Adenovirus vector, and method for using adenovirus vector

Abstract

To provide an adenovirus vector and a method for using an adenovirus vector.SOLUTION: Provided are a method and a material regarding an adenovirus vector and use of an adenovirus vector. Provided is an adenovirus for delivering a nucleic acid encoding one or more immunogens (e.g., one or more immunogens related to a pathogen causing infection) into a cell in a mammal such that a mammal generates an effective immunological response to an immunogen, for example.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 16 / 996,740, filed August 18, 2020, which claims the benefit of U.S. Provisional Patent Application No. 63 / 066,740, filed August 17, 2020. The disclosures of the prior applications are considered part of (and incorporated by reference into) the disclosure of this application.

[0002] Sequence Listing This document contains a sequence listing that was submitted to the United States Patent and Trademark Office via its electronic filing system as an ASCII text file. The Sequence Listing incorporated herein by reference is entitled "07039-1964WO1_ST25.txt", was created on August 6, 2021, and is 892 kilobytes in size.

[0003] Technical Field This document relates to adenoviral vectors, as well as methods and materials related to the use of adenoviral vectors. For example, adenoviral vectors can be used to deliver one or more immunogens (e.g., one or more immunogens associated with a pathogen causing an infection) to cells within a mammal so that the mammal can generate an effective immune response to the immunogens. [Background technology]

[0004] Background information The infectious disease caused by the coronavirus known as COVID-19 was first reported to the World Health Organization (WHO) country office in China on December 31, 2019. As of June 3, 2020, approximately 6,287,771 confirmed cases of COVID-19, including 379,941 deaths, have been reported to WHO (covid19.who.int / ). Summary of the Invention [Means for solving the problem]

[0005] overview This document relates to adenoviral vectors, as well as methods and materials related to the use of adenoviral vectors. For example, this document provides adenoviral vectors, nucleic acid molecules encoding the adenoviral vectors, cell lines containing the adenoviral vectors, and methods of using adenoviral vectors to deliver nucleic acids to cells in vitro or in vivo. This document also provides methods and materials for using adenoviral vectors to induce an immune response in a mammal (e.g., a human). In some cases, an adenoviral vector (e.g., a single-cycle adenoviral (SC-Ad) vector) can be used to deliver one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) immunogens that elicit an immune response in a mammal (e.g., a human).

[0006] As shown herein, SC-Ad can be engineered to express one or more immunogens as fusion and secreted polypeptides capable of inducing an effective immune response against the immunogen. For example, administration of SC-Ad expressing a C. difficile TcdA / B fusion polypeptide protected mice and Syrian hamsters from lethal toxin challenge for extended periods (e.g., 36 weeks or more) after a single immunization.

[0007] The ability to generate an effective immune response against viral and / or bacterial pathogens (e.g., coronaviruses) in mammals (e.g., humans) can improve survival and minimize the impact of infection. Adenoviral vectors encoding one or more immunogens can be used to provide mammals with sustained, long-term immunity against infectious pathogens (e.g., coronaviruses). For example, adenoviral vectors encoding one or more immunogens associated with COVID-19 (e.g., one or more immunogens derived from SARS-CoV-2) could be used as potent vaccines in the COVID-19 pandemic to generate humoral immunity against both primary infection and recurrence.

[0008] In general, one aspect of this document features an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding a coronavirus immunogen. The adenoviral polypeptide can be a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, or a pIIIa polypeptide. The coronavirus immunogen can comprise a coronavirus spike polypeptide or an immunogenic fragment thereof. The coronavirus immunogen can consist of or consist essentially of the amino acid sequence set forth in any one of SEQ ID NOS: 1-4. The SC-Ad can also comprise a nucleic acid sequence encoding an adjuvant polypeptide. The adjuvant polypeptide can be a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide, an interleukin-4 (IL-4) polypeptide, an interleukin-21 (IL-21) polypeptide, a CD40 ligand (CD40L) polypeptide, a 4-1BB ligand (4-1BBL) polypeptide, a transforming growth factor beta (TGF-β) polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, or a biologically active fragment thereof. A coronavirus spike polypeptide can be fused to the adjuvant polypeptide. The coronavirus spike polypeptide fused to the adjuvant polypeptide can consist essentially of or consist of the amino acid sequence set forth in SEQ ID NO: 5. The SC-Ad can also contain a nucleic acid sequence encoding a chaff polypeptide. The chaff polypeptide can be a fragment of an ACE2 polypeptide. The ACE2 polypeptide fragment can include the extracellular region of the ACE2 polypeptide and lack the transmembrane domain. The chaff polypeptide can consist essentially of or consist of the amino acid sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 9. The coronavirus spike polypeptide can be fused to the chaff polypeptide.

[0009] In another aspect, this document features a composition comprising an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding a coronavirus immunogen.

[0010] In another aspect, this document features a method for inducing an immune response to a coronavirus in a mammal. The method can include, or can consist essentially of, administering to a mammal a composition comprising: i) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding a coronavirus immunogen; or ii) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding a coronavirus immunogen, under conditions in which the SC-Ad infects cells of the mammal and expression of an immunogen in the cells results in the induction of an immune response. The mammal can be a human. The coronavirus can be a betacoronavirus. The betacoronavirus can be SARS-CoV-2. The administration can include mucosal delivery of the SC-Ad.

[0011] In another aspect, this document features an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding an adjuvant polypeptide. The adenoviral polypeptide can be a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, or a pIIIa polypeptide. The immunogen can be a coronavirus immunogen. The coronavirus immunogen can include a coronavirus spike polypeptide or an immunogenic fragment thereof. The coronavirus immunogen can consist of, or consist essentially of, the amino acid sequence set forth in any one of SEQ ID NOs: 1-4. The adjuvant polypeptide can be a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, or a biologically active fragment thereof. A coronavirus spike polypeptide can be fused to the adjuvant polypeptide. The coronavirus spike polypeptide fused to the adjuvant polypeptide can consist essentially of, or consist of, the amino acid sequence set forth in SEQ ID NO:5. The SC-Ad can also contain a nucleic acid sequence encoding a chaff polypeptide. The chaff polypeptide can be a fragment of an ACE2 polypeptide. The fragment of an ACE2 polypeptide can include the extracellular region of the ACE2 polypeptide and lack the transmembrane domain. The chaff polypeptide can consist essentially of, or consist of, the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0012] In another aspect, this document features a composition comprising an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding an adjuvant polypeptide.

[0013] In another aspect, this document features a method for inducing an immune response to a virus in a mammal. The method can include, or can essentially consist of, administering to a mammal a composition comprising: i) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen and (b) a nucleic acid sequence encoding an adjuvant polypeptide; or ii) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen and (b) a nucleic acid sequence encoding an adjuvant polypeptide, under conditions in which the SC-Ad infects cells of the mammal and expression of an immunogen in the cells results in the induction of an immune response. The mammal can be a human. The virus can be a coronavirus, and the immunogen can be related to a coronavirus. The coronavirus can be a betacoronavirus. The betacoronavirus can be SARS-CoV-2. Administration can include mucosal delivery of the SC-Ad.

[0014] In another aspect, this document features an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen and (b) a nucleic acid sequence encoding a chaff polypeptide. The adenoviral polypeptide can be a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, or a pIIIa polypeptide. The immunogen can be a coronavirus immunogen. The coronavirus immunogen can include a coronavirus spike polypeptide or an immunogenic fragment thereof. The coronavirus immunogen can consist of, or consist essentially of, the amino acid sequence set forth in any one of SEQ ID NOS: 1-4. The chaff polypeptide can be a fragment of an ACE2 polypeptide. The fragment of an ACE2 polypeptide can include the extracellular region of an ACE2 polypeptide and can lack the transmembrane domain. The chaff polypeptide can consist essentially of, or consist of, the amino acid sequence set forth in SEQ ID NOS: 8 or 9. The coronavirus spike polypeptide can be fused to the chaff polypeptide. The SC-Ad can also include a nucleic acid sequence encoding an adjuvant polypeptide, which can be a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, or a biologically active fragment thereof.

[0015] In another aspect, this document features a composition comprising an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding a chaff polypeptide.

[0016] In another aspect, this document features a method for inducing an immune response to a virus in a mammal. The method can include, or can essentially consist of, administering to a mammal a composition comprising: i) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen and (b) a nucleic acid sequence encoding a chaff polypeptide; or ii) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen and (b) a nucleic acid sequence encoding a chaff polypeptide, under conditions in which the SC-Ad infects cells of the mammal and expression of an immunogen in the cells results in the induction of an immune response. The mammal can be a human. The virus can be a coronavirus, and the immunogen can be related to a coronavirus. The coronavirus can be a betacoronavirus. The betacoronavirus can be SARS-CoV-2. Administration can include mucosal delivery of the SC-Ad.

[0017] In another aspect, this document features an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, (b) a nucleic acid sequence encoding an adjuvant polypeptide, and (c) a nucleic acid sequence encoding a chaff polypeptide. The adenoviral polypeptide can be a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, or a pIIIa polypeptide. The immunogen can be a coronavirus immunogen. The coronavirus immunogen can include a coronavirus spike polypeptide or an immunogenic fragment thereof. The coronavirus immunogen can consist of or consist essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4. The adjuvant polypeptide can be a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, or a biologically active fragment thereof. The chaff polypeptide can be a fragment of an ACE2 polypeptide. The fragment of an ACE2 polypeptide can include the extracellular region of the ACE2 polypeptide and can lack the transmembrane domain. The chaff polypeptide can consist essentially of or consist of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0018] In another aspect, this document features a composition comprising an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, (b) a nucleic acid sequence encoding an adjuvant polypeptide, and (c) a nucleic acid sequence encoding a chaff polypeptide.

[0019] In another aspect, this document features a method for inducing an immune response to a virus in a mammal. The method can include, or can essentially consist of, administering to a mammal a composition comprising: i) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, (b) a nucleic acid sequence encoding an adjuvant polypeptide, and (c) a nucleic acid sequence encoding a chaff polypeptide; or ii) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, (b) a nucleic acid sequence encoding an adjuvant polypeptide, and (c) a nucleic acid sequence encoding a chaff polypeptide, under conditions in which the SC-Ad infects cells of the mammal and expression of an immunogen in the cells results in the induction of an immune response. The mammal can be a human. The virus can be a coronavirus, and the immunogen can be related to a coronavirus. The coronavirus can be a betacoronavirus. The betacoronavirus can be SARS-CoV-2. The administration can include mucosal delivery of the SC-Ad.

[0020] In another aspect, this document features an SC-Ad, the SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, the SC-Ad including an adenoviral polypeptide, and the SC-Ad including a nucleic acid sequence encoding an immunogen expressed or shed by an allergen. The adenoviral polypeptide can be a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, or a pIIIa polypeptide. The SC-Ad can also include a nucleic acid sequence encoding an adjuvant polypeptide. The adjuvant polypeptide can be a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, or a biologically active fragment thereof. The SC-Ad can also include a nucleic acid sequence encoding a chaff polypeptide. The chaff polypeptide can be a fragment of an ACE2 polypeptide. A fragment of an ACE2 polypeptide may comprise the extracellular region of the ACE2 polypeptide and may lack the transmembrane domain. A chaff polypeptide may consist essentially of, or consist of, the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0021] In another aspect, this document features a composition comprising an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen that is expressed or shed by an allergen.

[0022] In another aspect, this document features a method for inducing an immune response to an allergen in a mammal. The method can include, or can consist essentially of, administering to a mammal a composition comprising: i) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen that is expressed or shed by an allergen, or ii) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen that is expressed or shed by an allergen, under conditions such that the SC-Ad infects cells of the mammal and expression of an immunogen in the cells results in the induction of an immune response. The mammal can be a human.

[0023] In another aspect, this document features an SC-Ad, the SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, the SC-Ad including an adenoviral polypeptide, and the SC-Ad including a nucleic acid sequence encoding an immunogen expressed by a cancer cell. The adenoviral polypeptide can be a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, or a pIIIa polypeptide. The SC-Ad can also include a nucleic acid sequence encoding an adjuvant polypeptide. The adjuvant polypeptide can be a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, or a biologically active fragment thereof. The SC-Ad can also include a nucleic acid sequence encoding a chaff polypeptide. The chaff polypeptide can be a fragment of an ACE2 polypeptide. A fragment of an ACE2 polypeptide may comprise the extracellular region of the ACE2 polypeptide and may lack the transmembrane domain. A chaff polypeptide may consist essentially of, or consist of, the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0024] In another aspect, this document features a composition comprising an SC-Ad, wherein the SC-Ad has a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises an adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen expressed by a cancer cell.

[0025] In another aspect, this document features a method for inducing an immune response against cancer cells in a mammal. The method can include, or can consist essentially of, administering to a mammal a composition comprising: i) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen expressed by the cancer cell, or ii) an SC-Ad having a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen expressed by the cancer cell, under conditions such that the SC-Ad infects cells of the mammal and expression of an immunogen in the cells results in the induction of an immune response. The mammal can be a human.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although the present invention can be practiced using methods and materials similar or equivalent to those described herein, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0027] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. [Brief explanation of the drawings]

[0028] DESCRIPTION OF THE DRAWINGS [Figure 1A]Schematic diagram of an exemplary TcdA / B fusion protein and an exemplary SC-Ad6 plasmid expressing the fusion protein, according to some embodiments. The TcdA / B fusion protein contains a human alpha-1-antitrypsin (AAT) secretion leader sequence and the RBDs of TcdA and TcdB separated by two furin cleavage sites. [Figure 1B] Schematic diagram of an exemplary TcdA / B fusion protein and an exemplary SC-Ad6 plasmid expressing the fusion protein, according to some embodiments. SC-Ad6 plasmid expressing the TcdA / B fusion using a CMV promoter. [Figure 2A] Single-cycle adenoviral expression of C. difficile toxin A and B fusion proteins. Western blot detecting expression of TcdA fragments in cell lysates and medium harvested from uninfected cells, cells infected with an Ad control (SC-Ad6-GFP-luciferase (GL)), and cells infected with SC-Ad6-TcdA / B. [Figure 2B] Single-cycle adenoviral expression of C. difficile toxin A and B fusion proteins. Western blot detecting expression of TcdB fragments in cell lysates and medium harvested from uninfected cells, cells infected with an Ad control (SC-Ad6-GFP-luciferase (GL)), and cells infected with SC-Ad6-TcdA / B. [Figure 3A] Serum antibody responses in immunized CD1 mice and toxin A challenge. Male and female CD1 mice (n = 10) were vaccinated intramuscularly (i.m.) with 1 x 10 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. Serum collected at week 6 was assayed by ELISA and neutralization assay. Serum endpoint titers at week 6 were significantly higher in female mice immunized with SC-Ad-TcdA / B than in males (p = 0.0066) (geometric mean, 95% CI). [Figure 3B]Serum antibody responses in immunized CD1 mice and toxin A challenge. Male and female CD1 mice (n = 10) were vaccinated intramuscularly (i.m.) with 1 x 10 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. Sera collected at week 6 were assayed by ELISA and neutralization assay. Toxin A neutralization titers were significantly higher in female and male groups compared with gender-matched controls (adjusted Dunn's p = 0.0001 and 0.0238 for females and males, respectively). [Figure 3C] Serum antibody responses in immunized CD1 mice and toxin A challenge. Male and female CD1 mice (n=10) were vaccinated intramuscularly (i.m.) with 1x10 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. Sera collected at week 6 were assayed by ELISA and neutralization assay. Combined male and female toxin A survival curves show significant survival rates compared to PBS or PEB1 control animals (p<0.0001). [Figure 4A] SC-Ad6-TcdA / B provides long-term protection against lethal challenge after a single immunization. Female CD1 mice (n=5) were vaccinated im with 1x10 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. Sera collected at weeks 3, 6, 14, 26, and 36 were titrated to determine toxin A binding endpoint titers, expressed as geometric means with standard deviations. [Figure 4B] SC-Ad6-TcdA / B provides long-term protection against lethal challenge after a single immunization. Female CD1 mice (n=5) were vaccinated im with 1x10 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. Sera collected at weeks 3, 6, 14, 26, and 36 were titrated to determine toxin B binding endpoint titers, expressed as geometric means with standard deviations. [Figure 4C]SC-Ad6-TcdA / B provides long-term protection against lethal challenge after a single immunization. Female CD1 mice (n=5) were vaccinated im with 1x1010 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. The mean neutralizing titers of toxin B were significantly higher in SC-Ad-TcdA / B than in SC-Ad-PEB1-immunized animals (p>0.0079 by Mann-Whitney). [Figure 4D] SC-Ad6-TcdA / B provides long-term protection against lethal challenge after a single immunization. Female CD1 mice (n=5) were vaccinated im with 1x10 viral particles of SC-Ad6-PEB1, SC-Ad6-TcdA / B, or PBS. Survival curves for SC-Ad-TcdA / B-vaccinated mice challenged with toxin A show significant protection compared with PBS or PEB1 control animals (p=0.0019 and 0.0021, respectively). [Figure 5A] Serum neutralizing antibody responses and protection from lethal spore challenge in immunized Syrian hamsters. Female Syrian hamsters (n=10) were vaccinated with 1×10 virus particles of SC-Ad6-TcdA / B intranasally (in) or im, or with PBS in. Sera collected 6, 12, and 18 weeks after immunization were assayed to determine the mean neutralizing titer of toxin A (*adjusted p<0.05 vs. control, **adjusted p<0.05 vs. control and in route). [Figure 5B] Serum neutralizing antibody responses and protection from lethal spore challenge in immunized Syrian hamsters. Female Syrian hamsters (n=10) were vaccinated with 1×10 virus particles of SC-Ad6-TcdA / B intranasally (in) or im, or with PBS in. Sera collected 6, 12, and 18 weeks after immunization were assayed to determine the mean neutralizing titer of toxin B (*adjusted p<0.05 vs. control, **adjusted p<0.05 vs. control and in route). [Figure 5C]Serum neutralizing antibody responses and protection from lethal spore challenge in immunized Syrian hamsters. Female Syrian hamsters (n=10) were vaccinated intranasally (in) or im with 1 x 10 viral particles of SC-Ad6-TcdA / B, or in with PBS. Survival curves for SC-Ad-TcdA / B-vaccinated animals challenged with UK1 spores show significant protection compared to PBS control animals (p<0.0001). [Figure 6A] SC-Ad6-TcdA / B provides protection against lethal spore challenge 45 weeks after a single immunization. Female Syrian hamsters (n=10) were vaccinated with 1×10 viral particles of SC-Ad6-TcdA / B in or im, or with PBS in. Sera collected at 6, 12, 18, 25, and 36 weeks post-immunization were assayed to determine the mean neutralizing titer of toxin A (*adjusted p<0.05 vs. control, **adjusted p<0.05 vs. control and in route). The breaks on the x-axis represent the end of the low-dose challenge study. Sera were collected at week 36 from the remaining animals in each group (n=5). [Figure 6B] SC-Ad6-TcdA / B provides protection against lethal spore challenge 45 weeks after a single immunization. Female Syrian hamsters (n=10) were vaccinated with 1×10 viral particles of SC-Ad6-TcdA / B in or im, or with PBS in. Sera collected at 6, 12, 18, 25, and 36 weeks post-immunization were assayed to determine the mean neutralizing titer of toxin B (*adjusted p<0.05 vs. control, **adjusted p<0.05 vs. control and in route). The breaks on the x-axis represent the end of the low-dose challenge study. Sera were collected at week 36 from the remaining animals in each group (n=5). [Figure 6C]SC-Ad6-TcdA / B provides protection against lethal spore challenge 45 weeks after a single immunization. Female Syrian hamsters (n = 10) were vaccinated in or im with 1 x 10 viral particles of SC-Ad6-TcdA / B or in with PBS. Survival curves for in (n = 5) and im (n = 4) SC-Ad-TcdA / B-vaccinated animals challenged with UK1 spores 45 weeks after a single immunization show significant protection compared to PBS control animals (n = 4) (p = 0.0027 vs. p = 0.0067, respectively). [Figure 6D] SC-Ad6-TcdA / B provides protection against lethal spore challenge 45 weeks after a single immunization. Female Syrian hamsters (n=10) were vaccinated in or im with 1 x 10 viral particles of SC-Ad6-TcdA / B, or in with PBS. Neutralizing toxin A and toxin B titers at week 36 of in-immunized animals that survived challenge compared to non-survivors. [Figure 7] Blood chemistry of SC-Ad6-TcdA / B-vaccinated animals. Groups of 10 Syrian hamsters were immunized once with 10 viral particles of SC-Ad6-TcdA / B via the in or im route. Control animals received in PBS. Blood was collected 3 days after immunization for clinical chemistry. [Figure 8A] Blood chemistry and CBC of SC-Ad6-TcdA / B vaccinated animals. Groups of 10 Syrian hamsters were immunized once with 10 viral particles of SC-Ad6-TcdA / B via the in or im route. Control animals received in PBS. One-half of the cohort (n=5 per group) was bled 3 days after immunization for clinical chemistry. [Figure 8B]Blood chemistry and CBC of SC-Ad6-TcdA / B vaccinated animals. Groups of 10 Syrian hamsters were immunized once with 10 viral particles of SC-Ad6-TcdA / B via the in or im route. Control animals received in PBS. The other half of the cohort (n=5 per group) was bled 4 days after immunization for clinical chemistry. [Figure 8C] Blood chemistry and CBC of SC-Ad6-TcdA / B-vaccinated animals. Groups of 10 Syrian hamsters were immunized once with 10 viral particles of SC-Ad6-TcdA / B via the in or im route. Control animals received in PBS. Blood was collected from one-half of the hamsters (n=5 per group) on day 4 for CBC. [Figure 9] Titration of toxin on Vero cells. [Figure 10] Titers of toxin B neutralizing antibodies (nAbs) 26 weeks after challenge. [Figure 11] Survival curves 8 weeks after toxin A challenge. [Figure 12A] Schematic diagram of an exemplary SC-Ad vector that can be used to deliver nucleic acids encoding one or more immunogens, according to some embodiments. Schematic diagram of an exemplary SC-Ad vector encoding a SARS-CoV-2 spike variant immunogen, and optionally one or more adjuvants and / or one or more chaff polypeptides. [Figure 12B] Schematic diagram of an exemplary SC-Ad vector that can be used to deliver nucleic acids encoding one or more immunogens according to some embodiments. Schematic diagram of an exemplary SC-Ad vector encoding a SARS-CoV-2 spike variant immunogen and, optionally, one or more adjuvants and / or one or more chaff polypeptides. The polypeptide-coding sequence of pIIIA, normally located between 52K and the penton, is deleted. [Figure 13] SARS-CoV-2 spike gene and RBD-Sb subdomain gene with restriction sites. [Figure 14]Western blot of spike polypeptide expressed by SC-Ad vector. 1° = anti-spike polyclonal (1:1000); 2° = protein A / G-HRP (1:10,000); substrate = Pico. [Figure 15] SC-Ad-spike infects ACE2+ cells and forms a cell fusion event. [Figure 16] The SC-Ad-spike infects ACE2+ cells, forming a cell fusion event and expressing adenoviral DNA and adenoviral protein adjuvant. [Figure 17] Western blot of ACE2 expression in 293-IIIA-ACE2 cells. 1° = anti-ACE2 (1:1000); 2° = protein A / G-HRP (1:10,000). [Figure 18] Western blot of spike polypeptides expressed by various plasmid expression vectors. [Figure 19] Antibody responses in mice 2 weeks after administration of a plasmid vector expressing the spike polypeptide or a negative control GFP-luciferase (GL) vector. [Figure 20A] IgA and IgG antibody responses in mice 2 weeks after intranasal (IN) or intramuscular (IM) administration of SC-Ad expressing spike polypeptide or negative control SC-Ad expressing Zika protein or buffer (PBS). [Figure 20B] IgA and IgG antibody responses in mice 6 weeks after intranasal (IN) or intramuscular (IM) administration of SC-Ad expressing spike polypeptide or negative control SC-Ad expressing Zika protein or buffer (PBS). [Figure 20C] IgA and IgG antibody responses in mice 2 weeks after intranasal (IN) or intramuscular (IM) administration of SC-Ad expressing spike polypeptide or negative control SC-Ad expressing Zika protein or buffer (PBS). [Figure 20D]IgA and IgG antibody responses in mice 2 weeks after intranasal (IN) or intramuscular (IM) administration of SC-Ad expressing spike polypeptide or negative control SC-Ad expressing Zika protein or buffer (PBS). [Figure 20E] IFNγ was also measured. [Figure 20F] CD8 T cell counts were also measured. [Figure 21] Western blot of spike polypeptide expression by replication-deficient adenovirus (RD-Ad) and SC-Ad expressing SARS-CoV-2 spike. [Figure 22] Example of an SC-Ad with SARS-CoV-2 spike or RBD, carrying the centralized influenza HA gene H1-CON. [Figure 23] An exemplary SC-Ad with converged influenza HA genes H1-CON covering the H1 hemagglutinin sequence and H1-5CON covering the H1-H5 hemagglutinin sequence. [Figure 24] Serum antibodies generated by the plasmid vaccine are increased by co-immunization with the granulocyte-macrophage colony-stimulating factor (GM-CSF) adjuvanted plasmid. [Figure 25] Serum antibodies 6 weeks after a single i.n. administration of SC-Ad HIV Env combined with SC-Ad expressing a genetic adjuvant. [Figure 26] Vaginal antibodies 6 weeks after a single i.n. administration of SC-Ad HIV Env combined with SC-Ad expressing a genetic adjuvant. [Figure 27] Vaginal antibodies after a single im administration of SC-Ad HIV Env combined with SC-Ad expressing a genetic adjuvant, followed by im or in HIV-1 envelope SOSIP polypeptide administration. [Figure 28] FIG. 1 is a schematic diagram of an exemplary Ad vector that can be used to deliver nucleic acids encoding gamma mink spike polypeptide variant immunogens, according to some embodiments. [Figure 29]Schematic diagram of an exemplary Ad vector that can be used to deliver nucleic acids encoding B.1.617.2 deltaspike polypeptide variant immunogens, according to some embodiments. [Figure 30] Schematic diagram of an exemplary Ad vector that can be used to deliver a nucleic acid encoding a B.1.617.2 delta plus spike polypeptide variant immunogen, according to some embodiments. [Figure 31] Schematic diagram of an exemplary Ad vector that can be used to deliver nucleic acids encoding SARS-CoV-2 M / N fusion polypeptide immunogens, according to some embodiments. [Figure 32] Antibody responses generated by single-cycle Ad6 and Ad657 vectors expressing the original spike polypeptide or the gamma mink spike polypeptide. A 1 / 1000 dilution of serum was analyzed by ELISA against the spike S1 polypeptide for IgG antibodies that bind to the polypeptide. [Figure 33] Schematic diagram of an exemplary Ad vector that can be used to deliver nucleic acids encoding C. difficile tcdB / B (tcdBx2) fusion polypeptide immunogens, according to some embodiments. [Figure 34] Schematic diagram of an exemplary Ad vector that can be used to deliver nucleic acids encoding lambda spike polypeptide variant immunogens, according to some embodiments. [Figure 35] FIG. 1 is a schematic diagram of an exemplary Ad vector that can be used to deliver nucleic acids encoding epsilon spike polypeptide variant immunogens, according to some embodiments. DETAILED DESCRIPTION OF THE INVENTION

[0029] Detailed Description This document provides adenoviral vectors, as well as methods and materials for using adenoviral vectors. In some cases, adenoviral vectors encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) immunogens can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal will produce an effective immune response (e.g., an immune response to the immunogens). For example, adenoviral vectors encoding one or more immunogens can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal will produce antibodies against pathogens, allergens, and / or cancer cells associated with the immunogens. In some cases, nucleic acid molecules capable of encoding adenoviral vectors encoding one or more immunogens can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal will produce an effective immune response (e.g., an immune response to the immunogens). For example, nucleic acid molecules capable of encoding adenoviral vectors encoding one or more immunogens can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal produces antibodies against pathogens, allergens, and / or cancer cells associated with those immunogens.

[0030] This document also provides adenoviral vectors encoding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) immunogens (e.g., SC-Ads encoding one or more immunogens), nucleic acid molecules encoding adenoviral vectors encoding one or more immunogens, cell lines containing adenoviral vectors encoding one or more immunogens, methods of using adenoviral vectors encoding one or more immunogens to deliver immunogens to cells in vitro or in vivo, and methods of using adenoviral vectors encoding one or more immunogens to induce an immune response in a mammal (e.g., a human).

[0031] The adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can be derived from any adenovirus. The adenovirus used to generate the adenoviral vectors provided herein can be of any suitable serotype (e.g., Ad1 to Ad57). In some cases, the adenovirus can be a replication-competent adenovirus. In some cases, the adenovirus can be a replication-deficient adenovirus. In some cases, the adenovirus can infect human cells (e.g., a human adenovirus). In some cases, the adenovirus can infect non-human cells, such as chimpanzee cells (e.g., a non-human adenovirus). Examples of adenoviruses that can be used to generate the adenoviral vectors provided herein include, but are not limited to, Ad5 adenovirus, Ad6 adenovirus, ChAdOx1, and ChAdOx2.

[0032] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) may be SC-Ad. SC-Ad may have a genome lacking all or part of at least one of the following adenoviral nucleic acid sequences: fiber protein coding sequence, V protein coding sequence, hexon coding sequence, penton base coding sequence (also called pIII coding sequence), VA RNA coding sequence, pIIIa protein coding sequence (also called minor capsid protein coding sequence), or other early or late gene product coding sequence. Examples of nucleic acid sequences encoding adenoviral polypeptides include, but are not limited to, those set forth in GenBank gi numbers 209842, 58478, or 2935210 and / or those annotated under GenBank accession numbers M73260, X17016, or AF030154. In some cases, a deletion of all or part of the nucleic acid encoding one or more of the following polypeptides can be engineered into the adenovirus-encoding nucleic acid so that the adenoviral vector does not encode the full-length adenoviral polypeptide or a fully functional version of that adenoviral polypeptide: fiber protein coding sequence, V protein coding sequence, hexon coding sequence, penton base coding sequence, VA RNA coding sequence, pIIIa protein coding sequence, or other early or late gene product coding sequence. Such deletions can be of any length that results in the deletion of one or more encoded amino acids and reduces or eliminates the normal function of the polypeptide. For example, a portion of the adenoviral nucleic acid sequence can be deleted so that the polypeptide encoded other than the deleted portion lacks 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, or more amino acid residues and lacks its normal activity. The deleted portion can be deleted from any position along the length of the sequence.For example, portions of the adenoviral nucleic acid sequence can be deleted at the 5' end, 3' end, or internal regions of the adenoviral nucleic acid, such as the fiber protein coding sequence, V protein coding sequence, hexon coding sequence, penton base coding sequence, VA RNA coding sequence, pIIIa protein coding sequence, or other early or late gene product coding sequence. In some cases, SC-Ad can be as described elsewhere (see, e.g., Matchett et al., J. of Virol., 2019 93(10):e02016-18 (2019); and WO 2009 / 111738).

[0033] The adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can include a nucleic acid sequence encoding any suitable immunogen (e.g., a nucleic acid that drives expression of any suitable immunogen). In some cases, the immunogen can be an antigen. The immunogen can be a full-length immunogenic polypeptide or a portion thereof (e.g., can be derived from an immunogenic polypeptide).

[0034] When the immunogenic polypeptide is derived from a pathogen, the immunogenic polypeptide can be derived from any type of pathogen (e.g., a virus, a bacterium, a protozoan, a prion, a viroid, or a fungus). In some cases, the immunogenic polypeptide can be a polypeptide expressed by a virus (e.g., a viral polypeptide). For example, the immunogenic polypeptide can be a polypeptide expressed by a coronavirus (e.g., a betacoronavirus). Examples of viruses capable of expressing immunogenic polypeptides include, but are not limited to, SARS-CoV, HCoV NL63, HKU1, MERS-CoV, SARS-CoV-2, HIV-1, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, influenza, Ebola virus, Chiningunya virus, Zika virus, cytomegalovirus, West Nile virus, and those listed in Table 3-1 of "Learning from SARS: Preparing for the Next Disease Outbreak: Workshop Summary." Institute of Medicine (US) Forum on Microbial Threats; Knobler S, Mahmoud A, Lemon S, et al., editors. Washington (DC): National Academies Press (US); 2004. In some cases, the immunogen may be derived from a polypeptide expressed by bacteria (e.g., a bacterial polypeptide). Examples of bacteria expressing polypeptides from which immunogens can be derived include, but are not limited to, Clostridium (e.g., C. difficile), Staphylococcus aureus (e.g., methicillin-resistant S. aureus), Campylobacter (e.g., Campylobacter jejuni), Mycobacteria (e.g., M. tuberculosis), and Borrelia (B. burgdorferi).Examples of immunogenic polypeptides that may be expressed by a pathogen include, but are not limited to, a C. difficile toxin A (TcdA) polypeptide, a C. difficile toxin B (TcdB) polypeptide, a coronavirus spike polypeptide, the amino acid sequence set forth in SEQ ID NO: 1 (see, e.g., Example 5), a coronavirus nucleoprotein, a coronavirus membrane protein, a coronavirus envelope protein, and a coronavirus nonstructural protein (e.g., coronavirus nonstructural proteins 1-16). For example, an immunogenic polypeptide associated with a pathogen may have or be encoded by a sequence set forth in, e.g., National Center for Biotechnology Information (NCBI) Accession Numbers: MN938384 and AY772062.

[0035] When the immunogenic polypeptide is derived from an allergen, the immunogenic polypeptide can be derived from any type of allergen (e.g., a substance capable of eliciting an immune response that results in an allergic reaction). Examples of allergens from which immunogenic polypeptides can be expressed and / or shed include, but are not limited to, Fel d 7, Can f1, beta-lactoglobulin, prolamin, parvalbumin, gliadin, Fel d1, chitinase, glutenin, cupin, prolamin, profilin, porcalcin, bet v-1-related protein, 2S albumin, vicilin, legumin, nsLTP, and Aed a 2. For example, adenoviral vectors encoding one or more immunogens described herein can be used to deliver the immunogens to a mammal (e.g., a human) such that the mammal produces antibodies against the allergens associated with those immunogens. For example, a nucleic acid molecule capable of encoding an adenoviral vector encoding one or more immunogens can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal produces antibodies to the allergens associated with those immunogens. For example, immunogenic polypeptides associated with allergens can have or be encoded by, for example, the sequences set forth in NCBI Accession Numbers: NP_001363134.1, AAD56719, NP_001363136.1, NP_001363139.1, P27762.1, P10414.2, P15494.2, P43176.2, NP_001191706.1, NP_001003190.1, XP_030099003.1, or XP_001657779.1.

[0036] When the immunogenic polypeptide is derived from a cancer cell (e.g., a cancer cell in a mammal with cancer), the immunogenic polypeptide can be expressed by any cancer cell. For example, the immunogenic polypeptide expressed by a cancer cell can be a tumor antigen. In some cases, the immunogenic polypeptide expressed by a cancer cell can be a cell surface tumor antigen. In some cases, the immunogenic polypeptide expressed by a cancer cell can be a tumor-associated antigen (TAA; for example, an antigen such as an abnormal protein present on tumor cells). In some cases, the immunogenic polypeptide can be a tumor-specific antigen (TSA; for example, an antigen present only on tumor cells). Examples of immunogenic polypeptides that can be expressed by cancer cells and used as described herein include, but are not limited to, folate receptor alpha, mucin 1 (MUC-1), human epidermal growth factor receptor 2 (HER-2), estrogen receptor (ER), epidermal growth factor receptor (EGFR), folate receptor alpha, mesothelin, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, epithelial tumor antigen (ETA), melanoma-associated antigen (MAGE), antigens produced by Epstein-Barr virus, and antigens produced by human papillomavirus. For example, adenoviral vectors encoding one or more immunogens as described herein can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal produces antibodies against cancer cells associated with those immunogens. For example, nucleic acid molecules capable of encoding adenoviral vectors encoding one or more immunogens as described herein can be used to deliver the immunogens to a mammal (e.g., a human) so that the mammal produces antibodies against cancer cells associated with those immunogens. For example, an immunogenic polypeptide associated with a cancer cell can have or be encoded by, for example, the sequence set forth in NCBI Accession Numbers: XP_002754883.1, AAA03229.1, Q02496.2, AAD33253.1, CEQ32409.1, YP_401631.1, YP_401632.1, or QAR15051.1.

[0037] When the immunogenic polypeptide is derived from a cancer cell (e.g., a cancer cell in a mammal having cancer), the immunogenic polypeptide can be expressed by any type of cancer cell, including, but not limited to, lung cancer, breast cancer, prostate cancer, liver cancer, kidney cancer, brain cancer, B-cell cancer, T-cell cancer, ovarian cancer, and skin cancer.

[0038] The immunogen can be a full-length immunogenic polypeptide or a portion thereof (e.g., derived from an immunogenic polypeptide). For example, a nucleic acid sequence encoding an immunogenic polypeptide can be modified to remove a portion of the nucleic acid so that the encoded polypeptide lacks any number of amino acids (e.g., 5, 10, 15, 20, 30, or all amino acids of the immunogenic polypeptide). In some cases, a portion of the nucleic acid sequence encoding an immunogenic polypeptide can be removed anywhere along the length of the sequence. For example, a portion of the nucleic acid sequence can be removed at the 5' end, 3' end, or an internal region of the target nucleic acid. In some cases, the immunogen can be designed to be secreted from cells infected with an adenoviral vector encoding the immunogen. For example, a nucleic acid sequence encoding an ER retention sequence can be removed from the nucleic acid sequence encoding the immunogen (e.g., so that the encoded immunogen lacks the ER retention sequence). In some cases, the immunogen can be designed to spread into the extracellular space from cells infected with an adenoviral vector encoding the immunogen. For example, the immunogen can include an ectodomain of an immunogenic polypeptide. In some cases, the immunogen can bind to (e.g., can be designed to bind to) a viral receptor (e.g., an ACE2 polypeptide). For example, the immunogen can include a receptor-binding domain of an immunogenic polypeptide.

[0039] In some cases, an immunogen may comprise two or more immunogenic polypeptides described herein (e.g., fusion polypeptides thereof). For example, an immunogen may comprise a first immunogenic polypeptide and a second immunogenic polypeptide. In some cases, the first immunogenic polypeptide and the second immunogenic polypeptide may be different polypeptides. For example, an immunogen may comprise a tcdA polypeptide and a tcdB polypeptide (e.g., a tcdA / B fusion polypeptide). In some cases, the first immunogenic polypeptide and the second immunogenic polypeptide may be the same polypeptide. For example, an immunogen may comprise a tcdB polypeptide and a tcdB polypeptide (e.g., a tcdB / B fusion polypeptide). When an immunogen comprises a first immunogenic polypeptide and a second immunogenic polypeptide, the first immunogenic polypeptide may be derived from a first pathogen, and the second immunogenic polypeptide may be derived from a second pathogen. The first pathogen and the second pathogen may be the same pathogen or different pathogens. When the first and second pathogens are the same pathogen, the first and second immunogenic polypeptides can be derived from different strains of that pathogen, for example, the first and second immunogenic polypeptides can be derived from different strains of the same bacterium (e.g., C. difficile).

[0040] Examples of immunogens derived from immunogenic polypeptides that can be used as described herein include, but are not limited to, the amino acid sequence set forth in SEQ ID NO:2 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:3 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:4 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:11 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:12 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:13 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:14 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:15 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO:16 (see, e.g., Example 5), Examples of the amino acid sequence include the amino acid sequence shown in SEQ ID NO: 17 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 18 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 19 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 42 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 43 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 44 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 45 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 46 (see, e.g., Example 5), the amino acid sequence shown in SEQ ID NO: 47 (see, e.g., Example 5), and the amino acid sequence shown in SEQ ID NO: 48 (see, e.g., Example 5).

[0041] In some cases, the immunogens described herein may be variants of wild-type immunogens. For example, a variant of a coronavirus spike polypeptide (e.g., a SARS-CoV-2 spike polypeptide) may comprise or consist essentially of the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid deletions, additions, substitutions, or combinations thereof. Examples of amino acid deletions (e.g., numbered in any one of SEQ ID NOS: 1-4) that may be present in a variant of a coronavirus spike polypeptide include, but are not limited to, a deletion of residues 69-70, a deletion of residue 144, a deletion of residues 156-157, a deletion of residues 241-243, and a deletion of residues 246-252.Examples of amino acid substitutions that may be present in variants of coronavirus spike polypeptides (e.g., numbered in any one of SEQ ID NOS: 1-4) include, but are not limited to, an L5F amino acid substitution, an S13I amino acid substitution, an L18F amino acid substitution, a T19R amino acid substitution, a T20N amino acid substitution, a P26S amino acid substitution, a G75I amino acid substitution, an A67V amino acid substitution, a V70F amino acid substitution, a T76I amino acid substitution, a D80A amino acid substitution, a D80G amino acid substitution, a T95I amino acid substitution, a D138Y amino acid substitution, a G142D amino acid substitution, a W152C amino acid substitution, an E154K amino acid substitution, an F157S amino acid substitution, an R158G amino acid substitution, an R190S amino acid substitution, a D215G amino acid substitution, an A222V amino acid substitution, a D253G amino acid substitution, a W258L amino acid substitution, a K417N amino acid substitution, a K417T ... amino acid substitution, L452R amino acid substitution, L452Q amino acid substitution, Y453F amino acid substitution, S477N amino acid substitution, T478K amino acid substitution, E484Q amino acid substitution, E484K amino acid substitution, F490S amino acid substitution, E484K amino acid substitution, S494P amino acid substitution, N501Y amino acid substitution, A570D amino acid substitution, D614G amino acid substitution, H655Y amino acid substitution, Q677H amino acid substitution, P68 These include a 1H amino acid substitution, a P681R amino acid substitution, an A701V amino acid substitution, a T716I amino acid substitution, a T859N amino acid substitution, a F888L amino acid substitution, a D950N amino acid substitution, a Q957R amino acid substitution, a S982A amino acid substitution, a K986P amino acid substitution, a V987P amino acid substitution, a T1027I amino acid substitution, a Q1071H amino acid substitution, a D1118H amino acid substitution, and a K1191N amino acid substitution. For example, a coronavirus spike polypeptide variant may include a K986P amino acid substitution and a V987P amino acid substitution (e.g., a PP substitution). In some cases, a coronavirus spike polypeptide variant may be a gamma mink variant of a coronavirus spike polypeptide. In some cases, a coronavirus spike polypeptide variant may be a delta variant of a coronavirus spike polypeptide.In some cases, the variant of the coronavirus spike polypeptide can be a lambda variant of the coronavirus spike polypeptide. In some cases, the variant of the coronavirus spike polypeptide can be an epsilon variant of the coronavirus spike polypeptide. In some cases, the variant of the coronavirus spike polypeptide can be a delta plus variant of the coronavirus spike polypeptide.

[0042] In some cases, the immunogens described herein may have an amino acid sequence having at least 85% sequence identity (e.g., at least 88% sequence identity, at least 90% sequence identity, at least 93% sequence identity, at least 95% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity) to the amino acid sequence set forth in any one of SEQ ID NOs: 1-4.

[0043] The percent sequence identity between a particular amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows: First, the sequence represented by a particular sequence identification number is compared to the amino acid sequence using the BLAST 2 Sequences (Bl2seq) program from the standalone version of BLASTZ, including BLASTN version 2.0.14 and BLASTP version 2.0.14. This standalone version of BLASTZ is available online at fr.com / blast or ncbi.nlm.nih.gov. Instructions explaining how to use the Bl2seq program can be found in the readme file accompanying BLASTZ. Bl2seq performs a comparison between two sequences using the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, and BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, set the options as follows: -i to the file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j to the file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p to blastn; -o to any desired file name (e.g., C:\output.txt); -q to -1; -r to 2; and leave all other options at their default settings. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq -ic:\seq1.txt -jc:\seq2.txt -p blastn -oc:\output.txt -q -1 -r 2. To compare two amino acid sequences, set the Bl2seq options as follows: -i to the file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j to the file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p to blastp; -o to any desired filename (e.g., C:\output.txt); all other options should be left at their default settings.For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq -ic:\seq1.txt -jc:\seq2.txt -p blastp -oc:\output.txt. If the two compared sequences share homology, the specified output file will present these regions of homology as aligned sequences. If the two compared sequences do not share homology, the specified output file will not present aligned sequences. Once aligned, the number of matches is determined by counting the number of positions where identical nucleotides or amino acid residues are present in both sequences. A matched position refers to a position where an identical amino acid exists at the same position in the aligned sequences. The percent sequence identity is determined by dividing the number of matches by the length of the sequence represented in the identified sequence (e.g., SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4), and then multiplying the resulting value by 100. For example, an amino acid sequence that has 220 matches when aligned with the sequence set forth in SEQ ID NO:2 is 93.2 percent identical to the sequence set forth in SEQ ID NO:2 (i.e., 220÷236×100=93.2). Note that percent sequence identity values ​​are rounded to two decimal places. For example, 75.1, 75.2, 75.3, and 75.4 would be rounded down to 75, and 75.5, 75.6, 75.7, 75.8, and 75.9 would be rounded up to 76. Note also that length values ​​are always integers.

[0044] In some cases, a coronavirus spike polypeptide variant may contain the entire amino acid sequence set forth in any one of SEQ ID NOs: 1-4, except that the amino acid sequence contains 1 to 10 (e.g., 1 to 9, 2 to 9, 1 to 8, 2 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1) amino acid additions, deletions, substitutions, or combinations thereof, provided that the coronavirus spike polypeptide variant has the ability to induce an immune response against a coronavirus in a mammal (e.g., a human). In some cases, a coronavirus spike polypeptide variant may consist essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4, except that the amino acid sequence contains 1, 2, 3, 4, or 5 amino acid residues before the linked sequence of the sequence identifier (e.g., SEQ ID NO: 1) and / or has 1, 2, 3, 4, or 5 amino acid residues after the linked sequence of the sequence identifier (e.g., SEQ ID NO: 1), provided that the coronavirus spike polypeptide has the ability to induce an immune response against coronavirus in a mammal (e.g., a human).

[0045] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can contain nucleic acid sequences encoding immunogens from two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) different immunogenic polypeptides. For example, the adenoviral vectors provided herein can contain a nucleic acid sequence encoding an immunogen derived from a first pathogen (e.g., an immunogen derived from an immunogenic polypeptide expressed by SARS-CoV-2) and can contain a nucleic acid sequence encoding an immunogen derived from a second pathogen (e.g., an immunogen derived from an immunogenic polypeptide expressed by a pathogen other than SARS-CoV-2). In some cases, the adenoviral vectors provided herein that comprise a nucleic acid sequence encoding two or more immunogens derived from immunogenic polypeptides expressed by different pathogens may comprise a nucleic acid sequence encoding a polypeptide comprising, consisting of, or consisting essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4, or may comprise a nucleic acid sequence encoding a polypeptide comprising, consisting of, or consisting essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 20-21. When the adenoviral vectors provided herein comprise a nucleic acid sequence encoding two or more immunogens from immunogenic polypeptides expressed by different pathogens, the adenoviral vectors can be used to induce immune responses against two or more pathogens.

[0046] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) may contain nucleic acid sequences encoding two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the same immunogenic polypeptide and / or immunogens from the same pathogen. For example, the adenoviral vectors provided herein may contain nucleic acid sequences encoding two or more immunogens derived from the same pathogen. In some cases, the adenoviral vectors provided herein that contain nucleic acid sequences encoding two or more immunogens derived from immunogenic polypeptides expressed by influenza may contain a nucleic acid sequence encoding a polypeptide comprising, consisting of, or consisting essentially of the amino acid sequence set forth in SEQ ID NO:20 (see, e.g., Example 5), or may contain a nucleic acid sequence encoding a polypeptide comprising, consisting of, or consisting essentially of the amino acid sequence set forth in SEQ ID NO:21 (see, e.g., Example 5).

[0047] In some cases, adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) that include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) immunogen-encoding nucleic acid sequences may also include one or more regulatory sequences (e.g., enhancer or promoter sequences, such as constitutive, inducible, and / or tissue-specific promoter sequences) to drive transcription of the immunogens. Examples of enhancers and promoters that can be used to drive expression of nucleic acid sequences encoding one or more immunogens in the adenoviruses provided herein include, but are not limited to, a CMV enhancer sequence, a CMV promoter sequence, a CAG enhancer sequence, a CAG promoter sequence, an RSV enhancer sequence, an RSV promoter sequence, an Ef1 alpha enhancer sequence, an Ef1 alpha promoter sequence, a ubiquitin enhancer sequence, a ubiquitin promoter sequence, an adenovirus enhancer sequence, and an adenovirus promoter sequence. Any suitable method can be used to detect the expression of an immunogen from cells infected with an adenoviral vector, for example, the presence or absence of the immunogen can be detected using an antibody that recognizes the immunogen.

[0048] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) adjuvant polypeptides (e.g., nucleic acids driving the expression of one or more adjuvant polypeptides). For example, the adenoviral vector can include a nucleic acid sequence encoding one or more polypeptides capable of enhancing an immune response in a mammal. In some cases, the adjuvant polypeptide can be a cytokine. In some cases, the adjuvant polypeptide can be an immunostimulant. In some cases, the adjuvant polypeptide can be a toxin. In some cases, the adjuvant polypeptide can promote a systemic T cell response against a pathogen present in a mammal. In some cases, the adjuvant polypeptide can increase the concentration of antibodies against a pathogen at a site where the pathogen can enter the mammal's body. For example, the adjuvant polypeptide can increase the concentration of antibodies against a virus (eg, a coronavirus) at mucosal sites where the virus can enter the mammalian body.Examples of adjuvant polypeptides that may be encoded by the adenoviral vectors encoding one or more immunogens described herein include, but are not limited to, granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptides, interleukin 4 (IL-4) polypeptides, interleukin 21 (IL-21) polypeptides, CD40 ligand (CD40L) polypeptides, 4-1BB ligand (4-1BBL) polypeptides, transforming growth factor beta (TGF-β) polypeptides, C. difficile toxin polypeptides (e.g., C. difficile TcdA polypeptides (see, e.g., SEQ ID NO: 22), C. difficile toxin polypeptides (e.g., C. difficile TcdA polypeptides (see, e.g., SEQ ID NO: 22) ... difficile TcdB polypeptide (e.g., see SEQ ID NO:23), and / or the amino acid sequence set forth in SEQ ID NO:10 (e.g., see Example 5)), and influenza polypeptides (e.g., N polypeptide, H polypeptide, M polypeptide, the amino acid sequence set forth in SEQ ID NO:20 (e.g., see Example 5), and / or the amino acid sequence set forth in SEQ ID NO:21 (e.g., see Example 5)). In some cases, the adjuvant polypeptide (e.g., SEQ ID NO:22) may be preceded by an AAT secretion sequence (e.g., MPSSVSWGILLLAGLCCLVPVSLAEDP; SEQ ID NO:28). In some cases, the nucleic acid sequence encoding the adjuvant polypeptide (e.g., SEQ ID NO:23) may be preceded by a cleavage site, such as a synthetic furin cleavage site (e.g., RGRRSRGRRS; SEQ ID NO:29). Examples of nucleic acid sequences capable of encoding the adjuvant polypeptides described herein include, but are not limited to, the nucleic acid sequence set forth in SEQ ID NO:24 (e.g., see Example 5) and the nucleic acid sequence set forth in SEQ ID NO:25 (e.g., see Example 5). In some cases, the nucleic acid sequence encoding the adjuvant polypeptide (e.g., SEQ ID NO: 24) may be preceded by an AAT secretory sequence (e.g., ATGCCTTCATCCGTGTCATGGGGAATCCTGCTGCTGGCTGGACTGTGCTGTCTGGTGCCTGTCTCACTGGCCGAGGACCCT; SEQ ID NO: 40).In some cases, the nucleic acid sequence encoding the adjuvant polypeptide (e.g., SEQ ID NO: 25) can be preceded by a cleavage site, such as a synthetic furin cleavage site (e.g., AGAGGACGGAGATCAAGAGGAAGGCGCAGC; SEQ ID NO: 41). The adjuvant polypeptide can be a full-length polypeptide or a fragment of an adjuvant polypeptide described herein, provided that the fragment has the ability to enhance an immune response (e.g., a biologically active fragment). In some cases, the adjuvant polypeptide can be as described elsewhere (see, e.g., Matchett et al., Vaccines, 8(1):64 (2020)).

[0049] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can encode (e.g., can be designed to encode) a polypeptide comprising an immunogen fused to an adjuvant polypeptide. For example, a nucleic acid sequence encoding an immunogen can be fused to a nucleic acid sequence encoding an adjuvant polypeptide (e.g., such that the encoded immunogen is fused to the encoded adjuvant polypeptide). An example of an immunogen fused to an adjuvant polypeptide that can be encoded by the adenoviral vectors encoding one or more immunogens described herein includes, but is not limited to, the amino acid sequence set forth in SEQ ID NO: 5 (see, e.g., Example 5).

[0050] In some cases, adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chaff polypeptides (e.g., nucleic acids driving expression of one or more chaff polypeptides). The chaff polypeptide can be a full-length polypeptide or a fragment thereof, provided that it reduces the rate of entry of a pathogen into cells in a mammal or inhibits entry. In some cases, the chaff polypeptide can be a soluble polypeptide. For example, a soluble chaff polypeptide can be a full-length chaff polypeptide or a fragment of a chaff polypeptide that lacks the transmembrane domain. For example, a soluble chaff polypeptide can comprise the ectodomain of a chaff polypeptide. In some cases, the chaff polypeptide can target (e.g., target and bind to) a particular pathogen (e.g., a virus such as a coronavirus) and reduce the rate of entry of the pathogen into cells in a mammal or inhibit entry. In some cases, a chaff polypeptide can target (e.g., target and bind to) two, three, four, five, six, or more different pathogens. In some cases, a chaff polypeptide can include one or more mutations (e.g., inactivating mutations). Examples of chaff polypeptides that can be encoded by adenoviral vectors encoding one or more immunogens described herein include, but are not limited to, full-length ACE2 polypeptides and fragments thereof, full-length CD13 polypeptides and fragments thereof, full-length CEACAM1 polypeptides and fragments thereof, full-length sialylated polypeptides and fragments thereof, full-length CD46 polypeptides and fragments thereof, full-length nestin polypeptides and fragments thereof, the amino acid sequence set forth in SEQ ID NO: 8 (see, e.g., Example 5), and the amino acid sequence set forth in SEQ ID NO: 9 (see, e.g., Example 5).

[0051] In some cases, adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can encode (e.g., can be designed to encode) a polypeptide comprising an immunogen fused to a chaff polypeptide. For example, a nucleic acid sequence encoding an immunogen can include a nucleic acid sequence encoding a chaff polypeptide (e.g., such that the encoded immunogen is fused to the encoded chaff polypeptide).

[0052] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) marker polypeptides (e.g., nucleic acids that drive the expression of one or more marker polypeptides). Examples of marker polypeptides that can be encoded by the adenoviral vectors encoding one or more immunogens described herein include, but are not limited to, fluorescent polypeptides (e.g., GFP, RFP, CFP, and YFP), streptavidin polypeptides, Cre recombinase polypeptides, Cas polypeptides, luciferase polypeptides, beta-galactosidase polypeptides, and sodium iodide symporter polypeptides.

[0053] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) polypeptides capable of forming multimers (e.g., nucleic acids that drive the expression of one or more polypeptides capable of forming multimers). Examples of polypeptides capable of forming multimers that may be encoded by the adenoviral vectors encoding one or more immunogens described herein include, but are not limited to, immunoglobulin constant region polypeptides (e.g., Ig polypeptides), streptavidin polypeptides, and sigma coil polypeptides.

[0054] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can encode (e.g., can be designed to encode) a polypeptide comprising an immunogen fused to a polypeptide capable of forming multimers. For example, the nucleic acid sequence encoding the immunogen can include a nucleic acid sequence encoding a polypeptide capable of forming multimers (e.g., such that the encoded immunogen is fused to an encoded polypeptide capable of forming multimers). Examples of immunogens fused to polypeptides capable of forming multimers that can be encoded by the adenoviral vectors encoding one or more immunogens described herein include, but are not limited to, the amino acid sequence set forth in SEQ ID NO: 5 (see, e.g., Example 5), the amino acid sequence set forth in SEQ ID NO: 6 (see, e.g., Example 5), and the amino acid sequence set forth in SEQ ID NO: 7 (see, e.g., Example 5).

[0055] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) may have a genome that is at least 85% identical (e.g., at least 88% sequence identical, at least 90% sequence identical, at least 93% sequence identical, at least 95% sequence identical, at least 97% sequence identical, at least 98% sequence identical, or at least 99% sequence identical) to the sequence set forth in any one of SEQ ID NOs: 28-39. For example, the adenoviral vectors provided herein may have a genome that comprises, consists of, or consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 28 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome that comprises, consists of, or consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 29 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome that comprises, consists of, or consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 30 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 31 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 32 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 33 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 34 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 35 (see, e.g., Example 5).For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 36 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 37 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 38 (see, e.g., Example 5). For example, the adenoviral vectors provided herein may have a genome comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 39 (see, e.g., Example 5).

[0056] In some cases, adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) can have a genome that includes one or more of the coding regions set forth in any one of SEQ ID NOS: 28-39. For example, an SC-Ad can be designed to have a genome in which all encoded polypeptides of the SC-Ad have the same amino acid sequence as the polypeptide encoded by the nucleic acid set forth in any one of SEQ ID NOS: 28-39.

[0057] This document also provides nucleic acid molecules capable of encoding the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens, such as SC-Ad, described herein). As used herein, the term "nucleic acid" encompasses both RNA and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA. Nucleic acids can be double-stranded or single-stranded. Single-stranded nucleic acids can be the sense strand or the antisense strand. Furthermore, nucleic acids can be circular or linear.

[0058] This document also provides cells (e.g., cell lines) containing the adenoviral vectors described herein (e.g., adenoviral vectors encoding one or more immunogens, such as SC-Ad described herein). Where the adenoviral vector lacks all or part of at least one adenoviral sequence, the cells containing the adenoviral vector can provide the missing adenoviral polypeptide. For example, where an adenovirus is engineered to lack nucleic acid encoding an adenoviral fiber polypeptide, an adenoviral fiber polypeptide-expressing cell line can be used to generate the adenovirus such that the adenovirus contains a fiber polypeptide (e.g., a wild-type fiber polypeptide) but lacks nucleic acid encoding the fiber polypeptide (e.g., a wild-type fiber polypeptide). For example, where an adenovirus is engineered to lack nucleic acid encoding a V polypeptide, an adenoviral V polypeptide-expressing cell line can be used to generate the adenovirus such that the adenovirus contains a V polypeptide (e.g., a wild-type V polypeptide) but lacks nucleic acid encoding the V polypeptide (e.g., a wild-type V polypeptide). For example, if an adenovirus is engineered to lack a nucleic acid encoding a pIIIa polypeptide, an adenovirus pIIIa polypeptide-expressing cell line can be used to generate the adenovirus such that the adenovirus contains a pIIIa polypeptide (e.g., a wild-type pIIIa polypeptide) but lacks the nucleic acid encoding the pIIIa polypeptide (e.g., a wild-type pIIIa polypeptide). In some cases, cells containing the adenoviral vectors described herein can increase the available copy number of the virus by at least 100-fold (e.g., 100-fold to 15,000-fold, 500-fold to 10,000-fold, 5,000-fold to 10,000-fold, or 5,000-fold to 15,000-fold). The virus can be expanded in standard cell culture medium (e.g., DMEM or RPMI-1640 supplemented with 5-10% fetal bovine serum at 37°C in 5% CO2) until the desired concentration is achieved.Viral titers are typically assayed by inoculating cells in culture (e.g., A549 or 293 cells) or quantifying viral genomes by optical density or real-time PCR. In some cases, cells containing the adenoviral vectors provided herein can be used to propagate the adenoviral vector (e.g., to establish an adenoviral vector stock). For example, an adenoviral vector stock can be produced by propagation in mammalian cells. In some cases, the adenoviral vector stock can be aliquoted, frozen, and stored at -70°C to -80°C (e.g., at a concentration higher than the therapeutically effective dose). In some cases, the adenoviral vector stock can be stored in a stabilizing solution. Examples of stabilizing solutions include, but are not limited to, sugars (e.g., trehalose, dextrose, and glucose), amino acids, glycerol, gelatin, monosodium glutamate, and Ca. 2+ , and Mg 2+ Examples include:

[0059] In some cases, an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can be formulated into a composition (e.g., a pharmaceutical composition such as a vaccine composition) for administration to a mammal. For example, a composition comprising an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more viral immunogens) can be formulated with one or more pharmaceutically acceptable carriers (additives), excipients, and / or diluents.Examples of pharmaceutically acceptable carriers, excipients, and diluents that can be used in the compositions described herein include, but are not limited to, sucrose, lactose, starch (e.g., starch glycolate), cellulose, cellulose derivatives (e.g., modified celluloses such as microcrystalline cellulose and cellulose ethers such as hydroxypropyl cellulose (HPC) and the cellulose ether hydroxypropylmethylcellulose (HPMC)), xylitol, sorbitol, mannitol, gelatin, polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), cross-linked polyvinylpyrrolidone (crospovidone), carboxymethylcellulose, polyethylene-polyoxypropylene-block polymers, and cross-linked sodium carboxymethylcellulose (croscarmellose sodium), and the like. Examples of suitable pharmaceutical formulations include: titanium dioxide, azo dyes, silica gel, fumed silica, talc, magnesium carbonate, vegetable stearin, magnesium stearate, aluminum stearate, stearic acid, antioxidants (e.g., vitamin A, vitamin E, vitamin C, retinyl palmitate, and selenium), citric acid, sodium citrate, petrolatum (e.g., methylparaben and propylparaben), petrolatum, dimethyl sulfoxide, mineral oil, serum proteins (e.g., human serum albumin), glycine, sorbic acid, potassium sorbate, water, salts or electrolytes (e.g., saline, protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, and zinc salts), colloidal silica, magnesium trisilicate, polyacrylate, wax, wool fat, lecithin, and corn oil. Suitable pharmaceutical formulations depend in part on the application and route of administration. Such forms must not prevent the composition or formulation from reaching target cells or exerting its effect. For example, pharmacological compositions injected into the blood stream must be soluble.

[0060] In some cases, a composition comprising an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) may include multiple identical adenoviral vectors designed to include one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens).

[0061] In some cases, a composition comprising an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can include two or more (e.g., two, three, four, five, or more) different populations of adenoviral vectors. For example, a composition can be designed to include two populations of adenoviral vectors, where the first population contains one or more coronavirus immunogens (e.g., an amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48) and the second population contains one or more adjuvant polypeptides (e.g., a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a C. difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and / or biologically active fragments thereof). For example, a composition can be designed to include two populations of adenoviral vectors, the first population containing one or more coronavirus immunogens (e.g., an amino acid sequence set forth in any one of SEQ ID NOs: 1-4, 42-44, 47, and 48) and the second population containing a chaff polypeptide (e.g., a fragment of an ACE2 polypeptide).

[0062] In some cases, a composition comprising an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can be designed to include different populations of adenoviral vectors, each population of adenoviral vectors of the composition containing a single immunogen (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding a single immunogen). For example, a composition of adenoviral vectors can be designed to include a first population of adenoviral vectors having a first coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48) and a second population of adenoviral vectors having a second coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48). For example, an adenoviral vector composition can be designed to include a first population of adenoviral vectors having a first coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48), a second population of adenoviral vectors having a second coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48), and a third population of adenoviral vectors having a third coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48).In another example, an adenoviral vector composition can be designed to include a first population of adenoviral vectors having a first coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48), a second population of adenoviral vectors having a second coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOS: 1-4, 42-44, 47, and 48), and a third population of adenoviral vectors of an adjuvant polypeptide (e.g., a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a C. difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and / or a biologically active fragment thereof). a first population of adenoviral vectors having a first coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOs: 1-4, 42-44, 47, and 48); a second population of adenoviral vectors having a second coronavirus immunogen (e.g., the amino acid sequence set forth in any one of SEQ ID NOs: 1-4, 42-44, 47, and 48); and a third population of adenoviral vectors having a chaff polypeptide (e.g., a fragment of an ACE2 polypeptide).

[0063] This document also provides methods of using the adenoviral vectors described herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein. In some cases, the adenoviral vectors described herein and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to a mammal (e.g., a human) to increase an immune response (e.g., an increased antibody response and / or an increased T cell response) against a pathogen (e.g., a bacterial or viral pathogen associated with the immunogen encoded by the adenoviral vector). For example, a composition comprising an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can be administered to a mammal to provide the mammal with an immune response effective to reduce the severity of an infection caused by a pathogen associated with the immunogen encoded by the adenoviral vector. In some cases, a composition comprising an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector encoding one or more immunogens) can be administered to a mammal as described herein to provide the mammal with an immune response effective to prevent the mammal from exhibiting symptoms of infection caused by a pathogen associated with the immunogen encoded by the adenoviral vector. In some cases, the adenoviral vector described herein and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein can be administered to a mammal (e.g., a human) to increase a B-cell response in the mammal.For example, an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can be administered to a mammal as described herein to increase the number of activated B cells (e.g., plasmablasts, plasma cells, and memory B cells) in the mammal by, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more.

[0064] In some cases, the adenoviral vectors described herein and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to a mammal (e.g., a human) to increase the number of antibodies in the mammal (e.g., antibodies to a pathogen, such as a bacterial or viral pathogen, associated with the immunogen encoded by the adenoviral vector). For example, an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can be administered to a mammal as described herein to increase the number of antibodies in the mammal by, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In some cases, the adenoviral vectors described herein and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to a mammal as described herein to produce antibodies against an immunogen in the mammal, for example, for about one week (e.g., about 1 day to about 7 days, about 1 day to about 6 days, about 1 day to about 5 days, about 1 day to about 4 days, about 1 day to about 3 days, about 2 days to about 7 days, about 3 days to about 7 days, about 4 days to about 7 days, about 5 days to about 7 days, about 2 days to about 6 days, about 3 days to about 5 days, about 2 days to about 4 days, about 3 days to about 5 days, or about 4 days to about 6 days).

[0065] In some cases, the adenoviral vectors described herein and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to a mammal (e.g., a human) to increase a T cell response in the mammal. For example, an adenoviral vector described herein encoding one or more immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more immunogens) can be administered to a mammal as described herein to increase the number of activated T cells (e.g., cytotoxic T cells and macrophages) in the mammal by, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more.

[0066] The adenoviral vectors described herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to any suitable mammal (e.g., to increase an immune response in the mammal against a pathogen, such as a bacterial or viral pathogen, associated with the immunogens encoded by the adenoviral vectors). In some cases, the mammal may be a mammal that has not previously been infected with a pathogen associated with an immunogen encoded by an adenoviral vector provided herein. In some cases, the mammal may be a mammal that has a previous infection with a pathogen closely related (e.g., genetically related) to a pathogen associated with an immunogen encoded by an adenoviral vector provided herein. In some cases, the mammal may be a mammal that has an infection (e.g., an ongoing infection) with a pathogen associated with an immunogen encoded by an adenoviral vector provided herein. Examples of mammals to which the adenoviral vectors described herein encoding one or more immunogens (and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein encoding one or more immunogens) can be administered include, but are not limited to, humans, non-human primates such as monkeys, dogs, cats, horses, cows, pigs, sheep, mice, rats, rabbits, hamsters, bats, raccoons, and ferrets. In some cases, the methods and materials described herein can be applied to avian species instead of mammals. For example, the methods and materials described herein for treating mammals can be applied to chickens and turkeys. In some cases, the methods and materials described herein can be applied to reptilian species instead of mammals. In some cases, the methods and materials described herein can be applied to amphibian species instead of mammals. In some cases, the methods and materials described herein can be applied to fish species instead of mammals.In some cases, one or more of the adenoviral vectors described herein and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to a human to increase an immune response against a pathogen (e.g., a bacterial or viral pathogen related to the immunogen encoded by the adenoviral vector).

[0067] When administering an adenoviral vector described herein (e.g., an adenoviral vector encoding one or more immunogens) and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein (e.g., a composition, such as a vaccine composition, comprising an adenoviral vector described herein and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein), any suitable route of administration can be used. For example, the compositions provided herein (e.g., vaccine compositions) can be administered to a mammal (e.g., a human) orally (e.g., sublingually) or parenterally (including, but not limited to, intranasally, subcutaneously, intramuscularly, intravenously, intradermally, intracerebrally, intrathecally, or intraperitoneally). In some cases, the route and / or mode of administration of a composition provided herein (e.g., a vaccine composition) can be tailored to the mammal being treated. In some cases, the adenoviral vector described herein and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein can be administered to a mammal via mucosal delivery. In some cases, the adenoviral vectors described herein and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein can be administered to a mammal as described elsewhere (see, e.g., Weaver et al. PLOS ONE, 8(7):e67574 (2013)).

[0068] The adenoviral vectors described herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding the adenoviral vectors described herein (e.g., compositions, such as vaccine compositions, comprising the adenoviral vectors provided herein and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein) can be administered to a mammal (e.g., a human) in any suitable amount (e.g., any suitable dose). The effective amount will vary depending on the route of administration, the age and general health of the subject, the use of excipients, the possibility of co-administration with other therapeutic treatments, such as the use of other drugs, and the judgment of the treating physician. An effective amount of a composition containing an adenoviral vector encoding one or more immunogens (and / or nucleic acid molecules capable of encoding an adenoviral vector encoding one or more immunogens) can be any amount capable of inducing an immune response in a mammal as described herein without causing significant toxicity to the mammal. For example, an effective amount of an adenoviral vector encoding one or more immunogens can be, for example, about 10 8 Virus particles (vp) ~ approx. 10 14 vp (e.g., about 10 8 vp~about 10 13 vp, about 10 8 vp~about 10 12 vp, about 10 8 vp~about 10 11 vp, about 10 8 vp~about 10 10 vp, about 10 8 vp~about 10 9 vp, about 10 9 vp~about 10 14 vp, about 10 10 vp~about 10 14 vp, about 10 11 vp~about 10 14 vp, about 10 12 vp~about 10 14 vp, about 10 13 vp~about 10 14 vp, about 10 9 vp~about 10 13 vp, about 10 10 vp~about 10 12vp, about 10 9 vp~about 10 11 vp, about 10 10 vp~about 10 12 vp, or about 10 1 vp~about 10 13 vp). The effective amount may remain constant or may be adjusted as a sliding scale or variable dose depending on the mammal's response to treatment. Various factors may affect the actual effective amount used for a particular application. For example, the frequency of administration, the duration of treatment, the use of multiple therapeutic agents, and / or the route of administration may require an increase or decrease in the actual effective amount administered.

[0069] The adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein (e.g., compositions such as vaccine compositions comprising the adenoviral vectors provided herein and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein) can be administered to a mammal (e.g., a human) at any suitable frequency. The administration frequency can be any frequency capable of inducing an immune response in the mammal without causing significant toxicity to the mammal. In some cases, the adenoviral vectors provided herein and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein can be administered to the mammal once (e.g., in a single dose). In some cases, the adenoviral vectors provided herein and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein can be administered to the mammal several times (e.g., as several doses). For example, the administration frequency can be about once a day to about every three days, about once a day to about once a week, about once a week to about every three weeks, or about once a week to about every six weeks. The administration frequency can remain constant or can be varied over the course of treatment. As with the effective dose, various factors can affect the actual administration frequency used for a particular application. For example, the effective dose, the duration of treatment, the use of multiple therapeutic agents, and / or the route of administration may require an increase or decrease in the administration frequency.

[0070] The adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein (e.g., compositions such as vaccine compositions comprising the adenoviral vectors provided herein and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein) can be administered to a mammal (e.g., a human) for any suitable period of time. The period of administration or use of a composition containing an adenoviral vector encoding one or more immunogens (and / or nucleic acid molecules capable of encoding an adenoviral vector encoding one or more immunogens) can be any period that is capable of inducing an immune response in the mammal without causing significant toxicity to the mammal. For example, the effective period can vary from a couple of days to a week, from several days to several weeks, or from a few days to a month. Multiple factors can affect the actual effective period used for a particular treatment. For example, the effective period can vary depending on the frequency of administration, the effective amount, the use of multiple therapeutic agents, and / or the route of administration.

[0071] In some cases, the adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein (e.g., compositions such as vaccine compositions comprising the adenoviral vectors provided herein and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein) can be administered to a mammal (e.g., a human) in an effective amount one, two, or three times, with one to four weeks between each administration if administered more than once.

[0072] In some cases, one or more adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding an adenoviral vector provided herein (e.g., a composition, such as a vaccine composition, comprising an adenoviral vector provided herein and / or a nucleic acid molecule capable of encoding an adenoviral vector provided herein) can be administered to a mammal (e.g., a human) as the sole active ingredient to increase the immune response (e.g., an increased antibody response and / or an increased T cell response) to a pathogen (e.g., a bacterial or viral pathogen related to the immunogen encoded by the adenoviral vector). For example, a composition containing an adenoviral vector described herein encoding one or more coronavirus immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more coronavirus immunogens) can be administered to a mammal (e.g., a human) as the sole active ingredient to increase the immune response (e.g., an increased antibody response and / or an increased T cell response) to a coronavirus.

[0073] In some cases, one or more adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding an adenoviral vector provided herein (e.g., a composition such as a vaccine composition comprising an adenoviral vector provided herein and / or a nucleic acid molecule capable of encoding an adenoviral vector provided herein) can be administered to a mammal (e.g., a human) along with one or more (e.g., one, two, three, four, five, or more) additional agents / therapies used to increase the immune response (e.g., increase the antibody response and / or increase the T cell response) to a pathogen (e.g., a bacterial or viral pathogen related to the immunogen encoded by the adenoviral vector). For example, a composition containing an adenoviral vector described herein encoding one or more coronavirus immunogens (and / or a nucleic acid molecule capable of encoding an adenoviral vector described herein encoding one or more coronavirus immunogens) can be administered to a mammal (e.g., a human) along with one or more (e.g., one, two, three, four, five, or more) additional agents / therapies used to increase the immune response (e.g., increasing an antibody response and / or increasing a T cell response) to the coronavirus. When one or more adenoviral vectors provided herein (e.g., adenoviral vectors encoding one or more immunogens) and / or nucleic acid molecules capable of encoding an adenoviral vector provided herein (e.g., a composition such as a vaccine composition comprising an adenoviral vector provided herein and / or a nucleic acid molecule capable of encoding an adenoviral vector provided herein) are used in combination with one or more additional agents / therapies used to increase an immune response (e.g., an increased antibody response and / or an increased T cell response), the one or more adenoviral vectors provided herein (and / or nucleic acid molecules capable of encoding an adenoviral vector provided herein) and the one or more additional agents / therapies can be administered simultaneously (e.g., in a single composition) or independently.For example, one or more adenoviral vectors provided herein (and / or nucleic acid molecules capable of encoding the adenoviral vectors provided herein) can be administered first, followed by one or more additional agents / therapies, or vice versa.

[0074] The present invention is further described in the following examples, which do not limit the scope of the invention described in the claims. [Example]

[0075] Example Example 1: Replicating Single-Cycle Adenovirus Vaccine Against Clostridium difficile Clostridium difficile causes approximately 500,000 infections and 30,000 deaths annually in the United States, costing up to $4.8 billion annually. C. difficile infection (CDI) occurs when the bacterium colonizes the large intestine and releases two toxins, toxin A (TcdA) and toxin B (TcdB). This example describes an SC-Ad gene-based vaccine against C. difficile.

[0076] result A single-cycle adenovirus expressing C. difficile toxin A and B fusion proteins. The SC-Ad-TcdA / B vector was generated using adenovirus type 6 (Ad6) (Figure 1). This vector contains a mammalian codon-optimized cDNA expressing a fusion protein consisting of a secretory leader and the RBDs of TcdA and TcdB separated by two furin cleavage sites. The toxin RBD was derived from the VPI 10463 strain (toxinotype 0), with asparagine substitutions at putative N-linked glycosylation sites replaced with glutamines. This resulted in a total of eight substitutions in the TcdA RBD and three alterations in the TcdB RBD sequence. Human lung A549 cells were infected with SC-Ad6-TcdA / B, and cell supernatants and lysates were analyzed by Western blot using antibodies specific for TcdA and TcdB. The fusion protein was predicted to be 160 kDa, while the RBDs of TcdA and TcdB were predicted to be 100 and 60 kDa, respectively. Under these conditions, both the RBD and the fusion protein were observed in the cells and concentrated cell supernatants (Fig. 2).

[0077] A single intramuscular vaccination with SC-Ad6-TcdA / B induces an immune response in mice. Groups of 10 male and female outbred CD-1 mice were cultured in PBS or 10% SC-Ad6-TcdA / B medium. 10Mice were immunized once im with either viral particles or a negative control vector, SC-Ad6-PEB1, expressing a mismatched protein from another bacterium, Campylobacter jejuni. Serum was collected 6 weeks after immunization, and antitoxin antibody responses were assessed by ELISA and in vitro toxin neutralization assays. Following a single immunization, the majority of SC-Ad6-TcdA / B-vaccinated animals generated significant antibodies against toxin A (Figures 3A and 3B). Reciprocal titers were defined as those significantly higher than the levels in PBS control mice. Therefore, antibody levels in the PBS group are not shown. Both sexes of animals generated significantly higher antibody responses than control mice. The geometric mean reciprocal toxin A binding titer in female mice was 1,467,329, and that in male mice was 397,964 (Figure 3A). Binding titers in females were significantly higher than those in males (Mann-Whitney p<0.0066). A similar pattern was observed for TcdA neutralizing (nAb) titers from the two sexes, with mean titers of 1682 in females and 379 in males (Figure 3B). However, these differences were not significant (Dunn p=0.8004). When compared with animals immunized with SC-Ad6-PEB1, nAb titers in animals administered SC-Ad6-TcdA / B were significantly higher than those in sex-matched controls.

[0078] A single intramuscular vaccination with SC-Ad6-TcdA / B provides protection against toxin challenge. Eight weeks after the single immunization, mice were challenged with 300 ng (6 × LD50) of purified TcdA from List Labs. The recombinant toxin was derived from the ribotype 087 and toxinotype 0 strain, similar to the VPI 10463 antigen in the SC-Ad vaccine. Eight of 10 PBS and PEB1 mice died from toxin within 24 hours of challenge (Figure 3C). One additional PBS mouse met the sacrifice criteria 3 days later. Seventeen of 20 mice vaccinated with the SC-Ad6-TcdA / B vaccine survived challenge. Log-rank comparison of Kaplan-Meier survival curves showed that SC-Ad6-TcdA / B-vaccinated animals survived significantly better than PBS or PEB1 control animals. The three SC-Ad6-TcdA / B-vaccinated mice that did not survive had reduced TcdA binding titers and a complete absence of nAbs (Figures 3A and 3B).

[0079] SC-Ad6-TcdA / B provides protection against toxin challenge 38 weeks after a single immunization. A second set of female CD1 mice received 10 immunizations of SC-Ad6-TcdA / B, SC-Ad6-PEB1, or PBS (n=5 per group). 10 Mice were immunized once with viral particles im. This single vaccination with SC-Ad6-TcdA / B generated a strong antibody response with reciprocal endpoint binding titers of TcdA and TcdB that rose to over 100,000 over 26 weeks (Figures 4A and 4B). At week 26, the mean reciprocal TcdB nAb titer in the SC-Ad-TcdA / B group reached 174 (Figure 4C). At week 38, mice were challenged with 300 ng (6 × LD50) of TcdA. All PBS- and control SC-Ad-PEB1-vaccinated animals died of toxin within 48 hours (Figure 4D). In contrast, all animals in the SC-Ad C. difficile vaccine group survived.

[0080] Pilot toxicology and efficacy studies in hamsters. Groups of 10 Syrian hamsters were administered 10 mg of 10 ... 11The animals were immunized once with SC-Ad6-TcdA / B virus particles. Control animals received in PBS. Blood was collected 3 days after immunization for clinical chemistry. These results revealed no significant differences in blood chemistry (Figure 7).

[0081] A single intranasal or intramuscular vaccination with SC-Ad6-TcdA / B induces an immune response in hamsters. Serum was collected from hamsters 6, 12, and 18 weeks after immunization to evaluate antitoxin antibody responses. A single immunization with SC-Ad6-TcdA / B, regardless of route, generated significant serum nAb levels against toxin A. These antibody levels increased over the course of the study (Fig. 5A). Immunization with im immunization produced higher mean nAb levels against toxin A than the in group, but these were not significantly different by week 18 (p = 0.0336 by Dunn). Toxin B antibodies were detectable by ELISA at week 6. However, significant levels of nAb against toxin B took longer to develop (Fig. 5B). All im immunized animals and 6 / 10 in immunized animals had significant toxin B nAb levels by week 12. At week 18, all im and in immunized animals had significant toxin B nAb levels, with mean reciprocal titers of 2084 and 229, respectively.

[0082] A single intramuscular vaccination with SC-Ad6-TcdA / B provides protection against C. difficile spore challenge in hamsters. CDI can be induced in Syrian hamsters by sensitizing them with clindamycin. This model mimics the fecal-oral route of infection by orogastric delivery of purified C. difficile spores, which induces symptoms similar to those observed in patients with CDI. Various toxin isoforms have been identified within clinical isolates of C. difficile. Recent studies have reported that the BI / NAP1 / 027 strain of C. difficile is the most common cause of CDI in North America. Given its clinical relevance and expression of heterogeneous toxin isoforms, vaccine efficacy was tested using spores from the UK1 (BI / NAP1 / 027) strain. Hamsters were administered clindamycin 24 hours after a single immunization and then challenged with 10,000 spores 20–21 weeks later. All animals immunized with PBS died upon spore challenge (Figure 5C). Surprisingly, all hamsters vaccinated with the SC-Ad6-TcdA / B vaccine survived to the end of the study, regardless of the route of vaccine administration. Log-rank comparison of Kaplan-Meier survival curves showed that both in- and im-vaccinated SC-Ad6-TcdA / B-vaccinated animals survived significantly better than PBS control animals. Weight loss was observed in all animals over the course of the experiment, although weight loss in SC-Ad6-TcdA / B animals stabilized or began to reverse by day 7.

[0083] SC-Ad6-TcdA / B provides protection against lethal spore challenge 45 weeks after a single immunization. A second group of 10 female Syrian hamsters was placed in a 10-kg / 100-mL syringe. 11Mice were immunized once with SC-Ad6-TcdA / B viral particles or PBS. Blood was collected 3 or 4 days after immunization and tested using the same analyte panel as before. Similarly, no significant differences were observed between vaccinated and non-vaccinated animals on days 3 or 4 (Figures 8A and 8B). On day 4, CBC was measured in half of the animals. Compared with controls, vaccinated animals had a significantly increased percentage of neutrophils and a corresponding decrease in the percentage of lymphocytes. However, no differences were observed when comparing neutrophil and lymphocyte counts (Figure 8C). Immunized animals showed an increase in platelets and plateletcrit, but these were still within the normal range.

[0084] Sera collected at weeks 6, 12, and 18 showed increases in toxin A and B nAbs, similar to those in the first vaccination study (Figures 6A and 6B). At week 24, half of the hamsters in each group were sensitized with oral gavage of clindamycin (30 mg / kg) and challenged 5 days later with 200 C. difficile spores. Surprisingly, this low-dose challenge did not induce any symptoms or signs of C. difficile infection in any of the hamsters, including the PBS control. Serum antibodies collected at the end of the challenge revealed no increase in toxin A or B antibodies due to pathogen challenge compared with unchallenged animals within the cohort. Unchallenged animals were followed for an additional 20 weeks. During this period, one PBS- and one im-immunized animal became moribund and had to be euthanized at weeks 42 and 44, respectively.

[0085] The remaining animals were challenged with a high-dose 10,000 spore challenge at week 45. All PBS-immunized animals met the endpoint criteria and were euthanized (Figure 6C). Two animals immunized intranasally also died upon challenge. All animals in the im vaccine group survived the spore challenge. Log-rank comparison of these survival curves showed a significant difference in survival rates for both in and im SC-Ad6-TcdA / B vaccinated animals compared with PBS. Prechallenge (week 36) toxin nAb levels correlated with group survival (Figure 6D). Animals in the in group that survived the spore challenge had high toxin nAb levels before challenge. In contrast, animals in this group that did not survive had low toxin nAb levels before challenge. Protection against C. difficile challenge was observed 10 months after only a single immunization with the SC-Ad vaccine.

[0086] Materials and Methods cell culture A549 and Vero cells were purchased from the American Type Culture Collection. 293-IIIA cells were generated as described elsewhere (Crosby et al., Virology 462-463:158-165 (2014)). All cells were maintained at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS; HyClone) and 100 U / mL penicillin / streptomycin (Invitrogen).

[0087] Single-cycle adenovirus expressing C. difficile TcdA / B fusion A codon-optimized cDNA encoding a novel fusion of the receptor-binding domains of C. difficile toxins A and B was synthesized by Genscript. This cDNA contains a secretory leader sequence from alpha-1 antitrypsin (AAT) to facilitate secretion of the fusion protein. The receptor-binding domains are separated by two furin cleavage sites to liberate the two Tcds from each other during secretion from mammalian cells. This cDNA was inserted into the shuttle plasmid pAd6-NdePfl and recombined into SC-Ad6 as described elsewhere (Crosby et al., Virology 462-463:158-165 (2014); Crosby et al., J. Virol. 91(2):e00720-16 (2017); and Crosby et al., J. Virol. 89:669-675 (2015)) to generate SC-Ad6-C. diff. Control SC-Ad6 viruses expressing GFP-luciferase or Campylobacter jejuni PEB1 were also used. Viruses were rescued, amplified, and purified as described elsewhere (Crosby et al., Virology 462-463:158-165 (2014); Crosby et al., J. Virol. 91(2):e00720-16 (2017); and Crosby et al., J. Virol. 89:669-675 (2015)). Virus comparisons were based on viral particles.

[0088] Western blotting A549 cells were infected with SC-Ad6-TcdA / B or SC-Ad-GL expressing GFP-luciferase at 10 cells / cell. 4Cells were infected with 1000 viral particles. 24 hours after infection, the medium was replaced with serum-free DMEM. After 24 hours, the medium was collected and concentrated using an Amicon Ultra-15 30k (Millipore). Cells were harvested using Triton-X lysis buffer supplemented with Complete™ Protease Inhibitor Cocktail (Roche). The medium concentrate and cell lysates were analyzed by Western blot using antibodies against C. difficile toxin A or B (1:1000; List Biological Labs, Inc.) followed by a goat anti-chicken horseradish peroxidase secondary antibody (1:1000; Invitrogen). SuperSignal West Dura (ThermoScientific) was added, and blots were imaged using an In Vivo F Station (KODAK).

[0089] animal Male and female outbred CD-1 mice (Charles River Laboratories) and female golden Syrian hamsters (Envigo) were housed at the Mayo Clinic Animal Facility. All animal handling and experiments were conducted in accordance with the provisions of the Animal Welfare Act, the PHS Animal Welfare Policy, the principles of the NIH Guide for the Care and Use of Laboratory Animals, and the policies and procedures of the Mayo Clinic Institutional Animal Care and Use Committee.

[0090] Immunization and sample collection Mice were anesthetized with isoflurane and administered the indicated vaccine. 10 Hamsters were anesthetized with isoflurane and immunized intramuscularly (im) with 10 11Mice were immunized intramuscularly (im) or intranasally (in) with the vp vaccine. Serum was collected from the facial vein at the indicated time points. Hamsters were anesthetized and blood was collected from the jugular vein at various time points.

[0091] Enzyme-linked immunosorbent assay (ELISA) Immulon 4 HBX plates (Thermo) were coated overnight with 100 ng / well of either C. difficile A or B toxoid (List Biological Labs, Inc.) in 1x phosphate-buffered saline (PBS). The wells were washed and blocked with 5% milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 2 hours at room temperature (RT). After washing with TBST, triplicate half-log dilutions of each serum sample were plated and incubated for 3 hours at RT. The wells were washed, and 100 μL of 1:10,000 goat anti-mouse IgG-horseradish peroxidase (Thermo Fisher Scientific Inc.) was added to each well. The plates were incubated for 2 hours at RT. The wells were washed, and 50 μL of 1-step Ultra TMB ELISA (Thermo Fisher Scientific Inc.) was added to each well. Upon color development, 50 μL of 2M H2SO4 was added. OD450 was measured using a BioTek Synergy H1 Hybrid Multi-Mode Reader. Reciprocal titers were statistically defined based on 95% confidence intervals.

[0092] Cytotoxicity and neutralization assays The cytotoxicity of C. difficile toxin A and toxin B was determined in Vero cells using methods described elsewhere (Donald et al., Microbiology 159:1254-1266 (2013)). Vero cells were used instead of IMR-90 because they have similar sensitivity to toxin B but higher sensitivity to toxin A compared to IMR-90 cells. Vero cells were plated at 10 per well in a 96-well plate. 4Cells were seeded with C. difficile toxin A or toxin B (List Biological Laboratories, Inc.) serially diluted in DMEM supplemented with 10% HI-FBS and added to the cells 24 hours after plating. After 3 days, cell viability was measured using the bioluminescent CellTiter-Glo reagent (Promega). The EC50 was determined as the amount of toxin causing a 50% reduction in luminescence by fitting the data with a four-parameter equation. Toxin neutralization was determined using serial dilutions of mouse or hamster serum mixed with 8x the EC50 value determined in the cytotoxicity assay. The mixtures were incubated for 90 minutes at 37°C in a humidified incubator (5% CO2) before being added to Vero cells in a 96-well plate. After 3 days, cell viability was measured using CellTiter-Glo. A four-parameter regression response was fitted to the luciferase relative light unit (RLU) values ​​obtained from the serum dilutions. Neutralizing antibody (nAb) titers were expressed as the derived sample dilution showing a 50% reduction in cytotoxicity. If a serum titration failed to produce 50% inhibition within the concentration range tested, a titer of half the highest serum concentration tested was attributed to it.

[0093] Challenge with recombinant C. difficile toxin A in mice Immunized mice were challenged intraperitoneally (ip) with 300 ng of C. difficile toxin A (List Biological Laboratories, Inc.). After toxin challenge, mice were monitored every 3 hours for the first 30 hours, then at 6-hour intervals for 72 hours, and then every 12 hours from days 3 to 7 (168 hours). Mice were monitored for clinical signs. Briefly, animals' condition was recorded as normal, lethargic, abnormal, or moribund. Moribund animals were immediately euthanized and recorded. The survival rate for each treatment group was determined.

[0094] Hematology and clinical chemistry in hamsters Blood was collected for clinical chemistry analysis (200 μL in lithium heparin tubes; Greiner Bio-One) and complete blood count (CBC, 100 μL in K2EDTA tubes; Greiner Bio-One). Blood chemistry was analyzed on a Piccolo Xpress Analyzer (Abaxis), and CBC was determined on a VetScan HM5 hematology analyzer (Abaxis). Analyte parameters for the two studies are shown in Tables 1 and 2.

[0095] [Table 1]

[0096] [Table 2]

[0097] Challenge with C. difficile spores in hamsters Prior to challenge, hamsters were housed individually in ventilated cages. For the low-dose challenge, hamsters were sensitized to infection using clindamycin phosphate (Sigma-Aldrich) antibiotic solution (30 mg / kg body weight) delivered orogastrically via a feeding needle. Five days later, hamsters were orogastrically challenged with 200 spores from C. difficle strain UK1. Because the low-dose spore challenge did not induce symptoms in our hamsters, a high-dose challenge with modified clindamycin administration was used. For this challenge, hamsters were sensitized with clindamycin phosphate antibiotic solution (10 mg / kg body weight) via the intraperitoneal route rather than the orogastric route. Hamsters were then sensitized 24 hours later with 10 4Hamsters were orogastrically challenged with UK1 spores. Following both the high-dose and low-dose challenge, hamsters were monitored four times daily in a microbiological safety cabinet by individual assessment for several parameters, including the presence and severity of wet tail, loose stools, diarrhea, weight loss, activity level, starey coat, sunken eyes, hunched back, and reactions to stimuli. To quantify the animals' condition, a scoring system based on the severity of observed changes (ranging from 0 to 3 for each parameter) was used. Animals were euthanized and considered to have died from the disease if they reached a score of 15, were moribund, or had lost more than 20% of their body weight.

[0098] statistical analysis Prism 8 Graphical software was used for all statistical analyses.

[0099] Example 2: Single-cycle adenoviral vectors expressing SARS-CoV-2 polypeptides The full-length codon-optimized SARS-CoV-2 spike cDNA (Figure 13) or the RBD-Sb subdomain was inserted into pAd6-ΔIII-ΔE3 with and without a genetic adjuvant or chaff gene (Figure 12) and rescued in 293-IIIA cells. CsCl-purified SC-Ad6-spike not only cleaved the S2 domain but also generated spike monomers, dimers, and trimers after infection of A549 human lung cells, as shown by Western blot analysis with an anti-spike antibody (Figure 14). SC-Ad6-spike induced cell-cell fusion and syncytia formation in cells engineered to express its receptor, ACE2 (Figure 15). These syncytia were examined and contained large amounts of adenoviral proteins, as shown by immunohistochemical staining of adenoviral hexon using AdenoX Rapid Titer Reagent (Figure 16). When BALB / c mice were immunized intranasally (in) or intramuscularly (im) with SC-Ad6-spike, the virus induced strong spike antibodies within two weeks, as shown by ELISA using a 1 / 1000 dilution of mouse serum (Fig. 20A). These were class-switched IgG antibodies and were significantly higher than those of negative control mice immunized with PBS buffer or SC-Ad expressing Zika E (p<0.0001 by one-way ANOVA). Six weeks after immunization, IgG antibodies in serum remained elevated. Notably, intranasal immunization also generated IgA antibodies, indicative of a response at the mucosal barrier (Fig. 20B). A dose-finding study in BALB / c mice revealed that significant IgG antibody responses were observed at 10 8 It was shown that viral particles were produced 2 weeks after a single in or im immunization with SC-Ad-spike (ANOVA). ** p<0.01, **** p<0.0001, Figure 20C).

[0100] Replication-deficient Ad6 with an E1 deletion (RD-Ad6) was constructed with the same spike expression cassette. RD-Ad6-spike and SC-Ad-spike were used to infect A549 human lung cells at different numbers of viral particles per cell (vp). Cell lysates were examined by Western blot for spike protein 24 hours later, and 10 2 or 10 4 It was found that SC-Ad expressed high levels of spike protein in the case of vp virus (Fig. 21). In contrast, RD-Ad-spike expressed 10% of the virus. 2 The particles do not produce detectable spike protein, and 10% of the virus 4 vp produces only low levels of spike protein.

[0101] SC-Ad expressing coronavirus spike or RBD proteins can be modified by the addition of influenza genes to generate combination coronavirus and influenza virus vaccines. For example, SC-Ad6 containing spike and a centralized H1 consensus influenza hemagglutinin (H1-CON) gene, or SC-Ad6 containing spike RBD domains and a centralized H1 consensus influenza hemagglutinin (H1-CON) gene (Figure 22). Alternatively, spike- or RBD-expressing SC-Ads can be co-immunized with SC-Ads expressing two influenza consensus immunogens. For example, SC-Ad6 containing a centralized H1 consensus influenza H1-CON and an H1-5 centralized HA gene H1-5-CON (Figure 23).

[0102] Example 3: Single-cycle adenoviral vectors expressing genetic adjuvants 10 of SC-Ad6 expressing clade C gp140 from SHIV-1157ipd3N4 9 Viral particles (vp) were used to express 4-1BBL, GMCSF, and C. diff toxin fragment TcdA / B. 9BALB / c mice were immunized in combination with SC-Ad or a nonspecific adenovirus control expressing GFP-luciferase. ELISA using sera collected 6 weeks after a single immunization demonstrated a significant increase in antibody isotypes with GMCSF and TcdA / B (p<0.05 for all IgG) (Figure 25). Vaginal washes assayed for IgA at the same time points revealed a similar trend, with highest mucosal IgA mediated by in co-delivery of the TcdA / B adjuvant (Figure 26).

[0103] SC-Ad-GMCSF and TcdA / B were again tested by the im route with 10-fold more SC-Ad. Due to their ability to stimulate Tfh and other T cells, SC-Ad-IL-21 adjuvant was also added. In this case, im injections were administered into the quadriceps muscle, close to the vaginal sample site. Six weeks after this single, high-dose im immunization, ELISA at a 1 / 2000 dilution of serum demonstrated increased levels of envelope IgG with SC-Ad-GMCSF, TcdA / B, and IL-21 (p<0.05 vs. PBS). SC-Ad-IL-21 provided even higher antibody levels than GMCSF or TcdA / B (p<0.0001 vs. PBS). When vaginal wash samples were tested for IgG, an increase was observed in all SC-Ad-1157 animals, but only the SC-Ad-IL-21 adjuvant reached significance (p<0.05 vs. PBS). Assaying vaginal washes for IgA at the same time points revealed a similar trend of elevated mucosal IgA in most animals in the GMCSF, TcdA / B, and IL-21 groups, with only the IL-21 group reaching a p<0.05. Soluble HIV SOSIP envelope protein was used to boost the responses generated by SC-Ad. Each imSC-Ad-1157 + SC-Ad adjuvant-immunized mouse was boosted with 5 μg of clade C CZA97 SOSIP.v4.2-M6.IT mixed with the NKT cell adjuvant alpha-GalCer. Half of the mice were boosted via the im route, and the other half via the in route. Two weeks later, vaginal washes were collected and assayed for IgA or IgG antibodies against the clade C envelope (Figure 27).

[0104] These data demonstrated a strong bias in antibody responses based on the delivery route of the SOSIP protein boost. ImSOSIP increased vaginal IgG levels generated by imSC-Ad-1157 and SC-AdGFP-Luc or GMCSF more than in protein. In contrast, inSOSIP protein boosting strongly amplified vaginal IgA levels in mice primed im with SC-Ad-1157, and the most potent SC-Ad adjuvants were GMCSF, TcdA / B, and IL-21. The SC-Ad-1157 + SC-Ad-GFP-Luc group showed strong IgG responses when primed and boosted intramuscularly, but failed to generate strong IgG responses when SOSIP was administered in vivo. Furthermore, none of these combinations generated IgA responses. This suggests that the genetic adjuvant administered instead of SC-Ad-GFP-Luc primes animals to drive the IgA responses observed when animals are boosted in vivo, also indicating priming at mucosal surfaces. Protein administered to unprimed animals produced little IgG or IgA responses in the vaginal wash.

[0105] Example 4: Antibody responses generated by SC-Ad vectors expressing spike variant polypeptides Groups of five hamsters were immunized intramuscularly with the indicated number of viral particles of the designated SC-Ad Ad6 or Ad657 vector expressing the spike polypeptide or the gamma mink spike variant polypeptide. DE3ADP indicates an SC-Ad with an alternative E3 deletion expressing the original Wuhan spike. Serum was collected two weeks later. The administering personnel were blinded to the groups administered.

[0106] The antibody response generated by the vector was measured. A 1 / 1000 dilution of serum was analyzed by ELISA against the spike S1 protein for IgG antibodies that bind to the protein. Data are shown as the OD450 of the ELISA for each sample.

[0107] All immunizations elicited similar immune responses capable of recognizing both the gamma mink spike variant polypeptide and the spike polypeptide (Figure 32).

[0108] Example 5: Exemplary embodiment Embodiment 1. A single-cycle adenovirus (SC-Ad), wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding a coronavirus immunogen.

[0109] Embodiment 2. The SC-Ad of embodiment 1, wherein the adenoviral polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0110] Embodiment 3. The SC-Ad of any one of embodiments 1-2, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

[0111] Embodiment 4. The SC-Ad of embodiment 3, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4.

[0112] Embodiment 5. The SC-Ad of any one of Embodiments 1 to 4, wherein the SC-Ad further comprises a nucleic acid sequence encoding an adjuvant polypeptide.

[0113] Embodiment 6. The SC-Ad of embodiment 5, wherein the adjuvant polypeptide is selected from the group consisting of a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide, an interleukin-4 (IL-4) polypeptide, an interleukin-21 (IL-21) polypeptide, a CD40 ligand (CD40L) polypeptide, a 4-1BB ligand (4-1BBL) polypeptide, a transforming growth factor beta (TGF-β) polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0114] Embodiment 7 The SC-Ad of embodiment 5 or embodiment 6, wherein the coronavirus spike polypeptide is fused to the adjuvant polypeptide.

[0115] Embodiment 8. The SC-Ad of embodiment 7, wherein the coronavirus spike polypeptide fused to the adjuvant polypeptide consists essentially of, or consists of, the amino acid sequence set forth in SEQ ID NO:5.

[0116] Embodiment 9. The SC-Ad of any one of embodiments 1 to 4, wherein the SC-Ad further comprises a nucleic acid sequence encoding a chaff polypeptide.

[0117] Embodiment 10. The SC-Ad of embodiment 9, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0118] Embodiment 11. The SC-Ad of embodiment 10, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0119] Embodiment 12. The SC-Ad of embodiment 11, wherein the chaff polypeptide consists essentially of, or consists of, the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0120] Embodiment 13. The SC-Ad of any one of embodiments 9 to 12, wherein the coronavirus spike polypeptide is fused to the chaff polypeptide.

[0121] Embodiment 14. A composition comprising the SC-Ad of any one of embodiments 1 to 13.

[0122] Embodiment 15. A method for inducing an immune response to a coronavirus in a mammal, the method comprising administering to the mammal an SC-Ad of any one of Embodiments 1 to 13 or a composition of Embodiment 14 under conditions in which the SC-Ad infects cells of the mammal, and expression of the immunogen in the cells results in the induction of the immune response.

[0123] Embodiment 16 The method of embodiment 15, wherein the mammal is a human.

[0124] Embodiment 17. The method of any one of embodiments 15 to 16, wherein the coronavirus is a betacoronavirus.

[0125] Embodiment 18. The method of embodiment 17, wherein the betacoronavirus is SARS-CoV-2.

[0126] Embodiment 19. The method of any one of embodiments 15-18, wherein the administering comprises mucosal delivery of the SC-Ad.

[0127] Embodiment 20. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding an adjuvant polypeptide.

[0128] Embodiment 21. The SC-Ad of embodiment 20, wherein the adenovirus polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0129] Embodiment 22. The SC-Ad of any one of embodiments 20-21, wherein the immunogen is a coronavirus immunogen.

[0130] Embodiment 23 The SC-Ad of embodiment 22, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

[0131] Embodiment 24. The SC-Ad of embodiment 23, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4.

[0132] Embodiment 25. The SC-Ad of any one of embodiments 20 to 24, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0133] Embodiment 26 The SC-Ad of embodiment 25, wherein the coronavirus spike polypeptide is fused to the adjuvant polypeptide.

[0134] Embodiment 27. The SC-Ad of embodiment 26, wherein the coronavirus spike polypeptide fused to the adjuvant polypeptide consists essentially of, or consists of, the amino acid sequence set forth in SEQ ID NO:5.

[0135] Embodiment 28 The SC-Ad of any one of embodiments 20 to 27, wherein the SC-Ad further comprises a nucleic acid sequence encoding a chaff polypeptide.

[0136] Embodiment 29 The SC-Ad of embodiment 28, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0137] Embodiment 30. The SC-Ad of embodiment 29, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0138] Embodiment 31. The SD-Ac of embodiment 30, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0139] Embodiment 32. A composition comprising the SC-Ad of any one of embodiments 20 to 31.

[0140] Embodiment 33. A method for inducing an immune response to a virus in a mammal, the method comprising administering to the mammal an SC-Ad described in any one of embodiments 20 to 31 or a composition described in embodiment 32 under conditions in which the SC-Ad infects cells of the mammal, and expression of the immunogen in the cells results in the induction of the immune response.

[0141] Embodiment 34 The method of embodiment 33, wherein the mammal is a human.

[0142] Embodiment 35. The method of any one of embodiments 33-34, wherein the virus is a coronavirus and the immunogen is related to the coronavirus.

[0143] Embodiment 36. The method of any one of embodiments 33 to 35, wherein the coronavirus is a betacoronavirus.

[0144] Embodiment 37. The method of embodiment 36, wherein the betacoronavirus is SARS-CoV-2.

[0145] Embodiment 38. The method of any one of embodiments 33 to 37, wherein the administering comprises mucosal delivery of the SC-Ad.

[0146] Embodiment 39. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding a chaff polypeptide.

[0147] Embodiment 40. The SC-Ad of embodiment 39, wherein the adenovirus polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0148] Embodiment 41. The SC-Ad of any one of embodiments 39-40, wherein the immunogen is a coronavirus immunogen.

[0149] Embodiment 42 The SC-Ad of embodiment 41, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

[0150] Embodiment 43. The SC-Ad of embodiment 42, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4.

[0151] Embodiment 44 The SC-Ad of embodiment 43, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0152] Embodiment 45. An SC-Ad according to embodiment 44, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0153] Embodiment 46. The SD-Ac of embodiment 45, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0154] Embodiment 47. The SC-Ad of any one of embodiments 39 to 46, wherein the coronavirus spike polypeptide is fused to the chaff polypeptide.

[0155] Embodiment 48 The SC-Ad of any one of embodiments 39 to 47, wherein the SC-Ad further comprises a nucleic acid sequence encoding an adjuvant polypeptide.

[0156] Embodiment 49. The SC-Ad of embodiment 48, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0157] Embodiment 50. A composition comprising the SC-Ad of any one of embodiments 39-49.

[0158] Embodiment 51. A method for inducing an immune response to a virus in a mammal, the method comprising administering to the mammal an SC-Ad of any one of claims 39-49 or a composition of claim 50 under conditions in which the SC-Ad infects cells of the mammal, and expression of the immunogen in the cells results in the induction of the immune response.

[0159] Embodiment 52 The method of embodiment 51, wherein the mammal is a human.

[0160] Embodiment 53. The method of any one of embodiments 51-52, wherein the virus is a coronavirus and the immunogen is related to the coronavirus.

[0161] Embodiment 54. The method of embodiment 53, wherein the coronavirus is a betacoronavirus.

[0162] Embodiment 55. The method of embodiment 54, wherein the betacoronavirus is SARS-CoV-2.

[0163] Embodiment 56. The method of any one of embodiments 51 to 55, wherein the administering comprises mucosal delivery of the SC-Ad.

[0164] Embodiment 57. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, (b) a nucleic acid sequence encoding an adjuvant polypeptide, and (c) a nucleic acid sequence encoding a chaff polypeptide.

[0165] Embodiment 58. The SC-Ad of embodiment 57, wherein the adenovirus polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0166] Embodiment 59. The SC-Ad of any one of embodiments 57-58, wherein the immunogen is a coronavirus immunogen.

[0167] Embodiment 60. The SC-Ad of embodiment 59, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

[0168] Embodiment 61. The SC-Ad of embodiment 60, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4.

[0169] Embodiment 62. The SC-Ad of any one of embodiments 57 to 61, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0170] Embodiment 63. The SC-Ad of any one of embodiments 57 to 61, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0171] Embodiment 64. An SC-Ad according to embodiment 63, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0172] Embodiment 65. The SD-Ac of embodiment 64, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0173] Embodiment 66. A composition comprising the SC-Ad of any one of embodiments 57 to 65.

[0174] Embodiment 67. A method for inducing an immune response to a virus in a mammal, the method comprising administering to the mammal an SC-Ad described in any one of embodiments 57 to 65 or a composition described in embodiment 66 under conditions in which the SC-Ad infects cells of the mammal, and expression of the immunogen in the cells results in the induction of the immune response.

[0175] Embodiment 68. The method of embodiment 67, wherein the mammal is a human.

[0176] Embodiment 69. The method of any one of embodiments 67-68, wherein the virus is a coronavirus and the immunogen is related to the coronavirus.

[0177] Embodiment 70. The method of embodiment 69, wherein the coronavirus is a betacoronavirus.

[0178] Embodiment 71. The method of embodiment 70, wherein the betacoronavirus is SARS-CoV-2.

[0179] Embodiment 72. The method of any one of embodiments 51 to 55, wherein the administering comprises mucosal delivery of the SC-Ad.

[0180] Embodiment 73. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding an immunogen that is expressed or shed by an allergen.

[0181] Embodiment 74. The SC-Ad of embodiment 73, wherein the adenovirus polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0182] Embodiment 75. The SC-Ad of any one of embodiments 73-74, wherein the SC-Ad further comprises a nucleic acid sequence encoding an adjuvant polypeptide.

[0183] Embodiment 76. The SC-Ad of embodiment 75, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0184] Embodiment 77. The SC-Ad of any one of embodiments 73 to 76, wherein the SC-Ad further comprises a nucleic acid sequence encoding a chaff polypeptide.

[0185] Embodiment 78. The SC-Ad of embodiment 77, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0186] Embodiment 79. The SC-Ad of embodiment 78, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0187] Embodiment 80. The SC-Ad of embodiment 79, wherein the chaff polypeptide consists essentially of, or consists of, the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0188] Embodiment 81. A composition comprising the SC-Ad of any one of embodiments 73 to 80.

[0189] Embodiment 82. A method for inducing an immune response to an allergen in a mammal, the method comprising administering to the mammal an SC-Ad described in any one of embodiments 73 to 80 or a composition described in embodiment 81 under conditions in which the SC-Ad infects cells of the mammal, and expression of the immunogen in the cells results in the induction of the immune response.

[0190] Embodiment 83 The method of embodiment 15, wherein the mammal is a human.

[0191] Embodiment 84. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, the SC-Ad comprises the adenoviral polypeptide, and the SC-Ad comprises a nucleic acid sequence encoding an immunogen expressed by a cancer cell.

[0192] Embodiment 85. The SC-Ad of embodiment 84, wherein the adenovirus polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0193] Embodiment 86 The SC-Ad of any one of embodiments 84-85, wherein the SC-Ad further comprises a nucleic acid sequence encoding an adjuvant polypeptide.

[0194] Embodiment 87. The SC-Ad of embodiment 86, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0195] Embodiment 88 The SC-Ad of any one of embodiments 84 to 87, wherein the SC-Ad further comprises a nucleic acid sequence encoding a chaff polypeptide.

[0196] Embodiment 89. The SC-Ad of embodiment 88, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0197] Embodiment 90. The SC-Ad of embodiment 89, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0198] Embodiment 91. The SC-Ad of embodiment 90, wherein the chaff polypeptide consists essentially of, or consists of, the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0199] Embodiment 92. A composition comprising the SC-Ad of any one of embodiments 84 to 91.

[0200] Embodiment 93. A method for inducing an immune response against cancer cells in a mammal, the method comprising administering to the mammal an SC-Ad described in any one of embodiments 84 to 91 or a composition described in embodiment 92 under conditions in which the SC-Ad infects cells of the mammal, and expression of the immunogen in the cells results in the induction of the immune response.

[0201] Embodiment 94 The method of embodiment 93, wherein the mammal is a human.

[0202] Embodiment 95. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, the SC-Ad comprises the adenoviral polypeptide, and the SC-Ad comprises a nucleic acid sequence encoding a C. difficile polypeptide.

[0203] Embodiment 96 The SC-Ad of embodiment 95, wherein the C. difficile polypeptide is a TcdA / B fusion polypeptide.

[0204] Embodiment 97. The SC-Ad of embodiment 95, wherein the C. difficile polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 22 or an amino acid sequence that is at least 85 percent identical to the sequence set forth in SEQ ID NO: 22.

[0205] Embodiment 98. The SC-Ad of embodiment 97, wherein the C. difficile polypeptide comprises the amino acid sequence set forth in SEQ ID NO:22.

[0206] Embodiment 99. The SC-Ad of embodiment 95, wherein the C. difficile polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 23 or an amino acid sequence that is at least 85 percent identical to the sequence set forth in SEQ ID NO: 23.

[0207] Embodiment 100. The SC-Ad of embodiment 97, wherein the C. difficile polypeptide comprises the amino acid sequence set forth in SEQ ID NO:23.

[0208] Embodiment 101. The SC-Ad of embodiment 95, wherein the C. difficile polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 10 or an amino acid sequence that is at least 85 percent identical to the sequence set forth in SEQ ID NO: 10.

[0209] Embodiment 102. The SC-Ad of embodiment 101, wherein the C. difficile polypeptide comprises the amino acid sequence set forth in SEQ ID NO:10.

[0210] Embodiment 103. An SC-Ad comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:31.

[0211] Embodiment 104. The SC-Ad of embodiment 3, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 42-44, 47, and 48.

[0212] Embodiment 105. The SC-Ad of embodiment 23, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 42-44, 47, and 48.

[0213] Embodiment 106. The SC-Ad of embodiment 42, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 42-44, 47, and 48.

[0214] Embodiment 107. A composition comprising two or more populations of SC-Ad, wherein each population of SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, each population of SC-Ad comprises said adenoviral polypeptide, and each population of SC-Ad independently comprises a nucleic acid sequence encoding a coronavirus immunogen.

[0215] Embodiment 108. The composition of embodiment 107, wherein the adenovirus polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

[0216] Embodiment 109. The composition of any one of embodiments 107-108, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

[0217] Embodiment 110. The composition of any one of embodiments 107 to 109, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1-4, 42-44, 47, and 48.

[0218] Embodiment 111. The composition of any one of embodiments 107 to 110, wherein the SC-Ad of the two or more populations of SC-Ad further comprise a nucleic acid sequence encoding an adjuvant polypeptide.

[0219] Embodiment 112. The composition of embodiment 111, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a C. difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

[0220] Embodiment 113. The composition of embodiment 111 or embodiment 112, wherein the coronavirus spike polypeptide is fused to the adjuvant polypeptide.

[0221] Embodiment 114. The composition of embodiment 113, wherein the coronavirus spike polypeptide fused to the adjuvant polypeptide consists essentially of, or consists of, the amino acid sequence set forth in SEQ ID NO:5.

[0222] Embodiment 115. The composition of any one of embodiments 107 to 110, wherein the SC-Ad of the two or more populations of SC-Ad further comprise a nucleic acid sequence encoding a chaff polypeptide.

[0223] Embodiment 116. The composition of embodiment 115, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

[0224] Embodiment 117. The composition of embodiment 116, wherein said fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

[0225] Embodiment 118. The composition of embodiment 117, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:9.

[0226] Embodiment 119. The composition of any one of embodiments 115 to 118, wherein the coronavirus spike polypeptide is fused to the chaff polypeptide.

[0227] Sequence Listing Free Text SEQ ID NO: 1 SARS-CoV-2 spike polypeptide amino acid sequence SEQ ID NO: 2 Amino acid sequence of the SARS-CoV-2 spike polypeptide lacking the ER retention sequence SEQ ID NO: 3 Amino acid sequence of the ectodomain of the SARS-CoV-2 spike polypeptide SEQ ID NO:4 Amino acid sequence of the receptor-binding domain of the SARS-CoV-2 spike polypeptide SEQ ID NO:5 Amino acid sequence of the receptor-binding domain of the SARS-CoV-2 spike polypeptide fused to an Ig polypeptide SEQ ID NO:6 Amino acid sequence of the receptor-binding domain of the SARS-CoV-2 spike polypeptide fused to a streptavidin polypeptide SEQ ID NO:7 Amino acid sequence of the receptor-binding domain of the SARS-CoV-2 spike polypeptide fused to a sigma coil polypeptide SEQ ID NO:8 Amino acid sequence of the ectodomain of the ACE2 chaff polypeptide SEQ ID NO:9 Amino acid sequence of the inactivation ectodomain of the ACE2 chaff polypeptide SEQ ID NO: 10 Amino acid sequence of the TcdA / B fusion polypeptide SEQ ID NO: 11 Amino acid sequence of SARS-CoV-2 ORF1ab polypeptide SEQ ID NO: 12 Amino acid sequence of SARS-CoV-2 S polypeptide SEQ ID NO: 13 Amino acid sequence of SARS-CoV-2 ORF3 polypeptide SEQ ID NO: 14 Amino acid sequence of SARS-CoV-2E polypeptide SEQ ID NO: 15 Amino acid sequence of SARS-CoV-2 M polypeptide SEQ ID NO: 16 Amino acid sequence of SARS-CoV-2 ORF3 polypeptide SEQ ID NO: 17 Amino acid sequence of SARS-CoV-2 ORF7 polypeptide SEQ ID NO: 18 Amino acid sequence of SARS-CoV-2 ORF8 polypeptide SEQ ID NO: 19 Amino acid sequence of SARS-CoV-2N polypeptide SEQ ID NO: 20 Amino acid sequence of concentrated H1 influenza hemagglutinin polypeptides. SEQ ID NO: 21 Amino acid sequence of the convergent H1-5 influenza hemagglutinin polypeptide SEQ ID NO: 22 Amino acid sequence of the TcdA polypeptide SEQ ID NO: 23 Amino acid sequence of the TcdB polypeptide SEQ ID NO: 24 Nucleic acid sequences capable of encoding the TcdA polypeptide from C. difficile toxin SEQ ID NO: 25 Nucleic acid sequences capable of encoding the TcdB polypeptide from C. difficile toxin SEQ ID NO: 26 Nucleic acid sequence capable of encoding SC-Ad-spike virus SEQ ID NO: 27 Nucleic acid sequence capable of encoding SC-Ad-TcdA / B virus SEQ ID NO: 28 SC-Ad6-ΔIII-ΔE3-CMV-spike-3X-LZL nucleic acid SEQ ID NO: 29 SC-Ad6-ΔIII-ΔE3-CMV-Spike-PP-3X-LZL nucleic acid SEQ ID NO: 30 SC-Ad6-ΔIII-ΔE3ADP-I-CMV-Spike-3X-L Nucleic Acid SEQ ID NO: 31 SC-Ad6-ΔIII-ΔE3ADP-I-CMV-Spike-PP-3X-L Nucleic Acid SEQ ID NO: 32 SC-Ad-FZF-657-ΔIIIF-ΔE3-Spike-3X-L Nucleic Acid SEQ ID NO: 33 SC-Ad-FZF-657-ΔIIIF-ΔE3-Spike PP-3X-L Nucleic Acid SEQ ID NO: 34 SC-Ad-FZF-C68-ΔIIIF-ΔE3-Spike-3X-L Nucleic Acid SEQ ID NO: 35 SC-Ad-FZF-C68-ΔIIIF-ΔE3-Spike PP-3X-L Nucleic Acid SEQ ID NO: 36 SC-Ad-F-657-ΔIIIF-ΔE3-Spike-3X-L Nucleic Acid SEQ ID NO: 37 SC-Ad-F-657-ΔIIIF-ΔE3-Spike PP-3X-L Nucleic Acid SEQ ID NO: 38 SC-Ad-F-C68-ΔIIIF-ΔE3-Spike-3X-L Nucleic Acid SEQ ID NO: 39 SC-Ad-F-C68-ΔIIIF-ΔE3-Spike PP-3X-L Nucleic Acid SEQ ID NO: 40 Nucleic acid sequence encoding the AAT secretory sequence SEQ ID NO: 41 Nucleic acid sequence encoding a synthetic furin cleavage site SEQ ID NO: 42 Amino acid sequence of SARS-CoV-2 gamma mink spike variant polypeptide with K417T, Y453F, E484K, N501Y, D614G, K986P, and V987P mutations SEQ ID NO: 43 Amino acid sequence of the SARS-CoV-2 B.1.617.2 (Delta) spike variant polypeptide with T19R, G142D, R158G, 156-157del, L452R, T478K, D614G, P681R, D950N, K986P, and V987P mutations SEQ ID NO: 44 Amino acid sequence of SARS-CoV-2 B.1.617.2.1 (Delta Plus) spike polypeptide variant with T19R, G142D, R158G, 156-157del, K417T, L452R, T478K, D614G, P681R, D950N, K986P, and V987P mutations SEQ ID NO: 45 Amino acid sequence of the M / N fusion polypeptide SEQ ID NO: 46 Amino acid sequence of the C. difficile TcdB / B (TcdB x 2) fusion polypeptide SEQ ID NO: 47 Amino acid sequences of SARS-CoV-2 lambda spike polypeptide variants with G75I, T76I, del246-252, L452Q, F490S, D614G, T859N, K986P, and V987P mutations SEQ ID NO: 48 Amino acid sequence of SARS-CoV-2 Epsilon spike polypeptide variant with S13I, W152C, L452R, D614G, K986P, and V987P mutations

[0228] Other embodiments While the present invention has been described in conjunction with its detailed description, it should be understood that the foregoing description is intended to be illustrative, but not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. A single-cycle adenovirus (SC-Ad), wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises a nucleic acid sequence encoding a coronavirus immunogen.

2. The SC-Ad of claim 1, wherein the adenoviral polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

3. The SC-Ad of claim 1 or 2, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

4. The SC-Ad of claim 3, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 4.

5. The SC-Ad of any one of claims 1 to 4, wherein the SC-Ad further comprises a nucleic acid sequence encoding an adjuvant polypeptide.

6. 6. The SC-Ad of claim 5, wherein the adjuvant polypeptide is selected from the group consisting of a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide, an interleukin-4 (IL-4) polypeptide, an interleukin-21 (IL-21) polypeptide, a CD40 ligand (CD40L) polypeptide, a 4-1BB ligand (4-1BBL) polypeptide, a transforming growth factor beta (TGF-β) polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

7. The SC-Ad of claim 5 or 6, wherein the coronavirus spike polypeptide is fused to the adjuvant polypeptide.

8. The SC-Ad of claim 7, wherein the coronavirus spike polypeptide fused to the adjuvant polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:

5.

9. The SC-Ad of any one of claims 1 to 4, wherein the SC-Ad further comprises a nucleic acid sequence encoding a chaff polypeptide.

10. The SC-Ad of claim 9, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

11. The SC-Ad of claim 10, wherein the fragment of the ACE2 polypeptide comprises the extracellular region of the ACE2 polypeptide and lacks the transmembrane domain.

12. The SC-Ad of claim 11, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:

9.

13. The SC-Ad of any one of claims 9 to 12, wherein the coronavirus spike polypeptide is fused to the chaff polypeptide.

14. A composition comprising the SC-Ad of any one of claims 1 to 13.

15. 15. A method of inducing an immune response against coronavirus in a mammal, said method comprising administering to said mammal the SC-Ad of any one of claims 1 to 13 or the composition of claim 14 under conditions such that said SC-Ad infects cells of said mammal, and expression of said immunogen in said cells results in the induction of said immune response.

16. 16. The method of claim 15, wherein the mammal is a human.

17. The method of claim 15 or 16, wherein the coronavirus is a betacoronavirus.

18. The method of claim 17, wherein the betacoronavirus is SARS-CoV-2.

19. The method of any one of claims 15 to 18, wherein the administering comprises mucosal delivery of the SC-Ad.

20. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, wherein the SC-Ad comprises the adenoviral polypeptide, and wherein the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding an adjuvant polypeptide.

21. 21. The SC-Ad of claim 20, wherein the adenoviral polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

22. The SC-Ad of claim 20 or 21, wherein the immunogen is a coronavirus immunogen.

23. The SC-Ad of claim 22, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

24. The SC-Ad of claim 23, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 4.

25. 25. The SC-Ad of any one of claims 20-24, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

26. The SC-Ad of claim 25, wherein the coronavirus spike polypeptide is fused to the adjuvant polypeptide.

27. The SC-Ad of claim 26, wherein the coronavirus spike polypeptide fused to the adjuvant polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:

5.

28. The SC-Ad of any one of claims 20 to 27, wherein the SC-Ad further comprises a nucleic acid sequence encoding a chaff polypeptide.

29. The SC-Ad of claim 28, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

30. 30. The SC-Ad of claim 29, wherein the fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

31. The SD-Ac of claim 30, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:

9.

32. A composition comprising the SC-Ad of any one of claims 20 to 31.

33. 10. A method of inducing an immune response to a virus in a mammal, said method comprising administering to said mammal the SC-Ad of any one of claims 20 to 31 or the composition of claim 32 under conditions such that said SC-Ad infects cells of said mammal, and expression of said immunogen in said cells results in the induction of said immune response.

34. 34. The method of claim 33, wherein the mammal is a human.

35. 35. The method of claim 33 or 34, wherein the virus is a coronavirus and the immunogen is related to the coronavirus.

36. The method of any one of claims 33 to 35, wherein the coronavirus is a betacoronavirus.

37. The method of claim 36, wherein the betacoronavirus is SARS-CoV-2.

38. 38. The method of any one of claims 33 to 37, wherein said administering comprises mucosal delivery of said SC-Ad.

39. An SC-Ad, wherein the SC-Ad comprises a genome lacking at least a portion of a nucleic acid sequence encoding an adenoviral polypeptide, the SC-Ad comprises the adenoviral polypeptide, and the SC-Ad comprises (a) a nucleic acid sequence encoding an immunogen, and (b) a nucleic acid sequence encoding a chaff polypeptide.

40. 40. The SC-Ad of claim 39, wherein the adenoviral polypeptide is selected from the group consisting of a fiber polypeptide, a V polypeptide, a hexon polypeptide, a penton base polypeptide, and a pIIIa polypeptide.

41. The SC-Ad of claim 39 or 40, wherein the immunogen is a coronavirus immunogen.

42. The SC-Ad of claim 41, wherein the coronavirus immunogen comprises a coronavirus spike polypeptide or an immunogenic fragment thereof.

43. The SC-Ad of claim 42, wherein the coronavirus immunogen consists of or consists essentially of the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 4.

44. The SC-Ad of claim 43, wherein the chaff polypeptide is a fragment of an ACE2 polypeptide.

45. The SC-Ad of claim 44, wherein the fragment of an ACE2 polypeptide comprises the extracellular region of an ACE2 polypeptide and lacks the transmembrane domain.

46. The SD-Ac of claim 45, wherein the chaff polypeptide consists essentially of or consists of the amino acid sequence set forth in SEQ ID NO:8 or SEQ ID NO:

9.

47. The SC-Ad of any one of claims 39 to 46, wherein the coronavirus spike polypeptide is fused to the chaff polypeptide.

48. The SC-Ad of any one of claims 39 to 47, wherein the SC-Ad further comprises a nucleic acid sequence encoding an adjuvant polypeptide.

49. 49. The SC-Ad of claim 48, wherein the adjuvant polypeptide is selected from the group consisting of a GM-CSF polypeptide, an IL-4 polypeptide, an IL-21 polypeptide, a CD40L polypeptide, a 4-1BBL polypeptide, a TGF-β polypeptide, a Clostridium difficile TcdA polypeptide, a C. difficile TcdB polypeptide, and biologically active fragments thereof.

50. A composition comprising the SC-Ad of any one of claims 39 to 49.

51. 51. A method of inducing an immune response to a virus in a mammal, said method comprising administering to said mammal an SC-Ad of any one of claims 39 to 49 or a composition of claim 50 under conditions such that said SC-Ad infects cells of said mammal, and expression of said immunogen in said cells results in the induction of said immune response.

52. 52. The method of claim 51, wherein the mammal is a human.

53. 53. The method of claim 51 or 52, wherein the virus is a coronavirus and the immunogen is related to the coronavirus.

54. 54. The method of claim 53, wherein the coronavirus is a betacoronavirus.

55. 55. The method of claim 54, wherein the betacoronavirus is SARS-CoV-2.

56. 56. The method of any one of claims 51-55, wherein said administering comprises mucosal delivery of said SC-Ad.

Images