Compositions and methods for inhibition of factor xii gene expression

Abstract

To provide: RNA interference agents for inhibiting the expression of Factor XII (FXII) gene; pharmaceutical compositions comprising one or more FXII RNAi agents together with one or more excipients capable of delivering the RNAi agents to liver cells in vivo; and, through the delivery of the FXII RNAi agents to liver cells in vivo, inhibition of FXII gene expression and treatment of angioedema, including hereditary angioedema (HAE), and venous thromboembolism (VTE), and diseases associated with angioedema.SOLUTION: The invention provides an RNAi agent which comprises a sense strand and an antisense strand, where the antisense strand comprises nucleotides 2-18 of any of the antisense strand sequences in Table 2, Table 3 or Table 6, and where the sense strand is at least partially complementary to the antisense strand.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 451,868, filed January 30, 2017, the contents of which are incorporated herein by reference in their entirety.

[0002] Disclosed herein are RNA interference (RNAi) agents for inhibiting Factor XII gene expression, compositions comprising the FXII RNAi agents, and methods of their use. [Background technology]

[0003] Factor XII (also called FXII, F12, or Hageman factor) is a serine protease primarily expressed in the liver and found in the blood. It has dual functions in both the intrinsic coagulation pathway and the kinin-kallikrein system. The kinin-kallikrein system plays a role in inflammation, blood pressure regulation, coagulation, and pain. The activated form of factor XII binds to and cleaves both factor XI in the coagulation cascade and prekallikrein in the kinin-kininogen system, generating activated FXI and kallikrein, respectively.

[0004] Patients with complete loss of FXII do not exhibit bleeding disorders. Furthermore, mice lacking FXII by gene knockout have been shown to be protected from thrombosis (Renne et al. JEM 2005, 202:271-281). The thromboprotective effects of FXII loss were also observed in mice, rabbits, and primates treated with an FXII-inhibiting antibody (Larsson et al. Science Trans Med 2014 6:22ra17). Current treatments for thromboembolic events target downstream enzymes in the coagulation pathway, which are critical for controlling blood loss associated with fibrin formation injury. Therefore, treatment with these agents has the potential for life-threatening bleeding. The administration of current anticoagulants increases the risk of major bleeding events, especially when factor Xa inhibitors are contraindicated.

[0005] Hereditary angioedema (HAE) is a rare disease characterized by frequent episodes of severe swelling. The most common body areas affected are the extremities, face, intestines, and airways. Episodes can occur spontaneously or be triggered by physical trauma or stress. Laryngeal (airway) edema can be life-threatening, potentially resulting in death from asphyxiation. The primary treatment options for HAE involve ictal administration, focusing on either C1INH replacement, kallikrein inhibition, or signaling via the bradykinin 2 receptor. Currently, the only long-term preventative treatment is C1INH replacement therapy.

[0006] Previously discovered RNAi agents targeting FXII are described, inter alia, in International Patent Application Publication No. WO2016 / 149331A2, which is incorporated herein by reference in its entirety as if fully set forth herein. Additionally, FXII iRNA compositions are disclosed in International Patent Application Publication Nos. WO2016 / 179342 and WO2017 / 120397. However, the sequences and modifications of the FXII RNAi agents disclosed herein differ from those previously disclosed or known in the art. The FXII RNAi agents disclosed herein potently and efficiently inhibit FXII gene expression. Summary of the Invention

[0007] There is a need for novel FXII RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) that can selectively and efficiently inhibit FXII expression. Additionally, there is a need for novel FXII-specific RNAi agent compositions. Because both thrombosis (including venous thromboembolism, VTE) and angioedema are thought to result from overactive signaling in the respective pathways, inhibition of FXII gene expression would be useful, inter alia, for use as a preventative treatment for thrombosis and / or angioedema.

[0008] In general, the disclosure features FXII RNA interference (RNAi) agents, compositions comprising the FXII RNAi agents, and in vitro and / or in vivo methods for inhibiting FXII gene expression using the FXII RNAi agents and compositions comprising the FXII RNAi agents. The FXII RNAi agents described herein can be used to treat conditions or diseases resulting from overactivation of kinin-kallikrein or the intrinsic coagulation pathway, such as thrombosis and / or HAE.

[0009] The FXII gene-specific RNAi agents described herein can selectively and efficiently reduce FXII expression. The FXII RNAi agents described herein can be used in methods for therapeutic treatment (including prophylactic treatment) of diseases and conditions associated with angioedema, including, but not limited to, hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor-associated angioedema, allergic angioedema, nonhistamine angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombo-occlusive disease, and perioperative venous occlusive disease prevention. The use of the FXII RNAi agents described herein provides methods for the treatment and prevention of venous occlusive disease, such as deep vein thrombosis or pulmonary embolism, and the treatment and prevention of arterial thromboembolic disease. Such methods include administering the FXII RNAi agents described herein to a subject, such as a human or animal subject, by any suitable means known in the art, such as subcutaneous injection or intravenous administration.

[0010] In one aspect, the disclosure features an RNAi agent for inhibiting expression of the human FXII gene, wherein the RNAi agent comprises a sense strand and an antisense strand. Also described herein is a composition comprising an RNAi agent capable of inhibiting expression of the FXII gene, wherein the RNAi agent comprises a sense strand and an antisense strand, and further comprises at least one pharmaceutically acceptable excipient.

[0011] Each FXII RNAi agent described herein comprises a sense strand and an antisense strand. The sense strand and antisense strand may be partially, substantially, or fully complementary to one another. The sense and antisense strands of the RNAi agents described herein may each be 16-30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17-26 nucleotides in length. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21-24 nucleotides in length. In some embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The sense and antisense strands may be the same length or different lengths. The RNAi agents described herein inhibit the expression of one or more FXII genes in vivo or in vitro when delivered to cells expressing FXII.

[0012] FXII RNAi agents comprise a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand of the FXII RNAi agent described herein comprises a base sequence having at least 85% identity over a core stretch of at least 16 consecutive nucleotides to a sequence in FXII mRNA. In some embodiments, the sense strand core stretch having at least 85% identity to a sequence in FXII mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch having at least 85% identity to a sequence in FXII mRNA is 19 nucleotides in length. The antisense strand of the FXII RNAi agent comprises a base sequence having at least 85% complementarity over a core stretch of at least 16 consecutive nucleotides to a sequence in FXII mRNA and the corresponding sense strand. In some embodiments, the antisense strand core stretch having at least 85% complementarity to the sequence of FXII mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0013] In some embodiments, the FXII RNAi agents disclosed herein target a portion of the FXII gene having any of the sequences disclosed in Table 1.

[0014] Examples of FXII RNAi agent sense and antisense strands that can be used in FXII RNAi agents are listed in Tables 2, 3, 4, and 6. Examples of duplexes that comprise FXII RNAi agents are listed in Tables 5 and 6. Examples of 19-nucleotide core stretch sequences that may consist of or be included in the sense and antisense strands of certain FXII RNAi agents disclosed herein are listed in Table 2.

[0015] In another aspect, the present disclosure features a method for in vivo delivery of an FXII RNAi agent to liver cells in a subject, such as a mammal. In some embodiments, one or more FXII RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. Nucleic acid delivery methods include encapsulation in liposomes, iontophoresis, or by hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, proteinaceous vectors, or dynamic polyconjugates. TM Examples of delivery vehicles include, but are not limited to, incorporation into other vehicles such as delivery protein constructs (DPCs) (see, e.g., WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, each of which is incorporated herein by reference). In some embodiments, delivery vehicles, such as polymers, amphipathic polymers, membrane-active polymers, peptides, e.g., melittin or melittin-like peptides, reversibly modified polymers or peptides, or lipids, can be used with the FXII RNAi agents disclosed herein.

[0016] In some embodiments, the FXII RNAi agent is delivered to a target cell or tissue by covalently linking or conjugating the RNAi agent to a targeting group, such as an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of a galactose or galactose derivative cluster. In some embodiments, the FXII RNAi agent is linked to a targeting ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. Examples of targeting groups useful for delivering RNAi agents are disclosed, for example, in US Patent Application No. 15 / 452,324 and International Patent Application Publication No. WO2017 / 156012, which are incorporated herein by reference in their entireties.

[0017] The targeting group can be attached to the 3' or 5' end of the sense strand or antisense strand of the FXII RNAi agent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is attached to an intranucleotide of the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is attached to the RNAi agent via a linker.

[0018] The targeting group, with or without a linker, can be linked to either the 5' or 3' end of the sense and / or antisense strand as described in Tables 2, 3, 4, and 6. The targeting group, with or without a linker, can be attached to either the 5' or 3' end of the sense and / or antisense strand as described in Tables 2, 3, 4, and 6.

[0019] In another aspect, the disclosure features a composition including one or more FXII RNAi agents having a double-stranded structure disclosed in Table 5.

[0020] In another aspect, the disclosure features a composition including one or more FXII RNAi agents having a double-stranded structure disclosed in Table 6.

[0021] In some embodiments, the present disclosure provides compositions comprising a combination or cocktail of at least two FXII RNAi agents having different base sequences. In some embodiments, two or more different FXII RNAi agents are each separately and independently bound to a targeting group. In some embodiments, two or more different FXII RNAi agents are each bound to a targeting group comprising or consisting of a targeting ligand comprising one or more moieties that target the asialoglycoprotein receptor. In some embodiments, two or more different FXII RNAi agents are each bound to a targeting group comprising or consisting of a targeting ligand comprising one or more galactose derivatives. In some embodiments, two or more different FXII RNAi agents are each bound to a targeting group comprising or consisting of a targeting ligand comprising one or more N-acetyl-galactosamine. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent independently binds to the same targeting group. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent independently binds to a different targeting group, such as a targeting group having a different chemical structure.

[0022] In some embodiments, the targeting group is bound to the FXII RNAi agent without the use of an additional linker. In some embodiments, the targeting group is designed to facilitate the presence of a linker to facilitate binding to the FXII RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents may be bound to their respective targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents are each bound to their respective targeting groups using a different linker.

[0023] In another aspect, the present disclosure features a method for inhibiting FXII gene expression in a subject, the method comprising administering to the subject an FXII RNAi agent in an amount capable of inhibiting expression of the FXII gene, wherein the FXII RNAi agent comprises a sense strand and an antisense strand.

[0024] In some embodiments, a composition for in vivo delivery of an FXII RNAi agent to a liver cell, particularly a hepatocyte, is described, the composition comprising the FXII RNAi agent conjugated to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein ligand.

[0025] In some embodiments, pharmaceutical compositions comprising one or more FXII RNAi agents are described. In some embodiments, the FXII RNAi agent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The additional therapeutic agents may be other FXII RNAi agents (e.g., FXII RNAi agents targeting different sequences within the FXII target). The additional therapeutic agents may be small molecule drugs, antibodies, antibody fragments, aptamers, and / or vaccines. The FXII RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0026] Also described are methods for treating a human subject having or at risk of developing a pathological condition (e.g., a condition or disease) mediated at least in part by expression of FXII, comprising administering to the subject a therapeutically effective amount of an FXII RNAi agent and / or a composition containing an FXII RNAi agent. Methods of treating a subject with an FXII RNAi agent and / or a composition containing an FXII RNAi agent can optionally be combined with one or more steps of administering one or more additional (i.e., second) therapeutic agents or therapeutic agents. The FXII RNAi agent and the additional therapeutic agents can be administered alone or separately.

[0027] In some embodiments, disclosed herein is a method for treating (including prophylactic treatment) a pathological condition mediated at least in part by expression of FXII, comprising administering to a subject a therapeutically effective amount of an FXII RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or 3.

[0028] In some embodiments, disclosed herein is a method for inhibiting expression of the FXII gene, comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or 3.

[0029] In some embodiments, disclosed herein is a method for treating (including prophylactic treatment) a pathological condition (e.g., a condition or disease) mediated at least in part by expression of FXII, comprising administering to a subject a therapeutically effective amount of an FXII RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or 4.

[0030] In some embodiments, disclosed herein is a method for inhibiting expression of the FXII gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Tables 2 or 4.

[0031] In some embodiments, disclosed herein is a method for treating (including prophylactic treatment) a pathological condition mediated at least in part by expression of FXII, comprising administering to a subject a therapeutically effective amount of an FXII RNAi agent comprising a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.

[0032] In some embodiments, disclosed herein is a method for inhibiting expression of the FXII gene, comprising administering to a cell an FXII RNAi agent comprising a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.

[0033] In some embodiments, disclosed herein are methods for inhibiting expression of the FXII gene, comprising administering to a subject an FXII RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4 and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3. In another embodiment, disclosed herein are methods for inhibiting expression of the FXII gene, comprising administering to a subject an FXII RNAi agent comprising a sense strand consisting of a modified sequence of any of the sequences in Table 4 and an antisense strand consisting of a modified sequence of any of the sequences in Table 3.

[0034] In some embodiments, disclosed herein is a method for inhibiting expression of the FXII gene, comprising administering to a cell one or more FXII RNAi agents having a double-stranded structure described in Table 5.

[0035] In some embodiments, disclosed herein is a method for inhibiting expression of the FXII gene, comprising administering to a cell one or more FXII RNAi agents having a double-stranded structure described in Table 6.

[0036] The FXII RNAi agent disclosed herein is designed to target a specific position on the FXII gene (SEQ ID NO: 1). As defined herein, an antisense strand sequence is designed to target the FXII gene at a given position on the FXII gene if the 5'-terminal nucleobase of the antisense strand aligns with a position 19 nucleotides downstream (towards the 3' end) from the position on the gene when base-pairing with the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the FXII gene at position 127 must align with position 145 of the FXII gene when base-pairing with the gene. As provided herein, an FXII RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided that the antisense strand is at least 85% complementary (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary) to the gene over a core stretch sequence of at least 16 consecutive nucleotides. For example, in the case of an FXII RNAi agent disclosed herein that is designed to target position 127 of the FXII gene, the 5'-terminal nucleobase sequence of the antisense strand of the FXII RNAi agent must align with position 145 of the gene, provided that the antisense strand is at least 85% complementary (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary) to the gene over a core stretch sequence of at least 16 contiguous nucleotides; however, the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 145 of the FXII gene. Notably, as shown in various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the FXII RNAi agent (e.g., whether the FXII RNAi agent is designed to target the FXII gene at position 127, 91, 321, or another position) is critical to the degree of inhibition achieved by the FXII RNAi agent.

[0037] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where all or substantially all nucleotides are modified nucleotides.

[0038] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), where all or substantially all nucleotides are modified nucleotides.

[0039] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all nucleotides are modified nucleotides.

[0040] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein all or substantially all nucleotides are modified nucleotides.

[0041] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all nucleotides are modified nucleotides.

[0042] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where all or substantially all nucleotides are modified nucleotides.

[0043] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), where all or substantially all nucleotides are modified nucleotides.

[0044] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein all or substantially all nucleotides are modified nucleotides.

[0045] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein all or substantially all nucleotides are modified nucleotides.

[0046] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein all or substantially all nucleotides are modified nucleotides.

[0047] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein all or substantially all nucleotides are modified nucleotides.

[0048] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein all or substantially all nucleotides are modified nucleotides.

[0049] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein all or substantially all nucleotides are modified nucleotides.

[0050] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein all or substantially all nucleotides are modified nucleotides.

[0051] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein one or more nucleotides are modified nucleotides.

[0052] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein one or more nucleotides are modified nucleotides.

[0053] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein one or more nucleotides are modified nucleotides.

[0054] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein one or more nucleotides are modified nucleotides.

[0055] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein one or more nucleotides are modified nucleotides.

[0056] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein one or more nucleotides are modified nucleotides.

[0057] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein one or more nucleotides are modified nucleotides.

[0058] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all of the nucleotides are modified nucleotides.

[0059] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all of the nucleotides are modified nucleotides.

[0060] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all of the nucleotides are modified nucleotides.

[0061] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), in which all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), in which all or substantially all nucleotides are modified nucleotides.

[0062] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all of the nucleotides are modified nucleotides.

[0063] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all of the nucleotides are modified nucleotides.

[0064] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all of the nucleotides are modified nucleotides.

[0065] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896).

[0066] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827).

[0067] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855).

[0068] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846).

[0069] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829).

[0070] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868).

[0071] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866).

[0072] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD05333.

[0073] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04131.

[0074] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04157.

[0075] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04254.

[0076] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04623.

[0077] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04625.

[0078] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of AD04627.

[0079] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUG (SEQ ID NO:23), where one or more nucleotides are modified nucleotides, and SEQ ID NO:23 is located at positions 1 to 19 (5' to 3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUG (SEQ ID NO:23), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO:23 is located at positions 1 to 19 (5' to 3') of the antisense strand.

[0080] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGG (SEQ ID NO: 51), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 51 is located at positions 1-19 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGG (SEQ ID NO: 51), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 51 is located at positions 1-19 (5'→3') of the antisense strand.

[0081] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 87 is located at positions 1 to 19 (5' to 3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 87 is located at positions 1 to 19 (5' to 3') of the antisense strand.

[0082] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 90 is located at positions 1 to 19 (5' to 3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 90 is located at positions 1 to 19 (5' to 3') of the antisense strand.

[0083] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 93 is located at positions 1-19 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 93 is located at positions 1-19 (5'→3') of the antisense strand.

[0084] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), where one or more nucleotides are modified nucleotides, and SEQ ID NO: 37 is located at positions 1 to 19 (5' to 3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 37 is located at positions 1 to 19 (5' to 3') of the antisense strand.

[0085] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 804 is located at positions 1-21 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 804 is located at positions 1-21 (5'→3') of the antisense strand.

[0086] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO:751), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO:751 is located at positions 1-21 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO:751), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO:751 is located at positions 1-21 (5'→3') of the antisense strand.

[0087] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 673 is located at positions 1-21 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 673 is located at positions 1-21 (5'→3') of the antisense strand.

[0088] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO:793), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO:793 is located at positions 1-21 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO:793), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO:793 is located at positions 1-21 (5'→3') of the antisense strand.

[0089] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO:767), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO:767 is located at positions 1-21 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO:767), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO:767 is located at positions 1-21 (5'→3') of the antisense strand.

[0090] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 805 is located at positions 1 to 21 (5' to 3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO: 805 is located at positions 1 to 21 (5' to 3') of the antisense strand.

[0091] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO:787), where at least one or more nucleotides are modified nucleotides, and SEQ ID NO:787 is located at positions 1-21 (5'→3') of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO:787), where all or substantially all nucleotides are modified nucleotides, and SEQ ID NO:787 is located at positions 1-21 (5'→3') of the antisense strand.

[0092] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 804 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896).

[0093] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 751 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827).

[0094] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 673 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855).

[0095] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleic acid base sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 793 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of the nucleic acid base sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846).

[0096] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 767 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829).

[0097] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 805 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868).

[0098] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein at least one or more nucleotides are modified nucleotides, and SEQ ID NO: 787 is located at the 5' end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of a sequence that differs by 0, 1, 2, or 3 nucleotides from the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866).

[0099] The FXII RNAi agents described herein may include one or more modified nucleotides. The FXII RNAi agents described herein may also include one or more phosphorothioate internucleoside linkages.

[0100] The FXII RNAi agents described herein may also include one or more targeting or binding groups. In some embodiments, the FXII RNAi agents disclosed herein include one or more targeting groups. In some embodiments, the targeting group consists of an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand includes a galactose or galactose-derivative cluster. In some embodiments, the galactose-derivative cluster includes N-acetyl-galactosamine. In some embodiments, the targeting ligand includes an N-acetyl-galactosamine trimer. In some embodiments, the targeting group is conjugated to the sense strand of the FXII RNAi agent disclosed herein.

[0101] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (5'→3') (SEQ ID NO: 404), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0102] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usGfsgucuuUfcAfcUfuUfcuuggsusu (5'→3') (SEQ ID NO: 289), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0103] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (5'→3') (SEQ ID NO: 300), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0104] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (5'→3') (SEQ ID NO: 319), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0105] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (5'→3') (SEQ ID NO: 304), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0106] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (5'→3') (SEQ ID NO: 375), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0107] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (5'→3') (SEQ ID NO: 377), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0108] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') (SEQ ID NO: 643) of (NAG37)gsccaaggaGfCfAfuaaguacaaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0109] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usGfsgucuuUfcAfcUfuUfcuuggsusu (SEQ ID NO: 289), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') of (NAG25)sasaccaagaAfAfGfugaaagacc(invdA) (SEQ ID NO: 1277), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invdA) is inverted deoxyriboadenosine (invdA); and (NAG25) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0110] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (SEQ ID NO: 300), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') (SEQ ID NO: 519) of (NAG25)sasggaacucAfAfUfaaagugcuuas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG25) is a targeting ligand comprising N-acetyl-galactosamine having the structure shown in Table 7 herein.

[0111] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (SEQ ID NO: 319), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') (SEQ ID NO: 526) of (NAG25)sascucaauaAfAfGfugcuuugaaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG25) is a targeting ligand comprising an N-acetyl-galactosamine having the structure shown in Table 7 herein.

[0112] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (SEQ ID NO: 304), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') (SEQ ID NO: 610) of (NAG37)sasacucaauAfAfAfgugcuuugaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0113] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') (SEQ ID NO: 611) of (NAG37)scsccaaggaGfCfAfuaaguacaaas(invAb), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0114] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5' to 3') of usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (SEQ ID NO: 377), and The sense strand of the RNAi agent comprises or consists of the sequence (5'→3') of (NAG37)s(invAb)sccaaggAfGfCfauaaguacaauus(invAb) (SEQ ID NO: 613), where a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is an N-acetyl-galactosamine-containing targeting ligand having the structure shown in Table 7 herein.

[0115] In some embodiments, FXII as described herein The RNAi agent comprises one or more targeting groups having the structure of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as set forth in Table 7.

[0116] In some embodiments, the FXII RNAi agents described herein contain at the 5' end of the sense strand a nucleotide sequence selected from the group consisting of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG56), (NAG57), (NAG58), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG65), (NAG66), (NAG67), (NAG68), (NAG69), (NAG70), (NAG71), (NAG72), (NAG73), (NAG74), (NAG75), (NAG76), (NAG77), (NAG78), (NAG79), (NAG80), (NAG81), (NAG82), (NAG83), (NAG84), (NAG85), (NAG86), (NAG87), (NAG88), (NAG89), (NAG90), (NAG91), (NAG92), (NAG93), (NAG94), (NAG95), (NAG96), (NAG97), (NAG (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0117] The FXII RNAi agent disclosed herein can be formulated into a composition comprising one or more of the disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient. In some embodiments, the composition disclosed herein comprising one or more of the disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient is a pharmaceutical composition.

[0118] Pharmaceutical compositions containing one or more FXII RNAi agents can be administered in a variety of ways, depending on whether local or systemic treatment is desired. Administration can be by any method commonly known in the art, including, but not limited to, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, subcutaneous administration (e.g., via an implantable device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0119] In some embodiments, compositions comprising one or more of the disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient can further comprise one or more additional therapeutic agents or therapeutic agents.

[0120] In some embodiments, the compositions described herein, including one or more FXII RNAi agents, are packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the compositions described herein are administered parenterally.

[0121] The FXII RNAi agents disclosed herein and compositions comprising same may be administered to a subject for treatment (including prophylactic treatment) of a pathological condition (e.g., a condition or disease) mediated at least in part by expression of FXII. Conditions or diseases in a subject that may be treated, prevented, and / or controlled by administration of the FXII RNAi agents disclosed herein and compositions comprising same include HAE, AAE, ACE inhibitor-associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thrombo-occlusive disease, and perioperative venous occlusive disease prevention.

[0122] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may be independently modified or unmodified.

[0123] As used herein, "RNAi agent" (also referred to as "RNAi trigger") refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of sequence-specifically degrading or inhibiting translation of a messenger RNA (mRNA) transcript of a target mRNA. As used herein, an RNAi agent may operate via the RNA interference mechanism (i.e., inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. As used herein, an RNAi agent is considered to operate primarily via the RNA interference mechanism, although the disclosed RNAi agents are not constrained or limited to a particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the target mRNA (e.g., FXII mRNA). An RNAi agent may contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0124] As used herein, the terms "silence," "decreasing, decreasing, reducing," "inhibit," "down-regulate," or "knockdown," when used in reference to the expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from that gene or the level of polypeptide, protein, or protein subunit translated from mRNA in a cell, group of cells, tissue, organ, or subject in which that gene is transcribed, is lower when such cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a cell, group of cells, tissue, organ, or subject that has not been so treated.

[0125] As used herein, the terms "sequence" and "base sequence" mean the sequence or order of nucleic acid bases or nucleotides described as a sequence of letters using standard nomenclature.

[0126] As used herein, a "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a standard building block of all nucleic acids and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. As used herein, the term "nucleotide" can include modified nucleotides (e.g., nucleotide mimics, abasic residues (Abs), or surrogate replacement moieties).

[0127] As used herein, and unless otherwise specified, when used to describe a first nucleobase or base sequence (e.g., an RNAi agent sense strand or targeting mRNA) in relation to a second nucleobase or base sequence (e.g., an RNAi agent antisense strand or single-stranded antisense oligonucleotide), the term "complementary" refers to the ability of an oligonucleotide or polynucleotide comprising the first base sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or analogous conditions in vitro)) with an oligonucleotide or polynucleotide comprising the second base sequence and form a double-stranded or double-helical structure under specific standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and also include natural or modified nucleotides or nucleotide mimics, at least to the extent that they satisfy the above hybridization requirements. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0128] As used herein, "perfectly complementary" or "fully complementary" means that every (100%) nucleobase or nucleotide in a contiguous sequence of a first polynucleotide hybridizes with the same number of nucleobases or nucleotides in a contiguous sequence of a second polynucleotide. The contiguous sequence may include all or a portion of the first or second base sequence.

[0129] As used herein, "partially complementary" means that in a hybridizing pair of nucleobase sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.

[0130] As used herein, "substantially complementary" means that in a hybridizing pair of nucleobase sequences, at least 85%, but not all, of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to matching nucleobases or nucleotides between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of FXII mRNA.

[0131] As used herein, the term "substantially identical" or "substantial identity," when used with respect to a nucleic acid sequence, means that the nucleic acid sequence comprises a sequence having at least about 85% or more sequence identity to a reference sequence, e.g., at least 90%, at least 95%, or at least 99% identity. The percent sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percent sequence identity is calculated by determining the number of positions with identical nucleic acid bases in both sequences to determine the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to determine the percent sequence identity. The invention disclosed herein encompasses base sequences substantially identical to those disclosed herein.

[0132] As used herein, the terms "treat," "treatment," and the like refer to a method or process performed to provide relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" may include prevention, management, prophylactic treatment, and / or suppression of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0133] As used herein, when referring to an RNAi agent, the phrase "introducing into a cell" refers to functionally delivering an RNAi agent to a cell.The phrase "functionally delivering" refers to delivering an RNAi agent to a cell so that the RNAi agent can have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0134] Unless otherwise specified, the following symbols are used herein: [ka] The use of means that any group may be attached as long as it complies with the scope of the invention described herein.

[0135] As used herein, the term "isomer" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereomers," and stereoisomers that are non-superimposable mirror images are termed "enantiomers," or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a "chiral center."

[0136] As used herein, unless identified as having a particular stereochemistry within a structure, for each structure in which asymmetric centers exist, giving rise to enantiomers, diastereomers, or other stereoisomers, each structure disclosed herein is intended to represent all possible such isomers, including optically pure and racemic forms. For example, the structures disclosed herein are intended to encompass not only single stereoisomers but also mixtures of diastereomers.

[0137] The phrase "consisting of," as used in any claim herein, excludes any element, step, or ingredient not specified in the claim. The phrase "consisting essentially of," as used in any claim herein, limits the scope of the claim to the specified materials or steps, and to steps that do not materially affect the basic and novel characteristics of the claimed invention.

[0138] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (such as N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, the structures disclosed herein as used herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (such as pH), as will be readily understood by those skilled in the art.

[0139] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in practicing or testing the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and practices are for illustrative purposes only and are not intended to be limiting.

[0140] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]

[0141] [Figure 1] Figure 1 is a graph showing knockdown in mice treated with a single subcutaneous dose of 3 mg / kg of the FXII RNAi agent AD03632 on day 1 relative to saline-treated mice. The standard error of the mean is displayed as error bars graphed above the mean.

[0142] [Figure 2] Figure 2 is a graph showing knockdown in mice treated with (i) a single subcutaneous administration of 0.6 mg / kg of FXII RNAi agent AD03632 (dashed line with triangles), (ii) a single subcutaneous administration of 2 mg / kg of FXII RNAi agent AD03632 (solid line with triangles), and (iii) saline (solid line with circles). Standard deviations are displayed as error bars graphed above the mean.

[0143] [Figure 3]Figure 3 is a graph showing knockdown in mice treated with (ii) a single subcutaneous dose of 0.6 mg / kg of the FXII RNAi agent AD03632 every week for 6 consecutive weeks starting on day 1 (dashed line with squares), (iii) a single subcutaneous dose of 2 mg / kg of the FXII RNAi agent AD03632 every week for 6 consecutive weeks starting on day 1, and (iv) saline (solid line with circles). The standard error of the mean is displayed as error bars graphed above the mean.

[0144] [Figure 4] Figure 4 is a plot showing FXII serum levels in rats treated with a single subcutaneous administration of either (i) saline, (ii) heparin (1000 U / kg, administered by intubation), (iii) 1 mg / kg of the FXII RNAi agent AD03224, or (iv) 3 mg / kg of the FXII RNAi agent AD03224 on day 1.

[0145] [Figure 5] Figure 5 is a plot showing the weight of thrombus taken on day 14 from an arteriovenous shunt model in rats after a single subcutaneous administration on day 1 of either (i) saline, (ii) heparin, (iii) 1 mg / kg of FXII RNAi agent AD03224, or (iv) 3 mg / kg of FXII RNAi agent AD03224. DETAILED DESCRIPTION OF THE INVENTION

[0146] RNAi agents Disclosed herein are RNAi agents (also referred to herein as FXII RNAi agents or FXII RNAi triggers) for inhibiting expression of the Factor XII gene. Each FXII RNAi agent comprises a sense strand and an antisense strand. The sense strand and antisense strand can each be 16-30 nucleotides in length. In some embodiments, the sense strand and antisense strand can each be 17-26 nucleotides in length. The sense and antisense strands can be the same length or different lengths. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are 21 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agent are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0147] In some embodiments, the region of perfect or substantial complementarity between the sense and antisense strands is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfect or substantially complementary).

[0148] The sense and antisense strands each contain a core stretch sequence that is 16 to 23 nucleobases in length. The core stretch sequence of the antisense strand is 100% (fully) complementary or at least about 85% (substantially) complementary to a base sequence present in the FXII mRNA target (e.g., also referred to as the target sequence). The core stretch sequence of the sense strand is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch sequence of the antisense strand, such that the core stretch sequence of the sense strand is completely identical or at least about 85% identical to a base sequence present in the FXII mRNA target (the target sequence). The core stretch sequence of the sense strand may be the same length as the corresponding antisense core sequence, or may be a different length. In some embodiments, the core stretch sequence of the antisense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the core stretch sequence of the sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0149] Examples of sequences used to generate FXII RNAi agents are listed in Tables 2, 3, 4, and 6. Examples of FXII RNAi agent duplexes containing the sense and antisense strand sequences of Tables 2, 3, and 4 are listed in Table 5.

[0150] The sense and antisense strands of the FXII RNAi agent anneal to form a duplex. The sense and antisense strands of the FXII RNAi agent may be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the core stretch sequence of the sense strand is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the core stretch sequence of the sense strand comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 base sequence of the core stretch sequence of the antisense strand (i.e., the sense and antisense core stretch sequences of the FXII RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).

[0151] In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

[0152] In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 6. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 6.

[0153] The sense strand and / or the antisense strand may optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, at one of the 5' ends, or at both the 3' and 5' ends of the core stretch sequence. If present, the additional nucleotides in the antisense strand may or may not be complementary to the sequence of the corresponding FXII mRNA. If present, the additional nucleotides in the sense strand may or may not be identical to the sequence of the corresponding FXII mRNA. If present, the additional nucleotides in the antisense strand may or may not be complementary to the additional nucleotides in the corresponding sense strand.

[0154] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extension nucleotides of the sense strand may or may not be complementary to any of the nucleotides of the corresponding core stretch sequence nucleotides or extension nucleotides of the antisense strand. Conversely, the extension nucleotides of the antisense strand may or may not be complementary to any of the nucleotides of the corresponding core stretch nucleotides or extension nucleotides of the sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent comprise 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of one strand are base-paired with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more 3' extension nucleotides of one strand are not base-paired with one or more 5' extension nucleotides of the other strand. In some embodiments, the FXII RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension.

[0155] In some embodiments, the FXII RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the FXII RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises a uracil or thymidine nucleotide or a nucleotide complementary to the corresponding FXII mRNA sequence. In some embodiments, the 3' antisense strand extension comprises or consists of one of the following sequences, including but not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each shown 5'→3').

[0156] In some embodiments, the 3'-end of the antisense strand may contain an additional abasic residue (Ab). An "abasic residue" or "abasic site" is a nucleotide or nucleoside that lacks a nucleobase at the first position of the sugar. In some embodiments, Ab or AbAb may be added to the 3'-end of the antisense strand. In some embodiments, the abasic residue may be added as an inverted abasic residue (invAb) (see Table 7). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16).

[0157] In some embodiments, the FXII RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide corresponding to a nucleotide in the FXII mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, including but not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each represented 5'→3').

[0158] In some embodiments, the 3'-end of the sense strand may include an additional abasic residue. In some embodiments, UUAb, UAb, or Ab is added to the 3'-end of the sense strand. In some embodiments, the one or more abasic residues added to the 3'-end of the sense strand are inverted (invAb). In some embodiments, one or more inverted abasic residues or abasic sites may be inserted between the target ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, inclusion of one or more inverted abasic residues or abasic sites at or near one or more ends of the sense strand of the RNAi agent allows for enhanced activity or other desirable properties of the RNAi agent.

[0159] In some embodiments, the FXII RNAi agent comprises a sense strand having a 5' extension 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises a uracil or adenosine nucleotide or a nucleotide corresponding to a nucleotide in the FXII mRNA sequence. In some embodiments, the sense strand 5' extension comprises or consists of one of the following sequences, including but not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each shown 5'→3'). The sense strand may comprise a 3' extension and / or a 5' extension.

[0160] In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, the one or more abasic residues added to the 5' end of the sense strand can be inverted (e.g., invAb). In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of an RNAi agent. In some embodiments, inclusion of one or more inverted abasic residues at or near one or both ends of the sense strand of an RNAi agent can enhance the activity or other desirable properties of the RNAi agent. In some embodiments, abasic (deoxyribose) residues can be substituted with ribitol (abasic ribose) residues.

[0161] In some embodiments, the 3'-terminal core stretch sequence of the antisense strand or the 3'-terminal sequence of the antisense strand may comprise an inverted abasic residue (invAb (see Table 7)).

[0162] Exemplary sequences for use in forming FXII RNAi agents are set forth in Tables 2, 3, 4, and 6. In some embodiments, the FXII RNAi agent antisense strand comprises any of the sequences in Tables 2, 3, or 6. In some embodiments, the FXII RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 2, Table 3, or Table 4. In certain embodiments, the FXII RNAi agent antisense strand comprises or consists of any of the modified sequences in Table 4. In some embodiments, the FXII RNAi agent sense strand comprises any of the sequences in Tables 2, 3, or 5. In some embodiments, the FXII RNAi agent sense strand comprises nucleotides (5' end to 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-2 or consisting of a modified sequence comprising a sequence of 1, 3 to 22, 3 to 23, 3 to 24, 3 to 25, 3 to 26, 4 to 21, 4 to 22, 4 to 23, 4 to 24, 4 to 25, 4 to 26, 5 to 22, 5 to 23, 5 to 24, 5 to 25, 5 to 26, 6 to 23, 6 to 24, 6 to 25, 2 to 26, 7 to 24, 7 to 25, or 7 to 26.

[0163] In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense and antisense strands of an RNAi agent described herein comprise different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, a blunt end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0164] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand and may form either a 3' or 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a ragged end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a ragged end and a 5' overhanging end, a ragged end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two ragged ends, or two blunt ends.

[0165] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can increase the serum stability of these compounds while simultaneously maintaining the activity of the compounds within cells, and can minimize the potential for activating interferon activity in humans upon administration of such polynucleotide or oligonucleotide constructs.

[0166] In some embodiments, the FXII RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the FXII RNAi agent is prepared as a sodium salt. Such forms are within the scope of the invention disclosed herein.

[0167] Modified Nucleotides In some embodiments, an FXII RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (referred to herein as Ab), 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides (referred to herein as invdN, invN, invn), modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs, referred to herein as N UNA or NUNA), locked nucleotides (referred to herein as N LNA or NLNA), 3'-O-methoxy (2' internucleoside linked) nucleotides (referred to herein as 3'-OMen), 2'-F-arabinonucleotides (referred to herein as NfANA or Nf ANA, 5'-Me, 2'-fluoronucleotides (referred to herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (referred to herein as vpdN), vinyl phosphonate-containing nucleotides, and cyclopropyl phosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2'-position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (referred to herein as a lowercase "n" in the base sequence), 2'-deoxy-2'-fluoro nucleotides (referred to herein as Nf, also referred to as 2'-fluoro nucleotides), 2'-deoxy nucleotides (referred to herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (referred to herein as NM or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need to be uniformly modified. Conversely, multiple modifications can be incorporated into a single FXII RNAi agent or even a single nucleotide thereof. The sense and antisense strands of the FXII RNAi agent can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

[0168] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, Examples of suitable substituted adenines and guanines include 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0169] In some embodiments, all or substantially all nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all nucleotides present are modified nucleotides is an RNAi agent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides of both the sense strand and the antisense strand are ribonucleotides (i.e., modified). As used herein, substantially all present sense strands are sense strands in which two or fewer (i.e., 0, 1, or 2) nucleotides of the sense strand are ribonucleotides. As used herein, substantially all present antisense strands are antisense strands in which two or fewer (i.e., 0, 1, or 2) nucleotides of the antisense strand are ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent are ribonucleotides.

[0170] Modified internucleoside linkages In some embodiments, one or more nucleotides of an FXII RNAi agent are linked by a non-standard bond or backbone (i.e., a modified internucleoside bond or backbone). Modified internucleoside bond or backbone includes, but is not limited to, 5'-phosphorothioate group (represented herein by a lowercase "s"), chiral phosphorothioate, thiophosphate, phosphorodithioate, phosphotriester, aminoalkyl-phosphotriester, alkylphosphonate (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonate, phosphinate, phosphoramidate (e.g., 3' -aminophosphoramidates, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked boranophosphates with inverted polarity, or boranophosphate analogs, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones containing mixed N, O, S, and CH moieties.

[0171] In some embodiments, the sense strand of an FXII RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. The antisense strand of an FXII RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an FXII RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an FXII RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0172] In some embodiments, the FXII RNAi agent sense strand can contain at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between nucleotides 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, the FXII RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, the FXII RNAi agent comprises at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.

[0173] In some embodiments, the FXII RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0174] FXII RNAi agent In some embodiments, the FXII RNAi agents disclosed herein target the FXII gene at or near the FXII sequence shown in Table 1. In some embodiments, the antisense strand of the FXII RNAi agents disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to an FXII 19-mer target sequence disclosed in Table 1.

[0175] [Table 1]

[0176] In some embodiments, the FXII RNAi agent comprises an antisense strand in which position 19 of the antisense strand (5'→3') can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, the FXII RNAi agent comprises an antisense strand in which position 1 of the antisense strand (5'→3') can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0177] In some embodiments, the FXII RNAi agent comprises an antisense strand in which position 2 of the antisense strand (5'→3') can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, the FXII RNAi agent comprises an antisense strand in which positions 2-18 of the antisense strand (5'→3') can base pair with positions 18-2 of a 19-mer target sequence disclosed in Table 1.

[0178] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3') can be perfectly complementary to the FXII gene or can be non-complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') forms an A:U or U:A base pair with the sense strand.

[0179] In some embodiments, the FXII RNAi agent antisense strand comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2, Table 3, or Table 6. In some embodiments, the FXII RNAi agent sense strand comprises the sequence of nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0180] In some embodiments, the FXII RNAi agent comprises (i) an antisense strand comprising a sequence of nucleotides 2 to 18 or 2 to 19 (5' end to 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 6, and (ii) a sense strand comprising a sequence of nucleotides 1 to 17, 1 to 18, or 2 to 18 (5' end to 3' end) of any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0181] In some embodiments, the FXII RNAi agent comprises the core 19-mer base sequence shown in Table 2 below.

[0182] [Table 2-1] [Table 2-2] [Table 2-3] The sense and antisense strands of an FXII RNAi agent comprising or consisting of a base sequence in Table 2 can be modified or unmodified nucleotides. In some embodiments, an FXII RNAi agent having sense and antisense strand sequences comprising or consisting of a base sequence in Table 2 is all or substantially all modified nucleotides.

[0183] In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0184] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected. In some embodiments, the N listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position in the other strand. In some embodiments, the N listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position in the other strand. In some embodiments, the N listed in a sequence disclosed in Table 2 has the same nucleobase as the N nucleotide at the corresponding position in the other strand. In some embodiments, the N listed in a sequence disclosed in Table 2 has a different nucleobase than the N nucleotide at the corresponding position in the other strand.

[0185] The sense and antisense strands of certain modified FXII RNAi agents are set forth in Tables 3 and 4. The modified FXII RNAi agent antisense strands, as well as their corresponding unmodified nucleobase sequences, are set forth in Table 3. The modified FXII RNAi agent sense strands, as well as their corresponding unmodified sequences, are set forth in Table 4. In forming FXII RNAi agents, as in Table 2, each nucleotide of the corresponding base sequences listed in Tables 3 and 4 above can be a modified nucleotide.

[0186] The FXII RNAi agents described herein are formed by annealing a sense strand and an antisense strand, where a sense strand containing a sequence listed in Table 2, Table 3, or Table 6 can hybridize to an antisense strand containing a sequence listed in Table 2, Table 4, or Table 6, provided that the two sequences share a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 base sequence.

[0187] In some embodiments, the antisense strand of the FXII RNAi agent comprises the base sequence of any of the sequences in Table 2, Table 3, or Table 6.

[0188] In some embodiments, the FXII RNAi agent consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, Table 4, or Table 6.

[0189] Examples of antisense strands containing modified nucleotides are listed in Table 3. Examples of sense strands containing modified nucleotides are listed in Table 4.

[0190] As used in Tables 3 and 4, the following notations are used to denote modified nucleotides, targeting groups, and linking groups: One of skill in the art will readily understand that, unless otherwise indicated in the sequence, when present in an oligonucleotide, the monomers are linked to each other by 5'-3'-phosphodiester bonds; A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3′-phosphate; U = uridine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate N UNA = 2',3'-seconucleotide mimic (unlocked nucleobase Analogue)-3'-phosphate N UNA s = 2',3'-seconucleotide mimic (unlocked nucleobase Analogue)-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N = see table 7 a_2Ns = See Table 7 pu_2N = see table 7 pu_2Ns = see table 7 Npu = see table 7 Nus = see table 7 N LNA= locked nucleotide Nf ANA = 2'-F-arabinonucleotide NM = 2'-methoxyethyl nucleotide AM = 2'-methoxyethyl adenosine-3'-phosphate AMs = 2'-methoxyethyl adenosine-3'-phosphorothioate TM = 2'-methoxyethylthymidine-3'-phosphate TMs = 2'-methoxyethylthymidine-3'-phosphorothioate R = Ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linkage) nucleotide) (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide, see Table 7 (invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5'- Phosphorothioates, see Table 7 (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate linkage vpdN = vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me,2'-fluoronucleotide cPrp = cyclopropylphosphonate, see Table 7 epTcPr = see Table 7 epTM = see Table 7 (Chol-TEG) ​​= See Table 7 (TEG-Biotin) = See Table 7 (PEG-C3-SS) = See Table 7 (Alk-SS-C6) = See Table 7 (C6-SS-Alk) = See Table 7 (C6-SS-Alk-Me) = See Table 7

[0191] Those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the 3' position of each given monomer ex vivo instead of a phosphate moiety. Unless otherwise specified herein, this understanding of those skilled in the art will apply when describing the FXII RNAi agents and compositions of FXII RNAi agents disclosed herein.

[0192] Targeting and binding groups include the following, the chemical structures of which are shown in Table 7: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG 26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30 )s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and / or antisense strand may have any of the targeting or binding groups described above, as well as other targeting or binding groups conjugated to the 5' and / or 3' end of the sequence.

[0193] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] Table 3-6 Table 3-7 Table 3-8 Table 3-9 Table 3-10 Table 3-11

[0194] Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 4-11

[0195] The FXII RNAi agents described herein are formed by annealing a sense strand and an antisense strand, where a sense strand containing a sequence listed in Table 2, Table 4, or Table 6 can hybridize to an antisense strand containing a sequence listed in Table 2, Table 3, or Table 6, provided that the two sequences share a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 base sequence.

[0196] In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.

[0197] In some embodiments, the antisense strand of the FXII RNAi agent comprises the base sequence of any of the sequences in Table 2, Table 3, or Table 6. In some embodiments, the antisense strand of the FXII RNAi agent comprises the sequence of nucleotides (5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, 1-25, 2-25, 1-16, or 2-16 of any of the sequences in Table 2, Table 3, or Table 6. In certain embodiments, the antisense strand of the FXII RNAi agent comprises or consists of any one of the modified sequences in Table 3. In certain embodiments, the antisense strand of the FXII RNAi agent comprises or consists of any one of the modified sequences in Table 6.

[0198] In some embodiments, the sense strand of the FXII RNAi agent comprises the base sequence of any of the sequences in Table 2, Table 4, or Table 6. In some embodiments, the sense strand of the FXII RNAi agent comprises a sequence of nucleotides (5' end to 3' end) 1 to 17, 2 to 17, 3 to 17, 4 to 17, 1 to 18, 2 to 18, 3 to 18, 4 to 18, 1 to 19, 2 to 19, 3 to 19, 4 to 19, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 1 to 21, 2 to 21, 3 to 21, 4 to 21, 1 to 22, 2 to 22, 3 to 22, 4 to 22, 1 to 23, 2 to 23, 3 to 23, 4 to 23, 1 to 24, 2 to 24, 3 to 24, 4 to 24, 1 to 25, 2 to 25, 3 to 25, 4 to 25, 1 to 26, 2 to 26, 3 to 26, or 4 to 26 of any of the sequences in Table 2, Table 4, or Table 6. In certain embodiments, the sense strand of the FXII RNAi agent comprises or consists of any one of the modified sequences in Table 5. In certain embodiments, the sense strand of the FXII RNAi agent comprises or consists of any one of the modified sequences in Table 6.

[0199] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3') can be perfectly complementary to the FXII gene or can be non-complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') is U, A, or dT (or modified versions of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') forms an A:U or U:A base pair with the sense strand.

[0200] In some embodiments, the FXII RNAi agent antisense strand comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2, Table 3, or Table 6. In some embodiments, the FXII RNAi agent sense strand comprises the sequence of nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0201] In some embodiments, the FXII RNAi agent comprises (i) an antisense strand comprising a sequence of nucleotides 2 to 18 or 2 to 19 (5' end to 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 6, and (ii) a sense strand comprising a sequence of nucleotides 1 to 17, 1 to 18, or 2 to 18 (5' end to 3' end) of any of the sense strand sequences in Table 2, Table 4, or Table 6.

[0202] A sense strand comprising a sequence listed in Table 2, Table 4, or Table 6 can hybridize to an antisense strand comprising a sequence listed in Table 2, Table 3, or Table 6, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 base sequence. In some embodiments, an FXII RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3. Certain representative sequence pairings are exemplified by the duplex ID numbers shown in Tables 5 and 6.

[0203] In some embodiments, the FXII RNAi agent comprises any duplex represented by any of the duplex ID numbers provided herein. In some embodiments, the FXII RNAi agent consists of any duplex represented by any of the duplex ID numbers provided herein. In some embodiments, the FXII RNAi agent comprises any duplex sense and antisense strand base sequences represented by any of the duplex ID numbers provided herein. In some embodiments, the FXII RNAi agent comprises any duplex sense and antisense strand base sequences represented by any of the duplex ID numbers provided herein, and a targeting group and / or binding group, wherein the targeting group and / or binding group are covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the FXII RNAi agent comprises any duplex sense and antisense strand modified base sequences represented by any of the duplex ID numbers provided herein. In some embodiments, the FXII RNAi agent comprises any double-stranded sense and antisense strand modified base sequence represented by any of the double-strand ID numbers provided herein, and a targeting group and / or binding group, wherein the targeting group and / or binding group is covalently attached to the sense strand or the antisense strand.

[0204] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having the base sequence of an antisense strand / sense strand duplex in Table 2, Table 5, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

[0205] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having the base sequence of an antisense strand / sense strand duplex in Table 2, Table 5, or Table 6, and further comprises a targeting group selected from the group consisting of: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG 28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the targeting group is (NAG25) or (NAG25) as defined in Table 7. In other embodiments, the targeting group is (NAG37) or (NAG37) as defined in Table 7.

[0206] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having a modified base sequence of any of the antisense and / or sense strand base sequences of any of the duplexes in Table 5.

[0207] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having modified base sequences of any of the antisense and / or sense strand base sequences of any duplex in Table 5, and comprises an asialoglycoprotein receptor ligand targeting group.

[0208] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the double-stranded structure of any of the duplexes in Table 5.

[0209] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0210] [Table 6-1] [Table 6-2]

[0211] In some embodiments, the FXII RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agents described herein knock down or inhibit expression of one or more FXII genes in vivo when delivered to cells expressing the FXII gene.

[0212] Targeting Groups, Binding Groups, and Delivery Vehicles In some embodiments, the FXII RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a delivery polymer, or a delivery vehicle. The non-nucleotide group may enhance targeting, delivery, or binding of the RNAi agent. Examples of targeting groups and linking groups are listed in Table 7. The non-nucleotide group may be covalently attached to the 3' and / or 5' end of the sense strand and / or the antisense strand. In some embodiments, the FXII RNAi agent comprises a non-nucleotide group attached to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is attached to the 5' end of the FXII RNAi agent sense strand. The non-nucleotide group may be attached to the RNAi agent directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide group is attached to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0213] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate, hi some embodiments, the non-nucleotide group promotes endocytosis of the RNAi agent.

[0214] The targeting group or targeting moiety enhances the pharmacokinetics or biodistribution properties of the conjugate or the RNAi agent to which it is attached, improving cell-specific distribution and cell-specific uptake of the conjugate or RNAi agent. The targeting group can be monovalent, divalent, trivalent, tetravalent, or have a higher valency relative to the target to which it is directed. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, the targeting group is attached to the RNAi agent using a linker, such as a PEG linker or, in some instances, one, two, or three abasic and / or ribitol (abasic ribose) residues, which can function as linkers. In some embodiments, the targeting group comprises a galactose-derivative cluster.

[0215] The FXII RNAi agents described herein may be synthesized with a reactive group, e.g., an n-amine group, at the 5' end. The reactive group may be used to subsequently attach a targeting group using methods typical in the art.

[0216] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose that have affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (see, for example, ST Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0217] Galactose derivatives have been used to target molecules to hepatocytes in vivo via binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of an asialoglycoprotein receptor ligand to the asialoglycoprotein receptor promotes cell-specific targeting to hepatocytes and endocytosis of molecules into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. Preparation of targeting groups such as galactose derivative clusters is described in U.S. Patent Application No. 15 / 452,324 and U.S. Patent Publication No. 2017 / 0253875, both of which are incorporated herein by reference in their entireties.

[0218] As used herein, a galactose derivative cluster includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through the C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a triantennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster includes a plurality of N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster includes three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraantennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster includes four N-acetyl-galactosamines.

[0219] As used herein, a galactose derivative trimer contains three galactose derivatives each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives each linked to a central branch point. The galactose derivatives may be linked to the central branch point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, e.g., US Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the linkage of three galactose derivatives and further allows for the linkage of the branch point to an RNAi agent. An example of a branch point group is dilysine or diglutamic acid. Attachment of the branch point to the RNAi agent can be via a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0220] Embodiments of the present disclosure include pharmaceutical compositions for in vivo delivery of FXII RNAi agents to hepatocytes. Such pharmaceutical compositions include, for example, FXII RNAi agents conjugated to galactose derivative clusters. In some embodiments, the galactose derivative clusters comprise galactose derivative trimers, which may be, for example, N-acetyl-galactosamine trimers, or galactose derivative tetramers, which may be, for example, N-acetyl-galactosamine tetramers.

[0221] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29) as defined in Table 7. s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

[0222] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group or a delivery polymer or delivery vehicle. The linking group can be attached to the 3' or 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0223] A linker or linking group is a connection between two atoms that connects one chemical group or segment of interest (such as an RNAi agent) to another chemical group or segment of interest (e.g., a targeting group or delivery polymer) via one or more covalent bonds. Labile linkages include labile bonds. A bond optionally includes a spacer that increases the distance between the two joined atoms. The spacer can provide additional flexibility and / or length to the bond. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, or sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the description.

[0224] Any of the FXII RNAi agent sequences listed in Tables 2, 3, 4, or 6 may include a 3' or 5' targeting group or linking group, whether modified or unmodified. Alternatively, any of the FXII RNAi agent sequences listed in Tables 3 or 4 that include a 3' or 5' targeting group or linking group may not include a 3' or 5' targeting group or linking group, or may include a different 3' or 5' targeting group or linking group, including, but not limited to, those shown in Table 7. Any of the FXII RNAi agent duplexes listed in Tables 2, 5, or 6, whether modified or unmodified, may include an additional targeting group or linking group, including, but not limited to, those shown in Table 7, which may be attached to the 3' or 5' end of either the sense or antisense strand of the FXII RNAi agent duplex.

[0225] Examples of targeting groups and linking groups are described in Table 7. Table 4 provides several embodiments of FXII RNAi agent sense strands with targeting groups or linking groups linked to the 5' or 3' end.

[0226] Table 7-1 Table 7-2 Table 7-3 Table 7-4 Table 7-5 Table 7-6 Table 7-7 Table 7-8 Table 7-9 Table 7-10 Table 7-11 Table 7-12 Table 7-13 Table 7-14 Table 7-15 Table 7-16 Table 7-17

[0227] As will be understood by one of skill in the art in light of the above structures and the description provided herein, in each of the above structures in Table 7, NAG comprises N-acetyl-galactosamine or other asialoglycoprotein receptor ligands. For example, in some embodiments, NAG in the structures shown in Table 7 is represented by the following structure: [ka]

[0228] Each (NAGx) may be linked to an FXII RNAi agent via a phosphate or phosphorothioate group (such as (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or other linking group (such as those shown in (NAG25), (NAG30), and (NAG31)).

[0229] [ka] Other linking groups known in the art may also be used.

[0230] In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of an RNAi agent to a cell or tissue. The delivery vehicle may include or consist of, but is not limited to, a polymer, such as an amphiphilic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine. In some embodiments, the RNAi agent may be combined with a lipid, nanoparticle, polymer, liposome, micelle, DPC, or other delivery system available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

[0231] Pharmaceutical Compositions and Formulations The FXII RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, the pharmaceutical composition comprises at least one FXII RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting expression of a target mRNA in a target cell, cell population, tissue, or organism. The pharmaceutical composition can be used to treat a subject with a disease or disorder that would benefit from a reduction in the level of the target mRNA or inhibition of expression of the target gene. The pharmaceutical composition can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from a reduction in the level of the target mRNA or inhibition of expression of the target gene. In one embodiment, a method comprises administering to a subject to be treated an FXII RNAi agent bound to a target ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an FXII RNAi agent, thereby forming a pharmaceutical formulation suitable for delivery to a subject, including a human.

[0232] Pharmaceutical compositions and methods comprising the FXII RNAi agents disclosed herein reduce the level of target mRNA in a cell, a group of cells, a group of cells, a tissue, or a subject, including, for example, inhibiting expression of FXII mRNA in a subject by administering to the subject a therapeutically effective amount of an FXII RNAi agent described herein.

[0233] In some embodiments, the described pharmaceutical compositions comprising FXII RNAi agents are used to treat or manage clinical symptoms in subjects with diseases or disorders that would benefit from inhibition of FXII mRNA expression (e.g., including HAE, AAE, ACE inhibitor-associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thrombo-occlusive disease, and perioperative venous occlusive disease prophylaxis). In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed FXII RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0234] The described pharmaceutical compositions comprising FXII RNAi agents can be used to treat at least one symptom in a subject with a disease or disorder that would benefit from reducing or inhibiting FXII mRNA expression. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising an FXII RNAi agent, thereby treating the symptom. In another embodiment, the subject is administered an effective amount of one or more FXII RNAi agents prophylactically, thereby preventing at least one symptom.

[0235] The administration route is the route by which the FXII RNAi agent comes into contact with the body. Generally, methods for administering drugs and oligonucleotides and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The FXII RNAi agent disclosed herein can be administered by an appropriate route using a formulation appropriately prepared for a particular route. Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0236] Pharmaceutical compositions containing the FXII RNAi agents described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intracerebroventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, transtracheal (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0237] Thus, in some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0238] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one FXII RNAi agent described herein and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., FXII RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can a) aid in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) act to enhance the overall safety, efficacy, or delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0239] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline solutions, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0240] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, the maintenance of the required particle size in the case of dispersion, and the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the compositions. Prolonged absorption of injectable compositions can be brought about by the inclusion of an agent delaying absorption, for example, aluminum monostearate or gelatin.

[0241] Sterile injectable solution can be prepared by incorporating the required amount of active compound into a suitable solvent with one or a combination of the ingredients listed above as needed, followed by filter sterilization.Generally, dispersion is prepared by incorporating active compound into a sterile vehicle that contains a basic dispersion medium and other necessary ingredients listed above.For sterile powder to prepare sterile injectable solution, preparation methods include vacuum drying or freeze-drying, which produces a powder of active ingredient and any additional desired ingredients from the solution that has been previously sterile-filtered.

[0242] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, such as in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular or ophthalmic administration.

[0243] The active compounds may be prepared with carriers that protect the compound from rapid excretion from the body, such as sustained-release formulations, including implants or microencapsulated delivery systems. Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, may be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions may also be used as pharmaceutically acceptable carriers. These may be prepared by methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0244] FXII RNAi agent can be formulated into a dosage unit composition for ease of administration and uniformity of dosage.Dosage unit refers to a physically separate unit suitable as a single dose for the patient to be treated, each unit containing a predetermined amount of active compound calculated to produce the desired therapeutic effect in association with the necessary pharmaceutical carrier.The specification of dosage unit of the present disclosure is determined and directly influenced by the inherent characteristics of active compound and the therapeutic effect to be achieved, and the inherent limitations of the technology of compounding such active compound for individual treatment.

[0245] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory drugs (antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs expressing or containing the RNAi agent defined herein may be used as a "pharmaceutical composition." As used herein, a "pharmacologically effective amount," a "therapeutically effective amount," or simply an "effective amount" refers to that amount of an RNAi agent that produces a pharmacological, therapeutic, or preventative result.

[0246] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or agent in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another FXII RNAi agent (e.g., an FXII RNAi agent that targets a different sequence within the FXII target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, an aptamer, and / or a vaccine.

[0247] In general, an effective amount of active compound will be, for example, in the range of about 1.0 to about 50 mg / kg body weight / day. In some embodiments, an effective amount of active compound will be in the range of about 0.25 to about 5 mg / kg body weight / day per dose. In some embodiments, an effective amount of active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight / day per dose. Dosages often depend on variables such as the patient's overall health, the relative bioavailability of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Additionally, the initial dose may optionally be increased beyond the upper levels noted above, or the initial dose may optionally be less than optimal, to rapidly achieve desired blood or tissue levels.

[0248] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein containing an FXII RNAi agent may be combined with an excipient or a second therapeutic agent or agent, including, but not limited to, a second or another RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0249] The FXII RNAi agents described herein may be packaged in kits, containers, packs, or dispensers when added to pharmaceutically acceptable excipients or adjuvants. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.

[0250] Methods of Treatment and Inhibition of Expression The FXII RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from administration of the compounds. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduced and / or inhibited FXII gene expression, such as subjects diagnosed with or at risk of developing conditions related to hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor-associated angioedema, allergic angioedema, nonhistamine angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombo-occlusive disease, and / or perioperative venous occlusive disease prevention. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of one or more of the FXII RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions herein can be to humans or animals.

[0251] In some embodiments, the FXII RNAi agents described herein are used in subjects who would benefit from reduced and / or inhibited FXII gene expression. In some embodiments, the FXII RNAi agents described are used in the treatment (including prophylactic treatment) of at least one symptom or condition mediated, at least in part, by FXII expression. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby preventing at least one symptom.

[0252] In certain embodiments, the present invention provides methods for treating diseases, disorders, conditions, or pathological states mediated at least in part by expression of FXII in a patient in need thereof, wherein the method comprises administering to the patient any of the FXII RNAi agents described herein.

[0253] In some embodiments, the FXII RNAi agent is used to treat or manage a pathological condition (e.g., a condition or disease) in a subject that is mediated, at least in part, by expression of FXII. The subject is administered a therapeutically effective amount of one or more of the FXII RNAi agents or compositions containing the FXII RNAi agents described herein. In some embodiments, the method comprises administering to the patient being treated a composition containing the FXII RNAi agent described herein.

[0254] In some embodiments, gene expression levels and / or mRNA levels in a subject administered a described FXII RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the FXII RNAi agent or to a subject not administered the FXII RNAi. Gene expression levels and / or mRNA levels in a subject are reduced in cells, cell populations, and / or tissues of the subject.

[0255] In some embodiments, the protein level of FXII in a subject administered a described FXII RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the FXII RNAi agent or to a subject not administered the FXII RNAi agent. The protein level in the subject is reduced in the subject's cells, cell populations, tissues, blood, and / or other bodily fluids.

[0256] The reduction in FXII gene expression level, FXII mRNA level, or FXII protein level can be assessed and quantified by common methods known in the art. Examples disclosed herein include commonly known methods for assessing inhibition of FXII gene expression and reduction in FXII protein level. Herein, a reduction or decrease in FXII mRNA level and / or protein level is collectively referred to as a reduction or decrease in FXII or inhibition or reduction of FXII expression.

[0257] Cells, tissues, and non-human organisms Cells, tissues, and non-human organisms are contemplated that contain at least one of the FXII RNAi agents described herein, which are generated by delivering the RNAi agent to the cell, tissue, or non-human organism. [Example]

[0258] The embodiments and clauses provided above are illustrated by the following non-limiting examples.

[0259] Example Example 1. Identification of the sequence of FXII RNAi agents and synthesis of FXII RNAi agents The selection process for identifying lead sequences targeting FXII began with an in silico approach to identify sequences conserved across variants of the FXII gene (SEQ ID NO: 1). FXII sequences were initially screened using bioinformatics against 19 nucleotide sequences with complementary sequences that were cross-reactive in humans and non-human primates. Sequences with known manufacturing challenges and sequences predicted to have low RNAi activity based on known parameters were eliminated. Sequences were also evaluated for specificity to avoid nonspecific effects on the human and cynomolgus monkey genomes. A family of 17 sequences, each 19 bases long, was initially selected as promising candidates. Additional sequences were also identified by altering the nucleotide at position 1 (5'→3') of the antisense strand with the corresponding base pair in the sense strand to form a U:A base pair. Once the modification pattern was selected, the sense and antisense strands of the modified RNAi agents were synthesized by solid-phase phosphoramidite technology using methods known in the art for oligonucleotide synthesis. The duplexes in Tables 5 and 6 herein were synthesized, for example, by the following method.

[0260] synthesis The sense and antisense strands of the FXII RNAi agent were synthesized by solid-phase phosphoramidite technology used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or equivalent commercially available synthesizer was used. Synthesis was carried out on a solid support consisting of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following compounds are listed: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N2-(isopropylamino) phosphoramidite, The 2'-O-methyl phosphoramidites used were (5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 2'-O-deoxy-2'-fluoro-phosphoramidite. The 2'-O-methyl phosphoramidite possessed the same protecting groups as the 2'-O-methyl RNA amidite.The following are listed: 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-( The UNA phosphoramidites used were 4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxy-trityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0261] The targeting ligand-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 15 min (targeting ligand), 90 s (2'OMe), and 60 s (2'F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0262] Cleavage and deprotection of support-bound oligomers

[0263] After completion of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine and 28–31% ammonium hydroxide solution (Aldrich) in water for 1.5 h at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0264] purification The crude oligomer was purified by anion-exchange HPLC using a TKSgel SuperQ-5PW 13u column and a Shimadzu LC-8 system. Buffer A was 20mM Tris, 5mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A but with the addition of 1.5M sodium chloride. The UV trace at 260nm was recorded. Appropriate fractions were pooled and then run on a size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 media, with a running buffer of 100mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water.

[0265] annealing RNAi agents were formed by combining the complementary strands of RNA (sense and antisense) in equimolar solutions in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1x PBS with a UV-visible spectrometer. The absorbance of the solution at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. Unless otherwise noted, all conversion factors were 0.037 mg / (mL·cm). In some experiments, the conversion factor was calculated from the experimentally determined extinction coefficient.

[0266] Example 2. In vitro testing of candidate RNAi agents To test the modified FXII RNAi constructs in vitro, the human FXII cDNA sequence (accession number NM_000505.3 (SEQ ID NO: 1)) was synthesized and cloned into the commercially available reporter-based screening plasmid psiCHECK2 (Promega, Madison, WI), which generated a Renilla luciferase / FXII fusion mRNA. For siRNA efficacy in a human background, Huh7 cells (a human hepatocellular carcinoma line) were seeded at approximately 7,500 cells / well in a 96-well format. Each of the FXII siRNAs selected for in vitro testing was cotransfected at three concentrations: 10 nM, 1 nM, and 0.1 nM, using 25 ng of FXII-psiCHECK2 plasmid DNA per well and 0.2 μL of Lipofectamine 2000 per well. Gene knockdown was determined using a dual luciferase reporter assay (Promega, Madison, WI) by measuring Renilla luciferase levels normalized to the level of constitutively expressed firefly luciferase, which was also present on the psiCHECK2 plasmid. The candidate sequence duplexes listed in Table 6 were tested in vitro. The data are reported in Table 8 below.

[0267] [Table 8-1] [Table 8-2]

[0268] Example 3. FXII knockdown in wild-type mice after delivery of FXII RNAi agents NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, three mice (n = 3) from each group were injected with either saline or 3 mg / kg AD03632 (see Tables 3-5 and 7 for modified FXII RNAi agents and NAG ligand structures). On days 8, 15, 22, 29, and 36, blood samples were collected and analyzed for FXII protein levels. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes an in-house developed, commercially available antibody (Molecular Innovations). While this method offers high throughput, commercially available mF12 ELISA kits can also be used. For normalization, the FXII levels for each animal at each time point were divided by the pretreatment expression level for that animal (in this case, day 1) to determine the "normalized" expression ratio relative to day 1. FXII knockdown is reported in Figure 1.

[0269] Example 4. Factor 12 (FXII) in wild-type mice after delivery of FXII RNAi agents NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, four mice per group were injected with either (i) 0.6 mg / kg AD03632, (ii) 2 mg / kg AD03632, or (iii) saline (see Tables 3-5 and 7 for modified FXII RNAi agents and NAG ligand structures). Blood samples were collected on days 7, 14, 21, 28, 35, 42, 49, 56, and 63 to analyze FXII protein levels. FXII protein levels were measured using the mF12 alphaLISA® (Perkin Elmer) assay, which utilizes an in-house developed, commercially available antibody (Molecular Innovations). Alternatively, a commercially available mF12 ELISA kit could be used, although this offers higher throughput. For normalization, the FXII levels for each animal at each time point were divided by the pretreatment expression level in that animal (in this case, day 1) to determine the ratio of "normalized" expression relative to day 1. FXII knockdown is reported in Figure 2.

[0270] Example 5. Dose response of Factor 12 (FXII) in mice after delivery of FXII RNAi agent NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, six mice in each group were injected with either (i) 0.6 mg / kg AD03632, (ii) 2 mg / kg AD03632, or (iii) saline (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). The mice were reinjected weekly for the next six weeks with either AD03632 at the same dose administered on day 1 or saline. Blood samples were collected the day before the next injection (i.e., blood samples were collected on days 7, 14, 21, 28, 35, 42, 49, 56, and 63) to analyze FXII protein levels. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes an in-house developed, commercially available antibody (Molecular Innovations); however, although this has a higher throughput, commercially available mF12 ELISA kits may alternatively be used. For normalization, the FXII levels for each animal at each time point were divided by the pretreatment expression level in that animal (day 1 in this case) to determine a "normalized" expression ratio relative to day 1. FXII knockdown is reported in Figure 3.

[0271] Example 6. Factor 12 (FXII) serum protein levels and clot weight in a rat arteriovenous shunt model after FXII RNAi agent delivery NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, five mice in each group were injected with either (i) saline, (ii) saline on day 1 followed by 1000 U / kg heparin via intubation on days 7, 8, or 9, (iii) 1 mg / kg of the FXII RNAi agent AD03224, or (iv) 3 mg / kg of the FXII RNAi agent AD03224 (see Tables 3-5 and 7 for modified FXII RNAi agents and NAG ligand structures). Blood samples were collected on the day of surgery (i.e., day 7, 8, or 9). For normalization, the FXII levels of each animal at each time point were divided by that animal's pretreatment serum level (in this case, day 1) to determine the "normalized" expression ratio relative to day 1. FXII serum protein levels are reported in Figure 4. FXII protein levels were measured using mF12 alphaLISA® (Perkin Elmer), which utilizes an in-house developed commercially available antibody (Molecular Innovations); although this has high throughput, commercially available mF12 ELISA kits may alternatively be used.

[0272] Furthermore, an arteriovenous shunt model was performed and measured in these mice. On the day of the shunt experiment (i.e., day 7, 8, or 9), a polyurethane tube (with silk thread) was implanted to connect (cannulate) the carotid artery to the jugular vein. After 15 minutes, the shunt was removed and the net clot weight was measured. The clot weight (in mg) is reported in Figure 5.

[0273] Example 7. Administration of NAG-binding FXII RNAi agents to cynomolgus monkeys NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer for subcutaneous (SQ) injection as known in the art. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as "cynos" or "monkeys") were subcutaneously injected with 3 mg / kg of AD03635, AD04131, AD04157, AD04162, AD04254, or AD04443 (see Tables 3-5 and 7 for modified FXII RNAi agents and NAG ligand structures). Three monkeys per group were tested for AD03635, AD04131, AD04157, AD04162, and AD04254 (n=3). Only two monkeys were tested for AD04443 (n=2). On day 29, two (2) monkeys from each respective group were administered a subsequent dose of the same respective FXII RNAi agent administered on day 1 at 1.5 mg / kg.

[0274] Serum samples from treated cynomolgus monkeys were collected on days -29, -7, and 1 (before treatment), as well as days 8, 15, 22, 29, 36, 43, 50, 57, 64, and 78. Blood samples were collected at the indicated time points, and serum was analyzed for FXII protein levels. FXII protein levels were measured using a commercially available human F12 ELISA (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistries, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine, were also evaluated using an automated chemistry analyzer according to the manufacturer's recommendations. Activated partial thromboplastin time (aPTT) was also measured using an STA Compact MAX® (Stago). Functional readout of F12 knockdown can be observed by a prolongation of the activated partial thromboplastin time (aPTT) compared to pretreatment. The samples were also assessed for FXII activity using an FXII activity assay. The FXII activity assay was performed using the aPTT method (a standard technique known in the art) with a factor-deficient substrate. Subjects' plasma was incubated with an FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and an aPTT reagent. After a specific incubation period, calcium was added to trigger the clotting process and measure clot formation. The results were then compared to those of a normal human (100%) to calculate % activity.

[0275] The FXII protein level for each animal at each time point was divided by the pretreatment expression level in that animal (average of day -29, day -7, and day 1 (pretreatment)) to determine the "normalized to pretreatment" expression ratio. Furthermore, the mean knockdown levels at each nadir (i.e., mean nadir expression level on the day serum was collected) for both FXII protein and FXII activity were calculated.

[0276] [Table 9]

[0277] [Table 10]

[0278] [Table 11]

[0279] [Table 12]

[0280] Each of the FXII RNAi agents tested in Example 7 demonstrated significant FXII knockdown in cynos. Furthermore, administration of a second dose of the FXII RNAi agent was shown to further improve FXII protein and activity knockdown and aPTT prolongation in cynos. For example, AD04162, which contains an antisense strand with at least partial complementarity to positions 127-145 of the FXII gene (SEQ ID NO: 1), was shown to inhibit FXII protein expression by 93.5% at its nadir after the second dose.

[0281] Example 8. Administration of NAG-binding FXII RNAi agents to cynomolgus monkeys NAG-conjugated FXII RNAi agents were prepared for subcutaneous (SQ) injection as known in the art and combined in a pharmaceutically acceptable saline buffer. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as "cynos" or "monkeys") were subcutaneously injected with 3 mg / kg of AD04623, AD04624, AD04625, AD04626, AD04627, or AD04628 (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). Two monkeys per group, one male and one female per group, were studied (n=2). On day 24, each cyno received a single subcutaneous dose of 3 mg / kg of the same FXII RNAi agent administered to each animal on day 1 (i.e., the second dose).

[0282] Serum samples from treated cynomolgus monkeys were collected on days -6 and 1 (before treatment), and on days 8, 15, 24, 29, 36, and 43. Blood samples were collected at the indicated time points, and serum was analyzed for FXII protein levels. FXII protein levels were measured using a commercially available human F12 ELISA (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistries, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine, were also evaluated on an automated chemistry analyzer according to the manufacturer's recommendations. FXII activity in the samples was also assessed using an FXII activity assay. The FXII activity assay was performed using the aPTT method (a standard technique known in the art) with a factor-deficient substrate. Subjects' plasma was incubated with an FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and the aPTT reagent. After a specific incubation period, calcium was added to trigger the coagulation process and clot formation was measured. The results were then compared to those of normal humans (100%) to calculate % activity.

[0283] The FXII protein level for each animal at each time point was divided by the pretreatment expression level in that animal (average of day -6 and day 1 (pretreatment)) to determine the "normalized to pretreatment" expression ratio. In addition, the mean knockdown levels at the nadir of FXII protein and FXII activity (i.e., the mean nadir expression level on the day serum was collected) were calculated. [Table 13]

[0284] [Table 14]

[0285] [Table 15]

[0286] Each of the FXII RNAi agents administered in Example 8 demonstrated significant inhibition of FXII expression in cytosines. For example, AD04625, which contains an antisense strand designed to target positions 127-145 of the FXII gene (SEQ ID NO: 1), demonstrated a mean normalized knockdown of 91.0% of FXII protein at day 29 (0.090 + / - 0.007) (see Group 3 in Table 14).

[0287] Example 9. Administration of NAG-binding FXII RNAi agents to cynomolgus monkeys NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable saline buffer for subcutaneous (SQ) injection as known in the art. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as "cynos" or "monkeys") were subcutaneously injected with 4.0 mg / kg of AD04623, AD04625, AD04753, or AD04757 (see Tables 3-5 and 7 for modified FXII RNAi agent and NAG ligand structures). On day 29, a second subcutaneous injection of 4.0 mg / kg of the same FXII RNAi agent was administered. Two female monkeys per group were tested (n=2).

[0288] Serum samples from treated cynomolgus monkeys were collected on days -14, -7, and 1 (before treatment), as well as days 8, 15, 22, 29, 30, 36, and 43. Blood samples were collected at the indicated time points, and serum was analyzed for FXII protein levels. FXII protein levels were measured using a commercially available human F12 ELISA (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistries, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine, were also evaluated on an automated chemistry analyzer according to the manufacturer's recommendations. Activated partial thromboplastin time (aPTT) was also measured using a STA®-PTT Automate 5 (Stago). A functional readout of F12 knockdown can be observed by a prolongation of the activated partial thromboplastin time (aPTT) compared to pretreatment. FXII activity in the samples was also assessed using an FXII activity assay. FXII activity assays were performed using the aPTT method (a standard technique known in the art) with a factor-deficient substrate. Subjects' plasma was incubated with the FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and the aPTT reagent. After a specific incubation period, calcium was added to trigger the coagulation process and measure clot formation. Results were then compared to those of a normal human (100%) to calculate % activity.

[0289] The FXII protein level for each animal at each time point was divided by the pretreatment expression level in that animal (average of day -6 and day 1 (pretreatment)) to determine the "normalized to pretreatment" expression ratio. Additionally, the mean knockdown levels at each nadir (i.e., mean nadir expression level on the day serum was collected) for both FXII protein and FXII activity were calculated.

[0290] [Table 16]

[0291] [Table 17]

[0292] [Table 18]

[0293] [Table 19]

[0294] In Example 9, each of the FXII RNAi agents demonstrated significant knockdown of the FXII gene. For example, AD04625 demonstrated the greatest knockdown of FXII protein after both the first and second doses of the RNAi agent (91% knockdown after the first dose, 94.5% knockdown after the second dose). AD04625 also demonstrated the greatest knockdown of FXII activity and the greatest prolongation of aPTT over baseline (2.02 over baseline after the first dose, 2.435 over baseline at the peak after the second dose).

[0295] Example 10. Factor 12 (FXII)-SEAP Mouse Model Female C57BL / 6 albino mice, 6–8 weeks old, were transiently transfected in vivo with the plasmid via hydrodynamic tail vein injection at least 15 days before administration of the FXII RNAi agent or control. The plasmid contained a human FXII cDNA sequence (GenBank NM_000505.3 (SEQ ID NO: 1)) inserted into the 3'UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. FXII-SEAP model mice were generated by injecting 50 μg of the FXII cDNA-containing plasmid in Ringer's solution into the tail vein at a total volume of 10% of the animal's body weight. The solution was injected through a standard 27-gauge needle for 5–7 seconds as previously described (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA," Human Gene Therapy 1999 Vol. 10, pp. 1735–1737). Inhibition of FXII expression by FXII RNAi agents concomitantly inhibited SEAP expression, as measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen). Before treatment, SEAP expression levels were measured in serum, and mice were grouped according to their mean SEAP levels.

[0296] Analysis: SEAP levels can be measured at various times both before and after administration of the FXII RNAi agent.

[0297] i) Serum collection: Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to clot for 20 minutes at ambient temperature. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C.

[0298] ii) Serum SEAP levels: Serum was collected and measured using the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. To account for the non-treatment-related decrease in FXII expression in this model, serum SEAP levels for each animal were normalized to a control group of saline-injected mice. First, to determine a "normalized to pretreatment" expression ratio, each animal's SEAP level at a given time point was divided by that animal's pretreatment expression level (pretreatment). Expression at a particular time point was then normalized to the control group by dividing the individual animal's "normalized to pretreatment" ratio by the average "normalized to pretreatment" ratio for all mice in the normal saline control group.

[0299] Example 11. FXII RNAi Agents in the FXII-SEAP Mouse Model The FXII-SEAP mouse model described above in Example 10 was used. On day 1, each mouse received a single subcutaneous injection of 200 μl of saline without FXII RNAi agent to serve as a control, or 200 μl of FXII RNAi agent in an amount according to Table 20 below.

[0300] [Table 20]

[0301] Each FXII RNAi agent contained an N-acetyl-galactosamine targeting ligand attached to the 5' end of the sense strand, as shown in Tables 4 and 5. Injections were performed in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Three (3) mice per group were tested (n=3). Serum was collected on days -3, 8, 15, 22, and 29, and SEAP expression levels were measured according to the procedure described in Example 10, above. Data from the experiment are shown in Table 21 below, where the mean SEAP reflects the normalized average value of SEAP.

[0302] [Table 21]

[0303] Each of the FXII RNAi agents tested in Example 11 demonstrated significant inhibition of FXII expression compared to controls in the SEAP mouse model.

[0304] Example 12. FXII RNAi Agents in the FXII-SEAP Mouse Model The FXII-SEAP mouse model described above in Example 10 was used. On day 1, each mouse received a single subcutaneous injection of 200 μl of saline without an FXII RNAi agent to serve as a control, or 200 μl containing 1.0 mg / kg of an FXII RNAi agent according to Table 22 below.

[0305] [Table 22]

[0306] Each FXII RNAi agent contained an N-acetyl-galactosamine targeting ligand attached to the 5' end of the sense strand, as shown in Tables 4 and 5. Injections were performed in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Three (3) mice per group were tested (n=3). Serum was collected on days -2, 8, 15, 22, 29, and 36, and SEAP expression levels were measured according to the procedure described in Example 10, above. Data from the experiment are shown in Table 23 below, with the mean SEAP reflecting the normalized (relative to pre-treatment only) mean value of SEAP.

[0307] [Table 23]

[0308] As shown in Table 23, almost all of the tested FXII RNAi agents showed significant inhibition of FXII expression compared to controls in the SEAP mouse model. For example, at day 15, AD04625, AD05330, and AD05331 each showed approximately 95% knockdown compared to pre-treatment expression levels.

[0309] Example 13. FXII RNAi Agents in the FXII-SEAP Mouse Model The FXII-SEAP mouse model described above in Example 10 was used. On day 1, each mouse received a single subcutaneous injection of 200 μl of saline without FXII RNAi agent to serve as a control, or 200 μl of FXII RNAi agent in an amount according to Table 24 below.

[0310] [Table 24]

[0311] Each FXII RNAi agent contained an N-acetyl-galactosamine targeting ligand attached to the 5' end of the sense strand, as shown in Tables 3 and 4. Injections were performed in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Three (3) mice per group were tested (n=3). Serum was collected on days -3, 8, 15, 22, and 29, and SEAP expression levels were measured according to the procedure described in Example 10, above. Data from the experiment are shown in Table 25 below, where the mean SEAP reflects the normalized mean value of SEAP.

[0312] [Table 25]

[0313] Other embodiments While the present invention has been described in conjunction with a detailed description, the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. An RNAi agent for inhibiting the expression of factor XII (FXII) gene, comprising: the RNAi agent comprises a sense strand and an antisense strand; The RNAi agent, wherein the antisense strand comprises nucleotides 2-18 of any of the antisense strand sequences of Table 2, Table 3, or Table 6, and the sense strand is at least partially complementary to the antisense strand.

2. An RNAi agent for inhibiting the expression of factor XII (FXII) gene, comprising: the RNAi agent comprises a sense strand and an antisense strand; The RNAi agent, wherein the sense strand comprises nucleotides 2-18 of any of the sense strand sequences of Table 2, Table 4, or Table 6, and the antisense strand is at least partially complementary to the sense strand.

3. The RNAi agent of claim 1, wherein the antisense strand comprises a base sequence of any of the antisense strand sequences in Table 2, Table 3, or Table 6.

4. The RNAi agent of claim 2, wherein the sense strand comprises a base sequence of any of the sense strand sequences in Table 2, Table 4, or Table 6.

5. The RNAi agent of claim 1, wherein the sense strand comprises a base sequence of any one of the sense strand sequences in Table 4, and the antisense strand comprises a base sequence of any one of the antisense strand sequences in Table 3.

6. The RNAi agent of any one of claims 1 to 5, wherein the RNAi agent comprises at least one modified nucleotide.

7. 7. The RNAi agent of claim 6, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic ribose, ribitol, inverted nucleotides, inverted abasic nucleotides, inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, cyclopropyl phosphonate deoxyribonucleotides, and 3'-OMe nucleotides.

8. The RNAi agent of any one of claims 1 to 5, wherein the RNAi agent comprises at least one phosphorothioate internucleoside linkage.

9. The RNAi agent of any one of claims 1 to 5, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.

10. The RNAi agent of any one of claims 1 to 5, wherein the antisense strand comprises 1, 2, 3, or 4 phosphorothioate internucleoside linkages.

11. The RNAi agent of any one of claims 1 to 5, wherein substantially all nucleotides of the sense strand and the antisense strand are modified nucleotides.

12. The RNAi agent of any one of claims 1 to 11, further comprising a targeting group conjugated to the sense strand and / or the antisense strand.

13. The RNAi agent of claim 12 , wherein the targeting group comprises an asialoglycoprotein receptor ligand.

14. The RNAi agent of any one of claims 1 to 13, wherein the targeting group comprises N-acetyl-galactosamine.

15. The RNAi agent of any one of claims 12 to 14, wherein a targeting group is conjugated to the 5' end of the sense strand.

16. The target groups are (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NA 16. The RNAi agent of any one of claims 12 to 15, having a structure selected from the group consisting of (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.

17. 3. The RNAi agent of claim 1 or 2, comprising a sense strand and an antisense strand that form a duplex having the structure of any of the duplexes in Table 5 or Table 6.

18. The RNAi agent of claim 1 or 2, wherein the RNAi agent has a double-stranded structure of AD05333, AD04131, AD04157, AD04254, AD04623, AD04625, or AD04627.

19. 19. A composition comprising the RNAi agent of any one of claims 1 to 18 and at least one pharmaceutically acceptable excipient.

20. 20. The composition of claim 19, further comprising a second therapeutic agent or agents.

21. 21. The composition of claim 20, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.

22. 22. A method for inhibiting factor XII gene expression in a cell, the method comprising administering an effective amount of an RNAi agent according to any one of claims 1 to 18 or a composition according to any one of claims 19 to 21.

23. 22. A method for inhibiting factor XII gene expression in a subject, the method comprising administering to the subject an effective amount of an RNAi agent of any one of claims 1 to 18 or a composition of any one of claims 19 to 21.

24. 1. A method for the treatment of a pathological condition (including a condition or disease) mediated at least in part by expression of FXII, comprising: The method comprises administering to a subject in need thereof an effective amount of the RNAi agent of any one of claims 1 to 18 or the composition of any one of claims 19 to 21.

25. 25. The method of claim 24, wherein the pathological condition is hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor-associated angioedema, allergic angioedema, nonhistamine angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombo-occlusive disease, or perioperative venous occlusive disease prophylaxis.

Images