e.g., muscular atrophy). Severe cases that can lead to death in infancy, such as those seen in the well-known mtDNA depletion syndrome There is a great deal of phenotypic diversity.

[0005] To date, most genes associated with defects in intergenomic transfer have been linked to mtDNA replication. Deoxyribonucleosides, which are directly involved or are the building blocks of DNA synthesis However, the increasing incidence of MDDS is Mutations in genes that cause mtDNA instability through unknown pathological mechanisms Defects in certain genes have been identified (OPA1, MPV17, FBXL4, etc.). It has long been thought that mtDNA deletions lead to either specific depletion or multiple mtDNA deletions. For example, DGUOK defects usually lead to mtDNA depletion, whereas OPA1 defects typically It causes multiple mtDNA deletions. Nevertheless, mtDNA depletion and multiple deletions This may be a possible manifestation of the same pathogenic pathway affecting mtDNA replication and repair. Until recently, genetic testing was limited to childhood-onset mtDNA depletion. Mutations in the offspring (TK2, DGUOK) now also cause multiple mtDNA deletions. It has been shown that the disease can occur in adults in some cases.

[0006] Because MDDS is a multi-organ disorder, supportive care and symptomatic treatment of associated complications are provided. A multidisciplinary team including various specialists is needed to treat the disease.

[0007] To date, no effective therapies have been developed to treat these highly complex diseases. There is essentially no information about the exact factors and mechanisms that cause such diseases. This is due to the variability between one syndrome and another, etc.

[0008] Notwithstanding the above, dNTP substitutions known to impair dNTP availability are Several attempts have been made to find an appropriate treatment for MDDS caused by defects in the For example, recent experimental studies have shown that It has been shown that mtDNA depletion can be overcome by bypassing the defective step involved. The addition of purine dN-monophosphate (dNMP) suppressed mtDNA depletion in TK2-KO mice. It has been reported that deoxyribonucleic acid can relieve thirst (Non-Patent Document 1). The use of ribonucleosides and / or specific inhibitors of their catabolism has been shown to inhibit the synthesis of dNTP homeostasis. Effective pharmacological approaches to treat different MDDS due to defects in osteogenesis It has been reported that this could be a promising approach.

[0009] Despite attempts, therapeutic approaches for these and other MDDS variants is still needed. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Garone C, Garcia-Diaz B, Emmanuele V, Lopez LC, Tadesse S, et al. (2014) Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency. EMBO Molecular Medichine 6:1016-1027. [Non-patent document 2] Camara Y, Gonzalez-Vioque E, Scarpelli M, Torres-Torronteras J, Caballero A, et al. (2014) Administration of deoxyribonucleosides or inhibition of their catabolism as a pharmacological approach for mitochondrial DNA depletion syndrome. Human Molecular Genetics 23:2459-2467. Summary of the Invention [Problem to be solved by the invention]

[0011] The present inventors have demonstrated that administration of deoxyribonucleosides can reduce defects in dNTP metabolism. This may enable the restoration of mtDNA levels in MDDS diseases that are not caused by I found that...

[0012] To date, nucleoside administration has been associated with defects in dNTP metabolism. It was generally believed that it was only effective in treating mitochondrial diseases. The technology aims to identify diseases caused by defects in dNTP metabolism by identifying "defective" nucleic acids. It was hypothesized that the treatment could be overcome by administering certain nucleotides. Only diseases caused by defects in the octides are considered to be "defective" diseases. It was anticipated that treatment could be achieved by administering sufficient amounts of nucleotides / nucleosides.

[0013] Contrary to the teachings of the prior art, the present inventors have demonstrated that polymerase gamma protein 1 (mtDN A mutation affecting the catalytic subunit of one of the enzymes involved in the replication mechanism Deoxyribonucleic acid was introduced into fibroblast samples from patients previously diagnosed with MDDS. Surprisingly, deoxyribonucleosides were administered to these samples. By doing so, the mtDNA levels are determined to be "normal" ( It was found that the level of ATP was restored to normal (normal) levels (Table 3, see below). This leads to abnormal functioning of the POLG1 enzyme, which ultimately has a negative impact on the correct functioning of the replication machinery. The results showed that the deoxyribonucleoside-mediated cytotoxicity (which has a negative effect on the immune system) was suppressed in cells from all three patients. It was not predicted that the same degree of improvement could be achieved by administering dextromethorphan. Restoration of mtDNA levels by administration of xyribonucleosides is consistent with defects in the mtDNA replication mechanism. This indicates that the mutation is unrelated to the cause. [Means for solving the problem]

[0014] Thus, in a first aspect, the present invention provides a method for treating mitochondrial DNA depletion and / or deletion disorders. COMPOSITIONS COMPRISING ONE OR MORE CANNONICAL DEOXYRIBONUCLEOSIDES FOR USE IN THE TREATMENT OF SYNDROMES - Patent application provided that the syndrome is a deoxyribonucleoside triphosphate (dNTP) metabolic disorder. This aspect is also not due to defects in mitochondrial DNA depletion and and / or deletion syndromes. The syndrome may also be treated with a composition containing cleoside, provided that the syndrome is not caused by dextromethorphan. Not due to defects in dNTP metabolism. This aspect may alternatively be applied to deoxyribonucleoside triphosphate (dNTP) metabolism. Prescribed as a treatment for mitochondrial DNA depletion and / or deletion syndromes not due to a defect The method can include administering a therapeutically effective amount of one or more canonical deoxyribonucleic acids. The method includes administering a steroid to a subject in need thereof.

[0015] Experimental data are based on cells from patients suffering from different clinical conditions due to defects in POLG. was obtained.

[0016] POLG is a mitochondrial DNA polymerase called DNA polymerase gamma. In eukaryotic cells, mitochondrial DNA is the gene encoding the catalytic subunit of , the 140 kDa catalytic subunit encoded by the POLG gene and POLG2 A trimeric protein composed of a 55 kDa dimeric auxiliary subunit encoded by a gene It is replicated by the protein complex DNA polymerase gamma, the catalytic subunit It has three enzymatic activities: DNA polymerase activity, misincorporated nucleotides, and 3'-5' exonuclease activity that proofreads the base, and 5'-dR required for base excision repair In the examples below, patients are found to have exonuclease or polymerase P lyase activity. domain (R309C (in the exonuclease domain), and G848S and V11 Mutations in 77L (in the polymerase domain) and the linker region (W748S) He had POLG deficiency caused by

[0017] The inventors have surprisingly found that administration of deoxyribonucleosides has been shown to be effective in all PO "Affects" with respect to LG mutations, meaning that the mutation alters either the function or structure of POLG. Regardless of whether mtDNA levels are affected, the mtDNA levels are restored and the levels shown by healthy subjects are The enzyme activity of the mutant POLG forms was substantially improved, to the extent that it was comparable to that of the mutant form. That is, the administration of deoxyribonucleosides was found to be effective in preventing the formation of polymerase chain reaction (PCR) in the presence of deoxyribonucleosides. It overstimulates a form of the POLG enzyme that is partially deficient in enzyme activity.

[0018] The experimental data presented below (summarized in Table 3 below) indicate that the administration accelerates the rate of mtDNA polymerization independent of mutations in the POLG gene. However, these findings also support the conclusion that mtD mtDNA loss (either due to a reduction in DNA copy number or multiple mtDNA deletions) It is known that proteins from the replication machinery itself (polymerase chain reaction) are characterized by POLG1, POLG2, which encode the gram-negative auxiliary units; PEO1, MGME, among others 1, and DNA2) or proteins indirectly involved in mtDNA replication (e.g., MPV1 Another MDDS disease caused by mutations in deoxyribonucleosides (7) is also This can be effectively treated by overstimulating POLG enzyme activity by administering: Thus, by enhancing POLG activity, there is a substantial increase in mtDNA levels, This is irrespective of the cause of such loss (specific mutations in specific proteins). It is possible to "neutralize" the loss of mtDNA and restore "normal" levels. It also suggests that it is possible.

[0019] Therefore, a dN-based therapeutic strategy would be beneficial for either partially or fully active polymerase activity. mtDNA depletion in any defect where mtDNA replication is attacked, provided by The thirst can be partially or completely counteracted.

[0020] The experiments shown below show that the restoration of mitochondrial DNA levels is independent of the severity of the patient's disease. It can be concluded that these may be irrelevant, which gives the present invention great therapeutic value. Assign a value.

[0021] Further methods related to the administration of deoxyribonucleosides in the treatment of MDDS subjects of the present invention include The main advantages are cost (cheap) and the lack of special requirements for their storage. In addition, canonical deoxyribonucleosides are naturally present in all living organisms. It is a natural compound. [Brief explanation of the drawings]

[0022] [Figure 1] Amino acids of the POLG1 protein from the NCBI database. Highlighted are the following mutations: position 309 → mutation of arginine with cysteine, position 748 → mutation of tryptophan with serine, position 848 → mutation of glycine with serine, position 1143 → mutation of glutamic acid with glycine, position 1177 → mutation of valine with leucine. [Figure 2]Diagram of metabolic pathways involved in mtDNA depletion and deletion syndrome (MDDS). Proteins whose dysfunction is associated with MDDS are labeled with number 1 (involved in dNTP metabolism), number 2 (belonging to the replication machinery), or number 3 (linked to MDDS by an unknown pathological mechanism). Although the association of SUCLA2 and SUCLG1 with nucleotide diphosphate kinases has been demonstrated, their relationship to dNTP metabolism remains unclear. Other proteins involved in dNTP metabolism but not yet associated with MDDS and specific inhibitors of deoxyribonucleoside catabolism enzymes are also depicted: tetrahydrouridine (THU); 5-chloro-6-[1-(2-iminopyrrolidinyl)methyl]uracil hydrochloride (TPI), imucillin H (IH), and erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA).Abbreviations: ABAT: 4-aminobutyrate aminotransferase; ADA: adenosine deaminase; ANT1: adenine nucleotide translocator 1; CDA: cytidine deaminase; cdN: cytoplasmic deoxyribonucleotidase; dAdo: deoxyadenosine; dCK: deoxycytidine kinase; dCTD: dCMP deaminase; dCtd: deoxycytidine; dGK: deoxyguanosine kinase; dGuo: deoxyguanosine; dlno: deoxyinosine; DNA2: DNA replicative helicase 2; dThd: thymidine; dUrd: deoxyuridine; ENT1: equilibrative nucleoside transporter 1; FBXL4: F-box and leucine-rich repeat protein 4; mdN: mitochondrial deoxyribonucleotidase; MFN2: mitofusin-2; MGME1: mitochondrial deoxyribonucleotidase Mitochondrial genome maintenance exonuclease 1; MPV17: mitochondrial inner membrane MPV17; NDPK: nucleotide diphosphate kinase; NMPK: nucleotide monophosphate kinase; OPA1: optic atrophy 1; PNP: purine nucleoside phosphorylase; POLG1: polymerase gamma subunit 1; POLG2: polymerase gamma subunit 2; RNR: ribonucleotide reductase; SAMHD1: SAM domain and HD domain containing protein 1; SUCLA2: β-subunit, succinate-CoA ligase; SUCLG1: α-subunit, succinate-CoA ligase; TK1: thymidine kinase 1; TK2: thymidine kinase 2; TP: thymidine phosphorylase; TS: thymidylate synthase; Twinkle: mitochondrial Twinkle helicase. [Figure 3] Scheme of the experimental design followed to determine mtDNA levels in cells collected at the indicated times (t0, t7, t14, t21, and t26). dN stability was monitored in cell medium after 2–3 days of culture (t16–t17). DETAILED DESCRIPTION OF THE INVENTION

[0023] The present invention relates to a method for treating patients suffering from MDDS caused by defects other than defects in dNTP metabolism. administration of deoxyribonucleosides to the brain can restore mtDNA levels. Based on the findings, nucleosides can be thought of as nucleotides without the phosphate group. A nucleoside is simply a nucleic acid base (also called a nitrogenous base) and and five-carbon sugars (either ribose or deoxyribose), whereas nucleosides Nucleosides consist of a nucleic acid base, a pentose sugar, and one or more phosphate groups. The base is attached to either ribose or deoxyribose via a beta-glycosidic bond. Examples of nucleosides are cytidine, uridine, adenosine, and guanosine. , thymidine, and inosine.

[0024] As explained above, MDDS disease is caused by a disruption in mitochondrial DNA (mtDNA) replication. A group of diseases caused by defects in the mtDNA copy number (mtDNA depletion syndrome) or multiple mtDNA deletions (mtDNA deletion syndromes) These are links to reference sites for these types of pathology techniques. Orphaned sites and Online Mendelian In It is well recognized in the Heritage in Man catalogue.

[0025] This group of mitochondrial diseases is a well-recognized group of diseases caused by mutations in specific genes. They constitute a well-known group of disorders and are therefore well known to experts in mitochondrial disorders. For example, the names by which this group of disorders is called can vary: mtDNA depletion and deletion disorders syndrome [3, 4]; defective intergenomic communication (or signal transduction) [5]; defective mtDNA replication etc. In some cases, two or more of these names coexist in the same publication.

[0026] Diseases caused by defects in mtDNA replication result from mutations in: obtain: A: Genes encoding proteins belonging to the mtDNA replication machinery (numbered in Figure 2) Shown as "2") [7, 8, 9, 10, 11] B: Encodes proteins involved in nucleoside / nucleotide catabolism or anabolism genes (indicated by the number "1" in Figure 2) [12, 13, 14, 15] C: Function is unknown or does not belong to category A or B, mtDN A gene encoding a protein that cannot be biochemically linked to the replication process (Indicated by the number "3" in Figure 2). [16, 17, 18, 19, 20, 21, 22, 2 3, 24]

[0027] This classification is clearly recognized by those skilled in the art [3, 4, 6, 25, 26, 27].

[0028] dNTPs are required at the replication fork as substrates for DNA synthesis. from different metabolic sources, cytoplasmic de novo synthesis and salvage pathways for DNA synthesis and repair The latter is the precursor of two enzymes located in the cytoplasm and mitochondrial matrix. Based on parallel sets. Synthesis of dNTPs is the highest cellular requirement for DNA precursors. The dNTP pool is coupled to nuclear DNA replication at the end of the replication phase (S phase). In cells that divide, or are not dividing, de novo synthesis is significantly reduced. Based on the cytoplasmic activity of mitochondrial thymidylate reductase (RNR), which has recently been (Except for dTMP, for which a synthase has been identified). RNR consists of four ribonucleoside diphosphates. Allosterically balanced reduction to all corresponding deoxyribonucleosides (dN) RNR catalyzes the synthesis of dNTPs, providing cells with a high concentration of dNTPs during the S phase of the cell cycle. contains two copies of the large subunit (R1) and two copies of the small subunit (R2 or p53R2) R2 is a heterotetramer containing R1 and R2. R2 undergoes proteasome-dependent degradation in the late mitotic phase. However, p53R2 is present throughout the cell cycle and its expression is limited in non-dividing cells. Unlike nuclear genome replication, mtDNA synthesis is independent of cell division. Cytoplasmic de novo synthesis supported by p53R2 occurs during the S phase. Although much lower than those provided, mutations in the p53R2 gene are present in mtDNA This has been shown to be essential for mtDNA maintenance, leading to its depletion.

[0029] The salvage synthesis pathway involves the precursor nucleosides dNMP, dNDP and ultimately d The first rate-limiting step in this pathway is the deoxyribonucleic acid (NTP) phosphorylation. It is irreversibly catalyzed by thymidine kinase 1 (TK1) and deoxyribonucleotide kinase (DK2). Deoxycytidine kinase (dCK) functions in the cytosol, whereas thymidine kinase 2 (T K2) and deoxyguanosine kinase (dGK) are localized in the mitochondria. Mutations in mitochondrial kinases involved in the Rubesi pathway cause severe MDDS. Mitochondria involved in the salvage supply of dNTPs for DNA maintenance and repair Further nucleotide kinases completely phosphorylate all four dNMPs, demonstrating their phosphorylation dependence. dNTPs, which are converted to the corresponding dNTPs required for DNA synthesis. Although the chondria matrix is ​​an independent compartment, they are actively connected and have not been widely Bidirectional exchange of pool components across the inner mitochondrial membrane by an unidentified carrier As a result of this crosstalk, changes in dNTP pool size occur in parallel in both compartments. Therefore, mitochondria are thought to be involved in the dNTP synthesis in postmitotic cells. They are more susceptible to defects in their own salvage supplies, in this case Ruppur has decreased significantly.

[0030] The dNTP pool size is determined by the above-mentioned assimilation pathways, the rate of incorporation into DNA, and the rate of dNTP degradation. It depends on the balance between the responsible degradation products reactions.

[0031] dNTPs are incorporated into DNA by mitochondrial polymerase gamma (POLG). The exact mode of mtDNA replication is currently under debate. Although under discussion, the catalytic subunit of polymerase gamma (encoded by POLG1) (composed of a nucleotide sequence encoding the ribosomal protein and two auxiliary subunits encoded by POLG2) , a group formed by Twinkle helicase and single-strand binding (SSB) protein The full mitochondrial replisome has been reconstituted in vitro

[28] . Uncharacterized activities include the transcription of mtDNA molecules (e.g., primase, topoisomerases) for a complete in vivo replication of the process in response to different stimuli and stresses. Some examples are required for the initiation and regulation of the replication process (7S RNA, respectively). MG, which encodes a protein that is involved at some level in the maturation of helicase activity The ME1 and DNA2 genes, mutations of which have recently been associated with MDDS.

[0032] In one embodiment, the syndrome is treated by increasing polymerase gamma activity. This is achieved.

[0033] In one embodiment, one or more deoxyribonucleosides are canonical deoxyribonucleosides. Advantageously, the use of such deoxyribonucleosides allows The onset of effect may be even faster because no extra processing of the metabolites is required. In addition, canonical deoxyribonucleosides are substantially identical to endogenous deoxyribonucleosides. Since the compound is identical to the compound of formula (I), the risk of side effects associated with treating this disease may be reduced.

[0034] In one embodiment of the first aspect of the invention, the syndrome is a disorder characterized by an abnormality in the mitochondrial DNA replication machinery This is due to a defect in

[0035] In another embodiment of the first aspect of the present invention, the defect is in the mitochondrial DNA replication machinery It is caused by one or more mutations in one or more proteins of the

[0036] In yet another embodiment, the protein is DNA polymerase subunit gamma 1 (POLG1), DNA polymerase subunit gamma 2 (POLG2), Twin kle protein (PEO1), mitochondrial genome maintenance exonuclease 1 (MG ME1), and human helicase / nuclease DNA2 protein. In another embodiment, the protein is DNA polymerase subunit gamma 1 ( POLG1) or Twinkle protein.

[0037] Polymerase gamma has one catalytic subunit (encoded by POLG1) and two auxiliary subunits ( It is a heterotrimer composed of NC (encoded by POLG2) and NC The BI database accession number is NP_001119603.1 (Fig. 1 and SEQ ID NO: Also available as 1).

[0038] POLG-related disorders represent a broad and overlapping range of manifestations present from early childhood through late adulthood. The clinical phenotypes of POLG-related disorders include autosomal recessive and dominant adult-onset PE. O, Myoclonic epilepsy, myopathy, and sensory ataxia (MEMSA) syndrome, Mitochondrial Ataxia-neuropathy, including myocardial recessive ataxia syndrome (MIRAS) and sensory ataxia Disability spectrum, neurological disorders, dysarthria, ophthalmoplegia (SANDO) syndrome, and hepatocerebral MD Recently, MNGIE has been reported. POLG mutations were identified in individuals with clinical features but without leukoencephalopathy.

[0039] The incidence of Alpers-Huttenlocher syndrome is approximately 1:50,000 It is thought to be associated with POLG mutations and causes intractable epilepsy and psychomotor retardation. The most severe phenotype is characterized by progressive encephalopathy with stenosis, neurological deficits, and liver failure. Affected individuals usually develop seizures (focal, generalized, myoclonic, and chronic) between the ages of 2 and 4. partial epilepsy continuum, or status epilepticus), typically associated with visual or visual aura They present with headache, hypotension, and psychomotor regression. Early in the course of the disease, areflexia and Hypotension is present, followed later by spastic paraparesis, lasting from months to years. Affected individuals experience liver dysfunction with elevated transaminases, hypoalbuminemia, and dyslipidemia. Hepatic complications develop rapidly. may progress to end-stage liver failure within a few months. CSF protein is generally elevated. Neuroimaging may show gliosis and generalized brain atrophy. Liver histology may show large droplets. Hepatic and microvesicular fatty liver, centrilobular necrosis, fibrosis, cirrhosis, bile duct proliferation, and mitochondria The mtDNA content is decreased in the liver. The progression of the disease is variable, with an average of 10% from onset. Life expectancy ranges from 3 months to 12 years.

[0040] In one embodiment, the mitochondrial DNA depletion and / or deletion syndrome is a mitochondrial DNA depletion syndrome. The defect is due to a defect in the replication pathway, which is caused by the following abrupt change in the POLG1 protein: This is due to one or more of the following mutations: mutation of arginine at position 309 by cysteine ​​

[0029] , mutation of tryptophan residue at position 748 by serine (rs11399409 7), mutation of glycine at position 848 by serine (rs113994098), Gly Mutation at glutamic acid position 1143 (rs2307441) by rheumatoid arthritis and rheumatoid arthritis Mutation at position 1177 of valine by Syn.

[0041] Alternatively, in another embodiment of the first aspect of the invention, the defect is in ANT1, MPV1 7, SUCLA2, FBXL4, ABAT, SUCLG1, MFN2, and OPA1 The mutations are due to one or more mutations in one or more proteins selected from the group consisting of: In another embodiment of this aspect, the defect is in OPA1, SUCLA2, and SUCLG1. The method is caused by one or more mutations in a protein selected from the group consisting of:

[0042] In another embodiment, one or more deoxyribonucleosides are canonical deoxyribonucleosides. In another embodiment, one or more deoxyribonucleosides are , deoxyadenosine, deoxyguanosine, deoxycytidine, and deoxythymidine In yet another embodiment, the composition comprises four canonical cardiomyocytes. In yet another embodiment, the composition comprises four canonical derivatives of xyribonucleosides. hydroxyribonucleosides and no further nucleosides (which means that the composition These four deoxyribonucleosides are uniquely identified as "deoxyribonucleoside components." (The term "compound" means "essentially including, but may include, excipients, carriers, etc.") In yet another embodiment, The composition contains deoxyadenosine, deoxythymidine, deoxycytidine, and deoxyguanylate. In yet another embodiment, the composition comprises deoxyadenosine, deoxyadenosine, Contains thymidine, deoxycytidine, and deoxyguanosine, and contains additional nucleosides (This means that the composition does not contain these four nucleosides as "nucleoside components"). (meaning that it uniquely includes, but may include, excipients, carriers, etc.)

[0043] Those skilled in the art will be able to determine the exact deoxyribonucleosides required to restore mtDNA levels. and determining an amount of the compound (i.e., a therapeutically effective amount for ameliorating the signs and symptoms of mitochondrial disorders). In another embodiment, the composition comprises a plurality of canonical deoxyribonucleic acids. When nucleosides are included, the nucleosides are present in equimolar ratios.

[0044] In one embodiment, the composition comprises deoxyadenosine (dAdo), deoxycytidine (dCtd), deoxyguanosine (dGuo), and deoxythymidine (usually thymidine The combination of all nucleosides is equimolar. include.

[0045] In another embodiment, the composition comprises one or more pharmaceutically acceptable inhibitors of nucleoside degradation. The composition further comprises an anti-inflammatory agent.

[0046] There are nucleoside degradation inhibitors well known in the state of the art. Non-limiting examples include: Examples of dGuo degradation inhibitors include Inmucilin H or F volodesine, tetrahydrouridine as a dCtd degradation inhibitor, and dThd degradation inhibitor 5-chloro-6-[1-(2-iminopyrrolidinyl)methyl]uracil hydrochloride (T PI), and erythro-9-(2-hydroxy-3-nonyl) ) adenine (EHNA). Figure 1 shows the mode of action of these inhibitors.

[0047] Those skilled in the art will appreciate that the biological activity of the nucleoside(s) to restore mtDNA levels is important. The amount of inhibitor(s) required to ensure effective availability can be determined.

[0048] In one embodiment, the composition comprises one pharmaceutically acceptable nucleoside degradation inhibitor. In another embodiment, the pharmaceutically acceptable inhibitor is a deoxyadenosine moiety. In another embodiment, the inhibitor is erythro-9-(2-hydroxy- 3-nonyl)adenine (EHNA).

[0049] The active ingredients described for use herein are intended to be used in a variety of applications, including those in which such compositions are administered orally, directly or indirectly. Enteral, parenteral (e.g., intravenous, intramuscular, intraarterial, intraperitoneal, etc.), or inhalation routes, osmotic pumps The pharmaceutical composition may be prepared using a pharmaceutically suitable excipient or carrier selected to be suitable for delivery via the nose, topical, ocular, etc. It can be prescribed.

[0050] Ointments are semisolids consisting of the active ingredient incorporated into a fatty, waxy, or synthetic base. It is a formulation.

[0051] Examples of suitable creams include water-in-oil and oil-in-water emulsions. Water-in-oil creams may contain, but are not limited to, cetyl alcohol or cetostearyl alcohol. It is similar to, but not limited to, fatty alcohol emulsifiers such as alcohol and emulsifying waxes. The formulation can be carried out by using a suitable emulsifier with unspecified properties. Medium-oil creams can be formulated using emulsifiers such as cetomacrogol emulsifying wax. Favourable properties include the ability to modify the viscosity of the emulsion and the ability to vary over a wide range of pH. Physical and chemical stability are included. The water-soluble or miscible cream base contains a preservative system. and can be buffered to maintain an acceptable physiological pH.

[0052] In addition to the topical administration methods described above, there are various methods for systemically administering the compounds of the present invention. Such means include an aerosol suspension of respirable particles of the active compound that are inhaled by the subject. The active compound is absorbed into the bloodstream via the lungs and contacts the systemic circulation in pharmaceutically effective amounts. Respirable particles are liquids with particle sizes small enough to pass through the mouth and larynx upon inhalation. It may be a body or a solid.

[0053] Another means of systemically administering the active compound to a subject is by administering a liquid / liquid suspension in the form of a liquid nasal spray. or administration of respirable particles in the form of a nasal spray, which is inhaled by the subject. Liquid pharmaceutical compositions of the active compound for preparing nasal sprays or nasal drops can be prepared by techniques known to those skilled in the art. The active compound is combined with a suitable vehicle, such as sterile pyrogen-free water or sterile saline. It can be prepared by combining

[0054] Another means of systemic administration of the active compound is when the pharmaceutical composition containing the compound of Formula I is administered as a solid, solution, This includes oral administration in the form of emulsions, dispersions, micelles, liposomes, etc., resulting in The resulting formulation may be mixed with an organic or inorganic carrier or excipient suitable for nasal, enteral, or parenteral application. The active ingredient is, for example, For example, tablets, pellets, capsules, troches, lozenges, aqueous or oily suspensions, dispersible Powder or granules, suppositories, solutions, emulsions, suspensions, hard or soft capsules, caplets Ordinary non-toxic liquids for use as syrups or elixirs and any other suitable form. The pharmaceutical composition can be formulated with a pharmaceutically or physiologically acceptable carrier such as: Contains acacia gum, gelatin, mannitol, starch paste, magnesium trisilicate , talc, corn starch, keratin, colloidal silica, potato starch, urea, Manufacturing of formulations containing medium-chain triglycerides, dextran, and solid, semi-solid, or liquid forms In addition, adjuvants, stabilizers, thickeners, and colorants may be used. The active compounds contemplated for use herein can be administered When present in a pharmaceutical formulation, the compound is present in an amount sufficient to produce the desired effect (i.e., a therapeutically effective amount). Included.

[0055] Those skilled in the art of developing oral delivery systems can select using conventional criteria, and include powders, solutions, suspensions, and the like. The suspensions or tablets contain the active compound in a physiologically compatible vehicle. The formulation may contain flavoring agents (e.g., peppermint) to provide a pharmaceutically elegant and palatable preparation. one or more selected from the group consisting of citric acid, wintergreen oil, or cherry), coloring agents, preservatives, etc. The active ingredient may be in admixture with non-toxic, pharmaceutically acceptable excipients. Tablets containing the compound can also be manufactured by known methods. The excipients used include, for example, (1) carbon inert diluents such as calcium carbonate, lactose, calcium phosphate, sodium phosphate, ( 2) Granulating and disintegrating agents such as corn starch, potato starch, and alginic acid; (3) Binders such as tragacanth gum, cornstarch, gelatin, and acacia, as well as (4) stevia. The tablet may be coated with a lubricant such as magnesium phosphate, stearic acid, talc, or the like. The drug may be uncoated or may be coated by known techniques to prevent disintegration in the gastrointestinal tract. Delays breakdown and absorption, allowing for longer duration of action For example, a time delay material such as glyceryl monostearate or glyceryl distearate. may also be used.

[0056] When the formulation for oral use is in the form of a hard gelatin capsule, the active ingredient is Mixing with a suitable solid diluent such as calcium carbonate, calcium phosphate, kaolin, etc. They also contain active ingredients in water or oil media, e.g., peanut oil, liquid paraffin The compound may also be in the form of a soft gelatin capsule mixed with peanuts, olive oil, etc.

[0057] A further means of systemically administering an active compound to a subject is to deliver a therapeutically effective amount of the compound to the systemic circulation. The present invention also includes suppository forms of the active compound that are administered intravenously.

[0058] Depending on the solubility of the particular formulation of the active compound administered, symptoms of mitochondrial disorders and The symptom-ameliorating daily dose can be divided into one or more unit dose administrations.

[0059] Throughout the specification and claims, the words "comprise" and "comprises" are used interchangeably. Variations of the word "compound" are intended to exclude other technical features, additives, ingredients, or steps. Furthermore, the word "comprise" should not be interpreted as meaning "consisting of" Further objects, advantages, and features of the invention will become apparent from a review of the description. These and other aspects will become apparent to those skilled in the art or may be learned by practice of the invention. Provided as examples, they are not intended to limit the invention. It is intended to cover all possible combinations of the specific preferred embodiments described therein. [Example]

[0060] 1. Method patient Cells from three patients with POLG deficiency were used in the experiment. Informed consent was provided in accordance with the Institutional Review Board and the Declaration of Helsinki. Mutations in POLG (RefSeq NP_001119603.1) were identified by Sanger sequencing. The DNA was identified in all three patients by fibroblast sequencing. The target mutation site was isolated using QiaAMP Mini (Qiagen). A fragment of approximately 500 bp containing the following primer pair and rTaq (Takara) was amplified by conventional PCR using:

[0061] The primers used were as follows: Primer 1 (R309C, 925 c→t) Forward primer GTCCACACCACCAAGCAGT (SEQ ID NO: 2) Reverse primer GGTCCCAAGCACTATGCTCC (SEQ ID NO: 3) Primer 2 (W748S c.2243G→C) Forward primer CCTTGCTGAATGCAGGTGCT (SEQ ID NO: 4) Reverse primer TGTGCCTGAAATCACACTCTGT (SEQ ID NO: 5) Primer 3 (G848S c.2542G→A) Forward primer ATGGTCTGCTGAGTGGTTGT (SEQ ID NO: 6) Reverse primer CCCTCAGAGCCCAGTTTCTAC (SEQ ID NO: 7) Primer 3 (E1143G c.3428A→G) Forward primer CCCAGTTTATGACCAGCCGT (SEQ ID NO: 8) Reverse primer CAAGGAACGCTCACCCAAAG (SEQ ID NO: 9) Primer 4 (V1177L c.3529G→C) Forward primer AGGGGAAGCCCTGCTCTAAG (SEQ ID NO: 10) Reverse primer ACAAATGTGTTGTGCTCACCC (SEQ ID NO: 11)

[0062] Sequencing reactions were performed using the same primers and BigDye v3.1 sequencing kit. The assay was performed using a BigDye X-Te Purified using the Rminator purification kit (Life Technologies). and sequenced on an ABI 3130 sequencer (Applied Biosystems). Patient 1 (homozygous for the p.R309C mutation) presented with severe neurological symptoms. type (neuropathy, encephalopathy, MNGIE-like) leading to death at age 20; patient 2 (p. Compound heterozygotes for the W748S and p.G848S mutations have a less severe manifestation type but mainly neurological (neuropathy, neurological symptoms, MNGIE-like); patients 3(cis p.V1177L and p.E1143G) Heterozygotes (thus heterozygous) have a dominant gene for PEO (progressive external ophthalmoplegia), neurological symptoms, and proximal muscle weakness. Skeletal muscle from all three patients showed accumulation of mtDNA deletions, a well-known pattern of inheritance. showed no significant depletion.

[0063] cell culture Primary fibroblasts were obtained from skin biopsies of patients 1-3 and four healthy donors. All subjects were informed and in accordance with our Institutional Review Board and the Declaration of Helsinki. Consent was submitted.

[0064] Cells were incubated in a humidified incubator at 37°C and 5% CO2 with 2 mM L-glutamine, 4.5 g / L glucose supplemented with 100 U / mL penicillin and streptomycin and Dulbecco's solution containing 10% dialyzed fetal bovine serum (FBS) (Invitrogen). Modified Eagle's Medium (DMEM), 9.5 cm 2 The cells were seeded in a 6-well plate. After reaching dense confluence, FBS was reduced to 0.1% to induce quiescence, and then 5n Simultaneous treatment with EtBr (ethidium bromide, Merck) at 0.05 mg / ml was initiated (0 Day 14 (t14). The cell culture medium was replaced with the same treatment every 2-3 days for 2 weeks. Finally, EtBr was removed from the cell medium and all cell sets were treated with 200 μM EtBr in four doses. All oxynucleosides (dN): dAdo (deoxyadenosine, Sigma), dC td (deoxycytidine, Sigma), dGuo (deoxyguanosine, Sigma) , dThd (deoxythymidine, Sigma), and 5 μM EHNA (Sigma). A set of cells was left untreated and all parameters were monitored in parallel. The cell culture medium was replaced with the same treatment every 2-3 days for another 12 days. On the 16th or 17th day, the culture medium was The culture medium was collected and stored at -20°C until further use. For DNA analysis, cells were collected at 0, 7, and 8 days. On days 14, 21, and 26, the cells were harvested by trypsinization and washed with phosphate-buffered saline. The mixture was pelleted and stored at -20°C until DNA isolation (Figure 2). Total DNA was isolated using the NA mini kit (Qiagen).

[0065] Assessment of deoxynucleoside stability in cell culture media dN and some related metabolites were analyzed by liquid chromatography coupled with tandem mass spectrometry. The data were analyzed by LC-MS / MS using an Acquity UPLC-MS / MS instrument ( Acquity UPLC-Xevo(TM) TQ Mass Spectromete r, Waters, Milford, MA) as previously described. The cell culture medium was subjected to ultrafiltration (3 kDa) at 14,000 × g and 4°C for 30 min. Proteins were purified by Amicon Ultra filters (Millipore). After filtration, the mixture was injected into the LC-MS / MS system.

[0066] mtDNA survey mtDNA copy number was assessed by quantitative PCR as previously described [2].

[0067] PCR conditions and primers disclosed in Nishigaki et al.

[30] Therefore, we investigated mtDNA deletions by long-range PCR blot:

[0068] Forward primer (F1142-1516): ACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGG (Sequence number No. 12) Reverse primer (R1180-1146): ACCGCCAGGTCCTTTGAGTTTTAAGCTGTGGCTCG (Sequence No. No. 13)

[0069] 2.Results EtBr exposure induces greater mtDNA depletion in POLG-deficient quiescent fibroblasts do.

[0070] An important limitation when testing the therapeutic potential of mtDNA depletion is that it is often difficult to identify patients with MDDS. The reason for this is the fact that cells derived from these individuals do not exhibit mtDNA abnormalities in cell culture. Since then, different models have been developed to demonstrate molecular defects affecting mtDNA replication. EtBr exposure depletes mtDNA in cultured cells and To recover normal mtDNA levels, we repeatedly analyzed the replicative capacity of the cells using state-of-the-art techniques. It has been used (Pontarinet et al. "Mammalian ribonuc leotide reductase subunit p53R2 is requi red for mitochondrial DNA replication an d DNA repair in quiescent cells”,2012,PN AS, v.109(33), pages 13302-13307). mtDNA depletion In both healthy control and POLG-deficient quiescent cells, exposure to 5 ng / ml EtBr for 14 days A significant mtDNA depletion was observed in all cells. However, all POLG-deficient cells were found to be fibroblast cell lines derived from healthy controls. We observed a higher degree of mtDNA depletion in fibroblast cell lines compared with that observed in normal mice ( Mean percentage of residual mtDNA levels ± SE: 17.5 ± 2.3%, control cells: 39.68 This data suggests that the molecular defect caused by POLG mutations is responsible for the E of the replication process. This suggests that it may worsen tBr disorders.

[0071] POLG-deficient fibroblasts, when treated with the combination of dN and EHNA, showed a marked increase in EtBr Fully restores mtDNA levels after forced depletion.

[0072] After EtBr removal, the effect of supplementing cell culture medium on the recovery of mtDNA levels in all four dNs was The main findings were that dAdo is particularly sensitive to extracellular and intracellular enzyme degradation. It was previously reported that ADA (adenosine deaminase) [2]. To exert partial inhibition of catabolism and improve its stability, equimolar concentrations of all Four canonical dNs (200 μM dGuo, dAdo, dThd, and dCtd) 5 μM EHNA (Sigma) was added. Following the same protocol as that disclosed in [2], the cells were added at 16-17 days. The concentration of dN was measured, and some of its induced metabolites were also measured in the conditioned medium for 2-3 days. Despite partial decomposition, in all cases the concentration of all remaining dN was the same as that initially added. The difference between conditioned medium from control or patient-derived cells was greater than 70% (Table 2). No significant differences in N stability were observed.

[0073] [Table 1]

[0074] Results are means ± SD from three different POLG-deficient cell lines and four control cell lines. dUrd: deoxyuridine; dIno: deoxyinosine.

[0075] mtDNA recovery was performed before and after EtBr removal in either the presence or absence of dN supplementation. The protocol used was the same as that used in Camara Y. et al., 2014 [2]. (The mtDNA copy number from control cells was significantly higher than that from EtBr removal, regardless of DNA treatment.) After 12 days of administration, mtDNA residual levels reached more than 100% of the initial levels (± SE mean percentage of: 129.8 ± 35.2% without treatment, 153.9 ± 40.6% with treatment). Conversely, POLG-deficient cells cannot restore normal mtDNA levels without additional DNA. (26.6±1.5%).

[0076] [Table 2]

[0077] Values ​​are expressed as the percentage of mtDNA copy number relative to the mtDNA copy number on day 0. E After tBr-induced depletion, cells were treated with dN+EHNA from day 14 of the experiment or Do not process.

[0078] The results shown in Table 3 indicate that administration of canonical nucleosides improves the health of MDDS patients. We conclude that it is possible to achieve mtDNA levels comparable to those found in normal subjects. (150.3±21.9%, Table 3). Administration of dNTPs to patients suffering from MDDS due to defects other than those in dNTP metabolism In patients with mtDNA mutations, it is possible to restore mtDNA levels to levels associated with a "healthy" state. and demonstrate the therapeutic potential of the combination in the treatment of this type of disease.

[0079] References 1. Garone C, Garcia-Diaz B, Emmanuele V, Lo pez LC, Tadesse S, et al. (2014) Deoxypyrimi dine monophosphate bypass therapy for th ymidine kinase 2 deficiency.EMBO Molecule ar Medichine 6:1016–1027. 2.Camara Y, Gonzalez-Vioque E, Scarpelli M, Torres-Torronteras J, Caballero A, et al. (2014) Administration of deoxyribonucleo sides or inhibition of their catabolism as a pharmacological approach for mitoch ondrial DNA depletion syndrome.Human Mol ecular Genetics 23:2459-2467. 3.Camara Y,Gonzalez-Vioque E,Scarpelli M,Torres-Torronteras J,Marti R(2013)Feed ing the deoxyribonucleoside salvage path way to rescue mitochondrial DNA.Drug Dis cov Today 18:950-957. 4.Suomalainen A,Isohanni P(2010)Mitocho ndrial DNA depletion syndromes-many gene s,common mechanisms.Neuromuscul Disord 2 0:429-437. 5.Spinazzola A,Zeviani M(2005)Disorders of nuclear-mitochondrial intergenomic s ignaling.Gene 354:162-168. 6.Copeland WC(2012)Defects in mitochond rial DNA replication and human disease.C rit Rev Biochem Mol Biol 47:64-74. 7.Naviaux RK,Nyhan WL,Barshop BA,Poulto n J,Markusic D,et al.(1999)Mitochondrial DNA polymerase gamma deficiency and mtD NA depletion in a child with Alpers’ syn drome.Ann Neurol 45:54-58. 8.Hakonen AH,Isohanni P,Paetau A,Herva R,Suomalainen A,et al.(2007)Recessive Tw inkle mutations in early onset encephalo pathy with mtDNA depletion.Brain 130:303 2-3040. 9.Kornblum C,Nicholls TJ,Haack TB,Schol er S,Peeva V,et al.(2013)Loss- of-functi on mutations in MGME1 impair mtDNA repli cation and cause multisystemic mitochond rial disease.Nat Genet. 10.Ronchi D,Di Fonzo A,Lin W,Bordoni A, Liu C,et al.(2013) Mutations in DNA2 Lin k Progressive Myopathy to Mitochondrial DNA Instability.Am J Hum Genet. 11.Longley MJ,Clark S,Yu Wai Man C,Huds on G,Durham SE,et al.(2006) Mutant POLG2 disrupts DNA polymerase gamma subunits and causes progressive external ophthalm oplegia.Am J Hum Genet 78:1026–1034. 12.Mandel H,Szargel R,Labay V,Elpeleg O ,Saada A,et al.(2001) The deoxyguanosine kinase gene is mutated in individuals w ith depleted hepatocerebral mitochondria l DNA.Nat Genet 29:337–341. 13.Saada A,Shaag A,Mandel H,Nevo Y,Erik sson S,et al.(2001) Mitochondrial mutants thymidine kinase in mitochondrial DNA d epletion myopathy.Nat Genet 29:342–344. 14.Bourdon A,Minai L,Greenhouse V,Jais JP,Sa rzi E, et al.(2007) Mutation of RRM2B,enc oding p53-controlled ribonucleotide reduction ctase (p53R2),causes severe mitochondria l DNA depletion.Nat Genet 39:776-780. [ PubMed ] 15. Nishino I, Spinazzola A, Hirano M (199). 9) Thymidine phosphorylase gene mutation s in MNGIE,a human mitochondrial disorder r.Science 283:689–692. 16.Rouzier C,Bannwarth S,Chaussenot A,C hevrollier A,Verschueren A,et al.(2012) The MFN2 gene is responsible for mitocho ndrial DNA instability and optic atrophy ’plus’ phenotype.Brain 135:23-34. 17.Renaldo F,Amati-Bonneau P,Slama A,Ro mana C,Forin V,et al.(2012) MFN2,a new g ene responsible for mitochondrial DNA de pletion.Brain. 18.Ostergaard E,Schwartz M,Batbayli M,C hristensen E,Hjalmarson O,et al.(2005) A novel missense mutation in SUCLG1 assoc iated with mitochondrial DNA depletion,e ncephalomyopathic form,with methylmaloni c aciduria.Eur J Pediatr 169:201-205. 19.Amati-Bonneau P,Valentino ML,Reynier P,Gallardo ME,Bornstein B,et al.(2008) OPA1 mutations induce mitochondrial DNA instability and optic atrophy ’plus’ phe notypes.Brain 131:338-351. 20.Blakely EL,Butterworth A,Hadden RD,B odi I,He L,et al.(2012) MPV17 mutation c auses neuropathy and leukoencephalopathy with multiple mtDNA deletions in muscle .Neuromuscul Disord 22:587-591. 21.Spinazzola A,Viscomi C,Fernandez-Viz arra E,Carrara F,D’Adamo P,et al.(2006) MPV17 encodes an inner mitochondrial mem brane protein and is mutated in infantil e hepatic mitochondrial DNA depletion.Na t Genet 38:570-575. 22.Wedding IM,Koht J,Tran GT,Misceo D,S elmer KK,et al.(2014) Spastic paraplegia type 7 is associated with multiple mito chondrial DNA deletions.PLoS One 9:e8634 0. 23.Bonnen PE,Yarham JW,Besse A,Wu P,Faq eih EA,et al.(2013) Mutations in FBXL4 c ause mitochondrial encephalopathy and a disorder of mitochondrial DNA maintenanc e.Am J Hum Genet 93:471-481. 24.Gai X,Ghezzi D,Johnson MA,Biagosch C A,Shamseldin HE,et al.(2013) Mutations i n FBXL4,encoding a mitochondrial protein ,cause early-onset mitochondrial encepha lomyopathy.Am J Hum Genet 93:482-495. 25.Nogueira C,Almeida LS,Nesti C,Pezzin i I,Videira A,et al.(2014) Syndromes ass ociated with mitochondrial DNA depletion .Ital J Pediatr 40:34. 26.Copeland WC (2008) Inherited mitocho ndrial diseases of DNA replication.Annu Rev Med 59:131-146. 27.Copeland WC (2014) Defects of mitoch ondrial DNA replication.J Child Neurol 2 9:1216-1224. 28.Korhonen JA,Pham XH,Pellegrini M,Fal kenberg M (2004) Reconstitution of a min imal mtDNA replisome in vitro.Embo J 23: 2423-2429. 29.Amiot A,Tchikviladze M,Joly F,Slama A,Hatem DC,et al.(2009) Frequency of mit ochondrial defects in patients with chro nic intestinal pseudo-obstruction.Gastro enterology 137:101-109. 30.Nihigaki Y,Marti R,Hirano M (2004) N D5 is a hot-spot for multiple atypical m itochondrial DNA deletions in mitochondr ial neurogastrointestinal encephalomyopa thy.Human Molecular Genetics 13:91-101.

Claims

1. One or more of the following for use in treating mitochondrial DNA depletion and / or deletion syndromes: A composition comprising a deoxyribonucleoside, The composition is not caused by a defect in dinucleotide triphosphate (dNTP) metabolism.

2. The treatment of the syndrome is achieved by increasing polymerase gamma activity.

10. A composition for use according to claim 1.

3. 10. The method of claim 1, wherein the one or more deoxyribonucleosides are canonical nucleosides.

2. A composition for use as described in 2.

4. the syndrome is caused by a defect in the mitochondrial DNA replication machinery, A composition for use according to any one of claims 1 to 3.

5. The defect is in one or more proteins of the mitochondrial DNA replication machinery. A composition for use according to any one of claims 1 to 4, resulting from a mutation in

6. The one or more proteins are DNA polymerase subunit gamma 1 (POLG1) , DNA polymerase subunit gamma 2 (POLG2), Twinkle protein (PEO1), mitochondrial genome maintenance exonuclease 1 (MGME1), and human and helicase / nuclease DNA2 protein (DNA2).

6. A composition for use according to claim 5.

7. The syndrome is caused by the DNA polymerase subunit gamma 1 (POLG1) protein.

7. The composition for use according to claim 6, which is caused by defects in the

8. The mitochondrial DNA depletion and deletion syndrome is a disorder in the mitochondrial replication pathway. The defect is caused by one of the following mutations in the POLG1 protein: R309C, W748S, V1177L, G848S, E1143, and E1143G 1 or more, and the positions are referred to with respect to SEQ ID NO:

1. Composition for use in

9. The one or more deoxyribonucleosides may be deoxyadenosine, deoxyguanosine, 9. The method of claim 1, wherein the nucleotide sequence is selected from the group consisting of deoxycytidine, deoxythymidine, and deoxythymidine. A composition for use according to any one of the preceding claims.

10. Deoxyadenosine, deoxyguanosine, deoxycytidine, and deoxythymidine A composition for use according to any one of claims 1 to 9, comprising:

11. 11. The composition for use according to claim 10, which does not contain any other additional nucleosides.

12. The composition further comprises one or more pharmaceutically acceptable inhibitors of nucleoside degradation.

12. A composition for use according to any one of claims 1 to 11.

13. the composition further comprises a pharmaceutically acceptable inhibitor of said nucleoside degradation.

13. A composition for use according to claim 12.

14. 13. The method of claim 12, wherein the pharmaceutically acceptable inhibitor is an inhibitor of deoxyadenosine degradation. A composition for use according to any one of claims 1 to 13.

15. The inhibitor is erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA).

15. A composition for use according to claim 14, wherein