Composition containing bacteria having immunity-activating capability
By controlling heat treatment parameters and DNA amplification in heat-treated bacteria, the immunostimulatory activity is maintained or enhanced, addressing the reduction caused by high-temperature sterilization.
Patent Information
- Application Number
- JP2025153880
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-28
- Filing Date
- 2025-09-17
- Publication Date
- 2025-12-11
AI Technical Summary
Heat treatment at temperatures of 120°C or higher reduces the immunostimulatory activity of bacteria, necessitating a new approach to maintain or enhance this activity in compositions containing bacteria.
A composition comprising heat-treated bacteria with specific parameters, such as DIN (DNA Integrity Number) within 1.0 to 8.5 and Cp value between 15.5 to 24.0, and using specific primer sets for DNA amplification, ensures the immunostimulatory activity is maintained or enhanced.
The described composition and method improve the immunostimulatory activity of bacteria, enabling effective dendritic cell activation and IFN-α production, even after heat treatment.
Smart Images

Figure 2025181859000011 
Figure 2025181859000012 
Figure 2025181859000013
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to compositions comprising bacteria with immunostimulatory capabilities. [Background technology]
[0002] Immunostimulating compositions containing bacteria are known. For example, Patent Document 1 discloses an immunostimulating food composition containing lactic acid bacteria that activates pDCs (plasmacytoid dendritic cells) and induces IFN-α (interferon α) production (Patent Document 1).
[0003] When bacteria are used in compositions, heat treatment may be performed for the purpose of sterilization, etc. The most common sterilization method is high-pressure steam sterilization, which requires heating at 121°C for 15 minutes or more. [Prior art documents] [Patent documents]
[0004] [Patent Document 1] Japanese Patent Application Publication No. 2017-201984 Summary of the Invention [Problem to be solved by the invention]
[0005] The present inventors have discovered a new problem in that when bacteria having immunostimulatory activity are heat-treated at a temperature of 120°C or higher, as is the case with common sterilization methods, the immunostimulatory activity of the bacteria is reduced.
[0006] An object of the present invention is to provide a composition containing bacteria having immunostimulatory activity. Another object of the present invention is to provide a method for producing a composition containing bacteria having immunostimulatory activity and a method for improving the immunostimulatory activity of bacteria. [Means for solving the problem]
[0007] In response to the above-mentioned novel problem, the present inventors have discovered that when a parameter indicating a predetermined characteristic of an immunostimulatory bacterium or bacterial DNA, or the copy number of a bacterial DNA fragment amplified by a predetermined primer set, is within a predetermined range, and / or when an immunostimulatory bacterium is heat-treated at a predetermined temperature lower than 120° C., it is possible to suppress the decrease in immunostimulatory activity observed in bacteria heat-treated at temperatures of 120° C. or higher. Furthermore, in the above cases, it was discovered that not only is the decrease in immunostimulatory activity suppressed, but the immunostimulatory activity of the bacteria is actually improved compared to unsterilized bacteria, and the present disclosure has been completed based on these findings.
[0008] The present disclosure relates, for example, to the following sections: [A1] A composition comprising a heat-treated bacterium having immunopotentiating ability, wherein the DIN (DNA Integrity Number), which indicates the degree of degradation of the genomic DNA of the bacterium, is 1.0 to 8.5. [A2] A composition comprising a heat-treated bacterium having immunopotentiating ability, wherein the Cp value (Crosspoint value) of the bacterium measured under the following conditions is 15.5 to 24.0. <Condition> The DNA solution extracted from the above bacteria is amplified by real-time PCR using the primer set shown below and the program shown below, and the cycle number at which the amplification curve reaches its maximum inflection point is taken as the Cp value based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 50°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second [A3] A composition containing heat-treated bacteria with immunostimulatory activity, wherein the composition contains 2.4 × 10 DNA fragments amplified by the following primer set: 2 A composition containing more than one copy. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [A4] A composition comprising heat-treated bacteria having immunostimulatory activity, wherein a DNA fragment amplified by the following primer set is added to 1.2 × 10 5 A composition containing more than one copy. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [A5] A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the composition contains 1.1 times or more copies of a DNA fragment amplified by the following primer set per 1 mg of the bacteria compared to the number of copies of a DNA fragment amplified by the primer set contained per 1 mg of bacteria of the same strain that has been heat-treated at 120°C for 30 minutes. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [A6] A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include Lactococcus sp., and the composition contains 1.0 × 10 DNA fragments amplified by the following primer set: 5 A composition containing more than one copy. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) [A7] A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include bacteria of the genus Lactococcus, and a DNA fragment amplified by the following primer set is added at 5.1 × 10 per 1 mg of the bacteria of the genus Lactococcus: 7 A composition containing more than one copy. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) [A8] A composition comprising a heat-treated bacterium having immunopotentiating ability, which satisfies at least one selected from the group consisting of the following (1) to (7): (1) The DIN (DNA Integrity Number), which indicates the degree of degradation of the genomic DNA of the bacteria, is 1.0 to 8.5. (2) The Cp value (Crosspoint value) of the above bacteria measured under the following conditions is 15.5 to 24.0. <Condition> The DNA solution extracted from the above bacteria is amplified by real-time PCR using the primer set shown below and the program shown below, and the cycle number at which the amplification curve reaches its maximum inflection point is taken as the Cp value based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 50°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second (3) 2.4 × 10 DNA fragments amplified with the following primer set 2 Contains more than one copy. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) (4) The DNA fragment amplified by the following primer set was diluted to 1.2 × 10 per 1 mg of the above bacteria. 5 Contains more than one copy. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) (5) The number of copies of the DNA fragment amplified by the following primer set per 1 mg of the above bacteria is 1.1 times or more compared to the number of copies of the DNA fragment amplified by the above primer set contained per 1 mg of bacteria of the same strain that have been heat-treated at 120°C for 30 minutes. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) (6) The bacteria include Lactococcus sp., and the DNA fragment amplified by the following primer set is 1.0 × 10 5 Contains more than one copy. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) (7) The bacteria include Lactococcus sp., and the DNA fragment amplified by the following primer set is used at 5.1 × 10 per 1 mg of the Lactococcus sp. 7 Contains more than one copy. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) [A9] The composition according to any one of [A1] to [A8], wherein the immunopotentiating ability includes the ability to activate dendritic cells. [A10] The composition according to [A9], wherein the ability to activate dendritic cells includes the ability to promote IFN-α production. [A11] The composition according to any one of [A1] to [A10], wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria. [A12] The above bacteria are Lactobacillus rhamnosus CRL1505, Gluconacetobacter hansenii GK-1, Lactobacillus acidophilus L-92, Lactobacillus plantarum L-137, Lactobacillus bulgaricus OLL1073R-1, Lactococcus lactis subsp. lactis JCM5805, Weissella paramesenteroides JCM9890, Bifidobacterium animalis subsp. lactis The composition according to any one of [A1] to [A11], wherein the composition is at least one bacterium selected from the group consisting of Lactobacillus gasseri SBT2055 and Lactobacillus japonicus JCM10602. [A13] The composition according to any one of [A1] to [A12], wherein the Cp value of the heat-treated bacteria is 1.10 to 1.50 times the Cp value of the non-heat-treated bacteria. [A14] The composition according to any one of [A1] to [A13], wherein the proportion of the area occupied by DNA of 250 to 60,000 bp in a histogram of the genomic DNA of the bacterium is 65% or more. [A15] The composition according to any one of [A1] to [A14], wherein the heat-treated bacterium has improved immunopotentiating ability compared to the bacterium that has not been heat-treated. [A16] The composition according to any one of [A1] to [A15], which is a food composition, a pharmaceutical composition, or a feed. [A17] The composition according to any one of [A1] to [A16], which is an immunostimulatory composition. [A18] The composition according to any one of [A1] to [A17], wherein the dry weight of the bacteria is 0.0001% by mass or more relative to the total dry weight of the composition. [A19] When the composition is liquid, the number of bacteria in the composition is 1.0 × 10 3 cells / ml~1.0×10 11 The composition according to any one of [A1] to [A17], wherein the concentration is 100 cells / ml. [A20] A method for stimulating the immunity of a subject, comprising having the subject ingest or administering to a subject in need thereof the composition according to any one of [A1] to [A19]. [A21] Use of the composition according to any one of [A1] to [A19] in stimulating the immune system of a subject. [A22] The composition according to any one of [A1] to [A19] for use in stimulating the immunity of a subject. [A23] Use of the bacterium in the production of the composition according to any one of [A1] to [A19]. [B1] A method for producing a composition containing bacteria having immunostimulatory activity, comprising a heating step of heating the bacteria at a temperature of 60°C or higher and 110°C or lower. [B2] The method according to [B1], wherein the immunostimulatory activity includes dendritic cell activation activity. [B3] The method according to [B2], wherein the dendritic cell activation ability includes the ability to promote IFN-α production. [B4] The method according to any one of [B1] to [B3], wherein the bacterium is a lactic acid bacterium and / or an acetic acid bacterium. [B5] The method according to any one of [B1] to [B4], wherein the heating step comprises heating the bacteria at a temperature of 70°C or higher and 90°C or lower. [B6] The method according to any one of [B1] to [B5], wherein the heating time in the heating step is 5 minutes or more and 60 minutes or less. [B7] The method according to any one of [B1] to [B6], further comprising the step of culturing the bacterium in a glucose-containing medium before the heating step. [B8] The method according to [B7], wherein the glucose-containing medium is an MRS medium. [B9] The method according to any one of [B1] to [B8], further comprising a step of drying the heated bacteria after the heating step. [B10] The method according to [B9], wherein the drying treatment is spray drying. [B11] The method according to any one of [B1] to [B10], wherein the bacterium after the heating step has improved immunostimulatory activity compared to the bacterium before the heating step. [B12] The method according to any one of [B1] to [B11], wherein the composition produced is the composition according to any one of [A1] to [A19]. [B13] A composition produced by the method according to any one of [B1] to [B11]. [B14] The composition according to any one of [A1] to [A19], produced by the method according to any one of [B1] to [B11]. [B15] A method for stimulating the immunity of a subject, comprising having the subject ingest or administering the composition according to [B13] or [B14] to a subject in need thereof. [B16] Use of the composition according to [B13] or [B14] in stimulating the immune system of a subject. [B17] The composition according to [B13] or [B14] for use in stimulating the immune system of a subject. [B18] Use of the bacterium in the production of the composition according to [B13] or [B14]. [C1] A method for improving the immunostimulatory activity of a bacterium, comprising a heating step of heating the bacterium at a temperature of 60°C or higher and 110°C or lower. [C2] The method according to [C1], wherein the immunostimulatory activity includes dendritic cell activation activity. [C3] The method according to [C2], wherein the dendritic cell activation ability includes the ability to promote IFN-α production. [C4] The method according to any one of [C1] to [C3], wherein the bacterium is a lactic acid bacterium and / or an acetic acid bacterium. [C5] The method according to any one of [C1] to [C4], wherein the heating step comprises heating the bacteria at a temperature of 70°C or higher and 90°C or lower. [C6] The method according to any one of [C1] to [C5], wherein the heating time in the heating step is 5 minutes or more and 60 minutes or less. [C7] The method according to any one of [C1] to [C6], further comprising the step of culturing the bacterium in a glucose-containing medium before the heating step. [C8] The method according to [C7], wherein the glucose-containing medium is an MRS medium. [C9] The method according to any one of [C1] to [C8], further comprising the step of spray-drying the heated bacteria after the heating step. [C10] The method according to [C9], wherein the drying treatment is spray drying. [C11] The method according to any one of [C1] to [C10], wherein the bacterium after the heating step has improved immunostimulatory activity compared to the bacterium before the heating step. [C12] The composition according to any one of [A1] to [A19], wherein the bacterium has an improved immunostimulatory activity by a method according to any one of [C1] to [C11]. [Effects of the Invention]
[0009] According to the present disclosure, a composition containing bacteria having immunostimulatory activity can be provided. In particular, according to the present disclosure, a composition containing bacteria having high immunostimulatory activity can be provided. According to the present disclosure, a method for producing a composition containing bacteria having immunostimulatory activity or a method for improving the immunostimulatory activity of bacteria can also be provided. Furthermore, according to the present disclosure, a sterilization method or a heating method for maintaining or improving the immunostimulatory activity of bacteria having immunostimulatory activity can be provided. [Brief explanation of the drawings]
[0010] [Figure 1] FIG. 1 shows the results of measuring the amount of IFN-α in Example 1. [Figure 2] FIG. 1 shows the results of measuring the amount of IFN-α in Example 2. [Figure 3] FIG. 1 shows the results of electrophoresis and DIN in the Genomic DNA ScreenTape assay of heat-treated bacteria in Example 3. [Figure 4] FIG. 10 shows the copy number of DNA amplified with A9 primers when LC-Plasma was evaluated in Example 6. [Figure 5] FIG. 10 is a diagram showing the copy number of DNA amplified with V3 primer when LC-Plasma was evaluated in Example 6. [Figure 6] FIG. 10 shows the copy number of DNA amplified with the V3 primer when JCM9890 was evaluated in Example 6. [Figure 7] FIG. 10 shows the copy number of DNA amplified with the V3 primer when JCM10602 was evaluated in Example 6. [Figure 8] FIG. 10 shows the copy number of DNA amplified with V3 primers when SBT2055 was evaluated in Example 6. DETAILED DESCRIPTION OF THE INVENTION
[0011] Hereinafter, an embodiment for carrying out the present invention will be described, but the present invention is not limited to the following embodiment.
[0012] A first embodiment of the present invention is a composition containing a bacterium having immunostimulatory activity. Hereinafter, the bacterium having immunostimulatory activity contained in the composition of this embodiment may be referred to as "the bacterium according to this embodiment." In one aspect, the bacterium according to this embodiment has a DIN (DNA Integrity Number), which indicates the degree of degradation of genomic DNA, that falls within a predetermined range. In another aspect, the bacterium according to this embodiment has a Cp value measured under predetermined conditions that falls within a predetermined range.
[0013] Immunostimulatory ability (immunostimulatory ability) refers to the ability to stimulate (activate) the innate immune system in cells or living organisms. The immunostimulatory ability according to one embodiment may include or be dendritic cell activation ability, in which case the bacteria possess the dendritic cell activation ability. The dendritic cell activation ability may be an increase in the amount of cytokine expression by dendritic cells compared to when the bacteria are not administered, etc. The immunostimulatory ability according to one embodiment may include or be pDC activation ability, in which case the bacteria possess pDC activation ability. The pDC activation ability may be an increase in the amount of cytokine expression by pDC compared to when the bacteria are not administered, etc. Plasmacytoid dendritic cells (pDCs), also known as plasmacytoid dendritic cells, are a type of dendritic cell that constitutes the innate immune system. pDCs are the main type I interferon-producing cells in the body. Type I interferon exhibits growth inhibitory activity against viruses and the like. Representative type I interferons are known to be interferon α (IFN-α) and interferon β (IFN-β), which are thought to have immunostimulatory activity. The immunostimulatory activity, dendritic cell activation activity, or pDC activation activity according to one embodiment may include the ability to promote interferon α (IFN-α) production, or may be the ability to promote IFN-α production. Furthermore, the composition of the present embodiment may be an immunostimulatory composition.
[0014] Whether the bacteria of this embodiment have immunostimulatory activity can be confirmed, for example, by culturing the bacteria in the presence of pDCs induced from bone marrow cells of a mammal such as a mouse, and measuring the amount or concentration of IFNs such as IFN-α or IFN-β produced in the culture system upon activation of pDCs.
[0015] As a more detailed example, whether the bacterium according to this embodiment has immunostimulatory activity can be confirmed by measuring the IFN-α concentration according to the following procedures (i) to (iv): As a further detailed example, whether the bacterium according to this embodiment has immunostimulatory activity can be confirmed by measuring the IFN-α concentration according to the procedures shown in the Examples. (i) Mouse-derived bone marrow cells were depleted of red blood cells and diluted to 1 × 10 in RPMI medium prepared according to the following composition: 6 The cells are suspended at a concentration of 1000 cells / mL to prepare a cell suspension. <Culture composition> 10% by volume FBS 100U / mL penicillin / streptomycin 1mM sodium pyruvate 2.5mM HEPES 1% by weight MEM non-essential amino acid solution (x100) 50 μM β-mercaptoethanol 100ng / mL Flt-3L (ii) 1 mL of the prepared cell suspension is seeded into each well and cultured in a CO2 incubator at 37°C and 5% CO2 by volume for 1 week to induce pDCs. (iii) 2 × 10 bone marrow cells containing induced pDCs 5 The bacteria are suspended at a concentration of bacteria / mL, and 200 μL of each is seeded onto a 96-well plate, to which 2 μL of a lactic acid bacteria suspension adjusted to a concentration of 1 mg / mL with PBS is added. (iv) After 24 hours, the culture supernatant is collected and the IFN-α concentration is measured by ELISA using a commercially available IFN-α measurement kit.
[0016] Whether the bacteria according to this embodiment have immunostimulatory activity or not was determined by combining the bacteria at a final concentration of 10 μg / mL with pDCs collected from mouse bone marrow and cultured for 7 days in a cell culture medium containing 100 ng / mL Flt3-L at a final concentration of 2 × 10 5 By co-culturing with bone marrow cells at 1000 cells / mL for 24 hours, the IFN-α produced can be expressed as an index of IFN-α production of 30 pg / mL or more, preferably 50 pg / mL or more, more preferably 60 pg / mL or more, more preferably 70 pg / mL or more, more preferably 80 pg / mL or more, more preferably 90 pg / mL or more, more preferably 100 pg / mL or more, more preferably 150 pg / mL or more, more preferably 200 pg / mL or more, more preferably 250 pg / mL or more, more preferably 300 pg / mL or more, more preferably 400 pg / mL or more, more preferably 500 pg / mL or more, more preferably 600 pg / mL or more, more preferably 700 pg / mL or more, and particularly preferably 800 pg / mL or more.
[0017] The bacteria according to this embodiment are not particularly limited, and may be bacteria that are harmless to the human body. In one embodiment, the bacteria may be gram-positive or gram-negative bacteria. The bacteria according to this embodiment may be lactic acid bacteria and / or acetic acid bacteria, and particularly lactic acid bacteria. The bacteria having immunostimulatory ability according to this embodiment may be one type of bacteria or a mixture of two or more types of bacteria, such as one or more types of lactic acid bacteria, one or more types of acetic acid bacteria, or a mixture of one or more types of lactic acid bacteria and one or more types of acetic acid bacteria.
[0018] Lactic acid bacteria are bacteria that produce lactic acid as a metabolite. Examples of lactic acid bacteria include bacteria of the genus Oenococcus, Bifidobacterium, Weissella, Tetragenococcus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Enterococcus, Lactobacillus, and Bacillus.
[0019] The Lactobacillus bacteria of the present invention include bacteria that were classified into the genus Lactobacillus before the reclassification of the genus Lactobacillus. For example, with the reclassification of the Lactobacillus genus, the following new species have been added: Acetilactobacillus, Agrilactobacillus, Amylolactobacillus, Apilactobacillus, Bombilactobacillus, Companilactobacillus, Dellaglioa, Fructilactobacillus, Furfurilactobacillus, Holzapfelia, Lacticaseibacillus, Lactiplantibacillus, and Lapidilactobacillus. This includes bacteria classified into the genera Lapidilactobacillus, Latilactobacillus, Lentilactobacillus, Levilactobacillus, Ligilactobacillus, Limosilactobacillus, Liquorilactobacillus, Loigolactobacillus, Paralactobacillus, Paucilactobacillus, Schleiferilactobacillus, and Secundilactobacillus.
[0020] Among the above, bacteria of the genus Oenococcus, Bifidobacterium, Lentilactobacillus, Weissella, Tetragenococcus, Lactococcus, Leuconostoc, Pediococcus, Enterococcus, Lactobacillus, and Lactiplantibacillus are preferred.
[0021] Examples of the Oenococcus bacteria include Oenococcus oeni, etc. Specific examples of the Oenococcus bacteria include Oenococcus oeni JCM 6125, etc.
[0022] Examples of the Bifidobacterium bacteria include Bifidobacterium animalis subsp. lactis and Bifidobacterium longum subsp. infantis. Specific examples of Bifidobacterium include Bifidobacterium animalis subsp. lactis JCM 10602, Bifidobacterium longum subsp. infantis JCM 1222, Bifidobacterium longum subsp. longum BB536, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantis M-63, Bifidobacterium longum subsp. longum N61, Bifidobacterium bifidum OLB6378, Bifidobacterium breve M-16V, Bifidobacterium breve MCC1274, and Bifidobacterium pseudolongum JCM 1205.
[0023] Examples of the Weissella genus include Weissella paramesenteroides and Weissella viridescens. Specific examples of the Weissella genus include Weissella paramesenteroides JCM 9890 and Weissella viridescens JCM 1174.
[0024] Examples of the Tetragenococcus bacteria include Tetragenococcus halophilus, etc. Specific examples of the Tetragenococcus bacteria include Tetragenococcus halophilus NRIC 0098 and Tetragenococcus halophilus No. 1.
[0025] Examples of the Lactococcus bacteria include Lactococcus lactis, Lactococcus lactis subsp. lactis, Lactococcus garvieae, Lactococcus lactis subsp. cremoris, Lactococcus lactis subsp. hordniae, and Lactococcus plantarum.
[0026] Specific examples of the Lactococcus genus include Lactococcus lactis subsp. lactis JCM 5805, Lactococcus lactis subsp. lactis NBRC 12007, Lactococcus lactis subsp. lactis NRIC 1150, Lactococcus lactis subsp. lactis JCM 20101, Lactococcus lactis subsp. lactis JCM7638, Lactococcus lactis subsp. lactis ATCC 7963, Lactococcus lactis subsp. lactis ATCC 7962, Lactococcus lactis subsp. lactis ATCC 29146, and Lactococcus lactis subsp. lactis ATCC 27861, Lactococcus lactis subsp. lactis ATCC 19435, Lactococcus lactis subsp. lactis ATCC 15577, Lactococcus lactis subsp. lactis ATCC 15346, Lactococcus lactis subsp. lactis ATCC 13675, Lactococcus lactis subsp. lactis ATCC 12929, Lactococcus lactis subsp. lactis ATCC 11955, Lactococcus lactis subsp. lactis ATCC 11454, Lactococcus lactis subsp. lactis ATCC 11007, Lactococcus garvieae NBRC 100934, Lactococcus lactis subsp. cremoris JCM 16167, Lactococcus lactis subsp. cremoris NBRC 100676, Lactococcus lactis subsp. holdoniae JCM 1180, Lactococcus lactis subsp. holdoniae JCM 11040, and Lactococcus plantarum JCM 11056.
[0027] Examples of the Leuconostoc genus include Leuconostoc carnosum and Leuconostoc lactis. Specific examples of the Leuconostoc genus include Leuconostoc carnosum JCM 9695 and Leuconostoc lactis NBRC 12455.
[0028] Examples of the Pediococcus bacteria include Pediococcus acidilactici, Pediococcus pentosaceus, Pediococcus cellicola, Pediococcus claussenii, Pediococcus damnosus, Pediococcus ethanolidurans, Pediococcus inopinatus, Pediococcus parvulus, and Pediococcus stilesii. Specific examples of bacteria of the genus Pediococcus include Pediococcus acidilactici JCM 8797, Pediococcus acidilactici K15, and Pediococcus damnosus JCM 5886.
[0029] Examples of the genus Streptococcus include Streptococcus thermophilus, etc. Specific examples of the genus Pediococcus include Streptococcus thermophilus SBC 8781, etc.
[0030] Examples of the Enterococcus bacteria include Enterococcus alcedinis and Enterococcus faecalis. Specific examples of Enterococcus bacteria include Enterococcus faecalis EC-12.
[0031] Examples of the Lactobacillus bacteria include Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus fructivorans, Lactobacillus hilgardii, Lactobacillus rhamnosus, Lactobacillus gasseri, Lactobacillus acidophilus, and Lactobacillus bulgaricus. Lactobacillus bulgaricus, Lactobacillus parakefiri, Lactobacillus plantarum, and Lactobacillus pentosus.
[0032] Specific examples of Lactobacillus species include Lactobacillus paracasei KW3110, Lactobacillus paracasei MCC 1849, Lactobacillus paracasei K71, Lactobacillus paracasei K-2, Lactobacillus rhamnosus GG, Lactobacillus rhamnosus CRL1505, Lactobacillus gasseri SBT 2055, Lactobacillus gasseri OLL2716, Lactobacillus gasseri PA-3, Lactobacillus acidophilus L-92, Lactobacillus casei subsp. casei 327, Lactobacillus (newly classified as Lacticaseibacillus) casei Shirota, Lactobacillus bulgaricus OLL 1073R-1, and Lactobacillus parakeefili (newly classified as Lentilactobacillus parakeefili). JCM 8573, Lactobacillus plantarum (newly classified as Lactiplantibacillus plantarum) L-137, Lactobacillus pentosus (newly classified as Lactiplantibacillus pentosus) ONRICb0240, and Lactobacillus helveticus GCL1815.
[0033] The Bacillus bacteria are not particularly limited, but include, for example, Bacillus coagulans, etc. Specific examples of Bacillus bacteria include, for example, Bacillus coagulans SANK70258 strain, etc.
[0034] Acetic acid bacteria are bacteria that produce acetic acid as a metabolite. Examples of acetic acid bacteria include, but are not limited to, bacteria of the genus Gluconacetobacter, Acetobacter, and Gluconobacter. Gluconacetobacter is preferred, Gluconacetobacter hansenii is more preferred, and Gluconacetobacter hansenii GK-1 is even more preferred.
[0035] In a preferred embodiment, the bacterium may be at least one bacterium selected from the group consisting of Lactobacillus rhamnosus CRL1505, Gluconacetobacter hansenii, Lactobacillus acidophilus (GK-1, Lactobacillus acidophilus) L-92, Lactobacillus plantarum L-137, Lactobacillus bulgaricus OLL1073R-1, and Lactococcus lactis subsp. lactis JCM5805.
[0036] Of the above lactic acid bacteria and acetic acid bacteria, JCM strains can be obtained from the Microbial Materials Development Laboratory, RIKEN BioResource Center (3-1-1 Takanodai, Tsukuba, Ibaraki Prefecture), NBRC strains from the Biological Genetic Resources Division, National Institute of Technology and Evaluation (2-5-8 Kazusa Kamatari, Kisarazu, Chiba Prefecture), NRIC strains from the Tokyo University of Agriculture and Technology Culture Collection (1-1-1 Sakuragaoka, Setagaya-ku, Tokyo), and ATCC strains from the American Type Culture Collection (USA). In addition to being available from public institutions, the above lactic acid bacteria and acetic acid bacteria can also be obtained by isolation or purification using known methods from commercially available products containing lactic acid bacteria or acetic acid bacteria.
[0037] Lactobacillus paracasei KW3110 has been deposited with the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary (Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki, Japan), an international depositary authority under the Budapest Treaty for the Deposit of Patent Microorganisms (currently the National Institute of Technology and Evaluation (NITE) Biotechnology Center Patent Organism Depositary (NITE-IPOD) (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu, Chiba, Japan), under the accession number FERM BP-08634 (deposit date: February 20, 2004). A derivative of Lactobacillus paracasei KW3110 has been deposited with the same Patent Organism Depositary under the accession number FERM BP-08635 (deposit date: February 20, 2004).
[0038] Lactococcus lactis subsp. lactis JCM 5805 can be obtained from the Microbial Engineering Division of the RIKEN BioResource Center, as described above, but the present invention can also use the same strain of Lactococcus lactis subsp. lactis JCM 5805 stored in a collection institution other than the Microbial Engineering Division of the RIKEN BioResource Center. Specifically, the same strain of Lactococcus lactis subsp. lactis JCM 5805 can be obtained from the Biological Genetic Resources Division of the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamatari, Kisarazu, Chiba, Japan), the Strain Collection of Tokyo University of Agriculture (1-1-1 Sakuragaoka, Setagaya-ku, Tokyo, Japan), the American Type Culture Collection (USA), and other sources. Lactococcus lactis subsp. lactis JCM 5805 has been deposited with the American Type Culture Collection as Lactococcus lactis subsp. lactis ATCC 9936 and Lactococcus lactis subsp. lactis ATCC 19435.
[0039] The bacterium according to this embodiment may be a mutant strain of a bacterial strain included in the above list. The bacterial mutant strain may have properties that can achieve the objective of the present technology (e.g., immunostimulatory activity when the composition is an immunostimulatory composition). Such a mutant strain may be constructed by non-artificially introducing a mutation into a bacterial strain included in the above list. Furthermore, such a mutant strain may be constructed by artificially introducing a mutation into a bacterial strain included in the above list, for example, by introducing a mutation into the bacterium by treatment with a mutagen such as ultraviolet (UV) or a DNA alkylating agent, or by introducing a mutation into the strain using a genetic engineering method such as gene editing, typified by CRISPR-Cas9.
[0040] The bacteria according to this embodiment can be cultured by a conventional method depending on the bacterial species. For example, when the bacteria are lactic acid bacteria or acetic acid bacteria, they can be cultured by a known method using a known medium. The medium is not particularly limited as long as it is a medium that can grow the bacteria, and for example, a glucose-containing medium can be used. The glucose-containing medium is a medium containing glucose, and the glucose is, for example, D-glucose. As the glucose-containing medium, for example, a medium obtained by appropriately adding glucose to MRS medium, GAM medium, or M17 medium can be used, and inorganic salts, vitamins, and / or amino acids, etc. may be added as appropriate. Culturing can be carried out at 25 to 40°C for several hours to several days.
[0041] The bacterium according to this embodiment may have a DNA Integrity Number (DIN), a parameter indicating the degree of degradation of genomic DNA relative to intact genomic DNA contained within the bacterium, within a predetermined range. That is, DNA extracted from one embodiment of the bacterium, for example, by phenol-chloroform extraction, may have a DIN within a predetermined range. The DIN is a value output by the 4200 TapeStation Software Controller Version A.02.01 SR1 in a Genomic DNA ScreenTape assay using an Agilent 4200 TapeStation system. The DIN is a score of 1 to 10 for DNA depending on the degree of degradation of genomic DNA. A higher DIN value indicates a longer base length and closer to intact genomic DNA. The DIN of the bacteria according to this embodiment may be 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.8 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or may be 8.5 or less, 8.0 or less, 7.7 or less, 7.5 or less, 7.3 or less, 6.5 or less, 5.5 or less, 5.0 or less, 4.5 or less, 4.0 or less, 3.5 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be combined arbitrarily, and the DIN of the bacteria according to this embodiment can be, for example, 1.0 to 8.5, 1.0 to 8.0, 1.0 to 7.7, 1.0 to 7.5, 1.0 to 7.3, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 5.0, 1.0 to 4.5, 1.0 to 4.0, 1.0 to 3.5, 1.0 to 3.0, 1.0 to 2.5, 1.0 to 2.1, 1.2 to 8.5, 1.2 to 8.0, 1.2 to 7.7, 1.2 to 7.5, 1.2 to 7.3, 1.2 to 6.5, 1.2 to 5.5 , 1.2~5.0, 1.2~4.5, 1.2~4.0, 1.2~3.5, 1.2~3.0, 1.2~2.5, 1.2~2.1, 1.4~8.5, 1.4~8.0, 1.4~7.7, 1.4~7.5, 1.4~7.3, 1.4~6.5, 1.4~5.5, 1.4~5.0, 1.4~4.5, 1.4~4.0, 1.4~3.5, 1.4~3.0, 1.4~2.5, 1.4~2.1, 1.6~8.5, 1.6~8.0, 1.6~7.7, 1.6~7.5, 1.6~7.3, 1.6~6.5, 1.6~5.5, 1.6~5.0, 1.6~4.5, 1.6~4.0, 1.6~3.5, 1.6~3.0, 1.6~2.5, 1.6~2.1, 1.8~8.5, 1.8~8.0, 1.8~7.7, 1.8~7.5, 1.8~7.3, 1.8~6.5, 1.8~5.5, 1.8~5.0, 1.8~4.5, 1.8~4.0, 1.8~3 .5, 1.8~3.0, 1.8~2.5, 1.8~2.1, 1.9~8.5, 1.9~8.0, 1.9~7.7, 1.9~7.5, 1.9~7.3, 1.9~6.5, 1.9~5.5, 1.9~5.0, 1.9~4.5, 1.9~4.0, 1.9~3.5, 1.9~3.0, 1.9~2.5, 1.9~2.1, 2.1~8.5, 2 .1~8.0, 2.1~7.7, 2.1~7.5, 2.1~7.3, 2.1~6.5, 2.1~5.5, 2.1~5.0, 2.1~4.5, 2.1~4.0, 2.1~3.5, 2.1~3.0, 3.0~8.5, 3.0~8.0, 3.0~7.7, 3.0~7.5, 3.0~7.3, 3.0~6.5, 3.0~5.5, 3.0~ The DIN of the bacterium according to the present embodiment may be 5.0, 3.0 to 4.5, 3.0 to 4.0, 4.0 to 8.5, 4.0 to 8.0, 4.0 to 7.7, 4.0 to 7.5, 4.0 to 7.3, 4.0 to 6.5, 4.0 to 5.5, 4.0 to 5.0, 5.0 to 8.5, 5.0 to 8.0, 5.0 to 7.7, 5.0 to 7.5, 5.0 to 7.3, 5.0 to 6.5, or 5.0 to 5.5. When the DIN of the bacterium according to the present embodiment is within the above range, the bacterium has a higher immunostimulatory activity (e.g., dendritic cell activation ability, IFN-α production promotion ability, etc.) than bacteria having a DIN outside the above range. The method for extracting the genome from the bacterium (e.g., phenol-chloroform method) and the method for measuring the DIN may be the same as those described in the Examples. For example, DIN can be measured using Genomic DNA ScreenTape and Genomic DNA Reagent Kit (both manufactured by Agilent Technologies) on a TapeStation (Agilent Technologies) according to the instrument specifications.
[0042] More specifically, when the bacterium is a heat-treated bacterium belonging to the genus Lactococcus or Lactococcus lactis (e.g., heat-treated Lactococcus lactis subsp. lactis JCM5805), the DIN of the bacterium according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or 8.5 or less, 8.0 or less, 7.3 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These upper and lower limits can be arbitrarily combined, and the DIN of the bacterium according to this embodiment may be, for example, 1.0 to 8.5, 1.2 to 8.0, 1.4 to 7.3, 1.8 to 5.0, or 1.9 to 2.5.
[0043] Furthermore, for example, when the bacterium includes or is a heat-treated bacterium belonging to the genus Weissella or Weissella paramesenteroides (e.g., heat-treated Weissella paramesenteroides JCM9890), the DIN of the bacterium according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or 8.5 or less, 8.0 or less, 6.5 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be arbitrarily combined, and in this case, the DIN of the bacterium according to this embodiment may be, for example, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 4.5, or 1.0 to 3.5.
[0044] Furthermore, for example, when the bacteria include or are heat-treated bacteria belonging to the genus Bifidobacterium or Bifidobacterium animalis (e.g., heat-treated Bifidobacterium animalis subsp. lactis JCM 10602), the DIN of the bacteria according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or may be 8.5 or less, 8.0 or less, 7.7 or less, 7.5 or less, 6.5 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be combined arbitrarily, and in this case, the DIN of the bacterium according to this embodiment may be, for example, 1.0 to 7.7, 1.0 to 7.5, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 4.5, or 1.0 to 3.5.
[0045] Furthermore, for example, when the bacteria include or are heat-treated bacteria belonging to the genus Lactobacillus or Lactobacillus gasseri (e.g., heat-treated Lactobacillus gasseri SBT2055), the DIN of the bacteria according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or 8.5 or less, 8.0 or less, 7.7 or less, 7.5 or less, 6.5 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be arbitrarily combined, and in this case, the DIN of the bacteria according to this embodiment may be, for example, 1.0 to 8.0, 1.0 to 7.7, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 4.5, or 1.0 to 3.5.
[0046] The bacteria according to this embodiment may have a DIN within a predetermined range relative to the DIN of live bacteria. Here, live bacteria refer to bacteria that belong to the same species as the immunostimulatory bacteria and are alive; they do not necessarily have to be the same strain. Live bacteria may unintentionally contain a small amount of dead bacteria as contamination. When the immunostimulatory bacteria is a mixture of two or more species, the live bacteria is a live population in which live bacteria of each bacterial species constituting the immunostimulatory bacteria are present in the same proportion as in the immunostimulatory bacteria. Live bacteria according to this embodiment may be unsterilized bacteria that have not been sterilized or unheated bacteria that have not been heat-treated. The DIN of the bacteria according to this embodiment may be 0.10 or more, 0.15 or more, 0.20 or more, 0.50 or more, or 0.70 or more times the DIN of live bacteria, or may be 1.00 or less, 0.99 or less, 0.95 or less, or 0.90 or less. These lower and upper limits can be combined arbitrarily, and the DIN of bacteria in one embodiment is, for example, 0.10 to 1.00 times, 0.10 to 0.99 times, 0.10 to 0.95 times, 0.10 to 0.90 times, 0.15 to 1.00 times, 0.15 to 0.99 times, 0.15 to 0.95 times, 0.15 to 0.90 times, or 0.20 times or more of the DIN of live bacteria. The DIN of the bacterium may be 1.00 or less, 0.20 to 0.99, 0.20 to 0.95, 0.20 to 0.90, 0.50 to 1.00, 0.50 to 0.99, 0.50 to 0.95, 0.50 to 0.90, 0.70 to 1.00, 0.70 to 0.99, 0.70 to 0.95, or 0.70 to 0.90. When the bacterium has a DIN within the above range, the bacterium has a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than bacteria having a DIN outside the above range.
[0047] The bacterium of this embodiment may have a DNA histogram in which the proportion of the area occupied by DNA of 250 to 60,000 bp falls within a predetermined range. The DNA histogram of the present invention is obtained by electrophoretically separating DNA extracted from the bacterium of this embodiment by phenol-chloroform extraction according to base length, followed by fluorescent labeling and fluorescence measurement. The horizontal axis represents DNA base length and the vertical axis represents fluorescence intensity. The electrophoresis conditions and the dye used for fluorescent labeling are not limited as long as they are capable of separating and labeling DNA extracted from the bacterium of this embodiment, and any dye commonly used by those skilled in the art can be used. For example, the DNA histogram may be a histogram obtained by using Agilent's Genomic DNA ScreenTape assay on DNA extracted from the bacterium of this embodiment by phenol-chloroform extraction. The percentage of the area occupied by DNA of 250 to 60,000 bp in the histogram of bacterial DNA according to this embodiment may be 65% or more, 70% or more, 75% or more, 80% or more, or 85% or more, or may be 100% or less, 99% or less, 97% or less, 95% or less, or 90% or less. These lower and upper limits can be arbitrarily combined, and the percentage of the area occupied by DNA of 250 to 60,000 bp in the histogram of bacterial DNA according to this embodiment may be, for example, 65% to 100%, 65% to 99%, 65% to 97%, 65% to 95%, 65% to 90%, 70% to 100%, 70% to 9 ... The percentage of the area occupied by DNA of 250 to 60,000 bp in the bacterium according to this embodiment may be 7%, 70% to 95%, 70% to 90%, 75% to 100%, 75% to 99%, 75% to 97%, 75% to 95%, 75% to 90%, 80% to 100%, 80% to 99%, 80% to 97%, 80% to 95%, 80% to 90%, 85% to 100%, 85% to 99%, 85% to 97%, 85% to 95%, or 85% to 90%. When the percentage of the area occupied by DNA of 250 to 60,000 bp in the bacterium according to this embodiment is within the above range, the bacterium has higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than bacteria having a percentage of the area occupied by DNA of 250 to 60,000 bp outside the above range.
[0048] The bacteria according to this embodiment may have a Cp value (crosspoint value) that is a multiplier within a predetermined range relative to the Cp value of live bacteria of the bacteria. Here, live bacteria refer to bacteria that belong to the same species as the bacteria having immunostimulatory ability and that are alive; they do not necessarily have to be the same strain as the bacteria having immunostimulatory ability; in one aspect, they may be the same strain as the bacteria having immunostimulatory ability. Live bacteria may unintentionally contain a small amount of dead bacteria as contamination. When the bacteria having immunostimulatory ability is a mixture of two or more species of bacteria, the live bacteria are a live bacterial population in which live bacteria of each bacterial species constituting the bacteria having immunostimulatory ability are present in the same proportion as the proportion in the bacteria having immunostimulatory ability. The live bacteria according to this aspect may be unsterilized bacteria that have not been sterilized or unheated bacteria that have not been heat-treated. In the present invention, the Cp value is one of the parameters obtained by analyzing the results of real-time PCR amplification of target sequences in DNA extracted from bacteria by phenol-chloroform extraction. Specifically, it is the cycle number at which the maximum inflection point of the amplification curve is reached, calculated from the second derivative using the second derivative maximum method (SDM) based on the measurement results of the DNA amplification curve in real-time PCR. A smaller Cp value indicates a larger amount of target DNA. For example, in a sample exposed to conditions that may cause DNA cleavage, a smaller Cp value indicates less degradation of the target DNA. The Cp value of the bacterium according to this embodiment may be 1.01 times or more, 1.05 times or more, 1.10 times or more, 1.13 times or more, 1.17 times or more, 1.20 times or more, 1.24 times or more, 1.27 times or more, or 1.30 times or more of the Cp value of live cells of the bacterium, or may be 1.80 times or less, 1.50 times or less, 1.46 times or less, 1.43 times or less, 1.40 times or less, 1.35 times or less, 1.30 times or less, or 1.25 times or less.These lower and upper limits can be combined arbitrarily, and the Cp value of the bacterium according to this embodiment is, for example, 1.01 to 1.80 times, 1.01 to 1.50 times, 1.01 to 1.46 times, 1.01 to 1.43 times, 1.01 to 1.40 times, 1.01 to 1.35 times, 1.01 to 1.30 times, 1.05 to 1.80 times, 1.05 to 1.50 times, 1.05 to 1.46 times, 1.05 to 1.43 times, or 1.05 to 1.40 times the Cp value of live bacteria of the above bacteria. Less than or equal to 1.05 times and less than 1.35 times, more than 1.05 times and less than 1.30 times, more than 1.10 times and less than 1.80 times, more than 1.10 times and less than 1.50 times, more than 1.10 times and less than 1.46 times, more than 1.10 times and less than 1.43 times, more than 1.10 times and less than 1.40 times, more than 1.10 times and less than 1.35 times , 1.10 times to 1.30 times, 1.13 times to 1.80 times, 1.13 times to 1.50 times, 1.13 times to 1.46 times, 1.13 times to 1.43 times, 1.13 times to 1.40 times, 1.13 times to 1.35 times, 1.13 times to 1.30 times, 1 .17 times to 1.80 times, 1.17 times to 1.50 times, 1.17 times to 1.46 times, 1.17 times to 1.43 times, 1.17 times to 1.40 times, 1.17 times to 1.35 times, 1.17 times to 1.30 times, 1.20 times to 1.80 times, 1. 20 times to 1.50 times, 1.20 times to 1.46 times, 1.20 times to 1.43 times, 1.20 times to 1.40 times, 1.20 times to 1.35 times, 1.20 times to 1.30 times, 1.24 times to 1.80 times, 1.24 times to 1.50 times, 1.24 1.46 times or more and 1.43 times or less, 1.24 times or more and 1.40 times or less, 1.24 times or more and 1.35 times or less, 1.27 times or more and 1.80 times or less, 1.27 times or more and 1.50 times or less, 1.27 times or more and 1.46 times or less, 1.27 times or more and 1.43 times or less, 1.27 times or more and 1.40 times or less, 1.27 times or more and 1.35 times or less, 1.30 times or more and 1.80 times or less, 1.30 times or more and 1.50 times or less, 1.30 times or more and 1.46 times or less, 1.30 times or more and 1.43 times or less, 1.30 times or more and 1.40 times or less, or 1.30 times or more and 1.35 times or less.When the Cp value of the bacterium according to this embodiment is within the above range, the bacterium has a higher immunostimulatory ability (for example, the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than when the Cp value of the bacterium is outside the above range.
[0049] The Cp value in the present disclosure may be measured by a conventional method. The Cp value in the present disclosure may be measured by amplifying and labeling DNA using commercially available real-time PCR reagents such as TB Green® Premix Ex Taq® II according to the specifications, or may be a Cp value obtained by amplifying, labeling, and measuring DNA in a manner similar to that described in the Examples. Primers used in real-time PCR for measuring Cp values may be primers that amplify part or the entire 16S rRNA conserved region of prokaryotes. The length of the sequence to be amplified may be 50 to 500 bp, preferably 100 to 400 bp, and more preferably 200 to 300 bp. For example, primers that amplify part or the entire 16S rRNA conserved region of prokaryotes may be primers that amplify the V5 16S rRNA conserved region of prokaryotes. For example, primers used in real-time PCR may be a primer set consisting of the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2. The bacterium according to this embodiment has a predetermined Cp value range. For example, when measured by real-time PCR using a primer set consisting of the base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 below, the Cp value may be, for example, 15.0 or more, 15.5 or more, 16.0 or more, 16.5 or more, 17.0 or more, 17.5 or more, 18.0 or more, 18.5 or more, 19.0 or more, 19.5 or more, 20.0 or more, 20.5 or more, 21.0 or more, 21.5 or more, 22.0 or more, 22.5 or more, or 23.0 or more, or 31.0 or less, 30.5 or less, 30.0 or less, 29.5 or less, 29.0 or less, 28.0 or less, 27.0 or less, 26.0 or less, 25.0 or less, 24.0 or less, 23.0 or less, 22.0 or less, 21.0 or less, or 20.5 or less. These lower and upper limits can be combined in any desired manner, and in this case, the Cp value of the bacterium according to this embodiment can be, for example, 15.0 or more and 31.0 or less, 15.0 or more and 30.5 or less, 15.0 or more and 30.0 or less, 15.0 or more and 29.5 or less, 15.0 or more and 29.0 or less, 15.0 or more and 28.0 or less, 15.0 or more and 27.0 or less, 15.0 or more and 26.0 or less, 15.0 or more and 25.0 or less, 15.0 or more and 24.0 or less, 15.0 or more and 23.0 or less, 15.0 or more and 22.0 or less, or 15.0 or more and 21.0 or less.Below 0, 15.0 to 20.5, 15.5 to 31.0, 15.5 to 30.5, 15.5 to 30.0, 15.5 to 29.5, 15.5 to 29.0, 15.5 to 28.0, 15.5 to 27.0, 15.5 to 26.0, 15.5 to 25.0, 15.5 to 24.0, 15.5 to 23.0, 15.5 to 22.0, 15.5 to 21.0, 15.5 to 20.5, 16.0 to 31.0, 16.0 to 30.5, 16.0 to 30.0, 16.0 to 29.5 16.0 to 29.0, 16.0 to 28.0, 16.0 to 27.0, 16.0 to 26.0, 16.0 to 25.0, 16.0 to 24.0, 16.0 to 23.0, 16.0 to 22.0, 16.0 to 21.0, 16.0 to 20.5, 16.5 to 31.0, 16.5 to 30.5, 16.5 to 30.0, 16.5 to 29.5, 16.5 to 29.0, 16.5 to 28.0, 16.5 to 27.0, 16.5 to 26.0, 16.5 to 25.0, 16 17.0 to 31.0, 17.0 to 30.5, 17.0 to 30.5, 17.0 to 29.5, 17.0 to 29.0, 17.0 to 28.0, 17.0 to 27.0, 17.0 to 26.0, 17.0 to 25.0, 17.0 to 24.0, 17.0 to 23.0, 17.0 to 22.0, 17.0 to 21.0, 17.0 to 20.5, and below 17.5. Above 31.0 and below, 17.5 and above 30.5, 17.5 and above 30.0, 17.5 and above 29.5, 17.5 and above 29.0, 17.5 and above 28.0, 17.5 and above 27.0, 17.5 and above 26.0, 17.5 and above 25.0, 17.5 and above 24.0, 17.5 and above 23.0, 17.5 and above 22.0, 17.5 and above 21.0, 17.5 and above 20.5, 18.0 and above 31.0, 18.0 and above 30.5, 18.0 and above 30.0, 18.0 and above 29.5, 18.0 and above 29.0, 18.0 and above 28.Below 0, 18.0 to 27.0, 18.0 to 26.0, 18.0 to 25.0, 18.0 to 24.0, 18.0 to 23.0, 18.0 to 22.0, 18.0 to 21.0, 18.0 to 20.5, 18.5 to 31.0, 18.5 to 30.5, 18.5 to 30.0, 18.5 to 29.5, 18.5 to 29.0, 18.5 to 28.0, 18.5 to 27.0, 18.5 to 26.0, 18.5 to 25.0, 18.5 to 24.0, 18.5 to 23.0, 18.5 to 22.0, 18.5 The following are the numerical values for different price ranges: 19.0 and below 21.0, 18.5 and below 20.5, 19.0 and below 31.0, 19.0 and below 30.5, 19.0 and below 30.0, 19.0 and below 29.5, 19.0 and below 29.0, 19.0 and below 28.0, 19.0 and below 27.0, 19.0 and below 26.0, 19.0 and below 25.0, 19.0 and below 24.0, 19.0 and below 23.0, 19.0 and below 22.0, 19.0 and below 21.0, 19.0 and below 20.5, 19.5 and below 31.0, 19.5 and below 30.5, 19.5 and below 30.0, 19.5 and below 29.5, 19.5 and below 29.0. 19.5 to 28.0, 19.5 to 27.0, 19.5 to 26.0, 19.5 to 25.0, 19.5 to 24.0, 19.5 to 23.0, 19.5 to 22.0, 19.5 to 21.0, 19.5 to 20.5, 20.0 to 31.0, 20.0 to 30.5, 20.0 to 30.0, 20.0 to 29.5, 20.0 to 29.0, 20.0 to 28.0, 20.0 to 27.0, 20.0 to 26.0, 20.0 to 25. Below .0, 20.0 to 24.0, 20.0 to 23.0, 20.0 to 22.0, 20.0 to 21.0, 20.0 to 20.5, 20.5 to 31.0, 20.5 to 30.5, 20.5 to 30.0, 20.5 to 29.5, 20.5 to 29.0, 20.5 to 28.0, 20.5 to 27.0, 20.5 to 26.0, 20.5 to 25.0, 20.5 to 24.0, 20.5 to 23.0, 20.5 to 22.0, 20.5 or more and 21.0 or less, 21.0 or more and 31.0 or less, 21.0 or more and 30.5 or less, 21.0 or more and 30.0 or less, 21.0 or more and 29.5 or less, 21.0 and 29.0 or less, 21.0 to 28.0, 21.0 to 27.0, 21.0 to 26.0, 21.0 to 25.0, 21.0 to 24.0, 21.0 to 23.0 Below, 21.5 to 31.0, 21.5 to 30.5, 21.5 to 30.0, 21.5 to 29.5, 21.5 to 29.0, 21.5 to 2 8.0 or less, 21.5 or more and 27.0 or less, 21.5 or more and 26.0 or less, 21.5 or more and 25.0 or less, 21.5 or more and 24.0 or less, 22.0 or more and 31.0 or less, 22.0 or less Upper 30.5 or less, 22.0 or more and 30.0 or less, 22.0 or more and 29.5 or less, 22.0 or more and 29.0 or less, 22.0 or more and 28.0 or less, 22.0 or more and 27.0 or less, 22 .0 to 26.0, 22.0 to 25.0, 22.5 to 31.0, 22.5 to 30.5, 22.5 to 30.0, 22.5 to 29.5 , 22.5 or more and 29.0 or less, 22.5 or more and 28.0 or less, 22.5 or more and 27.0 or less, 22.5 or more and 26.0 or less, 23.0 or more and 31.0 or less, 23.0 or more and 30.5 or less, 23.0 or more and 30.0 or less, 23.0 or more and 29.5 or less, 23.0 or more and 29.0 or less, 23.0 or more and 28.0 or less, or 23.0 or more and 27.0 or less. SEQ ID NO: 1: GGATTAGATACCCGTAGTC SEQ ID NO: 2: CTTGTGCGGGCCCCCGTCAATTC
[0050] As a more specific example of the Cp value, when the bacterium includes or is a heat-treated bacterium belonging to the genus Lactococcus or Lactococcus lactis (e.g., heat-treated Lactococcus lactis subsp. lactis JCM5805), the Cp value of the bacterium according to this embodiment may be, for example, 15.0 or more and 24.0 or less, 16.0 or more and 23.0 or less, 17.0 or more and 22.0 or less, 17.5 or more and 21.0 or less, 17.5 or more and 20.0 or less, or 18.0 or more and 19.5 or less.
[0051] Furthermore, for example, when the bacterium includes or is a heat-treated bacterium belonging to the genus Weissella or Weissella paramesenteroides (e.g., heat-treated Weissella paramesenteroides JCM9890), the Cp value of the bacterium according to this embodiment may be, for example, 17.0 or more and 30.0 or less, 20.0 or more and 30.0 or less, or 20.0 or more and 26.0 or less.
[0052] Furthermore, for example, when the bacterium includes or is a heat-treated bacterium belonging to the genus Bifidobacterium or Bifidobacterium animalis (e.g., heat-treated Bifidobacterium animalis subsp. lactis JCM 10602), the Cp value of the bacterium according to this embodiment may be, for example, 21.0 or more and 31.0 or less, 22.5 or more and 31.0 or less, or 23.0 or more and 29.0 or less.
[0053] Furthermore, for example, when the bacterium includes or is a heat-treated bacterium belonging to the genus Lactobacillus or Lactobacillus gasseri (e.g., heat-treated Lactobacillus gasseri SBT2055), the Cp value of the bacterium according to this embodiment may be, for example, 18.0 or more and 31.0 or less.
[0054] The Cp value can be measured under the following conditions. <Condition> The DNA solution extracted from the above bacteria is amplified by real-time PCR using the primer set shown below and the program shown below, and the cycle number at which the amplification curve reaches its maximum inflection point is taken as the Cp value based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 50°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second
[0055] An example of a specific measurement condition is Condition 1 shown below. <Condition 1> Bacterial DNA solution extracted by phenol-chloroform extraction was used to evaluate the DNA content at 90 ng by real-time PCR using a LightCycler® 480 (Roche). For real-time PCR, the primer set shown above was used, and amplification was performed using TB Green® Premix Ex Taq® II according to the manufacturer's instructions, using the program shown above.
[0056] The bacteria according to the present embodiment may be bacteria including killed bacteria, and may be, for example, heat-treated or sterilized bacteria. The bacteria according to the present embodiment may preferably be heat-treated bacteria. The bacteria according to the present embodiment have higher immunostimulatory activity (e.g., dendritic cell activation ability, IFN-α production promotion ability) than live bacteria (e.g., unsterilized or unheated bacteria). In particular, when the bacteria according to the present embodiment have a DIN and / or a proportion of the area occupied by DNA of 250 to 60,000 bp and / or a Cp value within a predetermined range, the bacteria have higher immunostimulatory activity (e.g., dendritic cell activation ability, IFN-α production promotion ability) than live bacteria (e.g., unsterilized or unheated bacteria).
[0057] The composition or bacterium of this embodiment may be a composition or bacterium heat-treated at a predetermined temperature range. The heat treatment temperature may be 60°C or higher, 65°C or higher, 70°C or higher, or 75°C or higher, or 110°C or lower, 100°C or lower, 90°C or lower, 85°C or lower, 80°C or lower, less than 80°C, 75°C or lower, or 70°C or lower. These lower and upper limits can be arbitrarily combined. For example, the heat treatment temperature may be 60°C or higher to 110°C or lower, 60°C or higher to 100°C or lower, 60°C or higher to 90°C or lower, 60°C or higher to 85°C or lower, 60°C or higher to 80°C or lower, 65°C or higher to 100°C or lower, 65°C or higher to 90°C or lower, 65°C or higher to 85°C or lower, 65°C or higher to 80°C or lower, 70°C or higher to 90°C or lower, 70°C or higher to 85°C or lower, 70°C or higher to 80°C or lower, 75°C or higher to 90°C or lower, or 75°C or higher to 85°C. When the heat treatment temperature is within the above range, the immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) is increased, and the immunostimulatory ability is greater than that of unsterilized and unheated bacteria, for example. The composition of this embodiment or the bacterium of this embodiment may be heated at a temperature not exceeding a predetermined upper temperature limit (e.g., 130°C, 120°C, 110°C, etc.). When heated at or below the predetermined upper temperature limit, the immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) is greater than that of bacteria heated at a temperature exceeding the predetermined upper temperature limit.
[0058] The bacteria according to this embodiment may be heat-treated, for example, in the form of a powder or suspension, preferably in the form of a suspension. In these cases, the solvent for the suspension is not particularly limited and may be, for example, a glucose-containing medium (e.g., MRS (de Man, Rogosa and Sharpe) medium, etc.), a buffer solution (e.g., phosphate-buffered saline (PBS), etc.), or a mixture thereof. Heat treatment can be carried out using heating devices commonly used by those skilled in the art, such as a plate sterilizer, a tubular sterilizer, a direct-heat sterilizer, a jacketed tank, or an autoclave.
[0059] Patent Document 1 describes that the DNA or RNA of lactic acid bacteria contained in the immunostimulatory food composition is thought to activate pDCs and induce IFN production. Therefore, because nucleic acids such as DNA and RNA tend to decompose under high-temperature conditions, it has generally been thought that heat treatment of bacteria may decrease the bacterial immunostimulatory ability, but not increase it. In contrast, the present inventors have unexpectedly discovered that when the heat treatment temperature is within the above-mentioned specified range, the heat treatment improves the immunostimulatory ability of bacteria compared to unsterilized bacteria.
[0060] The bacterium according to this embodiment may be a bacterium that has been heat-treated for a predetermined time at a temperature within the above-mentioned predetermined range. For example, the heat treatment time may be 1 minute or more, 3 minutes or more, 5 minutes or more, or 10 minutes or more, or 24 hours or less, 4 hours or less, 60 minutes or less, 45 minutes or less, or 30 minutes or less. These lower and upper limits may be combined arbitrarily. For example, the heat treatment time may be 1 minute or more and 24 hours or less, 3 minutes or more and 4 hours or less, or 5 minutes or more and 60 minutes or less.
[0061] The bacterium according to this embodiment may be a bacterium that has been heat-treated so that the product of the temperature (°C) and time (minutes) during the heat treatment is within a predetermined range. In a preferred embodiment, the bacterium may be heat-treated at a temperature within the above-mentioned predetermined range, with the product of the temperature (°C) and time (minutes) during the heat treatment being within a predetermined range. For example, the product of the temperature (°C) and time (minutes) during the heat treatment of the bacterium according to this embodiment may be 150 or more, 300 or more, 500 or more, 800 or more, 1200 or more, 1500 or more, 1800 or more, or 2000 or more, or may be 30,000 or less, 20,000 or less, 15,000 or less, 10,000 or less, 7,000 or less, 5,000 or less, 4,000 or less, 3,500 or less, 3,000 or less, 2,700 or less, or 2,500 or less. These lower and upper limits may be combined arbitrarily, and the product of the temperature (°C) and time (minutes) in the heat treatment of the bacteria according to this embodiment may be, for example, 150 to 30,000, 150 to 20,000, 150 to 15,000, 150 to 10,000, 150 to 7,000, 150 to 5,000, 150 to 4,000, 150 to 3,500, 150 to 5,000, 150 to 6,000, 150 to 7,000, 150 to 8,000, 150 to 10,000, 150 to 15 ... 3000 or less, 150 to 2700, 150 to 2500, 300 to 30000, 300 to 20000, 300 to 15000, 300 to 10000, 3 00 to 7000, 300 to 5000, 300 to 4000, 300 to 3500, 300 to 3000, 300 to 2700, 300 to 2500, 50 0 to 30,000, 500 to 20,000, 500 to 15,000, 500 to 10,000, 500 to 7,000, 500 to 5,000, 500 to 4,000 Lower, 500 to 3,500, 500 to 3,000, 500 to 2,700, 500 to 2,500, 800 to 30,000, 800 to 20,000, 800 to 1,500 0 or less, 800 to 10,000, 800 to 7,000, 800 to 5,000, 800 to 4,000, 800 to 3,500, 800 to 3,000, 800 to 270 0 or less, 800 to 2500, 1200 to 30000, 1200 to 20000, 1200 to 15000, 1200 to 10000, 1200 to 7000,1200 to 5000, 1200 to 4000, 1200 to 3500, 1200 to 3000, 1200 to 2700, 1200 to 2500, 1500 to 30000, 1500 to 20000, 1500 to 15000, 1500 to 10000 Below, 1,500 to 7,000, 1,500 to 5,000, 1,500 to 4,000, 1,500 to 3,500, 1,500 to 3,000, 1,500 to 2,700, 1,500 to 2,500, 1,800 to 30,000, 1,800 to 20,000, 1,800 to 1,500 0 or less, 1800 to 10000 or less, 1800 to 7000 or less, 1800 to 5000 or less, 1800 to 4000 or less, 1800 to 3500 or less, 1800 to 3000 or less, 1800 to 2700 or less, 1800 to 2500 or less, 2000 to 30000 or less, 2000 to 20000 or less, 2000 to 15000 or less, 2000 to 10000 or less, 2000 to 7000 or less, 2000 to 5000 or less, 2000 to 4000 or less, 2000 to 3500 or less, 2000 to 3000 or less, 2000 to 2700 or less, or 2000 to 2500 or less. In this case, heat treatment includes all treatments in which bacteria are exposed to temperatures exceeding 50°C. When two or more such treatments are performed, it is preferable that the product of the temperature (°C) and the time (minutes) in those two or more treatments be within the above range.
[0062] The bacteria according to this embodiment include dead bacteria, and may be a mixture of live and dead bacteria. In other words, the composition according to this embodiment may include dead bacteria, or may include live and dead bacteria.
[0063] When the bacterium according to this embodiment is a heat-treated bacterium, the bacterium may be a dried bacterium that has been subjected to a drying treatment after the heat treatment. The drying treatment may be, for example, spray drying, which may be performed using a spray dryer used for spray drying bacteria. The drying treatment may also be, for example, freeze drying.
[0064] The bacterium according to this embodiment may not have been exposed to a temperature exceeding a predetermined temperature. The predetermined temperature may be 130°C, 120°C, 115°C, 110°C, 105°C, 100°C, 95°C, 90°C, or 89°C. When the bacterium according to one embodiment has not been exposed to a temperature exceeding the predetermined temperature, it has a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than a bacterium exposed to a temperature exceeding the predetermined temperature.
[0065] The bacteria according to the present embodiment may satisfy at least one, at least two, at least three, at least four, or five of the following: a DIN within a predetermined range; a DIN that is a predetermined ratio relative to the DIN of unsterilized bacteria; a Cp value that is a predetermined ratio relative to the Cp value of unsterilized bacteria; a predetermined range of the proportion of the area occupied by DNA of 250 to 60,000 bp in a DNA histogram; and bacteria that have been heat-treated under predetermined temperature conditions. The bacteria according to the present embodiment may satisfy at least one, at least two, or three of the following: a DIN within a predetermined range; a Cp value that is a predetermined ratio relative to the Cp value of live bacteria; and a predetermined range of the proportion of the area occupied by DNA of 250 to 60,000 bp in a DNA histogram. The bacteria according to the present embodiment may satisfy the following: a DIN within a predetermined range and / or a Cp value that is a predetermined ratio relative to the Cp value of live bacteria. The bacterium according to the present embodiment may be a bacterium that satisfies at least one, at least two, or three of the following: a DIN within a predetermined range; a Cp value that is a multiplier within a predetermined range relative to the Cp value of live bacteria; and a DNA histogram in which the proportion of the area occupied by DNA of 250 to 60,000 bp is within a predetermined range; and that has been heat-treated under predetermined temperature conditions. The bacterium according to the present embodiment may be a bacterium whose Cp value is a multiplier within a predetermined range relative to the Cp value of live bacteria and that has been heat-treated. The bacterium according to the present embodiment may be a bacterium whose Cp value is 1.10 to 1.50 times, or 1.20 to 1.40 times, the Cp value of live bacteria, and that has been heat-treated, for example, at 60°C to 110°C or 70°C to 90°C.
[0066] The bacteria according to this embodiment have improved immunostimulatory ability compared to live bacteria. The bacteria according to this embodiment have improved immunostimulatory ability compared to bacteria that have not been heat-treated (unheated bacteria) or bacteria that have not been sterilized (unkilled bacteria). In these cases, the unheated bacteria and unkilled bacteria used for comparison are bacteria of the same strain as the bacteria according to this embodiment. For example, the immunostimulatory ability of the bacteria according to this embodiment may be 1.10 times or more, 1.50 times or more, 1.70 times or more, 1.90 times or more, 2.00 times or more, 2.50 times or more, 3.00 times or more, 3.50 times or more, 4.00 times or more, 4.25 times or more, or 4.26 times or more, or may be 10.0 times or less, or 5.00 times or less, compared to live bacteria (e.g., unheated or unkilled bacteria). These lower and upper limits may be combined arbitrarily, and the immunostimulatory ability of the bacteria according to this embodiment is, for example, 1.10 to 10.0 times, 1.10 to 5.00 times, 1.50 to 10.0 times, 1.50 to 5.00 times, 1.70 to 10.0 times, 1.70 to 5.00 times, 1.90 to 10.0 times, 1.90 to 5.00 times, 2.00 to 10.0 times, The immunopotentiator may be 2.00 to 5.00 times, 2.50 to 10.0 times, 2.50 to 5.00 times, 3.00 to 10.0 times, 3.00 to 5.00 times, 3.50 to 10.0 times, 3.50 to 5.00 times, 4.00 to 10.0 times, 4.00 to 5.00 times, 4.25 to 10.0 times, 4.25 to 5.00 times, 4.26 to 10.0 times, or 4.26 to 5.00 times. Furthermore, as described above, the improved immunopotentiator may be the ability to activate dendritic cells or the ability to promote IFN-α production. The immunostimulatory activity may be evaluated, for example, by the amount of IFN-α produced by dendritic cells when the bacteria are exposed to the dendritic cells, and as a more detailed example, may be evaluated according to the method described in the Examples.
[0067] The effective amount of bacteria contained in the composition of the present embodiment is not particularly limited as long as it is an amount that can exert immunostimulatory activity, and may vary depending on the subject of application. When the subject of application is a mammal such as a human, for example, it is 1.0 × 104 pcs or more, 5.0×10 4 That's it, 1.0 x 10 5 pcs or more, 3.0×10 5 pcs or more, 1.0×10 6 pcs or more, 3.0×10 6 pcs or more, 1.0×10 7 pcs or more, 3.0×10 7 pcs or more, 1.0×10 8 pcs or more, 3.0×10 8 pcs or more, 5.0×10 8 pcs or more, 1.0×10 9 pcs or more, 5.0×10 9 pcs or more, 1.0×10 10 pcs or more, 5.0×10 10 or more or 1.0 x 10 11 may be 1.0 x 10 or more, 14 pcs or less, 1.0×10 13 or less, or 1.0 x 10 12 These upper and lower limits can be arbitrarily combined, and the effective amount range is, for example, 1.0 × 10 5 pcs or more 1.0×10 14 pcs or less, 1.0×10 5 pcs or more 1.0×10 13 pcs or less, 1.0×10 5 pcs or more 1.0×10 12 pcs or less, 3.0×10 5 pcs or more 1.0×10 14 pcs or less, 3.0×10 5 pcs or more 1.0×10 13 pcs or less, 3.0×10 5 pcs or more 1.0×10 12 pcs or less, 1.0×10 6 pcs or more 1.0×10 14 pcs or less, 1.0×10 6 pcs or more 1.0×10 13 pcs or less, 1.0×10 6 pcs or more 1.0×10 12 pcs or less, 3.0×10 6 pcs or more 1.0×10 14 pcs or less, 3.0×10 6 pcs or more 1.0×10 13 pcs or less, 3.0×106 More than 1.0 × 10 12 Less than 1.0 × 10 7 More than 1.0 × 10 14 Less than 1.0 × 10 7 More than 1.0 × 10 13 Less than 1.0 × 10 7 More than 1.0 × 10 12 Less than 3.0 × 10 7 More than 1.0 × 10 14 Less than 3.0 × 10 7 More than 1.0 × 10 13 Less than 3.0 × 10 7 More than 1.0 × 10 12 Less than 1.0 × 10 8 More than 1.0 × 10 14 Less than 1.0 × 10 8 More than 1.0 × 10 13 Less than 1.0 × 10 8 More than 1.0 × 10 12 Less than 3.0 × 10 8 More than 1.0 × 10 14 Less than 3.0 × 10 8 More than 1.0 × 10 13 Less than 3.0 × 10 8 More than 1.0 × 10 12 Less than 5.0 × 10 8 More than 1.0 × 10 14 Less than 5.0 × 10 8 More than 1.0 × 10 13 Less than 5.0 × 10 8 More than 1.0 × 10 12 Less than 1.0 × 10 9 More than 1.0 × 10 14 Less than 1.0 × 10 9 More than 1.0 × 10 13 Less than 1.0 × 10 9 More than 1.0 × 10 12 Less than 5.0 × 10 9 More than 1.0 × 10 14 Less than 5.0 × 10 9 More than 1.0 × 10 13 Less than 5.0 × 10 9 More than 1.0 × 10 12 Less than 1.0 × 10 10pcs or more 1.0×10 14 pcs or less, 1.0×10 10 pcs or more 1.0×10 13 pcs or less, 1.0×10 10 pcs or more 1.0×10 12 Less than or equal to 5.0×10 10 pcs or more 1.0×10 14 Less than or equal to 5.0×10 10 pcs or more 1.0×10 13 Less than or equal to 5.0×10 10 pcs or more 1.0×10 12 pcs or less, 1.0×10 11 pcs or more 1.0×10 14 pcs or less, 1.0×10 11 pcs or more 1.0×10 13 or less than 1.0 x 10 11 pcs or more 1.0×10 12 The number of bacteria may be 1 or less. The number of bacteria can be measured using a known microscope, flow cytometer, or non-culture rapid microorganism testing device (e.g., ELESTA PixeeMo (AFI Technology Co., Ltd.)), but measurement by microscope is preferred from the viewpoint of high versatility. The bacterium of one embodiment may be used as an immunostimulant as it is, or may be blended with other components and used as a composition having immunostimulating properties. The composition having immunostimulating properties may be used in the form of, for example, a food composition, a pharmaceutical composition, a quasi-drug, a bacterial bulk powder (a powder obtained by drying bacterial cells or a powder containing the same), or a feed. The subject to which the composition according to this embodiment is administered or ingested may be a human and / or a non-human mammal, and is preferably a human.
[0068] The content of bacteria in the composition of this embodiment is not particularly limited as long as it is an amount that can exert immunostimulatory activity, and therefore generally can vary depending on the form of the composition and the amount ingested or administered. For example, the dry weight of bacteria in the composition of this embodiment can be 0.0001% by mass or more, 0.001% by mass or more, 0.005% by mass or more, 0.01% by mass or more, 0.02% by mass or more, 0.05% by mass or more, 0.10% by mass or more, 0.30% by mass or more, 1.0% by mass or more, 1.5% by mass or more, 2.0% by mass or more, 2.5% by mass or more, 3.0% by mass or more, 5.0% by mass or more, or 6.0% by mass or more, based on the total dry weight of the composition. % or more, 7.0% by mass or more, 10.0% by mass or more, 80.0% by mass or more, 90.0% by mass or more, 95.0% by mass or more, 99.0% by mass or more, or 100% by mass, or 100% by mass or less, 95% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 30% by mass or less, 25% by mass or less, 20% by mass or less, or 15% by mass or less. These lower and upper limits can be combined arbitrarily. For example, the dry weight of bacteria relative to the total dry weight of the composition of this embodiment can be set to 0.0001% by mass or more and 100% by mass or less, 0.0001% by mass or more and 95% by mass or less, 0.0001% by mass or more and 90% by mass or less, 0.0001% by mass or more and 80% by mass or less, 0.0001% by mass or more and 70% by mass or less, 0.0001% by mass or more and 60% by mass or less, 0.0001% by mass or more and 50% by mass or less, 0.0001% by mass or more and 30% by mass or less, 0.0001% by mass or more and 25% by mass or less, 0.0001% by mass or more and 20% by mass or less, 0.0001% by mass or more and 15% by mass or less, 0.0001% by mass or more and ... 10 mass% or more, 0.001 mass% or more and 100 mass% or less, 0.001 mass% or more and 95 mass% or less, 0.001 mass% or more and 90 mass% or less, 0.001 mass% or more and 80 mass% or less, 0.001 mass% or more and 70 mass% or less, 0.001 mass% or more and 60 mass% or less, 0.001 mass% or more and 50 mass% or less, 0.001 0.001 mass% to 20 mass%, 0.001 mass% to 15 mass%, 0.001 mass% to 10 mass%, 0.005 mass% to 100 mass%, 0.005 mass% to 95 mass%, 0.005 mass% to 90 mass%, 0.0.005% to 80% of mass, 0.005% to 70% of mass, 0.005% to 60% of mass, 0.005% to 50% of mass, 0.005% to 30% of mass, 0.005% to 25% of mass, 0.005% to 20% of mass, 0.005% to 15% of mass, 0.005% to 10% of mass, 0.01% to 100% of mass, 0.01% to 95% of mass, 0.01% to 90% of mass, 0.01% to 80% of mass, 0.01% to 70% of mass, 0.01% of mass... The following weight percentages are listed: ≥60% and ≤50%; ≥30% and ≤0.01%; ≥25% and ≤20%; ≥15% and ≤10%; ≥100% and ≤0.02%; ≥95% and ≤0.02%; ≥80% and ≤70%; ≥60% and ≤0.02%; ≥50% and ≤0.02%; ≥30% and ≤0.02%. Below, 0.02% mass% to 25% mass%, 0.02% mass% to 20% mass%, 0.02% mass% to 15% mass%, 0.02% mass% to 10% mass%, 0.05% mass% to 100% mass%, 0.05% mass% to 95% mass%, 0.05% mass% to 90% mass%, 0.05% mass% to 80% mass%, 0.05% mass% to 70% mass%, 0.05% mass% to 60% mass%, 0.05% mass% to 50% mass%, 0.05% mass% to 30% mass%, 0.05% mass% to 25% mass%, 0.05% mass% to 20% mass%, 0.05% mass% and above. Less than 15% by mass, 0.05% to 10% by mass, 0.10% to 100% by mass, 0.10% to 95% by mass, 0.10% to 90% by mass, 0.10% to 80% by mass, 0.10% to 70% by mass, 0.10% to 60% by mass, 0.10% to 50% by mass, 0.10% to 30% by mass, 0.10% to 25% by mass, 0.10% to 20% by mass, 0.10% to 15% by mass, 0.10% to 10% by mass, 0.30% to 100% by mass, 0.30% to 95% mass, 0.30% to 90% mass, 0.30% to 80% mass, 0.30% to 70% mass, 0.30% to 60% mass, 0.30% to 50% mass, 0.30% to 30% mass, 0.30% to 25% mass, 0.30% to 20% mass, 0.30% to 15% mass, 0.30% to 10% mass, 1.0% to 100% mass, 1.0% to 95% mass, 1.0% to 90% mass, 1.0% to 80% mass and below Below, 1.0% mass percentage to 70% mass percentage, 1.0% mass percentage to 60% mass percentage, 1.0% mass percentage to 50% mass percentage, 1.0% mass percentage to 30% mass percentage, 1.0% mass percentage to 25% mass percentage, 1.0% mass percentage to 20% mass percentage, 1.0% mass percentage to 15% mass percentage, 1.0% mass percentage to 10% mass percentage, 1.5% mass percentage to 100% mass percentage, 1.5% mass percentage to 95% mass percentage, 1.5% mass percentage to 90% mass percentage, 1.5% mass percentage to 80% mass percentage, 1.5% mass percentage to 70% mass percentage, 1.5% mass percentage to 60% mass percentage, 1.5% mass percentage to 50% mass percentage, 1.5% mass percentage 1.5% to 30% mass, 1.5% to 25% mass, 1.5% to 20% mass, 1.5% to 15% mass, 1.5% to 10% mass, 2.0% to 100% mass, 2.0% to 95% mass, 2.0% to 90% mass, 2.0% to 80% mass, 2.0% to 70% mass, 2.0% to 60% mass, 2.0% to 50% mass, 2.0% to 30% mass, 2.0% to 25% mass, 2.0% to 20% mass, 2.0% to 15% mass Below 2.0%, 2.0% to 10%, 2.5% to 100%, 2.5% to 95%, 2.5% to 90%, 2.5% to 80%, 2.5% to 70%, 2.5% to 60%, 2.5% to 50%, 2.5% to 30%, 2.5% to 25%, 2.5% to 20%, 2.5% to 15%, 2.5% to 10%, 3.0% to 100%, 3.0% to 95%, 3.0% to 90% of mass, 3.0% to 80% of mass, 3.0% to 70% of mass, 3.0% to 60% of mass, 3.0% to 50% of mass, 3.0% to 30% of mass, 3.0% to 25% of mass, 3.0% to 20% of mass, 3.0% to 15% of mass, 3.0% to 10% of mass, 5.0% to 100% of mass, 5.0% to 95% of mass, 5.0% to 90% of mass, 5.0% of mass... Quantity % or more but less than 80% of mass, 5.0% or more but less than 70% of mass, 5.0% or more but less than 60% of mass, 5.0% or more but less than 50% of mass, 5.0% or more but less than 30% of mass, 5.0% or more but less than 25% of mass, 5.0% or more but less than 20% of mass, 5.0% or more but less than 15% of mass, 5.0% or more but less than 10% of mass, 7.0% or more but less than 100% of mass, 7.0% or more but less than 95% of mass, 7.0% or more but less than 90% of mass, 7.0% or more but less than 80% of mass, 7.0% of mass Above 70% mass percentage and below, 7.0% mass percentage and above 60% mass percentage, 7.0% mass percentage and above 50% mass percentage, 7.0% mass percentage and above 30% mass percentage, 7.0% mass percentage and above 25% mass percentage, 7.0% mass percentage and above 20% mass percentage, 7.0% mass percentage and above 15% mass percentage, 7.0% mass percentage and above 10% mass percentage, 10.0% mass percentage and above 10% mass percentage, 10.0% mass percentage and above 100% mass percentage, 10.0% mass percentage and above 95% mass percentage, 10.0% mass percentage and above 90% mass percentage, 10.0% mass percentage and above 80% mass percentage, 10.0% mass percentage and above 70% mass percentage, 10. 0% or more quality, 60% or less quality, 10.0% or more quality, 50% or less quality, 10.0% or more quality, 30% or less quality, 10.0% or more quality, 25% or less quality, 10.0% or more quality, 20% or less quality, 10.0% or more quality, 15% or less quality, 80.0% or more quality, 100% or more quality, 80.0% or more quality, 95% or less quality, 90.0% or more quality, 100% or less quality, 90.0% or more quality, 95% or less quality. (Also, 95.0% or more quality, 100% or less quality.)
[0069] The present application forms include compositions, such as food compositions, medical compositions, bacterial cell powder (bacterial cells, dry powder, and containing powder, etc.) and feedstuffs.
[0070] When the composition of this embodiment is in a liquid form, the number of bacteria according to this embodiment in the composition is 1.0 × 10 3 Cells / mL or more, 1.0×10 4 Cells / mL or more, 1.0×10 5 Cells / mL or more, 1.0×10 6 Cells / mL or more, 1.0×10 7 cells / mL or 4.0 x 10 7 cells / mL or greater than 1.0 x 10 11 Cells / mL or less, 1.0×10 10 Cells / mL or less, 3.0×10 9 cells / mL or less or 1.0 x 10 9 The number of bacteria contained in the composition according to this embodiment may be 1.0 × 10 cells / mL or less. These lower and upper limits may be combined arbitrarily and are not particularly limited. For example, the number of bacteria contained in the composition according to this embodiment may be 1.0 × 10 cells / mL or less. 3 cells / mL or more 1.0×10 11 Cells / mL or less, 1.0×10 3 cells / mL or more 1.0×10 10 Cells / mL or less, 1.0×10 3 cells / mL or more 3.0×10 9 Cells / mL or less, 1.0×10 3 cells / mL or more 1.0×10 9 Cells / mL or less, 1.0×10 4 cells / mL or more 1.0×10 11 Cells / mL or less, 1.0×10 4 cells / mL or more 1.0×10 10 Cells / mL or less, 1.0×10 4 cells / mL or more 3.0×10 9 Cells / mL or less, 1.0×10 4 cells / mL or more 1.0×10 9 Cells / mL or less, 1.0×10 5 cells / mL or more 1.0×10 11 Cells / mL or less, 1.0×10 5 cells / mL or more 1.0×10 10 Cells / mL or less, 1.0×10 5 cells / mL or more 3.0×10 9 Cells / mL or less, 1.0×10 5cells / mL or more 1.0×10 9 Cells / mL or less, 1.0×10 6 cells / mL or more 1.0×10 11 Cells / mL or less, 1.0×10 6 cells / mL or more 1.0×10 10 Cells / mL or less, 1.0×10 6 cells / mL or more 3.0×10 9 Cells / mL or less, 1.0×10 6 cells / mL or more 1.0×10 9 Cells / mL or less, 1.0×10 7 cells / mL or more 1.0×10 11 Cells / mL or less, 1.0×10 7 cells / mL or more 1.0×10 10 Cells / mL or less, 1.0×10 7 cells / mL or more 3.0×10 9 Cells / mL or less, 1.0×10 7 cells / mL or more 1.0×10 9 Cells / mL or less, 4.0×10 7 cells / mL or more 1.0×10 11 Cells / mL or less, 4.0×10 7 cells / mL or more 1.0×10 10 Cells / mL or less, 4.0×10 7 cells / mL or more 3.0×10 9 cells / mL or less or 4.0 x 10 7 cells / mL or more 1.0×10 9 In these cases, when the composition is a liquid food composition, liquid pharmaceutical composition, or liquid feed, the daily intake or administration amount of the composition may be 10 mL to 1,000 mL, 10 mL to 800 mL, 10 mL to 500 mL, 10 mL to 250 mL, 30 mL to 1,000 mL, 30 mL to 800 mL, 30 mL to 500 mL, 30 mL to 250 mL, 50 mL to 1,000 mL, 50 mL to 800 mL, 50 to 500 mL, 50 mL to 250 mL, 100 mL to 1,000 mL, 100 mL to 800 mL, 100 to 500 mL, or 100 to 250 mL.
[0071] In one aspect, the composition of this embodiment may contain a DNA fragment amplified by a predetermined primer set. In the present disclosure, a composition containing a certain DNA fragment may mean that the composition contains bacteria having the DNA fragment and / or that the composition contains the DNA fragment in a free state. In other words, the content of the DNA fragment in the composition of this embodiment may be the sum of the amount of the DNA fragment in the bacteria contained in the composition and the amount of the DNA fragment contained in the composition in a free state. In one aspect, a composition containing a certain DNA fragment may mean that the composition contains at least bacteria having the DNA fragment, and the bacteria may be, for example, heat-treated bacteria.
[0072] The method for determining the amount and concentration of DNA fragments amplified by a predetermined primer set contained in a composition is not particularly limited, and can be evaluated, for example, as follows: In a specific embodiment, the amount and concentration of DNA fragments amplified by a predetermined primer set may be determined according to the same method as in Example 6.
[0073] First, nucleic acids are extracted from the composition while eluting them from the bacteria contained in the composition. The method for extracting nucleic acids from the composition is not particularly limited, as long as it does not degrade the DNA fragments that serve as PCR templates in the subsequent evaluation, and can be performed using methods commonly used by those skilled in the art. Extracting nucleic acids from the composition may include, for example, disrupting the bacterial cell walls and extracting the nucleic acids from a solution containing the contents of the bacteria whose cell walls have been disrupted, and may further include purifying the nucleic acids by isolating them as precipitates. Disruption of the bacterial cell walls may be physical, for example, by bead crushing or ultrasonic irradiation, or chemical, for example, by adding a surfactant. Nucleic acids can be extracted, for example, by adding phenol and chloroform to a portion or all of the composition or a diluted solution thereof, and recovering the supernatant (phenol-chloroform extraction). In addition to phenol and chloroform, an organic solvent (e.g., isoamyl alcohol) may also be added. Nucleic acids can be precipitated, for example, by adding a reagent (e.g., sodium acetate) to adjust the pH and ion concentration as needed to a solution containing the nucleic acids, and then mixing the solution with isopropanol, ethanol, or the like.
[0074] In a more detailed example of the extraction method, a surfactant-containing extraction buffer (e.g., 300 μL of the extraction buffer whose composition is shown below) and a solution containing phenol and chloroform (e.g., 500 μL of the phenol / chloroform / isoamyl alcohol solution whose composition is shown below) are added to a portion or all of the composition or a diluted solution thereof (e.g., 200 μL). The bacterial cell walls contained in the resulting mixture are disrupted by bead crushing, followed by centrifugation to recover the supernatant. If necessary, the recovered supernatant is washed again with a solution containing phenol and chloroform, and then 3 M sodium acetate (e.g., 25 μL) and isopropanol (e.g., 250 μL) are added to the washed supernatant (e.g., 250 μL) to precipitate the nucleic acids. The precipitated nucleic acids are recovered by centrifugation or other methods, and then washed with 70% ethanol or other methods as needed to extract the nucleic acids from the composition. The nucleic acids extracted in this manner can be used for subsequent evaluation, for example, by adding water to the dried pellet to obtain a DNA solution. The amount of nucleic acid thus extracted may also be determined, for example, by absorbance measurement. [Extraction buffer] Mix 20 mL of 1 M Tris HCl (pH 8), 16 mL of UltraPure 0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, ref: 15575-020), 64 mL of MilliQ, and 20 mL of 10% SDS. [Phenol / chloroform / isoamyl alcohol solution] A mixture of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1
[0075] Next, the copy number of the DNA fragment amplified by a predetermined primer set in the extracted nucleic acid is evaluated. The evaluation method is not particularly limited as long as it can evaluate the copy number of the DNA fragment amplified by a predetermined primer set, and may be, for example, digital PCR. Digital PCR involves dividing a solution containing the DNA fragment into multiple microsolutions so that the DNA fragment to be amplified is stochastically contained in less than one molecule, and then causing PCR in each microsolution. The proportion of microsolutions in which PCR occurred is used as an indicator to evaluate the copy number of the DNA fragment contained in a unit volume of solution. The specific method of digital PCR is not particularly limited, and may be, for example, a method using droplets or microwells, and in one embodiment, a method using droplets. Digital PCR using droplets is known as ddPCR (Droplet Digital PCR).
[0076] A detailed example of the ddPCR method is evaluation using the ddPCR method using a QX600 AutoDG Droplet Digital PCR System (Bio-Rad). More specifically, the DNA solution is first diluted to an appropriate concentration. The dilution ratio may be determined based on the amount of extracted nucleic acid, for example, by absorbance measurement. Next, ddPCR Evagreen Supermix (Bio-Rad, 1864033), a 10 μM forward primer solution, a 10 μM reverse primer solution, water, and a diluted DNA solution are mixed in a volume ratio of 11:0.4:0.4:8.2:2.0. This mixture is then fed into an Automated Droplet Generator (Bio-Rad, 1864101JA) to generate droplets. Then, a Pierceable Foil Heat Seal (Bio-Rad, 1814040) is attached to the plate using a PX1 (registered trademark) PCR Plate Sealer (Bio-Rad, 1814000J1), and PCR is performed using a PTC Tempo Deepwell Thermal Cycler (Bio-Rad, 12015392). The PCR amplification program involves a temperature change of, for example, 2°C / second. Alternatively, PCR may be performed using, for example, the following program: After PCR, the sample is loaded onto a QX600 Droplet Reader (Bio-Rad, 12013328) to measure the concentration of the DNA fragment amplified by the specified primer set. In ddPCR, the concentration of the DNA fragment can be measured as the number of copies per unit volume. [program] Stage 1: 95°C for 5 minutes, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 58°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second and 4°C for 20 seconds
[0077] Using the above method, for example, the final measured DNA fragment concentration can be multiplied by the dilution factor used up to the preparation of the PCR reaction solution, and converted to the total amount of the composition if only a portion of the composition was used to prepare the DNA solution, to calculate the copy number of the DNA fragment contained in the total amount of the composition amplified by the specified primer set (total composition copy number). Furthermore, by dividing the total composition copy number by the volume or mass of the composition, the copy number of the DNA fragment amplified by the specified primer set per unit volume or unit mass of the composition can be calculated. Furthermore, by dividing the total composition copy number by the mass or number of cells of the heat-treated bacteria contained in the composition, the copy number of the DNA fragment amplified by the specified primer set per unit mass or number of cells of the heat-treated bacteria contained in the composition can be calculated.
[0078] The predetermined primer set may be, for example, a primer set consisting of the following forward and reverse primers (hereinafter also referred to as the "A9 primer set"). The A9 primer set is a set of primers that amplify a genomic region of Lactococcus bacteria. Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4)
[0079] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the A9 primer set in a concentration of, for example, 1.0 × 10 5 Copy or more, 3.0 x 10 5 Copy or more, 7.0 x 10 5 Copy or more, 1.2 x 10 6 Copy or more, 1.9 x 10 6 Copy or more, 2.0 x 10 6 Copy or more, 2.1 x 10 6 Copy or more, 2.5 x 10 6 Copy or more or 3.0 x 10 6 May contain more than 1.2 x 10 copies 7Copy and below, 1.0 x 10 7 Copy and below, 9.0 x 10 6 Copy and below, 8.0 x 10 6 Copy or less or 7.6 x 10 6 In this case, the lower and upper limits may be arbitrarily combined, and the composition may contain, for example, 1.0 × 10 copies of the DNA fragment amplified by the A9 primer set. 5 Over 1.2 x 10 7 Below, 1.0 x 10 5 Over 1.0 x 10 7 Below, 1.0 x 10 5 Over 9.0 x 10 6 Below, 1.0 x 10 5 Over 8.0 x 10 6 Below, 1.0 x 10 5 Over 7.6 x 10 6 Below, 3.0 x 10 5 Over 1.2 x 10 7 Below, 3.0 x 10 5 Over 1.0 x 10 7 Below, 3.0 x 10 5 Over 9.0 x 10 6 Below, 3.0 x 10 5 Over 8.0 x 10 6 Below, 3.0 x 10 5 Over 7.6 x 10 6 Below, 7.0 x 10 5 Over 1.2 x 10 7 Below, 7.0 x 10 5 Over 1.0 x 10 7 Below, 7.0 x 10 5 Over 9.0 x 10 6 Below, 7.0 x 10 5 Over 8.0 x 10 6 Below, 7.0 x 10 5 Over 7.6 x 10 6 Below, 1.2 x 10 6 Over 1.2 x 10 7 Below, 1.2 x 10 6 Over 1.0 x 10 7 Below, 1.2 x 10 6 Over 9.0 x 10 6 Below, 1.2 x 10 6 Over 8.0 x 10 6 Below, 1.2 x 106 Above 7.6×10 6 Below, 1.9×10 6 Above 1.2×10 7 Below, 1.9×10 6 Above 1.0×10 7 Below, 1.9×10 6 Above 9.0×10 6 Below, 1.9×10 6 Above 8.0×10 6 Below, 1.9×10 6 Above 7.6×10 6 Below, 2.0×10 6 Above 1.2×10 7 Below, 2.0×10 6 Above 1.0×10 7 Below, 2.0×10 6 Above 9.0×10 6 Below, 2.0×10 6 Above 8.0×10 6 Below, 2.0×10 6 Above 7.6×10 6 Below, 2.1×10 6 Above 1.2×10 7 Below, 2.1×10 6 Above 1.0×10 7 Below, 2.1×10 6 Above 9.0×10 6 Below, 2.1×10 6 Above 8.0×10 6 Below, 2.1×10 6 Above 7.6×10 6 Below, 2.5×10 6 Above 1.2×10 7 Below, 2.5×10 6 Above 1.0×10 7 Below, 2.5×10 6 Above 9.0×10 6 Below, 2.5×10 6 Above 8.0×10 6 Below, 2.5×10 6 Above 7.6×10 6 Below, 3.0×10 6 Above 1.2×10 7 Below, 3.0×10 6 Above 1.0×10 7 Below, 3.0×10 6Over 9.0 x 10 6 Below, 3.0 x 10 6 Over 8.0 x 10 6 or less than 3.0 x 10 6 Over 7.6 x 10 6 It may contain the following copies:
[0080] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Lactococcus, the composition contains a DNA fragment amplified by the A9 primer set at, for example, 5.1 × 10 per mg of bacteria of the genus Lactococcus. 7 Copy or more, 1.5 x 10 8 Copy or more, 3.5 x 10 8 Copy or more, 3.5 x 10 8 Copy or more, 6.0 x 10 8 Copy or more, 9.5 x 10 8 Copy or more, 1.0 x 10 9 Copy or more, 1.0 x 10 9 Copy or more, 1.2 x 10 9 Copy or more or 1.5 x 10 9 May contain more than 6.0 x 10 copies 9 Copy and below, 5.0 x 10 9 Copy or less, 4.5 x 10 9 Copy and below, 4.0 x 10 9 Copy or less or 3.8 x 10 9 In this case, the lower and upper limits may be arbitrarily combined, and the composition may contain, for example, 5.1 × 10 copies of the DNA fragment amplified by the A9 primer set per mg of Lactococcus bacteria. 7 Over 6.0 x 10 9 Below, 5.1 x 10 7 Over 5.0 x 10 9 Below, 5.1 x 10 7 Over 4.5 x 10 9 Below, 5.1 x 10 7 Over 4.0 x 10 9 Below, 5.1 x 10 7 Over 3.8 x 10 9 Below, 1.5 x 10 8 Over 6.0 x 10 9 Below, 1.5 x 10 8Above 5.0×10 9 Below, 1.5×10 8 Above 4.5×10 9 Below, 1.5×10 8 Above 4.0×10 9 Below, 1.5×10 8 Above 3.8×10 9 Below, 3.5×10 8 Above 6.0×10 9 Below, 3.5×10 8 Above 5.0×10 9 Below, 3.5×10 8 Above 4.5×10 9 Below, 3.5×10 8 Above 4.0×10 9 Below, 3.5×10 8 Above 3.8×10 9 Below, 6.0×10 8 Above 6.0×10 9 Below, 6.0×10 8 Above 5.0×10 9 Below, 6.0×10 8 Above 4.5×10 9 Below, 6.0×10 8 Above 4.0×10 9 Below, 6.0×10 8 Above 3.8×10 9 Below, 9.5×10 8 Above 6.0×10 9 Below, 9.5×10 8 Above 5.0×10 9 Below, 9.5×10 8 Above 4.5×10 9 Below, 9.5×10 8 Above 4.0×10 9 Below, 9.5×10 8 Above 3.8×10 9 Below, 1.0×10 9 Above 6.0×10 9 Below, 1.0×10 9 Above 5.0×10 9 Below, 1.0×10 9 Above 4.5×10 9 Below, 1.0×10 9 Above 4.0×10 9 Below, 1.0×10 9 Above 3.8×109 Below, 1.x10 9 Over 6.0 x 10 9 Below, 1.x10 9 Over 5.0 x 10 9 Below, 1.x10 9 Over 4.5 x 10 9 Below, 1.x10 9 Over 4.0 x 10 9 Below, 1.x10 9 Over 3.8 x 10 9 Below, 1.2 x 10 9 Over 6.0 x 10 9 Below, 1.2 x 10 9 Over 5.0 x 10 9 Below, 1.2 x 10 9 Over 4.5 x 10 9 Below, 1.2 x 10 9 Over 4.0 x 10 9 Below, 1.2 x 10 9 Over 3.8 x 10 9 Below, 1.5 x 10 9 Over 6.0 x 10 9 Below, 1.5 x 10 9 Over 5.0 x 10 9 Below, 1.5 x 10 9 Over 4.5 x 10 9 Below, 1.5 x 10 9 Over 4.0 x 10 9 or less or 1.5 x 10 9 Over 3.8 x 10 9 It may contain the following copies:
[0081] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the A9 primer set at, for example, 5.2 × 10 per mL of the composition. 5 Copy or more, 1.5 x 10 6 Copy or more, 3.5 x 10 6 Copy or more, 6.0 x 10 6 Copy or more, 9.5 x 10 6 Copy or more, 1.0 x 10 7 Copy or more, 1.0 x 10 7 Copy or more, 1.2 x 10 7 Copy or more or 1.5 x 107 May contain more than 6.0 x 10 copies 7 Copy and below, 5.0 x 10 7 Copy or less, 4.5 x 10 7 Copy and below, 4.0 x 10 7 Copy or less or 3.8 x 10 7 In this case, these lower and upper limits may be arbitrarily combined, and the composition may contain, for example, 5.2 × 10 copies of the DNA fragment amplified by the A9 primer set. 5 Over 6.0 x 10 7 Below, 5.2 x 10 5 Over 5.0 x 10 7 Below, 5.2 x 10 5 Over 4.5 x 10 7 Below, 5.2 x 10 5 Over 4.0 x 10 7 Below, 5.2 x 10 5 Over 3.8 x 10 7 Below, 1.5 x 10 6 Over 6.0 x 10 7 Below, 1.5 x 10 6 Over 5.0 x 10 7 Below, 1.5 x 10 6 Over 4.5 x 10 7 Below, 1.5 x 10 6 Over 4.0 x 10 7 Below, 1.5 x 10 6 Over 3.8 x 10 7 Below, 3.5 x 10 6 Over 6.0 x 10 7 Below, 3.5 x 10 6 Over 5.0 x 10 7 Below, 3.5 x 10 6 Over 4.5 x 10 7 Below, 3.5 x 10 6 Over 4.0 x 10 7 Below, 3.5 x 10 6 Over 3.8 x 10 7 Below, 6.0 x 10 6 Over 6.0 x 10 7 Below, 6.0 x 10 6 Over 5.0 x 10 7 Below, 6.0 x 10 6 Over 4.5 x 10 7 Below, 6.0 x 106 Above 4.0×10 7 Below, 6.0×10 6 Above 3.8×10 7 Below, 9.5×10 6 Above 6.0×10 7 Below, 9.5×10 6 Above 5.0×10 7 Below, 9.5×10 6 Above 4.5×10 7 Below, 9.5×10 6 Above 4.0×10 7 Below, 9.5×10 6 Above 3.8×10 7 Below, 1.0×10 7 Above 6.0×10 7 Below, 1.0×10 7 Above 5.0×10 7 Below, 1.0×10 7 Above 4.5×10 7 Below, 1.0×10 7 Above 4.0×10 7 Below, 1.0×10 7 Above 3.8×10 7 Below, 1.0×10 7 Above 6.0×10 7 Below, 1.0×10 7 Above 5.0×10 7 Below, 1.0×10 7 Above 4.5×10 7 Below, 1.0×10 7 Above 4.0×10 7 Below, 1.0×10 7 Above 3.8×10 7 Below, 1.2×10 7 Above 6.0×10 7 Below, 1.2×10 7 Above 5.0×10 7 Below, 1.2×10 7 Above 4.5×10 7 Below, 1.2×10 7 Above 4.0×10 7 Below, 1.2×10 7 Above 3.8×10 7 Below, 1.5×10 7 Above 6.0×10 7 Below, 1.5×10 7Over 5.0 x 10 7 Below, 1.5 x 10 7 Over 4.5 x 10 7 Below, 1.5 x 10 7 Over 4.0 x 10 7 or less or 1.5 x 10 7 Over 3.8 x 10 7 It may contain the following copies:
[0082] The predetermined primer set may be, for example, a primer set consisting of the following forward and reverse primers (hereinafter also referred to as a "V3 primer set"). The V3 primer set is a pair of primers that amplify the 16S conserved region V3 of prokaryotes. In the following forward primers, W means A or T, and N means A, C, G, or T. Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6)
[0083] In one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 5.0 × 10 copies or more, 2.0 × 10 copies or more, 2 Copy or more, 2.4 x 10 2 Copy or more, 2.6 x 10 2 Copy or more, 4.0 x 10 2 Copy or more, 6.0 x 10 2 Copy or more, 1.0 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more, 3.0 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 2.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.0 x 10 7 Copy or more, 3.0 x 10 7 Copy or more, 8.5 x 10 7 Copy or more, 1.2 x 10 8 Copy or more, 1.5 x 10 8Copy or more, 1.8 x 10 8 Copy or more, 3.0 x 10 8 Copy or more, 1.0 x 10 9 Copy or more, 1.12 x 10 9 Copy or more, 1.2 x 10 9 Copy or more, 1.3 x 10 9 Copy or more, 1.4 x 10 9 Copy or more, 1.4 x 10 9 Copy or more or 1.5 x 10 9 May contain more than 2.0 x 10 copies 9 Copy or less, 1.6 x 10 9 Copy and below, 2.0 x 10 8 Copy or less, 1.9 x 10 8 Copy or less, 1.5 x 10 8 Copy or less or 1.3 x 10 8 These lower and upper limits may be combined in any combination, and in one aspect of this embodiment, the composition may contain, for example, 5.0 × 10 copies of the DNA fragment amplified by the V3 primer set. 1 Over 2.0 x 10 9 Below, 5.0 x 10 1 Over 1.6 x 10 9 Below, 5.0 x 10 1 Over 2.0 x 10 8 Below, 5.0 x 10 1 Over 1.9 x 10 8 Below, 5.0 x 10 1 Over 1.5 x 10 8 Below, 5.0 x 10 1 Over 1.3 x 10 8 Below, 2.0 x 10 2 Over 2.0 x 10 9 Below, 2.0 x 10 2 Over 1.6 x 10 9 Below, 2.0 x 10 2 Over 2.0 x 10 8 Below, 2.0 x 10 2 Over 1.9 x 10 8 Below, 2.0 x 10 2 Over 1.5 x 10 8 Below, 2.0 x 10 2 Over 1.3 x 10 8 Below, 2.4 x 102 Above 2.0×10 9 Below, 2.4×10 2 Above 1.6×10 9 Below, 2.4×10 2 Above 2.0×10 8 Below, 2.4×10 2 Above 1.9×10 8 Below, 2.4×10 2 Above 1.5×10 8 Below, 2.4×10 2 Above 1.3×10 8 Below, 2.6×10 2 Above 2.0×10 9 Below, 2.6×10 2 Above 1.6×10 9 Below, 2.6×10 2 Above 2.0×10 8 Below, 2.6×10 2 Above 1.9×10 8 Below, 2.6×10 2 Above 1.5×10 8 Below, 2.6×10 2 Above 1.3×10 8 Below, 4.0×10 2 Above 2.0×10 9 Below, 4.0×10 2 Above 1.6×10 9 Below, 4.0×10 2 Above 2.0×10 8 Below, 4.0×10 2 Above 1.9×10 8 Below, 4.0×10 2 Above 1.5×10 8 Below, 4.0×10 2 Above 1.3×10 8 Below, 6.0×10 2 Above 2.0×10 9 Below, 6.0×10 2 Above 1.6×10 9 Below, 6.0×10 2 Above 2.0×10 8 Below, 6.0×10 2 Above 1.9×10 8 Below, 6.0×10 2 Above 1.5×10 8 Below, 6.0×10 2Above 1.3×10 8 Below, 1.0×10 3 Above 2.0×10 9 Below, 1.0×10 3 Above 1.6×10 9 Below, 1.0×10 3 Above 2.0×10 8 Below, 1.0×10 3 Above 1.9×10 8 Below, 1.0×10 3 Above 1.5×10 8 Below, 1.0×10 3 Above 1.3×10 8 Below, 3.0×10 3 Above 2.0×10 9 Below, 3.0×10 3 Above 1.6×10 9 Below, 3.0×10 3 Above 2.0×10 8 Below, 3.0×10 3 Above 1.9×10 8 Below, 3.0×10 3 Above 1.5×10 8 Below, 3.0×10 3 Above 1.3×10 8 Below, 1.0×10 4 Above 2.0×10 9 Below, 1.0×10 4 Above 1.6×10 9 Below, 1.0×10 4 Above 2.0×10 8 Below, 1.0×10 4 Above 1.9×10 8 Below, 1.0×10 4 Above 1.5×10 8 Below, 1.0×10 4 Above 1.3×10 8 Below, 3.0×10 4 Above 2.0×10 9 Below, 3.0×10 4 Above 1.6×10 9 Below, 3.0×10 4 Above 2.0×10 8 Below, 3.0×10 4 Above 1.9×10 8 Below, 3.0×10 4 Above 1.5×108 Below, 3.0×10 4 Above 1.3×10 8 Below, 1.0×10 5 Above 2.0×10 9 Below, 1.0×10 5 Above 1.6×10 9 Below, 1.0×10 5 Above 2.0×10 8 Below, 1.0×10 5 Above 1.9×10 8 Below, 1.0×10 5 Above 1.5×10 8 Below, 1.0×10 5 Above 1.3×10 8 Below, 2.5×10 6 Above 2.0×10 9 Below, 2.5×10 6 Above 1.6×10 9 Below, 2.5×10 6 Above 2.0×10 8 Below, 2.5×10 6 Above 1.9×10 8 Below, 2.5×10 6 Above 1.5×10 8 Below, 2.5×10 6 Above 1.3×10 8 Below, 5.0×10 6 Above 2.0×10 9 Below, 5.0×10 6 Above 1.6×10 9 Below, 5.0×10 6 Above 2.0×10 8 Below, 5.0×10 6 Above 1.9×10 8 Below, 5.0×10 6 Above 1.5×10 8 Below, 5.0×10 6 Above 1.3×10 8 Below, 1.0×10 7 Above 2.0×10 9 Below, 1.0×10 7 Above 1.6×10 9 Below, 1.0×10 7 Above 2.0×10 8 Below, 1.0×10 7 Above 1.9×10 8Below, 1.0×10 7 Above 1.5×10 8 Below, 1.0×10 7 Above 1.3×10 8 Below, 3.0×10 7 Above 2.0×10 9 Below, 3.0×10 7 Above 1.6×10 9 Below, 3.0×10 7 Above 2.0×10 8 Below, 3.0×10 7 Above 1.9×10 8 Below, 3.0×10 7 Above 1.5×10 8 Below, 3.0×10 7 Above 1.3×10 8 Below, 8.5×10 7 Above 2.0×10 9 Below, 8.5×10 7 Above 1.6×10 9 Below, 8.5×10 7 Above 2.0×10 8 Below, 8.5×10 7 Above 1.9×10 8 Below, 8.5×10 7 Above 1.5×10 8 Below, 8.5×10 7 Above 1.3×10 8 Below, 1.2×10 8 Above 2.0×10 9 Below, 1.2×10 8 Above 1.6×10 9 Below, 1.2×10 8 Above 2.0×10 8 Below, 1.2×10 8 Above 1.9×10 8 Below, 1.2×10 8 Above 1.5×10 8 Below, 1.2×10 8 Above 1.3×10 8 Below, 1.5×10 8 Above 2.0×10 9 Below, 1.5×10 8 Above 1.6×10 9 Below, 1.5×10 8 Above 2.0×10 8 Below, 1.5×108 Over 1.9 x 10 8 Below, 1.5 x 10 8 Over 1.3 x 10 8 Below, 1.8 x 10 8 Over 2.0 x 10 9 Below, 1.8 x 10 8 Over 1.6 x 10 9 Below, 1.8 x 10 8 Over 2.0 x 10 8 Below, 1.8 x 10 8 Over 1.9 x 10 8 Below, 3.0 x 10 8 Over 2.0 x 10 9 Below, 3.0 x 10 8 Over 1.6 x 10 9 Below, 3.0 x 10 8 Over 2.0 x 10 8 Below, 3.0 x 10 8 Over 1.9 x 10 8 Below, 1.0 x 10 9 Over 2.0 x 10 9 Below, 1.0 x 10 9 Over 1.6 x 10 9 Below, 1.12 x 10 9 Over 2.0 x 10 9 Below, 1.12 x 10 9 Over 1.6 x 10 9 Below, 1.2 x 10 9 Over 2.0 x 10 9 Below, 1.2 x 10 9 Over 1.6 x 10 9 Below, 1.3 x 10 9 Over 2.0 x 10 9 Below, 1.3 x 10 9 Over 1.6 x 10 9 Below, 1.4 x 10 9 Over 2.0 x 10 9 Below, 1.4 x 10 9 Over 1.6 x 10 9 Below, 1.4 x 10 9 Over 2.0 x 10 9 Below, 1.4 x 10 9 Over 1.6 x 10 9 Below, 1.5 x 10 9 Over 2.0 x 10 9 or less or 1.5 x 10 9Over 1.6 x 10 9 It may contain the following copies:
[0084] In one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set at a concentration of, for example, 2.5 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 1.2 x 10 5 Copy or more, 1.3 x 10 5 Copy or more, 2.0 x 10 5 Copy or more, 3.0 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.5 x 10 7 Copy or more, 5.0 x 10 7 Copy or more, 1.2 x 10 9 Copy or more, 2.5 x 10 9 Copy or more, 5.0 x 10 9 Copy or more, 1.5 x 10 10 Copy or more, 4.2 x 10 10 Copy or more, 6.0 x 10 10 Copy or more, 7.5 x 10 10 Copy or more, 9.0 x 10 10 Copy or more, 1.5 x 10 11 Copy or more, 5.0 x 10 11 Copy or more, 5.6 x 10 11 Copy or more, 6.0 x 10 11 Copy or more, 6.5 x 10 11 Copy or more, 7.0 x 10 11 Copy or more, 7.2 x 10 11 Copy or more or 7.5 x 10 11 May contain more than 1.0 x 10 copies 12 Copy and below, 8.0 x 10 11 Copy and below, 1.0 x 10 11 Copy and below, 9.3 x 10 10 Copy or less, 7.5 x 10 10 Copy or less or 6.5 x 10 10These lower and upper limits may be combined in any combination, and in one aspect of this embodiment, the composition may contain, for example, 2.5 × 10 copies or less of the DNA fragment amplified by the V3 primer set per mg of bacteria. 4 Over 1.0 x 10 12 Below, 2.5 x 10 4 Over 8.0 x 10 11 Below, 2.5 x 10 4 Over 1.0 x 10 11 Below, 2.5 x 10 4 Over 9.3 x 10 10 Below, 2.5 x 10 4 Over 7.5 x 10 10 Below, 2.5 x 10 4 Over 6.5 x 10 10 Below, 1.0 x 10 5 Over 1.0 x 10 12 Below, 1.0 x 10 5 Over 8.0 x 10 11 Below, 1.0 x 10 5 Over 1.0 x 10 11 Below, 1.0 x 10 5 Over 9.3 x 10 10 Below, 1.0 x 10 5 Over 7.5 x 10 10 Below, 1.0 x 10 5 Over 6.5 x 10 10 Below, 1.2 x 10 5 Over 1.0 x 10 12 Below, 1.2 x 10 5 Over 8.0 x 10 11 Below, 1.2 x 10 5 Over 1.0 x 10 11 Below, 1.2 x 10 5 Over 9.3 x 10 10 Below, 1.2 x 10 5 Over 7.5 x 10 10 Below, 1.2 x 10 5 Over 6.5 x 10 10 Below, 1.3 x 10 5 Over 1.0 x 10 12 Below, 1.3 x 10 5 Over 8.0 x 10 11 Below, 1.3 x 10 5 Over 1.0 x 10 11Below, 1.3×10 5 Above 9.3×10 10 Below, 1.3×10 5 Above 7.5×10 10 Below, 1.3×10 5 Above 6.5×10 10 Below, 2.0×10 5 Above 1.0×10 12 Below, 2.0×10 5 Above 8.0×10 11 Below, 2.0×10 5 Above 1.0×10 11 Below, 2.0×10 5 Above 9.3×10 10 Below, 2.0×10 5 Above 7.5×10 10 Below, 2.0×10 5 Above 6.5×10 10 Below, 3.0×10 5 Above 1.0×10 12 Below, 3.0×10 5 Above 8.0×10 11 Below, 3.0×10 5 Above 1.0×10 11 Below, 3.0×10 5 Above 9.3×10 10 Below, 3.0×10 5 Above 7.5×10 10 Below, 3.0×10 5 Above 6.5×10 10 Below, 5.0×10 5 Above 1.0×10 12 Below, 5.0×10 5 Above 8.0×10 11 Below, 5.0×10 5 Above 1.0×10 11 Below, 5.0×10 5 Above 9.3×10 10 Below, 5.0×10 5 Above 7.5×10 10 Below, 5.0×10 5 Above 6.5×10 10 Below, 1.5×10 6 Above 1.0×10 12 Below, 1.5×10 6 Above 8.0×10 11 Below, 1.5×106 Above 1.0×10 11 Below, 1.5×10 6 Above 9.3×10 10 Below, 1.5×10 6 Above 7.5×10 10 Below, 1.5×10 6 Above 6.5×10 10 Below, 5.0×10 6 Above 1.0×10 12 Below, 5.0×10 6 Above 8.0×10 11 Below, 5.0×10 6 Above 1.0×10 11 Below, 5.0×10 6 Above 9.3×10 10 Below, 5.0×10 6 Above 7.5×10 10 Below, 5.0×10 6 Above 6.5×10 10 Below, 1.5×10 7 Above 1.0×10 12 Below, 1.5×10 7 Above 8.0×10 11 Below, 1.5×10 7 Above 1.0×10 11 Below, 1.5×10 7 Above 9.3×10 10 Below, 1.5×10 7 Above 7.5×10 10 Below, 1.5×10 7 Above 6.5×10 10 Below, 5.0×10 7 Above 1.0×10 12 Below, 5.0×10 7 Above 8.0×10 11 Below, 5.0×10 7 Above 1.0×10 11 Below, 5.0×10 7 Above 9.3×10 10 Below, 5.0×10 7 Above 7.5×10 10 Below, 5.0×10 7 Above 6.5×10 10 Below, 1.2×10 9 Above 1.0×10 12 Below, 1.2×10 9Above 8.0×10 11 Below, 1.2×10 9 Above 1.0×10 11 Below, 1.2×10 9 Above 9.3×10 10 Below, 1.2×10 9 Above 7.5×10 10 Below, 1.2×10 9 Above 6.5×10 10 Below, 2.5×10 9 Above 1.0×10 12 Below, 2.5×10 9 Above 8.0×10 11 Below, 2.5×10 9 Above 1.0×10 11 Below, 2.5×10 9 Above 9.3×10 10 Below, 2.5×10 9 Above 7.5×10 10 Below, 2.5×10 9 Above 6.5×10 10 Below, 5.0×10 9 Above 1.0×10 12 Below, 5.0×10 9 Above 8.0×10 11 Below, 5.0×10 9 Above 1.0×10 11 Below, 5.0×10 9 Above 9.3×10 10 Below, 5.0×10 9 Above 7.5×10 10 Below, 5.0×10 9 Above 6.5×10 10 Below, 1.5×10 10 Above 1.0×10 12 Below, 1.5×10 10 Above 8.0×10 11 Below, 1.5×10 10 Above 1.0×10 11 Below, 1.5×10 10 Above 9.3×10 10 Below, 1.5×10 10 Above 7.5×10 10 Below, 1.5×10 10 Above 6.5×10 10 Below, 4.2×10 10 Above 1.0×1012 Below, 4.2×10 10 Above 8.0×10 11 Below, 4.2×10 10 Above 1.0×10 11 Below, 4.2×10 10 Above 9.3×10 10 Below, 4.2×10 10 Above 7.5×10 10 Below, 4.2×10 10 Above 6.5×10 10 Below, 6.0×10 10 Above 1.0×10 12 Below, 6.0×10 10 Above 8.0×10 11 Below, 6.0×10 10 Above 1.0×10 11 Below, 6.0×10 10 Above 9.3×10 10 Below, 6.0×10 10 Above 7.5×10 10 Below, 6.0×10 10 Above 6.5×10 10 Below, 7.5×10 10 Above 1.0×10 12 Below, 7.5×10 10 Above 8.0×10 11 Below, 7.5×10 10 Above 1.0×10 11 Below, 7.5×10 10 Above 9.3×10 10 Below, 7.5×10 10 Above 6.5×10 10 Below, 9.0×10 10 Above 1.0×10 12 Below, 9.0×10 10 Above 8.0×10 11 Below, 9.0×10 10 Above 1.0×10 11 Below, 9.0×10 10 Above 9.3×10 10 Below, 1.5×10 11 Above 1.0×10 12 Below, 1.5×10 11 Above 8.0×10 11 Below, 1.5×10 11 Above 1.0×10 11Below, 1.5 x 10 11 Over 9.3 x 10 10 Below, 5.0 x 10 11 Over 1.0 x 10 12 Below, 5.0 x 10 11 Over 8.0 x 10 11 Below, 5.6 x 10 11 Over 1.0 x 10 12 Below, 5.6 x 10 11 Over 8.0 x 10 11 Below, 6.0 x 10 11 Over 1.0 x 10 12 Below, 6.0 x 10 11 Over 8.0 x 10 11 Below, 6.5 x 10 11 Over 1.0 x 10 12 Below, 6.5 x 10 11 Over 8.0 x 10 11 Below, 7.0 x 10 11 Over 1.0 x 10 12 Below, 7.0 x 10 11 Over 8.0 x 10 11 Below, 7.2 x 10 11 Over 1.0 x 10 12 Below, 7.2 x 10 11 Over 8.0 x 10 11 Below, 7.5 x 10 11 Over 1.0 x 10 12 or less or 7.5 x 10 11 Over 8.0 x 10 11 It may contain the following copies:
[0085] In one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 2.5 × 10 2 Copy or more, 1.0 x 10 3 Copy or more, 1.2 x 10 3 Copy or more, 1.3 x 10 3 Copy or more, 2.0 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.5 x 10 4 Copy or more, 5.0 x 10 4 Copy or more, 1.5 x 10 5Copy or more, 5.0 x 10 5 Copy or more, 1.2 x 10 7 Copy or more, 2.5 x 10 7 Copy or more, 5.0 x 10 7 Copy or more, 1.5 x 10 8 Copy or more, 4.2 x 10 8 Copy or more, 6.0 x 10 8 Copy or more, 7.5 x 10 8 Copy or more, 9.0 x 10 8 Copy or more, 1.5 x 10 9 Copy or more, 5.0 x 10 9 Copy or more, 5.6 x 10 9 Copy or more, 6.0 x 10 9 Copy or more, 6.5 x 10 9 Copy or more, 7.0 x 10 9 Copy or more, 7.2 x 10 9 Copy or more or 7.5 x 10 9 May contain more than 1.0 x 10 copies 10 Copy and below, 8.0 x 10 9 Copy and below, 1.0 x 10 9 Copy and below, 9.3 x 10 8 Copy or less, 7.5 x 10 8 Copy or less or 6.5 x 10 8 These lower and upper limits may be combined in any combination, and in one aspect of this embodiment, the composition may contain, for example, 2.5 × 10 copies or less of the DNA fragment amplified by the V3 primer set per mL of the composition. 2 Over 1.0 x 10 10 Below, 2.5 x 10 2 Over 8.0 x 10 9 Below, 2.5 x 10 2 Over 1.0 x 10 9 Below, 2.5 x 10 2 Over 9.3 x 10 8 Below, 2.5 x 10 2 Over 7.5 x 10 8 Below, 2.5 x 10 2 Over 6.5 x 10 8 Below, 1.0 x 10 3 Over 1.0 x 10 10 Below, 1.0 x 10 3Above 8.0×10 9 Below, 1.0×10 3 Above 1.0×10 9 Below, 1.0×10 3 Above 9.3×10 8 Below, 1.0×10 3 Above 7.5×10 8 Below, 1.0×10 3 Above 6.5×10 8 Below, 1.2×10 3 Above 1.0×10 10 Below, 1.2×10 3 Above 8.0×10 9 Below, 1.2×10 3 Above 1.0×10 9 Below, 1.2×10 3 Above 9.3×10 8 Below, 1.2×10 3 Above 7.5×10 8 Below, 1.2×10 3 Above 6.5×10 8 Below, 1.3×10 3 Above 1.0×10 10 Below, 1.3×10 3 Above 8.0×10 9 Below, 1.3×10 3 Above 1.0×10 9 Below, 1.3×10 3 Above 9.3×10 8 Below, 1.3×10 3 Above 7.5×10 8 Below, 1.3×10 3 Above 6.5×10 8 Below, 2.0×10 3 Above 1.0×10 10 Below, 2.0×10 3 Above 8.0×10 9 Below, 2.0×10 3 Above 1.0×10 9 Below, 2.0×10 3 Above 9.3×10 8 Below, 2.0×10 3 Above 7.5×10 8 Below, 2.0×10 3 Above 6.5×10 8 Below, 3.0×10 3 Above 1.0×1010 Below, 3.0×10 3 Above 8.0×10 9 Below, 3.0×10 3 Above 1.0×10 9 Below, 3.0×10 3 Above 9.3×10 8 Below, 3.0×10 3 Above 7.5×10 8 Below, 3.0×10 3 Above 6.5×10 8 Below, 5.0×10 3 Above 1.0×10 10 Below, 5.0×10 3 Above 8.0×10 9 Below, 5.0×10 3 Above 1.0×10 9 Below, 5.0×10 3 Above 9.3×10 8 Below, 5.0×10 3 Above 7.5×10 8 Below, 5.0×10 3 Above 6.5×10 8 Below, 1.5×10 4 Above 1.0×10 10 Below, 1.5×10 4 Above 8.0×10 9 Below, 1.5×10 4 Above 1.0×10 9 Below, 1.5×10 4 Above 9.3×10 8 Below, 1.5×10 4 Above 7.5×10 8 Below, 1.5×10 4 Above 6.5×10 8 Below, 5.0×10 4 Above 1.0×10 10 Below, 5.0×10 4 Above 8.0×10 9 Below, 5.0×10 4 Above 1.0×10 9 Below, 5.0×10 4 Above 9.3×10 8 Below, 5.0×10 4 Above 7.5×10 8 Below, 5.0×10 4 Above 6.5×10 8Below, 1.5×10 5 Above 1.0×10 10 Below, 1.5×10 5 Above 8.0×10 9 Below, 1.5×10 5 Above 1.0×10 9 Below, 1.5×10 5 Above 9.3×10 8 Below, 1.5×10 5 Above 7.5×10 8 Below, 1.5×10 5 Above 6.5×10 8 Below, 5.0×10 5 Above 1.0×10 10 Below, 5.0×10 5 Above 8.0×10 9 Below, 5.0×10 5 Above 1.0×10 9 Below, 5.0×10 5 Above 9.3×10 8 Below, 5.0×10 5 Above 7.5×10 8 Below, 5.0×10 5 Above 6.5×10 8 Below, 1.2×10 7 Above 1.0×10 10 Below, 1.2×10 7 Above 8.0×10 9 Below, 1.2×10 7 Above 1.0×10 9 Below, 1.2×10 7 Above 9.3×10 8 Below, 1.2×10 7 Above 7.5×10 8 Below, 1.2×10 7 Above 6.5×10 8 Below, 2.5×10 7 Above 1.0×10 10 Below, 2.5×10 7 Above 8.0×10 9 Below, 2.5×10 7 Above 1.0×10 9 Below, 2.5×10 7 Above 9.3×10 8 Below, 2.5×10 7 Above 7.5×10 8 Below, 2.5×107 Above 6.5×10 8 Below, 5.0×10 7 Above 1.0×10 10 Below, 5.0×10 7 Above 8.0×10 9 Below, 5.0×10 7 Above 1.0×10 9 Below, 5.0×10 7 Above 9.3×10 8 Below, 5.0×10 7 Above 7.5×10 8 Below, 5.0×10 7 Above 6.5×10 8 Below, 1.5×10 8 Above 1.0×10 10 Below, 1.5×10 8 Above 8.0×10 9 Below, 1.5×10 8 Above 1.0×10 9 Below, 1.5×10 8 Above 9.3×10 8 Below, 1.5×10 8 Above 7.5×10 8 Below, 1.5×10 8 Above 6.5×10 8 Below, 4.2×10 8 Above 1.0×10 10 Below, 4.2×10 8 Above 8.0×10 9 Below, 4.2×10 8 Above 1.0×10 9 Below, 4.2×10 8 Above 9.3×10 8 Below, 4.2×10 8 Above 7.5×10 8 Below, 4.2×10 8 Above 6.5×10 8 Below, 6.0×10 8 Above 1.0×10 10 Below, 6.0×10 8 Above 8.0×10 9 Below, 6.0×10 8 Above 1.0×10 9 Below, 6.0×10 8 Above 9.3×10 8 Below, 6.0×10 8Above 7.5×10 8 Below, 6.0×10 8 Above 6.5×10 8 Below, 7.5×10 8 Above 1.0×10 10 Below, 7.5×10 8 Above 8.0×10 9 Below, 7.5×10 8 Above 1.0×10 9 Below, 7.5×10 8 Above 9.3×10 8 Below, 7.5×10 8 Above 6.5×10 8 Below, 9.0×10 8 Above 1.0×10 10 Below, 9.0×10 8 Above 8.0×10 9 Below, 9.0×10 8 Above 1.0×10 9 Below, 9.0×10 8 Above 9.3×10 8 Below, 1.5×10 9 Above 1.0×10 10 Below, 1.5×10 9 Above 8.0×10 9 Below, 1.5×10 9 Above 1.0×10 9 Below, 1.5×10 9 Above 9.3×10 8 Below, 5.0×10 9 Above 1.0×10 10 Below, 5.0×10 9 Above 8.0×10 9 Below, 5.6×10 9 Above 1.0×10 10 Below, 5.6×10 9 Above 8.0×10 9 Below, 6.0×10 9 Above 1.0×10 10 Below, 6.0×10 9 Above 8.0×10 9 Below, 6.5×10 9 Above 1.0×10 10 Below, 6.5×10 9 Above 8.0×10 9 Below, 7.0×10 9 Above 1.0×1010 Below, 7.0 x 10 9 Over 8.0 x 10 9 Below, 7.2 x 10 9 Over 1.0 x 10 10 Below, 7.2 x 10 9 Over 8.0 x 10 9 Below, 7.5 x 10 9 Over 1.0 x 10 10 or less or 7.5 x 10 9 Over 8.0 x 10 9 It may contain the following copies:
[0086] In one aspect of this embodiment, the composition may contain 1.1-fold or more, 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 10.0-fold or more, 15.0-fold or more, 50.0-fold or more, 100-fold or more, 190-fold or more, 400-fold or more, 670-fold or more, 800-fold or more, 900-fold or more, 1200-fold or more, or 1500-fold or more copies of the DNA fragment amplified by the V3 primer set per mg of heat-treated bacteria relative to the copies of the DNA fragment amplified by the V3 primer set contained per mg of bacteria of the same strain heat-treated at 120°C for 30 minutes, or may contain 10,000-fold or less, 3,000-fold or less, 2,700-fold or less, 2,000-fold or less, 1,500-fold or less, 1,200-fold or less, or 1,000-fold or less copies. These lower and upper limits may be combined arbitrarily, and in one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set per mg of heat-treated bacteria at a concentration of, for example, 1.1 to 10,000 times, 1.1 to 3,000 times, 1.1 to 2,700 times, 1.1 to 2,000 times, 1.1 to 1,500 times, 1.1 to 1,200 times, 1.1 to 1,000 times, 1.2 to 10,000 times, 1.2 to 3,000 times, 1.2 to 2,700 times, 1.2 to 2,000 times, 1.2 to 1,500 times, 1.2 to 1,200 times, 1.1 to 1,000 times, 1.2 to 10,000 times, 1.2 to 3,000 times, 1.2 to 2,700 times, 1.2 to 2,000 times, 1.2 to 1,500 times, 1.2 to 1,200 times, 1.2 to 1,200 times, or 1.2 times or more. 1000x or less, 1.3x or more and 10000x or less, 1.3x or more and 3000x or less, 1.3x or more and 2700x or less, 1.3x or more and 2000x or less, 1.3x or more and 1500x or less, 1.3x or more 1200x or less, 1.3x or more and 1000x or less, 1.4x or more and 10000x or more, 1.4x or more and 3000x or less, 1.4x or more and 2700x or less, 1.4x or more and 2000x or less, 1.4x or more 1500x or less, 1.4x or more and 1200x or less, 1.4x or more and 1000x or less, 1.5x or more and 10000x or less, 1.5x or more and 3000x or less, 1.5x or more and 2700x or less, 1.5x or more 2000x or less, 1.5x or more and 1500x or less, 1.5x or more and 1200x or less, 1.5x or more and 1000x or less, 10.0x or more and 10000x or less, 10.0x or more and 3000x or less, 10.0 to 2700 times, 10.0 times to 2000 times, 10.0 times to 1500 times, 10.0 times to 1200 times, 10.0 times to 1000 times, 15.0 times to 10000 times, 15.0 times to 3000 times, 15.0 times to 2700 times, 15.0 times to 2000 times, 15.0 times to 1500 times, 15.0 times to 1200 times, 15.0 times to 1000 times, 50.0 times to 10000 times, 50.0 times to 3000 times, 50.0 times to 2700 times, 50.0 times to 2000 times, 50.0 times to 1500 times, 50.0 times to 1200 times, 50.0x to 1000x, 100x to 10000x, 100x to 3000x, 100x to 2700x, 100x to 2000x, 100x to 1500x, 100x to 120 0x or less, 100x or more and 1000x or less, 190x or more and 10000x or less, 190x or more and 3000x or less, 190x or more and 2700x or less, 190x or more and 2000x or less, 190x or more and 1500x or less, 19 0x to 1200x, 190x to 1000x, 400x to 10000x, 400x to 3000x, 400x to 2700x, 400x to 2000x, 400x to 150 0x or less, 400x or more and 1200x or less, 400x or more and 1000x or less, 670x or more and 10000x or less, 670x or more and 3000x or less, 670x or more and 2700x or less, 670x or more and 2000x or less, 67 0x to 1500x, 670x to 1200x, 670x to 1000x, 800x to 10000x, 800x to 3000x, 800x to 2700x, 800x to 200 0x or less, 800x or more and 1500x or less, 800x or more and 1200x or less, 800x or more and 1000x or less, 900x or more and 10000x or less, 900x or more and 3000x or less, 900x or more and 2700x or less, 90 It may be contained at a concentration of 0 to 2000 times, 900 to 1500 times, 900 to 1200 times, 900 to 1000 times, 1200 to 10000 times, 1200 to 3000 times, 1200 to 2700 times, 1200 to 2000 times, 1500 to 10000 times, 1500 to 3000 times, 1500 to 2700 times, or 1500 to 2000 times.
[0087] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the V3 primer set in a concentration of, for example, 2.0 × 10 2 Copy or more, 1.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 1.0 x 10 6 Copy or more, 2.5 x 10 6Copy or more, 1.0 x 10 6 Copy or more, 3.5 x 10 7 Copy or more, 7.0 x 10 7 Copy or more, 1.2 x 10 8 Copy or more, 1.8 x 10 8 Copy or more, 4.0 x 10 8 Copy or more, 1.0 x 10 9 Copy or more, 1.1 x 10 9 Copy or more, 1.2 x 10 9 Copy or more, 1.3 x 10 9 Copy or more, 1.4 x 10 9 Copy or more or 1.5 x 10 9 May contain more than 1.6 x 10 copies 9 Copy or less, 1.1 x 10 9 Copy and below, 7.0 x 10 8 Copy and below, 4.0 x 10 8 Copy below 2.0 x 10 8 Copy or less or 1.4 x 10 8 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.
[0088] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Lactococcus, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.0 × 10 per mg of bacteria of the genus Lactococcus. 5 Copy or more, 5.0 x 10 5 Copy or more, 5.0 x 10 6 Copy or more, 5.0 x 10 7 Copy or more, 5.0 x 10 8 Copy or more, 1.2 x 10 9 Copy or more, 5.0 x 10 8 Copy or more, 1.7 x 10 10 Copy or more, 3.5 x 10 10 Copy or more, 6.0 x 10 10 Copy or more, 9.0 x 10 10 Copy or more, 2.0 x 10 11 Copy or more, 5.0 x 10 11 Copy or more, 5.6 x 10 11 Copy or more, 6.0 x 10 11Copy or more, 6.5 x 10 11 Copy or more, 7.0 x 10 11 Copy or more or 7.5 x 10 11 May contain more than 8.0 x 10 copies 11 Copy or less, 5.5 x 10 11 Copy or less, 3.5 x 10 11 Copy and below, 2.0 x 10 11 Copy or less 1.0 x 10 11 Copy or less or 7.0 x 10 10 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.
[0089] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.0 × 10 per mL of the composition. 3 Copy or more, 5.0 x 10 3 Copy or more, 5.0 x 10 4 Copy or more, 5.0 x 10 5 Copy or more, 5.0 x 10 6 Copy or more, 1.2 x 10 7 Copy or more, 5.0 x 10 6 Copy or more, 1.7 x 10 8 Copy or more, 3.5 x 10 8 Copy or more, 6.0 x 10 8 Copy or more, 9.0 x 10 8 Copy or more, 2.0 x 10 9 Copy or more, 5.0 x 10 9 Copy or more, 5.6 x 10 9 Copy or more, 6.0 x 10 9 Copy or more, 6.5 x 10 9 Copy or more, 7.0 x 10 9 Copy or more or 7.5 x 10 9 May contain more than 8.0 x 10 copies 9 Copy or less, 5.5 x 10 9 Copy or less, 3.5 x 10 9 Copy and below, 2.0 x 10 9 Copy or less 1.0 x 10 9 Copy or less or 7.0 x 10 8The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.
[0090] In one aspect of this embodiment, when the heat-treated bacteria include Weissella sp., the composition contains a DNA fragment amplified by the V3 primer set in a volume of, for example, 2.5 × 10 2 Copy or more, 4.0 x 10 2 Copy or more, 5.0 x 10 2 Copy or more or 6.0 x 10 2 May contain more than 6.0 x 10 copies 5 Copy and below, 4.0 x 10 5 Copy or less, 2.2 x 10 5 Copy and below, 1.0 x 10 5 Copy and below, 6.0 x 10 4 Copy or less or 3.0 x 10 4 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.
[0091] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Weissella, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.2 × 10 per mg of bacteria of the genus Weissella. 5 Copy or more, 2.0 x 10 5 Copy or more, 2.5 x 10 5 Copy or more or 3.0 x 10 5 May contain more than 3.0 x 10 copies 8 Copy and below, 2.0 x 10 8 Copy or less, 1.1 x 10 8 Copy and below, 5.0 x 10 7 Copy and below, 3.0 x 10 7 Copy or less or 1.5 x 10 7 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.
[0092] In one aspect of this embodiment, when the heat-treated bacteria include Weissella sp., the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.2 × 10 per mL of the composition. 3 Copy or more, 2.0 x 103 Copy or more, 2.5 x 10 3 Copy or more or 3.0 x 10 3 May contain more than 3.0 x 10 copies 6 Copy and below, 2.0 x 10 6 Copy or less, 1.1 x 10 6 Copy and below, 5.0 x 10 5 Copy and below, 3.0 x 10 5 Copy or less or 1.5 x 10 5 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.
[0093] In one aspect of this embodiment, when the heat-treated bacteria include Bifidobacterium, the composition contains, for example, 1.5 × 10 2 Copy or more, 2.0 x 10 2 Copy or more, 2.5 x 10 2 Copy or more, 3.0 x 10 2 Copy or more, 1.0 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more or 1.5 x 10 4 May contain more than 2.0 x 10 copies 6 Copy or less, 1.1 x 10 6 Copy and below, 8.0 x 10 5 Copy and below, 6.0 x 10 5 Copy or less or 4.5 x 10 5 The lower limit and upper limit may be arbitrarily combined.
[0094] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Bifidobacterium, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 7.5 × 10 per mg of bacteria of the genus Bifidobacterium. 4 Copy or more, 1.0 x 10 5 Copy or more, 1.2 x 10 5 Copy or more, 1.5 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.5 x 106 Copy or more, 5.0 x 10 6 Copy or more or 7.5 x 10 6 May contain more than 1.0 x 10 copies 9 Copy or less, 5.5 x 10 8 Copy and below, 4.0 x 10 8 Copy and below, 3.0 x 10 8 Copy or less or 2.3 x 10 8 The lower limit and upper limit may be arbitrarily combined.
[0095] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Bifidobacterium, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 7.5 × 10 per mL of the composition. 2 Copy or more, 1.0 x 10 3 Copy or more, 1.2 x 10 3 Copy or more, 1.5 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.5 x 10 4 Copy or more, 5.0 x 10 4 Copy or more or 7.5 x 10 4 May contain more than 1.0 x 10 copies 7 Copy or less, 5.5 x 10 6 Copy and below, 4.0 x 10 6 Copy and below, 3.0 x 10 6 Copy or less or 2.3 x 10 6 The lower limit and upper limit may be arbitrarily combined.
[0096] In one aspect of this embodiment, when the heat-treated bacteria include Lactobacillus bacteria, the composition contains a DNA fragment amplified by the V3 primer set in a volume of, for example, 3.0 × 10 2 Copy or more, 4.0 x 10 2 Copy or more, 5.0 x 10 2 Copy or more, 5.9 x 10 2 Copy or more, 6.0 x 10 2 Copy or more, 1.0 x 10 3 Copy or more, 2.5 x 10 3Copy or more, 5.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more, 3.0 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 3.0 x 10 5 Copy or more, 1.0 x 10 6 Copy or more, 3.0 x 10 6 Copy or more or 1.0 x 10 7 May contain more than 2.0 x 10 copies 7 Copy or less, 1.5 x 10 7 Copy or less, 1.1 x 10 7 Copy and below, 8.0 x 10 6 Copy and below, 2.0 x 10 6 Copy and below, 6.0 x 10 5 Copy or less or 3.2 x 10 5 The lower limit and upper limit may be arbitrarily combined.
[0097] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Lactobacillus, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.5 × 10 per mg of bacteria of the genus Lactobacillus. 5 Copy or more, 2.0 x 10 5 Copy or more, 2.5 x 10 5 Copy or more, 2.9 x 10 5 Copy or more, 3.0 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.2 x 10 6 Copy or more, 2.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.5 x 10 7 Copy or more, 5.0 x 10 7 Copy or more, 1.5 x 10 8 Copy or more, 5.0 x 10 8 Copy or more, 1.5 x 10 9 Copy or more or 5.0 x 10 9 May contain more than 1.0 x 10 copies 10 Copy or less, 7.5 x 10 9 Copy or less, 5.5 x 10 9Copy and below, 4.0 x 10 9 Copy and below, 1.0 x 10 9 Copy and below, 3.0 x 10 8 Copy or less or 1.6 x 10 8 The lower limit and upper limit may be arbitrarily combined.
[0098] In one aspect of this embodiment, when the heat-treated bacteria include Lactobacillus bacteria, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.5 × 10 per mL of the composition. 3 Copy or more, 2.0 x 10 3 Copy or more, 2.5 x 10 3 Copy or more, 2.9 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.2 x 10 4 Copy or more, 2.5 x 10 4 Copy or more, 5.0 x 10 4 Copy or more, 1.5 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.5 x 10 7 Copy or more or 5.0 x 10 7 May contain more than 1.0 x 10 copies 8 Copy or less, 7.5 x 10 7 Copy or less, 5.5 x 10 7 Copy and below, 4.0 x 10 7 Copy and below, 1.0 x 10 7 Copy and below, 3.0 x 10 6 Copy or less or 1.6 x 10 6 The lower limit and upper limit may be arbitrarily combined.
[0099] The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment may be ingested or administered once or multiple times, and if sustained immunostimulation is desired, it is preferably ingested or administered continuously or intermittently over a certain period of time. The food composition of one embodiment may be ingested, for example, 1 to 5 times a day, once every 2 days, once every 3 days, once every 4 days, or once a week for at least 1 week, 2 weeks or more, 1 month or more, 3 months or more, 6 months or more, 1 year or more, 3 years or more, 5 years or more, or 10 years or more.
[0100] The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment may contain the bacterium of this embodiment as an active ingredient. The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment may contain an effective amount of the bacterium of this embodiment.
[0101] The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment can be ingested or administered to a subject in need of immunostimulation. The subject in need of immunostimulation is not particularly limited, but examples include subjects infected with a virus, subjects with a cold, and subjects aged 65 or older.
[0102] Examples of food compositions of this embodiment include immunostimulating health foods, functional foods, nutritional compositions, dietary supplements, supplements, health foods, foods for specified health uses, foods with nutrient functions, and foods with functional claims. Such food compositions can be labeled, for example, as those that support the maintenance of immune function in healthy people (immune care), those concerned about a decline in immune function, those that suppress a decline in immune function, those concerned about sunburn, those concerned about skin damage in daily life, those concerned about dry skin, those concerned about hot flashes, those concerned about erythema, those concerned about redness of the skin, those concerned about rosy faces, and those concerned about rough hands.
[0103] The food composition of this embodiment may be in any form, such as solid, semi-solid, liquid, paste, jelly, etc. Examples of food compositions include, but are not limited to, beverages such as lactic acid bacteria drinks, yogurt drinks, carbonated drinks, coffee, juice, tea drinks, and dairy drinks; alcoholic beverages such as beer, sake, Western liquor, and fruit wine; confectioneries such as chocolate, donuts, pies, cream puffs, gum, jelly, candy, cookies, cakes, puddings, daifuku (rice cakes), mochi (rice cakes), manju (buns), castella cakes, anmitsu (sweet bean paste), and yokan (sweet bean jelly); frozen desserts such as ice cream, popsicles, and sherbet; cooked foods such as retort pouch foods; seasonings such as dressings, mayonnaise, furikake (rice seasonings), umami seasonings, and soup bases; and fermented milk (yogurt). In the case of a food composition such as a nutritional supplement, supplement, etc., it may be in the form of, for example, a tablet (including plain tablets, sugar-coated tablets, effervescent tablets, film-coated tablets, chewable tablets, troches, etc.), capsule, pill, powder (pulverized medicine), fine granules, granules, liquid, suspension, emulsion, syrup, paste, etc.
[0104] In addition to the bacteria of this embodiment, the food composition of this embodiment may contain other food-acceptable ingredients, such as at least one selected from the group consisting of sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, colorings, flavorings, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, colorings, preservatives, sustained-release regulators, surfactants, solubilizers, humectants, and water quality conditioners. One aspect of the food composition can be produced using the bacteria of this embodiment as a raw material according to a method typically selected by those skilled in the art depending on the form of the food composition. For example, a food composition can be obtained by mixing an effective amount of the bacteria of this embodiment with an intermediate product or a final product during the production process. The bacteria of this embodiment may be obtained according to the production method of the second embodiment described below. Furthermore, the food composition of this embodiment also includes bacteria produced during the production process of the food composition.
[0105] The pharmaceutical composition of this embodiment can be formulated as an oral or parenteral preparation and provided as a pharmaceutical or quasi-drug. Oral preparations include granules, powders, tablets (including sugar-coated tablets), pills, capsules, syrups, liquids, jellies, emulsions, and suspensions. Parenteral preparations include injections suitable for local administration (including intradermal, subcutaneous, intramuscular, and intravenous injections), inhalants (e.g., inhalation aerosols, inhalation powders, and inhalation liquids), nasal drops (e.g., nasal powders and nasal liquids), ointments, creams, gels, suppositories, patches, and poultices. These preparations can be formulated using the bacteria of this embodiment and a pharmaceutically acceptable carrier using techniques commonly used in the art. Pharmaceutically acceptable carriers include excipients, binders, diluents, additives, flavorings, buffers, thickeners, colorants, stabilizers, emulsifiers, dispersants, suspending agents, and preservatives. The bacteria according to this embodiment can be obtained according to the manufacturing method of the second embodiment described below, and the pharmaceutical composition of this embodiment also includes bacteria according to this embodiment produced during the manufacturing process of the pharmaceutical composition.
[0106] Examples of diseases for which the pharmaceutical composition of this embodiment can be administered include cancers already known to be treated with type I interferon, including renal cancer, multiple myeloma, chronic myeloid leukemia, hairy cell leukemia, glioblastoma, medulloblastoma, astrocytoma, malignant melanoma, mycosis fungoides, and adult T-cell leukemia; viral infections including subacute sclerosing panencephalitis, HTLV-1 myelopathy, hepatitis B, and hepatitis C; bacterial infections such as chlamydia (sexually transmitted diseases), mycobacterium (tuberculosis), listeria (sepsis, etc.), staphylococcus (food poisoning), and helicobacter (gastritis); and autoimmune diseases including multiple sclerosis. The composition of this embodiment can be used to prevent or treat the above-mentioned diseases. Furthermore, because type I interferon is known to have the function of inhibiting differentiation of osteoblasts into osteoclasts, the composition of the present invention can also be used to prevent or treat osteoporosis and other conditions.
[0107] The bacterial cell bulk powder of this embodiment may be obtained by sterilizing and drying the bacterial cells themselves, obtained by separating the culture medium from a culture of the bacterium of this embodiment, according to the manufacturing method of Embodiment 2. Alternatively, the bacterial cell bulk powder of this embodiment may be obtained by sterilizing and drying a culture containing the bacterial cells of the bacterium of this embodiment according to the manufacturing method of Embodiment 2.
[0108] The bacterial bulk powder of this embodiment may contain components acceptable for use as food, medicine, or feed, in addition to the bacteria of this embodiment and components derived from the medium used to culture the bacteria, and may further contain at least one component selected from the group consisting of, for example, sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, colorings, fragrances, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, colorings, preservatives, sustained-release regulators, surfactants, and solubilizers.
[0109] The bacterial bulk powder of this embodiment can be used as a raw material for the food composition, pharmaceutical composition, or feed of this embodiment.
[0110] In addition, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, in another aspect, a method for stimulating the immunity of a subject, comprising having a subject ingest or administering to a subject the composition according to one aspect of the first embodiment. The subject to which the composition is ingested or administered may be a subject in need thereof, such as a subject in need of the above-mentioned immunostimulation.
[0111] Furthermore, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, in another aspect, the use of the composition according to one aspect of the first embodiment in stimulating the immunity of a subject. In this case, the use may be non-therapeutic use and / or therapeutic use, and is preferably non-therapeutic use.
[0112] In the present disclosure, "therapeutic" use refers to use in treating the human or animal body. A therapeutic use according to the present disclosure may be, for example, a use for the purpose of or in conjunction with medical treatment. A therapeutic use according to the present disclosure may involve, for example, a medical professional administering or ingesting a substance to a human or animal, or instructing a human or animal to administer or ingest a substance. A therapeutic use according to the present disclosure may be, for example, a use for therapeutic purposes or a preventative purpose, or may be a preventative use involving the ingestion of a food composition, or may be a therapeutic purpose. A therapeutic use according to the present disclosure may be, for example, a use on an unhealthy individual.
[0113] In the present disclosure, "non-therapeutic" use refers to use of a substance that does not fall under therapeutic use. Non-therapeutic use according to the present disclosure may, for example, be use that is not intended for and / or does not involve medical treatment. Non-therapeutic use according to the present disclosure may not, for example, involve a medical professional administering or having a human or animal ingest the substance and / or instructing a human or animal to administer or ingest the substance. Non-therapeutic use according to the present disclosure may, for example, be use for preventive or health promotion purposes, and may be use for preventive or health promotion purposes involving the administration or ingestion of a pharmaceutical composition or quasi-drug. Non-therapeutic use according to the present disclosure may, for example, be use in healthy individuals.
[0114] Furthermore, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, in another aspect, a composition according to one aspect of the first embodiment for use in stimulating the immunity of a subject. In this case, the use is, for example, therapeutic use.
[0115] Furthermore, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, as another aspect, the use of the above-mentioned bacterium in the production of a composition relating to one aspect of the first embodiment.
[0116] A second embodiment of the present invention is a method for producing a composition containing bacteria having immunostimulatory activity, the method comprising a heating step of heating the bacteria at a temperature within a predetermined range. One aspect of the second embodiment of the present invention may also be a method for producing a composition according to one aspect of the first embodiment of the present invention. Furthermore, the heat-treated composition containing bacteria according to one aspect of the first embodiment of the present invention may be a composition containing bacteria produced by a method according to one aspect of the second embodiment of the present invention. Furthermore, the production method according to one aspect of the second embodiment of the present invention may also provide a composition containing bacteria according to one aspect of the first embodiment of the present invention, the composition having a DIN within a predetermined range, and / or a DIN that is a multiplier within a predetermined range relative to the DIN of live bacteria, and / or a Cp value that is a multiplier within a predetermined range relative to the Cp value of live bacteria, and / or a DNA histogram in which the proportion of the area occupied by DNA of 250 to 60,000 bp is within a predetermined range, and / or the composition contains a predetermined number of copies or more of a DNA fragment amplified by a predetermined primer set.
[0117] The biological classification and strain of bacteria that can be used as a raw material in the production method of the second embodiment of the present invention are the same as those of the "bacteria according to this embodiment" described in the first embodiment of the present invention. For example, the bacteria used as a raw material may be lactic acid bacteria and / or acetic acid bacteria. Furthermore, the bacteria used as a raw material in the production method of the second embodiment of the present invention may primarily contain live bacteria, for example, bacteria containing 80% or more, 85% or more, 90% or more, or 95% or more live bacteria, and may also contain a small amount of dead bacteria (for example, 20% or less, 15% or less, 10% or less, 5% or less, 3% or less, or 1% or less).
[0118] Furthermore, the immunostimulatory ability of the composition containing the bacteria having immunostimulatory ability produced by the production method of the second embodiment of the present invention is the same as the immunostimulatory ability described in the first embodiment of the present invention. For example, the immunostimulatory ability of the composition containing the bacteria having immunostimulatory ability may include the ability to activate dendritic cells. Furthermore, the dendritic cell activation ability of the composition containing the bacteria having dendritic cell activation ability may include the ability to promote IFN-α production.
[0119] In the heating step, the bacteria may be heated as is, in powder form, or in the form of a bacterial suspension. Heating in the heating step can be carried out using a temperature-setting heating device commonly used by those skilled in the art, such as a plate sterilizer, a tubular sterilizer, a direct heating sterilizer, a jacketed tank, or an autoclave. The bacterial powder may be, for example, a powder obtained by dry spraying at a temperature at which the bacteria will not die. The temperature at which the bacteria will not die varies depending on the bacteria, but may be, for example, a temperature of 90°C or less, 80°C or less, 70°C or less, 60°C or less, or 50°C or less.
[0120] When bacteria in a suspension are heated in the heating step, the concentration of bacteria in the suspension is not particularly limited and may be, for example, 0.001% to 10.0% by volume or 0.01% to 1.0% by volume. The cell suspension may be a bacterial suspension obtained by suspending bacteria in, for example, a culture medium, a buffer solution, or a mixture thereof. The culture medium may be a culture medium commonly used by those skilled in the art for bacterial culture, such as MRS medium. The buffer solution may be a buffer solution commonly used by those skilled in the art for cell experiments, such as phosphate-buffered saline (PBS) or Hank's balanced salt solution (HBSS). The liquid component of the suspension may contain components that may be contained in culture media commonly used by those skilled in the art for bacterial culture and buffer solutions commonly used by those skilled in the art for cell experiments, such as at least one selected from the group consisting of sugars, peptone, beef extract, yeast extract, metal ions, buffers, osmotic pressure adjusters, pH adjusters, amino acids, vitamins, antioxidants, and surfactants.
[0121] In the heating step, the bacteria are heated within a predetermined temperature range. The heating temperature may be 60°C or higher, 65°C or higher, 70°C or higher, or 75°C or higher, or 110°C or lower, 100°C or lower, 90°C or lower, 85°C or lower, or 80°C or lower. These lower and upper limits can be arbitrarily combined. For example, the heating temperature may be 60°C or higher and 110°C or lower, 60°C or higher and 100°C or lower, 60°C or higher and 90°C or lower, 60°C or higher and 85°C or lower, 60°C or higher and 80°C or lower, 65°C or higher and 100°C or lower, 65°C or higher and 90°C or lower, 65°C or higher and 85°C or lower, 65°C or higher and 80°C or lower, 70°C or higher and 90°C or lower, 70°C or higher and 85°C or lower, 70°C or higher and 80°C or lower, 75°C or higher and 90°C or lower, or 75°C or higher and 85°C or lower.
[0122] The heating time in the heating step is not particularly limited, but may be, for example, 1 minute or more, 3 minutes or more, 5 minutes or more, or 10 minutes or more, and may be 24 hours or less, 4 hours or less, 60 minutes or less, 45 minutes or less, or 30 minutes or less. These lower and upper limits can be combined arbitrarily, and for example, the heat treatment time may be 1 minute or more and 24 hours or less, 3 minutes or more and 4 hours or less, or 5 minutes or more and 60 minutes or less.
[0123] In one embodiment of the manufacturing method, the product of the heating temperature (°C) and the heating time (minutes) in the heating step may be within a predetermined range. In one embodiment of the manufacturing method, the product of the heating temperature (°C) and the heating time (minutes) in the heating step may be within a predetermined range, and the temperature may be within the above-mentioned predetermined range. For example, in one embodiment of the manufacturing method, the product of the heating temperature (°C) and the heating time (minutes) in the heating step may be 150 or more, 300 or more, 500 or more, 800 or more, 1200 or more, 1500 or more, 1800 or more, or 2000 or more, or may be 30,000 or less, 20,000 or less, 15,000 or less, 10,000 or less, 7,000 or less, 5,000 or less, 4,000 or less, 3,500 or less, 3,000 or less, 2,700 or less, or 2,500 or less. These lower and upper limits may be combined arbitrarily, and the product of the heating temperature (°C) and time (minutes) in the heating step of one embodiment of the production method may be, for example, 150 to 30,000, 150 to 20,000, 150 to 15,000, 150 to 10,000, 150 to 7,000, 150 to 5,000, 150 to 4,000, 150 to 3,500, 150 to 3,000, or 150 to 3,000. 00 or less, 150 to 2,700, 150 to 2,500, 300 to 30,000, 300 to 20,000, 300 to 15,000, 300 to 10,000, 300 or more 7,000 or less, 300 to 5,000, 300 to 4,000, 300 to 3,500, 300 to 3,000, 300 to 2,700, 300 to 2,500, 500 to 300 00 or less, 500 to 20,000, 500 to 15,000, 500 to 10,000, 500 to 7,000, 500 to 5,000, 500 to 4,000, 500 to 3 500 or less, 500 to 3,000, 500 to 2,700, 500 to 2,500, 800 to 30,000, 800 to 20,000, 800 to 15,000, 800 to 1 0000 or less, 800 to 7000, 800 to 5000, 800 to 4000, 800 to 3500, 800 to 3000, 800 to 2700, 800 to 25 00 or less, 1,200 or more and 30,000 or less, 1,200 or more and 20,000 or more, 1,200 or more and 15,000 or less, 1,200 or more and 10,000 or less, 1,200 or more and 7,000 or less, 1,200 or more and 5,000 or less,1,200 to 4,000, 1,200 to 3,500, 1,200 to 3,000, 1,200 to 2,700, 1,200 to 2,500, 1,500 to 30,000, 1,500 to 20,000, 1,500 to 15,000, 1,500 to 10,000, 1,500 to 7 000 or less, 1500 to 5000, 1500 to 4000, 1500 to 3500, 1500 to 3000, 1500 to 2700, 1500 to 2500, 1800 to 30000, 1800 to 20000, 1800 to 15000, 18 00 or more and 10,000 or less, 1,800 or more and 7,000 or less, 1,800 or more and 5,000 or less, 1,800 or more and 4,000 or less, 1,800 or more and 3,500 or less, 1,800 or more and 3,000 or less, 1,800 or more and 2,700 or less, 1,800 or more and 2,500 or less, 2,000 or more and 30,000 or less, 2,000 or more and 20,000 or less, 2,000 or more and 15,000 or less, 2,000 or more and 10,000 or less, 2,000 or more and 7,000 or less, 2,000 or more and 5,000 or less, 2,000 or more and 4,000 or less, 2,000 or more and 3,500 or less, 2,000 or more and 3,000 or less, 2,000 or more and 2,700 or less, or 2,000 or more and 2,500 or less.
[0124] In one embodiment of the production method, the bacteria after the heating step have improved immunostimulatory ability compared to the bacteria before the heating step. For example, in one embodiment of the production method, the immunostimulatory ability of the bacteria after the heating step may be 1.10-fold or more, 1.50-fold or more, 1.70-fold or more, 1.90-fold or more, 2.00-fold or more, 2.50-fold or more, 3.00-fold or more, 3.50-fold or more, 4.00-fold or more, 4.25-fold or more, or 4.26-fold or more, or may be 10.0-fold or less, or 5.00-fold or less, compared to the immunostimulatory ability of the bacteria before the heating step. Furthermore, the improved immunostimulatory ability may be the ability to activate dendritic cells or the ability to promote IFN-α production. The immunostimulatory ability may be evaluated, for example, by the amount of IFN-α produced by dendritic cells when the bacteria are exposed to them. As a more detailed example, it may be evaluated according to the method described in the Examples. Thus, in one aspect, the production method according to the second embodiment of the present invention can also be a method for improving the immunostimulatory ability of bacteria, which includes a heating step of heating the bacteria at a temperature within a predetermined range.
[0125] One embodiment of the production method may include a step of culturing bacteria (culturing step) prior to the heating step. The medium used in the culturing step may be a medium that a person skilled in the art would use for culturing bacteria, preferably MRS medium. The culturing time in the culturing step may be a time sufficient to increase the bacteria to a desired number, and may be, for example, 1 hour or more, 3 hours or more, 6 hours or more, or 12 hours or more, and may be 336 hours or less, 168 hours or less, 72 hours or less, or 48 hours or less, for example, 24 hours. The culturing temperature in the culturing step is less than 60°C. Within this range, the temperature may be 20°C or more, 22°C or more, 25°C or more, or 30°C or more, or 45°C or less, 40°C or less, 38°C or less, 35°C or less, or 30°C or less, for example, 30°C.
[0126] One embodiment of the production method may include a step of washing the bacteria after the culturing step and before the heating step. The washing method in the washing step is not particularly limited, but in a preferred embodiment, washing by centrifugation (centrifugal washing) may be used. In centrifugal washing, the culture medium after the culturing step is centrifuged to precipitate the bacteria, and then a portion or all of the supernatant is removed. Instead, a washing solution may be added, for example, in an amount equal to the amount of the removed supernatant. The bacteria are then washed by repeating the centrifugation, removal of a portion or all of the supernatant, and addition of a washing solution. The washing solution may be one that is commonly used for washing bacteria, such as a buffer solution such as PBS. The number of washes (i.e., the number of centrifugations) in the washing step is not particularly limited and may be, for example, 1, 2, 3, 4, or 5 times. The centrifugation speed may be a condition commonly used for precipitating bacteria, and may be, for example, 1,000 to 10,000 rpm, e.g., 5,000 rpm.
[0127] The production method of one embodiment may further include a step of drying the heated bacteria after the heating step. The drying step may be, for example, spray drying. The spray drying method is not particularly limited and may be performed using a spray dryer as described above. The drying step may be, for example, freeze drying.
[0128] The production method of one embodiment does not need to include exposing the bacteria to a temperature exceeding a predetermined temperature. The predetermined temperature may be 130°C, 120°C, 115°C, 110°C, 105°C, 100°C, 95°C, 90°C, or 89°C. When the production method of one embodiment does not include exposing the bacteria to a temperature exceeding the predetermined temperature, the produced bacteria will have a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than bacteria produced by a production method that includes exposing the bacteria to a temperature exceeding the predetermined temperature.
[0129] Compositions produced by the production method of one embodiment include food compositions, pharmaceutical compositions, bacterial bulk powders, and feeds.
[0130] When the composition produced by one embodiment of the production method is a bacterial bulk powder, the bacterial culture, or the bacterial cells themselves obtained by separating the culture medium from the bacterial culture, can be sterilized and dried as described above to obtain the bacterial bulk powder.
[0131] When the composition produced by one embodiment of the production method is a bacterial bulk powder, the production process of the bacterial bulk powder may include a step of adding components acceptable for use as food, pharmaceuticals, or feed, in addition to the bacteria and components derived from the culture medium used to culture the bacteria. For example, the process may include a step of further adding at least one selected from the group consisting of sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, coloring agents, fragrances, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, coloring agents, preservatives, sustained-release regulators, surfactants, and solubilizers.
[0132] When the composition produced by one embodiment of the production method is a food composition, examples of the food composition include, but are not limited to, the above-mentioned lactic acid bacteria drinks, yogurt drinks, coffee, juice, tea drinks, dairy drinks, fermented milk, etc. When the composition produced by one embodiment of the production method is a food composition, the bacteria contained in the food composition may be a bacterial bulk powder obtained through the above-mentioned culturing step, heating step, drying step, etc., or may be a bacterium obtained through the above-mentioned culturing step, heating step, drying step, etc. in the production process of the food composition.
[0133] When the composition produced by the production method of one embodiment is a pharmaceutical composition, examples of the pharmaceutical composition include, but are not limited to, the oral or parenteral forms described above. When the composition produced by the production method of one embodiment is a pharmaceutical composition, the bacteria contained in the pharmaceutical composition may be a bacterial bulk powder obtained through the culturing step, heating step, drying step, or the like described above, or may be a bacterium obtained through the culturing step, heating step, drying step, or the like in the production process of the pharmaceutical composition.
[0134] When the composition produced by one embodiment of the production method is a feed, the bacteria contained in the feed may be a bacterial bulk powder obtained through the above-mentioned culturing step, heating step, drying step, etc., to which has been added, or may be a bacterial bulk powder obtained through the above-mentioned culturing step, heating step, drying step, etc., in the production process of the feed. [Example]
[0135] The present invention will be described in more detail below using examples, but the present invention is not limited to the following examples.
[0136] In this example, the bacterium used was Lactococcus lactis subsp. lactis JCM5805. Hereinafter, this strain will also be referred to as "LC-Plasma." LC-Plasma used in this example is manufactured by Kirin Holdings Co., Ltd.
[0137] Example 1: Effect of heating temperature on immunostimulatory activity of LC-Plasma In a 150 ml storage bottle (CORNING), 100 ml of MRS medium (MRS BROTH, CM0359, Oxoid) was inoculated (seeded) with LC-Plasma at a concentration of 0.1% (v / v) and cultured for 24 hours (static culture) at 30°C in an incubator (Tokyo Rikakikai Co., Ltd.). After static culture, the culture solution was concentrated by centrifugation (5000 rpm), and the supernatant was removed to obtain a bacterial suspension. The resulting bacterial suspension was then mixed with milliQ at a ratio of 1:19 and washed twice by centrifugation (5000 rpm).
[0138] The washed LC-Plasma was suspended in 20 mL of milliQ and heated in an autoclave at 60°C, 70°C, 80°C, 90°C, 100°C, 110°C, 120°C, or 130°C for 30 minutes to obtain heat-treated bacterial samples. A control bacterial sample was also prepared that was not heat-treated. These bacterial samples were then freeze-dried to obtain bacterial powder.
[0139] The test was carried out according to the following steps (i) to (iv). (i) Bone marrow cells derived from female BALB / c mice were cultured in RPMI medium (Sigma Co., Ltd.) with the following composition at 1 × 10 6 The cells were suspended at a density of 100 cells / mL to prepare a cell suspension. [Medium composition] 10% by volume FBS 100U / mL penicillin / streptomycin 1mM sodium pyruvate 2.5mM HEPES 1% MEM non-essential amino acid solution (x100) (Gibco, REF: 11140-050) 50 μM β-mercaptoethanol 100ng / mL Flt-3L (ii) 1 mL of the prepared cell suspension was seeded and cultured in a CO2 incubator at 37°C and 5% CO2 for 1 week to induce pDCs. (iii) 2 × 10 bone marrow cells containing induced pDCs 5 The cells were suspended at a concentration of 100 cells / mL, and 200 μL of each was inoculated into a 96-well plate (Corning). Bacterial powder was added to a final concentration of 2 μg / well, and the plate was incubated at 37° C. for 24 hours. (iv) After 24 hours, the culture supernatant was collected and the IFN-α concentration was measured using an IFN-α measurement kit (PBL Assay Science Ltd.) according to the protocol described in the kit's instructions.
[0140] FIG. 1 shows the results of measuring the amount of IFN-α. The results in FIG. 1 are shown as mean values ± standard deviations. As shown in FIG. 1, the amount of IFN-α produced by dendritic cells exposed to bacteria heat-treated at 60 to 110°C was significantly increased compared to exposure to bacteria that had not been heat-treated. On the other hand, in dendritic cells exposed to bacteria heat-treated at temperatures above 110°C, no increase in the amount of IFN-α was observed; in fact, it was lower than when exposed to bacteria that had not been heat-treated. These results demonstrate that bacteria heat-treated at temperatures between 60°C and 110°C have high immunostimulatory activity.
[0141] Example 2: Effect of heating time on immunostimulatory activity of LC-Plasma LC-Plasma cells were statically cultured and washed as in Example 1, and then heated in an autoclave at 60°C, 80°C, or 110°C for 5, 30, or 60 minutes to obtain heat-treated bacterial samples. A control bacterial sample was also prepared without heat treatment. These bacterial samples were then dried in a freeze dryer to obtain bacterial powder. Subsequently, as in Example 1, the bacteria were exposed to mouse BMDCs, and the amount of IFN-α in the culture supernatant was measured.
[0142] Figure 2 shows the results of measuring the amount of IFN-α. The results in Figure 2 are shown as mean values ± standard deviation. Figure 2 reveals that bacteria heat-treated within a specified temperature range exhibit high immunostimulatory activity, at least when the heating time is in the range of 5 to 60 minutes.
[0143] <Example 3: Measurement of DNA size in heat-treated LC-Plasma> Heat-treated and unheat-treated bacterial powders were prepared as in Example 1. DNA was extracted from these bacterial powders by phenol-chloroform extraction. Specifically, the bacterial powder was diluted with PBS to a concentration of 10 mg / mL. 200 μL of the resulting bacterial suspension was mixed with 300 μL of extraction buffer solution with the following composition and 500 μL of phenol / chloroform / isoamyl alcohol solution with the following composition:
[0144] [Extraction buffer] Mix 20 mL of 1 M Tris HCl (pH 8) (Nippon Gene, ref: 312-90061), 16 mL of UltraPure 0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, ref: 15575-020), 64 mL of MilliQ, and 20 mL of 10% SDS (Nippon Gene, ref: 311-90271).
[0145] [Phenol / chloroform / isoamyl alcohol solution] A mixture of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1 (Nippon Gene, ref: 311-90151)
[0146] The resulting mixture was added to a tube (Lysing MatrixE TUBE, MP, ref: 6914500, hereinafter the same) and vortexed for 60 seconds using a vortex mixer (VORTEX GENIE2, Scientific Industries, hereinafter the same). The resulting tube containing the mixture was centrifuged at 12,000 rpm for 5 minutes at room temperature using a centrifuge (TOMY MX-301, hereinafter the same). 350 μL of the supernatant was collected in a new tube, mixed with 350 μL of phenol / chloroform / isoamyl alcohol solution, and homogenized using a vortex mixer. The tube containing the mixed solution was centrifuged at 12,000 rpm for 5 minutes at room temperature using a centrifuge. DNA was thus extracted from the bacteria. 250 μL of the supernatant was collected in a new tube, and 50 μL of 3 M sodium acetate and 250 μL of isopropanol were added. The solution was centrifuged at 15,000 rpm for 15 minutes at 4°C. The supernatant was discarded, and 500 μL of 70% ethanol was added. The solution was centrifuged at 15,000 rpm at 4°C for 3 minutes. After discarding the supernatant, the pellet in the tube was dried under reduced pressure. RNase-free water (Qiagen, ref: 129112) was added to the dried pellet and mixed to obtain a DNA solution.
[0147] The DNA solution was evaluated using the Genomic DNA ScreenTape assay, an electrophoresis method using a fully automated electrophoresis system, TapeStation (Agilent Technologies). For electrophoresis, the Genomic DNA ScreenTape and Genomic DNA Reagent Kit (both from Agilent Technologies) were used according to their specifications. The evaluation result was a DNA Integrity Number (DIN). The DIN is a value output from the Genomic DNA ScreenTape assay using the Agilent 4200 TapeStation system, and is a score of 1 to 10 (the lower the value, the more degraded the DNA) based on the degree of DNA degradation. 1 is the detection limit of the above machine.
[0148] Figure 3 shows the results of electrophoresis and DIN in a Genomic DNA ScreenTape assay of heat-treated bacteria. According to the results in Figure 3, the DIN of bacteria heat-treated at 60 to 100°C was 1.0 to 8.5. Furthermore, the DIN of heat-treated bacteria decreased in a temperature-dependent manner when the heat treatment temperature was greater than 70°C and less than 110°C. These results, together with those of Example 1, suggest that bacteria with a DIN within a specified range have high immunostimulatory activity.
[0149] Example 4: Evaluation of DNA size distribution in heat-treated LC-Plasma In the electrophoresis results obtained in Example 3 (Figure 3), a range of 250 to 60,000 bp was specified on the DNA histogram on the TapeStation device, and the spectral area ratio occupied by DNA having a base length in this range among all DNA was calculated.
[0150] Table 1 shows the spectral area ratio of DNA having a base length of 250 to 60,000 bp to the total DNA in heat-treated bacteria. According to the results in Table 1, the spectral area ratio of 250 to 60,000 bp was 70% or more when the heat treatment temperature was 70°C or higher. Furthermore, the spectral area ratio in this range was maximized in the bacteria heat-treated at 80°C and 90°C, which showed high immunopotentiating ability in Example 1. These results, together with those of Example 1, suggest that bacteria with a spectral area ratio of 250 to 60,000 bp in a predetermined range have high immunopotentiating ability.
[0151] [Table 1]
[0152] The DNA solution obtained in Example 3 was used so that the amount of DNA was 90 ng, and evaluation was performed by real-time PCR using a LightCycler® 480 (Roche). In real-time PCR, the primer set shown below was used, and TB Green® Premix Ex Taq® II was used according to the specifications, and amplification was performed according to the program shown below. In the program below, the temperature was changed at 20°C / second. [Primer set] Primer set 1: Primers that amplify the prokaryotic 16S conserved region V5 Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 50°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second
[0153] Table 2 shows Cp values (crosspoint values) calculated on the instrument based on the measurement results of fluorescence intensity in real-time PCR. The Cp value is the cycle number at which the amplification curve reaches its maximum inflection point, calculated from the second derivative using the second derivative maximum method (SDM). The results shown in Table 2 indicate that a smaller Cp value indicates less degradation of the DNA to be amplified. The results in Table 2 indicate that bacteria heat-treated at temperatures of 60°C or higher and lower than 110°C had higher Cp values than unheated bacteria and lower Cp values than bacteria heat-treated at temperatures of 120°C or higher. These results, along with those of Example 1, suggest that bacteria with a Cp value of 15.5 to 24.0, or bacteria with a Cp value that is 1.10 to 1.50 times higher than that of live bacteria, have high immunostimulatory activity.
[0154] [Table 2]
[0155] <Example 5: Evaluation using various heat-treated bacteria> Similar tests were also performed with lactic acid bacteria other than those used in Example 1. Table 3 lists the strains of lactic acid bacteria used. Table 4 lists the culture conditions indicated as A and B in Table 3. In the examples, lactic acid bacteria, except for Lactobacillus gasseri SBT 2055, were cultured according to the culture method described in Table 4 according to the correspondence between A and B in Table 3, and then used as bacterial bulk powder (dried bacterial powder or powder containing the same, etc.) prepared as follows. Bacteria were cultured in MRS medium (MRS BROTH, CODE: CM0359, Oxoid). The culture solution was centrifuged (5000 rpm), and the supernatant was removed to obtain a bacterial solution. The resulting bacterial solution was then mixed with phosphate-buffered saline (Takara Bio) at a ratio of 1:19 and washed twice by centrifugation (5000 rpm). The washed bacterial solution was then heat-treated according to the temperature and time conditions specified in each example to kill the lactic acid bacteria in the bacterial solution. The heat-treated bacterial solution was freeze-dried to obtain a bacterial bulk powder. [Table 3] [Table 4]
[0156] Lactobacillus gasseri SBT 2055 was prepared using a bacterial bulk powder prepared as follows. A Lactobacillus gasseri SP capsule (Megmilk Snow Brand), a supplement containing Lactobacillus gasseri SBT 2055, was dissolved in 10 mL of MRS medium to prepare a solution containing Lactobacillus gasseri SBT 2055. The solution was then spread onto MRS agar medium and streaked to obtain single colonies of Lactobacillus gasseri SBT 2055. A colony of Lactobacillus gasseri SBT 2055 was added to MRS medium and incubated at 37°C for 24 hours. 700 μL of the culture was then mixed with 300 μL of 80% glycerol to prepare a glycerol stock of Lactobacillus gasseri SBT 2055 and stored at -80°C. 100 μL of glycerol stock of Lactobacillus gasseri SBT 2055 was added to 100 mL of MRS medium and incubated at 37°C for 24 hours. The culture medium was collected, centrifuged, washed twice with ultrapure water, and then suspended in 20 mL of ultrapure water. The resulting suspension was heat-treated according to the temperature and time conditions of each example and then freeze-dried. The resulting powder was used as the bacterial bulk powder of Lactobacillus gasseri SBT 2055 in the following examples.
[0157] Weissella paramesenteroides JCM 9890, Bifidobacterium animalis subsp. lactis JCM 10602, and Lactobacillus gasseri SBT2055 were each prepared by heat-treating them at 60°C, 80°C, 100°C, 110°C, or 120°C for 30 minutes, and by preparing unsterilized and unpasteurized cells. The amount of IFN-α expressed by dendritic cells was measured for each strain using the method described in Example 1. The results are shown in Table 5. These results suggest that bacteria other than LC-Plasma that were heat-treated within the specified temperature range also possess high immunostimulatory activity. [Table 5]
[0158] Example 6: Evaluation of various heat-treated bacteria using droplet digital PCR (ddPCR) Heat-treated and unheat-treated bacterial powders were prepared for LC-Plasma, JCM9890, JCM10602, and SBT2055 as in Examples 1 and 5. DNA was extracted from these bacterial powders using phenol-chloroform extraction. Specifically, the bacterial powder was first diluted with PBS to a concentration of 10 mg / mL. Next, 200 μL of the resulting bacterial suspension was mixed with 300 μL of extraction buffer solution with the following composition and 500 μL of phenol / chloroform / isoamyl alcohol solution with the following composition:
[0159] [Extraction buffer] Mix 20 mL of 1 M Tris HCl (pH 8) (Nippon Gene, ref: 312-90061), 16 mL of UltraPure 0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, ref: 15575-020), 64 mL of MilliQ, and 20 mL of 10% SDS (Nippon Gene, ref: 311-90271).
[0160] [Phenol / chloroform / isoamyl alcohol solution] A mixture of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1 (Nippon Gene, ref: 311-90151)
[0161] [Test method] The resulting mixture was added to a tube (Lysing MatrixE TUBE, MP Biomedicals, ref: 6914500, hereinafter the same) and vortexed for 60 seconds (VORTEX GENIE2: Scientific Industries, hereinafter the same). The tube containing the mixed solution was disrupted using a FastPrep-24® 5G (MP Biomedicals) at 6.5 m / s for 45 seconds, and then centrifuged at 12,000 rpm for 5 minutes at room temperature using a centrifuge (TOMY MX-301, hereinafter the same). 350 μL of the supernatant was collected in a new tube, mixed with 350 μL of phenol / chloroform / isoamyl alcohol solution, and homogenized using a vortex mixer. The tube containing the mixed solution was centrifuged at 12,000 rpm for 5 minutes at room temperature using a centrifuge. DNA was thus extracted from the bacteria. 250 μL of the supernatant was collected in a new tube, and 25 μL of 3M sodium acetate and 250 μL of isopropanol were added. The solution was centrifuged at 15,000 rpm at 4°C for 15 minutes. The supernatant was discarded, and 500 μL of 70% ethanol was added. The solution was centrifuged at 15,000 rpm at 4°C for 5 minutes. After discarding the supernatant, the pellet in the tube was dried. RNase-Free Water (Qiagen, ref: 129112) was added to the dried pellet and mixed to obtain a DNA solution. The amount of DNA (ng / μL) in the DNA solution obtained from the 10 mg / mL bacterial suspension was measured using a Thermo Scientific® NanoDrop® spectrophotometer (ThermoFisher Scientific).
[0162] [ddPCR] The DNA solution obtained above was diluted to 0.03 ng / μL, 0.3 ng / μL, or 3 ng / μL for ddPCR, and evaluated by ddPCR using a QX600 AutoDG Droplet Digital PCR System (Bio-Rad). For ddPCR, the following primer set (FASMAC) was used, along with ddPCR Evagreen Supermix (Bio-Rad, 1864033) and the following composition was used to generate droplets in an Automated Droplet Generator (Bio-Rad, 1864101JA). Then, a Pierceable Foil Heat Seal (Bio-Rad, 1814040) was attached to the plate using a PX1 (registered trademark) PCR Plate Sealer (Bio-Rad, 1814000J1), and PCR amplification was performed using a PTC Tempo Deepwell Thermal Cycler (Bio-Rad, 12015392). The PCR amplification program was performed with a temperature change of 2°C / sec. After PCR amplification, the samples were subjected to a QX600 Droplet Reader (Bio-Rad, 12013328) to measure the DNA concentration. [composition] The DNA solution was added at 2 μL / well to ddPCR Evagreen Supermix 11 μL / well, 10 μM forward primer 0.4 μL / well, 10 μM reverse primer 0.4 μL / well, and RNase-free water 8.2 μL / well. [Primer set] Primer set 1: Primers that amplify the genomic region of Lactococcus (A9 primer) Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) Primer set 2: Primers that amplify the prokaryotic 16S conserved region V3 (V3 primers) Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [program] Stage 1: 95°C for 5 minutes, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 58°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second and 4°C for 20 seconds
[0163] 1) Evaluation of LC-Plasma using A9 primer Table 6 and Figure 4 show the DNA copy numbers calculated by ddPCR using the A9 primer for LC-Plasma under various heat treatment conditions (N = 3). In ddPCR, a lower DNA copy number indicates greater degradation of the DNA to be amplified. Therefore, the decrease in DNA concentration in heat-treated bacteria indicates increased DNA degradation due to heat. Furthermore, based on the amount of DNA in the DNA solution obtained from the 10 mg / mL bacterial suspension obtained in this example and the DNA copy number calculated by ddPCR, the copy number of the DNA to be amplified by the A9 primer contained in the bacterial cells and each well used to evaluate IFN-α production in Example 1 was calculated as shown in Table 7, expressed as the number per 2 mg of bacterial cells and per well in Example 1. In this calculation, the efficiency of DNA extraction from the bacterial cells was assumed to be 100%. Taking into account the results of Example 1 and these results, it was suggested that compositions in which the DNA copy number calculated by ddPCR using A9 primers falls within a predetermined range have high immunostimulatory activity. [Table 6] [Table 7]
[0164] 2) Evaluation of four bacterial species using V3 primers Table 8 and Figures 5 to 8 show the DNA copy numbers calculated by ddPCR using the V3 primer for various bacteria under various heat treatment conditions (N = 1). Figures 5, 6, 7, and 8 show the results of evaluation of LC-Plasma, JCM9890, JCM10602, and SBT2055, respectively. Table 8 and Figures 5 to 8 indicate that the accelerated DNA degradation in heat-treated bacteria is not specific to LC-Plasma; the other three strains also underwent heat-dependent DNA degradation. Based on the DNA amount in the DNA solution obtained from the 10 mg / mL bacterial suspension obtained in this example and the DNA copy numbers calculated by ddPCR, the copy numbers of DNA to be amplified by the V3 primer contained in the bacterial cells used to evaluate IFN-α production in Examples 1 and 5 were calculated as shown in Tables 9 and 10, respectively, per 2 mg of bacterial cells and per well in Example 5. In the calculations, the DNA extraction efficiency from the bacterial cells was assumed to be 100%. In Tables 8 to 10, the measurement result "-" indicates that the measurement was not performed. Taking into account the results of Examples 1 and 5 and these results, it was suggested that compositions in which the DNA copy number calculated by ddPCR using V3 primers falls within a predetermined range have high immunostimulatory activity. [Table 8] [Table 9] [Table 10]
Claims
1. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the composition contains 2.4 x 10 DNA fragments amplified by the following primer set: 2 A composition containing more than one copy. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6)
2. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein a DNA fragment amplified by the following primer set is added to 1.2 × 10 5 A composition containing more than one copy. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6)
3. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the composition contains 1.1 times or more copies of DNA fragments amplified by the following primer set per 1 mg of the bacteria compared to the number of copies of DNA fragments amplified by the primer set contained per 1 mg of bacteria of the same strain that have been heat-treated at 120°C for 30 minutes. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6)
4. A composition comprising a heat-treated bacterium having immunopotentiating activity, wherein the DIN (DNA Integrity Number), which indicates the degree of degradation of the genomic DNA of the bacterium, is 1.0 to 8.
5.
5. A composition comprising a heat-treated bacterium having immunostimulatory activity, wherein the bacterium has a Cp value (Crosspoint value) of 15.5 to 24.0 as measured under the following conditions: <Conditions> The DNA solution extracted from the bacteria is amplified by real-time PCR using the primer set shown below and the program shown below, and the cycle number at which the amplification curve reaches its maximum inflection point is defined as the Cp value based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 40 cycles of 95°C for 5 seconds and 50°C for 20 seconds Stage 3: 1 cycle of 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second
6. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include bacteria of the genus Lactococcus, and the composition contains 1.0 x 10 DNA fragments amplified by the following primer set: 5 A composition containing more than one copy. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4)
7. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include bacteria of the genus Lactococcus, and a DNA fragment amplified by the following primer set is added at 5.1 x 10 per 1 mg of the bacteria of the genus Lactococcus: 7 A composition containing more than one copy. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4)
8. The composition according to any one of claims 1 to 7, wherein the immunostimulatory activity includes the ability to activate dendritic cells.
9. The composition according to claim 8, wherein the ability to activate dendritic cells includes the ability to promote IFN-α production.
10. The composition according to any one of claims 1 to 7, wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria.
11. The bacterium is selected from the group consisting of Lactobacillus rhamnosus CRL1505, Gluconacetobacter hansenii GK-1, Lactobacillus acidophilus L-92, Lactobacillus plantarum L-137, Lactobacillus bulgaricus OLL1073R-1, Lactococcus lactis subsp. lactis, and the like. The composition according to any one of claims 1 to 7, wherein the bacterium is at least one bacterium selected from the group consisting of Bifidobacterium animalis subsp. lactis JCM5805, Weissella paramesenteroides JCM9890, Bifidobacterium animalis subsp. lactis JCM10602, and Lactobacillus gasseri SBT2055.
12. The composition according to any one of claims 1 to 7, wherein the Cp value of the heat-treated bacteria is 1.10 to 1.50 times the Cp value of the non-heat-treated bacteria.
13. The composition according to any one of claims 1 to 7, wherein the area ratio occupied by DNA of 250 to 60,000 bp in a histogram of the bacterial genomic DNA is 65% or more.
14. The composition according to any one of claims 1 to 7, wherein the heat-treated bacterium has improved immunostimulatory activity compared to the bacterium that has not been heat-treated.
15. The composition according to any one of claims 1 to 7, which is a food composition, a pharmaceutical composition or a feed.
16. The composition according to any one of claims 1 to 7, which is an immunostimulatory composition.
17. The composition according to any one of claims 1 to 7, wherein the dry weight of the bacteria is 0.0001% by mass or more relative to the total dry weight of the composition.
18. When the composition is in a liquid form, the number of bacteria in the composition is 1.0 x 10 3 cells / ml~1.0×10 11 The composition of any one of claims 1 to 7, wherein the composition is in a concentration of 0.1 to 0.5% by weight of cells / ml.
19. A method for producing a composition containing bacteria having immunostimulatory activity, comprising a heating step of heating the bacteria at a temperature of 60°C or higher and 110°C or lower.
20. The method of claim 19 , wherein the immunostimulatory activity includes dendritic cell activation activity.
21. The method according to claim 20, wherein the ability to activate dendritic cells includes the ability to promote IFN-α production.
22. 20. The method of claim 19, wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria.
23. 20. The method of claim 19, wherein the heating step comprises heating the bacteria at a temperature of 70°C or higher and 90°C or lower.
24. The method according to claim 19, wherein the heating time in the heating step is 5 minutes or more and 60 minutes or less.
25. 20. The method of claim 19, further comprising culturing the bacteria in a glucose-containing medium prior to the heating step.
26. 20. The method of claim 19, further comprising the step of drying the heated bacteria after the heating step.
27. The method according to claim 19, wherein the bacterium after the heating step has improved immunostimulatory activity compared to the bacterium before the heating step.
28. A method for improving the immunostimulatory activity of a bacterium, comprising a heating step of heating the bacterium at a temperature of 60°C or higher and 110°C or lower.
29. The method of claim 28, wherein the immunostimulatory activity includes dendritic cell activation activity.
30. The method according to claim 29, wherein the ability to activate dendritic cells includes the ability to promote IFN-α production.
31. 29. The method of claim 28, wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria.
32. 29. The method of claim 28, wherein the heating step comprises heating the bacteria at a temperature of 70°C or more and 90°C or less.
33. The method according to claim 28, wherein the heating time in the heating step is from 5 minutes to 60 minutes.
34. 30. The method of claim 28, further comprising culturing the bacteria in a glucose-containing medium prior to the heating step.
35. 29. The method of claim 28, further comprising the step of drying the heated bacteria after the heating step.
36. The method according to claim 28, wherein the bacterium after the heating step has improved immunostimulatory activity compared to the bacterium before the heating step.
Citation Information
Patent Citations
Interferon production inducer containing lactic acid bacteria
JP2017201984A