HTRA1 modulation for treatment of AMD
By increasing HTRA1 expression in RPE cells using CRISPR-mediated transcriptional activation and gene therapy, the methods address the limitations of current AMD treatments, providing effective prevention and treatment of Chromosome 10-dependent AMD.
Patent Information
- Application Number
- JP2025093119
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-04-10
- Filing Date
- 2025-06-04
- Publication Date
- 2025-12-01
AI Technical Summary
Current treatments for age-related macular degeneration (AMD) are invasive, inconvenient, and often administered only after significant damage has occurred, with no approved methods for early AMD or prevention, and existing approaches focus on reducing HTRA1 expression despite its unexpected benefit in increasing risk.
Methods and compositions that increase HTRA1 expression in retinal pigment epithelial (RPE) cells through CRISPR-mediated transcriptional activation, gene therapy, or small molecule compounds to treat, prevent, or slow the progression of Chromosome 10-dependent AMD.
Increasing HTRA1 expression in RPE cells provides unexpected benefits in treating and preventing AMD, reversing symptoms, and slowing disease progression, contrary to the conventional belief that HTRA1 overexpression increases risk.
Smart Images

Figure 2025175283000019 
Figure 2025175283000020 
Figure 2025175283000021
Abstract
Description
[Technical Field]
[0001] The present invention relates to methods and compositions for the treatment of age-related macular degeneration and finds application in the fields of biology and medicine.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on April 9, 2020, is named 098846-1185529-000810PC_SL.txt, and is 46,642 bytes in size.
[0003] Related Patent Cross-References This application claims priority to U.S. Provisional Application No. 62 / 832,182, filed April 10, 2019, the entire contents of which are incorporated herein by reference. [Background technology]
[0004] Age-related macular degeneration (AMD) is the leading cause of irreversible vision loss in the developed world [for review, see Zarbin, Eur. Ophthalmol. 8:199-206, (1998)], affecting approximately 15% of people aged 60 years and older. An estimated 600 million people are in this demographic age group. The prevalence of AMD increases with age; mild or early forms occur in nearly 30% of people aged 75 years and older, and advanced forms in approximately 7% [Vingerling et al., Epidemiol. Rev. 17(2):347-360, 1995].
[0005] Traditional treatments generally involve bimonthly or as-needed intravitreal injections of therapeutic agents, such as anti-VEGF agents. These treatments require repeated invasive surgeries that cause significant discomfort and inconvenience to patients. The procedures involved in these treatments may also increase the risk of side effects. Furthermore, therapeutic agents are often administered only after choroidal neovascularization (CNV) has occurred and when there is significant damage to the macula. There are no currently approved treatments for early AMD or to prevent the onset of AMD.
[0006] Based on detailed genotyping studies of AMD patients, it is now understood that AMD comprises two distinct biological diseases: Chromosome 1-directed AMD (or "Chr1 AMD"), which results from dysregulation of the complement system, including complement factor H dysregulation, and Chromosome 10-dependent AMD (or "Chr10 AMD"), which is associated with genetic variants in chromosome region 10q26, which harbors the ARMS2 and HTRA1 genes. See Keenan et al, 2015, "ASSESSMENT OF PROTEINS ASSOCIATED WITH COMPLEMENT ACTIVATION AND INFLAMMATION IN MACULAE OF HUMAN DONORS HOMOZYGOUS RISK AT CHROMOSOME 1 CFH-TO-F13B" Invest Ophthalmol Vis Sci. 56:487-79; Hageman, 2015, "METHODS OF PREDICTING THE DEVELOPMENT OF AMD BASED ON CHROMOSOME 1 AND CHROMOSOME 10" U.S. Patent Publication No. 2015 / 0211065, which are incorporated herein by reference. These loci on chromosomes 1 and 10 together account for 95% of all AMD risk in Caucasians, and chromosome region 10q26 has been reported to be strongly associated with increased risk of AMD (Fisher et al., 2005; Rivera et al. 2005). The risk region contains genes (including ARMS2 and HTRA1) that share extensive linkage disequilibrium (LD) (D'=0.99). Summary of the Invention [Problem to be solved by the invention]
[0007] The present disclosure provides methods and compositions for treating, preventing the onset of, slowing the progression of, reversing, or ameliorating the symptoms and signs of Chromosome 10-driven age-related macular degeneration (AMD). [Means for solving the problem]
[0008] In some aspects, the present disclosure provides a method for treating, preventing the onset of, delaying the progression of, reversing, or alleviating the symptoms and signs of Chr10 AMD in a subject by administering an agent that increases HTRA1 expression in the subject's cells (e.g., RPE cells, horizontal cells, or photoreceptor cells).In some cases, the subject has a single chromosome 10 risk allele.In some cases, the subject is homozygous for the chromosome 10 risk allele.In some cases, the subject shows Chr10 AMD clinical phenotype.In some cases, the subject does not carry a chromosome 1 risk allele(s).
[0009] In some approaches, the agent causes the transcription upregulation of endogenous HTRA1 gene sequence. For example, the agent may be a transcription activator that binds to a target sequence in the HTRA1 transcriptional control region or HTRA1 promoter. In some cases, the agent is a fusion protein of i) a DNA targeting protein that can recognize a target sequence in the HTRA1 transcriptional control region and ii) a transcription activator. In some cases, the DNA targeting protein recognizes the target sequence through a guide RNA that is complementary to a sequence in the HTRA1 transcriptional control region or HTRA1 promoter region. In some cases, the DNA targeting protein is an enzymatically inactive Cas9 protein (dCas9). In some cases, the transcription activator is VP16. In some cases, the method further comprises administering an sgRNA that is complementary to a sequence in the HTRA1 transcriptional control region.
[0010] In some cases, administering the agent causes the expression of exogenous HTRA1 protein in target cells (including, for example, RPE cells, horizontal cells or photoreceptor cells).In gene therapy approach, the agent can be a vector such as a viral vector (for example, AAV or lentivirus) that delivers exogenous HTRA1 protein or the nucleic acid sequence that encodes HTRA1 protein, preferably operably linked to promoter.In some cases, the promoter is an RPE-specific promoter.
[0011] In some cases, treating a subject with an agent results in modification of genomic DNA in the subject's RPE cells. For example, genome editing methods can be used to change the sequence in the HTRA1 gene or transcriptional regulatory region and convert one or more risk alleles to corresponding non-risk allele(s). In some cases, the agent is a DNA endonuclease-based system. In some cases, the DNA endonuclease is a Cas9 endonuclease, a zinc finger nuclease, a transcription activator-like effector nuclease, a homing endonuclease, a meganuclease, or a Cre recombinase. In some cases, the agent modifies the genomic DNA to produce a genomic DNA sequence comprising SEQ ID NO: 34. In some cases, the agent modifies the genomic DNA to produce a genomic DNA sequence comprising SEQ ID NO: 14. In some cases, the risk allele sequence (c) at rs36212733 is changed to a non-risk allele sequence (t). In some cases, the agent is administered by subretinal injection. In some cases, the agent is delivered by suprachoroidal injection.In some cases, the agent is delivered by intravitreal injection.In some cases, the agent is delivered by other routes.In some cases, the one or more agents comprise Cas9 and one or more sgRNA, wherein the one or more sgRNA directs Cas9 to the genomic region that comprises one or more risk alleles, thereby modifying the genomic region, and one or more risk alleles are replaced with corresponding non-risk alleles.
[0012] In some cases, the agent is a small molecule compound, peptide, or nucleic acid that increases HTRA1 expression or activity in RPE cells.
[0013] In some aspects, the present disclosure provides a pharmaceutical composition for treating Chr10 AMD, comprising: (i) an agent that increases HTRA1 expression in RPE cells of a subject; and (ii) a pharmaceutically acceptable carrier.
[0014] In one embodiment, the composition of the invention comprises a guide RNA (gRNA) comprising a guide sequence of at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 promoter or the HTRA1 2kb regulatory region. In one embodiment, the HTRA1 promoter has the sequence set forth in SEQ ID NO:5, 7, 8, or 13, and the 2kb regulatory region has the sequence set forth in SEQ ID NO:14.
[0015] In another aspect, the present invention provides a ribonucleoprotein (RNP) complex comprising: (a) a guide RNA (gRNA) comprising a guide sequence of at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 promoter or the HTRA1 2kb regulatory region; and (b) a fusion protein comprising a CRISPR-associated protein (Cas) domain fused to a transcription activator domain, wherein the Cas protein domain lacks nuclease activity, the HTRA1 promoter has a sequence set forth in SEQ ID NO: 5, 7, 8, or 13, and the 2kb regulatory region has a sequence set forth in SEQ ID NO: 14. In one embodiment, the Cas of the RNP complex is dCas9 or dCas12a. In one aspect, the target sequence of the RNP complex is in the promoter, and the transcription activator is selected from VP16, VP64, VP160, MLL, E2A, HSF1, NF-IL6, NFAT1, and NF-kB. In another embodiment, the target sequence of the RNP complex is in the 2 kb regulatory region and the transcriptional activator is LHX2.
[0016] In a further aspect, the present invention includes a ribonucleoprotein (RNP) complex comprising: (a) a guide RNA (gRNA) comprising a guide sequence of at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 2kb regulatory region; and (b) a CRISPR-associated (Cas) protein, wherein the 2kb regulatory region has the sequence set forth in SEQ ID NO: 14. In one embodiment, the Cas of the RNP complex is Cas9, Cas12a, or Cas3.
[0017] In one aspect, the guide sequence of the gRNA or RNP complex comprises at least 15 contiguous nucleotides corresponding to the target sequence. In another aspect, the guide sequence of the gRNA or RNP complex comprises at least 20 contiguous nucleotides corresponding to the target sequence. In yet another aspect, the guide sequence of the gRNA or RNP complex comprises 15-25 contiguous nucleotides corresponding to the target sequence. In one embodiment, the target sequence of the gRNA or RNP complex is contiguous with the protospacer adjacent motif (PAM) NGG.
[0018] In one embodiment, the guide sequence of the gRNA or RNP complex comprises any of SEQ ID NOs: 15-33, or a subsequence comprising at least 15 consecutive bases of any of SEQ ID NOs: 15-33.
[0019] In another aspect, the invention comprises a gRNA or RNP complex wherein (i) the guide sequence comprises any of SEQ ID NOs: 36-49; and / or (ii) the target sequence comprises or is flanked by a risk allele selected from the risk at rs10490924, rs144224550, rs36212731, rs36212732, rs36212733, rs3750848, rs3750847, and rs3750846.
[0020] In another aspect, the invention includes a polynucleotide that encodes a gRNA, wherein the polynucleotide is DNA. In one embodiment, the polynucleotide comprises a promoter operably linked to a sequence encoding the gRNA.
[0021] In yet another aspect, the invention includes a viral vector comprising the polynucleotide.
[0022] In a further aspect, the present invention provides a viral vector comprising a polynucleotide encoding an HTRA1 polypeptide, wherein the polynucleotide comprises a human codon-optimized sequence encoding HTRA1 operably linked to a promoter. In one embodiment, the viral vector is a retrovirus, lentivirus, herpesvirus, or adeno-associated virus (AAV).
[0023] In one embodiment, the promoter of the polynucleotide or viral vector is an RPE-specific promoter.
[0024] In another aspect, the present invention provides an HTRA1 activation system comprising: (a) a vector comprising a DNA sequence encoding a gRNA; and (b) a vector comprising a DNA sequence encoding a fusion protein comprising a Cas protein domain fused to a transcription activator domain, wherein the Cas protein domain lacks nuclease activity. In one embodiment, the vector in (a) and the vector in (b) are different vectors.
[0025] In yet another aspect, the invention includes an HTRA1 targeting system comprising: (a) a vector comprising a nucleic acid encoding a gRNA disclosed herein; and (b) a vector comprising a nucleic acid encoding a Cas protein. In one aspect, the HTRA1 targeting system further comprises (c) a vector comprising a nucleic acid encoding a template repair sequence, wherein the template repair sequence optionally comprises at least one of SEQ ID NOs: 87-94 or the complement of at least one of SEQ ID NOs: 87-94. In one embodiment, (a) and (b) are the same vector, or (a), (b), and (c) are the same vector.
[0026] In yet another aspect, the invention includes an isolated cell comprising the gRNA, RNP, polynucleotide, viral vector, activation system, or targeting system.
[0027] In one aspect, the present invention provides the use of gRNA, isolated polynucleotide, vector, activation system, targeting system or isolated cell for the preparation of a drug for treating age-related macular degeneration (AMD).In another aspect, guide RNA, isolated polynucleotide, vector, activation system, targeting system or isolated cell is used for the preparation of a drug for treating age-related macular degeneration (AMD).In one embodiment, the subject to be treated (a) exhibits Chr10 AMD clinical phenotype; (b) has chromosome 10 risk allele; (c) is homozygous for chromosome 10 risk allele; or (d) does not have chromosome 1 risk allele.
[0028] The present invention further includes methods for increasing HTRA1 expression in a cell, comprising expressing an activation system or a targeting system in the cell.
[0029] In yet another aspect, the present invention includes a method of treating, preventing the onset of, slowing the progression of, or ameliorating the symptoms and signs of Chr10 AMD in a subject, comprising administering an agent(s) that increases HTRA1 expression in the subject's RPE cells, horizontal cells, or photoreceptor cells. In one embodiment, the subject exhibits a Chr10 AMD clinical phenotype. In another embodiment, the subject has a chromosome 10 risk allele. In yet another embodiment, the subject is homozygous for the chromosome 10 risk allele. In yet another embodiment, the subject does not have a chromosome 1 risk allele. In one aspect, transcription of the endogenous HTRA1 gene sequence is increased. In one embodiment, the agent is a ribonucleoprotein complex comprising (a) a fusion protein of an enzymatically inactive Cas protein domain and a transcriptional activator domain and (b) a guide RNA. In one embodiment of this aspect, the enzymatically inactive Cas protein is dCas9. In one embodiment, the ribonucleoprotein complex binds to the HTRA1 promoter region. In another embodiment, the ribonucleoprotein complex binds to the HTRA1 enhancer region.In one embodiment, the transcriptional activator domain binds to the LHX2 binding motif.In yet another embodiment, the agent is a ribonucleic acid complex comprising guide RNA and Cas protein.In another aspect, the subject has a risk allele in the HTRA1 gene enhancer, and the agent is a combination comprising (a) a ribonucleic acid complex comprising guide RNA and Cas protein, and (ii) a template repair polynucleotide comprising the sequence of the non-risk allele corresponding to the risk allele. [Brief explanation of the drawings]
[0030] [Figure 1] FIG. 1 shows in situ hybridization of HTRA1 mRNA in human retina. [Figure 2] FIG. 2 shows microarray analysis of HTRA1 mRNA expression in the Newman dataset. [Figure 3]Figures 3A and 3B show qRT-PCR analysis of HTRA1 mRNA expression in the DiaxonHit (A) and Newman (B) datasets (human ocular tissues). [Figure 4] Figures 4A and 4B show the allele-specific expression of HTRA1 in human ocular tissues (RPE choroid and neural retina) and RPE scrapings, respectively. The amount of HTRA1 mRNA containing the risk allele at rs1049331 was determined relative to the amount of HTRA1 mRNA with the non-risk allele. [Figure 5] Figures 5A and 5B show the polarized expression of HTRA1 protein in hTERT-RPE1 and differentiated human fetal RPE cells. [Figure 6] FIG. 6 shows the amount of HTRA1 protein detected in various tissue extracts from the human eye. [Figure 7] Figure 7 shows the predicted and observed isoforms of the long non-coding RNA lncSCTM1 (LOC105378525). [Figure 8] FIG. 8 shows allele-specific expression of human HTRA1 mRNA and lncSCTM1 RNA in the RPE choroid and retina. [Figure 9] FIG. 9 shows the consensus binding motif for the LHX2 protein and disruption of the motif by the risk allele at the rs36212733 polymorphic site. [Figure 10] Figures 10A and 10B show binding to ChrlO probes containing the non-risk (WT) sequence at rs36212733 of LHX2, but weak binding to the risk sequence and no binding to the scrambled sequence. [Figure 11] FIG. 11 shows the results of the preferential binding affinity of LHX2 to the non-risk Chr10 probe sequence compared to the risk sequence. [Figure 12] 12A and 12B show HTRA1 protein and mRNA levels in human retina by Chr10 genotype group. [Figure 13]13A and 13B show HTRA1 protein and mRNA levels in the RPE choroid by Chr10 genotype group. [Figure 14-1] Figure 14 shows the sgRNA sequences used to target the HTRA1 promoter. [Figure 14-2] Same as above [Figure 15] Figure 15 shows HTRA1 and IL1B mRNA levels (quantitative RT-PCR) using total RNA isolated from h1RPE7 cells treated with CRISPR-based SAM constructs for 72 hours. [Figure 16] FIG. 16 shows HTRA1 mRNA levels (quantitative RT-PCR) in total RNA of h1RPE7 cells mock-transfected or transfected with LentiMPH plasmid (MPH), LentiSAM plasmid (SAM), or both (MPH+SAM) for 72 hours. [Figure 17] Figures 17A and 17B show the levels of HTRA1 (Figure 17A) and IL1B (Figure 17B) mRNA in total RNA (quantitative RT-PCR) from h1RPE7 cells transfected with HTRA1-targeting P7 sgRNA-LentiSAM (P7) or P18 sgRNA (P18) or IL1B-targeting P2 sgRNA-LentiSAM for 72 hours with or without LentiMPH plasmid (MPH). [Figure 18] Figures 18A and 18B show the levels of HTRA1 mRNA (quantitative RT-PCR) in total RNA in h1RPE7 cells transfected with different amounts of P7 sgRNA-LentiSAM plasmid (SAM) for 72 hours. [Figure 19] Figures 19A and 19B show the results of HTRA1 ELISA: (A) standard curve of HTRA1 protein; (B) HTRA1 protein levels in cell culture supernatants of h1RPE7 cells transfected with different amounts (2.5, 5.0, and 7.5 μg) of Ctrl sgRNA- or P18 sgRNA-LentiSAM for 3, 4, and 5 days. [Figure 20]Figures 20A and 20B show the results of normalized HTRA1 protein levels (A) and HTRA1 mRNA levels (B) in h1RPE7 cells transfected with different amounts (2.5, 5.0, and 7.5 μg) of Ctrl sgRNA-LentiSAM or P18 sgRNA for 3, 4, and 5 days. [Figure 21] Figure 21 shows HTRA1 protein levels in cell culture supernatants of h1RPE7 cells transduced for 3, 6, and 9 days with Ctrl- or P18-LentiSAM viral particles at an MOI of 20. Data are plotted as fold increase compared to Ctrl-LentiSAM. [Figure 22] FIG. 22 shows ENPP-2 protein levels (ng / ml) in cell culture supernatants of h1RPE7 transduced with Ctrl- or P18-LentiSAM lentiviral particles at an MOI of 20 for 3, 6, and 9 days. [Figure 23-1] Figures 23A and 23B show the results of normalized HTRA1 protein levels (A) and HTRA1 mRNA levels (B) in h1RPE7 cells transduced with Ctrl sgRNA- or P18 sgRNA-LentiSAM at an MOI of 20 for 3, 6, and 9 days. [Figure 23-2] Same as above [Figure 24] Figure 24 shows HTRA1 mRNA levels in HTRA1 knockdown RPE1 cells transfected with promoterless (None), BEST1, RPE65, or CMV-HTRA1 plasmids using Lipofectamine 3000 for 72 hours compared to the control pCTM259 vector. [Figure 25] FIG. 25 shows HTRA1 mRNA levels in RPE1 cells transfected with promoterless (None), BEST1, RPE65, or CMV-HTRA1 plasmids using Lipofectamine 3000 for 72 hours compared to the control pCTM259 vector. [Figure 26]FIG. 26 shows the time course kinetics of HTRA1 mRNA expression in RPE1 cells (HTRA1 KD) transfected with AAV2-HTRA1 plasmids driven by BEST1-, RPE65-, or CMV-derived promoters. [Figure 27] Figures 27A-27C show the time course kinetics of HtrA1 protein expression in RPE1 cells (HTRA1 KD) transfected with AAV2-HTRA1 plasmids driven by BEST1-, RPE65-, or CMV-derived promoters. [Figure 28] FIG. 28 shows an example of allele-specific deletion of a region within the Chr10 risk locus encompassing the ARMS2 gene. [Figure 29] Figure 29 shows the "causative" (regulatory) region and lncSCTM1 on the AMD chromosome 10 locus. The Chr10 regulatory region is approximately 2-4 kb. A novel lncRNA (designated lncSCTM1) was identified overlapping this regulatory region. The novel lncRNA contains ARMS2 rs10490924. The arrow indicates that lncSCTM1 is transcribed in the antisense direction from the HTRA1 promoter and may share a divergent promoter with HTRA1. [Figure 30-1] Figure 30 shows microarray analysis of HTRA1 mRNA expression using exon-targeted probes in human outer macular RPE choroid (Figure 30A), outer macular retina (Figure 30B), macular RPE choroid (Figure 30C), and macular retina (Figure 30D), comparing Chr10 non-risk (GG) donors with heterozygous (GT) and homozygous risk (TT) donors. [Figure 30-2] Same as above DETAILED DESCRIPTION OF THE INVENTION
[0031] 1. Introduction The present inventors have discovered that increasing HTRA1 mRNA and / or protein levels in the eye (e.g., retinal pigment epithelium) provides benefits to subjects with age-related macular degeneration (AMD) or at risk of developing it.In particular, increasing HTRA1 mRNA and / or protein levels provides benefits to patients with chromosome 10-dependent AMD (or "Chr10 AMD") or who have a genetic predisposition to developing chromosome 10-dependent AMD.
[0032] The present disclosure provides methods and reagents for treating, preventing the onset of, slowing the progression of, reversing, or ameliorating the symptoms and signs of age-related macular degeneration (AMD) by increasing HTRA1 expression or levels in the eye of a subject in need of treatment.
[0033] Exemplary methods for treating, preventing the onset of, slowing the progression of, reversing, or alleviating the symptoms and signs of Chr10 AMD are described. The method includes administering a drug to a subject, wherein the drug increases HTRA1 mRNA and / or protein levels in the subject's RPE cells, or alternatively, horizontal cells or photoreceptor cells. Exemplary methods for increasing HTRA1 mRNA and / or protein levels in cells are described below. In one approach, HTRA1 expression increases in the subject's retinal pigment epithelial (RPE) cells. Approaches for increasing the amount of HTRA1 mRNA and / or protein levels in the eye include transcriptional regulation of HTRA1, including upregulation of endogenous HTRA1 expression using CRISPRa, CRISPR-mediated repair in risk areas, gene therapy for introducing HTRA1 protein-coding sequences into cells, reducing HTRA1 degradation in cells, and cell therapy. However, the present invention is not limited to a specific method, and any effective therapeutic approach can be used. As used herein, "increasing HTRA1 expression" refers to increasing the level of HTRA1 protein by increasing transcription from an endogenous or exogenous gene and production of the gene product (mRNA or protein). Therefore, depending on the context, HTRA1 "expression" can refer to the production of HTRA1 mRNA or HTRA1 protein. "Increasing expression" can also refer to methods of increasing the amount of HTRA1 protein through mechanisms other than transcription, such as increasing the stability of HTRA1 protein or mRNA in cells, increasing the translation rate of HTRA1 mRNA, or directly introducing exogenous HTRA1 protein into cells through mRNA recruitment and direct introduction of exogenous HTRA1 protein into cells. Readers will recognize that "increasing HTRA1 expression" can also refer to increasing the amount of a desired molecular species of HTRA1 protein. For example, in cells expressing endogenous HTRA1 protein associated with a risk genotype, "increasing HTRA1 expression" can refer to increasing the amount of HTRA1 protein with a sequence not associated with the risk genotype. In one approach, HTRA1 serine protease activity is increased.The term "upregulation" can be used to refer to an increase in transcription (e.g., amount of mRNA production) of at least 10%, or at least 20%, or at least 30%, or at least 50%, compared to a subject cell not treated with an agent.
[0034] The finding that increased HTRA1 levels benefit patients was unexpected. The consensus in the AMD field has been that overexpression, not underexpression, of HTRA1 is associated with an increased risk of developing AMD, and that HTRA1 levels or activity should be reduced or inhibited to treat AMD. For example, Dewan et al. (2006) reported that the risk allele (A) of the HTRA1 promoter SNP at rs11200638 is associated with enhanced HTRA1 transcription in cultured RPE cells. Yang et al. (2006) also reported that circulating lymphocytes from individuals homozygous for the risk allele (AA) express higher levels of HTRA1 mRNA compared with lymphocytes from individuals homozygous for the non-risk allele (GG). Chan et al. (2007) reported that HTRA1 expression was upregulated at the mRNA level in preserved eyes of patients with AMD and concluded that enhanced HTRA1 expression is responsible for active neovascularization in the macular lesions of wet AMD. Similarly, Vierkotten et al. (2011) reported that overexpression of HTRA1 correlated with ultrastructural changes in the elastic layer of Bruch's membrane, suggesting that HTRA1 contributes to the pathophysiology of AMD. Jones et al. (2011) reported that overexpression of human HTRA1 in mouse retinal pigment epithelium was associated with the development of major characteristics of polypoidal choroidal vasculopathy (PCV), including choroidal branching vascular networks, polypoidal lesions, severe degeneration of the elastic lamina, and the medial layer of choroidal vessels. DeAngelis (U.S. Patent Publication No. 2013 / 0122016) proposed that reducing the expression of the HTRA1 gene or reducing the biological activity of the HTRA1 gene product could slow the progression of age-related macular degeneration in subjects. Wu et al. (US Patent Publication No. 2013 / 0129743) proposed the use of monoclonal antibodies that bind to and inhibit HTRA1 enzymatic activity for the treatment of AMD.
[0035] 2. HTRA1 regulatory elements associated with AMD The present inventors have identified targets and methods for treating AMD by increasing the level of HTRA1. Our findings are based in part on the studies described in the Examples.
[0036] Using donor eyes from human subjects homozygous or heterozygous (GT, TT) for the AMD risk allele at rs10490924 and from control subjects homozygous (GG) for the non-risk allele, we observed that donors with the AMD risk allele had lower HTRA1 mRNA expression compared to controls. Importantly, the data demonstrated that the reduction in HTRA1 mRNA levels in at-risk patients was tissue-specific. Reductions were detected in the RPE, but not in the neural retina or choroid. Furthermore, comparison of HTRA1 protein and mRNA levels in the human outer macular retina and RPE-choroid as a function of age in donors with and without risk at the Chr10 locus demonstrated that in the retina, HtrA1 levels remained relatively unchanged with age and were independent of the subject's Chr10 risk status, whereas in the RPE-choroid, there was a significant increase in HtrA1 mRNA and protein levels with age in donors without the Chr10 risk allele compared to donors with the risk allele.
[0037] 4kb AMD risk region An HTRA1 allele-specific expression assay was used to narrow the region on chromosome 10 responsible for AMD. The assay used mRNA from a human donor eye with a rare recombination event within the AMD-associated ARMS2 / HTRA1 LD block. We mapped the region associated with reduced HTRA1 mRNA to an approximately 4-kb regulatory region upstream of the HTRA1 coding sequence (located between and including rs11200632 and rs3750846). The 4-kb region includes rs10490924 (ARMS2 A69S). The same genetic region was found by Grassmann et al. (Genetics 2017) to be associated with an increased risk of AMD disease in their analysis of recombination haplotypes in a case-control study. The finding that the 4-kb region we identified as associated with HTRA1 allele-specific expression coincides with a region associated with AMD risk implies that a risk-related reduction in HTRA1 expression leads to an increased incidence of AMD. This region is referred to as the "4 kb AMD risk region," or equivalently as the "4 kb risk region," "4 kb control region," "4 kb causal region," or "4 kb region."
[0038] 2kb AMD risk region Using data describing epigenetic markers of transcriptional activation, we identified an approximately 2-kb genomic region [corresponding to Chr10:122454508-122456564 (hg38)] that overlaps with the 4-kb region and controls HTRA1 transcription. In RPE cells, this region is characterized by markers of transcriptional activation, including H3K27 acetylation; however, this region does not show H3K27 acetylation in retinal tissues or in data from ENCODE using various non-RPE cell lines, suggesting that the chromatin in this region is active in RPE tissues but not in other cell types. The "2-kb AMD risk region" (SEQ ID NO: 14) is also referred to as the "2-kb risk region," "2-kb control region," "2-kb causal region," or "2-kb region." The 2-kb AMD risk region is also referred to as the "HTRA1 enhancer region."
[0039] HTRA1 promoter The HTRA1 "promoter sequence" includes CRISPRa (CRISPR activation) target sequences and other features. The promoter region sequence is provided in the following sequence. Unless otherwise indicated or clear from the context, reference to "promoter" herein is intended to refer to each of these ranges of sequence. SEQ ID NO:8 (300 bp) shows the HTRA1 major promoter sequence, including the 5' 300 bp from the putative transcription start site. SEQ ID NO:5 (469 bp) shows the extended promoter sequence, including additional upstream sequences. SEQ ID NO:7 (400 bp) shows the major promoter sequence plus 100 bp of 5' UTR sequence. The "native promoter region" is SEQ ID NO:13 (853 bp), which includes both promoter and UTR sequences.
[0040] 3. Increased HTRA1 expression through transcriptional activation In some approaches, gene therapy is used to enhance the expression of endogenous HTRA1 in RPE cells. In some approaches, gene therapy involves delivering a transcriptional activator that can bind to the transcriptional regulatory region of HTRA1 and promote HTRA1 transcription. One approach uses a targeting component (e.g., a Cas protein-guide RNA complex) that binds to the HTRA1 promoter region and positions the transcriptional activator near the HTRA1 promoter region. In a related approach, the targeting component binds to the HTRA1 enhancer region and positions the transcriptional activator near a transcriptional activator binding motif.
[0041] In some approaches, transcriptional activator activity is provided by a fusion protein of a transcriptional activator and a DNA targeting protein. The DNA targeting protein disclosed herein can be a DNA targeting protein that binds to the HTRA1 transcriptional control region. Various platforms that use DNA targeting proteins can be used as discussed below. In certain embodiments, the "CRISPRa" (CRISPR activation) method is used. In some cases, the transcriptional activator is provided as a fusion protein in which a nuclease-deficient type II CRISPR-associated protein (Cas) is the DNA targeting protein. Generally, Cas is modified to lack endonuclease activity (i.e., "nuclease-dead Cas" or "dCas"). In some approaches, Cas is dCas9. In some approaches, Cas is dCas12a. In some approaches, Cas is any Cas protein that has a modification that makes it nuclease-deficient. As described above and elsewhere herein, the invention is not limited to this method of activation, and non-Cas proteins or components that direct transcriptional activators to promoter or enhancer regions can be used.
[0042] Thus, in some embodiments of the present invention, dCas9 is used to mediate the upregulation of HTRA1 expression in a CRISPR activation ("CRISPRa") system. In contrast to Cas9, which is widely used in type II CRISPR / Cas systems and generates double-strand breaks in genomic DNA when directed to a target sequence, dCas9 lacks nuclease activity and does not generate double-strand breaks in DNA. Instead, dCas9 can be linked to a transcriptional activator and complexed with a guide RNA (e.g., sgRNA) that specifically hybridizes to a sequence in the HTRA1 promoter region to achieve precise and robust RNA-guided transcriptional control. The use of dCas9-mediated gene activation systems is well known and is described, for example, in Dominquez et al., 2016, "Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation," Nat. Rev. Mol. Cell. Biol. 17: 5-15.
[0043] Other nuclease-deficient Cas proteins can also be used to recruit transcriptional activators to promoter or enhancer sites. For example, a dCas12a domain can be fused to a transcription activator domain for use in the methods of the invention (Sarstedt, "Spotlight on Cas12: A search for more type V Cas12 family members turns up unexpected functionality", Nature Methods, 2019, 16:213-219; Pickar-Oliver et al., "The next generation of CRISPR-Cas technologies and applications", Nature Reviews Molecular Cell Biology, 2019, 20:490-507; Kleinstiver et al., "Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing", Nature Biotechnology, 2019, 37:276-282; Xu et al., 2018, "A CRISPR-dCas toolbox for genetic engineering and synthetic biology", J. Mol. Biol. doi.org / 10.1016 / j.jmb.2018.06.037). In one approach, the Cas12a is Acidaminococcus sp. BV3L6 (AsCas12a).
[0044] Thus, in one embodiment, the method disclosed herein includes administering a drug to a patient, wherein the administration results in delivery of a dCas transcription activator fusion protein and one or more sgRNAs to the patient's eye (e.g., RPE) in need of treatment. The fusion protein binds to the HTRA1 regulatory region under the guidance of one or more single guide RNAs (sgRNAs), thereby upregulating HTRA1 transcription. In one approach, dCas9 is derived from Staphylococcus aureus ("Sa-dCas9"). In another approach, dCas9 is derived from Staphylococcus pyogenes ("Sp-dCas9"). The dCas9 transcription activator fusion protein can take different configurations, such as those disclosed in Dominguez et al., Nat Rev Mol Cell Biol. Jan; 17(1): 5-15 (2016). In one example, the fusion protein can consist of multiple copies of a transcriptional activator and one copy of dCas9.
[0045] 3.1 Fusion proteins for transcriptional activation Transcription factors useful for increasing HTRA1 mRNA or protein expression bind to the HTRA1 promoter or enhancer region, and binding results in increased transcription in target cells, such as RPE cells, horizontal cells, or photoreceptor cells. The term "transcription factor" encompasses factors that bind to promoter regions containing factors that activate transcription via a transactivation domain ("TAD"), and factors that bind to enhancer regions containing factors that activate transcription via scaffolds such as LIM elements and can recruit and assemble additional transcription factors and chromatin remodeling proteins to initiate transcription or through other mechanisms. See, for example, Hirai et al., Structure and functions of powerful transactivators: VP16, MyoD, and FoxA Int. J. Dev. Biol. 2010; 54(11-12):1589-1596. Members of both classes of transcription factors contain a DNA-binding domain that directs the transcription factor to a target promoter or enhancer element and an effector domain (e.g., a TAD or scaffold).
[0046] In one aspect, the present invention utilizes fusion proteins that combine the DNA binding and recognition properties of a nuclease-deficient Cas / guide RNA system with the transcription effector properties of a transcription factor. The transcription factor effector domains used in the present invention can be from any source, but are generally derived from human or viral transcription factors or engineered derivatives thereof. Exemplary transcription factors useful for upregulating HTRA1 transcription include VP16, VP64, VP160 (VP64 consisting of two or more copies of VP16, and VP160 consisting of ten tandem copies of VP16); MLL (UniProt ID Q00613), E2A (UniProt ID P15923), HSF1 (UniProt ID Q00613), NF-IL6 (UniProt ID P17676), NFAT1 (UniProt ID Q13469), NFIX (UniProt ID Q14938), NF-kB (UniProt ID Q04206); MEF2A [Potthoff & Olson (2007), "MEF2: a central regulator of diverse developmental programs," Development 2007; 134(23):4131-4140; UniProt ID Q02078]; and YY1 [Weintraub et al. (2017), "YY1 Is a Structural Regulator of Enhancer-Promoter Loops", Cell 2017;171:1573-88; UniProt ID P25490], LHX2 (ZIBETTI et al., "Epigenomic profiling of retinal progenitors reveals LHX2 is required for developmental regulation of open chromatin", Communications Biology, April 25, 2019, Pages 1-13, 2, UniProt ID P50458).
[0047] Human transcription factors (TFs), or transcriptional activators, are well known and well characterized. For example, Lambert et al. described over 1,600 potential human transcription factors (Lambert et al., 2018, "The Human Transcription Factors" Cell 172: 650-665). Similarly, Fulton et al. (2009), "TFCat: the curated catalog of mouse and human transcription factors", Genome Biol 2009; 10: R29, Vaquerizas et al. (2009), "A census of human transcription factors: function, expression and evolution", Nat. Rev. Genet. 2009; 10: 252-263, Wingender et al. (2015), "TFClass: a classification of human transcription factors and their rodent orthologs", Nucleic Acids Res. 2015; 43: D97-D102. Transcription factor binding motifs are well known and have been identified using TRANSFAC [(Matys et al. (2006), "TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes", Nucleic Acids Res. 2006; 34: D108-D110)], JASPAR [Mathelier et al. (2016), "JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles", Nucleic Acids Res. 2016; 44: D110-D115], and HT-SELEX [Jolma et al.(2013), "DNA-binding specificities of human transcription factors", Cell 2013; 152: 327-339;Jolma et al. (2015), "DNA-dependent formation of transcription factor pairs alters their binding specificity", Nature 2015; 527: 384-388;Yin et al. (2017), "Impact of cytosine methylation on DNA binding specificities of human transcription factors", Science 2017; 356: eaaj2239], UniPROBE[Hume et al. (2015), "UniPROBE,update 2015:new tools and content for the online database of protein-binding microarray data on protein-DNA interactions". Nucleic Acids Re. 2015; 43: D117-D122] and CisBP[Weirauch et al. al. (2014), “Determination and inference of eukaryotic transcription factor sequence specificity", Cell 2014; 158: 1431-1443].
[0048] Fusion proteins in which a transcription factor effector domain is combined with a nuclease-deficient DNA-binding domain can also be generated using programmable nucleases other than Cas proteins, including, for example, TALENs and ZFNs.
[0049] 3.2 Guide RNA In some approaches, the targeting component comprises an RNA having a region complementary to the DNA target. The RNA is referred to as a guide RNA (gRNA), and the region of complementarity may be referred to as a guide sequence. The "guide sequence" of a gRNA is a sequence that confers target specificity. It hybridizes to the opposite strand of the target sequence (i.e., its reverse complement). In nature, many CRISPR systems contain two RNA molecules: a tracrRNA that binds to the Cas endonuclease and a crRNA that binds to the DNA target sequence. Some CRISPR systems (e.g., CRISPR Cas12a / Cpf1) require only the crRNA. In research and biomedical applications, it is more typical to use a chimeric single guide RNA ("sgRNA"), a crRNA-tracrRNA fusion that binds both the Cas and the target, generally eliminating the need for RNase III and crRNA processing. Unless otherwise clear from the context, reference to "sgRNA" is understood to encompass any targeting method using any suitable guide RNA (e.g., sgRNA, crRNA, or other RNA containing a guide sequence) with appropriate binding specificity.
[0050] The most commonly used sgRNA is approximately 100 base pairs in length. The programmable targeting sequence comprises approximately 20 bases at or near the 5' end of the sgRNA. By programming this sequence, the CRISPR Cas9 system or other Cas system can be targeted to any genomic region that is complementary to the sequence.
[0051] Methods for designing sgRNAs that target specific genomic regions are well known in the art.See Doench et al. Nature Biotechnology 34: 184-191, 2016;Horlbeck et al. eLife.5e19760 (2016);Doench et al., Nt.Biotechnol 34 (2): 184-191 (2016);Cui et al., "Review of CRISPR / Cas9 sgRNA Design Tools.Interdiscip.Sci.2018,10:455-465;Jensen,2018,Design principles for nuclease-deficient CRISPR-based transcriptional regulators" FEMS Yeast Research,18:4 and PCT Publication No. WO2018107028. Methods and tools for designing such sgRNAs are commercially available, for example, from Dharmacon, Inc., and are publicly available on websites such as dharmacon.horizondiscovery.com / applications / crispra-transcriptional-activation-for-gene-overexpression or benchling.com / academic; and Broad institute.org / gpp / public / analysis-tools / sgrna-design-help-crisprai.
[0052] In one aspect, the present invention provides a guide RNA (gRNA) comprising a guide sequence comprising at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 promoter. In some cases, the guide RNA is an sgRNA. In some approaches, the guide sequence comprises at least 10, at least 15, at least 20, or at least 25 nucleotides. In some cases, the guide sequence is 20 nucleotides in length. In some embodiments, the present invention provides a guide RNA comprising a guide sequence, wherein the guide RNA is complexed with a Cas (such as Cas9) lacking nuclease activity (e.g., dCas9). In some cases, the present invention provides a guide RNA, such as an sgRNA, complexed with a Cas fusion protein comprising a Cas DNA-binding domain and a transcriptional activator. Typically, the Cas is a nuclease-deficient dCas (such as dCas9).
[0053] In some cases, the DNA target sequence (e.g., in the HTRA1 promoter or enhancer) is adjacent to a protospacer adjacent motif (PAM) recognized by the Cas protein. For example, Cas9 generally requires the PAM motif NGG for activity. Thus, in some systems, certain target sequences (and therefore certain guide sequences) are preferred based on the proximity of the target sequence to the PAM.However, some Cas proteins, including Cas9 mutants, have flexible PAM requirements (Karvekis et al., 2019, "PAM recognition by miniature CRISPR-Cas14 triggers programmable double-stranded DNA cleavage." bioRxiv. https: / / doi.org / 10.1101 / 654897; Legut et al., 2020, "High-Throughput Screens of PAM-Flexible Cas9", Cell Reports 30:2859-2868; Jakimo et al., 2018 Cas9 with Complete PAM Recognition for Adenine Dinucleotides bioRxiv doi.org / 10.1101 / 429654; Esvelt KM, Mali Pet et al. (2013) Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nature Methods, 10(11):1116-1121; Gleditzsch et al., 2019, PAM identification by CRISPR-Cas effector complexes: diversified mechanisms and structures. RNA Biol. 2019 Apr; 16(4): 504-517; Tang et al., 2019, Efficient cleavage resolves PAM preferences of CRISPR-Cas in human cells Cell Regeneration 8:44-50), while other Cas proteins are PAM-independent (e.g., Cas14a1).Exemplary PAMs include SpCas9 NGG from Streptococcus pyogenes; SpCas9 NRG from Streptococcus pyogenes; StCas9 NNAGAAW from Streptococcus thermophilus; NmCas9 NNNNGATT from Neisseria meningitidis; SaCas9 NNGRRT from Staphylococcus aureus; SaCas9 mutant (KKH SaCas9) NNNRRT; SpCas9 D1135E mutant NGG; SpCas9 VRER mutant NGCG; SpCas9 EQR mutant NGAG; SpCas9 VQR mutant NGAN or NGNG3'; AsCpf1 from Acidaminococcus; and LbCpf1 from Lachnospiraceae. TTTN; FnCpf1 TTN and / or CTA from Francisella novicida strain U112; and C2c1 TTN (N = A, T, C, or G; R = A or G; W = A or T) from four major taxa: Bacilli, Verrucomicrobia, Proteobacteria, and d-Proteobacteria, as described in Zhao et al., 2017, CRISPR-offinder: a CRISPR guide RNA design and off-target searching tool for user-defined protospacer adjacent motif. Int J Biol Sci 2017;13(12):1470-1478. Thus, while the commonly used Cas9 protein requires a target sequence and a consecutive NGG PAM, other naturally occurring or engineered Cas proteins have less stringent or no PAM requirements. As a result, through judicious selection of the CRISPR / Cas system, practitioners can select almost any subsequence within the HTRA1 transcriptional regulatory region as a target for recruiting transcriptional activators.In one approach, the HTRA1 promoter target is found in SEQ ID NO: 13. In some approaches, the HTRA1 promoter target is found in SEQ ID NO: 5. In some approaches, the HTRA1 promoter target is found in SEQ ID NO: 8. In some approaches, the HTRA1 promoter target is found in SEQ ID NO: 13. In some approaches, the HTRA1 promoter target is found in SEQ ID NO: 7. In one approach, the HTRA1 enhancer target is found in SEQ ID NO: 14 (2 kb region). In some approaches, the HTRA1 target is found in SEQ ID NO: 14 (2 kb region) or SEQ ID NO: 34 (4 kb region).
[0054] According to the present invention, the guide sequence hybridizes to a target sequence comprising at least 10, at least 15, at least 20, or about 20 consecutive nucleotides of the HTRA1 promoter sequence (SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:13), or the reverse complement of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:13, or the HTRA1 enhancer sequence (SEQ ID NO:14 or 34) or the reverse complement of SEQ ID NO:14 or 34.
[0055] In some cases, the guide sequence comprises 10 or more contiguous bases of the promoter sequence shown above. Examples of sequences comprising 10 contiguous bases of SEQ ID NO: 13 include GTCCCAACGG;TCCCAACGGA;CCCAACGGAT;CCAACGGATG;CAACGGATGC, etc., or reverse complements thereof. Sequences comprising 10 or more contiguous bases of SEQ ID NO: 13 include sequences encoding bases 1 to 10 of SEQ ID NO: 13, encoding bases 2-11 of SEQ ID NO: 13, encoding bases 3-12 of SEQ ID NO: 13, etc. Sequences comprising 10 or more contiguous bases of SEQ ID NO: 13 include sequences where the nucleotide is base X of SEQ ID NO: 13, where X is 1 to 300, and the 10 contiguous bases extend to X+Y of SEQ ID NO: 13, where Y is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more, with the proviso that guide sequences are often less than 50 bases in length. Sequences of 15 or at least 20 contiguous nucleotides can be written in the same manner. For example, in some cases, the guide sequence comprises 15 or more contiguous bases of SEQ ID NO: 13 (GTCCCAACGGATGCA;TCCCCAACGGATGCAC;CCCAACGGATGCACC;CCAACGGATGCACCA;CAACGGATGCACCAA) or their reverse complements.
[0056] Each of the 10, 15, or 20 nucleotide sequences and their complements are listed in a table, and it is recognized that individual sequences or combinations of sequences can be individually selected from such a table for inclusion in or exclusion from the set. That is, such a table describes and provides a basis for selecting or excluding individual sequences and combinations. It is understood that the above description is intended to be a substitute for such a table and has the same content.
[0057] As described in Example 9 (section 14.9), the inventors designed sgRNAs with guide sequences corresponding to target regions in SEQ ID NO: 13, designated SEQ ID NOs: 15-33, and tested their ability to activate transcription from the HTRA1 promoter. In some approaches, the gRNA used in the methods targets a sequence comprising one of SEQ ID NOs: 15-33.
[0058] In some embodiments, the target sequence in the gene of interest may be complementary to the guide region of the sgRNA. Generally, there is exact complementarity or identity between the guide sequence of the gRNA and its corresponding target sequence, and may be less than 100%. In some embodiments, the degree of complementarity or identity between the guide region of the sgRNA and its corresponding target sequence may be less than 100%, although 100% identity is desirable to avoid off-target effects. In some embodiments, the guide region of the sgRNA and the target region of the gene of interest may be at least 95% identical (e.g., 1 in 20 mismatch), at least 90% identical, or at least 85% identical.
[0059] 3.3 Delivery Methods for delivering Cas proteins (e.g., Cas9 and dCas9) fused to transcriptional activator proteins and gRNAs to cells are well known. The fusion proteins can be delivered in protein form (e.g., via microinjection). More frequently, the fusion proteins are delivered in DNA form in a suitable vector that can be introduced into, for example, RPE or choroid cells. Generally, DNA encoding the gRNA is cloned into a vector downstream of a promoter (e.g., a U6 promoter) for expression. In some approaches, delivery is via viruses, such as lentiviruses or adeno-associated viruses (AAVs), as described in Byrne et al., Methods Enzymol. 546, 119-38 (2014); Cong et al., Science (80). 339, 819-823; Hirsch et al., Mol. Ther. 18, 6-8 (2010). In some approaches, delivery is via cell-derived nanovesicles or other methods. See also section 7 below.
[0060] 3.4 Synergistic Activation Mediators In some approaches, the CRISPRa system, known as the synergistic activation mediator (SAM), is used to increase HTRA1 expression in Chr10 AMD patients. The SAM system uses multiple transcription factors to further improve the potency of Cas9-mediated gene activation. See Konermann et al., Nature, January 29; 517(7536) 2015, the relevant disclosure of which is incorporated herein by reference. In some cases, this system uses two plasmids: one encoding both the sgRNA and the dCas9-transcriptional activator, e.g., the dCas9VP64 molecule, and the other encoding the MS2-TAD fusion protein. The MS2-TAD comprises an MS2 polypeptide and at least one transcriptional activation domain. In some approaches, the MS2-TAD fusion protein comprises the MS2 polypeptide (SEQ ID NO: 56) and the transactivation domains of p65 and HSF1 (MS2-p65-HSF1). The sgRNA used in the SAM system contains one or more MS2-binding sequences (e.g., SEQ ID NO: 55) that can bind to an MS2-TAD fusion protein. In some embodiments, two MS2-binding sequences are included in the gRNA: one in the tetraloop and one in the stem loop of the gRNA. Plasmids encoding MS2-TAD (e.g., MS2-p65-HSF1) are commercially available, e.g., LentiMPH plasmid (Addgene, Watertown, MA, USA). Plasmids encoding the sgRNA and dCas9-VP64 fusion protein can be constructed by cloning a suitable sgRNA coding sequence into a plasmid carrying the dCas9-VP64 coding sequence. Plasmids carrying the dCas9-VP64 coding sequence are also commercially available, e.g., LentiSAM plasmid from Addgene (Watertown, MA, USA). The sgRNA coding sequence can be cloned into the LentiSAM plasmid.
[0061] 3.5 Enhancer binding sites In some approaches, transcription from the endogenous HTRA1 gene is increased by the binding of a transcriptional activator to a site in the HTRA1 2kb (enhancer) region. As discussed in detail below, the inventors identified a binding motif for the transcriptional activator LHX2 that overlaps with the risk allele of rs36212733. Several lines of genetic and experimental evidence suggest that LHX2 binding to the risk allele is absent or reduced compared to binding to the non-risk allele, resulting in reduced HTRA1 expression. In one approach, the LHX2 LIM domain fused to a Cas protein is combined with an appropriate guide RNA and recruited to the LHX2 risk binding site in patients carrying the risk allele. Delivery of LHX2 near the risk allele binding site is thought to result in increased gene expression because tethering the transcriptional activator effectively increases the local concentration of LHX2, eliminating or mitigating the negative impact of risk variation on binding and resulting in increased HTRA1 expression. In another approach, the LHX2 transcriptional activator is engineered to bind efficiently to risk allele sequences, thereby resulting in increased transcription.
[0062] Based in part on the findings that risk alleles consistent with transcriptional activator binding sites can reduce or otherwise affect transcriptional activator binding and result in low HTRA1 expression, and that recruiting the corresponding transcriptional activator to the site can increase HTRA1 expression, a 2-kb region was examined to identify other risk-associated sequence variations consistent with transcriptional activator binding motifs. Analysis of risk alleles (i.e., risk-associated variants) at rs144224550, rs10490924, rs3750848, and rs6212733 identified several binding motifs (in addition to the LXH2 motif) consistent with risk-associated SNPs. rs144224550(10:122455084-122455085);Nkx2-5(var2);NFIX; rs36212733(10:122455695);MEF2A;HOXB4;ALX3;HOXD3;LBX1;HOXD4;VAX1;LBX1;VSX1;VSX2, LHX9;MNX1;PDX1;EMX1;PRRX2;BARX2; rs10490924(10:122454932)RHOXF;Myog;TCF12;ASCL1;Ascl2;NHLH1;BHLHA15 var2 rs3750848(10:122455799);YY1;BARX2;
[0063] According to an embodiment of the present invention, the effector domain from the transcriptional activator listed above, for example, the LIM domain from LXH2, is placed in the corresponding binding motif (for example, using CRISPRa) to increase HTRA1 expression.Notably, NFIX, MEF2A and YY1 are expressed in RPE with FPKM greater than 1 based on RNA sequence data.In various embodiments of the present invention, HTRA1 expression is increased by binding any one of NFIX, MEF2A and YY1 to its corresponding binding motif.
[0064] Generally, the guide sequence for a suitable guide RNA binds to a target sequence within 20, sometimes within 50, and sometimes within 100 bases of the terminal risk-associated nucleotide.
[0065] 3.6 Other programmable endonucleases The method of the present invention is generally described in the context of the CRISPR / Cas system. (a) Other systems for sequence-specific ("programmable") modification of nucleic acids and (b) sequence-specific recruitment of transcription activators to promoter and enhancer regions can also be used. Examples of such systems include zinc finger nuclease systems, transcription activator-like effector nuclease (TALEN) systems, homing endonuclease systems, meganuclease systems or Cre recombinase systems (for example, Cre-induced recombination between cryptic loxP sites). The use of zinc finger nucleases, TALENs, meganucleases, and DNA guide polypeptides such as Natronobacterium gregoryi Argonaute (NgAgo) to modify sequence or expression in ocular cells is described in Yanik et al., 2017, In vivo genome editing as a potential treatment strategy for inherited retinal dystrophies Progress in Retinal and Eye Research 56: 1-18.Lloyd et al., Frontiers in Immunology, 4(221), 1-7(2013); Urnov et al., 2010, "Genome editing with engineered zinc finger nucleases," Nat Rev Genet. 11(9): 636-46; Sun et al., 2013, "Transcription activator-like effector nucleases (TALENs): a highly efficient and versatile tool for genome editing," Biotechnol Bioeng. 110(7):1811-21; Sengupta et al., 2017, "Viral Cre-LoxP tools aid genome modification in mammalian cells," J. Biological Engineering 11:45, (describing lentiviral and adeno-associated viral delivery systems for Cre-Lox) and Nagy 2, "Cre recombinase: the universal reagent for genome tailoring," each of which is also incorporated herein by reference. See also Genesis, 26(2):99-109. In each genome modification method, specific nucleic acid sequences are targeted and subsequent modifications are made. These modifications include target sequences that are edited by homologous recombination, non-homologous end joining, homology-directed repair, histone modification, transcriptional activation, RNA editing, and transcriptional repression.Additionally, examples of non-cleavage manipulations are described by Thakore et al. 2018 in "RNA-guided transcriptional silencing in vivo with S. aureus CRISPR-Cas9 repressors," Nat Commun. 9(1):1674, and by Amabile et al. 2016 in "Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing," Cell 167(1):219-232.e14.
[0060] In some embodiments, the DNA targeting molecule comprises one or more zinc finger proteins (ZFPs), or domains thereof, that bind to DNA in a sequence-specific manner and are fused to a nuclease. A ZFP or domain thereof is a protein or domain within a larger protein that binds to DNA in a sequence-specific manner via one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger DNA binding protein is often abbreviated to zinc finger protein or ZFP.
[0066] Among ZFPs, artificial ZFP domains are generated by the assembly of individual fingers, targeting specific DNA sequences, typically 9-18 nucleotides in length. ZFPs include those with two, three, four, five, or six fingers, each of which contains an alpha helix containing two invariant histidine residues coordinated via zinc to two cysteines in a single beta turn. Generally, the sequence specificity of a ZFP can be altered by making amino acid substitutions at four helix positions (-1, 2, 3, and 6) on the zinc finger recognition helix. Thus, in some embodiments, a ZFP or ZFP-containing molecule is engineered to bind to a non-naturally occurring, e.g., selected, target site. For example, Beerli et al. (2002) Nature Biotechnol. 20:135-141;Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340;Isalan et al. (2001) Nature Biotechnol. 19:656-660;Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637;Choo et al. (2) Curr. Opin. Struct. Biol. 10:411-416; U.S. Patent Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005 / 0064474; 2007 / 0218528; 2005 / 0267061, all of which are incorporated by reference herein in their entireties.
[0067] In some embodiments, the DNA targeting molecule is or comprises a zinc finger DNA binding domain, TALEN, or other DNA targeting protein fused to a DNA cleavage domain to form a targeting nuclease.In some embodiments, the fusion protein comprises at least one type IIS restriction enzyme and one or more cleavage domains (or cleavage half-domains) derived from a DNA targeting protein.In some embodiments, the cleavage domain is derived from the type IIS restriction endonuclease Fok I.Generally, Fok I catalyzes double-stranded cleavage of DNA at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand. See, for example, U.S. Patent Nos. 5,356,802; 5,436,150 and 5,487,994; and Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994) J. Biol. Chem. 269:31,978-31,982.
[0068] The term "programmable nuclease" can refer to a CRISPR family Cas nuclease or a derivative thereof, a transcription activator-like effector nuclease (TALEN) or a derivative thereof, a zinc finger nuclease (ZFN) or a derivative thereof, and a homing endonuclease (HE) or a derivative thereof.
[0069] 4. Gene editing to replace risk forms with non-risk forms In some approaches, the method for treating, preventing the onset of, slowing down the progression of, reversing or ameliorating the symptoms and signs of Chr10 AMD comprises administering an agent to modify the genomic DNA of patient's RPE cells by converting or replacing one or more risk alleles with corresponding non-risk alleles.In certain embodiments, the allele is in the 2.0 kb risk region (see, for example, Example 5 and Figure 13).
[0070] 4.1 Repair of risk alleles Some approaches use gRNAs that target one or more risk alleles in a 2-kb region. These risk alleles include, but are not limited to, rs10490924 (risk allele is T), rs144224550 (risk allele is GT insertion), rs36212731 (risk allele is T), rs36212733 (risk allele is C), rs3750848 (risk allele is G), rs3750847 (risk allele is T), and rs3750846 (risk allele is C). Exemplary sgRNAs / guide sequences that can be used to target these risk alleles are shown in Table 1 below. The bolded nucleotides are found in the risk allele.
[0071] [Table 1]
[0072] A template repair polynucleotide containing the sgRNA, Cas protein, and non-risk allele sequences can be introduced into RPE cells in one or more viral vectors. The template repair sequence generally requires a certain amount of overlap (homology) on each side of the cleavage site. For single-nucleotide repair, the "homologous arms" of the donor template should be approximately 200-500 nucleotides. For longer repairs (e.g., an entire 2 kb region), each homologous arm should be approximately 500-800 nucleotides. This results in the risk allele being replaced with the wild-type allele, thereby restoring HTRA1 expression to normal levels in RPE cells in Chr10 AMD patients. Exemplary repair sequences are shown in Table 2.
[0073] [Table 2]
[0074] It is understood that the guide sequence does not need to directly overlap with the target SNP.If the sgRNA is close to or adjacent to the SNP, it is sufficient to enable homology-directed repair of the defective SNP.In this context, "adjacent to" means that the nearest nucleotide that hybridizes to the guide sequence nucleotide is within 25 nucleotides, preferably within 20 nucleotides, and sometimes within 15 or 10 nucleotides from the SNP or other repair site.
[0075] 4.2 Large-scale substitution in the HTRA1 transcriptional regulatory region In some approaches, a gRNA pair is used in the CRISPR / Cas9 system to remove the entire 2-kb risk region in RPE cells from Chr10 AMD patients. The sgRNA pair is designed to target a region defined by two nucleotide positions, two positions encompassing the 2-kb risk region. In some approaches, the sgRNA pair is SEQ ID NO: 50 and SEQ ID NO: 52. In some approaches, the sgRNA pair is SEQ ID NO: 51 and SEQ ID NO: 52. Introduction of the sgRNA pair and Cas9 into RPE cells results in removal of the region encompassing the 2-kb region. A plasmid encoding a non-risk sequence corresponding to the deleted region and containing 500-800 nt of additional genomic sequence upstream of the 5' cleavage site and downstream of the 3' cleavage site is introduced into RPE cells so that the non-risk sequence is inserted into the deleted region by homology-directed repair, replacing the 2-kb risk region with the non-risk sequence. The plasmids encoding the sgRNA pair, Cas9, and non-risk template sequence may be introduced into the same or different viral vectors and may be introduced simultaneously or sequentially to increase HTRA1 expression in RPE cells of Chr10 AMD patients.
[0076] [Table 3]
[0077] 5. CRISPR / Cas System In some approaches, CRISPR technology is used to introduce one or more nucleotide substitutions into the genomic DNA of RPE or choroid cells in individuals carrying the Chr10 risk allele, thereby replacing one or more risk alleles with corresponding non-risk alleles. The "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against exogenous nucleic acids. CRISPR / Cas systems include subtypes I, II, and III. The wild-type type II CRISPR / Cas system uses an RNA-mediated nuclease, such as Cas9, in complex with guide and activator RNAs to recognize and cleave exogenous nucleic acids. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Csel, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are well known. For example, the amino acid sequence of Streptococcus pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2. Non-limiting examples of mutations in Cas9 protein are well known in the art (see, for example, WO2015 / 161276), any of which can be included in the CRISPR / Cas9 system in accordance with the provided method.Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1; 10 (5):726-737; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci US A. 2013 Sep 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17; 337(6096):816-21. Cas9 and its homologs can be used in conjunction with sgRNAs to introduce specific modifications into genomic regions of interest, such as genomic regions containing one or more Chr10 risk alleles.
[0078] Other RNA-mediated nucleases that can be used in the CRISPR / Cas system to convert risk alleles in the 2-kb risk region include, for example, Cas12a and Cascade / Cas3. See Pickar-Oliver and Gersbach, Nature, vol. 20, August 2019, the relevant portions of which are incorporated herein by reference. Cas12a recognizes a target sequence that is complementary to the spacer in the crRNA (sgRNA) located next to the 3'PAM. Target recognition results in the generation of a staggered DNA double-strand break. Cascade / Cas3 is a multimeric complex that is complementary to the spacer portion of the crRNA and located next to the 3'PAM, targeting DNA to generate a single-strand nick.
[0079] Therefore, in some approaches, the method involves introducing individual CRISPR systems into RPE cells, where the systems may include a Cas9 protein and a guide RNA (e.g., sgRNA) that hybridizes to the target sequence. The sgRNA and Cas9 may be expressed from the same or different vectors in the system. In addition, a donor vector encoding a non-risk nucleotide sequence that overlaps the cleavage site is delivered together with the CRISPR-Cas9 plasmid. The guide RNA targets a sequence containing or near the risk allele, and the Cas9 protein cleaves the genomic DNA molecule. The cleaved genomic DNA is repaired by homologous recombination using the donor sequence plasmid, resulting in a change in the genomic sequence from the risk allele to a non-risk allele. Any of the risk alleles described above can be converted to a non-risk allele. In some approaches, the entire 2.0 kb region (see Example 5) or the entire 4 kb AMD risk region (see Example 3), excluding the Chr10 risk allele, is converted to restore HTRA1 expression in RPE cells.
[0080] 5.1 Cas9 nickase In some approaches, Cas9 nickase-based CRISPR / Cas systems can be used to correct individual risk alleles. Compared to unmodified Cas9 proteins, Cas9 nickase proteins contain mutations in one of their nuclease domains. As a result, Cas9 nickase proteins "nick" target DNA, i.e., produce single-strand DNA breaks at the target site rather than double-strand breaks using unmodified Cas9. In one example, dCas9 contains mutations in each of its two nuclease domains, while Cas9 nickase contains mutations in only one of its nuclease domains. As in other CRISPR approaches described herein, guide RNAs can target Cas9 nickase to specific genomic locations. The Cas9 nickase protein is introduced along with base-editing proteins such as cytidine deaminase (e.g., APOBEC1, AID, APOBEC3G, or CDA1), which converts cytosine bases to uracil bases (which have the base-pairing properties of thymine bases), and adenine deaminase, which converts adenosine bases to inosine bases (which have the base-pairing properties of guanosine). These conversions have the effect of changing CG base pairs to TA base pairs (cytidine deaminase) or AT base pairs to GC base pairs (adenine deaminase). In some cases, the Cas9 nickase based CRISPR / Cas system also contains an inhibitor of the cellular DNA repair response to promote base editing efficiency. For example, a uracil DNA glycosylase inhibitor can be used to prevent the uracil DNA glycosylase enzyme in cells from catalyzing the removal of uracil bases from DNA. Removal of uracil can result in a reversion mutation of the edited uracil back to cytosine. Cas9 nickase-based gene editing systems are well known and are described, for example, in Komor et al., Nature, 533 (7603): 420-424 (2016).In one example, the system includes a cytidine deaminase (APOBEC1) fused to the N-terminus of a Cas9 nickase using a 16-amino acid residue XTEN linker, and a uracil DNA glycosylase inhibitor (UGI) fused to the C-terminus of the Cas9 nickase [e.g., editor BE3 in Komor et al., Nature, 533 (7603): 420-424 (2016)]. Such a system can efficiently edit CG base pairs to TA base pairs in vivo with low rates of indel (i.e., small deletions or insertions) formation and off-target activity (i.e., editing or indel formation at genomic locations other than the locus targeted by the guide RNA). In some cases, the editing protein linked to the Cas9 nickase can target multiple bases depending on the length of the linker sequence. For example, APOBEC1 fused to dCas9 using a 16-residue XTEN linker can deaminate cytosine bases within a window of approximately 5 nucleotides, typically at positions 4 to 8 within the protospacer sequence, counting the distal end relative to the protospacer adjacent motif as position 1 [see, e.g., Komor et al., Nature, 533(7603): 420-424 (2016)]. In some approaches, guide RNA sequences can be designed to target one or more bases within such a window.
[0081] In some approaches, vector sequences expressing Cas9 nickase and guide RNA are integrated into host cell DNA as transgenes. For example, the gene sequence encoding the APOBEC1-XTEN-Cas9 nickase-UGI fusion described above can be incorporated into a plasmid together with guide RNA and transfected into cells in a population. In some approaches, CRISPR base editing system components are delivered by viruses, such as lentiviruses or adeno-associated viruses (AAVs). In some cases, the DNA sequences encoding CRISPR base editing system components are too large for packaging in AAVs, which have a genome packaging size limit of less than 5 kilobases. In one approach, CRISPR base editing system components can be delivered using a dual-AAV strategy using intein sequences. Inteins are protein segments that can excise themselves and splice together the remaining protein portion. The inteins of precursor proteins can sometimes be derived from two genes, in which case they are called split inteins. In one example of such a dual-AAV strategy, described in Levy et al., Nat. Biomed. Eng., 4(1): 97-110 (2020), a cytosine base editor, such as BE3, described above, may be split in half, with each half fused to one half of a fast-splicing split intein. Sequences encoding these products may be incorporated into two separate AAV genomes, along with sequences encoding guide RNAs, and co-transduced into cells. When both products are expressed in a cell, they are spliced together, resulting in the reconstitution of a full-length base editor, such as BE3.
[0082] 6. Increasing HTRA1 expression using gene therapy by introducing exogenous HTRA1 protein-encoding polynucleotides In one embodiment, treating AMD comprises gene therapy to enhance HTRA1 expression in RPE cells.Gene therapy is a well-known technology, see, for example, Moore et al., 2017, "GENE THERAPY FOR AGE-RELATED MACULAR DEGENERATION" Expert Opinion on Biological Therapy 17:10: 1235-1244; Aponte-Ubillus et al., 2018, "MOLECULAR DESIGN FOR RECOMBINANT ADENO-ASSOCIATED VIRUS (RAAV) VECTOR PRODUCTION" Applied microbiology and biotechnology 102.3:1045-1054; Ochakovski et al., 2017, "RETINAL GENE THERAPY: SURGICAL VECTOR DELIVERY IN THE TRANSLATION TO CLINICAL TRIALS" Frontiers in Neuroscience 11; Schoen et al., 2015, "RETINAL GENE THERAPY: SURGICAL VECTOR DELIVERY IN THE TRANSLATION TO CLINICAL TRIALS" Frontiers in Neuroscience 11; GENE DELIVERY BY ADENO-ASSOCIATED VIRUS (AAV) VECTORS: STRATEGIES AND APPLICATIONS" European Journal of Pharmaceutics and Biopharmaceutics 95:343-352;Naso et al., 2017, "ADENO-ASSOCIATED VIRUS (AAV) AS A VECTOR FOR GENE THERAPY" BioDrugs 31:317;Dunbar et al., 2018, "GENE THERAPY COMES OF AGE" Science 359:6372;Penaud-Budloo et al., 2018., "PHARMACOLOGY OF RECOMBINANT ADENO-ASSOCIATED VIRUS PRODUCTION" Molecular Therapy: Methods & Clinical Development 8:166-180;
[0083] 6.1 Expression of exogenous HTRA1 protein In some approaches, gene therapy is performed to introduce exogenous HTRA1 protein into RPE cells. In some approaches, the introduced exogenous HTRA1 has the same amino acid sequence as the natural HTRA1 protein (SEQ ID NO: 2). In some approaches, the exogenous HTRA1 protein is different from SEQ ID NO: 2, but has an amino acid sequence that shares at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity with the amino acid sequence of SEQ ID NO: 2. In some approaches, the exogenous HTRA1 protein is different from SEQ ID NO: 2 (i.e., HTRA1 variant), but maintains the serine protease activity of HTRA1. The serine protease activity of HTRA1 can be measured using methods well known in the art, for example, as described in Grau et al., Proc. Natl. Acad. Sci. USA April 26, 102 (17) 6021-6026 (2005). For purposes of this disclosure, maintaining serine protease activity refers to an exogenous HTRA1 protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the serine protease activity of the native HTRA1 protein (SEQ ID NO: 2).
[0084] In some approaches, gene therapy involves administering a vector containing a nucleic acid sequence ("cargo") encoding an exogenous HTRA1 protein of SEQ ID NO:2, or a variant described above, such as a variant of HTRA1 with serine protease activity. In some approaches, the nucleic acid sequence comprises SEQ ID NO:1. In some approaches, the nucleic acid sequence shares significant sequence identity, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleic acid sequence identity, with SEQ ID NO:1. In some approaches, the nucleic acid sequence encoding the exogenous HTRA1 protein has significant sequence identity to SEQ ID NO:2, e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:2. In some cases, a nucleic acid encoding an HTRA1 protein comprises a sequence that contains a deletion, insertion, or substitution compared to a native HTRA1 nucleic acid sequence and still result in a polynucleotide that encodes a polypeptide having serine protease activity.
[0085] HTRA1 nucleic acids and polypeptides may also be modified through chemical or enzymatic alterations using methods well known to those skilled in the art. For example, the sequences may be modified by the addition of lipids, sugars, peptides, organic or inorganic compounds, by the inclusion of modified nucleotides or amino acids, etc. Thus, HTRA1 nucleic acids and proteins may be conjugated to another component (e.g., a reporter protein), the presence of which may facilitate detection or serve other purposes.
[0086] 6.2 Vectors for gene therapy Suitable viral vectors for introducing the HTRA1 coding sequence include, by way of example and not limitation, adenovirus, AAV2 virus, lentivirus, bovine papillomavirus (BPV-I), or Epstein-Barr virus (pHEBo, pREP-derived, and p205). Non-viral systems, such as naked DNA formulated as microparticles, can also be used. See Section 7 below.
[0087] 6.3 Promoters for gene therapy vectors In some approaches, the delivered transgene (e.g., an exogenous HTRA1 gene, or a recombinant nucleic acid whose expression in RPE cells can increase the expression of an endogenous HTRA1 gene) comprises a protein-coding sequence operably linked to a promoter sequence. In some approaches, the promoter is heterologous to the HTRA1 polynucleotide. In some approaches, the promoter is the native HTRA1 promoter (e.g., SEQ ID NO: 13). In some approaches, the promoter is an inducible promoter. In some approaches, the promoter is a constitutive promoter. The promoter may be a naturally occurring promoter or a hybrid promoter that combines elements of more than one promoter. In some approaches, the promoter is a tissue-specific promoter. Generally, the promoter is a shortened version of the human endogenous RPE-specific promoter sequence (e.g., RPE65-5022 nucleotides and BEST1-5479 nucleotides). Non-limiting examples of RPE-specific promoters include BEST1-EP-454; RPE65-EP-415; smCBA; CBA; RPE65-EP-419; sctmCBA; or VMD2, as described in International Patent Publication No. WO2020019002.Other promoters or modified promoters (including natural and synthetic) can also be used to regulate expression of the therapeutic products disclosed herein, including, but not limited to, UBC, GUSB, NSE, synapsin, MeCP2, GFAP, PAI1, ICAM, flt-1, and CFTR [Papadakis et al. 2004; PROMOTERS AND CONTROL ELEMENTS: DESIGNING EXPRESSION CASSETTES FOR GENE THERAPY in Current Gene Therapy, 2004, 4, 89-113; Gray & Samulski 2011; VECTOR DESIGN AND CONSIDERATIONS FOR CNS APPLICATIONS in Gene Vector Design and Application to Treat Nervous System Disorders, ed. J. Glorioso (Washington, DC: Society for Neuroscience), 1-9.; Trapani et al. 2014; VECTOR PLATFORMS FOR GENE THERAPY in Current Gene Therapy, 2004, 4, 89-113; each of which is incorporated herein by reference. THERAPY OF INHERITED RETINOPATHIES Progress in Retinal and Eye Research 43 (2014) 108-128; Powell and Gray 2015). VIRAL EXPRESSION CASSETTE ELEMENTS TO ENHANCE TRANSGENE TARGET SPECIFICITY AND EXPRESSION IN GENE THERAPY Discov. Med. 2015 January; 19(102): 49-57.Additional promoters that can be used include the early and late promoters of SV40, the tet promoter, the adenovirus or cytomegalovirus immediate early promoters, the RSV promoter, the T7 promoter, whose expression is directed by the T7 RNA polymerase, the major operator and promoter region of phage lambda, the regulatory region of the fd coat protein, promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of acid phosphatase such as Pho5, the promoter of yeast alpha mating factor, the polyhedron promoter of baculovirus systems and other sequences known to regulate the expression of genes in prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
[0088] The exogenous HTRA1 gene or transgene may be under the control of other regulatory sequences, such as enhancer or activator sequences, leader or signal sequences, ribosome binding sites, transcription initiation and termination sequences, and polyadenylation sequences. Enhancers that can be used in the approaches of the present invention include, but are not limited to, SV40 enhancers, cytomegalovirus (CMV) enhancers, elongation factor 1 (EF1) enhancers, yeast enhancers, viral gene enhancers, etc. Termination regulatory regions can include or be derived from synthetic sequences, synthetic polyadenylation signals, SV40 late polyadenylation signals, SV40 polyadenylation signals, bovine growth hormone (BGH) polyadenylation signals, viral termination sequences, etc.
[0089] Exemplary promoter and enhancer nucleotide sequences are provided as SEQ ID NOs: 6, 11, 12, and 13 ("promoter sequences"). It will be understood by those skilled in the art that regulatory (promoter / enhancer) sequences can tolerate some variation while retaining regulatory properties. In certain approaches described herein in which promoters / enhancers are called out, substantially identical sequences (e.g., sequences having at least about 90% identity, preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% nucleotide identity across the promoter / enhancer sequence) are contemplated as suitable substitutes for the called-out sequence.
[0090] 7. Delivery of CRISPR, CRISPRa, endonucleases, repair templates, and other components Systems for delivering proteins and nucleic acids, including CRISPR elements ("delivery systems"), are well known in the art. These systems can be used to deliver Cas proteins (with or without nuclease activity), Cas nickases, sgRNAs or other guide RNAs, Cas transcriptional activator fusion proteins, HTRA1 protein coding sequences, templated repair sequences, and the like, to cells (e.g., RPE, photoreceptor cells, and horizontal cells). The substance delivered to the cell is sometimes referred to herein as a "transgene" or "cargo." Hageman, G., and Richards, B., International Patent Publication No. WO2020019002, and Yanik et al., 2017, In vivo genome editing as a potential treatment strategy for inherited retinal dystrophies. Progress in Retinal and Eye Research 56: 1-18, describe methods for delivering components to ocular cells for transgene expression, gene repair, gene activation, and the like, which can be adapted for the present invention. In some approaches, delivery is by virus, e.g., lentivirus, adeno-associated virus (AAV), as described in Byrne et al., Methods Enzymol. 546, 119-38 (2014); Cong et al., Science (80). 339, 819-823; Hirsch et al., Mol. Ther. 18, 6-8 (2010).
[0091] In some approaches, cargo (e.g., HTRA1 transgene) is delivered using an rAAV2 expression vector. In one approach, a transgene or other component (e.g., an exogenous HTRA1 gene or a recombinant nucleic acid whose expression in RPE cells can increase endogenous HTRA1 expression) is delivered to RPE cells using the rAAV2 system, which can transduce RPE cells with high efficiency. In addition to AAV2, other adeno-associated virus-based vectors include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and pseudotyped AAV. Retroviruses, lentiviruses, adenoviruses, baculoviruses, and others can also be used, as disclosed in Lau and Suh (2017) doi: 10.12688 / f1research.11243.1, the relevant disclosures of which are incorporated herein by reference.
[0092] To package a transgene into an AAV vector, the ITRs are the only AAV components required in cis in the same construct as the transgene. The cap and rep genes may be supplied in trans. Thus, DNA constructs can be designed such that the AAV ITRs flank the coding sequence for the antipathogen construct (or a subunit thereof, or a subunit thereof fused to a dimerizable domain that is part of a regulatable promoter), thereby defining the region to be amplified and packaged—the only design constraint being an upper size limit for the packaged DNA (approximately 4.5 kb).
[0093] In addition to AAV vectors, other viral vectors that can be used include, but are not limited to, retroviruses, adenoviruses (AdV), lentiviruses, poxviruses, alphaviruses, and herpesviruses.
[0094] Viral vectors (e.g., rAAV2, lentiviral vectors) carrying expression cassettes containing HTRA1 transgenes or other cargo can be produced, harvested, and purified using methods well known in the art, including those described in the publications cited herein. For AAV methods, see Zolotukin et al., 2002, "Production And Purification Of Serotype 1, 2, And 5 Recombinant Adeno-Associated Viral Vectors," Methods 28: 158-167, which are incorporated by reference, and Aponte-Ubillus et al., 2018; Naso et al., 2017; and Penaud-Budloo et al., 2018, all of which are incorporated by reference and cited above. Similarly, for a general review of gene therapy, including a description of expression and delivery systems, see Moore et al., 2017, "Gene Therapy For Age-Related Macular Degeneration," Expert Opinion on Biological Therapy 17: 10: 1235-1244; Aponte-Ubillus et al., 2018, "Molecular Design For Recombinant Adeno-Associated Virus(Raav)Vector Production" Applied microbiology and biotechnology 102. 3: 1045-1054;Ochakovski et al., 2017, "Retinal Gene Therapy: Surgical Vector Delivery In The Translation To Clinical Trials" Frontiers in Neuroscience 11;Schon et al., 2015, "Retinal Gene Delivery By Adeno-Associated Virus (Aav) Vectors: Strategies And Appucations" European Journal of Pharmaceutics and Biopharmaceutics 95: 343-352; 31: 317;Dunbar et al., 2018, "Gene Therapy Comes Of Age" Science 359:6372;Penaud-Budloo et al. 166-180;
[0095] Non-viral vectors or methods can also be used to deliver cargo. These include delivery using virus-like particles (VLPs), administration using cationic liposomes, cell-derived nanovesicles, direct nucleic acid injection, hydrodynamic injection, the use of nucleic acids to aggregate peptides and non-peptides, cationic liposomes, and liposome encapsulation. In one approach, virus-like particles (VLPs) are used to deliver cargo. VLPs comprise engineered versions of viral vectors, in which nucleic acid or non-nucleic acid cargo is packaged into the VLP through alternative mechanisms (e.g., mRNA recruitment, protein fusion, protein-protein binding). See Itaka and Kataoka, 2009, "Recent development of nonviral gene delivery systems with virus-like structures and mechanisms," Eur J Pharma and Biopharma 71: 475-483 and Keeler et al., 2017, "Gene Therapy 2017: Progress and Future Directions" Clin. Transl. Sci. (2017) 10, 242-248, which are incorporated by reference.
[0096] 8. Other treatments to increase HTRA1 expression or activity 8.1 Cell therapy In one approach, stem cells (e.g., iPSCs) are modified in vivo and ex vivo for transplantation into the RPE (see Peddle et al., "CRISPR Interference—Potential Application in Retinal Disease," Int. J. Mol. Sci., 2020 21: 1-14).
[0097] 8.2 Other medications In some approaches, the method involves treating a patient with a small molecule compound that can increase the expression of HTRA1. Small molecule compounds, as disclosed herein, refer to organic compounds, typically with a molecular weight of less than 5,000 daltons, less than 1,000 daltons, less than 900 daltons, or less than 800 daltons. A method for treating, preventing the onset of, slowing the progression of, reversing, or alleviating the symptoms and signs of Chr10 AMD involves administering a small molecule compound to a patient, wherein the agent increases the expression of HTRA1. An exemplary compound is trichostatin A (TSA), an inhibitor of class I and class II histone deacetylases, which has been shown to increase HTRA1 mRNA expression by approximately two-fold. Wang et al., Plos|One 2012, https: / / doi.org / 10.1371 / journal.pone.0039446
[0098] In some cases, suitable compounds can be identified by screening a library of compounds using a quantitative in vitro transcription assay. The in vitro transcription assay can be in a cell-free system containing a plasmid containing HTRA1 and a regulatory element. In some approaches, identifying a drug that can increase the expression of HTRA1 involves contacting a library of drugs with cells that express HTRA1, measuring the expression level or activity of HTRA1, and selecting drugs that increase HTRA1 expression or activity. The library of compounds is screened, and the transcription of HTRA1 can be measured using means well known in the art. For example, transcription can be carried out in the presence of radiolabeled or fluorescently labeled nucleotides, and the labeled transcripts can be precipitated on a gel, separated by electrophoresis, and then quantified. Alternatively, HTRA1 mRNA can be measured by quantitative RT-PCR or digital PCR. Drugs that increase the transcription of HTRA1 are then selected and tested. Methods for selecting agents (including compounds or peptides) capable of activating transcription are well known in the art and are described, for example, in U.S. Pat. No. 6,174,722, the entire contents of which are incorporated herein by reference.
[0099] Methods for constructing libraries that can be used to screen for drugs capable of activating HTRA1 transcription are also well known. For example, combinatorial libraries can be created for many types of compounds that can be synthesized in a step-by-step manner. Large combinatorial libraries of compounds can be constructed by the encoded synthetic library (ESL) method described in WO95 / 12608, WO93 / 06121, WO94 / 08051, WO95 / 35503, and WO95 / 30642. Peptide libraries can also be generated by phage display methods (see, for example, Devlin, WO91 / 18980). Libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts can be obtained from commercial sources or recovered in the field. Known pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, and amidification, to produce structural analogs.
[0100] In some approaches, the test agent can be a naturally occurring protein or a fragment thereof. The test agent can be a peptide, for example, a peptide of about 5 to about 30 amino acids, with about 5 to about 20 amino acids being preferred, and about 7 to about 15 being particularly preferred. The peptide can be a digest of a naturally occurring protein, a random peptide, or a "biased" random peptide. The test agent can also be a nucleic acid of various lengths and sequences.
[0101] In some approaches, agents that can be used to treat, prevent the onset of, slow the progression of, reverse, or ameliorate the symptoms and signs of Chr10 AMD can be identified by contacting the agent with an HTRA1 promoter operably linked to a reporter gene and selecting the agent based on its ability to promote expression of the reporter gene.
[0102] 9. Patient population 9.1 Patient population The compositions and methods of the present invention find particular use in treating subjects with or at risk of developing chromosome 10 AMD. As mentioned above, Chr10 AMD is known to be associated with genetic lesions in chromosome region 10q26, which carries the ARMS2 and HTRA1 genes. See Hageman et al., 2015, "METHODS OF PREDICTING THE DEVELOPMENT OF AMD BASED ON CHROMOSOME 1 AND CHROMOSOME 10," U.S. Patent Publication No. 2015 / 0211065, incorporated herein by reference. Patients with Chr10 AMD can be identified based on disease manifestations and / or genotypes. In one approach, candidates for treatment exhibit a Chr10 AMD clinical phenotype. Thus, in one approach, the subject to be treated exhibits a Chr10 clinical phenotype. In one approach, the subject to be treated possesses one or two chromosome 10 risk alleles. In one approach, the subject to be treated has one risk allele in one or two copies of chromosome 10 risk allele.In one approach, the subject has Chr10 AMD clinical phenotype or genotype, and does not have any chromosome 1 risk allele.The chromosome 1 risk allele for AMD includes rs529825, rs800292, rs3766404, rs1061147, rs203674, rs0161170, rs2274700, rs375046, rs9427661, rs9427662 and rs12097550.
[0103] Patients with Chr10 AMD primarily exhibit classic choroidal neovascularization (CNV), rarely occult CNV, and retinal angiomatous proliferation (RAP), often resulting in severe and rapid vision loss. Patients with Chr10 AMD typically have fewer drusen, intraretinal fluid (cysts), a faster rate of geographic atrophy (GA), and retinal / choroidal thinning than patients with Chr1 AMD. Patients with Chr10 AMD also have reduced vascular density in the retina and choroid (including the choriocapillaris).
[0104] In some embodiments, enhancing HTRA1 expression is achieved by gene therapy.In some approaches, enhancing HTRA1 is achieved by administering drugs, such as small molecule compounds, peptides or nucleic acids, that upregulate the transcription of endogenous HTRA1 gene.Gene therapy for upregulating the transcription of HTRA1 can be carried out in various ways.In some approaches, gene therapy upregulates endogenous HTRA1 expression (mRNA or protein expression).In some approaches, gene therapy introduces exogenous HTRA1 gene that is expressed in RPE cells.In some approaches, gene therapy is used to convert Ch10 risk allele in cell genome to corresponding non-risk allele, as described below.
[0105] As described below, individuals with Chr10 AMD often carry one or more risk alleles ("Chr10 risk alleles") associated with the development of the disease. See Examples 1 and 3. The inventors surprisingly discovered that Chr10 AMD patients, compared with healthy or low-risk controls, have reduced HTRA1 mRNA expression specifically in the RPE (Figure 2). Furthermore, the inventors identified the genomic region responsible for the reduction of HTRA1, which corresponds to the region associated with increased AMD risk.
[0106] Patients homozygous for the risk allele have been shown to have reduced HTRA1 protein in RPE cells, which may also affect HTRA1 levels at the interface between the RPE and Bruch's membrane (the "sub-RPE space"). Reduced HTRA1 expression, for example in the sub-RPE space, is thought to contribute to the development of Chr10 AMD. HTRA1 is a serine protease that can degrade extracellular matrix (ECM) proteins, which are highly enriched in the sub-RPE space. Without intending to be bound by a particular theory or mechanism, reduced HTRA1 expression impairs the processing, maintenance, and turnover of ECM proteins, resulting in the accumulation of damaged, misfolded, and / or aggregated proteins. The accumulation of these proteins may then disrupt the attachment of RPE tissue to its basement membrane and / or to Bruch's membrane, resulting in the loss of the blood-retinal barrier and contributing to the development of AMD. Table 4 shows odds ratios and P values for the association of certain phenotypes with Chr10 risk. Both choroidal fibrosis and basal laminar deposits (BLD) have been observed in eyes from donors homozygous for the chromosome 10 risk allele. BLD, an abnormal extracellular material located between the RPE cell membrane and the basement membrane, has previously been shown to be strongly associated with late-stage AMD. Furthermore, mutations in ECM structural proteins, resulting in their misregulation, lead to AMD-like diseases, including L-ORD (C1qTNF5), Sorsby fundus degeneration (TIMP3), Ehlers-Danlos syndrome type VI (PLOD1), or Doyne honeycomb retinal dystrophy (EFEMP1). See Hayward et al., Hum. Mol. Genet. 12: 2657-67 (2003); Weber et al., Nat. Genet. 8 (4): 352-6; and Marmorstein et al., PNAS. 99 (20): 13067-72. These evidences suggest that ECM alterations and the formation of basement membrane deposits share a common cause, and that decreased expression of HTRA1 leads to the accumulation of damaged, misfolded, and aggregated proteins and the development of AMD.
[0107] [Table 4]
[0108] Therefore, in some aspects, the present disclosure provides a method for increasing HTRA1 expression in RPE cells to prevent or delay the onset of Chr10 AMD.HTRA1 treatment can be administered after patients are identified as having the risk of developing Chr10 AMD based on genetic profile, and in some cases before the appearance of any clinical symptoms of AMD.This early intervention can avoid the extensive tissue damage associated with AMD.The method disclosed herein requires minimal surgery, typically only once or twice in patients' lifetime, thereby minimizing the discomfort and adverse events associated with the frequent surgery required in conventional treatment.
[0109] 9.1.1 Selection of subjects for treatment In some approaches, patients are selected for treatment based on clinical phenotype or genetic factors for treatment, in some approaches, they are evaluated by genotyping to determine their individual genetic (e.g., by assessing the presence of the Chr10 risk allele disclosed above) and associated risk of disease. Additionally, they may be assessed via clinical examinations, including but not limited to: imaging and morphological assessments (e.g., but not limited to, color fundus photography, SD-OCT, OCT-A, indocyanine green angiography, fluorescein angiography, and confocal scanning laser ophthalmoscopy (e.g., Heidelberg Spectralis system) including near-infrared reflectance (NIR), blue-light autofluorescence, green-light autofluorescence); and functional tests (e.g., but not limited to, visual acuity, best-corrected visual acuity (BCVA using an ETDRS chart), low-luminance BCVA (LLVA, using neutral density film with an ETDRS chart), reading speed (monocular / binocular), fixation stability, dark-adapted microperimetry (S-MAIA), microperimetry (MAIA) including dark-adapted and mesopic microperimetry sensitivity, visual evoked potential (VEP) assessment, and multifocal ERG.
[0110] Additional measures include a combination of morphological and functional information (visual acuity, reading speed, low light vision, visual fixation, electroretinogram, etc.).
[0111] Additionally, patients can be evaluated based on multiple phenotypes and biomarkers. Administering the treatments disclosed herein increases HTRA1 expression and also provides benefits to patients when administered within a specific phenotypic window defined by changes in ocular anatomy and appearance, or changes in the levels of certain biomarkers, including but not limited to: few drusen (small and firm drusen), intraretinal fluid (cysts), high GA growth rate, and retinal / choroidal thinning.
[0112] In one aspect, administering the therapeutic agent disclosed herein at the very early stage of the progression of Chr10 AMD can provide excellent therapeutic benefits.For example, treating patients who have prior to the appearance of signs or symptoms of Chr10 AMD (for example, none of the following symptoms exist: drusen, intraretinal fluid (cyst), high GA growth rate and retinal / choroidal thinning), especially those who have high genetic risk due to having one or more Chr10 risk alleles.Therefore, provided herein are methods and compositions for preventing the onset of Chr10 AMD, and slowing down, reversing the progression of Chr10 AMD, or alleviating its symptoms and signs.In some approaches, patients do not have symptoms of AMD (i.e., are asymptomatic).In some approaches, patients do not show any clinical phenotype of Chr10 AMD at the time of first administration of therapeutic agent.
[0113] In some approaches, patients have a combination of both Chr1 and Chr10, Chr1 and other minor AMD-associated genes (such as C3, CFB, C2), or a combination of all, and the patient is treated with a therapy of the invention to treat, prevent, or slow the progression of the symptoms and signs of Chr10 AMD, and with a second agent to treat, prevent, or slow the progression of Chr1 AMD.
[0114] 9.2 Genetic factors associated with reduced HTRA1 expression and Chr10 AMD 9.2.1 Chr10 risk allele In addition to clinical phenotype, individuals may also be identified based on genetic factors alone as being at increased risk for developing Chr10 AMD.
[0115] Thus, the methods and compositions disclosed herein may be used to treat patients with these risk alleles with agents that increase HTRA1 expression in the subject's RPE cells, thereby treating, preventing the onset of, slowing the progression of, reversing, or ameliorating the symptoms and signs of Chr10 AMD.
[0116] As described in the Examples, the region associated with decreased HTRA1 mRNA may be located in the upstream regulatory region of HTRA1, inclusively between rs11200632 and rs3750846 (the "4 kb AMD risk region"). Exemplary Chr10 risk alleles are located at rs11200632 (risk allele G), rs11200633 (risk allele T), rs61871746 (risk allele C), rs61871747 (risk allele T), rs10490924 (risk allele T), rs36212731 (risk allele T), rs36212732 (risk allele G), rs36212733 (risk allele C), rs3750848 (risk allele G), rs3750847 (risk allele T), and rs3750846 (risk allele C). Table 5 shows the risk alleles (top) and non-risk alleles (bottom) at these polymorphic sites. The complete LD (r) with rs10490924 within the 4 kb risk region was 2 A complete list of SNPs in high LD (=1) or very high LD is shown in Table 5. The methods and compositions disclosed herein can be used to treat patients with one or more of these risk alleles.
[0117] [Table 5]
[0118] In some approaches, individuals who can benefit from the treatment disclosed herein may have one or more risk alleles that reduce the binding to one or more transcriptional activators and reduce the transcription of the HTRA1 gene.As shown in Examples, the inventors have discovered a 2kb region located at Chr10:122454508-Chr10:122456564 ("2kb risk region"), which is transcriptionally active in RPE cells and is believed to be responsible for binding to transcriptional activators that can activate HTRA1 transcription.This 2kb region contains epigenetic markers of active transcriptional enhancer elements, including H3K4 monomethylation and H3K27 acetylation.For example, LHX2 binds to the sequence motif within this region with the nucleotide sequence TTGCCATAGTATATATAATTAGACAAAT (rs36212733 contains the non-risk allele T, underlined). LHX2 binds poorly to TTGCCGTAGTATATATAACTAGACAAAT (rs36212733 contains the risk allele C, underlined). See Figure 9 (Figures 10 and 11). Thus, in some approaches, the methods disclosed herein include administering a drug to a patient whose genomic DNA in this 2.0 kb region has reduced binding affinity to transcriptional activators for HTRA1, and administration of the drug increases HTRA1 expression in RPE cells. In some approaches, the patient exhibits reduced or complete loss of binding to LHX2. In some approaches, the patient may have a risk allele of C at rs36212733 (i.e., TTGCCATAGTATATATAACTAGACAAAT), which causes loss of binding to LHX2. In some approaches, treatment methods include administering a drug to a patient, where the drug increases HTRA1 expression in the patient's RPE cells by promoting binding of transcriptional activators (e.g., LHX2) to the transcriptional regulatory region of HTRA1.
[0119] 9.2.2 lncSCTM1 expression is inversely related to HTRA1 expression. In some approaches, individuals who may benefit from the treatments disclosed herein exhibit increased allele-specific expression of the non-coding RNA lncSCTM1 (also referred to as LOC105378525) or its isoforms compared to controls. lncSCTM1 is transcribed from a DNA sequence that shares the same LD block as HTRA1. As shown in Figure 7 and the Examples, lncSCTM1 shares a divergent promoter with HTRA1 and is transcribed in the antisense direction from the HTRA1 promoter. The allele-specific expression of lncSCTM1 is inversely associated with the allele-specific expression of HTRA1. In heterozygous patients, the mRNA level of the risk allele of lncSCTM1 (e.g., rs11200638) is higher than that of the non-risk allele of lncSCTM1. In contrast, the mRNA level of the risk allele of HTRA1 is lower than that of the non-risk allele (Figure 8).
[0120] In some approaches, patients who may benefit from the treatments disclosed herein possess one or more splice forms of lncSCTM1 that correlate with decreased expression of HTRA1. As shown in the Examples, lncSCTM1 exists as various splice variants (FIG. 7) and is expressed in various ocular tissues (FIG. 14).
[0121] In some approaches, the methods and compositions disclosed herein can be used to treat Chr10 AMD in individuals who have one or more clinical phenotypes of Chr10 AMD, such as having few drusen, intraretinal fluid (cyst), fast GA growth rate, and retinal / choroidal thinning.In some approaches, patients have one or more Chr10 risk alleles as disclosed above.In some approaches, patients have both one or more clinical phenotypes of Chr10 AMD and one or more Chr10 risk alleles.
[0122] In some cases, in addition to having a Chr10 AMD clinical phenotype and / or having a Chr10 risk allele, the patient also has a Chr1 risk allele and / or a Chr1-induced AMD clinical phenotype. Chr1 risk allele / haplotype. See U.S. Patent No. 7,867,727, which is incorporated herein by reference. In some cases, the patient does not have a Chr1 risk allele / haplotype for AMD.
[0123] 10. Administration method and dosage As described above, embodiments of the present invention include methods of administering agents to either increase HTRA1 expression or edit genomic regions to convert risk alleles to non-risk alleles in a subject in need of treatment. Thus, embodiments of the present invention include contacting a subject with one or more therapeutic agents, such as viral vectors, compounds, peptides, or combinations thereof, under conditions such that delivery of the agent to the subject, as described above, results in a beneficial effect on one or more aspects of the subject's health. The present invention is not limited to a specific site or method of administration. For example, and not by way of limitation, agents can be administered by systemic administration (e.g., intravenous injection or infusion), local injection or infusion (e.g., subretinal, suprachoroidal, intravitreal, transscleral, or otherwise intraocular), by use of an osmotic pump, by electroporation, by application (e.g., eye drops), and other means. It is contemplated that the transgenes of the present invention may be introduced into and expressed in a variety of cell types, including neural retinal cell types such as rod, cone, RPE, and ganglion cells, ciliary epithelium, sclera, choroid, and other ocular cells.
[0124] The therapeutic agent disclosed herein may be suspended in a physiologically compatible carrier for administration to humans. Administration may be by ocular or non-ocular route (e.g., intravitreal, intravascular, extraocular administration). Suitable carriers can be easily selected by those skilled in the art, taking into account the route of delivery. For example, one suitable carrier includes saline, which may be formulated with various buffers (e.g., phosphate-buffered saline).
[0125] 10.1 Ocular administration 10.1.1 Subretinal and Other Injections Introduction of therapeutic agents near the level of the RPE-choroid interface results in better modulation of HTRA1 regulation in the early stages of Chr10 AMD, preventing the vision loss associated with late-stage geographic atrophy and choroidal neovascularization. In one approach, agents are administered via subretinal injection by creating a subretinal bleb or blister to deliver viral vectors directly to the area of the retina affected by the disease. One or more blebs may be created in one or more quadrants of the eye to ensure adequate distribution of the therapeutic agent. See Xue et al., "TECHNIQUE OF RETINAL GENE THERAPY: DELIVERY OF VIRAL VECTOR INTO THE SUBRETINAL SPACE," Eye 31:1308-1316, 2017. See also Moore et al. 2017, Ochakovski et al. 2017, Schoen et al. 2015, supra.
[0126] In another approach, the drug is administered via suprachoroidal injection, thereby reaching the basal surface of the RPE. See Ding et al., "AAV8-vectored suprachoroidal gene transfer produces widespread ocular transgene expression," J Clin Invest 129(11): 4901-4911, 2019. See also Emami and Yiu, Medical and Surgical Applications for the Suprachoroidal Space, Int Ophthalmol Clin 59(1): 195-207, 2019. In another approach, the drug can be injected into the vitreous. This approach may be particularly useful for delivering drugs to the RPE of Chr10 AMD patients with geographic atrophy or CNV. This technique is well known to those skilled in the art. See Kansar et al., "Suprachoroidal Delivery of Viral and Nonviral Gene Therapy for Retinal Disease", J Ocular Pharmacol Ther DOI: 10. 1089 / jop. 2019. 0126.2020.
[0127] dose It is noted that dosage values may vary depending on the nature of the product and the severity of the condition.It is further understood that for any specific subject, specific dosage regimens may be adjusted over time according to the individual's needs and the professional judgment of the person administering or supervising the administration of the composition, and the dosage ranges set forth herein are merely exemplary and are not intended to limit the scope and practice of the claimed compositions.
[0128] The amount of the agent administered is an "effective amount" or "therapeutically effective amount," i.e., an amount that is effective at the dosage and for the period necessary to achieve the desired result. Desired results include an improvement in HTRA1 expression or activity in target cells (e.g., RPE cells), or a detectable improvement in symptoms associated with reduced HTRA1 expression, including, but not limited to, an improvement in AMD symptoms or signs, preferably a statistically significant improvement. Alternatively, when the pharmaceutical composition is used prophylactically, the desired result includes demonstrable, preferably statistically significant, prevention of one or more symptoms of Chr10 AMD, including, but not limited to, an AMD symptom or sign. The therapeutically effective amount of such a composition may vary depending on factors such as the individual's disease stage, age, sex, and weight, or the ability of the viral vector to induce a desired response in the individual. The administration regimen may be adjusted to provide an optimal response. A therapeutically effective amount is also one in which the therapeutically beneficial effects outweigh any toxic or harmful effects of the agent, e.g., the viral vector. The amount of the viral vector in the composition may vary depending on factors such as the individual's disease stage, age, sex, and weight.
[0129] Dosage regimens can be adjusted to provide optimal therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as needed due to the exigencies of the therapeutic situation. When the therapeutic agent is an AAV particle, the preferred human dosage is 100 to 300 μl per subretinal bleb, with 10 AAV genomes per injection. 8 From 10 12 More than one bleb may be created in one eye. Multiple treatments may be required in any given individual's lifetime.
[0130] 11. Treatment Results HTRA1 gene therapy in suitable patients, including the treatment of individuals at risk of developing AMD or in the early stages of the disease, can stabilize, alleviate or reverse the symptoms or signs of AMD in patients.For example, but not limited to, providing exogenous HTRA1 protein, introducing transcriptional activators into patients who are heterozygous or homozygous for Chr10 risk allele, can stabilize the disease and / or slow or reverse its progression, as demonstrated by various ocular biomarkers. In one approach, the primary desired treatment outcome in patients treated with an HTRA1-related therapy is a detectable improvement in one or more of the symptoms associated with Chr10 AMD: presence of drusen, intraretinal fluid (cysts), rapid GA growth rate and retinal / choroidal thinning, reduced retinal and choroidal vascular density, choriocapillaris ghosts in the macular region (no flow on OCT-A), choroidal fibrosis in the macular region, choroidal fibrosis in extramacular regions, Bruch's basement membrane deposits (BLD) in the macular region, BLD in the macular region, thickened Bruch's membrane in the macular region, and BLD in extramacular regions.
[0131] It is also contemplated that the desirable treatment outcome for patients treated with HTRA1-related therapy may be a detectable improvement in one or more functional measurements, including but not limited to: visual acuity (Early Treatment Diabetic Retinopathy Study, or ETDRS); best-corrected visual acuity (or BCVA); microperimetry (macular integrity assessment, or MAIA); dark adaptation; reading speed; visual evoked potential (VEP); and multifocal electroretinogram (mfERG). Other biomarkers that indicate stabilization, slowing, or reversal of AMD progression include, but are not limited to: BCVA change; area of GA change (square root transformation or alternative); visual fixation; reading speed; % new area of GA; photoreceptor cell length; individual drusen characteristics.
[0132] 12. Pharmaceutical Compositions Another aspect of the present invention relates to pharmaceutical compositions of the vectors of the present invention.In one embodiment, the composition comprises an effective amount of a drug and a pharmaceutically acceptable carrier.In some approaches, a sterile injectable solution can be prepared by incorporating the required amount of a vector, for example, a viral vector, with a suitable diluent or excipient for injection into a human patient, as appropriate.A unit dosage form, such as a single-use, pre-filled syringe or other injection or device, is provided, which has enough AAV particles or compounds for a single administration to a patient.Any pharmaceutical preparation of the present invention can be packaged in a form that includes or is accompanied by information about the preparation and its use for treating AMD.
[0133] 13. Definitions and Conventions Before the present invention is described in detail, it is understood that the invention is not limited to the particular approaches described, as such variations may, of course, occur. It is also understood that the terminology used herein is for the purpose of describing particular approaches only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0134] As used herein, the term "transgene" is used interchangeably with "exogenous gene" and refers to a recombinant polynucleotide construct that is introduced into a cell for expression using a gene therapy vector.
[0135] As used herein, the term " native promoter " refers to the promoter that naturally and / or naturally exists in cells, and is typically designated for the expression of a specific gene.For example, SEQ ID NO: 13 is the native HTRA1 promoter.The non-native promoter of a gene is not naturally associated with the gene.For example, VMD2 promoter (SEQ ID NO: 6) is not the native HTRA1 promoter.
[0136] As used herein, the term "natural transcriptional activator" refers to a transcriptional activator that is naturally and / or naturally present in a cell and is typically designated to control the transcription of a specific gene. For example, LHX2 is a natural transcriptional activator for the HTRA1 promoter, while VP16 is not a natural transcriptional activator for HTRA1.
[0137] As used herein, "gene therapy vector" refers to a virus-derived sequence element used to introduce a transgene into a cell.
[0138] As used herein, "viral vector" refers to a gene therapy vector containing capsid proteins that is used to deliver a transgene into a cell.
[0139] As used herein, the term "promoter" refers to a DNA sequence that can regulate (e.g., increase) the expression of a coding sequence or functional RNA. A promoter may include a minimal promoter (a short DNA sequence consisting of a TATA box and other sequences that serve to specify the site of transcription initiation). An enhancer sequence (e.g., an upstream enhancer sequence) is a control element that can interact with a promoter to regulate (e.g., increase) the expression of a coding sequence or functional RNA. As used herein, reference to a "promoter" may include an enhancer sequence.
[0140] Promoters and other regulatory sequences are "operably linked" to a transgene if they affect the expression or stability of the transgene or transgene product (e.g., mRNA or protein).
[0141] As used herein, the term "introduction" or "introduced" refers, in the context of gene therapy, to the administration of a composition containing, for example, a polynucleotide (DNA) encoding an HTRA1 polypeptide, a transcriptional activator, or a DNA endonuclease capable of increasing HTRA1 expression, under conditions in which the polynucleotide enters cells and is expressed in the cells to produce protein. The polynucleotide can be introduced using a viral (e.g., AAV2) vector, a non-viral vector system, or as naked DNA by other methods.
[0142] The term "corresponding to" and grammatical equivalents are used herein to refer to a position in a similar or homologous protein or nucleotide sequence, regardless of whether the exact position is the same or different in the molecule to which similarity or homology is being measured. For example, in the case of a first protein 100 residues in length and a second protein that is identical to the first except for a 5 amino acid deletion at the amino terminus, position 12 of the first protein "corresponds to" position 7 of the second protein.
[0143] "Adeno-associated virus 2 (AAV2)" and "recombinant adeno-associated virus 2 (rAAV2)" are used equivalently. Exemplary AAV2 vectors are derived from the adeno-associated virus 2 genome and have been extensively described in the scientific literature. See, e.g., Srivastava, et al., 1983, J. Virol. 45: 555-564, which is incorporated herein by reference, and other references cited herein below.
[0144] As used herein, " lentivirus " refers to the gene therapy vector (lentivirus vector) that can be used to introduce transgene into cell.See, for example, Keeker et al., 2017, Clin Transl Sci. 10: 242-248, which is incorporated herein by reference, and other references cited herein below.
[0145] The term "identical" or percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that are the same ("identical") or have a specified percentage of identical amino acid residues or nucleotides (i.e., at least about 70% identity, at least about 75% identity, at least 80% identity, at least about 90% identity, preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity over the entire sequence of a specified region, as measured by manual alignment and visual inspection or by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below (see, e.g., the NCBI website, ncbi.nlm.nih.gov / BLAST / , etc.), when compared and aligned for maximum correspondence over a comparison window or designated region). Such sequences are then referred to as "substantially identical."
[0146] The term "subject" or "patient" refers to humans or animals (particularly mammals) and other organisms receiving either prophylactic or therapeutic treatment. For example, the subject may be a non-human primate.
[0147] As described below, preferred algorithms can take gaps and the like into account. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 or more amino acids or nucleotides in length. For sequence comparison, typically one sequence serves as a reference sequence to which a test sequence is compared. In some approaches, percent identity is determined relative to the entire length of a reference sequence selected from SEQ ID NO:1 (the nucleotide sequence of HTRA1) or SEQ ID NO:2 (the amino acid sequence of HTRA1). When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, and sequence algorithm program parameters are designated, if necessary. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the program parameters. As used herein, a "comparison window" includes reference to any one segment of the number of contiguous positions selected from the group consisting of 20 to 600, usually about 50 to about 200, and more usually about 100 to about 150, within which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of aligning sequences for comparison are well known in the art.Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)). Algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., Nuc. Acids Res. 25: 3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215: 403-410 (1990), respectively. BLAST and BLAST 2.0 are used with the parameters described herein to determine percent sequence identity for the nucleic acids and proteins of the present invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).This algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words in the query sequence that, when aligned with words of the same length in a database sequence, match or meet a certain positive threshold score, T. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. Word hits are extended along both sides of each sequence for as long as the cumulative alignment score can be increased. For nucleotide sequences, the cumulative score is calculated using the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of word hits in each direction is stopped if the cumulative alignment score falls below the maximum achieved value by more than X; if the cumulative score falls below zero due to the accumulation of one or more negative-scoring residue alignments; or if either end of the sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length of 3 and an expectation (E) of 10, and the BLOSUM62 scoring matrix [see Henikoff & Henikoff, Proc. Natl. Acad. SciUSA 89: 10915 (1989)] an alignment (B) of 50, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0148] "Drusen" are focal extracellular deposits containing lipids, fluid, and various proteins, including complement pathway-related proteins, located between the RPE basement membrane and Bruch's membrane. Drusen can be seen ophthalmoscope-wide as white / yellow dots and can be detected using various methods known in the art, including those described in Wu et al., 2015, "FUNDUS AUTOFLUORESCENCE CHARACTERISTICS OF NASCENT GEOGRAPHIC ATROPHY IN AGE-RELATED MACULAR DEGENERATION," Invest Ophthalmol Vis Sci. 56:1546-52 and references 1-8 in the literature. As used herein, the terms "small drusen" and "small, hard drusen" refer to discrete drusen with a diameter of less than approximately 63 μm. The terms "large drusen," "soft drusen," and "large, soft drusen" refer to drusen with a diameter greater than approximately 125 μm, often clustered. Drusen with diameters between 63 and 125 μm may be referred to as “intermediate drusen.” Localized detachment of the RPE, typically referred to as pigment epithelial detachment (PED), is often referred to as drusen.
[0149] As used herein, "haplotype" refers to DNA sequences or combinations of DNA sequences present at different loci on a chromosome that are transmitted together; a haplotype can be one locus, a few loci, or an entire chromosome, depending on the number of recombination events that have occurred between a given set of loci.
[0150] The term "polymorphism" refers to the occurrence of one or more genetically determined alternative sequences or alleles in a population. A "polymorphic site" is a locus where sequence divergence occurs. A polymorphic site has at least one allele. A diallelic polymorphism has two alleles. A triallelic polymorphism has three alleles. Diploid organisms may be homozygous or heterozygous for an allelic form. A polymorphic site may be as small as one base pair. Examples of polymorphic sites include: restriction fragment length polymorphisms (RFLPs), variable number of tandem repeats (VNTRs), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, and simple sequence repeats. As used herein, reference to a "polymorphism" may encompass a set of polymorphisms (i.e., a haplotype).
[0151] A "single nucleotide polymorphism (SNP)" can occur at a polymorphic site occupied by a single nucleotide, which is a site of variation between allelic sequences. The site may be preceded and followed by a highly conserved sequence of the allele. A SNP can arise due to the substitution of one nucleotide for another at the polymorphic site. The substitution of one purine for another or one pyrimidine for another is called a transition. The substitution of a purine for a pyrimidine, or vice versa, is called a transversion. A synonymous SNP refers to the substitution of one nucleotide for another in a coding region that does not change the amino acid sequence of the encoded polypeptide. A non-synonymous SNP refers to the substitution of one nucleotide for another in a coding region that changes the amino acid sequence of the encoded polypeptide. A SNP can also result from the deletion or insertion of one or more nucleotides compared to a reference allele.
[0152] As used herein, "linkage disequilibrium" or "LD" refers to the non-random association of alleles at two or more loci, not necessarily on the same chromosome. It is not the same as linkage, which describes the association of two or more loci on a chromosome with limited recombination between them. Linkage disequilibrium describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected based on their frequencies from the random formation of haplotypes from the alleles. The non-random association between polymorphisms at various loci is measured by the degree of linkage disequilibrium (LD). The level of linkage disequilibrium can be affected by numerous factors, including genetic linkage, recombination rate, mutation rate, random drift, non-random mating, and population structure. Thus, "linkage disequilibrium" or "allelic association" refers to the non-random association of a specific allele or genetic marker with another specific allele or genetic marker at a frequency higher than would be expected by chance for the frequency of any specific allele in a population. Markers in linkage disequilibrium with informative markers, such as one of the SNPs, haplotypes or diplotypes described herein, may be useful for detecting susceptibility to Chr10-induced AMD.
[0153] "ARMS2" refers to the AMD susceptibility 2 gene. The ARMS2 gene consists of two exons, has no homology to known protein motifs, and theoretically encodes a 107-amino acid protein of unknown function. The expression and localization of the ARMS2 protein within cells remain elusive, and the use of poorly characterized antibodies has produced conflicting reports (Fritsche et al., 2008; Kanda et al., 2007; Kortvely et al., 2010; Wang et al., 2012). Furthermore, RNA-Seq analysis has shown that ARMS2 mRNA expression is exceptionally low (TPM < 1.0) in most tissues, except for testis (TPM approximately 6.9) and placenta (qRT-PCR, data not shown) (Lonsdale et al., 2013; The GTEx Consortium, 2015).
[0154] "HTRA1" refers to HtrA serine peptidase 1, whose mRNA and protein are represented by Gene Bank accession numbers NM_002775 and NP_002766, respectively. HTRA1 is ubiquitously expressed in almost all cells and tissues examined, and is abundantly expressed in photoreceptor and horizontal cells of the retina, the retinal pigment epithelium (RPE), and various cell types in the choroid (Figure 1). HTRA1 is enriched in extracts from Bruch's membrane and choroid compared to the retina and RPE (Figure 6). HTRA1 acts as a secreted serine protease and exists primarily as an approximately 150 kDa trimer in solution. HTRA1 is activated by an allosteric mechanism (Cabrera et al., 2017) and cleaves various extracellular matrix proteins, proteoglycans, and numerous growth factors, such as TGFβ, FGF, and IGFBP. In HTRA1 knockout mouse models, loss of HTRA1 results in an increase in multiple ECM proteins in the cerebrovascular proteome, including TIMP3, clusterin, elastin, vitronectin, and fibulin-3 (Zellner et al., 2018). Loss-of-function mutations that impair HtrA1 protease activity or reduce mRNA expression can also result in CARASIL (autosomal recessive cerebral arteriopathy with subcortical infarctions and leukoencephalopathy) due to age-related vasculature defects in the brain (Hara et al., 2009; Fukutake, 2011).
[0155] The term "treatment" or any grammatical variations thereof (e.g., treat, treating, treatment, etc.) as used herein includes, but is not limited to, alleviating the symptoms of a disease or condition; and / or reducing, suppressing, inhibiting, palliating, ameliorating or affecting the progression, severity, and / or extent of a disease or condition.
[0156] As used herein, the term "transcriptional control region" refers to the HTRA1 promoter and HTRA1 enhancer.
[0157] As used herein, the term "enhancer" refers to the HTRA1 2 kb region.
[0158] As used herein, the term "corresponding to" in the context of a sequence refers to the complement, an RNA sequence that is equivalent to the DNA sequence except for substitutions that are clear from the context, such as U for T.
[0159] As used herein, "codon optimization" has its usual meaning in the art. Codon optimization can be used to increase the rate of translation or to produce recombinant RNA transcripts with desirable properties, such as a longer half-life or greater expression efficiency, compared to transcripts produced using non-optimized sequences. In some embodiments, the present disclosure provides HTRA1 coding sequences engineered to maximize expression efficiency. Methods for codon optimization are readily available, for example, optimizer, available for free at http: / / genomes.urv.es / OPTIMIZER and GeneGPS® Expression Optimization Technology from DNA 2.0 (Newark, California). In a specific embodiment, the coding sequence is codon-optimized for human expression using the OptimumGene™ algorithm from GenScript (Piscataway, New Jersey).
[0160] As used herein, a Cas protein that is "lacking nuclease activity" has at least a 50% reduction in activity, sometimes at least an 80% reduction, sometimes at least a 95% reduction, and sometimes at least a 99% reduction in activity compared to the wild-type equivalent.
[0161] As used herein, the term "horizontal cells" has its usual meaning in the art. See, for example, Poche et al., "Retinal horizontal cells: challenging paradigms of neural development and cancer biology," Development, 2009, 136, Pages 2141-2151. "Horizontal cells" are laterally interconnected neurons with their cell bodies in the inner nuclear layer of the vertebrate retina. They integrate and control inputs from multiple photoreceptor cells.
[0162] As used herein, the term "photoreceptor cells" refers to specialized neuroepithelial cells found in the outermost layer of the neural retina. They enable visual phototransduction and are of two main types: rods, which mediate scotopic vision, and cones, which mediate photopic vision.
[0163] As used herein, a "programmable" endonuclease is a nuclease that can be specifically targeted to a particular DNA sequence by selection of an associated molecule (e.g., a gRNA for a Cas protein), a fused protein sequence, or other means.
[0164] The following conventions are used herein: A DNA "target sequence" [A] is contiguous with the PAM [P] on the first DNA strand. The complement [C] of the target sequence is found on the complementary DNA strand. The guide sequence [G] of the gRNA hybridizes to and is complementary to the complement of the target, and has the sequence of the target [A] except that thymidines in the DNA are replaced by uracils in the RNA. The guide sequence of the gRNA can be produced by transcription from [C].
[0165] Unless otherwise indicated, nucleotide sequences are shown 5' to 3'.
[0166] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, representative illustrative methods and materials are described herein. [Example]
[0167] 14.1 HTRA1 expression is reduced in the RPE of human donors carrying the chromosome 10 risk allele. This example demonstrates that human donor eyes from individuals with AMD risk alleles have lower mRNA HTRA1 expression compared to controls.
[0168] Microarray-based gene expression analysis was performed using two independent sets of human donor ocular tissues (containing 80 and 200 donor samples, respectively). Results show that HTRA1 mRNA levels were reduced in RPE-choroid tissues from human donors homozygous or heterozygous for the risk allele at rs10490924 compared with non-risk donors homozygous for the non-risk allele (Figures 2 and 3). The results of reduced HTRA1 mRNA levels in RPE-choroid tissues were confirmed by qRT-PCR analysis (Figures 3A and 3B). Allele-specific expression analysis using mRNA from heterozygous donor RPE tissue samples also showed a significant and reproducible reduction in risk allele mRNA compared with wild-type allele mRNA. mRNA copy numbers for the non-risk allele versus the risk allele were determined using digital PCR and Taqman SNP assays. No allele-specific mRNA changes were detected in choroid or retina from the same donor samples (Figure 4). These results from allele-specific HTRA1 expression assays strongly support that AMD-associated risk alleles result in reduced expression of HTRA1 mRNA.
[0169] The results also show that the reduction in HTRA1 mRNA was tissue-specific and was detected only in the RPE, but not in the retina. Figures 2, 3A, 3B, and 30 show that HTRA1 mRNA levels were reduced in the RPE and choroid tissues of patients with one or two risk alleles at rs10490924 compared with non-risk donors with two wild-type non-risk alleles, whereas HTRA1 expression in the retina remained unchanged.
[0170] 14.2 In ocular tissues from human non-AMD samples, HTRA1 expression is enriched in Bruch's membrane and choroid. This example demonstrates that HTRA1 mRNA is secreted in a polarized manner and is enriched in Bruch's membrane and choroid in human ocular tissues from non-AMD samples.
[0171] In both polarized hTERT-RPE1 cells (a human RPE cell line; see Bodnar et al., 1998, Science 279:349-52) and human fetal RPE cells, HTRA1 protein was secreted in a polarized manner, with 70% HtrA1 secreted apically and 30% secreted basally (Figures 5A and 5B). Basal secretion of HTRA1 may be the exclusive source of HTRA1 beneath the RPE in elderly individuals, because HTRA1 trimers are not expected to enter the sub-RPE space from the choriocapillaris due to the selective permeability of Bruch's membrane and the RPE basement membrane (Moore, DJ et al., 2001). The interface between the RPE and Bruch's membrane is highly enriched in extracellular matrix (ECM) proteins, and HTRA1, a secreted serine protease with demonstrated ability to degrade various ECM proteins, is thought to have essential aging-related functions in this space. Compared with the retina, RPE, and choroid, the data show that HTRA1 protein was enriched in extracts from Bruch's membrane in samples from patients without AMD (Figure 6). Without intending to be bound by any particular theory or mechanism, these results are consistent with a model in which homozygous risk patients with reduced HTRA1 protein in the sub-RPE space have alterations in the processing, maintenance, or turnover of ECM proteins, resulting in the accumulation of damaged, misfolded, and / or aggregated proteins. This can disrupt the attachment of RPE tissue to its basement membrane and / or to Bruch's membrane, resulting in loss of the blood-retinal barrier. In support of this, the inventors demonstrated that both choroidal fibrosis and basement membrane deposits (BLDs) (abnormal extracellular material located between the RPE cell membrane and the basement membrane and previously shown to be strongly associated with late-stage AMD) occurred in donors homozygous for chromosome 10 risk (Table 1, above). Mutations in several ECM structural proteins resulting in misregulation result in AMD-like diseases, including L-ORD (C1qTNF5), Sorsby fundus degeneration (TIMP3), Ehlers-Danlos syndrome type VI (PLOD1) or Doyne's honeycomb retinal dystrophy (EFEMP1).See Hayward et al., Hum. Mol. Genet. 12: 2657-67 (2003); Weber et al., Nat. Genet. 8 (4): 352-6; and Marmorstein et al., PNAS. 99 (20): 13067-72, suggesting that alterations in ECM and BLD formation may share a common cause.
[0172] 14.3 HtrA1 protein in human ocular tissues The goal of AAV-HTRA1 therapy is to deliver therapeutic amounts of HtrA1 to the eye to restore function. Toward this goal, understanding the concentration of HtrA1 in human and AGM ocular tissues is necessary. We measured the concentration of HtrA1 by ELISA assay in extracts of various ocular tissues. The concentrations in human ocular tissues are summarized in Table 6.
[0173] [Table 6]
[0174] Comparison of HtrA1 protein and mRNA levels in the outer macular retina and RPE-choroid with age in donors with and without risk at the Chr10 locus demonstrated that HtrA1 levels remained relatively unchanged in the retina with age regardless of Chr10 risk status (Figure 12), but significantly increased with age in the RPE-choroid of donors without Chr10 risk (Figure 13A). In contrast, donors with Chr10 risk exhibited a significant impairment in the age-dependent increase of HtrA1 in the RPE-choroid of non-risk donors. This is consistent with a similar age-dependent increase in HTRA1 mRNA in non-risk donors but not in at-risk donors (Figure 13B). Without intending to be bound by any particular theory or mechanism, these results are consistent with a model in which there is an increased demand for HtrA1 with age, which is met by transcriptional upregulation of HTRA1 mRNA, resulting in greater HtrA1 protein translation, but in donors homozygous for risk, HTRA1 fails to be upregulated at either the mRNA or protein level.
[0175] 14.4 A 4 Kb region containing regulatory elements that result in decreased HTRA1 mRNA expression is also associated with AMD risk. This example demonstrates that the genomic region responsible for the loss of HTRA1 coincides with the region associated with the risk of developing AMD.
[0176] To narrow the region on chromosome 10 responsible for AMD (the risk region), we performed HTRA1 allele-specific expression assays using mRNA from donors with rare recombination events within the AMD-associated ARMS2 / HTRA1 LD block. The donors were heterozygous for the rs1049331 SNP in HTRA1 exon 1 but homozygous for either the risk or non-risk allele at some of the upstream SNPs within the LD block. These donors were used in allele-specific expression assays, and recombination sites in each donor were mapped via DNA sequencing to rule out the HTRA1 promoter SNP and the ARMS2 indel region as causal drivers of reduced HTRA1 mRNA expression. Instead, we mapped the region associated with reduced HTRA1 mRNA to the upstream regulatory region encompassing rs10490924 (ARMS2 A69S) and including and between rs11200632 and rs3750846 SNPs (Table 8). The same genetic region was found to be associated with an increased risk of AMD disease by Grassmann et al. (Genetics 2017) in an analysis of recombinant haplotypes in a case / control study. The finding that the region associated with allele-specific expression of HTRA1 coincides with the same region associated with AMD risk strongly implies that a risk-associated reduction in HTRA1 expression leads to an increased incidence of AMD. This region is referred to as the 4kb AMD risk region.
[0177] Table 7 below shows nine haplotypes in the ARMS2 region, each comprising more than 2% of the population. Haplotypes H1, H2, H3, and H6 all confer increased risk for Chr10 AMD and all contain the T allele at SNP rs10490924. This indicates that the presence of the risk allele at rs10490924 (A69S) is associated with the development of Chr10 AMD.
[0178] [Table 7-1] [Table 7-2] [Table 7-3]
[0179] [Table 8]
[0180] 14.5 Inverse correlation between HTRA1 and lncSCTM1 mRNA expression This example demonstrates an inverse correlation between HTRA1 and incSCTM1 allele-specific mRNA expression. A long noncoding RNA (LOC105378525) was identified and mapped to a region overlapping with the 4-kb AMD risk region. Our analysis showed that there are four predicted variants of this lncRNA, including XR_946382, XR_946383, XR_946384, and XR_9463 (Figure 7). The various isoforms of lncSCTM1 detected in hTERT-RPE1 cells, retina, and RPE tissues are listed in Table 9. This lncRNA is transcribed in the antisense direction from the HTRA1 promoter, suggesting that HTRA1 and LOC105378525 may share overlapping divergent promoters. We designated this lncRNA lncSCTM1. Rapid amplification of cDNA ends (RACE) PCR analysis of RNA from retina and RPE indicates that exon 3, which maps to XR_946382 variant 1, extends approximately 1 kb beyond the reported exon 3. This is supported by RNA-seq data from the GTEx Consortium, in which reads map to this extended region in various tissues. RACE PCR also indicates that the alternative exon 3, which maps to variant 4 (XR_946385), begins at either hg38 Chr10:122,455,021 (alt ex3a) or Chr10:122,454,857 (alt ex3b) and extends in the antisense direction to Chr10:122,454,457. Sequence analysis indicates that the alt ex3a variant contains the rs10490924 SNP, and that the risk form is associated with increased AMD risk, whereas alt ex3b is not. Furthermore, variants involving exon 3 instead of the alternative exon 3 do not contain rs10490924 or any other SNPs in the 4 kb AMD risk region. The lncSCTM1 alternative exon 3 almost completely overlaps with ARMS2 exon 1.
[0181] [Table 9]
[0182] Because lncRNAs sometimes regulate the expression of nearby genes, the relationship between HTRA1 mRNA and lncSCTM1 ncRNA levels was examined using allele-specific expression assays for HTRA1 (rs1049331, exon 1) and lncSCTM1 (rs11200638, exon 1). mRNA from heterozygous donors was used in the assays, and any deviation from the expected 50:50 ratio was indicative of allele-specific expression. Gene-specific primers were used for cDNA synthesis to ensure that the transcripts were derived from the expected strand. It was observed that allele-specific expression of HTRA1 was inversely correlated with that of lncSCTM1. Results also showed that mRNA from the risk allele of lncSCTM1 was expressed at higher levels than that from the non-risk allele, while mRNA from the risk allele of HTRA1 was reduced compared to that from the non-risk allele (Figure 8). The risk allele analyzed in Figure 8 was rs11200638, which is located in an LD block associated with AMD that includes rs10490924. rs11200638 is also located in exon 1 of lncSCTM1 and is present in all isoforms of lncSCTM1. RNA-seq analysis of retina and RPE showed that HTRA1 mRNA was expressed at levels >400-fold higher than lncSCTM1 mRNA (data not shown). If lncSCTM1 regulates HTRA1 expression, it is unlikely that it can regulate HTRA1 in trans. Rather, it is likely that lncSCTM1 regulates HTRA1 expression through a cis effect on HTRA1 transcription.
[0183] 14.6 A 2-kb AMD risk region containing regulatory elements that result in decreased HTRA1 mRNA expression Epigenetic markers This example describes a newly identified 2-kb region responsible for regulating HTRA1 transcription and its associated transcriptional activators. Examination of publicly available epigenetic data (ATAC-Seq and DNase-Seq) from human fetal RPE tissue or induced pluripotent stem cells differentiated into RPE (iPSC-RPE) reveals an approximately 2.0-kb region of open chromatin that overlaps with the 4-kb AMD risk region. Furthermore, this same 2-kb region contains epigenetic markers of active transcription, including H3K27 acetylation. This 2-kb region overlaps with both the ARMS2 exon 1-intron 1 and alternative exon 3 of lncSCTM1 (Figure 10), as well as other SNPs in the 4-kb AMD risk region, including rs36212731, rs36212732, rs36212733, and rs3750848.
[0184] ChIP-Seq analysis of retinal and RPE extracts was performed using antibodies targeting histone marks associated with enhancer elements, including monomethylated histone H3 lysine 4 (H3K4me1) and acetylated histone H3 lysine 27 (H3K27Ac). In RPE extracts, both marks were present in peaks overlapping with open chromatin regions, whereas only the H3K4me1 mark was present in the retina. These results support the hypothesis that this approximately 2-kb region within the ARMS2 intron functions as a tissue-specific enhancer element.
[0185] SNP located in a 2 kb region. Eight SNPs (rs10490924, rs144224550, rs36212731, rs36212732, rs36212733, rs3750848, rs3750847, and rs3750846) are located within the Chr10 LD block.
[0186] The 14.7 2 Kb region contains the LHX2 consensus binding motif that is present in the wild type but absent in the risk allele. We scanned sequences for known transcription factor binding motifs using the HOMER, JASPER, and TRANSFAC tools, comparing non-risk and risk genotypes for each AMD-associated SNP. This analysis identified the rs36212733 variant in the ARMS2 intron as a transcription factor binding site with predicted genotype-dependent differential binding of LHX2, POU6F1, and / or ZNF33. Of these, LHX2 mRNA expression is moderate (FPKM > 20) in the RPE, while POU6F1 and ZNF333 expression is low (FPKM < 2). Of these screened, only LHX2 possesses a consensus binding motif located in the wild-type but not in the risk sequence, with near-perfect matches for this sequence motif in the ARMS2 and lncSCTM1 introns (Figure 9). LHX2 is also expressed in some cell types in the retina and choroid, and is therefore not an RPE-specific transcription factor. The rs36212733 SNP, associated with AMD risk, disrupts one of the critical residues within this motif by converting a "T" to a "C" at position 6. The LHX2 site is surrounded by two potential binding sites for members of the SoxE family of transcription factors, which do not overlap with the Chr10-associated SNP.
[0187] Without intending to be bound by any particular theory or mechanism, these data are consistent with a model in which LHX2 binds to a motif in the 4-kb AMD risk region upstream of HTRA1, overlapping with rs36212733 and both the ARMS2 and lncSCTM1 genes. In non-risk RPE cells, LHX2 binds to this motif together with an RPE-specific cofactor and acts as an enhancer of HTRA1 transcription, thereby increasing HTRA1 expression above basal levels in an RPE-specific manner. The identity of the RPE-specific cofactor at this time and whether its expression is affected by age-related factors or other external signals are unknown. If LHX2 binding to this enhancer interferes with the ability of RNA polymerase to drive lncSCTM1 transcription, this results in reduced lncSCTM1 gene expression. Because LHX2 is predicted to bind only to the non-risk allele, this would result in allelic imbalance, including reduced levels of the non-risk allele compared to the risk allele in heterozygous donors. This hypothesis is supported by our finding that there is an inverse correlation between the allele-specific expression of HTRA1 and lncSCTM1 in RPE cells (Figure 8). Finally, in non-RPE cells, binding of LHX2 to non-risk sequences does not enhance HTRA1 expression due to the absence of RPE-specific cofactors. However, it still interferes with lncSCTM1 transcription, resulting in low-level expression of the non-risk allele. Thus, in non-RPE tissues, there is no allele-specific expression of HTRA1, but allele-specific expression of lncSCTM1 remains as long as the cells express LHX2.
[0188] 14.8 LHX2 binds more strongly to the wild-type probe than to the probe containing the risk sequence. To test whether LHX2 can bind to this DNA sequence, electrophoretic mobility shift assays (EMSAs) were performed using nuclear extracts from HEK293 cells transfected with an LHX2-encoding plasmid or an empty vector, and biotinylated oligoprobes containing either the wild-type (WT) sequence or the risk sequence (RISK) of the Chr10 region encompassing rs36212732 and rs36212733. Probes containing a scrambled sequence (SCR, a negative control) of this region or a previously reported LHX2 binding site (POS, a positive control) (Muralidharan et al. (2017) J. Neurosci 37(46):11245-54) were also used. The results show that LHX2 bound to both the wild-type and risk probes, as well as the positive control probe, but not to the scrambled probe (Figure 10A). Addition of anti-LHX2 antibody to the reaction resulted in a supershift of the LHX2 band, confirming its identity, while addition of unlabeled probe resulted in loss of the band (Figure 10B). Finally, we compared the binding affinity of LHX2 to wild-type versus risk probes by adding increasing amounts of probe to the reaction. LHX2 bound more strongly to the wild-type probe than to the probe containing the risk sequence (Figure 11). Collectively, these results indicate that LHX2 can bind to the sequence encompassing rs36212733 and that the presence of the risk allele significantly reduces LHX2 binding to this sequence. Combined with the epigenetic data described above and the eQTL association between rs36212733 and HTRA1 expression, our results support the hypothesis that this region functions as an enhancer for HTRA1 expression in RPE cells and that LHX2 may contribute to HTRA1 expression.
[0189] 14.9 Use of the CRISPRa system (lentiviral plasmid) to upregulate HTRA1 mRNA expression Microarray and qRT-PCR analysis of donor RPE tissue demonstrated that HTRA1 mRNA levels were downregulated by approximately 30% in donors homozygous for Chr10 at-risk compared with non-risk donors. The SAM CRISPRa system was selected to restore HTRA1 expression in RPE tissue to levels similar to those in non-risk donors while minimizing any off-target effects on gene expression. The SAM system consists of two plasmids: the LentiSAM plasmid (SAM; Addgene #92062), which encodes both the sgRNA and the dCas9-VP64 fusion protein, and the LentiMPH (MPH; Addgene #92065), which encodes a fusion protein consisting of an MS2 affinity tag and the p65 and HSF1 transcription factors.
[0190] Using Benchling software, sgRNAs were designed to encompass the promoter region of HTRA1 (Figure 14). These sequences, along with the published sgRNA sequence targeting IL1B, were cloned into the BsmBI site adjacent to the U6 promoter in the lentiSAM v2 (Puro) plasmid (Addgene). Cells were transfected by electroporation with the sgRNA-LentiSAM v2 (Puro) plasmid, with or without an equimolar amount of Addgene (Neo) plasmid (5 μg total). After 24–96 h, total RNA was extracted and purified using the RNeasy kit (Qiagen, catalog no. 74106). Complementary DNA was generated using 1 μg of total RNA and the SuperScript IV VILO Master Mix kit (Invitrogen, catalog no. 11756050). Quantitative PCR was performed using 50 ng of cDNA and TaqMan gene expression assays (Applied Biosystems) for HTRA1 (Hs01016151_m1), IL1B (Hs01555410_m1), and GAPDH (hs03929097_g1) according to standard protocols.
[0191] We tested the ability of the sgRNAs listed in Table 10 to upregulate HTRA1 expression using the SAM CRISPRa system [Konerman et al., Nature, 517 (7536) 015].
[0192] [Table 10]
[0193] Figure 15 shows that most sgRNAs upregulate HTRA1 to some degree. The P7 and P18 sgRNAs showed the highest increase in HTRA1 levels (approximately 3.6- and 3.2-fold for the P7 and P18 sgRNAs, respectively).
[0194] To assess whether either plasmid had off-target effects on mRNA levels, we transfected SAM components individually (MPH or SAM) or together (MPH + SAM) into h1RPE7 cells. In these experiments, the sgRNA in the SAM plasmid did not target any known human gene (Ctrl sgRNA). As shown in Figure 16, compared to mock-transfected cells, the MPH plasmid increased HTRA1 levels by approximately 1.8-fold in the absence of the HTRA1-targeting sgRNA. Similarly, there was an approximately 1.6-fold increase in HTRA1 in cells transfected with the SAM plasmid alone, which was not further increased by the presence of the MPH transcription factor. These data indicate that SAM system components can promote a general increase in transcription.
[0195] Next, we conducted experiments to determine whether the MPH plasmid was required for upregulation of HTRA1. We tested the effects of our strongest HTRA1-targeting sgRNAs (P7 and P18, Figure 17) on HTRA1 expression in h1RPE7 cells in the absence and presence of the MPH plasmid. We found that HTRA1 levels were increased by the SAM plasmid (5-fold for P7 and 2.5-fold for P18), even in the absence of the MPH plasmid, albeit at reduced levels compared to the levels when MPH was included (7-fold for P7d and 5-fold for P18). Therefore, a single plasmid encoding the HTRA1-targeting sgRNA and the dCas9-VP64 transactivator appears sufficient to upregulate HTRA1 expression. Additionally, if the SAM system is concentration-dependent on HTRA1 levels, the effect decreased with decreasing amounts of the SAM plasmid (Figure 18).
[0196] 14.10 Increased HTRA1 mRNA correlates with increased HTRA1 protein levels. Preliminary experiments were conducted to examine whether the increase in HTRA1 mRNA described above correlated with an increase in HtrA1 protein levels. Using an ELISA assay, we measured HtrA1 protein concentrations in the cell culture supernatants of h1RPE7 cells transfected with the LentiSAM plasmid. We transfected h1RPE7 cells with various amounts of the P18 sgRNA-LentiSAM plasmid (2.5, 5.0, and 7.5 μg) for various time points (3, 4, and 5 days). We also transfected cells with a non-targeting sgRNA (Ctrl) for use as a control. Figure 19 shows that HTRA1 protein levels specifically increased in P18 sgRNA-LentiSAM-transfected cells 3 and 4 days after transfection. Protein levels reached their maximum using 5 μg of the LentiSAM plasmid. Figure 20 shows HTRA1 protein levels normalized to ENPP-2 protein. These initial results show that HTRA1 protein levels were specifically increased in cells transfected with the P18 sgRNA-LentiSAM plasmid 3 and 4 days after transfection compared to controls.
[0197] The above data demonstrate that HTRA1 mRNA and protein levels are upregulated in a dose-dependent manner in h1RPE7 cells transiently transfected with the P18 sgRNA-LentiSAM plasmid.
[0198] 14.11 Lentiviral Delivery The lentiviral particles shown in Table 11 were constructed. These particles contain the P18-lentiSAM plasmid.
[0199] [Table 11]
[0200] We tested whether lentiviral delivery of the CRISPR-based SAM system could induce HTRA1 expression in RPE cells. h1RPE7 cells were transduced with lentiviral particles encoding the P18-LentiSAM plasmid at an MOI of 20, and cell culture supernatants were collected every three days after transduction. As a control, cells were transduced with lentiviral particles encoding a non-targeting sgRNA (Ctrl-LentiSAM). Cells were also treated with virus-free polybrene-containing medium (mock). HTRA1 protein levels in cell culture supernatants collected 3, 6, and 9 days after transduction were measured using an HTRA1 ELISA assay. As shown in Figure 21, HTRA1 protein levels increased approximately 40% (1.4-fold increase compared to Ctrl-LentiSAM) in cells transduced with P18-LentiSAM compared to cells transduced with Ctrl-LentiSAM viral particles at days 6 and 9 after transduction.
[0201] To compensate for possible differences in cell number after transduction for each individual sample, HtrA1 protein levels were normalized to ENPP2 protein levels, which increased in all samples over time but did not differ between control and P18-LentiSAM-treated cells (data not shown). Figure 23 shows HTRA1 protein levels normalized to ENPP-2 protein. HtrA1 levels increased approximately 30-40% at 6 and 9 days after transduction with P18 sgRNA-LentiSAM. To examine the correlation between HTRA1 mRNA expression and secreted HTRA1 protein levels, HTRA1 mRNA levels were measured from total RNA extracts extracted 9 days after transduction (Figure 23). HTRA1 mRNA levels were increased approximately twofold in cells treated with P18-LentiSAM compared to cells treated with Ctrl-LentiSAM. Thus, both HTRA1 mRNA and protein levels increased in response to P18-LentiSAM treatment. This indicates that viral delivery of the CRISPR-based SAM system can successfully induce HTRA1.
[0202] Experiments in this example were carried out to develop an AAV2-based vector carrying the HTRA1 gene under the control of a suitable RPE-specific promoter to restore wild-type expression levels of HTRA1 in the RPE of AMD patients. The HTRA1 gene was subcloned from the pCTM16 plasmid into pCTM295 (pCTM289) using the KpnI and SphI restriction sites to generate pTR-HTRA1. Fragments of the BEST1 and RPE65 promoters were PCR-amplified using primers with Acc65I (forward) and BamHI (reverse) restriction sites. The PCR product was digested with Acc65I and BamHI and subcloned into pCTM289 at these sites to generate an HTRA1 expression plasmid under the control of the BEST1 and RPE65-derived promoter fragments.
[0203] Table 12 shows the primers used to prepare the respective promoter fragments from the BEST1 promoter (SEQ ID NO: 11) and the RPE65 promoter fragment (SEQ ID NO: 12). RPE1 cells stably expressing the HTRA1 3-UTR-targeting shRNA plasmid (and therefore expressing low levels of endogenous HTRA1) were transfected with 5 μg of the indicated plasmids by electroporation using a 100 μl Neon tip or by lipid transfection in 96-well plates containing 10,000 cells per well. A combination of 0.15 μl Lipofectamine 3000, 0.2 μl P3000, and 100 ng DNA was used. Cell culture supernatants and RNA were harvested 24 to 96 hours after transfection. Our standard HTRA1 ELISA was performed to measure protein levels. Total RNA was extracted from cells using the RNeasy kit (Qiagen, catalog no. 74106). Complementary DNA was generated using 500 ng of total RNA and the SuperScript IV VILO Master Mix kit (Invitrogen, catalog no. 11756050). Quantitative PCR was performed for HTRA1 (Hs01016151_m1) and GAPDH (hs03929097_g1) using 50 ng of cDNA and TaqMan gene expression assays (Applied Biosystems).
[0204] [Table 12]
[0205] We tested these AAV-HTRA1 plasmids for HTRA1 overexpression in a pooled population of RPE1 clones (7-6 and 7-7) with stable knockdown of HTRA1 (>90%) using electroporation. Because HTRA1 levels are low in these cells, the signal-to-noise ratio improves and the sensitivity of the assay increases. As a negative control, we used pCTM259, which encodes a smCBA-driven CFH gene in the same AAV vector backbone as our plasmids. CFH overexpression did not affect HTRA1 expression (data not shown). Figure 24 shows that all BEST1- and RPE65-driven HTRA1 constructs increased HTRA1 to varying degrees compared to cells transfected with pCTM259.
[0206] We also tested these plasmids in parental RPE1 cells. As shown in Figure 25, HTRA1 mRNA was increased in cells transfected with the BEST1- and RPE65-HTRA1 plasmids compared with the negative control plasmid (pCTM259). The pattern of HTRA1 expression relative to each other is similar in both cell lines.
[0207] Six constructs, including BEST1_723, BEST_699, BEST1_418, BEST1_340, RPE65_316, and RPE65_146, were selected for further testing. A time-course analysis was performed to measure both HTRA1 mRNA and protein levels in cells transfected with our strongest candidate plasmids. Transfection was performed by electroporation using plasmid DNA prepared with an endotoxin-free maxi-prep kit to maximize transfection efficiency while reducing toxicity. Compared with the control plasmid (pCTM259), HTRA1 mRNA levels were strongly increased by several AAV-HTRA1 plasmids driven by the BEST1_723, BEST1_340, and RPE65_146 promoters (Figure 26). For each of these plasmids, mRNA levels peaked at 24 hours and gradually decreased at 48 and 72 hours. With the positive control CMV-driven promoter, HTRA1 levels also peak at 24 hours but decline sharply by the 48 and 72 hour time points.
[0208] We examined the kinetics of HTRA1 protein expression and normalized it to the level of VEGF, which is unaffected by HTRA1 overexpression (comparing the pCTM259 control to each of the other samples, Figure 27B). HTRA1 levels increase over time even in the pCTM259 control sample. However, the relative increase in HTRA1 protein is significantly greater than background in cells treated with AAV-HTRA1 plasmids driven by the BEST1_723, BEST1_340, and RPE65_146 promoters (Figure 27A). After normalization to VEGF, there was a 4- to 6-fold increase in HtrA1 protein expression compared to the control plasmid, which peaked at 24 hours and gradually decreased (Figure 27C).
[0209] Together, these data demonstrate that HTRA1 expression at both the mRNA and protein levels can be upregulated by transient transfection of AAV2-HTRA1 plasmids driven by BEST1- or RPE65-based promoters.
[0210] 14.12 CRISPR-mediated editing This example demonstrates experiments performed to selectively delete a region of DNA on Chr10 encompassing the HTRA1 regulatory region in an allele-specific manner. Specifically, the CRISPR / Cas9 system and a combination of CRISPR guide RNA pairs were used to specifically remove a large section of DNA surrounding the rs10490924 SNP from either the risk or wild-type allele in RPE1 cells.
[0211] Transfection was performed using the IDT Alt-R CRISPR system. The sequences of the individual guide RNAs are listed in Table 13 below. The crRNAs were resuspended in Tris-EDTA solution to a final concentration of 200 μM. Each crRNA was combined with tracrRNA (IDT Catalog No. 1072532) in a 1:1 ratio in nuclease-free duplex buffer (IDT Catalog No. 11-01-03-01) and annealed by heating to 95°C for 2 minutes and gradually cooling. The crRNA:tracrRNA complex was diluted with nuclease-free duplex buffer, and spCas9-3NLS (IDT Catalog No. 1074181) was added to the complex. The sample was incubated at room temperature for 20 minutes to allow RNP formation. During incubation, RPE1 cells were harvested and electroporated in "R" buffer at 5x10 7The cells were resuspended at a concentration of 15 cells / ml. Cells were mixed with 1.8 μM of the 3' and 5' RNP complex and 1.8 μM of carrier ssDNA. For each reaction, the final solution contained 2 μM spCas9-3NLS, 1.8 μM crRNA:tracrRNA, and 1.8 μM carrier ssDNA. The cell-RNP mixture was electroporated using a 10 μl Neon pipette tip at 1300 volts, a pulse width of 20, and two pulses, and transferred to 3 ml of medium in a 6-well plate. After 24 hours, the transfected cells were serially diluted to a concentration of 15 cells / ml. 100 μl (approximately 1.5 cells / well) was plated into triplicate 96-well plates.
[0212] [Table 13]
[0213] Genomic DNA was purified from clonal cultures using the DNeasy Blood & Tissue Kit (QIAGEN, catalog no. 69504). PCR was performed using 200 nM of the T7E1-Reg8-F (5'CTT ACCACCCTCGCTACATC3') and INDEL-DEL-R1 (5'CCAGGGTGGTGTAATCC ATC3') primers in Q5 PCR buffer (NEB, catalog no. B9027) containing 50 ng genomic DNA, 200 μM dNTPs (Thermo Fisher, catalog no. 18427), and Q5 Hot Start High-Fidelity DNA Polymerase (NEB, catalog no. M0493). PCR products were visualized by agarose gel electrophoresis.
[0214] RPE1 cells are triploid for chromosome 10q26, containing two copies of the rs10490924 wild-type allele and a single copy of the risk allele. PCR amplification of this region using untreated RPE1 cells yields two PCR products, corresponding to a 3.5 kb band for the wild-type allele and a 3.2 kb band for the risk allele. Agarose gel electrophoresis shows a 2:1 bias in the density of the wild-type versus mutant allele. When cells are treated with a CRISPR guide pair specific for the wild-type allele, three outcomes are possible: the single wild-type allele can be deleted, as indicated by a 1:1 ratio of 3.5 kb / 3.2 kb bands and a 600-800 bp band generated from the truncated allele where the fragment is removed. If both wild-type alleles are truncated, PCR yields only a 3.2 kb band from the mutant allele and a 600-800 bp band from the truncated wild-type allele. In contrast, cells treated with a CRISPR guide pair specific for the mutant allele should show only a dense 3.5 kb wild-type band and a 600-800 bp band corresponding to the truncated mutant allele.
[0215] We determined that targeting pairs of crRNA guides can effectively remove large sections of the rs10490924 region in an allele-dependent manner (Table 14 and Figure 28). This effect was demonstrated in bulk populations of RPE1 cells transfected with each CRISPR guide pair (data not shown). Based on these results, we isolated and established monoclonal cultures by limiting dilution of the bulk population to accurately assess our ability to delete a 2-kb region. Genomic DNA from the monoclonal cultures was screened by PCR amplification of the rs10490924 region surrounding the cleavage site and analyzed by agarose gel electrophoresis. Figure 28 shows an example in which the A2-WT2 crRNA combination results in deletion of the Chr10 non-risk allele (allele A), while the A2-INDEL1 crRNA combination results in deletion of the Chr10 risk allele (allele B). Other combinations of crRNAs generated the predicted allele-specific deletions (data not shown), demonstrating that it is possible to specifically target the removal of chromosomal regions in an allele-specific manner.
[0216] [Table 14]
[0217] [Table 15]
[0218] 15. References: 1. Cabrera AC, Melo E, Roth D, Topp A, Delobel F, Stucki C, Chen C, Jakob P, Banfai B, Dunkley T, Schilling O, Huber S, Iacone R, Petrone P. (2017) HtrA1 activation is driven by an allosteric mechanism of intermonomer communication. BioRxiv doi:10.1101 / 163717. 2. Chan C, Shen D, Zhou M, Ross R, Ding X, Zhang K, Green R, Tuo J. (2007) Human htra1 in the archived eyes with age-related macular degeneration. Trans Am Ophthalmol Soc. 2007;105: 92-98. 3. Chowers I, Meir T, Lederman M, Goldenberg-Cohen N, Cohen Y, Banin E, Averbukh E, Hemo I, Pollack A, Axer-Siegel R, Weinstein O, Hoh J, Zack DJ, Galbinur T. (2008) Sequence variants in HTRA1 and LOC387715 / ARMS2 and phenotype and response to photodynamic therapy in neovascular age-related macular degeneration in populations from Israel. Mol Vis 14:2263-71. 4. Colijn JM, Buitendijk GHS, Prokofyeva E. et al. (2017) Prevalance of age-related macular degeneration in Europe: The past and the future. Ophthalmology 124:1753-63. 5. Dewan A, Liu M, Hartman S, Zhang SS, Liu DT, Zhao C, Tam PO, Chan WM, Lam DS, Snyder M, Barnstable C, Pang CP, Hoh J. (2006) HTRA1 promoter polymorphism in wet age-related macular degeneration. Science: 314: 989-92. 6. Fisher SA, Abecasis GR, Yashar BM, et. al. (2005) Meta-analysis of genome scans of age-related macular degeneration. Hum Mol Genet 14: 2257-64. 7. Flaxman SR, Bourne RRA, Resnikoff S, et al. (2017) Global causes of blindness and distance vision impairment 1990-2020: a systematic review and meta-analysis. Lancet Glob Health 5(12): e1221-e1234. doi: 10.1016 / S2214-109X(17)30393-5. 8. Fritsche LG, Loenhardt T, Janssen A, Fisher SA, Rivera A, Keilhauer CN, Weber BH. (2008) Age-related macular degeneration is associated with an unstable ARMS2 (LOC387715) mRNA. Nature Genetics 40: 892-6. 9. Fukutake, T. (2011) Cerebral Autosomal Recessive Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CARASIL): From Discovery to Gene Identification. J Stroke Cerebrovasc Dis 20:85-93. 10. 0129. Lonsdale J, Thomas J, Salvatore M et al. (2013) The Genotype-Tissue Expression (GTEx) project. Nat Genet 45: 580-5. 11. The GTEx Consortium (2015) The Genotype-Tissue Expression (GTEx) pilot analysis: Multitissue gene regulation in humans. Science 348, 648-660. 12. Grassman F, Heid IM, Weber BH, International AMD Genomics Consortium. (2017) Recombinant haplotypes narrow the ARMS / HTRA1 association signal for age-related macular degeneration. Genetics 205: 919-924. 13. Hara K, Shiga A, Fukutake T et al. (2009) Association of HTRA1 mutations and familial sschemic cerebral small-vessel disease. N Engl J Med 360: 1729-39. 14. Holz FG, Tadayoni R, Beatty S, Berger A, Cereda MG, Cortez R, Hoyng CB, Hykin P, Staurenghi G, Heldner S, Bogumil T, Heah T, Sivaprasad S. (2015) Multi-country real-life experience of anti-vascular endothelial growth factor therapy for wet age-related macular degeneration. Br J Ophthalmol 99(2):220-6. 15. Jones A, Kumar S, Zhang N, Tong Z, Yang JH, Watt C, Anderson J, Amrita, Fillerup H, McCloskey M, Luo L, Yang Z, Ambati B, Marc R, Oka C, Zhang K, Fu Y. (2011) Increased expression of multifunctional serine protease, HTRA1, in retinal pigment epithelium induces polypoidal choroidal vasculopathy in mice. Proc. Natl. Acad. Sci. U.S.A. Aug. 30; 108(35): 14578-83. 16. Kanda A, Chen W, Othman M, Branham KE, Brooks M, Khanna R, He S, Lyons R, Abecasis GR, Swaroop A. (2007) A variant of mitochondrial protein LOC387715 / ARMS2, not HTRA1, is strongly associated with age-related macular degeneration. PNAS 104:16227-32. 17. Kortvely E, Hauck SM, Duetsch G, Gloeckner CJ, Kremmer E, Alge-Priglinger CS, Deeg CA, Ueffing M. (2010) ARMS2 is a constituent of the extracellular matrix providing a link between familial and sporadic age-related macular degenerations. Invest Ophtalmol Vis Sci 51: 79-88. 18. Lau C and Suh Y. (2017) In vivo genome editing in animals using AAV-CRISPR system: applications to translational research of human disease. (2017) F1 Res. 2017;6: 2153; doi: 10.12688 / f1research.11243.1. 19. Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR, Weirauch MT (2018) Cell 172(4):650-665. 20. Moore DJ and Clover GM. (2001) The effect of age on the macromolecular permeability of human Bruch’s membrane. Invest Ophthalmol Vis Sci 42:2970-5. 21. Peng Y, Shekhar K, Yan W, Herrmann D, Sappington A, Bryman GS, vanZyl T, Do MTH, Regev A and Sanes JR. 2019 Molecular classification and comparative taxonomics of foveal and peripheral cells in primate retina. Cell 176:5:1222-1237. 22. Regillo CD, Busbee BG, Ho AC, Ding B, Haskova Z (2015) Baseline predictors of 12-month treatment response to ranibizumab in patients with wet age-related macular degeneration. Am J Ophthalmol 160(5):1014-23. 23. Rivera A, Fisher SA, Fritsche LG, Keilhauer CN, Lichtner P, Meitinger T, Weber BH. (2005) Hypothetical LOC387715 is a second major susceptibility gene for age-related macular degeneration, contributing independently of complement factor H to disease risk. Hum Mol Genet 14: 3227-36. 24. Vierkotten S, Muether P, Fauser S (2011) Overexpression of HTRA1 Leads to Ultrastructural Changes in the Elastic Layer of Bruch's Membrane via Cleavage of Extracellular Matrix Components. PLoS One. 2011;6(8):e22959. 25. Wang N, Eckert K, Zomorrodi A, Xin P, Pan W, Shearer D, Weisz J, Maranus C, Clawson G, (2012) Plos|One, https: / / doi.org / 10.1371 / journal.pone.0039446. 26. Wang G, Scott WK, Whitehead P, Court BL, Kovach JL, Schwartz SG, Agarwal A, Dubovy S, Haines JL, Pericak-Vance MA. (2012) A novel ARMS2 splice variant is identified in human retina. Exp. Eye Res 94: 187-91. 27. Wong WL, Su X, Li X, Cheung CM, Klein R, Cheng CY, Wong TY (2014) Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-analysis. Lancet Glob Health 2(2):e106-16. doi: 10.1016 / S2214-109X(13)70145-1. 28. Yang Z, Camp NJ, Sun H, Tong Z, Gibbs D, Cameron DJ, Chen H, Zhao Y, Pearson E, Li X, Chien J, Dewan A, Harmon J, Bernstein PS, Shridhar V, Zabriskie NA, Hoh J, Howes K, Zhang K. (2006) A variant of the HTRA1 gene increases susceptibility to age-related macular degeneration. Science 314: 992-3. 29. Zellner A, Scharrer E, Arzberger T et al. (2018) CADASIL brain vessels show a HTRA1 loss-of-function profile. Acta Neuropathol 136: 111-125.
[0219] 16.
[0220] [Table 16]
[0221] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, those skilled in the art will understand that certain changes and modifications may be practiced within the scope of the appended claims.
[0222] The present invention may be embodied in other specific forms without departing from its structure, methods, or other essential characteristics as broadly described herein and claimed below. The described approaches are to be considered in all respects only as illustrative and not restrictive. The scope of the invention is, therefore, indicated by the appended claims rather than the foregoing description. All changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope.
[0223] All publications and patents cited herein are incorporated by reference to the same extent as if each individual publication or patent was specifically and individually indicated to be incorporated by reference as if it were incorporated by reference to disclose and describe the methods and / or materials in connection with which the publication is cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates which may need to be separately confirmed.
Claims
1. A guide RNA (gRNA) comprising a guide sequence of at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 promoter or the HTRA1 2 kb regulatory region.
2. 2. The gRNA of claim 1, wherein the HTRA1 promoter has the sequence set forth in SEQ ID NO: 5, 7, 8 or 13, and the 2 kb regulatory region has the sequence set forth in SEQ ID NO:
14.
3. a) a guide RNA (gRNA) comprising a guide sequence of at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 promoter or the HTRA1 2 kb regulatory region; and b) a fusion protein comprising a CRISPR-associated protein (Cas) domain fused to a transcriptional activator domain; A ribonucleoprotein (RNP) complex comprising: the Cas protein domain lacks nuclease activity; The HTRA1 promoter has the sequence set forth in SEQ ID NO: 5, 7, 8 or 13, and the 2 kb regulatory region has the sequence set forth in SEQ ID NO: 13; Ribonucleoprotein (RNP) complexes.
4. a) a guide RNA (gRNA) comprising a guide sequence of at least 10 consecutive nucleotides corresponding to a target sequence in the HTRA1 2 kb regulatory region; and ii) CRISPR-associated (Cas) proteins; A ribonucleoprotein (RNP) complex comprising: A ribonucleoprotein (RNP) complex having a 2 kb regulatory region having the sequence set forth in SEQ ID NO:
13.
5. 5. The gRNA of claim 1 or the RNP complex of claim 3 or claim 4, wherein the guide sequence comprises at least 15 consecutive nucleotides corresponding to the target sequence.
6. 5. The gRNA of claim 1 or the RNP complex of claim 3 or claim 4, wherein the guide sequence comprises at least 20 consecutive nucleotides corresponding to the target sequence.
7. 5. The gRNA of claim 1 or the RNP complex of claim 3 or claim 4, wherein the guide sequence comprises 15 to 25 consecutive nucleotides corresponding to the target sequence.
8. 5. The gRNA of claim 1 or the RNP complex of claim 3 or claim 4, wherein the target sequence is contiguous with a protospacer adjacent motif (PAM) NGG.
9. The RNP complex of claim 3, wherein the Cas is dCas9 or dCas12a.
10. The RNP complex of claim 4, wherein the Cas is Cas9, Cas12a, or Cas3.
11. 4. The RNP complex of claim 3, wherein the target sequence is in a promoter and the transcriptional activator is selected from VP16, VP64, VP160, MLL, E2A, HSF1, NF-IL6, NFAT1, and NF-kB.
12. 4. The RNP complex of claim 3, wherein the target sequence is within a 2 kb regulatory region and the transcriptional activator is LHX2.
13. 8. The gRNA of claims 1 to 2 or 4 to 7, or the RNP complex of claim 3, wherein the guide sequence comprises any of SEQ ID NOs: 15 to 33, or a subsequence comprising at least 15 consecutive bases of any of SEQ ID NOs: 15 to 33.
14. i) the guide sequence comprises any one of SEQ ID NOs: 36-49; ii) the target sequence comprises a risk allele selected from the risk at any one of rsl0490924, rsl44224550, rs36212731, rs36212732, rs36212733, rs3750848, rs3750847 and rs3750846; iii) the target sequence is adjacent to any one of rs10490924, rs144224550, rs36212731, rs36212732, rs36212733, rs3750848, rs3750847, and rs3750846; A gRNA according to claims 1 to 2 or 4 to 7 or an RNP complex according to claim 4.
15. 15. A polynucleotide encoding a gRNA according to any one of claims 1 to 2, 5 to 8 or 13 to 14, wherein the polynucleotide is DNA.
16. 16. The polynucleotide of claim 15, comprising a promoter operably linked to a sequence encoding a gRNA.
17. A viral vector comprising the polynucleotide of claim 15 or 16.
18. A viral vector comprising a polynucleotide encoding an HTRA1 polypeptide, wherein the polynucleotide comprises a human codon-optimized sequence encoding HTRA1 operably linked to a promoter.
19. 19. The viral vector of claim 17 or claim 18, which is a retrovirus, lentivirus, herpesvirus or adeno-associated virus (AAV).
20. 20. The polynucleotide of claim 16 or the viral vector of claims 18 to 19, wherein the promoter is an RPE-specific promoter.
21. a) a vector comprising a DNA sequence encoding a gRNA according to any one of claims 1, 2, 5 to 8 or 13 to 14, and b) a vector comprising a DNA sequence encoding a fusion protein comprising a Cas protein domain fused to a transcription activator domain, wherein the Cas protein domain lacks nuclease activity; An HTRA1 activation system comprising:
22. The HTRA1 activation system of claim 21 , wherein the vector in (a) and the vector in (b) are different vectors.
23. (a) a vector comprising a nucleic acid encoding a gRNA of any one of claims 1, 2, 5 to 8, or 13 to 14; and (b) a vector comprising a nucleic acid encoding a Cas protein An HTRA1 targeting system comprising:
24. (c) a vector comprising a nucleic acid encoding a template repair sequence, wherein the template repair sequence optionally comprises at least one of SEQ ID NOs: 87-94 or the complement of at least one of SEQ ID NOs: 87-94.
24. The HTRA1 targeting system of claim 23, further comprising:
25. 25. The HTRA1 targeting system of claim 24, wherein (a) and (b) are the same vector, or (a), (b) and (c) are the same vector.
26. The gRNA according to claim 1 or 2, and the RNP complex according to claim 3 or 4.
26. An isolated cell comprising a polynucleotide according to claim 15, 16 or 20, a viral vector according to claims 17 to 19, an activation system according to claims 21 to 22 or a targeting system according to claims 23 to 25.
27. Use of a gRNA described in any one of claims 1 to 2, 4 to 7 or 13 to 14, an isolated polynucleotide described in claim 15, a vector described in claims 17 to 19, an activation system described in claims 21 to 22, a targeting system described in claims 23 to 25 or an isolated cell described in claim 26 for the preparation of a medicament for treating age-related macular degeneration (AMD).
28. A guide RNA according to any one of claims 1 to 2, 4 to 7 or 13 to 14, an isolated polynucleotide according to claim 15, a vector according to claims 17 to 19, an activation system according to claims 21 to 22, a targeting system according to claims 23 to 25 or an isolated cell according to claim 26 for the preparation of a medicament for treating age-related macular degeneration (AMD).
29. The subject to be treated is a) exhibiting the Chr10 AMD clinical phenotype; b) have a chromosome 10 risk allele; c) homozygous for the chromosome 10 risk allele; or d) do not have the chromosome 1 risk allele; The use of claim 27 or the guide RNA of claim 28.
30. A method for increasing HTRA1 expression in a cell, comprising expressing an activation system according to claims 21 to 22 or a targeting system according to claims 23 to 25 in the cell.
31. A method of treating, preventing the onset of, slowing the progression of, reversing, or ameliorating the symptoms and signs of Chr10 AMD in a subject comprising administering an agent(s) that increases HTRA1 expression in RPE cells or horizontal cells of the subject.
32. 32. The method of claim 31, wherein the subject exhibits a Chr10 AMD clinical phenotype.
33. 33. The method of claim 31 or 32, wherein the subject has a chromosome 10 risk allele.
34. 34. The method of claim 33, wherein the subject is homozygous for the chromosome 10 risk allele.
35. 35. The method of claim 33 or 34, wherein the subject does not have the chromosome 1 risk allele.
36. 36. A method according to any one of claims 31 to 35, wherein transcription of the endogenous HTRA1 gene sequence is increased.
37. 37. The method of claim 36, wherein the agent is a ribonucleoprotein complex comprising (a) a fusion protein of an enzymatically inactive Cas protein domain and a transcription activator domain, and (b) a guide RNA.
38. 38. The method of claim 37, wherein the enzymatically inactive Cas protein is dCas9.
39. 38. The method of claim 37, wherein the ribonucleoprotein complex binds to the HTRA1 promoter region.
40. 38. The method of claim 37, wherein the ribonucleoprotein complex binds to the HTRA1 enhancer region.
41. 39. The method of claim 38, wherein the transcriptional activator domain binds to an LHX2 binding motif.
42. 37. The method of claim 36, wherein the agent is a ribonucleic acid complex comprising a guide RNA and a Cas protein.
43. 37. The method of claim 36, wherein the subject carries a risk allele in the HTRA1 gene enhancer, and the agent is a combination agent comprising: (a) a ribonucleic acid complex comprising a guide RNA and a Cas protein, and (ii) a template repair polynucleotide comprising the sequence of a non-risk allele corresponding to the risk allele.