USE OF TREM FOR REGULATING tRNA POOL

TREM compositions adjust tRNA pools by altering the relative amounts of tRNA moieties that pair with specific codons, effectively treating disorders and symptoms by modulating tRNA pools and selecting targeted therapies.

JP2025183248APending Publication Date: 2025-12-16FLAGSHIP PIONEERING INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025142222
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-05-31
Filing Date
2025-08-28
Publication Date
2025-12-16

AI Technical Summary

Technical Problem

Current methods lack effective ways to modulate tRNA pools in cells and subjects to address various disorders and symptoms, particularly those associated with endogenous open reading frames (ORFs) and synonymous mutations.

Method used

The use of tRNA-based effector molecules (TREMs) to regulate tRNA pools by adjusting the relative amounts of tRNA moieties that pair with specific codons, including those with synonymous mutations, through compositions that do not include anticodons pairing with stop codons.

Benefits of technology

This approach allows for targeted modulation of tRNA pools, treating or preventing disorders and symptoms by enhancing therapeutic efficacy and selecting appropriate therapies based on tRNA abundance assessment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025183248000064
    Figure 2025183248000064
  • Figure 2025183248000065
    Figure 2025183248000065
  • Figure 2025183248000066
    Figure 2025183248000066
Patent Text Reader

Abstract

To provide use of a TREM for regulating tRNA pool.SOLUTION: The present invention generally relates to use of a tRNA base effector molecule (TREM) and a method for producing the molecule. The present invention provides a method for evaluating a subject having an endogenous open reading frame (ORF) containing codon having a first sequence including: directly or indirectly acquiring a value to a state of codon having the first sequence in the subject, for example, in which the value includes a scale of presence or absence of codon having the first sequence in the sample from the subject; and identifying the subject assuming that it has codon having the first sequence, by which evaluating the subject.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 855,561, filed May 31, 2019, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on May 19, 2020, is named F2099-7001WO_SL.txt and is 105,520 bytes in size. [Background technology]

[0003] tRNA-based effector molecules (TREMs) are complex molecules with several functions, including protein initiation and elongation. Compositions containing TREMs can be used to modulate these functions to treat or prevent disease. Summary of the Invention [Means for solving the problem]

[0004] In one aspect, the invention provides a method for modulating a tRNA pool in a cell that contains an endogenous open reading frame (ORF) that includes a codon having a first sequence, the method comprising: optionally, obtaining knowledge about the abundance of one or both of (i) and (ii) in the cell, e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the cell, where (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of an ORF having a first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence; contacting a cell with a composition comprising a TREM in an amount and for a time sufficient to modulate the relative amounts of a first tRNA moiety and a second tRNA moiety in the cell, the TREM having an anticodon that pairs with either (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence; This regulates the tRNA pool in the cell. The present invention is characterized by a method comprising:

[0005] In certain embodiments, the composition comprising a TREM is a pharmaceutically acceptable composition.

[0006] In certain embodiments, the TREM does not include an anticodon that pairs with a stop codon.

[0007] In some embodiments, the method includes obtaining knowledge about (i). In some embodiments, the method includes obtaining knowledge about (ii). In some embodiments, the method includes obtaining knowledge about (i) and (ii).

[0008] In one aspect, the invention provides a method of modulating a tRNA pool in a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising: optionally, obtaining knowledge about the abundance of one or both of (i) and (ii) in a subject, e.g., obtaining knowledge about the relative amounts of (i) and (ii) in a subject, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of an ORF having a first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence; contacting the subject with a composition comprising a TREM in an amount and for a time sufficient to adjust the relative amounts of a first tRNA moiety and a second tRNA moiety in the subject, the TREM having an anticodon that pairs with either (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence; This allows for the regulation of the tRNA pool in the subject. The present invention is characterized by a method comprising:

[0009] In certain embodiments, the composition comprising a TREM is a pharmaceutically acceptable composition.

[0010] In certain embodiments, the TREM does not include an anticodon that pairs with a stop codon.

[0011] In some embodiments, the method includes obtaining knowledge about (i). In some embodiments, the method includes obtaining knowledge about (ii). In some embodiments, the method includes obtaining knowledge about (i) and (ii).

[0012] In another aspect, the disclosure provides a method of assessing a tRNA pool in a cell having an endogenous ORF, the ORF including a codon having a first sequence, comprising obtaining, e.g., directly or indirectly, knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the cell, where (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence in the cell, thereby assessing the tRNA pool in the cell.

[0013] In some embodiments, the method includes obtaining knowledge about (i). In some embodiments, the method includes obtaining knowledge about (ii). In some embodiments, the method includes obtaining knowledge about (i) and (ii).

[0014] In some embodiments, obtaining knowledge about (i) includes obtaining a value for the abundance, eg, relative abundance, of (i).

[0015] In some embodiments, obtaining knowledge about (ii) includes obtaining a value for the abundance, eg, relative abundance, of (ii).

[0016] In one embodiment, in response to the value, the method includes administering a composition comprising a TREM in an amount and for a time sufficient to adjust the relative amounts of the first tRNA portion and the second tRNA portion, wherein the TREM has an anticodon that pairs with either (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence.

[0017] In another aspect, the disclosure provides a method of assessing a tRNA pool in a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising obtaining, e.g., directly or indirectly, knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the subject, where (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence in the cell, thereby assessing the tRNA pool in the subject.

[0018] In some embodiments, the method includes obtaining knowledge about (i). In some embodiments, the method includes obtaining knowledge about (ii). In some embodiments, the method includes obtaining knowledge about (i) and (ii).

[0019] In some embodiments, obtaining knowledge about (i) includes obtaining a value for the abundance, eg, relative abundance, of (i).

[0020] In some embodiments, obtaining knowledge about (ii) includes obtaining a value for the abundance, eg, relative abundance, of (ii).

[0021] In one embodiment, in response to the value, the method includes administering a composition comprising a TREM in an amount and for a time sufficient to adjust the relative amounts of the first tRNA portion and the second tRNA portion, wherein the TREM has an anticodon that pairs with either (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence.

[0022] In another aspect, the invention provides a method for modulating a tRNA pool in a subject or cell that contains an endogenous ORF that includes a codon that includes a synonymous mutation (synonymous mutation codon or SMC), the method comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety comprising an anticodon sequence that pairs with an SMC(TREM); contacting the subject with a composition comprising a TREM, or in the case of a cell, contacting the cell with a TREM from the composition comprising a TREM, in an amount and for a time sufficient to modulate the tRNA pool in the subject or cell; thereby regulating the tRNA pool in the subject or cell. The present invention is characterized by a method comprising:

[0023] In one embodiment, prior to contact with a composition comprising a TREM, the subject or cell comprises a first tRNA portion (first tRNA portion) having an anticodon that pairs with an SMC and a second tRNA portion (second tRNA portion) having an anticodon that pairs with a codon other than an SMC.

[0024] In another aspect, the invention provides a method of treating a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising: providing a composition comprising a TREM, the TREM comprising an isoacceptor tRNA moiety having either (a) an anticodon that pairs with a codon of an ORF having a first sequence or (b) an anticodon that pairs with a codon other than the codon having the first sequence; contacting the subject with a composition comprising a TREM in an amount and for a time sufficient to treat the subject; Thereby treating the subject and The present invention is characterized by a method comprising:

[0025] In another aspect, the disclosure provides a method of treating a subject having an endogenous ORF that includes a codon that includes a synonymous mutation (synonymous mutation codon or SMC), the method comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with an SMC(TREM); contacting the subject with a composition comprising a TREM in an amount and for a time sufficient to treat the subject; Thereby treating the subject and The present invention provides a method comprising:

[0026] In another aspect, the invention provides a method of treating a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising: (i) obtaining, e.g., directly or indirectly, a value for the status of a codon having a first sequence in a subject, the value comprising a measure of the presence or absence of the codon having the first sequence in a sample from the subject, and identifying the subject as having a codon having the first sequence; and (ii) in response to said value, administering to the subject a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with a codon having a first sequence; Treating the subject thereby The present invention provides a method comprising:

[0027] In another aspect, the invention provides a method of treating a subject having an endogenous ORF that includes a codon that includes a synonymous mutation (synonymous mutation codon or SMC), the method comprising: (i) obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject, and identifying the subject as having SMC; and (ii) in response to said value, administering to the subject a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with an SMC; Treating the subject thereby The present invention is characterized by a method comprising:

[0028] In one aspect, the invention provides a method for selecting a therapy for a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising: obtaining, e.g., directly or indirectly, a value for the status of a codon having the first sequence in a subject, the value comprising a measure of the presence or absence of the codon having the first sequence in a sample from the subject; and the presence of the codon having the first sequence is indicative of the subject being likely to be a responder to the therapy or that the subject will respond or be likely to respond to the therapy; Therefore, the choice of therapy The present invention is characterized by a method comprising:

[0029] In one aspect, the present invention provides a method for selecting a therapy for a subject having an endogenous ORF that includes a codon that includes a synonymous mutation (synonymous mutation codon or SMC), the method comprising: obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject; and the presence of SMCs is indicative that the subject is likely to be a responder to the therapy or that the subject will respond or is likely to respond to the therapy; Therefore, the choice of therapy The present invention is characterized by a method comprising:

[0030] In one aspect, the invention provides a method for evaluating a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising: obtaining, e.g., directly or indirectly, a value for the status of a codon having the first sequence in a subject, the value comprising a measure of the presence or absence of the codon having the first sequence in a sample from the subject; and identifying the subject as having a codon having the first sequence; Evaluating the subject through this The present invention provides a method comprising:

[0031] In one aspect, the present invention provides a method for assessing a subject having an endogenous ORF that includes a codon containing a synonymous mutation (synonymous mutation codon or SMC), the method comprising: obtaining, e.g., directly or indirectly, a value for the subject's SMC status, said value comprising a measure of the presence or absence of SMC in a sample from the subject; Identifying a subject as having SMC; This allows us to evaluate the subject and The present invention is characterized by a method comprising:

[0032] As disclosed herein, tRNA-based effector molecules (TREMs) are complex molecules that can mediate various cellular processes. TREM-containing compositions or pharmaceutical compositions containing TREMs can be administered to cells, tissues, or subjects, for example, in vitro or in vivo, to modulate tRNA pools in the subject, tissue, or cell. Also disclosed herein are methods for treating or preventing disorders or symptoms of disorders by administering TREM-containing compositions or pharmaceutical compositions containing TREMs. Further disclosed herein are TREM-containing compositions or pharmaceutical compositions containing TREMs, preparations, and methods of making the same.

[0033] Additional features of any of the aforementioned compositions (e.g., compositions comprising TREM or pharmaceutical compositions comprising TREM), methods of using the compositions, and / or methods of making them include one or more of the embodiments listed below.

[0034] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the embodiments recited below.

[0035] Enumerated Embodiments 1. A method for assessing a tRNA pool in a cell having an endogenous ORF that includes a codon having a first sequence, the method comprising obtaining, e.g., directly or indirectly, knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the cell, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence in the cell, thereby assessing the tRNA pool in the cell.

[0036] 2. A method for assessing a tRNA pool in a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising obtaining, e.g., directly or indirectly, knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the subject, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon in the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence in the cell, thereby assessing the tRNA pool in the subject.

[0037] 3. The method of embodiment 1 or 2, comprising obtaining knowledge about (i).

[0038] 4. The method of embodiment 1 or 2, comprising obtaining knowledge about (ii).

[0039] 5. The method of embodiment 1 or 2, comprising obtaining knowledge of (i) and (ii).

[0040] 6. The method of any one of embodiments 1-3 or 5, wherein obtaining knowledge about (i) comprises obtaining a value for the abundance, e.g., relative abundance, of (i).

[0041] 7. The method of any one of embodiments 1-2 or 4-5, wherein obtaining knowledge about (ii) comprises obtaining a value for the abundance, e.g., relative abundance, of (ii).

[0042] 8. The method of embodiment 6 or 7, wherein in response to said value, the method comprises administering a composition comprising a TREM in an amount and for a time sufficient to adjust the relative amounts of the first tRNA portion and the second tRNA portion, wherein the TREM has an anticodon that pairs with either (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence.

[0043] 9. A method of modulating a tRNA pool in a cell containing an endogenous open reading frame (ORF), the ORF including a codon having a first sequence, comprising: optionally, obtaining knowledge about the abundance of one or both of (i) and (ii) in a cell, e.g., obtaining knowledge about the relative amounts of (i) and (ii) in a cell, where (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of an ORF having a first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence; contacting a cell with a composition comprising a TREM in an amount and / or for a time sufficient to modulate the relative amounts of a first tRNA moiety and a second tRNA moiety in the cell, wherein the TREM has an anticodon that pairs with (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence; thereby regulating the tRNA pool in the cell A method comprising:

[0044] 10. The method of embodiment 9, wherein the TREM comprises an anticodon that pairs with (a).

[0045] 11. The method of embodiment 9, wherein the TREM comprises an anticodon that pairs with (b).

[0046] 12. A method for modulating a tRNA pool in a subject having an endogenous open reading frame (ORF), the ORF including a codon having a first sequence, comprising: optionally, obtaining knowledge about the abundance of one or both of (i) and (ii) in a subject, e.g., obtaining knowledge about the relative amounts of (i) and (ii) in a subject, where (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of an ORF having a first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence; contacting a subject with a composition comprising a TREM in an amount and / or for a time sufficient to modulate the relative amounts of a first tRNA moiety and a second tRNA moiety in the subject, wherein the TREM has an anticodon that pairs with (a) a codon having a first sequence or (b) a codon other than the codon having the first sequence; thereby regulating the tRNA pool in the subject. A method comprising:

[0047] 13. The method of embodiment 12, wherein the TREM comprises an anticodon that pairs with (a).

[0048] 14. The method of embodiment 12, wherein the TREM comprises an anticodon that pairs with (b).

[0049] 15. The method of any one of embodiments 9-14, comprising obtaining knowledge about (i).

[0050] 16. The method of any one of embodiments 9-14, comprising obtaining knowledge about (ii).

[0051] 17. The method of any one of embodiments 9-14, comprising obtaining knowledge of (i) and (ii).

[0052] 18. The method of any one of embodiments 9-14, wherein obtaining knowledge about (i) comprises obtaining a value for the abundance, e.g., relative abundance, of (i).

[0053] 19. The method of any one of embodiments 9-14, wherein obtaining knowledge about (ii) comprises obtaining a value for the abundance, e.g., relative abundance, of (ii).

[0054] 20. The method of embodiment 18 or 19, wherein in response to said value, the cell or subject is contacted with a composition comprising a TREM having an anticodon that pairs with (a) or (b).

[0055] 21. A method for modulating a tRNA pool in a subject having an endogenous open reading frame (ORF) containing a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety comprising an anticodon sequence that pairs with an SMC(TREM); contacting a subject with a composition comprising a TREM in an amount and / or for a time sufficient to modulate the tRNA pool in the subject; thereby regulating the tRNA pool in the subject. A method comprising:

[0056] 22. A method for modulating a tRNA pool in a cell containing an endogenous open reading frame (ORF) that contains a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety comprising an anticodon sequence that pairs with an SMC(TREM); contacting the cell with a composition comprising a TREM in an amount and / or for a time sufficient to modulate the tRNA pool in the cell; thereby regulating the tRNA pool in the cell A method comprising:

[0057] 23. The method of embodiment 21 or 22, comprising obtaining knowledge about the abundance of one or both of (i) and (ii) in a subject or cell, e.g., obtaining knowledge about the relative amounts of (i) and (ii), wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with an SMC, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the SMC.

[0058] 24. The method of embodiment 23, comprising obtaining knowledge about (i).

[0059] 25. The method of embodiment 23, comprising acquiring knowledge about (ii).

[0060] 26. The method of embodiment 23, comprising obtaining knowledge of (i) and (ii).

[0061] 27. The method of embodiment 23, wherein obtaining knowledge about (i) includes obtaining a value for the abundance, e.g., relative abundance, of (i).

[0062] 28. The method of embodiment 23, wherein obtaining knowledge about (ii) comprises obtaining a value for the abundance, e.g., relative abundance, of (ii).

[0063] 29. The method of embodiment 27 or 28, wherein in response to said value, the cell or subject is contacted with a TREM.

[0064] 30. A method of treating a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, comprising: providing a composition comprising a TREM, the TREM comprising an isoacceptor tRNA moiety having an anticodon that pairs with a codon of an ORF having a first sequence or an anticodon that pairs with a codon other than the codon having the first sequence; contacting the subject with a composition comprising a TREM in an amount and / or for a time sufficient to treat the subject; treating the subject therewith; and A method comprising:

[0065] 31. A method of treating a subject having an endogenous open reading frame (ORF) that includes a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with an SMC(TREM); contacting the subject with a composition comprising a TREM in an amount and / or for a time sufficient to treat the subject; Treating the subject thereby A method comprising:

[0066] 32. Obtaining knowledge of the abundance of one or both of (i) and (ii), e.g. (i) a tRNA portion having an anticodon that pairs with a codon or SMC having a first sequence (first tRNA portion); and / or (ii) an isoacceptor tRNA portion (second tRNA portion) having an anticodon that pairs with a codon other than the codon having the first sequence or that pairs with a codon other than SMC; 32. The method of embodiment 30 or 31, comprising obtaining knowledge about the relative amounts of:

[0067] 33. The method of embodiment 32, comprising obtaining knowledge about (i).

[0068] 34. The method of embodiment 32, comprising acquiring knowledge about (ii).

[0069] 35. The method of embodiment 32, comprising obtaining knowledge of (i) and (ii).

[0070] 36. The method of embodiment 32, wherein obtaining knowledge about (i) includes obtaining a value for the abundance, e.g., relative abundance, of (i).

[0071] 37. The method of embodiment 32, wherein obtaining knowledge about (ii) comprises obtaining a value for the abundance, e.g., relative abundance, of (ii).

[0072] 38. The method of embodiment 27 or 28, wherein in response to said value, the subject is contacted with a TREM.

[0073] 39. A method of treating a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, comprising: (i) obtaining, e.g., directly or indirectly, a value for the status of a codon having a first sequence in a subject, the value comprising a measure of the presence or absence of the codon having the first sequence in a sample from the subject, and identifying the subject as having a codon having the first sequence; and (ii) in response to said value, administering to the subject a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with a codon having a first sequence; Treating the subject thereby A method comprising:

[0074] 40. A method of treating a subject having an endogenous open reading frame (ORF) that includes a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: (i) obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject, and identifying the subject as having SMC; and (ii) in response to said value, administering to the subject a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with an SMC; Treating the subject thereby A method comprising:

[0075] 41. A method for selecting a therapy for a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, comprising: obtaining, e.g., directly or indirectly, a value for the status of a codon having the first sequence in a subject, the value comprising a measure of the presence or absence of the codon having the first sequence in a sample from the subject; and the presence of the codon having the first sequence is indicative of the subject being likely to be a responder to the therapy or that the subject will respond or be likely to respond to the therapy; Therefore, the choice of therapy A method comprising:

[0076] 42. A method for selecting a therapy for a subject having an endogenous open reading frame (ORF) containing a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject; and the presence of SMCs is indicative that the subject is likely to be a responder to the therapy or that the subject will respond or is likely to respond to the therapy; Therefore, the choice of therapy A method comprising:

[0077] 43. A method for assessing a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, comprising: obtaining, e.g., directly or indirectly, a value for the status of a codon having the first sequence in a subject, the value comprising a measure of the presence or absence of the codon having the first sequence in a sample from the subject; and identifying the subject as having a codon having the first sequence; Evaluating the subject through this A method comprising:

[0078] 44. A method for evaluating a subject having an endogenous open reading frame (ORF) containing a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: Obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject; and identifying a subject as having SMC; Evaluating the subject through this A method comprising:

[0079] 45. The method of any one of embodiments 8-44, wherein the TREM does not comprise an anticodon that pairs with a stop codon.

[0080] 46. ​​The method of any one of embodiments 1-45, wherein (a) the ORF codon having the first sequence or (b) the SMC is other than a stop codon, e.g., TAA, TGA, or TAG.

[0081] 47. The method of any one of embodiments 8-46, wherein the TREM comprises a canonical anticodon / loading site combination.

[0082] 48. The method of any one of embodiments 1-47, wherein (a) the ORF codon having the first sequence or (b) the SMC has a mutation, e.g., a SNP, at the first position of said codon.

[0083] 49. The method of any one of embodiments 1-48, wherein (a) the ORF codon having the first sequence or (b) the SMC has a mutation, e.g., a SNP, at the second position of said codon.

[0084] 50. The method of any one of embodiments 1-49, wherein (a) the ORF codon having the first sequence or (b) the SMC has a mutation, e.g., an SNP, at the third position of said codon.

[0085] 51. The method of any one of embodiments 1-20, 23-29, 32-38, or 45-50, wherein the first tRNA portion comprises an endogenous tRNA and the second tRNA portion comprises an endogenous tRNA, e.g., the cell or subject has not been contacted with a composition comprising a TREM.

[0086] 52. The method of any one of embodiments 1-20, 23-29, 32-38, or 45-51, wherein one of the first tRNA portion and the second tRNA portion comprises an endogenous tRNA and a TREM.

[0087] 53. The method of any one of embodiments 1-52, wherein (a) the ORF codon having the first sequence or (b) the SMC is associated with a phenotype, e.g., an undesirable phenotype, e.g., a disorder or condition, e.g., a disorder or condition selected from Table 1, in the absence of contact with a composition comprising a TREM.

[0088] 54. The method of embodiment 53, wherein the disorder or condition is selected from the group of diseases provided in Table 1, e.g., cardiovascular, dermatological, endocrine, immunological, neurological, oncological, ophthalmological, or respiratory.

[0089] 55. The method of embodiment 53 or 54, wherein the disorder is cardiac hypertrophy.

[0090] 56. The method of embodiment 53 or 54, wherein the disorder is coronary artery disease.

[0091] 57. The method of embodiment 53 or 54, wherein the disorder is hypertension.

[0092] 58. The method of embodiment 53 or 54, wherein the disorder or condition is an obesity-related trait.

[0093] 59. The method of embodiment 53 or 54, wherein the disorder is type 1 diabetes.

[0094] 60. The method of embodiment 53 or 54, wherein the disorder is type 2 diabetes.

[0095] 61. The method of embodiment 53 or 54, wherein the disorder is psoriasis.

[0096] 62. The method of embodiment 53 or 54, wherein the disorder is endometriosis.

[0097] 63. The method of embodiment 53 or 54, wherein the disorder is a chronic inflammatory disease, such as ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis, or pleiotropy.

[0098] 64. The method of embodiment 53 or 54, wherein the disorder is Crohn's disease.

[0099] 65. The method of embodiment 53 or 54, wherein the disorder is Graves' disease.

[0100] 66. The method of embodiment 53 or 54, wherein the disorder is Alzheimer's disease, for example, age-onset Alzheimer's disease or familial Alzheimer's disease.

[0101] 67. The method of embodiment 53 or 54, wherein the disorder is major depressive disorder.

[0102] 68. The method of embodiment 53 or 54, wherein the disorder is migraine.

[0103] 69. The method of embodiment 53 or 54, wherein the disorder is Parkinson's disease.

[0104] 70. The method of embodiment 53 or 54, wherein the disorder is schizophrenia.

[0105] 71. The method of embodiment 53 or 54, wherein the disorder or condition is an adverse reaction to chemotherapy, for example, neutropenia or leukopenia.

[0106] 72. The method of embodiment 53 or 54, wherein the disorder is breast cancer, for example early-onset breast cancer.

[0107] 73. The method of embodiment 53 or 54, wherein the disorder is ovarian cancer.

[0108] 74. The method of embodiment 53 or 54, wherein the disorder is colorectal cancer.

[0109] 75. The method of embodiment 53 or 54, wherein the disorder is carboplatin abscission in epithelial ovarian cancer.

[0110] 76. The method of embodiment 53 or 54, wherein the disorder is Clostridium difficile infection in multiple myeloma.

[0111] 77. The method of embodiment 53 or 54, wherein the disorder is endometrial cancer, for example due to endometrioid histology.

[0112] 78. The method of embodiment 53 or 54, wherein the disorder is esophageal squamous cell carcinoma.

[0113] 79. The method of embodiment 53 or 54, wherein the disorder is glioblastoma.

[0114] 80. The method of embodiment 53 or 54, wherein the disorder is lung cancer.

[0115] 81. The method of embodiment 53 or 54, wherein the disorder or symptom is macrophage migration inhibitory factor levels.

[0116] 82. The method of embodiment 53 or 54, wherein the disorder is oral cavity and pharyngeal cancer.

[0117] 83. The method of embodiment 53 or 54, wherein the disorder is pancreatic cancer.

[0118] 84. The method of embodiment 53 or 54, wherein the disorder is myopia.

[0119] 85. The method of embodiment 53 or 54, wherein the disorder is COPD.

[0120] 86. The method of embodiment 53 or 54, wherein the disorder is asthma.

[0121] 87. The method of any one of embodiments 1-86, wherein the ORF codon or SMC having the first sequence is located in a gene, e.g., a transcript, provided in Table 1.

[0122] 88. The method of any one of embodiments 1-87, wherein the ORF codon or SMC having the first sequence comprises a codon provided in Table 1, e.g., a codon listed in the "Previous / Next Codon" column of Table 1, e.g., a second codon listed in said column of Table 1.

[0123] 89. The method of any one of embodiments 1-88, wherein contacting with a composition comprising a TREM is associated with amelioration of the second phenotype, e.g., the undesirable phenotype, e.g., amelioration of the disorder or symptom, e.g., amelioration of a disorder or symptom selected from Table 1.

[0124] 90. The method of embodiment 89, wherein the disorder or condition is selected from the group of diseases provided in Table 1, e.g., cardiovascular, dermatological, endocrine, immunological, neurological, oncological, ophthalmological, or respiratory.

[0125] 91. The method of any one of embodiments 1-90, wherein the subject has a disorder or condition selected from Table 1, or cells from the subject are associated with a disease group selected from the group consisting of disorders or conditions listed in Table 1, e.g., cardiovascular, dermatological, endocrine, immunological, neurological, oncological, ophthalmological, or respiratory diseases.

[0126] 92. The method of embodiment 91, wherein the disorder is cardiac hypertrophy.

[0127] 93. The method of embodiment 91, wherein the disorder is coronary artery disease.

[0128] 94. The method of embodiment 91, wherein the disorder is hypertension.

[0129] 95. The method of embodiment 91, wherein the disorder or condition is an obesity-related trait.

[0130] 96. The method of embodiment 91, wherein the disorder is type 1 diabetes.

[0131] 97. The method of embodiment 91, wherein the disorder is type 2 diabetes.

[0132] 98. The method of embodiment 91, wherein the disorder is psoriasis.

[0133] 99. The method of embodiment 91, wherein the disorder is endometriosis.

[0134] 100. The method of embodiment 91, wherein the disorder is a chronic inflammatory disease, such as ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis, or pleiotropy.

[0135] 101. The method of embodiment 91, wherein the disorder is Crohn's disease.

[0136] 102. The method of embodiment 91, wherein the disorder is Graves' disease.

[0137] 103. The method of embodiment 91, wherein the disorder is Alzheimer's disease, for example, age-onset Alzheimer's disease or familial Alzheimer's disease.

[0138] 104. The method of embodiment 91, wherein the disorder is major depressive disorder.

[0139] 105. The method of embodiment 91, wherein the disorder is migraine.

[0140] 106. The method of embodiment 91, wherein the disorder is Parkinson's disease.

[0141] 107. The method of embodiment 91, wherein the disorder is schizophrenia.

[0142] 108. The method of embodiment 91, wherein the disorder or condition is an adverse reaction to chemotherapy, for example, neutropenia or leukopenia.

[0143] 109. The method of embodiment 91, wherein the disorder is breast cancer, for example, early-onset breast cancer.

[0144] 110. The method of embodiment 91, wherein the disorder is ovarian cancer.

[0145] 111. The method of embodiment 91, wherein the disorder is colorectal cancer.

[0146] 112. The method of embodiment 91, wherein the disorder is carboplatin abscission in epithelial ovarian cancer.

[0147] 113. The method of embodiment 91, wherein the disorder is Clostridium difficile infection in multiple myeloma.

[0148] 114. The method of embodiment 91, wherein the disorder is endometrial cancer, for example endometrioid histology.

[0149] 115. The method of embodiment 91, wherein the disorder is esophageal squamous cell carcinoma.

[0150] 116. The method of embodiment 91, wherein the disorder is glioblastoma.

[0151] 117. The method of embodiment 91, wherein the disorder is lung cancer.

[0152] 118. The method of embodiment 91, wherein the disorder or symptom is macrophage migration inhibitory factor levels.

[0153] 119. The method of embodiment 91, wherein the disorder is oral cavity and pharyngeal cancer.

[0154] 120. The method of embodiment 91, wherein the disorder is pancreatic cancer.

[0155] 121. The method of embodiment 91, wherein the disorder is myopia.

[0156] 122. The method of embodiment 91, wherein the disorder is COPD.

[0157] 123. The method of embodiment 91, wherein the disorder is asthma.

[0158] 124. The method of any one of embodiments 1-123, wherein obtaining knowledge comprises obtaining a value for the relative amount of the first tRNA moiety and the second tRNA moiety.

[0159] 125. The method of embodiment 124, wherein in response to said value, the method comprises contacting the subject or cell with a composition comprising a TREM.

[0160] 126. The method of any one of embodiments 1-125, wherein the first tRNA portion comprises an endogenous tRNA and the second tRNA portion comprises an endogenous tRNA, e.g., the cell or subject has not been contacted with a composition comprising a TREM.

[0161] 127. The method of any one of embodiments 1-126, wherein one of the first tRNA portion and the second tRNA portion comprises an endogenous tRNA and a TREM.

[0162] 128. The method of any one of embodiments 8 to 127, wherein the first tRNA portion is more abundant than the second tRNA portion prior to contact with the subject or cell.

[0163] 129. For example, when abundance is determined by the assay described in any of Examples 29-32, the first tRNA portion is more abundant than the second tRNA portion. at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% abundant; or 0.5~99%, 1~99%, 2~99%, 3~99%, 4~99%, 5~99%, 6~99%, 7~99%, 8~99%, 9~99%, 10~99%, 15~99%, 20~99%, 25~99%, 30~99%, 40~99%, 50~99%, 60~99%, 70~99%, 80~99%, 95~99%, 0.5~95%, 0.5~90%, 0.5~85%, 0.5~ 129. The method of any one of embodiments 1-128, wherein the soluble fraction is enriched by 80%, 0.5 to 70%, 0.5 to 60%, 0.5 to 50%, 0.5 to 40%, 0.5 to 30%, 0.5 to 25%, 0.5 to 20%, 0.5 to 15%, 0.5 to 10%, 0.5 to 9%, 0.5 to 8%, 0.5 to 7%, 0.5 to 6%, 0.5 to 5%, 0.5 to 4%, 0.5 to 3%, 0.5 to 2% or 0.5 to 1%.

[0164] 130. The method of any one of embodiments 8-129, wherein the second tRNA portion is more abundant than the first tRNA portion prior to contact with the subject or cell.

[0165] 131. For example, when the abundance is determined by the assay described in any of Examples 29-32, the second tRNA portion is more abundant than the first tRNA portion. at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% abundant; or 0.5~99%, 1~99%, 2~99%, 3~99%, 4~99%, 5~99%, 6~99%, 7~99%, 8~99%, 9~99%, 10~99%, 15~99%, 20~99%, 25~99%, 30~99%, 40~99%, 50~99%, 60~99%, 70~99%, 80~99%, 95~99%, 0.5~95%, 0.5~90%, 0.5~85%, 0.5 131. The method of any one of embodiments 1-130, wherein the hydroxybenzoate is enriched by up to 80%, 0.5 to 70%, 0.5 to 60%, 0.5 to 50%, 0.5 to 40%, 0.5 to 30%, 0.5 to 25%, 0.5 to 20%, 0.5 to 15%, 0.5 to 10%, 0.5 to 9%, 0.5 to 8%, 0.5 to 7%, 0.5 to 6%, 0.5 to 5%, 0.5 to 4%, 0.5 to 3%, 0.5 to 2% or 0.5 to 1%.

[0166] 132. The method of any one of embodiments 8 to 131, wherein contacting or treating a cell or subject with a composition comprising a TREM comprises modulating a tRNA pool in the cell or subject.

[0167] 133. The method of any one of embodiments 9-29 or 45-132, wherein the modulating comprises increasing the amount of the first tRNA portion relative to the second tRNA portion.

[0168] 134. The method of embodiment 133, wherein the increase is an increase in the amount, e.g., absolute amount, of the first tRNA moiety in the subject or treated cell.

[0169] 135. The method of embodiment 133 or 134, wherein the increase is relative to a reference, e.g., a baseline level of a component of the treated cell, e.g., the first tRNA moiety or the second tRNA moiety.

[0170] 136. The method of any one of embodiments 133-135, wherein the amount of the first tRNA moiety is increased by at least 1.5, 2, 3, 4, 5, 10, 15, 20, 25, 50, or 100-fold, or 1-100-fold, 1-50-fold, 1-25-fold, 1-20-fold, 1-15-fold, 1-10-fold, 1-5-fold, 1-4-fold, 1-3-fold, 1-2-fold, 2-100-fold, 3-100-fold, 4-100-fold, 5-100-fold, 10-100-fold, 15-100-fold, 20-100-fold, 25-100-fold, or 50-100-fold relative to the reference.

[0171] 137. The method of any one of embodiments 9-29 or 45-136, wherein the modulating comprises increasing the relative amount of the second tRNA portion compared to the first tRNA portion.

[0172] 138. The method of embodiment 137, wherein the increase is an increase in the amount, e.g., absolute amount, of the second tRNA moiety in the subject or treated cell.

[0173] 139. The method of embodiment 137 or 138, wherein the increase is relative to a reference, e.g., a baseline level of a component of the treated cell, e.g., the second tRNA moiety or the first tRNA moiety.

[0174] 140. The method of any one of embodiments 137-139, wherein the amount of the first tRNA moiety is increased by at least 1.5, 2, 3, 4, 5, 10, 15, 20, 25, 50, or 100-fold relative to the reference.

[0175] 141. The method of any one of embodiments 9-29 or 45-140, wherein the modulating comprises modulating the ratio of the first tRNA moiety to the second tRNA moiety.

[0176] 142. The method of embodiment 141, wherein the ratio of the first tRNA portion to the second tRNA portion is 1:10,000, 1:5000, 1:1000, 1:900, 1:800, 1:700, 1:600, 1:500, 1:400, 1:300, 1:200, 1:100, 1:50, 1:40, 1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.

[0177] 143. The method of embodiment 141, wherein the ratio of the second tRNA portion to the first tRNA portion is 1:10,000, 1:5000, 1:1000, 1:900, 1:800, 1:700, 1:600, 1:500, 1:400, 1:300, 1:200, 1:100, 1:50, 1:40, 1:30, 1:20, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.

[0178] 144. The method of any one of embodiments 141-143, wherein the ratio of the first tRNA moiety to the second tRNA moiety is increased.

[0179] 145. The method of any one of embodiments 141-143, wherein the ratio of the first tRNA moiety to the second tRNA moiety is decreased.

[0180] 146. The method of any one of embodiments 141 to 145, wherein the ratio of the first tRNA moiety to the second tRNA moiety is compared to a reference, e.g., the ratio in similar cells but not contacted with a composition comprising a TREM.

[0181] 147. The method of any one of embodiments 1-146, wherein the cell is a human cell or the subject is a human.

[0182] 148. The method of any one of embodiments 8 to 147, wherein a mutant copy of the ORF is not introduced into the cell or subject.

[0183] 149. The method of any one of embodiments 8 to 147, wherein contacting with or treating with a composition comprising a TREM increases the production and / or function of the translation of the ORF, e.g., as assessed by an assay described in any one of Examples 33 to 38.

[0184] 150. The method of any one of embodiments 1-149, wherein the ORF or SMC-containing ORF encodes a polypeptide.

[0185] 151. The method of any one of embodiments 1-150, wherein the ORF or SMC-containing ORF is a chromosomal ORF.

[0186] 152. The method of any one of embodiments 1-150, wherein the ORF or SMC-containing ORF is a mitochondrial ORF.

[0187] 153. The method of any one of embodiments 8-152, wherein contacting with a composition comprising a TREM ameliorates a symptom or disorder, for example, a symptom or disorder associated with a codon or SMC having the first sequence.

[0188] 154. The method of embodiment 153, wherein the condition or disorder is selected from Table 1.

[0189] 155. The method of embodiment 153 or 154, wherein the disorder is cardiac hypertrophy.

[0190] 156. The method of embodiment 153 or 154, wherein the disorder is coronary artery disease.

[0191] 157. The method of embodiment 153 or 154, wherein the disorder is hypertension.

[0192] 158. The method of embodiment 153 or 154, wherein the disorder or condition is an obesity-related trait.

[0193] 159. The method of embodiment 153 or 154, wherein the disorder is type 1 diabetes.

[0194] 160. The method of embodiment 153 or 154, wherein the disorder is type 2 diabetes.

[0195] 161. The method of embodiment 153 or 154, wherein the disorder is psoriasis.

[0196] 162. The method of embodiment 153 or 154, wherein the disorder is endometriosis.

[0197] 163. The method of embodiment 153 or 154, wherein the disorder is a chronic inflammatory disease, such as ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis, or pleiotropy.

[0198] 164. The method of embodiment 153 or 154, wherein the disorder is Crohn's disease.

[0199] 165. The method of embodiment 153 or 154, wherein the disorder is Graves' disease.

[0200] 166. The method of embodiment 153 or 154, wherein the disorder is Alzheimer's disease, for example, age-onset Alzheimer's disease or familial Alzheimer's disease.

[0201] 167. The method of embodiment 153 or 154, wherein the disorder is major depressive disorder.

[0202] 168. The method of embodiment 153 or 154, wherein the disorder is migraine.

[0203] 169. The method of embodiment 153 or 154, wherein the disorder is Parkinson's disease.

[0204] 170. The method of embodiment 153 or 154, wherein the disorder is schizophrenia.

[0205] 171. The method of embodiment 153 or 154, wherein the disorder or condition is an adverse reaction to chemotherapy, for example, neutropenia or leukopenia.

[0206] 172. The method of embodiment 153 or 154, wherein the disorder is breast cancer, for example early-onset breast cancer.

[0207] 173. The method of embodiment 153 or 154, wherein the disorder is ovarian cancer.

[0208] 174. The method of embodiment 153 or 154, wherein the disorder is colorectal cancer.

[0209] 175. The method of embodiment 153 or 154, wherein the disorder is carboplatin abscission in epithelial ovarian cancer.

[0210] 176. The method of embodiment 153 or 154, wherein the disorder is Clostridium difficile infection in multiple myeloma.

[0211] 177. The method of embodiment 153 or 154, wherein the disorder is due to endometrial cancer, for example endometrioid histology.

[0212] 178. The method of embodiment 153 or 154, wherein the disorder is esophageal squamous cell carcinoma.

[0213] 179. The method of embodiment 153 or 154, wherein the disorder is glioblastoma.

[0214] 180. The method of embodiment 153 or 154, wherein the disorder is lung cancer.

[0215] 181. The method of embodiment 153 or 154, wherein the disorder or symptom is macrophage migration inhibitory factor levels.

[0216] 182. The method of embodiment 153 or 154, wherein the disorder is oral cavity and pharyngeal cancer.

[0217] 183. The method of embodiment 153 or 154, wherein the disorder is pancreatic cancer.

[0218] 184. The method of embodiment 153 or 154, wherein the disorder is myopia.

[0219] 185. The method of embodiment 153 or 154, wherein the disorder is COPD.

[0220] 186. The method of embodiment 153 or 154, wherein the disorder is asthma.

[0221] 187. The method of any one of embodiments 1-186, wherein the ORF codon or SMC having the first sequence is present in one allele, e.g., the subject or cell is heterozygous for the codon or SMC having the first sequence.

[0222] 188. The method of any one of embodiments 1-187, wherein the ORF codon or SMC having the first sequence is present in both alleles, e.g., the subject or cell is homozygous for the codon or SMC having the first sequence.

[0223] 189. The method of any one of embodiments 8-188, comprising modulating protein production in a subject or in a cell.

[0224] 190. The method of any one of embodiments 8 to 189, comprising modulating a translational profile in a subject or cell, such as the amount, rate, production rate, conformation, activity, cellular location, modification rate, or co-translational interaction of a polypeptide with a binding partner.

[0225] 191. The method of any one of embodiments 8 to 190, comprising regulating the initiation or elongation of a polypeptide translated from an mRNA comprising an ORF codon or SMC having the first sequence.

[0226] 192. The method of any one of embodiments 8 to 191, wherein the composition comprising TREM is produced by a method described herein, for example, by synthetic methods (e.g., synthesized using solid-phase synthesis or liquid-phase synthesis), using in vitro transcription (IVT), or by expressing a vector encoding TREM in a cell.

[0227] The method is (a) providing a host cell containing an exogenous nucleic acid, e.g., DNA or RNA, encoding a TREM under conditions sufficient to express the TREM; and (b) purifying the expressed TREM from the host cell culture to produce a composition comprising the TREM; thereby producing a composition comprising TREM. 193. The method of embodiment 192, comprising:

[0228] 194. The method of embodiments 8 to 193, wherein the composition comprising TREM is a pharmaceutical composition comprising TREM.

[0229] 195. The method of any of embodiments 8-194, wherein the composition comprising TREM comprises a pharmaceutical excipient.

[0230] 196. The method of any of embodiments 193-195, comprising introducing foreign DNA or RNA into a mammalian host cell.

[0231] 197. The method of any of embodiments 193-196, wherein the nucleic acid comprises DNA that, upon transcription, expresses TREM.

[0232] 198. The method of any of embodiments 193-197, wherein the nucleic acid comprises RNA that, upon reverse transcription, results in DNA that can be transcribed to provide TREM.

[0233] 199. The method of any of embodiments 8-198, wherein the composition comprising TREM comprises a TREM fragment, such as one described herein.

[0234] 200. The method of any of embodiments 193-199, wherein the host cell is a mammalian cell.

[0235] 201. The method of any of embodiments 193-200, wherein the host cells comprise cells selected from HEK293T cells (e.g., Freestyle 293-F cells), HT-1080 cells, PER.C6 cells, HKB-11 cells, CAP cells, HuH-7 cells, BHK 21 cells, MRC-S cells, MDCK cells, VERO cells, WI-38 cells, Chinese hamster ovary (CHO) cells, or MCF7 cells.

[0236] 202. The method of any of embodiments 193-201, wherein the host cell is a non-mammalian cell, such as a bacterial cell, a yeast cell, or an insect cell.

[0237] 203. The method of any of embodiments 8-202, wherein the TREM is a GMP-grade composition (e.g., a composition comprising a TREM made in accordance with cGMP and / or similar requirements) comprising a recombinant TREM comprising an RNA sequence at least 80% identical to an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment or functional fragment thereof.

[0238] 204. The method of any of embodiments 8-203, wherein the TREM comprises one or more post-transcriptional modifications listed in Table 3.

[0239] 205. The method of embodiment 203 or 204, wherein the composition comprising recombinant TREM is at least 0.5g, 1g, 2g, 3g, 4g, 5g, 6g, 7g, 8g, 9g, 10g, 15g, 20g, 30g, 40g, 50g, 100g, 200g, 300g, 400g or 500g.

[0240] 206. A composition containing recombinant TREM is 0.5g to 500g, 0.5g to 400g, 0.5g to 300g, 0.5g to 200g, 0.5g to 100g, 0.5g to 50g, 0.5g to 40g, 0.5g to 30g, 0.5g to 20g, 0.5g to 10g, 0.5g to 9g, 0.5g to 8g, 0.5g to 7g, 0.5g to 6g, 0.5g to 5g, 0.5g 205. The method of embodiment 203 or 204, wherein the amount of water is between 4 g and 4 g, 0.5 g and 3 g, 0.5 g and 2 g, 0.5 g and 1 g, 1 g and 500 g, 2 g and 500 g, 5 g and 500 g, 10 g and 500 g, 20 g and 500 g, 30 g and 500 g, 40 g and 500 g, 50 g and 500 g, 100 g and 500 g, 200 g and 500 g, 300 g and 500 g, or 400 g and 500 g.

[0241] 207. The method of any one of embodiments 8-206, wherein the composition comprising TREM comprises one or more, e.g., multiple, TREMs.

[0242] 208. A composition comprising a TREM (or an intermediate in the production of a composition comprising a TREM) having the following characteristics: (i) at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% pure; (ii) less than 0.1 ng / ml, 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, or 100 ng / ml of host cell protein (HCP) contamination; (iii) less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, or 100 ng of host cell protein (HCP) contamination per milligram (mg) of the composition containing TREM; (iv) less than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, or 100 ng / ml of DNA, e.g., host cell DNA; (v) fragments that are less than 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of the full-length TREM; (vi) low levels or absence of endotoxin, as measured, for example, by the Limulus amebocyte lysate (LAL) test; (vii) in vitro translation activity, for example, as measured by the assay described in Example 14; (viii) At least 0.1ng / mL, 0.5ng / mL, 1ng / mL, 5ng / mL, 10ng / mL, 50ng / mL, 0.1ug / mL, 0.5ug / mL, 1ug / mL, 2ug / mL, 5ug / mL, 10ug / mL, 20ug / mL, 30ug / mL, 40ug / mL, 50ug / mL, 60ug / mL, 70ug / mL, 80ug / mL, 100ug / mL, 200ug / mL, 300ug / mL, 500ug / mL, 1000ug / mL, 5000ug / mL, 10,000ug / mL, or 100,000ug / mL TREM concentration; (ix) Sterility, e.g., according to cGMP guidelines for sterile preparations, e.g., the composition or preparation supports the growth of less than 100 viable microorganisms when tested under sterile conditions, and the composition or preparation meets USP <71> and / or the composition or preparation meets the specifications of the U.S.P. <85> meets the standards for sterility; or (x) For example, the composition or preparation is free of viral contamination or has an undetectable level of viral contamination. 208. The composition of any one of embodiments 8 to 207, comprising one or more of:

[0243] 209. The method of any of embodiments 8-208, wherein the contacting is an in vitro method, for example, wherein a cell or tissue is contacted with a composition comprising a TREM in vitro.

[0244] 210. The method of any of embodiments 8 to 209, wherein the contacting is an ex vivo method, e.g., the cells or tissue are contacted with a composition comprising TREM ex vivo, and optionally the contacted cells or tissue are introduced, e.g., administered, to a subject, e.g., the subject from which the cells or tissue are derived, or a different subject.

[0245] 211. The method of any of embodiments 8-209, wherein the method is an in vivo method, for example, wherein a subject, or tissues or cells of a subject, are contacted with the composition comprising a TREM in vivo.

[0246] 212. The method of any of embodiments 8 to 211, wherein the composition comprising TREM is administered via a delivery agent, such as a liposome, a polymer (e.g., a polymer conjugate), a particle, a microsphere, a microparticle, or a nanoparticle.

[0247] 213. The method of any of embodiments 8-211, wherein the composition comprising TREM is administered without a carrier, for example, via naked delivery of TREM.

[0248] 214. TREM, (a) product, e.g., protein, stability and / or (b) Ribosome occupancy of the product The method of any one of embodiments 8 to 213, wherein the method enhances

[0249] 215. TREM, Does it regulate ribosome occupancy; whether it regulates protein translation or stability; Does it regulate mRNA stability? modulates protein folding or structure; whether it regulates protein transduction or compartmentalization; Does it regulate codon usage; Regulating cell fate; or modulating signaling pathways, e.g., cell signaling pathways; The method of any one of embodiments 8 to 214.

[0250] 216. The method of any of embodiments 8-215, wherein the TREM comprises a post-transcriptional modification from Table 3.

[0251] 217. The method of any of embodiments 8-216, wherein the TREM comprises a cognate adaptor function, and the TREM mediates acceptance and incorporation of an amino acid naturally associated with the anticodon of the TREM in the initiation or elongation of a peptide chain.

[0252] 218. The method of any of embodiments 8-217, wherein the TREM comprises an RNA sequence that is at least 80% identical to the RNA sequence of a naturally occurring tRNA.

[0253] 219. The method of any of embodiments 8-218, wherein the TREM comprises an RNA sequence at least 80% identical to an RNA encoded by a DNA sequence listed in Table 2, or a fragment or functional fragment thereof.

[0254] 220. The method of any of embodiments 8-219, wherein the TREM comprises an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment thereof.

[0255] 221. The method of any of embodiments 8-220, wherein the TREM comprises an RNA sequence that is at least XX% identical to an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment thereof, where XX is selected from 80, 85, 90, 95, 96, 97, 98, or 99.

[0256] 222. The method of embodiment 221, wherein XX is 80.

[0257] The method of embodiment 221, wherein 223.XX is 85.

[0258] 224. The method of embodiment 221, wherein XX is 90.

[0259] The method of embodiment 221, wherein 225.XX is 95.

[0260] The method of embodiment 221, wherein 226.XX is 97.

[0261] The method of embodiment 221, wherein 227.XX is 98.

[0262] The method of embodiment 221, wherein 228.XX is 99.

[0263] 229. The DNA sequence is SEQ ID NO: 1 or a fragment thereof, or SEQ ID NO: 2 or a fragment thereof, or SEQ ID NO: 3 or a fragment thereof, or SEQ ID NO: 4 or a fragment thereof, or SEQ ID NO: 5 or a fragment thereof, or SEQ ID NO: 6 or a fragment thereof, or SEQ ID NO: 7 or a fragment thereof, or SEQ ID NO: 8 or a fragment thereof, or SEQ ID NO: 9 or a fragment thereof, or SEQ ID NO: 10 or a fragment thereof, or SEQ ID NO: 11 or a fragment thereof, or SEQ ID NO: 12 or a fragment thereof, or SEQ ID NO: 13 or a fragment thereof, or SEQ ID NO: 14 or a fragment thereof, or SEQ ID NO: 15 or a fragment thereof, or SEQ ID NO: 16 or a fragment thereof, or SEQ ID NO: 17 or a fragment thereof, or SEQ ID NO: 18 or a fragment thereof, or SEQ ID NO: 19 or a fragment thereof, or SEQ ID NO: 20 or a fragment thereof, or SEQ ID NO: 21 or a fragment thereof, or SEQ ID NO: 22 or a fragment thereof, or SEQ ID NO: 23 or a fragment thereof, or SEQ ID NO: 24 or a fragment thereof, or SEQ ID NO: 25 or a fragment thereof, or SEQ ID NO: 26 or a fragment thereof, or SEQ ID NO: 27 or a fragment thereof, or SEQ ID NO: 28 or a fragment thereof, or SEQ ID NO: 29 or a fragment thereof, or SEQ ID NO:30 or a fragment thereof, or SEQ ID NO:31 or a fragment thereof, or SEQ ID NO:32 or a fragment thereof, or SEQ ID NO:33 or a fragment thereof, or SEQ ID NO:34 or a fragment thereof, or SEQ ID NO:35 or a fragment thereof, or SEQ ID NO:36 or a fragment thereof, or SEQ ID NO:37 or a fragment thereof, or SEQ ID NO:38 or a fragment thereof, or SEQ ID NO:39 or a fragment thereof, or SEQ ID NO:40 or a fragment thereof, or SEQ ID NO:41 or a fragment thereof, or SEQ ID NO:42 or a fragment thereof, or SEQ ID NO:43 or a fragment thereof, or SEQ ID NO:44 or a fragment thereof, or SEQ ID NO:45 or a fragment thereof, or SEQ ID NO:46 or a fragment thereof, or SEQ ID NO:47 or a fragment thereof, or SEQ ID NO:48 or a fragment thereof, or SEQ ID NO:49 or a fragment thereof, or SEQ ID NO:50 or a fragment thereof, or SEQ ID NO:51 or a fragment thereof, or SEQ ID NO:52 or a fragment thereof, or SEQ ID NO:53 or a fragment thereof, or SEQ ID NO:54 or a fragment thereof, or SEQ ID NO:55 or a fragment thereof, or SEQ ID NO:56 or a fragment thereof, or SEQ ID NO:57 or a fragment thereof, or SEQ ID NO:58 or a fragment thereof,or SEQ ID NO:59 or a fragment thereof, or SEQ ID NO:60 or a fragment thereof, or SEQ ID NO:61 or a fragment thereof, or SEQ ID NO:62 or a fragment thereof, or SEQ ID NO:63 or a fragment thereof, or SEQ ID NO:64 or a fragment thereof, or SEQ ID NO:65 or a fragment thereof, or SEQ ID NO:66 or a fragment thereof, or SEQ ID NO:67 or a fragment thereof, or SEQ ID NO:68 or a fragment thereof, or SEQ ID NO:69 or a fragment thereof, or SEQ ID NO:70 or a fragment thereof, or SEQ ID NO:71 or a fragment thereof, or SEQ ID NO:72 or a fragment thereof, or SEQ ID NO:73 or a fragment thereof, or SEQ ID NO:74 or a fragment thereof, or SEQ ID NO:75 or a fragment thereof, or SEQ ID NO:76 or a fragment thereof, or SEQ ID NO:77 or a fragment thereof, or SEQ ID NO:78 or a fragment thereof, or SEQ ID NO:79 or a fragment thereof, or SEQ ID NO:80 or a fragment thereof, or SEQ ID NO:81 or a fragment thereof, or SEQ ID NO:82 or a fragment thereof, or SEQ ID NO:83 or a fragment thereof, or SEQ ID NO:84 or a fragment thereof, or SEQ ID NO:85 or a fragment thereof, or SEQ ID NO:86 or a fragment thereof, or SEQ ID NO:87 or a fragment thereof or SEQ ID NO:88 or a fragment thereof, or SEQ ID NO:89 or a fragment thereof, or SEQ ID NO:90 or a fragment thereof, or SEQ ID NO:91 or a fragment thereof, or SEQ ID NO:92 or a fragment thereof, or SEQ ID NO:93 or a fragment thereof, or SEQ ID NO:94 or a fragment thereof, or SEQ ID NO:95 or a fragment thereof, or SEQ ID NO:96 or a fragment thereof, or SEQ ID NO:97 or a fragment thereof, or SEQ ID NO:98 or a fragment thereof, or SEQ ID NO:99 or a fragment thereof, or SEQ ID NO:100 or a fragment thereof, or SEQ ID NO:101 or a fragment thereof, or SEQ ID NO:102 or a fragment thereof, or SEQ ID NO:103 or a fragment thereof, or SEQ ID NO:104 or a fragment thereof, or SEQ ID NO:105 or a fragment thereof, or SEQ ID NO:106 or a fragment thereof, or SEQ ID NO:107 or a fragment thereof, or SEQ ID NO:108 or a fragment thereof, or SEQ ID NO:109 or a fragment thereof, or SEQ ID NO:110 or a fragment thereof, or SEQ ID NO:111 or a fragment thereof, or SEQ ID NO:112 or a fragment thereof, or SEQ ID NO:113 or a fragment thereof, or SEQ ID NO:114 or a fragment thereof, or SEQ ID NO:115 or a fragment thereof,or SEQ ID NO: 116 or a fragment thereof, or SEQ ID NO: 117 or a fragment thereof, or SEQ ID NO: 118 or a fragment thereof, or SEQ ID NO: 119 or a fragment thereof, or SEQ ID NO: 120 or a fragment thereof, or SEQ ID NO: 121 or a fragment thereof, or SEQ ID NO: 122 or a fragment thereof, or SEQ ID NO: 123 or a fragment thereof, or SEQ ID NO: 124 or a fragment thereof, or SEQ ID NO: 125 or a fragment thereof, or SEQ ID NO: 126 or a fragment thereof, or SEQ ID NO: 127 or a fragment thereof, or SEQ ID NO: 128 or a fragment thereof, or SEQ ID NO: 129 or or a fragment thereof, or SEQ ID NO: 130 or a fragment thereof, or SEQ ID NO: 131 or a fragment thereof, or SEQ ID NO: 132 or a fragment thereof, or SEQ ID NO: 133 or a fragment thereof, or SEQ ID NO: 134 or a fragment thereof, or SEQ ID NO: 135 or a fragment thereof, or SEQ ID NO: 136 or a fragment thereof, or SEQ ID NO: 137 or a fragment thereof, or SEQ ID NO: 138 or a fragment thereof, or SEQ ID NO: 139 or a fragment thereof, or SEQ ID NO: 140 or a fragment thereof, or SEQ ID NO: 141 or a fragment thereof, or SEQ ID NO: 142 or a fragment thereof, or SEQ ID NO: 143 or a fragment thereof, or SEQ ID NO: 144 or a fragment thereof, or SEQ ID NO: 145 or a fragment thereof, or SEQ ID NO: 146 or a fragment thereof, or SEQ ID NO: 147 or a fragment thereof, or SEQ ID NO: 148 or a fragment thereof, or SEQ ID NO: 149 or a fragment thereof, or SEQ ID NO: 150 or a fragment thereof, or SEQ ID NO: 151 or a fragment thereof, or SEQ ID NO: 152 or a fragment thereof, or SEQ ID NO: 153 or a fragment thereof, or SEQ ID NO: 154 or a fragment thereof, or SEQ ID NO: 155 or a fragment thereof, or SEQ ID NO: 156 or a fragment thereof, or the sequence No. 157 or a fragment thereof, or SEQ ID NO: 158 or a fragment thereof, or SEQ ID NO: 159 or a fragment thereof, or SEQ ID NO: 160 or a fragment thereof, or SEQ ID NO: 161 or a fragment thereof, or SEQ ID NO: 162 or a fragment thereof, or SEQ ID NO: 163 or a fragment thereof, or SEQ ID NO: 164 or a fragment thereof, or SEQ ID NO: 165 or a fragment thereof, or SEQ ID NO: 166 or a fragment thereof, or SEQ ID NO: 167 or a fragment thereof, or SEQ ID NO: 168 or a fragment thereof, or SEQ ID NO: 169 or a fragment thereof, or SEQ ID NO: 170 or a fragment thereof,or SEQ ID NO: 171 or a fragment thereof, or SEQ ID NO: 172 or a fragment thereof, or SEQ ID NO: 173 or a fragment thereof, or SEQ ID NO: 174 or a fragment thereof, or SEQ ID NO: 175 or a fragment thereof, or SEQ ID NO: 176 or a fragment thereof, or SEQ ID NO: 177 or a fragment thereof, or SEQ ID NO: 178 or a fragment thereof, or SEQ ID NO: 179 or a fragment thereof, or SEQ ID NO: 180 or a fragment thereof, or SEQ ID NO: 181 or a fragment thereof, or SEQ ID NO: 182 or a fragment thereof, or SEQ ID NO: 183 or a fragment thereof, or SEQ ID NO: 184 or or a fragment thereof, or SEQ ID NO: 185 or a fragment thereof, or SEQ ID NO: 186 or a fragment thereof, or SEQ ID NO: 187 or a fragment thereof, or SEQ ID NO: 188 or a fragment thereof, or SEQ ID NO: 189 or a fragment thereof, or SEQ ID NO: 190 or a fragment thereof, or SEQ ID NO: 191 or a fragment thereof, or SEQ ID NO: 192 or a fragment thereof, or SEQ ID NO: 193 or a fragment thereof, or SEQ ID NO: 194 or a fragment thereof, or SEQ ID NO: 195 or a fragment thereof, or SEQ ID NO: 196 or a fragment thereof, or SEQ ID NO: 197 or a fragment thereof, or SEQ ID NO: 198 or a fragment thereof, or SEQ ID NO: 199 or a fragment thereof, or SEQ ID NO: 200 or a fragment thereof, or SEQ ID NO: 201 or a fragment thereof, or SEQ ID NO: 202 or a fragment thereof, or SEQ ID NO: 203 or a fragment thereof, or SEQ ID NO: 204 or a fragment thereof, or SEQ ID NO: 205 or a fragment thereof, or SEQ ID NO: 206 or a fragment thereof, or SEQ ID NO: 207 or a fragment thereof, or SEQ ID NO: 208 or a fragment thereof, or SEQ ID NO: 209 or a fragment thereof, or SEQ ID NO: 210 or a fragment thereof, or SEQ ID NO: 211 or a fragment thereof, or the sequence SEQ ID NO: 212 or a fragment thereof, or SEQ ID NO: 213 or a fragment thereof, or SEQ ID NO: 214 or a fragment thereof, or SEQ ID NO: 215 or a fragment thereof, or SEQ ID NO: 216 or a fragment thereof, or SEQ ID NO: 217 or a fragment thereof, or SEQ ID NO: 218 or a fragment thereof, or SEQ ID NO: 219 or a fragment thereof, or SEQ ID NO: 220 or a fragment thereof, or SEQ ID NO: 221 or a fragment thereof, or SEQ ID NO: 222 or a fragment thereof, or SEQ ID NO: 223 or a fragment thereof, or SEQ ID NO: 224 or a fragment thereof, or SEQ ID NO: 225 or a fragment thereof,or SEQ ID NO: 226 or a fragment thereof, or SEQ ID NO: 227 or a fragment thereof, or SEQ ID NO: 228 or a fragment thereof, or SEQ ID NO: 229 or a fragment thereof, or SEQ ID NO: 230 or a fragment thereof, or SEQ ID NO: 231 or a fragment thereof, or SEQ ID NO: 232 or a fragment thereof, or SEQ ID NO: 233 or a fragment thereof, or SEQ ID NO: 234 or a fragment thereof, or SEQ ID NO: 235 or a fragment thereof, or SEQ ID NO: 236 or a fragment thereof, or SEQ ID NO: 237 or a fragment thereof, or SEQ ID NO: 238 or a fragment thereof, or SEQ ID NO: 239 or or a fragment thereof, or SEQ ID NO: 240 or a fragment thereof, or SEQ ID NO: 241 or a fragment thereof, or SEQ ID NO: 242 or a fragment thereof, or SEQ ID NO: 243 or a fragment thereof, or SEQ ID NO: 244 or a fragment thereof, or SEQ ID NO: 245 or a fragment thereof, or SEQ ID NO: 246 or a fragment thereof, or SEQ ID NO: 247 or a fragment thereof, or SEQ ID NO: 248 or a fragment thereof, or SEQ ID NO: 249 or a fragment thereof, or SEQ ID NO: 250 or a fragment thereof, or SEQ ID NO: 251 or a fragment thereof, or SEQ ID NO: 252 or a fragment thereof, or SEQ ID NO: 253 or a fragment thereof, or SEQ ID NO: 254 or a fragment thereof, or SEQ ID NO: 255 or a fragment thereof, or SEQ ID NO: 256 or a fragment thereof, or SEQ ID NO: 257 or a fragment thereof, or SEQ ID NO: 258 or a fragment thereof, or SEQ ID NO: 259 or a fragment thereof, or SEQ ID NO: 260 or a fragment thereof, or SEQ ID NO: 261 or a fragment thereof, or SEQ ID NO: 262 or a fragment thereof, or SEQ ID NO: 263 or a fragment thereof, or SEQ ID NO: 264 or a fragment thereof, or SEQ ID NO: 265 or a fragment thereof, or SEQ ID NO: 266 or a fragment thereof, or the sequence No. 267 or a fragment thereof, or SEQ ID NO: 268 or a fragment thereof, or SEQ ID NO: 269 or a fragment thereof, or SEQ ID NO: 270 or a fragment thereof, or SEQ ID NO: 271 or a fragment thereof, or SEQ ID NO: 272 or a fragment thereof, or SEQ ID NO: 273 or a fragment thereof, or SEQ ID NO: 274 or a fragment thereof, or SEQ ID NO: 275 or a fragment thereof, or SEQ ID NO: 276 or a fragment thereof, or SEQ ID NO: 277 or a fragment thereof, or SEQ ID NO: 278 or a fragment thereof, or SEQ ID NO: 279 or a fragment thereof, or SEQ ID NO: 280 or a fragment thereof,or SEQ ID NO: 281 or a fragment thereof, or SEQ ID NO: 282 or a fragment thereof, or SEQ ID NO: 283 or a fragment thereof, or SEQ ID NO: 284 or a fragment thereof, or SEQ ID NO: 285 or a fragment thereof, or SEQ ID NO: 286 or a fragment thereof, or SEQ ID NO: 287 or a fragment thereof, or SEQ ID NO: 288 or a fragment thereof, or SEQ ID NO: 289 or a fragment thereof, or SEQ ID NO: 290 or a fragment thereof, or SEQ ID NO:291 or a fragment thereof, or SEQ ID NO:292 or a fragment thereof, or SEQ ID NO:293 or a fragment thereof, or SEQ ID NO:294 or a fragment thereof, or SEQ ID NO:295 or a fragment thereof, or SEQ ID NO:296 or a fragment thereof, or SEQ ID NO:297 or a fragment thereof, or SEQ ID NO:298 or a fragment thereof, or SEQ ID NO:299 or a fragment thereof, or SEQ ID NO:300 or a fragment thereof, or SEQ ID NO:301 or a fragment thereof, or SEQ ID NO:302 or a fragment thereof, or SEQ ID NO:303 or a fragment thereof, or SEQ ID NO:304 or or a fragment thereof, or SEQ ID NO: 305 or a fragment thereof, or SEQ ID NO: 306 or a fragment thereof, or SEQ ID NO: 307 or a fragment thereof, or SEQ ID NO: 308 or a fragment thereof, or SEQ ID NO: 309 or a fragment thereof, or SEQ ID NO: 310 or a fragment thereof, or SEQ ID NO: 311 or a fragment thereof, or SEQ ID NO: 312 or a fragment thereof, or SEQ ID NO: 313 or a fragment thereof, or SEQ ID NO: 314 or a fragment thereof, or SEQ ID NO: 315 or a fragment thereof, or SEQ ID NO: 316 or a fragment thereof, or SEQ ID NO: 317 or a fragment thereof, or SEQ ID NO: 31 8 or a fragment thereof, or SEQ ID NO:319 or a fragment thereof, or SEQ ID NO:320 or a fragment thereof, or SEQ ID NO:321 or a fragment thereof, or SEQ ID NO:322 or a fragment thereof, or SEQ ID NO:323 or a fragment thereof, or SEQ ID NO:324 or a fragment thereof, or SEQ ID NO:325 or a fragment thereof, or SEQ ID NO:326 or a fragment thereof, or SEQ ID NO:327 or a fragment thereof, or SEQ ID NO:328 or a fragment thereof, or SEQ ID NO:329 or a fragment thereof, or SEQ ID NO:330 or a fragment thereof, or SEQ ID NO:331 or a fragment thereof, or the sequence No. 332 or a fragment thereof, or SEQ ID NO: 333 or a fragment thereof, or SEQ ID NO: 334 or a fragment thereof, or SEQ ID NO: 335 or a fragment thereof, or SEQ ID NO: 336 or a fragment thereof, or SEQ ID NO: 337 or a fragment thereof, or SEQ ID NO: 338 or a fragment thereof, or SEQ ID NO: 339 or a fragment thereof, or SEQ ID NO: 340 or a fragment thereof, or SEQ ID NO: 341 or a fragment thereof, or SEQ ID NO: 342 or a fragment thereof, or SEQ ID NO: 343 or a fragment thereof, or SEQ ID NO: 344 or a fragment thereof, or SEQ ID NO: 345 or a fragment thereof,or SEQ ID NO: 346 or a fragment thereof, or SEQ ID NO: 347 or a fragment thereof, or SEQ ID NO: 348 or a fragment thereof, or SEQ ID NO: 349 or a fragment thereof, or SEQ ID NO: 350 or a fragment thereof, or SEQ ID NO: 351 or a fragment thereof, or SEQ ID NO: 352 or a fragment thereof, or SEQ ID NO: 353 or a fragment thereof, or SEQ ID NO: 354 or a fragment thereof, or SEQ ID NO: 355 or a fragment thereof, or SEQ ID NO: 356 or a fragment thereof, or SEQ ID NO: 357 or a fragment thereof, or SEQ ID NO: 358 or a fragment thereof, or SEQ ID NO: 359 or or a fragment thereof, or SEQ ID NO: 360 or a fragment thereof, or SEQ ID NO: 361 or a fragment thereof, or SEQ ID NO: 362 or a fragment thereof, or SEQ ID NO: 363 or a fragment thereof, or SEQ ID NO: 364 or a fragment thereof, or SEQ ID NO: 365 or a fragment thereof, or SEQ ID NO: 366 or a fragment thereof, or SEQ ID NO: 367 or a fragment thereof, or SEQ ID NO: 368 or a fragment thereof, or SEQ ID NO: 369 or a fragment thereof, or SEQ ID NO: 370 or a fragment thereof, or SEQ ID NO: 371 or a fragment thereof, or SEQ ID NO: 372 or a fragment thereof, or SEQ ID NO: 373 or a fragment thereof, or SEQ ID NO: 374 or a fragment thereof, or SEQ ID NO: 375 or a fragment thereof, or SEQ ID NO: 376 or a fragment thereof, or SEQ ID NO: 377 or a fragment thereof, or SEQ ID NO: 378 or a fragment thereof, or SEQ ID NO: 379 or a fragment thereof, or SEQ ID NO: 380 or a fragment thereof, or SEQ ID NO: 381 or a fragment thereof, or SEQ ID NO: 382 or a fragment thereof, or SEQ ID NO: 383 or a fragment thereof, or SEQ ID NO: 384 or a fragment thereof, or SEQ ID NO: 385 or a fragment thereof, or SEQ ID NO: 386 or a fragment thereof, or the sequence No. 387 or a fragment thereof, or SEQ ID NO: 388 or a fragment thereof, or SEQ ID NO: 389 or a fragment thereof, or SEQ ID NO: 390 or a fragment thereof, or SEQ ID NO: 391 or a fragment thereof, or SEQ ID NO: 392 or a fragment thereof, or SEQ ID NO: 393 or a fragment thereof, or SEQ ID NO: 394 or a fragment thereof, or SEQ ID NO: 395 or a fragment thereof, or SEQ ID NO: 396 or a fragment thereof, or SEQ ID NO: 397 or a fragment thereof, or SEQ ID NO: 398 or a fragment thereof, or SEQ ID NO: 399 or a fragment thereof, or SEQ ID NO: 400 or a fragment thereof,or SEQ ID NO:401 or a fragment thereof, or SEQ ID NO:402 or a fragment thereof, or SEQ ID NO:403 or a fragment thereof, or SEQ ID NO:404 or a fragment thereof, or SEQ ID NO:405 or a fragment thereof, or SEQ ID NO:406 or a fragment thereof, or SEQ ID NO:407 or a fragment thereof, or SEQ ID NO:408 or a fragment thereof, or SEQ ID NO:409 or a fragment thereof, or SEQ ID NO:410 or a fragment thereof, or SEQ ID NO:411 or a fragment thereof, or SEQ ID NO:412 or a fragment thereof, or SEQ ID NO:413 or a fragment thereof, or SEQ ID NO:414 or a fragment thereof, or SEQ ID NO:415 or a fragment thereof, or SEQ ID NO:416 or a fragment thereof, or SEQ ID NO:417 or a fragment thereof, or SEQ ID NO:418 or a fragment thereof, or SEQ ID NO:419 or a fragment thereof, or SEQ ID NO:420 or a fragment thereof, or SEQ ID NO:421 or a fragment thereof, or SEQ ID NO:422 or a fragment thereof, or SEQ ID NO:423 or a fragment thereof, or SEQ ID NO:424 or a fragment thereof, or SEQ ID NO:425 or a fragment thereof, or SEQ ID NO:426 or a fragment thereof, or The method of any of embodiments 219 to 228, wherein the nucleic acid sequence is SEQ ID NO: 427 or a fragment thereof, or SEQ ID NO: 428 or a fragment thereof, or SEQ ID NO: 429 or a fragment thereof, or SEQ ID NO: 430 or a fragment thereof, or SEQ ID NO: 431 or a fragment thereof, or SEQ ID NO: 432 or a fragment thereof, or SEQ ID NO: 433 or a fragment thereof, or SEQ ID NO: 434 or a fragment thereof, or SEQ ID NO: 435 or a fragment thereof, or SEQ ID NO: 436 or a fragment thereof, or SEQ ID NO: 437 or a fragment thereof, or SEQ ID NO: 438 or a fragment thereof, or SEQ ID NO: 439 or a fragment thereof, or SEQ ID NO: 440 or a fragment thereof, or SEQ ID NO: 441 or a fragment thereof, or SEQ ID NO: 442 or a fragment thereof, or SEQ ID NO: 443 or a fragment thereof, or SEQ ID NO: 444 or a fragment thereof, or SEQ ID NO: 445 or a fragment thereof, or SEQ ID NO: 446 or a fragment thereof, or SEQ ID NO: 447 or a fragment thereof, or SEQ ID NO: 448 or a fragment thereof, or SEQ ID NO: 449 or a fragment thereof, or SEQ ID NO: 450 or a fragment thereof, or SEQ ID NO: 451 or a fragment thereof.

[0264] 230. A method of making a tRNA effector molecule (TREM), the method comprising synthetic methods (e.g., synthesized using solid phase synthesis or liquid phase synthesis) or in vitro transcription (IVT).

[0265] 231. A method for producing a tRNA effector molecule (TREM), comprising: (a) providing a host cell containing an exogenous nucleic acid, e.g., DNA or RNA, encoding a TREM under conditions sufficient to express the TREM; and (b) purifying the expressed TREM from the host cell culture to produce a composition comprising a TREM, thereby producing a composition comprising a TREM; A method comprising:

[0266] 232. The method of embodiment 230 or 231, wherein the composition comprising TREM comprises a TREM fragment, such as one described herein.

[0267] 233. The method of embodiment 232, wherein the TREM fragment is generated in vivo in a host cell.

[0268] 234. The method of embodiment 232 or 233, wherein the TREM fragment is produced by fragmenting expressed TREM after production of the TREM by the cell, for example, TREM produced by the host cell is fragmented after release or purification from the host cell, for example, TREM is fragmented ex vivo.

[0269] 235. The method of any of embodiments 230-234, wherein the method results in an increase, e.g., at least a 2.2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, or 20-fold increase (e.g., as measured by an assay described in any of Examples 1-3 or 7-11), in the production of total endogenous tRNA and TREM in the host cell, e.g., compared to a reference cell, e.g., a similar cell that has not been engineered or modified to express TREM.

[0270] 236. The method of embodiment 235, wherein the method results in a 2.2-20 fold, 2.2-15 fold, 2.2-10 fold, 2.2-9 fold, 2.2-8 fold, 2.2-7 fold, 2.2-6 fold, 2.2-5 fold, 2.2-4 fold, 2.2-3 fold, 2.2-2.5 fold, 2.5-20 fold, 3-20 fold, 4-20 fold, 5-20 fold, 6-20 fold, 7-20 fold, 8-20 fold, 9-20 fold, 10-20 fold, or 15-20 fold increase in TREM production and / or tRNA production.

[0271] 237. The method of any of embodiments 230-236, wherein the method results in a detectable level of TREM in the host cell, for example, as measured by an assay described in any of Examples 1-3 or 7-11.

[0272] 238. The method of any of embodiments 230-237, wherein the host cell is capable of post-transcriptional modification of TREM.

[0273] 239. The method of any of embodiments 230-238, wherein the host cell is capable of a post-transcriptional modification of TREM, e.g., a post-transcriptional modification selected from Table 3.

[0274] 240. The method of any of embodiments 230-239, wherein the host cell has been modified to modulate, e.g., increase, its ability to provide a post-transcriptional modification of a TREM, e.g., a post-transcriptional modification selected from Table 3, e.g., the host cell has been modified to allow increased or decreased expression of one or more genes, e.g., genes encoding enzymes from Table 3 or genes encoding enzymes with nuclease activity (e.g., endonuclease activity or ribonuclease activity), such as or Dicer, angiogenin, RNaseA, RNaseP, RNaseZ, Rny1, or PrrC.

[0275] 241. The method of any one of embodiments 230-240, wherein the host cell is a mammalian cell capable of post-transcriptional modification of TREM, e.g., a post-transcriptional modification selected from Table 3.

[0276] 242. The method of any of embodiments 230-241, wherein the host cells comprise HeLa cells, HEK293 cells, HT-1080 cells, PER.C6 cells, HKB11 cells, CAP cells, or HuH-7 cells.

[0277] 243. The method of any of embodiments 230-242, wherein the host cell has increased expression of an oncogene, such as Ras, c-myc, or c-jun.

[0278] 244. The method of any of embodiments 230-243, wherein the host cell has reduced expression of a tumor suppressor, for example, p53 or Rb.

[0279] 245. The method of any of embodiments 230-244, wherein the host cell has increased expression of RNA polymerase III (RNA pol III).

[0280] 246. The method of any of embodiments 230-245, wherein the host cell is a non-mammalian host cell.

[0281] 247. The method of any of embodiments 230-246, wherein the host cell is a bacterial cell, such as an E. coli cell or a yeast cell.

[0282] 248. The following characteristics of a composition comprising TREM (or an intermediate in the production of a composition comprising TREM): (i) a purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%; (ii) less than 0.1 ng / ml, 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, or 100 ng / ml of host cell protein (HCP) contamination; (iii) less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, or 100 ng of host cell protein (HCP) contamination per milligram (mg) of the composition containing TREM; (iv) less than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, or 100 ng / ml of DNA, e.g., host cell DNA; (v) Less than 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of fragments; (vi) low levels or absence of endotoxin, as measured, for example, by the Limulus amebocyte lysate (LAL) test; (vii) in vitro translation activity, for example, as measured by the assay described in Example 14; (viii) At least 0.1, ng / mL, 0.5ng / mL, 1ng / mL, 5ng / mL, 10ng / mL, 50ng / mL, 0.1ug / mL, 0.5ug / mL, 1ug / mL, 2ug / mL, 5ug / mL, 10ug / mL, 20ug / mL, 30ug / mL, 40u TREM concentrations of g / mL, 50ug / mL, 60ug / mL, 70ug / mL, 80ug / mL, 100ug / mL, 200ug / mL, 300ug / mL, 500ug / mL, 1000ug / mL, 5000ug / mL, 10,000ug / mL or 100,000ug / mL; (ix) Sterility, e.g., according to cGMP guidelines for sterile preparations, e.g., the composition or preparation supports the growth of less than 100 viable microorganisms when tested under sterile conditions, and the composition or preparation meets USP <71> and / or the composition or preparation meets the specifications of the U.S.P. <85> meets the standards for sterility; or (x) For example, the composition or preparation is free of viral contamination or has undetectable levels of viral contamination. 248. The method of any of embodiments 230 to 247, further comprising measuring one or more of:

[0283] 249. The method of embodiment 248, further comprising comparing the measurement value to a reference value or standard.

[0284] 250. Adjust the composition containing TREM according to the comparison. (i) increase the purity of the composition; (ii) reducing the amount of HCPs in the composition; (iii) reduce the amount of DNA in the composition; (iv) reducing the amount of fragments in the composition; (v) reduces the amount of endotoxin in the composition; (vi) increases the in vitro translation activity of the composition; (vii) increasing the TREM concentration of the composition; or (viii) increasing the sterility of the composition 250. The method of embodiment 249, further comprising:

[0285] 251. The TREM of any of embodiments 230-250, wherein the TREM is purified from host cells cultured in a bioreactor.

[0286] 252. (i) at least 1 × 10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 or 1 x 10 14 Contains host cells; (ii) comprises between 100 mL and 100 liters of culture medium, e.g., at least 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, or 100 liters of culture medium; (iii) the bioreactor is selected from a continuous flow bioreactor, a batch process bioreactor, a perfusion bioreactor, and a fed-batch bioreactor; or (iv) the bioreactor is maintained under conditions sufficient to express TREM; 252. The bioreactor of embodiment 251.

[0287] 253.TREM (i) control region sequences; (ii) a sequence encoding a modified TREM; (iii) a sequence encoding two TREMs; or (iv) tRNA MET Non-array arrays 253. The method of any of embodiments 230-252, wherein the polypeptide is encoded by or expressed from a nucleic acid sequence comprising:

[0288] 254. The method of embodiment 253, wherein the nucleic acid sequence comprises a promoter sequence.

[0289] 255. The method of embodiment 253 or 254, wherein the nucleic acid sequence comprises a promoter sequence, such as a U6 promoter sequence or a fragment thereof, comprising an RNA polymerase III (Pol III) recognition site, such as a Pol III binding site.

[0290] Other features, objects, and advantages of the invention will become apparent from the description and claims.

[0291] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting. [Brief explanation of the drawings]

[0292] [Figure 1][Figure 1A] Panel A: Depicts the mRNA and protein sequences and endogenous tRNA pool of a non-SNP subject. The sequence of the second codon is GTG (depicted by a white triangle), which encodes the amino acid valine. Two valine isoacceptor tRNA species are shown. Each of the two tRNA species recognizes a different valine codon. The two species have different abundances. The species that recognizes the wild-type codon GTG is unshaded and has higher abundance. The shaded species has lower abundance and does not pair with the wild-type codon. Therefore, the valine isoacceptor tRNA species corresponding to the used codon (GTG) is abundant. [Figure 1B] Panel B: Depicts the mRNA and protein sequences and endogenous tRNA pool of a subject with a single nucleotide polymorphism (SNP) at the third position of the second codon (depicted by a black triangle) in the depicted mRNA sequence. The composition of the endogenous tRNA pool is identical to that described for Figure 1, Panel A. However, incorporation of valine at the second codon here relies on the use of less abundant tRNA species (shade species). As a result, translation is impaired, as shown in Figure 1, panel B. Other consequences of using less abundant tRNA species may include, for example, disrupted peptide chain elongation, lower protein production, protein misfolding, protein mislocalization, altered protein function, or altered mRNA transcript stability. [Figure 1C] Panel C depicts the same mRNA sequence as Figure 1, panel B, containing a SNP at the third position of the second codon. The endogenous tRNA in the pool is identical to panels A and B, but the pool has been supplemented with exogenous TREM, which increases the abundance of species pairing with the SNP codon. This can result in improved mRNA translation. [Figure 2][Figure 2A] Panel A: Depicts the mRNA and protein sequences and endogenous tRNA pool of a non-SNP subject. The sequence of the second codon is GTG (depicted by a white triangle), which encodes the amino acid valine. Two valine isoacceptor tRNA species are shown. Each of the two tRNA species recognizes a different valine codon. The two species have different abundances. The species that recognizes the wild-type codon GTG is unshaded and has higher abundance. The shaded species has lower abundance and does not pair with the wild-type codon. Therefore, the valine isoacceptor tRNA species corresponding to the used codon (GTG) is abundant. This results in translation of the mRNA sequence into the corresponding protein, as depicted. [Figure 2B] Panel B: Depicts the mRNA and protein sequences and endogenous tRNA pool of a subject with a single nucleotide polymorphism (SNP) at the third position of the second codon (depicted by a black triangle) in the depicted mRNA sequence. The composition of the endogenous tRNA pool is identical to that described for Figure 1, panel A. However, incorporation of valine at the second codon now relies on the use of a less abundant tRNA species (shaded species). As a result, translation of the mRNA sequence into the corresponding protein is impaired, as shown in Figure 2, panel B. [Figure 2C] Panel C depicts an mRNA sequence identical to Figure 2, panel B, containing a SNP at the third position of the second codon (indicated by a filled triangle). The endogenous tRNAs of the pool are identical to those in panels A and B, but the pool has been supplemented with exogenous TREM, which increases the abundance of species that pair with the SNP codon. As a result, translation of the mRNA sequence into the corresponding protein is unimpaired and resembles that of a non-SNP control. [Figure 3]Top row: The endogenous tRNA pool for non-SNP subjects, and moving to the right, the mRNA and protein sequences are depicted. The sequence of the second codon is GTG (depicted by an open triangle), which encodes the amino acid valine. Two valine isoacceptor tRNA species are shown. Each of the two tRNA species recognizes a different valine codon. The two species have different abundances. The species that recognizes the wild-type codon GTG is unshaded and is of higher abundance. The shaded species has lower abundance and does not pair with the wild-type codon. Therefore, the valine isoacceptor tRNA species corresponding to the used codon (GTG) is highly abundant. This results in the translation of the mRNA sequence into the corresponding protein, as depicted. Using a more abundant tRNA species may also affect transcript stability, protein expression, protein function, protein folding, or protein localization. Middle row: Depicts the endogenous tRNA pool and mRNA and protein sequence of a subject with a single nucleotide polymorphism (SNP) at the third position of the second codon (indicated by a filled triangle) in the depicted mRNA sequence. The composition of the endogenous tRNA pool is identical to that described for the top row of Figure 3. However, incorporation of valine at the second codon now relies on the use of less abundant tRNA species (shaded species). As a result, translation of the mRNA sequence into the corresponding protein is impaired, as shown in the middle row of Figure 3. Using less abundant tRNA species can also result in reduced transcript stability, reduced protein expression, altered protein function, altered protein folding, or altered protein localization. Bottom row: Depicts an mRNA sequence identical to the middle row of Figure 3, containing a SNP at the third position of the second codon (indicated by a filled triangle). The endogenous tRNAs of the pool are identical to those in the top and middle rows, but the pool has been supplemented with exogenous TREMs to increase the abundance of species capable of pairing with the SNP codon. As a result, translation of the mRNA sequence into the corresponding protein is not impaired. [Figure 4]Figure 4A is a graph showing the increase in cell proliferation in three cell lines after transfection with TREMs corresponding to the initiating methionine (iMet). Figure 4A is a graph showing the increase in % cell confluency (a measure of cell proliferation) of U20S cells transfected with Cy3-labeled iMet-CAT-TREM or a Cy3-labeled untagged control. Figure 4B is a graph showing the increase in % cell confluency (a measure of cell proliferation) of H1299 cells transfected with Cy3-labeled iMet-CAT-TREM or a Cy3-labeled untagged control. Figure 4C is a graph showing the increase in % cell confluency (a measure of cell proliferation) of HeLa cells transfected with Cy3-labeled iMet-CAT-TREM or a Cy3-labeled untagged control. [Figure 5] Graph showing increase in NanoLuc reporter expression upon addition of iMET-TREM to translation reactions with cell-free lysate. As a control, translation reactions with buffer were performed. DETAILED DESCRIPTION OF THE INVENTION

[0293] In particular, the present disclosure features methods of using tRNA-based effector molecules (TREMs) to modulate tRNA pools in a cell or a subject. Also disclosed herein are methods of treating disorders or ameliorating symptoms of disorders by administering a composition comprising a TREM or a pharmaceutical composition comprising a TREM. As disclosed herein, tRNA-based effector molecules (TREMs) are complex molecules that can mediate various cellular processes. Pharmaceutical compositions comprising TREMs can be administered to cells, tissues, or subjects to modulate these functions.

[0294] definition "Obtain" or "obtaining," as those terms are used herein, refers to gaining possession of a value, e.g., a numerical value, by "directly obtaining" or "indirectly obtaining" a physical element or value. "Directly obtaining" refers to performing a process (e.g., performing an analytical method) to obtain the value. "Indirectly obtaining" refers to receiving a value from another party or source (e.g., a third-party testing lab that obtains the value directly).

[0295] A "cognate adaptor function TREM," as that term is used herein, refers to a TREM that mediates initiation or elongation by the AA that is naturally associated with the anticodon of the TREM (the cognate AA).

[0296] "Decreased expression," as that term is used herein, refers to a decrease compared to a reference, for example, if modification of a control region or addition of an agent results in decreased expression of the product of interest, which is decreased compared to other similar cells without the modification or addition.

[0297] "Foreign nucleic acid," as that term is used herein, refers to a nucleic acid sequence that is not present in, or differs by at least one nucleotide from, the closest sequence in a reference cell, e.g., the cell into which the foreign nucleic acid is introduced. In one embodiment, the foreign nucleic acid comprises a nucleic acid encoding a TREM.

[0298] "Extraneous TREM," as that term is used herein, means: (a) differs in at least one nucleotide or one post-transcriptional modification from the closest sequence tRNA in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced; (b) whether it has been introduced into cells other than those in which it was transcribed; (c) it is present in cells other than those in which it naturally occurs; or (d) A TREM that has an expression profile, e.g., a level or distribution, that is not wild-type (e.g., it is expressed at a level higher than wild-type). In some embodiments, the expression profile can be mediated by changes introduced into a nucleic acid that regulates expression or by the addition of an agent that regulates expression of an RNA molecule. In some embodiments, an exogenous TREM comprises one, two, three, or four of characteristics (a)-(d).

[0299] "GMP-grade composition," as that term is used herein, refers to a composition that complies with current Good Manufacturing Practice (cGMP) guidelines or other similar requirements. In certain embodiments, a GMP-grade composition may be used as a pharmaceutical product.

[0300] As used herein, the terms "increase" and "decrease" refer to modulation that results in an increase or decrease, respectively, in the amount of a particular indicator of function, expression, or activity relative to a reference. For example, after administration of a TREM as described herein to a cell, tissue, or subject, the amount of a marker of the indicator as described herein (e.g., protein translation, mRNA stability, protein folding) can be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%, 2X, 3X, 5X, 10X, or more relative to the amount of the marker before administration or relative to the effect of a negative control agent. The indicator can be measured after administration at a time when the administration has had the recited effect, for example, at least 12 hours, 24 hours, 1 week, 1 month, 3 months, or 6 months after treatment begins.

[0301] "Increased expression," as that term is used herein, refers to an increase compared to a reference, for example, where modification of a control region or addition of an agent results in increased expression of the product of interest, which is increased compared to other similar cells without the modification or addition.

[0302] "Isoacceptor," as that term is used herein, refers to multiple tRNA molecules or TREMs, where each molecule of the plurality contains a different naturally occurring anticodon sequence, and each molecule of the plurality mediates the incorporation of the same amino acid, which amino acid naturally corresponds to the anticodon.

[0303] A "non-cognate adapter function TREM," as that term is used herein, refers to a TREM that mediates initiation or extension by an AA other than the AA naturally associated with the anticodon of the TREM (non-cognate AA). In one embodiment, a non-cognate adapter function TREM is also referred to as a mischarged TREM (mTREM).

[0304] "Oncogene," as the term is used herein, refers to a gene that regulates one or more cellular processes, including cell fate determination, cell survival, and genome maintenance. In certain embodiments, an oncogene confers a selective growth advantage, e.g., deregulation, e.g., genetic deregulation (e.g., mutation or amplification) or epigenetic deregulation, to the cell in which it is present. Exemplary oncogenes include Myc (e.g., c-Myc, N-Myc, or L-Myc), c-Jun, Wnt, or RAS.

[0305] "Pharmaceutical composition," as the term is used herein, refers to a composition suitable for pharmaceutical use. Typically, pharmaceutical compositions include pharmaceutical excipients. In certain embodiments, a pharmaceutical composition may include a TREM (a pharmaceutical composition comprising a TREM). In certain embodiments, a TREM will be the only active ingredient in a pharmaceutical composition comprising a TREM. In certain embodiments, a pharmaceutical composition comprising a TREM, e.g., a pharmaceutical composition, is free, substantially free, or has less than a pharmaceutically acceptable amount of host cell proteins, DNA, e.g., host cell DNA, endotoxins, and bacteria. In certain embodiments, a pharmaceutical composition, e.g., a pharmaceutical composition comprising a TREM, is a GMP-grade composition that complies with current Good Manufacturing Practice (cGMP) guidelines or other similar requirements. In certain embodiments, a pharmaceutical composition, e.g., a pharmaceutical composition comprising a TREM, is sterile, e.g., the composition or preparation supports the growth of less than 100 viable microorganisms when tested under sterile conditions, and the composition or preparation meets USP <71> and / or the composition or preparation meets the specifications of the U.S.P. <85> Meets the standards.

[0306] "Post-transcriptional processing," as the term is used herein with respect to a molecule of interest, e.g., a TREM, RNA, or tRNA, refers to the covalent modification of the molecule of interest. In some embodiments, the covalent modification occurs post-transcriptionally. In some embodiments, the covalent modification occurs co-transcriptionally. In some embodiments, the modification is made in vivo, e.g., in the cells used to generate the TREM. In some embodiments, the modification is made ex vivo, e.g., on a TREM isolated or obtained from the cells that generated the TREM. In some embodiments, the post-transcriptional modification is selected from the post-transcriptional modifications listed in Table 3.

[0307] "Recombinant TREM," as that term is used herein, refers to a TREM expressed in a cell that has been modified by human intervention, with modifications that mediate the production of the TREM (e.g., the cell includes an exogenous sequence encoding the TREM), or modifications that mediate expression, e.g., transcriptional expression or post-transcriptional modification, of the TREM. A recombinant TREM may have the same or a different sequence, set of post-transcriptional modifications, or tertiary structure as a reference tRNA, e.g., a naturally occurring tRNA.

[0308] "Synthetic TREM," as that term is used herein, refers to a TREM that is synthesized outside of a cell that has endogenous nucleic acid encoding the TREM, for example, by cell-free solid-phase synthesis. A synthetic TREM may have the same or a different sequence, set of post-transcriptional modifications, or tertiary structure as a naturally occurring tRNA.

[0309] "TREM expressed in heterologous cells," as that term is used herein, refers to TREM produced under non-native conditions. For example, i) produced in cells that are genetically, metabolically different (e.g., have a different profile of gene expression or different levels of cellular components, such as absorbed nutrients), or epigenetically different from naturally occurring cells; ii) produced in cells cultured under conditions that differ from natural conditions (native conditions are those under which cells naturally produce tRNA), such as nutrient, pH, temperature, cell density, or stress conditions; or iii) produced in cells that are localized at a level, ratio, or concentration, or in a compartment or location that differs from the reference, e.g., a level, ratio, or concentration, or in a compartment or location that differs from that occurring under natural conditions. TREM expressed in heterologous cells may have the same or a different sequence, set of post-transcriptional modifications, or tertiary structure as natural tRNA.

[0310] "tRNA," as the term is used herein, refers to a naturally occurring transfer ribonucleic acid in its natural state.

[0311] "tRNA-based effector molecule" or "TREM," as that term is used herein, refers to an RNA molecule that comprises the structure or characteristics (a) through (v) below, and that is a recombinant TREM, a synthetic TREM, or a TREM expressed from a heterologous cell. A TREM may have the structure and function of more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9) of (a) through (v).

[0312] In certain embodiments, the TREM, such as a naturally occurring tRNA or a tRNA described herein, contains an anticodon and can accept an amino acid to mediate incorporation of the amino acid into a polypeptide chain.

[0313] In certain embodiments, the TREM is non-naturally occurring, as assessed by its structure or the manner in which it is made.

[0314] In certain embodiments, the TREM comprises one or more of the following structures or characteristics: (a) an amino acid binding domain, e.g., an acceptor stem domain (AStD), that binds to an amino acid (e.g., an AStD comprises an RNA sequence sufficient, when present in an otherwise wild-type tRNA, to accept an amino acid, e.g., its cognate or non-cognate amino acid, and mediate the transfer of the amino acid (AA) in the initiation or elongation of a polypeptide chain). Typically, the AStD comprises a 3'-terminal adenosine (CCA) for acceptor stem loading, which is part of the synthetase recognition. In some embodiments, the AStD has at least 75, 80, 85, 90, 95, or 100% identity to a naturally occurring AStD, e.g., an AStD encoded by a nucleic acid in Table 2. In some embodiments, the TREM may comprise a fragment or analog of an AStD, e.g., an AStD encoded by a nucleic acid in Table 2, where in embodiments the fragment has AStD activity and in other embodiments it does not have AStD activity. (One of skill in the art can determine the appropriate corresponding sequence for any of the domains, stems, loops, or other sequence features described herein from the sequences encoded by the nucleic acids in Table 2. For example, one of skill in the art can determine the sequence corresponding to AStD from the tRNA sequences encoded by the nucleic acids in Table 2.) (b) a dihydrouridine hairpin domain (DHD) (the DHD, e.g., when present in an otherwise wild-type tRNA, mediates aminoacyl-tRNA synthetase recognition, e.g., comprises a sufficient RNA sequence to act as a recognition site for an aminoacyl-tRNA synthetase for amino acid charging of the TREM). In embodiments, the DHD mediates stabilization of the tertiary structure of the TREM. In certain embodiments, the DHD has at least 75, 80, 85, 90, 95, or 100% identity to a naturally occurring DHD, e.g., a DHD encoded by a nucleic acid in Table 2. In certain embodiments, the TREM may comprise a fragment or analog of a DHD, e.g., a DHD encoded by a nucleic acid in Table 2, wherein the fragment in embodiments has DHD activity and in other embodiments does not have DHD activity. (c) an anticodon, e.g., an anticodon hairpin domain (ACHD), that binds to the respective codon in the mRNA (e.g., an ACHD includes a sequence, e.g., an anticodon triplet, sufficient to mediate pairing with the codon (with or without wobble) when present in an otherwise wild-type tRNA; in some embodiments, the ACHD has at least 75, 80, 85, 90, 95, or 100% identity to a naturally occurring ACHD, e.g., an ACHD encoded by a nucleic acid in Table 2). In some embodiments, the TREM may include a fragment or analog of an ACHD, e.g., an ACHD encoded by a nucleic acid in Table 2, where the fragment in some embodiments has ACHD activity and in other embodiments does not have ACHD activity. (d) Variable Loop Domain (VLD) (The VLD, e.g., when present in an otherwise wild-type tRNA, mediates aminoacyl-tRNA synthetase recognition, e.g., comprises sufficient RNA sequence to act as a recognition site for an aminoacyl-tRNA synthetase for amino acid charging of the TREM). In embodiments, the VLD mediates stabilization of the tertiary structure of the TREM. In some embodiments, the VLD modulates, e.g., increases, the specificity of the TREM for its cognate amino acid, e.g., the VLD modulates the cognate adaptor function of the TREM. In some embodiments, the VLD has at least 75, 80, 85, 85, 90, 95, or 100% identity to a naturally occurring VLD, e.g., a VLD encoded by a nucleic acid in Table 2. In some embodiments, the TREM may comprise a fragment or analog of a VLD, e.g., a VLD encoded by a nucleic acid in Table 2, wherein the fragment in embodiments has VLD activity and in other embodiments does not have VLD activity. (e) a thymine hairpin domain (THD) (the THD, e.g., when present in an otherwise wild-type tRNA, comprises sufficient RNA sequence to mediate ribosome recognition, e.g., to act as a recognition site for the ribosome to form a TREM-ribosome complex during translation). In some embodiments, the THD has at least 75, 80, 85, 85, 90, 95, or 100% identity to a naturally occurring THD, e.g., a THD encoded by a nucleic acid in Table 2. In some embodiments, the TREM may comprise a fragment or analog of a THD, e.g., a THD encoded by a nucleic acid in Table 2, wherein the fragment in embodiments has THD activity and in other embodiments does not have THD activity. (f) under physiological conditions, it comprises a stem structure and one or more loop structures, e.g., one, two, or three loops. The loop may comprise a domain described herein, e.g., a domain selected from (a)-(e). The loop may comprise one or more domains. In some embodiments, the stem or loop structure has at least 75, 80, 85, 85, 90, 95, or 100% identity to a naturally occurring stem or loop structure, e.g., a stem or loop structure encoded by a nucleic acid in Table 2. In some embodiments, the TREM may comprise a fragment or analog of a stem or loop structure, e.g., a stem or loop structure encoded by a nucleic acid in Table 2, where the fragment in embodiments has the activity of the stem or loop structure and in other embodiments does not have the activity of the stem or loop structure; (g) tertiary structure, e.g., L-type tertiary structure; (h) Adaptor function, i.e., TREM, mediates the acceptance of an amino acid, e.g., its cognate amino acid, and the transfer of AA in the initiation or elongation of a polypeptide chain; (i) cognate adaptor function (TREMs mediate acceptance and incorporation of amino acids (e.g., cognate amino acids) that are naturally linked to the anticodon of the TREM initiating or elongating a polypeptide chain); (j) noncognate adaptor function (TREMs mediate the acceptance and incorporation of amino acids other than those naturally linked to the anticodon of the TREM (e.g., noncognate amino acids) in the initiation or elongation of a polypeptide chain); (k) a regulatory function, such as an epigenetic function (e.g., a gene silencing function or a signal pathway regulation function), a cell fate regulation function, an mRNA stability regulation function, a protein stability regulation function, a protein transduction regulation function, or a protein compartmentalization function; (l) structures that allow ribosome binding; (m) a post-transcriptional modification (e.g., it includes one or more modifications in Table 3, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 modifications listed in Table 3); (n) a functional property of tRNA, e.g., the ability to inhibit any of the properties (h)-(k) possessed by tRNA; (o) the ability to regulate cell fate; (p) the ability to regulate ribosome occupancy; (q) the ability to regulate protein translation; (r) the ability to regulate mRNA stability; (s) the ability to regulate protein folding and structure; (t) the ability to regulate protein transduction or compartmentalization; (u) the ability to regulate protein stability; (v) The ability to modulate a signaling pathway, for example, a cellular signaling pathway. (w) the anticodon does not pair with a stop codon, e.g., is an anticodon that pairs with something other than UAG, UAA, or UGA; or (x) contains an anticodon and is capable of accepting an amino acid and mediating incorporation of the amino acid into a polypeptide chain, such as naturally occurring tRNAs and the tRNAs described herein.

[0315] In certain embodiments, the TREM comprises a full-length tRNA molecule or a fragment thereof.

[0316] In one embodiment, the TREM comprises the following properties: (a) through (e).

[0317] In one embodiment, the TREM comprises the following properties: (a) and (c).

[0318] In one embodiment, the TREM comprises the following characteristics: (a), (c), and (h).

[0319] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), and (b).

[0320] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), and (e).

[0321] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (b), and (e).

[0322] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (b), (e), and (g).

[0323] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), and (m).

[0324] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (m), and (g).

[0325] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (m), and (b).

[0326] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (m), and (e).

[0327] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (m), (g), (b), and (e).

[0328] In one embodiment, the TREM comprises the following characteristics: (a), (c), (h), (m), (g), (b), (e), and (q).

[0329] In one embodiment, the TREM is (i) an amino acid binding domain that binds to an amino acid (e.g., an AStD as described in (a) herein); and (ii) It contains an anticodon (e.g., ACHD as described in (c) herein) that binds to each codon in the mRNA.

[0330] In certain embodiments, the TREM comprises a flexible RNA linker that provides the covalent bond between (i) and (ii).

[0331] In certain embodiments, TREM mediates protein translation.

[0332] In some embodiments, the TREM comprises a linker, e.g., an RNA linker, e.g., a flexible RNA linker, that provides a covalent bond between the first and second structures or domains. In some embodiments, the RNA linker comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 ribonucleotides. The TREM may comprise one or more linkers; for example, in embodiments, a TREM comprising (a), (b), (c), (d), and (e) may have a first linker between the first and second domains and a second linker between the third domain and another domain.

[0333] In some embodiments, a TREM comprises an RNA sequence that is at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to, or differs by no more than 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 ribonucleotides from, an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment or functional fragment thereof. In some embodiments, a TREM comprises an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment or functional fragment thereof. In some embodiments, a TREM comprises an RNA sequence encoded by a DNA sequence that is at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to, a DNA sequence listed in Table 2, or a fragment or functional fragment thereof. In some embodiments, the TREM comprises a TREM domain, e.g., a domain described herein, or a fragment or functional fragment thereof, that is at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to, or differs by no more than 1, 2, 3, 4, 5, 10, or 15 ribonucleotides from, an RNA encoded by a DNA sequence listed in Table 2. In some embodiments, the TREM comprises a TREM domain, e.g., a domain described herein, that comprises an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment or functional fragment thereof. In some embodiments, the TREM comprises a TREM domain, e.g., a domain described herein, that comprises an RNA sequence encoded by a DNA sequence that is at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to, a DNA sequence listed in Table 2, or a fragment or functional fragment thereof.

[0334] In certain embodiments, the TREM is 76 to 90 nucleotides in length. In certain embodiments, the TREM, or a fragment or functional fragment thereof, is 10 to 90 nucleotides, 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 20 to 90 nucleotides, 20 to 80 nucleotides, 20 to 70 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, 30 to 90 nucleotides, 30 to 80 nucleotides, 30 to 70 nucleotides, 30 to 60 nucleotides, or 30 to 50 nucleotides.

[0335] In certain embodiments, the TREM is aminoacylated, eg, charged with an amino acid by an aminoacyl-tRNA synthetase.

[0336] In certain embodiments, the TREM is not loaded with amino acids, eg, unloaded TREM (uTREM).

[0337] In some embodiments, a TREM comprises a less than full-length tRNA. In embodiments, a TREM can correspond to a naturally occurring or non-naturally occurring fragment of a tRNA. Exemplary fragments include a TREM half (e.g., derived from an ACHD, e.g., a cleavage in the anticodon sequence, e.g., the 5' half or the 3' half); a 5' fragment (e.g., derived from a cleavage in the DHD or ACHD, e.g., a fragment including the 5' end); a 3' fragment (e.g., derived from a cleavage in the THD, e.g., a fragment including the 3' end); or an internal fragment (e.g., derived from a cleavage in one or more of the ACHD, DHD, or THD).

[0338] A "composition comprising a TREM," as that term is used herein, refers to a composition comprising a TREM described herein. A composition comprising a TREM can include one or more TREM species. In some embodiments, the composition includes only a single species of TREM. In some embodiments, the composition includes a first TREM species and a second TREM species. By way of example, in some embodiments, the first and second species are isoacceptors but have different sequences from each other. In some embodiments, the composition can include a first species that mediates the incorporation of a first amino acid, e.g., alanine, and a second species that mediates the incorporation of a second amino acid, e.g., lysine. In some embodiments, the composition includes X TREM species (X=2, 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, the TREM has at least 70, 75, 80, 85, 90, or 95, or 100% identity to a sequence encoded by a nucleic acid in Table 2. In some embodiments, the TREM is purified from a cell culture. In one embodiment, the cell culture from which TREM is purified comprises at least 1×10 7 host cells, 1 x 10 8 host cells, 1 x 10 9 host cells, 1 x 10 10 host cells, 1 x 10 11 host cells, 1 x 10 12 host cells, 1 x 10 13 host cells, or 1 x 10 14In some embodiments, the composition comprising a TREM is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 99% dry weight TREM (for liquid compositions, dry weight refers to the weight after removal of substantially all liquid, e.g., after lyophilization). In some embodiments, the composition is a liquid. In some embodiments, the composition is a dry, e.g., lyophilized, material. In some embodiments, the composition is a frozen composition. In some embodiments, the composition is sterile. In some embodiments, the composition is sterile, e.g., the composition supports the growth of less than 100 viable microorganisms when tested under sterile conditions, and the composition or preparation meets USP <71> and / or the composition or preparation meets the specifications of the U.S.P. <85> In some embodiments, the composition comprises at least 0.5 g, 1.0 g, 50 g, 10 g, 15 g, 25 g, 50 g, 100 g, 200 g, 400 g, or 500 g (e.g., as determined by dry weight) of TREM.

[0339] "tRNA pool," as the term is used herein, refers to the pool of all species that can function as tRNAs, e.g., endogenous tRNAs and TREMS. The endogenous tRNA pool of a cell or subject to which a TREM has not been administered contains only endogenous tRNAs. TREM can be added to adjust the tRNA pool to contain only endogenous tRNAs, but can also be administered to a cell or subject that has a tRNA pool containing a previously administered TREM. In some embodiments, the TREM administered to a cell or subject mediates initiation or elongation by incorporating the amino acid naturally bound to a particular anticodon (the cognate amino acid). In some embodiments, the administered TREM has an anticodon other than a stop codon.

[0340] "Tumor suppressor," as the term is used herein, refers to a gene that regulates one or more cellular processes, including cell fate determination, cell survival, and genome maintenance. In certain embodiments, a tumor suppressor confers a selective growth advantage to cells in which it is deregulated, e.g., genetically deregulated (e.g., mutated or deleted) or epigenetically deregulated. Exemplary tumor suppressors include p53 or Rb.

[0341] "Pair with" or "pairing," as those terms are used herein, refers to the correspondence between a codon and an anticodon, including fully complementary codon:anticodon pairs as well as "wobble" pairing, in which the third position need not be complementary. Fully complementary pairing refers to pairing of all three positions of a codon with the corresponding anticodon according to Watson-Crick base pairing. Wobble pairing refers to complementary pairing of the first and second positions of a codon with the corresponding anticodon and flexible pairing of the third position of a codon with the corresponding anticodon according to Watson-Crick base pairing.

[0342] The terms modified, replaced, derived from, and similar terms, when used or applied in reference to a product, refer only to the final product or the structure of the final product and are not limited to any method of making or producing the product unless expressly provided in this disclosure.

[0343] Headings, titles, sub-titles, numbering or other alphanumeric hierarchy are attached solely for ease of reading and do not, in the absence of express expression to the contrary, dictate any order of performance, importance, magnitude or other value.

[0344] Synonymous SNPs and methods for regulating the tRNA pool Single nucleotide polymorphisms (SNPs) are variations found in the genome. SNPs can occur anywhere in the genome, for example, in coding sequences (e.g., exons), regulatory regions (e.g., introns, promoter elements, enhancers), or non-coding sequences.

[0345] A SNP present in a coding sequence, e.g., an exon, can affect the corresponding polypeptide by altering the codon to specify a different amino acid, e.g., a different amino acid compared to that specified by the non-mutated codon.

[0346] A SNP present in a coding sequence that alters a codon but does not change the amino acid specified by the mutated codon will not change the amino acid incorporated at that position into the corresponding polypeptide. This may be due to the degeneracy of genetic codons (i.e., two or more codons that specify one amino acid). Codon degeneracy is supported by "wobble" base pairing at the first base of the tRNA anticodon. For example, if a wild-type CTT codon that specifies the amino acid leucine is mutated to a CTC codon that specifies the same amino acid leucine, the corresponding protein's composition at that specific position is not expected to change. Both the codons CTT and CTC are recognized by tRNAs that specify the amino acid leucine. These different types of tRNAs are called isoacceptor tRNAs.

[0347] A mutation that changes a codon but does not change the corresponding amino acid specified by the mutated codon is called a synonymous SNP. Synonymous SNPs are also known as silent SNPs.

[0348] Synonymous SNPs found in human populations are associated with certain diseases.Without wishing to be bound by theory, because synonymous SNPs are not expected to change the composition of polypeptide chains, the influence of synonymous SNPs is thought to be associated with codon usage bias.For example, synonymous SNPs may cause reduced protein translation, altered protein folding, altered protein localization, or altered protein function.The relationship between codon usage and tRNA abundance is currently being investigated.

[0349] In some embodiments, the amount of tRNA in cells is correlated with codon usage.In some embodiments, the tRNA that pairs with highly used codons is more abundant than the tRNA that pairs with less frequently used codons.In some embodiments, the tRNA that pairs with less frequently used codons is less abundant than the tRNA that pairs with highly used codons.

[0350] As defined herein, the tRNA pool in a cell is the tRNA pool of all species that can function as tRNAs, for example, endogenous tRNAs and TREMS. The endogenous tRNA pool of a cell or subject to which a TREM has not been administered contains only endogenous tRNAs. The tRNA pool of a cell or subject to which a TREM has been administered contains endogenous tRNAs and TREMs.

[0351] Without wishing to be bound by theory, it is believed that the tRNA pool in a cell or a subject can be altered by administering a composition comprising a TREM to the cell or subject, hi one embodiment, the tRNA pool in a cell or subject to which a composition comprising a TREM has been administered comprises endogenous tRNAs and the administered TREM.

[0352] In some embodiments, a subject or cell with a synonymous SNP has a tRNA pool with a lower abundance of tRNAs that pair with the SNP codon. In some embodiments, administration of a TREM that pairs with the SNP codon to a subject or cell increases the amount of isoaccepting tRNA pool in the subject or cell, e.g., increases the amount of amino acids that specify molecules that can pair with the SNP codon.

[0353] Exemplary synonymous SNPs are provided in Table 1. The column with the heading "Preceding / Subsequent Codons" lists the wild-type and mutant codons for a particular transcript. In some embodiments, a cell or subject described in the methods of treatment, modulating a tRNA pool, or evaluating methods disclosed herein has a SNP provided in Table 1. In some embodiments, a cell or subject described in the methods of treatment, modulating a tRNA pool, or evaluating methods disclosed herein has a disease listed in Table 1. In some embodiments, a cell or subject described in the methods of treatment, modulating a tRNA pool, or evaluating methods disclosed herein has a SNP and the corresponding disease listed in Table 1.

[0354] [Table 1]

[0355] [Table 2]

[0356] [Table 3]

[0357] [Table 4]

[0358] [Table 5]

[0359] [Table 6]

[0360] [Table 7]

[0361] [Table 8]

[0362] [Table 9]

[0363] host cell Host cells are cells (e.g., cultured cells) that can be used for expression and / or purification of TREM. In some embodiments, host cells include mammalian cells or non-mammalian cells. In some embodiments, host cells include mammalian cells, such as human cells or rodent cells. In some embodiments, host cells include HeLa cells, HEK293T cells (e.g., Freestyle 293-F cells), HT-1080 cells, PER.C6 cells, HKB-11 cells, CAP cells, HuH-7 cells, BHK 21 cells, MRC-S cells, MDCK cells, VERO cells, WI-38 cells, or Chinese hamster ovary (CHO) cells. In some embodiments, host cells include cancer cells, such as solid tumor cells (e.g., breast cancer cells (e.g., MCF7 cells), pancreatic cell lines (e.g., MIA PaCa-2 cells), lung cancer cells, prostate cancer cells, or blood cancer cells). In some embodiments, the host cell is a primary cell, e.g., a non-immortalized cell or a cell with finite proliferation capacity. In some embodiments, the host cell is a cell derived from a subject, e.g., a patient.

[0364] In some embodiments, the host cell comprises a non-mammalian cell, such as a bacterial cell, a yeast cell, or an insect cell. In some embodiments, the host cell comprises a bacterial cell, such as an E. coli cell. In some embodiments, the host cell comprises a yeast cell, such as an S. cerevisiae cell. In some embodiments, the host cell comprises an insect cell, such as an Sf9 cell or a Hi5 cell.

[0365] In some embodiments, the host cell comprises a cell that expresses one or more tissue-specific tRNAs. For example, the host cell can comprise a cell derived from a tissue associated with expression of a tRNA, e.g., a tissue-specific tRNA. In some embodiments, the host cell that expresses the tissue-specific tRNA is engineered to express a TREM, or a fragment thereof.

[0366] In certain embodiments, the host cell is one that can be maintained under conditions that allow expression of a TREM.

[0367] In some embodiments, the host cell is capable of post-transcriptionally modifying a TREM, e.g., adding a post-transcriptional modification selected from Table 3. In some embodiments, the host cell expresses (e.g., naturally or heterologously) an enzyme listed in Table 3. In some embodiments, the host cell expresses (e.g., naturally or heterologously) an enzyme, e.g., an enzyme having nuclease activity (e.g., endonuclease activity or ribonuclease activity), such as one or more of Dicer, angiogenin, RNase A, RNase P, RNase Z, Rny1, or PrrC.

[0368] Methods for culturing host cells Host cells can be cultured in a medium that promotes growth, e.g., proliferation or overgrowth, of host cells. Host cells can be cultured in a suitable medium, e.g., any of the following media: DMEM, MEM, MEM alpha, RPMI, F-10 medium, F-12 medium, DMEM / F-12 medium, IMDM, Medium 199, Leibovitz L-15, McCoy's 5A, MDCB medium, or CMRL medium. In some embodiments, the medium is supplemented with glutamine. In some embodiments, the medium is not supplemented with glutamine. In some embodiments, host cells are cultured in a medium with excess nutrients, e.g., not nutrient-limiting.

[0369] Host cells may be cultured in medium containing or supplemented with one or a combination of growth factors, cytokines, or hormones, such as one or a combination of serum (e.g., fetal bovine serum (FBS)), HEPES, fibroblast growth factor (FGF), epidermal growth factor (EGF), insulin-like growth factor (IGF), transforming growth factor beta (TGFb), platelet-derived growth factor (PDGF), hepatocyte growth factor (HGF), or tumor necrosis factor (TNF).

[0370] Host cells, eg, non-mammalian host cells, can be cultured in the following media: Luria broth, YPD medium, or Grace's medium.

[0371] Host cells can also be cultured under conditions that induce stress, e.g., cellular stress, osmotic stress, translational stress, or oncogenic stress. In some embodiments, host cells expressing TREM cultured under conditions that induce stress (e.g., as described herein) result in fragments of TREM, e.g., as described herein.

[0372] Host cells may be cultured in a nutrient-limited medium, e.g., the host cells are cultured in a medium in which the amount of one or more nutrients is limited. Examples of nutrients that can be limiting are amino acids, lipids, carbohydrates, hormones, growth factors, or vitamins. In some embodiments, TREM-expressing host cells cultured in a medium in which the amount of one or more nutrients is limited, e.g., a nutrient-deficient medium, produce fragments of TREM, e.g., as described herein. In some embodiments, TREM-expressing host cells cultured in a medium in which the amount of one or more nutrients is limited, e.g., a nutrient-deficient medium, produce unloaded TREM (e.g., uTREM).

[0373] Host cells can include immortalized cells, e.g., cells that express one or more enzymes involved in immortalization, e.g., TERT. In certain embodiments, host cells can be propagated indefinitely.

[0374] Host cells can be cultured in suspension or as a monolayer. Host cell culture can be carried out in a cell culture vessel or a bioreactor. Cell culture vessels include cell culture dishes, plates, or flasks. Exemplary cell culture vessels include 35 mm, 60 mm, 100 mm, or 150 mm dishes, multi-well plates (e.g., 6-well, 12-well, 24-well, 48-well, or 96-well plates), or T-25, T-75, or T-160 flasks.

[0375] In some embodiments, the host cells may be cultured in a bioreactor. The bioreactor may be, for example, a continuous flow batch bioreactor, a perfusion bioreactor, a batch process bioreactor, or a fed-batch bioreactor. The bioreactor may be maintained under conditions sufficient to express the TREM. Culture conditions may be adjusted to optimize the yield, purity, or structure of the TREM. In some embodiments, the bioreactor may contain at least 1 x 10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , or 1 × 10 14 In one embodiment, the bioreactor contains 1 x 10 host cells. 7 ~1×10 14 1 x 10 host cells 7 ~0.5×10 14 1 x 10 host cells 7 ~1×10 13 1 x 10 host cells 7 ~0.5×10 13 1 x 10 host cells 7 ~1×10 12 1 x 10 host cells 7 ~0.5×10 12 1 x 10 host cells 7 ~1×10 11 1 x 10 host cells 7 ~0.5×10 11 1 x 10 host cells 7 ~1×1010 1 x 10 host cells 7 ~0.5×10 10 1 x 10 host cells 7 ~1×10 9 1 x 10 host cells 7 ~0.5×10 9 1 x 10 host cells 7 ~1×10 8 1 x 10 host cells 7 ~0.5×10 8 0.5 x 10 host cells 8 ~1×10 14 1 x 10 host cells 8 ~1×10 14 0.5 x 10 host cells 9 ~1×10 14 1 x 10 host cells 9 ~1×10 14 0.5 x 10 host cells 10 ~1×10 14 1 x 10 host cells 10 ~1×10 14 0.5 x 10 host cells 11 ~1×10 14 1 x 10 host cells 11 ~1×10 14 0.5 x 10 host cells 12 ~1×10 14 1 x 10 host cells 12 ~1×10 14 0.5 x 10 host cells 13 ~1×10 14 1 x 10 host cells 13 ~1×10 14 host cells; or 0.5 x 10 13 ~1×10 14 The host cell comprises:

[0376] In one embodiment, the bioreactor contains at least 1 x 10 5 Host cells / mL, 2 x 10 5 Host cells / mL, 3 x 10 5 Host cells / mL, 4 x 10 5 Host cells / mL, 5 x 10 5 Host cells / mL, 6 x 105 Host cells / mL, 7 x 10 5 Host cells / mL, 8 x 10 5 Host cells / mL, 9 x 10 5 Host cells / mL, 1 x 10 6 Host cells / mL, 2 x 10 6 Host cells / mL, 3 x 10 6 Host cells / mL, 4 x 10 6 Host cells / mL, 5 x 10 6 Host cells / mL, 6 x 10 6 Host cells / mL, 7 x 10 6 Host cells / mL, 8 x 10 6 Host cells / mL, 9 x 10 6 Host cells / mL, 1 x 10 7 Host cells / mL, 2 x 10 7 Host cells / mL, 3 x 10 7 Host cells / mL, 4 x 10 7 Host cells / mL, 5 x 10 7 Host cells / mL, 6 x 10 7 Host cells / mL, 7 x 10 7 Host cells / mL, 8 x 10 7 Host cells / mL, 9 x 10 7 Host cells / mL, 1 x 10 8 Host cells / mL, 2 x 10 8 Host cells / mL, 3 x 10 8 Host cells / mL, 4 x 10 8 Host cells / mL, 5 x 10 8 Host cells / mL, 6 x 10 8 Host cells / mL, 7 x 10 8 Host cells / mL, 8 x 10 8 Host cells / mL, 9 x 10 8 host cells / mL, or 1 x 10 9 In one embodiment, the bioreactor contains 1 x 10 host cells / mL. 5 Host cells / mL~1×10 9 Host cells / mL, 5 x 10 5 Host cells / mL~1×10 9 Host cells / mL, 1 x 10 6 Host cells / mL~1×10 9 Host cells / mL; 5×10 6 Host cells / mL~1×109 Host cells / mL, 1 x 10 7 Host cells / mL~1×10 9 Host cells / mL, 5 x 10 7 Host cells / mL~1×10 9 Host cells / mL, 1 x 10 8 Host cells / mL~1×10 9 Host cells / mL, 5 x 10 8 Host cells / mL~1×10 9 Host cells / mL, 1 x 10 5 Host cells / mL~5×10 8 Host cells / mL, 1 x 10 5 Host cells / mL~1×10 8 Host cells / mL, 1 x 10 5 Host cells / mL~5×10 7 Host cells / mL, 1 x 10 5 Host cells / mL~1×10 7 Host cells / mL, 1 x 10 5 Host cells / mL~5×10 6 Host cells / mL, 1 x 10 5 Host cells / mL~1×10 6 host cells / mL, or 1 x 10 5 Host cells / mL~5×10 5 containing host cells / mL.

[0377] In one embodiment, the batch process bioreactor comprises a 1×10 6 ~1×10 7 Contains host cells / ml.

[0378] In one embodiment, a batch process bioreactor having a volume of 100 mL contains 1 x 10 8 ~1×10 9 The host cell comprises:

[0379] In one embodiment, a batch process bioreactor having a volume of 100 L contains 1 x 10 11 ~1×10 12 The host cell comprises:

[0380] In one embodiment, the fed-batch bioreactor contains 1 x 107 ~3×10 7 Contains host cells / ml.

[0381] In one embodiment, a fed-batch bioreactor with a volume of 100 mL contains 1 x 10 9 ~3×10 9 The host cell comprises:

[0382] In one embodiment, a fed-batch bioreactor with a volume of 100 L contains 1 x 10 12 ~3×10 12 The host cell comprises:

[0383] In one embodiment, the perfusion bioreactor contains 1×10 8 Contains host cells / ml.

[0384] In one embodiment, a perfusion bioreactor with a volume of 100 mL contains 1 x 10 10 The host cell comprises:

[0385] In one embodiment, a perfusion bioreactor with a volume of 100 L contains 1 x 10 13 The host cell comprises:

[0386] In one embodiment, the bioreactor is maintained under conditions that promote host cell growth, for example, at a temperature (e.g., 37°C) and gas concentration (e.g., 5% CO2) that is permissive for host cell growth.

[0387] For example, in some embodiments, a bioreactor unit can perform one or more, or all of the following: feeding nutrients and / or carbon sources, injecting a suitable gas (e.g., oxygen), inflow and outflow of fermentation or cell culture medium, separating gas and liquid phases, maintaining temperature, maintaining oxygen and CO2 levels, maintaining pH levels, agitation (e.g., stirring), and / or purifying / sterilizing. An exemplary bioreactor unit may contain multiple reactors within the unit, e.g., a unit can have 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more bioreactors in each unit, and / or a facility may contain multiple units with single or multiple reactors within the facility. Any suitable bioreactor diameter may be used.

[0388] In certain embodiments, a bioreactor can have a volume between about 100 mL and about 100 L. Non-limiting examples include volumes of 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, and 100 liters. Furthermore, suitable reactors can be multi-use, single-use, disposable, or non-disposable, and can be formed from any suitable material, including metal alloys such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastic, and / or glass. In some embodiments, suitable reactors can be circular, e.g., cylindrical. In some embodiments, suitable reactors can be square, e.g., rectangular. Square reactors offer advantages over circular reactors in some cases, such as ease of use (e.g., loading and installation by one skilled in the art), better mixing and uniformity of the reactor contents, and smaller bed footprint.

[0389] Methods for modifying host cells Host cells can be modified to optimize production of TREMs, e.g., to have optimized TREM yield, purity, structure (e.g., folding), or stability. In some embodiments, host cells can be modified (e.g., using methods described herein) to increase or decrease expression of genes that optimize production of a desired molecule, e.g., a TREM, e.g., to optimize TREM yield, purity, structure, or stability. In some embodiments, host cells can be epigenetically modified, e.g., using methods described herein, to increase or decrease expression of desired genes that optimize production.

[0390] In certain embodiments, host cells can be modified to increase or decrease expression of an oncogene (e.g., as described herein), a tumor suppressor (e.g., as described herein), or a molecule involved in tRNA or TREM regulation (e.g., a gene involved in tRNA or TREM transcription, processing, regulation, stability, or folding). Exemplary oncogenes include Myc (e.g., c-Myc, N-Myc, or L-Myc), c-Jun, Wnt, or RAS. Exemplary tumor suppressors include p53 or Rb. Exemplary molecules involved in tRNA or TREM regulation include RNA polymerase III (PolIII) and PolIII accessory molecules (e.g., TFIIIB); Maf1, Trm1, Mck1, or Kns1; enzymes involved in tRNA or TREM regulation, e.g., the genes listed in Table 3; or molecules with nuclease activity, e.g., one or more of Dicer, angiogenin, RNaseA, RNaseP, RNaseZ, Rny1, or PrrC.

[0391] In certain embodiments, host cells may be modified by transfection (e.g., transient or stable transfection); transduction (e.g., viral transduction, e.g., lentiviral, adenoviral, or retroviral transduction); electroporation; lipid-based delivery of drugs (e.g., liposomes), nanoparticle-based delivery of drugs; or other methods known in the art.

[0392] In certain embodiments, the host cell can be modified to increase expression, e.g., overexpress, one or more of a desired molecule, e.g., a gene (e.g., an oncogene, or a gene involved in tRNA or TREM regulation (e.g., a gene encoding an enzyme listed in Table 3, or a gene encoding an enzyme with nuclease activity (e.g., endonuclease activity or ribonuclease activity), such as Dicer, angiogenin, RNase A, RNase P, RNase Z, Rny1, or PrrC. Exemplary methods for increasing gene expression include: (a) contacting the host cell with a nucleic acid (e.g., DNA or RNA) encoding the gene; (b) contacting the host cell with a peptide that expresses the target protein; (c) contacting the host cell with a polypeptide that modulates expression of the target gene, e.g., ...; or (d) contacting the host cell with a gene editing moiety (e.g., a zinc finger nuclease (ZFN) or a Cas9 / CRISPR molecule) that inhibits (e.g., mutates or knocks out) expression of a negative regulator of the target gene. In some embodiments, a nucleic acid encoding a gene, or a plasmid containing a nucleic acid encoding a gene, can be introduced into the host cell by transfection or electroporation. In some embodiments, a nucleic acid encoding a gene can be introduced into the host cell by contacting the host cell with a virus (e.g., a lentivirus, adenovirus, or retrovirus) that expresses the gene.

[0393] In some embodiments, host cells can be modified to reduce, e.g., minimize, the expression of a desired molecule, e.g., a gene (e.g., a tumor suppressor, or a gene involved in tRNA or TREM regulation). Exemplary methods for reducing gene expression include: (a) contacting host cells with a nucleic acid (e.g., DNA or RNA) encoding an inhibitor of the gene (e.g., a dominant-negative variant or a negative regulator of the gene or protein encoded by the gene); (b) contacting host cells with a peptide that inhibits the target protein; (c) contacting host cells with a molecule (e.g., a small RNA (e.g., microRNA or small interfering RNA) or a low-molecular-weight compound) that regulates, e.g., inhibits, the expression of the target gene; or (d) contacting host cells with a gene editing moiety (e.g., a zinc finger nuclease (ZFN) or Cas9 / CRISPR molecule) that inhibits (e.g., mutates or knocks out) the expression of the target gene. In some embodiments, a nucleic acid encoding a gene inhibitor, or a plasmid containing a nucleic acid encoding a gene inhibitor, can be introduced into host cells by transfection or electroporation. In certain embodiments, a nucleic acid encoding an inhibitor of a gene can be introduced into a host cell by contacting the host cell with a virus (e.g., a lentivirus, adenovirus, or retrovirus) that expresses the inhibitor of the gene.

[0394] In certain embodiments, a host cell (e.g., a host cell described herein) is modified (e.g., by transfection with a nucleic acid) to express, e.g., overexpress, an oncogene, e.g., an oncogene described herein, e.g., c-Myc.

[0395] In some embodiments, a host cell (e.g., a host cell described herein) is modified (e.g., by transfection with a nucleic acid) to inhibit, e.g., downregulate, expression of a tumor suppressor, e.g., a tumor suppressor described herein, e.g., p53 or Rb.

[0396] In some embodiments, host cells (e.g., HEK293T cells) are modified to inhibit, e.g., knock out, expression of a gene that regulates a tRNA or a TREM, e.g., Maf1 (e.g., using CRISPR / Cas9 molecules). In some embodiments, host cells (e.g., HEK293T cells) are modified to overexpress a gene that regulates a tRNA or a TREM, e.g., Trm1.

[0397] In one embodiment, host cells (e.g., HEK293T cells) are engineered to overexpress a gene that regulates a tRNA or TREM, e.g., Trm1, and to overexpress an oncogene, e.g., an oncogene described herein, e.g., c-Myc.

[0398] TREM "tRNA-based effector molecule" or "TREM" refers to an RNA molecule that comprises one or more of the properties described herein. A TREM may be charged with an amino acid, e.g., a cognate amino acid; may be charged with a non-cognate amino acid (e.g., a mischarged TREM (mTREM)); or may not be charged with an amino acid (e.g., an uncharged TREM (uTREM)).

[0399] In some embodiments, the TREM comprises a deoxyribonucleic acid (DNA) sequence disclosed in Table 2, e.g., a ribonucleic acid (RNA) sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In some embodiments, the TREM comprises an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In one embodiment, the TREM comprises an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in Table 2, e.g., any one of SEQ ID NOs: 1-451 disclosed in Table 2.

[0400] In some embodiments, the TREM comprises at least 30 contiguous nucleotides of an RNA sequence encoded by a DNA sequence disclosed in Table 2, e.g., at least 30 contiguous nucleotides of an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In some embodiments, the TREM comprises at least 30 contiguous nucleotides of an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In one embodiment, the TREM comprises at least 30 contiguous nucleotides of an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in Table 2, e.g., any one of SEQ ID NOs: 1-451 disclosed in Table 2.

[0401] [Table 10]

[0402] Table 11

[0403] Table 12

[0404] Table 13

[0405] Table 14

[0406] Table 15

[0407] Table 16

[0408] Table 17

[0409] Table 18

[0410] Table 19

[0411] Table 20

[0412] Table 21

[0413] Table 22

[0414] Table 23

[0415] Table 24

[0416] Table 25

[0417] Table 26

[0418] Table 27

[0419] Table 28

[0420] Table 29

[0421] Table 30

[0422] [Table 31]

[0423] [Table 32]

[0424] [Table 33]

[0425] [Table 34]

[0426] [Table 35]

[0427] [Table 36]

[0428] [Table 37]

[0429] [Table 38]

[0430] In certain embodiments, the TREM, e.g., exogenous TREM, comprises one, two, three, or four of the following characteristics: (a) differs in at least one nucleotide or one post-transcriptional modification from the closest sequence tRNA in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced; (b) whether it has been introduced into cells other than those in which it was transcribed; (c) it is present in cells other than those in which it naturally occurs; or (d) has an expression profile, eg, level or distribution, that is not wild-type (eg, it is expressed at a higher level than wild-type).

[0431] In certain embodiments, the expression profile can be mediated by changes introduced into nucleic acids that regulate expression or by the addition of agents that regulate expression of RNA molecules.

[0432] In some embodiments, the TREM, eg, exogenous TREM, includes (a), (b), (c), and (d).

[0433] In some embodiments, the TREM, eg, exogenous TREM, comprises (a), (b), and (c).

[0434] In some embodiments, the TREM, eg, exogenous TREM, comprises (a), (b), and (d).

[0435] In some embodiments, the TREM, eg, exogenous TREM, comprises (a), (c), and (d).

[0436] In some embodiments, the TREM, eg, exogenous TREM, includes (b), (c), and (d).

[0437] In some embodiments, the TREM, eg, exogenous TREM, comprises (a) and (d).

[0438] In some embodiments, the TREM, eg, exogenous TREM, comprises (c) and (d).

[0439] TREM fragment In some embodiments, TREMs include fragments (sometimes referred to herein as TREM fragments), e.g., fragments of RNA encoded by deoxyribonucleic acid sequences disclosed in Table 2. For example, TREMs include tRNAs that are less than a complete sequence, e.g., tRNAs that have the same anticodon, an anticodon that is derived from the same species as the subject being treated, or both. In some embodiments, the production of TREM fragments, e.g., derived from full-length TREMs or longer fragments, can be catalyzed by enzymes, e.g., enzymes with nuclease activity (e.g., endonuclease activity or ribonuclease activity), such as Dicer, angiogenin, RNaseP, RNaseZ, Rny1, or PrrC.

[0440] In some embodiments, TREM fragments may be generated in vivo, ex vivo, or in vitro. In some embodiments, TREM fragments are generated in vivo in host cells. In some embodiments, TREM fragments are generated ex vivo. In some embodiments, TREM fragments are generated in vitro, e.g., as described in Example 12. In some embodiments, TREM fragments are generated by fragmenting an expressed TREM after production of the TREM by the cell, e.g., TREM produced by a host cell is fragmented after release or purification from the host cell, e.g., TREM is fragmented ex vivo or in vitro.

[0441] Exemplary TREM fragments include a TREM half (e.g., derived from a cleavage in the ACHD, e.g., a 5' TREM half or a 3' TREM half), a 5' fragment (e.g., derived from a cleavage in the DHD or ACHD, e.g., a fragment including the 5' end), a 3' fragment (e.g., derived from a cleavage in the THD, e.g., a fragment including the 3' end of the TREM), or an internal fragment (e.g., derived from a cleavage in one or more of the ACHD, DHD, or THD).

[0442] In one embodiment, the TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the RNA sequence encoded by a DNA sequence provided in Table 2, for example, any one of SEQ ID NOs: 1 to 451 disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of an RNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of an RNA sequence encoded by a DNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in Table 2, for example, any one of SEQ ID NOs: 1-451 disclosed in Table 2.

[0443] In one embodiment, the TREM fragment comprises at least 5 ribonucleotides (nt), 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, or 60 nt (less than the full length) of a DNA sequence disclosed in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5 ribonucleotides (nt), 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, or 60 nt (less than the full length) of an RNA sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence provided in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5 ribonucleotides (nt), 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt or 60 nt (less than the full length) of an RNA sequence encoded by a DNA sequence having at least 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identity to a DNA sequence provided in Table 2, e.g., any one of SEQ ID NOs: 1-451 disclosed in Table 2.

[0444] In one embodiment, the TREM fragment comprises a sequence of 10 to 90 ribonucleotides (rnt), 10 to 80rnt, 10 to 70rnt, 10 to 60rnt, 10 to 50rnt, 10 to 40rnt, 10 to 30rnt, 10 to 20rnt, 20 to 90rnt, 20 to 80rnt, 20 to 70rnt, 20 to 60rnt, 20 to 50rnt, 20 to 40rnt, 30 to 90rnt, 30 to 80rnt, 30 to 70rnt, 30 to 60rnt, or 30 to 50rnt in length.

[0445] In some embodiments, the TREM fragment comprises a TREM structure, domain, or activity, e.g., as described herein above. In some embodiments, the TREM fragment comprises an adaptor function, e.g., as described herein. In some embodiments, the TREM fragment comprises a cognate adaptor function, e.g., as described herein. In some embodiments, the TREM fragment comprises a non-cognate adaptor function, e.g., as described herein. In some embodiments, the TREM fragment comprises a regulatory function, e.g., as described herein.

[0446] In certain embodiments, the TREM fragment comprises a translation inhibitory function, eg, translocation of an initiation factor, eg, eIF4G.

[0447] In some embodiments, the TREM fragment comprises an epigenetic function, e.g., the epigenetic inheritance of a disorder, e.g., a metabolic disorder. In some embodiments, the epigenetic inheritance function can have a generational impact, e.g., compared to the epigenetic regulation of somatic cells.

[0448] In certain embodiments, the TREM fragment comprises a retroviral regulatory function, eg, regulation of retroviral reverse transcription, eg, HERV regulation.

[0449] In one embodiment, the TREM fragment comprises a gene silencing function, for example, by binding to AGO and / or PIWI.

[0450] In certain embodiments, the TREM fragment comprises a neuroprotective function, eg, by sequestration of translation initiation factors in stress granules, eg, promoting motor neuron survival, eg, under cellular stress.

[0451] In certain embodiments, the TREM fragment comprises an anti-cancer function, for example, by preventing cancer progression through binding and / or sequestering metastatic transcription stabilizing proteins.

[0452] In certain embodiments, the TREM fragment comprises a cell survival function, eg, increasing cell survival by binding to cytochrome c and / or the cyt c ribonucleoprotein complex.

[0453] In certain embodiments, the TREM fragment comprises a ribosome biogenesis function, eg, the TREM fragment can regulate ribosome biogenesis, eg, by binding to, eg, regulating, an mRNA encoding a ribosomal protein.

[0454] TREM modification The TREMs described herein may include moieties often referred to herein as modifications, e.g., moieties described in Table 3. The term modification as used herein should not generally be construed as the product of any particular process, although in embodiments, the formation of the modification may be mediated by an enzyme in Table 3. In embodiments, the modification is formed post-transcriptionally. In embodiments, the modification is formed co-transcriptionally. In certain embodiments, the modification occurs in vivo, e.g., in a host cell.

[0455] In some embodiments, the modification is a modification listed in any of columns 1-62 of Table 3. In some embodiments, the modification is a modification listed in any of columns 1-62 of Table 3, and formation of the modification is mediated by an enzyme in Table 3. In some embodiments, the modification is selected from a column in Table 3, and formation of the modification is mediated by an enzyme from the same column in Table 3.

[0456] [Table 39]

[0457] [Table 40]

[0458] [Table 41]

[0459] [Table 42]

[0460] TREM fusion In some embodiments, the TREMs disclosed herein comprise an additional moiety, such as a fusion moiety. In some embodiments, the fusion moiety may be used to alter the folding of the TREM for purification or may be used as a targeting moiety. In some embodiments, the fusion moiety may comprise a tag, a linker, may be cleavable, or may comprise a binding site for an enzyme. In some embodiments, the fusion moiety may be located at the N-terminus of the TREM or the C-terminus of the TREM. In some embodiments, the fusion moiety may be encoded by the same or different nucleic acid molecule encoding the TREM.

[0461] How to Make a TREM TREMs can be produced according to any method known in the art. For example, TREMs can be produced using synthetic methods, such as solid-phase synthesis or liquid-phase synthesis. In another example, TREMs can be produced using in vitro transcription (IVT) methods. In yet another example, TREMs can be produced by expressing a vector encoding a TREM in a cell.

[0462] In vitro methods for synthesizing oligonucleotides are known in the art and can be used to make the TREMs disclosed herein. For example, a chemical synthesis method for making a TREM is disclosed in Example 27. An example of an in vitro transcription method for making a TREM is disclosed in Example 28.

[0463] Additional methods for making synthetic oligonucleotides via 5'-silyl-2'-orthoester (2'-ACE) chemistry are disclosed in Hartsel SA et al., (2005) Oligonucleotide Synthesis, 033-050, the entire contents of which are hereby incorporated by reference and can be used to make the TREMs disclosed herein.

[0464] Methods for designing and constructing expression vectors and modifying host cells for the production of targets (e.g., TREMs or enzymes disclosed herein) use techniques known in the art. For example, cells are genetically modified to express an exogenous TREM using cultured mammalian cells (e.g., cultured human cells), insect cells, yeast, bacteria, or other cells under the control of an appropriate promoter. Generally, recombinant methods can be used. See, for example, Pharmaceutical Biotechnology: Fundamentals and Applications, Springer (2013); Green and Sambrook (Eds.), Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor Laboratory Press, 2014. See Harbor Laboratory Press (2012). For example, mammalian expression vectors may include non-transcribed elements, such as an origin of replication, a suitable promoter and enhancer, and other 5' or 3' flanking non-transcribed sequences. DNA sequences derived from the SV40 viral genome, such as SV40 origin, early promoter, enhancer, splice, and polyadenylation sites, may be used to provide other genetic elements required for expression of heterologous DNA sequences.

[0465] In certain embodiments, the methods of producing a TREM or a composition comprising a TREM disclosed herein involve the use of a host cell, eg, an engineered host cell, that expresses a TREM.

[0466] The modified host cells are cultured under conditions that allow expression of a TREM. In some embodiments, the culture conditions can be adjusted to increase expression of a TREM. The method of producing a TREM further includes purifying the expressed TREM from the host cell culture to produce a composition comprising a TREM. In some embodiments, the TREM is a TREM fragment, e.g., a fragment of a tRNA encoded by a deoxyribonucleic acid sequence disclosed in Table 2. For example, a TREM includes a less-than-complete tRNA, e.g., a tRNA with the same anticodon, an anticodon derived from the same species as the subject being treated, or both. In some embodiments, the production of a TREM fragment, e.g., derived from a full-length TREM or a longer fragment, can be catalyzed by an enzyme, e.g., an enzyme with nuclease activity (e.g., endonuclease activity or ribonuclease activity), such as RNase A, Dicer, angiogenin, RNase P, RNase Z, Rny1, or PrrC.

[0467] In some embodiments, a method of producing a TREM described herein comprises contacting (e.g., transducing or transfecting) a host cell (e.g., a modified host cell as described herein) with an exogenous nucleic acid, e.g., a DNA or RNA described herein, encoding a TREM under conditions sufficient to express the TREM. In some embodiments, the exogenous nucleic acid comprises an RNA (or a DNA encoding the RNA) that comprises a ribonucleic acid (RNA) sequence of an RNA encoded by a DNA sequence disclosed in Table 2. In some embodiments, the exogenous nucleic acid comprises an RNA sequence (or a DNA encoding an RNA sequence) that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identical to an RNA sequence encoded by a DNA sequence provided in Table 2. In some embodiments, the foreign nucleic acid comprises a deoxyribonucleic acid (RNA) sequence (or DNA encoding an RNA sequence) comprising at least 30 contiguous nucleotides of a ribonucleic acid (RNA) sequence encoded by a DNA sequence disclosed in Table 2. In some embodiments, the foreign nucleic acid comprises an RNA sequence (or DNA encoding an RNA sequence) comprising at least 30 contiguous nucleotides of an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identical to an RNA sequence encoded by a DNA sequence provided in Table 2.

[0468] In one embodiment, host cells are transduced with a virus (eg, a lentivirus, adenovirus, or retrovirus) that expresses a TREM, for example, as described in Example 8.

[0469] The expressed TREM can be purified from the host cell or host cell culture, for example, to produce a composition comprising the TREM as described herein. Purification of the TREM can be performed, for example, by affinity purification as described in the MACS isolation of a particular tRNA molecule protocol, or other methods known in the art. In one embodiment, the TREM is purified by the method described in Example 7.

[0470] In some embodiments, a method for producing a TREM, e.g., a composition comprising a TREM, includes contacting the TREM with a reagent, e.g., a capture reagent comprising a nucleic acid sequence complementary to the TREM. A single capture reagent or multiple capture reagents can be used to produce a TREM, e.g., a composition comprising a TREM. When a single capture reagent is used, the capture reagent can have a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% complementary to the TREM. When multiple capture reagents are used, a composition of TREM with multiple different TREMs can be produced. In some embodiments, the capture reagent can be conjugated to an agent, e.g., biotin.

[0471] In some embodiments, the methods include denaturing the TREM, e.g., prior to hybridization with a capture reagent. In some embodiments, the methods include regenerating the TREM after hybridization and / or release from the capture reagent.

[0472] In some embodiments, a method of making a TREM, e.g., a composition comprising a TREM, includes contacting the TREM with a reagent, e.g., a separation reagent, e.g., a chromatography reagent, which in some embodiments includes a column chromatography reagent, a planar chromatography reagent, a displacement chromatography reagent, a gas chromatography reagent, a liquid chromatography reagent, an affinity chromatography reagent, an ion exchange chromatography reagent, or a size exclusion chromatography reagent.

[0473] In certain embodiments, a TREM generated by any of the methods described herein may (i) be charged with an amino acid, e.g., a cognate amino acid; (ii) be charged with a non-cognate amino acid (e.g., a misloaded TREM (mTREM)); or (iii) be not charged with an amino acid (e.g., an unloaded TREM (uTREM)).

[0474] In some embodiments, the TREM produced by any of the methods described herein is an unloaded TREM (uTREM). In some embodiments, the method of producing a uTREM comprises culturing host cells in a medium having a limited amount of one or more nutrients (e.g., the medium is nutrient-deficient).

[0475] In certain embodiments, a loaded TREM, eg, a TREM loaded with a cognate AA or a non-cognate AA, can be unloaded, eg, by dissociating the AA, eg, by incubating the TREM at elevated temperature.

[0476] Foreign nucleic acid encoding TREM or a TREM fragment In one embodiment, the foreign nucleic acid, e.g., DNA or RNA, encoding a TREM comprises a nucleic acid sequence that includes one or more of the nucleic acid sequences of a DNA sequence disclosed in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 as disclosed in Table 2. In one embodiment, the foreign nucleic acid, e.g., DNA or RNA, encoding a TREM comprises a nucleic acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence disclosed in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 as disclosed in Table 2.

[0477] In one embodiment, the foreign nucleic acid, e.g., DNA or RNA, encoding a TREM comprises the nucleic acid sequence of a DNA sequence disclosed in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 as disclosed in Table 2. In one embodiment, the foreign nucleic acid, e.g., DNA or RNA, encoding a TREM comprises a nucleic acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a DNA sequence disclosed in Table 2, e.g., a plurality of RNA sequences encoded by any one of SEQ ID NOs: 1-451 as disclosed in Table 2. In one embodiment, the exogenous nucleic acid encoding a TREM comprises an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence disclosed in Table 2, e.g., any one of SEQ ID NOs: 1-451 as disclosed in Table 2.

[0478] In one embodiment, the exogenous nucleic acid, e.g., DNA or RNA, encoding a TREM comprises one or more RNA sequences, e.g., fragments of an RNA, encoded by a DNA sequence disclosed in Table 2 as described herein, e.g., a fragment of any one of SEQ ID NOs: 1-451 as disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the nucleic acid sequence of an RNA encoded by a DNA sequence provided in Table 2, e.g., any one of SEQ ID NOs: 1-451 as disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of a nucleic acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to an RNA encoded by a DNA sequence provided in Table 2. In one embodiment, the TREM fragment comprises at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the nucleic acid sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in Table 2, e.g., any one of SEQ ID NOs: 1-451 as disclosed in Table 2.

[0479] In one embodiment, the TREM fragment comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of a DNA sequence disclosed in Table 2, for example, an RNA sequence encoded by any one of SEQ ID NOs: 1 to 451 disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of an RNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to a DNA sequence provided in Table 2, e.g., an RNA sequence encoded by any one of SEQ ID NOs: 1-451 disclosed in Table 2. In one embodiment, the TREM fragment comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of an RNA sequence encoded by a DNA sequence that is at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in Table 2, e.g., any one of SEQ ID NOs: 1-451 as disclosed in Table 2.

[0480] In certain embodiments, the exogenous nucleic acid comprises DNA that, upon transcription, expresses a TREM.

[0481] In certain embodiments, the exogenous nucleic acid comprises RNA that, upon reverse transcription, results in DNA that can be transcribed to provide a TREM.

[0482] In certain embodiments, the exogenous nucleic acid encoding a TREM comprises: (i) a regulatory region sequence; (ii) a sequence encoding a modified TREM; (iii) a sequence encoding two or more TREMs; or (iv) a tRNA Met Contains non-array sequences.

[0483] In some embodiments, the exogenous nucleic acid encoding a TREM comprises a promoter sequence. In some embodiments, the exogenous nucleic acid comprises an RNA polymerase III (Pol III) recognition sequence, e.g., a Pol III binding sequence. In some embodiments, the promoter sequence comprises a U6 promoter sequence or a fragment thereof. In some embodiments, the nucleic acid sequence comprises a promoter sequence containing a mutation, e.g., a promoter-enhancing mutation, e.g., a mutation that increases transcription initiation, e.g., a mutation that increases TFIIIB binding. In some embodiments, the nucleic acid sequence comprises a promoter sequence that recognizes a Pol III (Pol III) recognition sequence, e.g., a Pol III binding sequence. In some embodiments, the promoter sequence comprises a U6 promoter sequence or a fragment thereof. In some embodiments, the nucleic acid sequence comprises a promoter sequence containing a mutation, e.g., a promoter-enhancing mutation, e.g., a mutation that increases transcription initiation, e.g., a mutation that increases TFIIIB binding. III binding and promoter sequences that result in increased tRNA production, e.g., increased TREM production.

[0484] Also disclosed herein are plasmids comprising exogenous nucleic acid encoding a TREM. In some embodiments, the plasmid comprises a promoter sequence, for example, as described herein.

[0485] Compositions containing TREM In some embodiments, a composition comprising TREM, e.g., a pharmaceutical composition comprising TREM, comprises a pharmaceutically acceptable excipient. Exemplary excipients include those provided in the FDA Inactive Ingredients Database (https: / / www.accessdata.fda.gov / scripts / cder / iig / index.Cfm).

[0486] In some embodiments, a composition comprising TREM, e.g., a pharmaceutical composition comprising TREM, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 150 grams of TREM. In some embodiments, a composition comprising TREM, e.g., a pharmaceutical composition comprising TREM, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or 100 milligrams of TREM.

[0487] In certain embodiments, the composition comprising TREM, eg, a pharmaceutical composition comprising TREM, is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 99% by dry weight TREM.

[0488] In one embodiment, a composition comprising a TREM produced by any of the production methods disclosed herein can be loaded with an amino acid using an in vitro loading reaction, as disclosed in Example 12 or as known in the art.

[0489] In one embodiment, the composition comprising TREM comprises at least 1×10 6 TREM molecules, at least 1 x 10 7 TREM molecules, at least 1 x 10 8 TREM molecules or at least 1 x 10 9 Contains TREM molecules.

[0490] TREM purification Compositions containing TREM, such as pharmaceutical compositions containing TREM, can be purified from host cells by nucleotide purification techniques. In one embodiment, a composition containing TREM is purified by affinity purification, such as that described in the MACS isolation of specific tRNA molecules protocol, or the method described in Example 7. In one embodiment, a composition containing TREM is purified by liquid chromatography, such as reversed-phase ion-pair chromatography (IP-RP), ion-exchange chromatography (IE), affinity chromatography (AC), size-exclusion chromatography (SEC), and combinations thereof. See, for example, Baronti et al. Analytical and Bioanalytical Chemistry (2018) 410:3239-3252.

[0491] TREM quality control and production evaluation A TREM or a composition comprising a TREM produced by any of the methods disclosed herein, e.g., a pharmaceutical TREM-containing composition, can be evaluated for characteristics associated with the TREM or TREM preparation, such as purity, host cell protein or DNA content, endotoxin levels, sterility, TREM concentration, TREM structure, or TREM functional activity. Any of the above characteristics can be evaluated by providing a value for the characteristic, e.g., by evaluating or testing the TREM, the composition comprising a TREM, or an intermediate in the production of the TREM-containing composition. The value can also be compared to a standard or reference value. Depending on the evaluation, the TREM-containing composition can be classified, for example, as ready for release, meeting production standards for human clinical trials, complying with ISO standards, complying with cGMP standards, or complying with other pharmaceutical standards. Depending on the evaluation, the TREM-containing composition can be subjected to further processing, e.g., it can be divided into aliquots, e.g., single or multiple doses, placed into containers, e.g., vials for final use, packaged, shipped, or sold commercially. In embodiments, depending on the evaluation, one or more of the characteristics may be adjusted, processed, or reprocessed to optimize the TREM-containing composition. For example, the TREM-containing composition may be adjusted, processed, or reprocessed to (i) increase the purity of the TREM-containing composition; (ii) reduce the amount of HCP in the composition; (iii) reduce the amount of DNA in the composition; (iv) reduce the amount of fragments in the composition; (v) reduce the amount of endotoxin in the composition; (vi) increase the in vitro translation activity of the composition; (vii) increase the TREM concentration in the composition; or (viii) inactivate or remove any viral contaminants present in the composition (e.g., by lowering the pH of the composition or by filtration).

[0492] In certain embodiments, the TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has a purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% by mass.

[0493] In some embodiments, the TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has a host cell protein (HCP) contamination of less than 0.1 ng / ml, 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, or 500 ng / ml.

[0494] In certain embodiments, the TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has a host cell protein (HCP) contamination of less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng, or 500 ng per milligram (mg) of the composition comprising a TREM.

[0495] In some embodiments, the TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has a DNA content, e.g., a host cell DNA content, of less than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, or 500 ng / ml.

[0496] In one embodiment, a TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has less than 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% TREM fragments compared to full-length TREM.

[0497] In some embodiments, the TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has low levels or an absence of endotoxin, as measured, for example, by a Limulus Amebocyte Lysate (LAL) test.

[0498] In certain embodiments, a TREM (eg, a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has in vitro translation activity, for example, as measured by the assay described in Example 15.

[0499] In some embodiments, the TREM (e.g., a composition comprising TREM or an intermediate in the production of a composition comprising TREM) has a TREM concentration of at least 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 0.1 ug / mL, 0.5 ug / mL, 1 ug / mL, 2 ug / mL, 5 ug / mL, 10 ug / mL, 20 ug / mL, 30 ug / mL, 40 ug / mL, 50 ug / mL, 60 ug / mL, 70 ug / mL, 80 ug / mL, 100 ug / mL, 200 ug / mL, 300 ug / mL, 500 ug / mL, 1000 ug / mL, 5000 ug / mL, 10,000 ug / mL, or 100,000 ug / mL.

[0500] In certain embodiments, a TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) is a composition that meets the USP 2000 / 2001 standard, e.g., the composition or preparation supports the growth of less than 100 viable microorganisms when tested under sterile conditions, and the composition or preparation meets the USP 2000 / 2001 standard. <71> and / or the composition or preparation meets the specifications of the U.S.P. <85> It is sterile and meets the standards.

[0501] In some embodiments, the TREM (e.g., a composition comprising a TREM or an intermediate in the production of a composition comprising a TREM) has a lack of viral contaminants or undetectable levels of viral contaminants, e.g., no viral contaminants. In some embodiments, viral contaminants, e.g., any residual viruses, present in the composition are inactivated or removed. In some embodiments, viral contaminants, e.g., any residual viruses, are inactivated, e.g., by lowering the pH of the composition. In some embodiments, viral contaminants, e.g., any residual viruses, are removed, e.g., by filtration or other methods known in the art.

[0502] TREM administration The TREM-containing compositions or pharmaceutical compositions comprising a TREM described herein can be administered to a cell, tissue, or subject, for example, by direct administration to the cell, tissue, and / or organ in vitro, ex vivo, or in vivo. In vivo administration can be, for example, by local, systemic, and / or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, genitourinary, intradermal, transdermal, enteral, intravitreal, intracerebral, intrathecal, or epidural.

[0503] In some embodiments, a composition comprising a TREM or a pharmaceutical composition comprising a TREM disclosed herein is administered to a subject with a condition or disorder disclosed herein. In some embodiments, a composition comprising a TREM or a pharmaceutical composition comprising a TREM disclosed herein is administered to prevent or treat the condition or disorder. In some embodiments, administration of a composition comprising a TREM or a pharmaceutical composition comprising a TREM results in treatment or prevention of the condition or disorder. In some embodiments, administration of a composition comprising a TREM or a pharmaceutical composition comprising a TREM modulates tRNA pools in a subject, for example, resulting in treatment of the condition or disorder. In some embodiments, the disorder is selected from Table 1.

[0504] In some embodiments, a composition comprising a TREM or a pharmaceutical composition comprising a TREM disclosed herein is administered to cells from a subject having a condition or disorder disclosed herein. In some embodiments, administration of a composition comprising a TREM or a pharmaceutical composition comprising a TREM modulates tRNA pools in cells from the subject. In some embodiments, a composition comprising a TREM or a pharmaceutical composition comprising a TREM can be administered to cells in vivo, in vitro, or ex vivo. In some embodiments, the subject has a disorder selected from Table 1.

[0505] In some embodiments, a composition comprising a TREM or a pharmaceutical composition comprising a TREM disclosed herein is administered to the tissue of a subject having a condition or disorder disclosed herein. In some embodiments, a composition comprising a TREM or a pharmaceutical composition comprising a TREM is administered to modulate tRNA pools in the tissue of the subject. In some embodiments, the subject has a disorder selected from Table 1.

[0506] Vectors and Carriers In some embodiments, a TREM, a composition comprising a TREM, or a pharmaceutical composition comprising a TREM described herein is delivered to a cell, e.g., a mammalian cell or a human cell, using a vector. The vector can be, for example, a plasmid or a virus. In some embodiments, delivery is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the virus is an adeno-associated virus (AAV), a lentivirus, or an adenovirus. In some embodiments, the system or components of the system are delivered to a cell in a virus-like particle or virosome. In some embodiments, delivery uses two or more viruses, virus-like particles, or virosomes.

[0507] Carrier The TREMs, compositions comprising a TREM or pharmaceutical compositions comprising a TREM described herein may comprise, be formulated with, or be delivered in a carrier.

[0508] viral vectors The carrier may be a viral vector (e.g., a viral vector comprising a sequence encoding a TREM). The viral vector may be administered to a cell or a subject (e.g., a human subject or an animal model) to deliver the TREM, a composition comprising a TREM, or a pharmaceutical composition comprising a TREM. The viral vector may be administered systemically or locally (e.g., injected).

[0509] Viral genomes provide a rich source of vectors that can be used for the efficient delivery of foreign genes into mammalian cells. Viral genomes are known in the art as useful vectors for delivery because the polynucleotides contained within such genomes are usually integrated into the nuclear genome of mammalian cells by generalized or specific transduction. These processes occur as part of the natural viral replication cycle and do not require additional proteins or reagents to induce gene integration. Examples of viral vectors include negative-strand RNA viruses such as retroviruses (e.g., Retroviridae family viral vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, orthomyxoviruses (e.g., influenza viruses), positive-strand RNA viruses such as rhabdoviruses (e.g., rabies and vesicular stomatitis viruses), paramyxoviruses (e.g., measles and Sendai), picornaviruses, and alphaviruses, as well as double-stranded DNA viruses including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus, replication-deficient herpesviruses), and poxviruses (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include avian leukosis sarcoma, avian C virus, mammalian C, B, and D viruses, oncoretrovirus, HTLV-BLV complex, lentivirus, alpharetrovirus, gammaretrovirus, and spumavirus (Coffin, J.M., Retroviridae: The viruses and their replication, Virology (Third Edition), Lippincott-Raven, Philadelphia, 1996).Other examples include murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon ape leukemia virus, Mason-Pfizer simian virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentivirus. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the teachings of which are incorporated herein by reference. In some embodiments, the system or components of the system are delivered to cells in a virus-like particle or virosome.

[0510] Cellular and Vesicular Carriers The TREMs, compositions comprising TREMs or pharmaceutical compositions comprising TREMs described herein may be administered to cells in vesicles or other membrane-based carriers.

[0511] In embodiments, the TREMs, compositions comprising TREMs, or pharmaceutical compositions comprising TREMs described herein are administered in or via cells, vesicles, or other membrane-based carriers. In one embodiment, the TREMs, compositions comprising TREMs, or pharmaceutical compositions comprising TREMs may be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicular structures composed of a unilamellar or multilamellar lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, can protect their cargo from degradation by plasma enzymes, and can transport cargo across biological membranes and the blood-brain barrier (BBB) ​​(see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679 for a review).

[0512] Vesicles can be made from several different types of lipids; phospholipids are most commonly used to produce liposomes as drug carriers.Methods for preparing multilamellar vesicular lipids are known in the art (for example, see U.S. Patent No. 6,693,086, the teachings of which are incorporated herein by reference for the preparation of multilamellar vesicular lipids).Vesicle formation can occur spontaneously when lipid film is mixed with aqueous solution, but it can also be promoted by applying force in the form of shaking by using a homogenizer, sonicator, or extrusion device (for example, see Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi: 10.1155 / 2011 / 469679 for a review). Extruded lipids can be prepared by extrusion through size-reducing filters as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which regarding the preparation of extruded lipids are incorporated herein by reference.

[0513] Lipid nanoparticles are another example of carriers, providing a biocompatible and biodegradable delivery system for the TREMs, compositions containing TREMs, or pharmaceutical compositions containing TREMs described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the characteristics of SLNs, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can efficiently direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a novel type of carrier that combines liposomes and polymers, can also be used. These nanoparticles possess the complementary advantages of PNPs and liposomes. PLNs are composed of a core-shell structure; the polymer core provides a stable structure, and the phospholipid shell provides good biocompatibility. Thus, the two components increase drug encapsulation efficiency, facilitate surface modification, and prevent leakage of water-soluble drugs. For a review, see, e.g., Li et al. 2017, Nanomaterials 7, 122; doi:10.3390 / nano7060122.

[0514] Exosomes may also be used as drug delivery vehicles for the TREMs or compositions comprising TREMs or pharmaceutical compositions comprising TREMs described herein. et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; see https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0515] Ex vivo differentiated erythrocytes can be used as carriers for the TREMs, compositions comprising TREMs, or pharmaceutical compositions comprising TREMs described herein (see, e.g., WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO 2016183482; WO 2015153102; WO 2018151829; WO 2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; U.S. Pat. No. 9,644,180; Huang et al. 2017. Nature 111(28):10131-10136). Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136.

[0516] For example, fusosome compositions as described in WO2018208728 may also be used as carriers to deliver the TREMs, compositions comprising TREMs or pharmaceutical compositions comprising TREMs described herein.

[0517] Virosomes and virus-like particles (VLPs) can also be used as carriers to deliver the TREMs, compositions comprising TREMs or pharmaceutical compositions comprising TREMs described herein to target cells.

[0518] Plant nanovesicles, such as those described in WO2011097480A1, WO2013070324A1 or WO2017004526A1, can also be used as carriers to deliver the TREMs, compositions comprising TREMs or pharmaceutical compositions comprising TREMs described herein.

[0519] Carrier-free delivery The TREM, TREM-containing composition or TREM-containing pharmaceutical composition described herein can be administered to cells without a carrier, for example, via naked delivery of the TREM, TREM-containing composition or TREM-containing pharmaceutical composition.

[0520] In some embodiments, naked delivery, as used herein, refers to delivery without a carrier. In some embodiments, carrier-free delivery, e.g., naked delivery, includes delivery with a moiety, e.g., a targeting peptide.

[0521] In some embodiments, a TREM, a composition comprising a TREM, or a pharmaceutical composition comprising a TREM described herein is delivered to a cell without a carrier, e.g., via naked delivery. In some embodiments, carrier-free delivery, e.g., naked delivery, includes delivery with a moiety, e.g., a targeting peptide.

[0522] Using TREM A composition comprising a TREM (e.g., a pharmaceutical composition comprising a TREM described herein) can be used, for example, as described herein, to modulate a tRNA pool in a cell or a subject. In embodiments, a composition comprising a TREM described herein (e.g., a pharmaceutical composition comprising a TREM) is contacted with a cell or tissue or administered to a subject in need thereof in an amount and for a time sufficient to modulate (increase or decrease) the tRNA pool. In embodiments, the tRNA pool comprises a first tRNA moiety and an additional tRNA moiety, e.g., a second tRNA moiety. In certain embodiments, the tRNA moiety comprises an endogenous tRNA and / or a TREM.

[0523] In some embodiments, a composition comprising a TREM (e.g., a pharmaceutical composition comprising a TREM described herein) can be used to treat a subject having an endogenous ORF that contains a codon containing a synonymous mutation (synonymous mutation codon or SMC). In some embodiments, the subject has a disorder disclosed in Table 1.

[0524] Compositions comprising a TREM (e.g., pharmaceutical compositions comprising a TREM described herein) can also be used to regulate function in a cell, tissue, or subject. In embodiments, a composition comprising a TREM described herein (e.g., a pharmaceutical composition comprising a TREM) is contacted with a cell or tissue or administered to a subject in need thereof in an amount and for a time sufficient to regulate (increase or decrease) one or more of the following parameters: adaptor function (e.g., cognate or non-cognate adaptor function), such as the rate, efficiency, robustness, and / or specificity of polypeptide chain initiation or elongation, ribosome binding and / or occupancy; regulatory function (e.g., gene silencing or signaling); cell fate; mRNA stability; protein localization; protein folding; protein stability; protein transduction; or protein compartmentalization.

[0525] A parameter may be modulated, for example, by at least 5% (e.g., by at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more) compared to a reference tissue, cell, or subject (e.g., a healthy, wild-type, or control cell, tissue, or subject).

[0526] All references and publications cited herein are hereby incorporated by reference.

[0527] The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the invention; it will be understood by their illustrative nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used. [Example]

[0528] [Table 43]

[0529] [Table 44]

[0530] [Table 45]

[0531] Example 1: Production of TREM in mammalian producer host cells from transient transfection This example describes the production of TREM produced in mammalian host cells that transiently express TREM.

[0532] In this example, to generate a plasmid containing a sequence encoding TREM, iMet-CAT TREM, sequence [ka] A DNA fragment containing one copy of was synthesized and cloned into the pLKO.1-puro-mCherry backbone plasmid with a U6 promoter according to the manufacturer's instructions and standard molecular cloning techniques.

[0533] Transfection 3 μg of the above plasmid was used to transfect a T175 flask of HEK293T cells plated at 80% confluency using 9 μL of Lipofectamine RNAiMax Reagent according to the manufacturer's instructions. Cells were harvested 48 hours post-transfection for purification.

[0534] Purification using a small RNA isolation kit iMet-overexpressing cells were lysed. To generate a small RNA (sRNA) fraction, a small RNA isolation kit, such as the Qiagen miRNeasy kit, was used to separate RNAs smaller than 200 nucleotides from the remainder of the total RNA pool in the lysate according to the manufacturer's instructions. To further eliminate larger RNAs, LiCl precipitation was performed to remove any remaining large RNAs in the sRNA fraction. Finally, the sRNA fraction was loaded onto a G50 column for removal of RNAs smaller than 10 nucleotides and buffer exchange.

[0535] To isolate TREMs from the sRNA fraction, a probe binding method was used. In this example, a biotinylated capture probe corresponding to a DNA probe or 2'-OMe nucleic acid complementary to a unique region of the target TREM being purified, conjugated to biotin at the 5' end with the sequence TAGCAGAGGATGGTTTCGATCCATCA (SEQ ID NO: 455), was used to bind to and purify iMet-CAT-TREMs. The sRNA fraction was incubated with annealing buffer and the biotinylated capture probe at 90°C for 4-5 minutes and then cooled to 25°C at a rate of 0.1°C / s.

[0536] The mixture was then incubated with binding buffer and streptavidin-conjugated RNase-free magnetic beads for 15 minutes to allow binding of the DNA-TREM complexes to the beads. The mixture was then added to a magnetic separator rack and washed two to three times with wash buffer. The TREMs retained on the beads were eluted by adding elution buffer with or without DNase enzyme to ensure complete removal of the DNA capture probes, and subsequently mixed with pharmaceutically acceptable excipients to produce the test TREM products.

[0537] Example 2: Production of TREM in mammalian producer host cells derived from stable cell lines This example describes the production of TREM produced in mammalian host cells stably expressing TREM.

[0538] Preparation of TREM-expressing lentivirus To prepare TREM-expressing lentivirus in 10 mm dishes, packaging cells such as HEK293T cells (293T cells (ATCC® CRL-3216™)) were forward transfected with 9 μg of a plasmid containing a TREM-encoding sequence as described in Example 1 and 9 μg of ViraPower Lentiviral Packaging Mix using TransIT-LT1 transfection reagent according to the manufacturer's instructions.

[0539] After 18 hours, the medium was replaced with fresh antibiotic-free high-FBS (30% FBS) medium, and after 24 hours, the virus-containing medium was collected and stored at 4°C. An additional 15 mL of high-FBS medium was added to the plate and collected after 24 hours. Both virus-containing medium collections were pooled and filtered through a 0.45 micron filter. Viral copy number was assessed using the Lenti-X qRT-PCR Titration Kit according to the manufacturer's protocol.

[0540] Transduction of host cells with TREM-expressing lentivirus To transduce cells with TREM-expressing lentivirus, the lentivirus-containing medium was diluted 1:4 with complete cell culture medium in the presence of 10 μg / mL polybrene and added to the cells. In this example, 293T cells were used. The plate was spun at 1000 x g for 2 hours to spin-infect the cells. After 18 hours, the medium was replaced to allow cells to recover. 48 hours after transduction, puromycin (2 μg / mL) antibiotic selection was performed for 5–7 days along with a population of untransduced control cells.

[0541] TREMs were isolated, purified, and formulated as described in Example 1 to obtain the TREM preparation.

[0542] Purification using phenol-chloroform extraction The total cellular RNA pool was recovered from cells by guanidinium thiocyanate-phenol-chloroform extraction and concentrated by ethanol precipitation as described in J. Sambrook and D. Russell (2001) Molecular Cloning: A Laboratory Manual, vol. 2, Cold Spring Harbor Laboratory Press, New York, NY, USA, 3rd edition 2. The total tRNA pool in the precipitate was then separated from larger nucleic acids (including rRNA and DNA) by precipitation under high lithium salt conditions as described in Cathala, G. et al., DNA, 1983;2(4):329-35. The eluted fraction containing TREM was further purified via probe binding.

[0543] The TREM fraction was incubated with annealing buffer and a DNA probe or biotinylated capture probe corresponding to a unique region of the target TREM being purified. In this example, a probe conjugated to biotin at the 5' end with the sequence TAGCAGAGGATGGTTTCGATCCATCA (SEQ ID NO: 455) was used to purify TREM containing iMet-CAT. The mixture was incubated at 90°C for 4-5 minutes and then cooled to 25°C at a rate of 0.1°C / s.

[0544] The mixture was then incubated with binding buffer and streptavidin-conjugated RNase-free magnetic beads for 15 minutes to allow binding of the DNA-TREM complexes to the beads. The mixture was then added to a magnetic separator rack and washed two to three times. The TREMs retained on the beads were eluted by adding elution buffer with or without DNase enzyme to ensure complete removal of the DNA capture probes, and subsequently mixed with pharmaceutically acceptable excipients to produce the test TREM products.

[0545] Example 3: Production of TREM in mammalian producer host cells derived from stable cell lines - 2 This example describes the production of TREM from crude cell lysates generated from mammalian host cells.

[0546] Generation of stable cells expressing TREM In this example, a plasmid containing a sequence encoding TREM was generated as described in Example 1 or 2. Preparation of TREM-expressing lentivirus and transduction of host cells with the TREM-expressing lentivirus were performed as described in Example 2.

[0547] Purification from crude cell lysate In this example, TREM-overexpressing cells and iMet-CAT-TREM-overexpressing cells were lysed, and the lysed material was incubated with annealing buffer and a DNA probe or biotinylated capture probe corresponding to a 2'-OMe nucleic acid complementary to a unique region of the target TREM being purified. In this example, a probe conjugated to biotin at the 5' end with the sequence TAGCAGAGGATGGTTTCGATCCATCA (SEQ ID NO: 455) was used to purify TREM containing iMet-CAT. The mixture was incubated at 90°C for 4-5 minutes and then cooled to 25°C at a rate of 0.1°C / s.

[0548] The mixture was then incubated with binding buffer and streptavidin-conjugated RNase-free magnetic beads for 15 minutes to allow binding of the DNA-TREM complexes to the beads. The mixture was then added to a magnetic separator rack and washed two to three times. The TREMs retained on the beads were eluted by adding elution buffer with or without DNase enzyme to ensure complete removal of the DNA capture probes, and subsequently mixed with pharmaceutically acceptable excipients to produce the test TREM products.

[0549] Example 4: Delivery of TREM into mammalian cells This example describes the delivery of TREM into mammalian cells.

[0550] To ensure proper folding, TREMs were heated to 85°C for 2 minutes, followed by rapid cooling to 4°C for 5 minutes. To deliver TREMs to mammalian cells, 100 nM of two TREM preparations (Cy3-iMET-1 and Cy3-iMET-2), labeled with Cy3 at different positions, were transfected into U2OS (U-2 OS (ATCC® HTB-96™)), H1299 (NCI-H1299 (ATCC® CRL-5803™)), and HeLa (HeLa (ATCC® CCL-2™)) cells using RNAiMax reagent according to the manufacturer's instructions. After 18 hours, the transfection medium was removed and replaced with fresh complete medium (U2OS: McCoy's 5A, 10% FBS, 1% PenStrep; H1299: RPMI1640, 10% FBS, 1% PenStrep; HeLa: EMEM, 10% FBS, 1% PenStrep).

[0551] To observe TREM delivery to cells, cells were monitored in a live cell analysis system. In this example, cells were monitored using an IncuCyte (Essen Bioscience). Cells were monitored for 4 days (20x, red 550ms).

[0552] Cy3 fluorescent signals were readily detected from cells into which Cy3-labeled TREM had been delivered. Cy3 fluorescent signals were observed from cells into which TREM had been delivered for 48 hours. Detection of Cy3 fluorescence from the cells confirmed delivery of Cy3-labeled TREM to the cells.

[0553] Example 5: Increased cell proliferation in mammalian cells with TREM This example describes the increase in cell proliferation of mammalian cells upon TREM delivery.

[0554] To ensure proper folding, iMet TREM was heated to 85°C for 2 minutes, followed by rapid cooling to 4°C for 5 minutes. To deliver iMet TREM into mammalian cells, 100 nM Cy3-labeled iMet TREM was transfected into U2OS (U-2 OS (ATCC® HTB-96™)), H1299 (NCI-H1299 (ATCC® CRL-5803™)), and HeLa (HeLa (ATCC® CCL-2™)) cells using RNAiMax reagent according to the manufacturer's instructions. As a control, a Cy3-labeled non-targeting control siRNA was delivered to the cells. After 18 hours, the transfection medium was removed and replaced with fresh complete medium (U2OS: McCoy's 5A, 10% FBS, 1% PenStrep; H1299: RPMI 1640, 10% FBS, 1% PenStrep; HeLa: EMEM, 10% FBS, 1% PenStrep). To observe changes in cell proliferation, cells were monitored for 4 days (20x magnification, phase contrast) using a live cell analysis system, in this example, IncuCyte (Essen Bioscience).

[0555] Delivery of iMet TREM to U2OS cells (Figure 4A), H1299 (Figure 4B), or HeLa cells (Figure 4C) resulted in a substantial increase in cell proliferation in all cell lines tested. The increase in cell proliferation was compared to that observed with delivery of a Cy3-labeled non-targeting control (Cy3-NTC). The data demonstrate that delivery of TREM to cells results in increased proliferation and growth.

[0556] Example 6: TREM translation activity assay in human cell extract cell-free protein synthesis (hCFPS) lysate This example describes TREM-mediated increase in translation activity in a cell-free lysate system.

[0557] Preparation of human cell extracts HEK293T cells were grown to approximately 80% confluency in 40 x 150 mm culture dishes. Cells were harvested, washed in PBS, and resuspended 1:1 in ice-cold hypotonic lysis buffer (20 mM HEPES pH 7.6, 10 mM KAc, 1.5 mM MgAc, 5 mM DTT, and 5x complete EDTA-free protease inhibitor cocktail) and incubated on ice for 30 minutes. Cells were lysed using a Dounce homogenizer or by passing the lysate through a 27G needle until >95% cell disruption was achieved. The lysate was centrifuged at 14,000 g for 10 minutes at 4°C, and the supernatant was collected and diluted with hypotonic lysis buffer to obtain a protein solution of approximately 15 mg / ml.

[0558] mRNA transcription The mRNA transcription template was designed to contain a T7 polymerase promoter, the beta-globin 3' UTR, the nanoLuc ORF, and a short artificial 3' UTR. The template was amplified by PCR and used to transcribe capped and polyadenylated mRNA using the HiScribe T7 ARCA mRNA with Tailing Kit (New England Biolabs) according to the manufacturer's recommended protocol.

[0559] TREM translation activity in hCFPS lysate Translation reactions were set up in translation buffer (16 mM HEPES pH 7.6, 2.2 mM MgAc, 60 mM KCl, 0.02 mM complete amino acid mix, 1 mM ATP, 0.5 mM GTP, 20 mM phosphocreatine, 0.1 μg / μL creatine kinase, 0.1 mM spermidine, 2 U / μL RiboLock RNase inhibitor) with 35% HEK293T cell lysate, 0.02 μM capped and polyadenylated nanoLuc mRNA, and 2 μM cell-purified TREM (purified according to Example 2). Reactions were performed in triplicate at 37°C for 30 minutes in 10 μl volumes. One control reaction was performed with the addition of TREM to the reaction, and one control reaction was performed without the addition of mRNA to the reaction. NanoLuc activity was then detected by mixing each reaction with 40 μl of room temperature Nano-Glo Luciferase Assay System (Promega) and reading luminescence in a plate reader.

[0560] As shown in Figure 5, the iMET TREM reaction resulted in an approximately 1.5-fold increase in NanoLuc expression compared to the control reaction (buffer). The data indicate that delivery of TREM results in an increase in nanoLuc mRNA translation, as reflected by an increase in luminescence.

[0561] Example 7: Production of TREM in mammalian producer host cells and their use to regulate cellular function This example describes the production of TREM produced in mammalian host cells.

[0562] Plasmid production In this example, to generate a plasmid containing a TREM encoding tRNA gene, tRNAiMet, genomic location 6p22.2 and sequence [ka] A DNA fragment containing the tRNA gene (chr6.tRNA-iMet(CAT)) is PCR amplified from human genomic DNA using the following primer pair: 5'-TGAGTTGGCAACCTGTGGTA (SEQ ID NO: 452) and 5'-TTGGGTGTCCATGAAAATCA (SEQ ID NO: 453). This fragment is cloned into the pLKO.1puro backbone plasmid with a U6 promoter (or any other RNA polymerase III-recruiting promoter) according to the manufacturer's instructions.

[0563] Transfection Using 1 mg of the above plasmid, 1 x 10 5 Transfect adapted HEK293T cells (Freestyle 293-F cells) in a suspension of 1 L of culture at 1000 cells / mL. Cells are harvested 24, 48, 72, or 96 hours post-transfection to determine the optimal time point for TREM expression as determined by Northern blot or quantitative PCR (q-PCR).

[0564] purification At the optimized harvest cell density, TREMs are purified as previously described in Cayama et al., Nucleic Acids Research. 28(12), e64 (2000). Briefly, short RNAs (e.g., tRNAs) are recovered from cells by phenol extraction and concentrated by ethanol precipitation. Next, total tRNAs in the precipitate are separated from larger nucleic acids (including rRNA and DNA) under high-salt conditions by stepwise isopropanol precipitation. The elution fractions containing TREMs are further purified via probe binding. The TREM fractions are incubated with an annealing buffer and a DNA probe or biotinylated capture probe corresponding to a unique region of the target TREM being purified, or a 2'-OMe nucleic acid. In this example, a probe conjugated to biotin at the 3' end with the sequence UAGCAGAGGAUGGUUUCGAUCCAUCA (SEQ ID NO: 454) is used to purify TREMs containing tRNA-Lys-UUU. The mixture is incubated at 90°C for 2-3 minutes, rapidly cooled to 45°C, and incubated overnight at 45°C. The mixture is then incubated with binding buffer preheated to 45°C and streptavidin-conjugated RNase-free magnetic beads for 3 hours to allow binding of the DNA-tRNA complex to the beads. The mixture is then applied to a pre-equilibrated column in a magnetic separator rack and washed four times. The TREM retained on the beads is eluted three times by adding elution buffer preheated to 80°C, followed by mixing with pharmaceutically acceptable excipients to create the test TREM product.

[0565] use One microgram of the test TREM preparation and a control agent is contacted with a cultured cell line, such as HEP-3B or HEK293T, a tissue, or a subject via transfection, electroporation, or liposome delivery for a time sufficient for the TREM preparation to modulate cellular translation levels or activity compared to the control agent.

[0566] Example 8: Production of TREM in mammalian producer host cells and its use to regulate cellular function This example describes the production of TREM produced in mammalian host cells.

[0567] Plasmid production In this example, to generate a plasmid containing a sequence encoding a TREM containing tRNA gene, [ka] A DNA fragment containing at least one copy of the tRNA with α-Gamma is synthesized and cloned into the pLKO.1 puro backbone plasmid with a U6 promoter (or any other RNA polymerase III-recruiting promoter) according to the manufacturer's instructions and standard molecular cloning techniques.

[0568] Transfection Using 1 mg of the above plasmid, 1 x 10 5 Transfect adapted HEK293T cells (Freestyle 293-F cells) in a suspension of 1 L of culture at 1000 cells / mL. Cells are harvested 24, 48, 72, or 96 hours post-transfection to determine the optimal time point for TREM expression as determined by Northern blot or by quantitative PCR (q-PCR) or nanopore sequencing.

[0569] purification At the optimized harvest time point, cells are lysed and isolation of RNAs smaller than 200 nucleotides from the lysate is performed using a small RNA isolation kit according to the manufacturer's instructions to generate a small RNA (sRNA) fraction.

[0570] To prepare the affinity purification reagent, streptavidin-conjugated RNase-free magnetic beads are incubated for 30 minutes at room temperature with a DNA probe or 200 mM biotinylated oligonucleotide corresponding to a unique region of the target TREM being purified, or a 2'-OMe nucleic acid. In this example, a probe with the sequence 5'biotin-TAGCAGAGGATGGTTTCGATCCATCA (SEQ ID NO: 455) is used to purify TREM (CAT) containing tRNA-iMet. The beads are washed and heated to 75°C for 10 minutes.

[0571] The sRNA fraction is heated to 75°C for 10 minutes and then mixed with the affinity purification reagent described above. The mixture is incubated at room temperature for 3 hours to allow sequence-specific binding of the TREM to the bead-bound DNA probes. The beads are then washed until the absorbance of the wash solution at 260 nm is near zero. Alternatively, the beads are washed three times, and the final wash is examined by UV spectroscopy to determine the amount of nucleic acid present in the final wash. The TREM retained on the beads is eluted three times using RNase-free water, which may be preheated to 80°C, and then mixed with pharmaceutically acceptable excipients to create the test TREM product.

[0572] use One microgram of the test TREM preparation and a control agent is contacted with a cultured cell line, such as HeLa, HEP-3B, or HEK293T, a tissue, or a subject by transfection, electroporation, or liposome delivery for a time sufficient to allow the TREM preparation to modulate cellular translation levels or activity compared to the control agent.

[0573] Example 9: Production of TREM in modified mammalian producer host cells expressing oncogenes This example describes the production of TREM in mammalian host cells engineered to overexpress Myc.

[0574] Plasmid construction and host cell modification To generate the production host cells for this example, HeLa cells (ATCC® CCL-2™) or HEP-3B cells (ATCC® HB-8064™) are transfected with a plasmid (e.g., pcDNA3-cmyc (Addgene plasmid #16011)) containing a gene sequence encoding the c-myc oncogene protein using conventional molecular biology techniques. The resulting cell lines are referred to herein as HeLamyc+ host cells or HEP-3Bmyc+ host cells.

[0575] Preparation of TREM-expressing lentivirus To prepare TREM-expressing lentivirus, HEK293T cells are co-transfected with 3 μg of each packaging vector (pRSV-Rev, pCMV-VSVG-G, and pCgpV) and 9 μg of a plasmid containing TREM as described in Example 7 using Lipofectamine 2000 according to the manufacturer's instructions. After 24 hours, the medium is replaced with fresh antibiotic-free medium, and after 48 hours, the virus-containing supernatant is collected and centrifuged at 2000 rpm for 10 minutes before being filtered through a 0.45 μm filter.

[0576] Transduction of host cells with TREM-expressing lentivirus Two milliliters of virus prepared as described above is used to transduce 100,000 HeLamyc+ or HEP-3Bmyc+ host cells in the presence of 8 μg / mL polybrene. 48 hours after transduction, puromycin (2 μg / mL) antibiotic selection is performed for 2–7 days along with a population of untransduced control cells.

[0577] The TREMs are isolated, purified, and formulated as described in Examples 7 or 8 to obtain a composition comprising a TREM or a preparation comprising a TREM.

[0578] Example 10: Preparation of TREM-producing host cells modified to inhibit repressors of tRNA synthesis This example describes the preparation of Hek293Maf- / TRM1 cells for the generation of TREM.

[0579] Maf1 is a repressor of tRNA synthesis. Maf1 knockout HEK293T cell lines are generated using standard CRISPR / Cas knockout technology (e.g., a CRISPR / Cas system can be designed to reduce or introduce a frameshift mutation in a coding exon of Maf1 to generate a Hek293Maf- cell line with reduced Maf1 expression level and / or activity). This cell line is then transfected with an expression plasmid for modifying the enzyme Trm1 (tRNA(guanine 26-N2)-dimethyltransferase), such as pCMV6-XL4-Trm1, and selected with a selectable marker, e.g., neomycin, to generate a stable cell line overexpressing Trm1 (Hek293Maf- / TRM1 cells).

[0580] Hek293Maf- / TRM1 cells can be used as production host cells for the preparation of TREM as described in any of Examples 7-9.

[0581] Example 11: Production of TREM in engineered mammalian producer host cells overexpressing oncogenes and tRNA-modifying enzymes This example describes the production of TREM in mammalian host cells engineered to overexpress Myc and Trm1.

[0582] Plasmid production In this example, a TREM-containing plasmid is constructed as described in Examples 7 or 8.

[0583] Host cell modification, transduction and purification Human cell lines such as HEK293T that stably overexpress the Myc oncogene are expressed using pBABEpuro-c-myc T58AIt is generated by transduction of a retrovirus expressing the myc oncogene from a plasmid into HEK293T cells. To generate the myc-expressing retrovirus, HEK293T cells were transfected with the human c-myc retroviral vector, pBABEpuro-c-myc. T58A The cells are transfected with the Ψ2 vector and the packaging vector using the calcium phosphate method. After 6 hours, the transfection medium is removed and replaced with fresh medium. After 24 hours of incubation, the medium is collected and filtered through a 0.45 μm filter. For retroviral infection, HEK293T cells are infected with the retrovirus and polybrene (8 μg / ml) using a spin-infection system at 2500 rpm and 18°C ​​for 1 hour. After 24 hours, the cell culture medium is replaced with fresh medium, and after 24 hours, the cells are selected with 2 μg / mL puromycin. Once cells stably overexpressing the oncogene myc are established, they are transfected with a Trm1 plasmid, such as the pCMV6-XL4-Trm1 plasmid, and selected for the selectable marker, in this case neomycin, to generate stable cell lines overexpressing Trm1 in addition to Myc. In parallel, a retrovirus overexpressing TREM is generated as described in Example 9 using HEK293T cells and the PLKO.1-tRNA vector.

[0584] 1 × 10 overexpressing Myc and Trm1 5 Cells are transduced with TREM virus in the presence of 8 μg / mL polybrene. The medium is replaced after 24 hours. 48 hours after transduction, antibiotic selection is performed with 2 μg / mL puromycin for 2-7 days along with a population of untransduced control cells. TREMs are isolated, purified, and formulated using methods as described in Examples 7 or 8 to produce the TREM preparation.

[0585] Example 12: Generation of Misloaded TREM This example describes the generation of a TREM charged with an amino acid that does not correspond to its natural anticodon.

[0586] TREMs are produced as described in any of Examples 7-11. The TREM product is charged with a heterologous amino acid using in vitro charging reactions known in the art (see, e.g., Walker & Fredrick (2008) Methods (San Diego, Calif.) 44(2):81-6). Briefly, purified TREMs, e.g., TREMs containing tRNA-Val(GTG), are placed in a buffer with a heterologous amino acid of interest (e.g., glutamate) and a corresponding aminoacyl-tRNA synthetase (e.g., a valyl-tRNA synthetase mutated to enhance tRNA mischarging) to induce TREM charging. To isolate the aminoacyl-TREMs, the in vitro charging reaction is passed through a spin column and purified using a 2000 ribonucleotide cleavage system. 260 Concentration based on absorbance is determined, as is the degree of aminoacylation using acid gel electrophoresis. Aminoacylated TREMs can also be isolated by binding to His6-tagged EF-Tu (EF-Tu disclosed as SEQ ID NO: 456) followed by affinity chromatography on Ni-NTA agarose, phenol-chloroform extraction, and subsequent nucleic acid precipitation, as described in Rezgui et al., 2013, PNAS 110:12289-12294.

[0587] Example 13: Generation of TREM fragments (in vitro) This example describes the generation of TREM fragments in vitro from TREM produced in mammalian host cells.

[0588] TREMs are produced as described above in any of Examples 7-13. Enzymatic cleavage assays with enzymes known to generate tRNA fragments, such as RNase A or angiogenin, are used to generate fragments for administration to cells, tissues, or subjects.

[0589] Briefly, TREM prepared as described above is incubated in either 0.1 M Hepes / NaOH, pH 7.4, containing RNase A at a final concentration of 10 nM for 10 minutes at 30°C, or in 0.1 M MES, 0.1 M NaCl, pH 6.0, containing an effective amount of angiogenin and BSA for 6 hours at 37°C.

[0590] To isolate the target TREM fragments after enzymatic digestion, a sequence affinity purification procedure is performed as described above.

[0591] Example 14: Production of TREM fragments in a cellular expression system This example describes the production of TREM fragments in a cellular expression system.

[0592] Cell lines stably overexpressing TREM were generated as described in either Examples 7-9 or 11. TREM-overexpressing Hek293T cells were treated with 0.5 μg / ml recombinant angiogenin for 90 minutes, after which total RNA was extracted with Trizol. Size selection of RNA smaller than 200 nucleotides was performed using a small RNA isolation kit according to the manufacturer's instructions. Streptavidin-conjugated RNase-free magnetic beads were incubated with 200 mM biotinylated oligonucleotides corresponding to a unique region of the tRNA half being purified or a DNA probe for 30 minutes at room temperature. The beads were washed and heated at 75°C for 10 minutes. The eluate of the size-selected RNA was also heated at 75°C for 10 minutes and then mixed with the beads. The TREM-bead mixture was incubated at room temperature for 3 hours to allow binding of TREM to the bead-bound DNA probe. The beads were then washed until the wash solution at 260 nm was near zero. Alternatively, the beads are washed three times and the final wash is examined by UV spectroscopy to determine the amount of nucleic acid present in the final wash. TREM retained on the beads is eluted three times using RNase-free water preheated to 80°C or elution buffer preheated to 80°C.

[0593] Example 15: TREM translation activity assay This example describes an assay to assess the ability of TREM to become incorporated into nascent polypeptide chains.

[0594] Translation of the FLAG-AA-His peptide sequence The test TREM is evaluated in an in vitro translation reaction with mRNA encoding the peptide FLAG-XXX-His6x ("His6x" disclosed as SEQ ID NO: 456), where XXX are three consecutive codons corresponding to the test TREM anticodon.

[0595] tRNA-depleted rabbit reticulocyte lysate (Jackson et al. 2001. RNA 7:765-773) is incubated with 10-25 μg / mL of tRNA required for FLAG and His tag translation, plus 10-25 μg / mL of test TREM for 1 hour at 30° C. In this example, the TREM used is tRNA-Ile-GAT, and therefore the peptide used is FLAG-LLL-His6x ("His6x" disclosed as SEQ ID NO: 456), and the following tRNAs are added: tRNA-Asp-GAC, tRNA-Tyr-TAC, tRNA-Lys-AAA, tRNA-Lys-AAAG, tRNA-Asp-GAT, tRNA-His-CAT, plus tRNA-Ile-GAT added to translate the peptide FLAG and HIS tag. To determine whether the test TREM can be functionally incorporated into the nascent peptide, an ELISA capture assay is performed. Briefly, an immobilized anti-His6X antibody ("His6x" disclosed as SEQ ID NO: 456) is used to capture the FLAG-LLL-His6x peptide ("His6x" disclosed as SEQ ID NO: 456) from the reaction mixture. The reaction mixture is then washed away, and the peptide is detected by an anti-FLAG antibody conjugated with an enzyme that reacts with the substrate in an ELISA detection step. If the generated TREM is functional, the FLAG-LLL-His6 peptide ("His6" disclosed as SEQ ID NO: 456) is generated and detected by an ELISA capture assay. The method described in this example can be adapted for use in assessing the functionality of TREM.

[0596] Translational repression assay This assay demonstrates that a test TREM possesses translational adaptor molecule function by rescuing a suppressor mutation and enabling complete protein translation. In this example, a test TREM, tRNA-Ile-GAT, is generated containing the tRNA-Ile-GAT-TREM body sequence but with an anticodon corresponding to CUA instead of GAT. HeLa cells are cotransfected with 50 ng of TREM and 200 ng of a DNA plasmid encoding a mutant GFP containing a UAG stop codon at position S29 as described in Geslain et al. 2010. J Mol Biol. 396:821-831. HeLa cells transfected with the GFP plasmid alone serve as a negative control. After 24 hours, cells are harvested and analyzed for fluorescence recovery by flow cytometry. Fluorescence is read using an emission peak at 509 nm (excitation at 395 nm). The methods described in this example can be adapted for use in assessing the functionality of TREM or whether TREM can rescue stop mutations in the GFP molecule and generate full-length fluorescent proteins.

[0597] In vitro translation assay This assay describes a test tRNA-binding protein (TREM) that has translational adaptor molecule function by successfully incorporating it into a nascent polypeptide chain in an in vitro translation reaction. First, rabbit reticulocyte lysate is prepared that is depleted of endogenous tRNAs using either (i) antisense or complementary oligonucleotides that target the sequence between the anticodon and the variable loop; or (ii) that bind to the region between the anticodon and the variable loop (e.g., Cui). (See, e.g., et al. 2018. Nucleic Acids Res. 46(12):6387-6400). 10-25 μg / mL of test TREM is added to the depleted lysate, in addition to 2 μg / uL of mRNA encoding GFP. Non-depleted lysate with GFP mRNA, with or without the test TREM added, is used as a positive control. Depleted lysate with GFP mRNA but without the test TREM added is used as a negative control. The progress of GFP mRNA translation is monitored by λ ex 485 / λ em The incubation is monitored by an increase in fluorescence on a microplate reader for 3-5 hours at 37 °C using 528. The method described in this example can be adapted for use in assessing whether a test TREM is able to complement the depleted lysate and is therefore likely to be functional.

[0598] Example 16: Assays for modulation of cell state This example describes an assay for detecting the activity of TREMs in regulating cellular conditions, such as cell death.

[0599] TREM fragments were generated as described in Example 13. 1 μM of TREM fragments was transfected into HEK293T cells with Lipofectamine 3000 and incubated for 1 to 6 hours at 1-hour intervals, followed by cell lysis. Cell lysates were analyzed by Western blotting, and blots were probed with antibodies against intact and cleaved caspases 3 and 9 as a readout for apoptosis. To measure cell viability, cells were washed and fixed with 4% paraformaldehyde in PBS for 15 minutes at room temperature. Next, fixed and washed cells were treated with 0.1% Triton X-100 for 10 minutes at room temperature and washed three times with PBS. Finally, cells were treated with the TUNEL assay reaction mixture for 1 hour at 37°C in the dark. Samples were analyzed by flow cytometry.

[0600] Example 17: Assay for the activity of unloaded TREM to regulate autophagy This example describes assays to test unloaded TREM for their ability to modulate, e.g., induce, autophagy, e.g., to activate GCN2-dependent stress response (starvation) pathway signaling, inhibit mTOR, or activate autophagy.

[0601] Test unloaded TREM (uTREM) preparations are delivered into HEK293T or HeLa cells via transfection or liposome delivery. Once uTREM is delivered, a time course ranging from 30 minutes to 6 hours is performed at 1-hour intervals. Cells are then trypsinized, washed, and lysed. The same procedure is performed with a loading control TREM and random RNA oligos as controls. Cell lysates are analyzed by Western blotting, and blots are probed with antibodies against known readouts of GCN2 pathway activation, mTOR pathway inhibition, or autophagy induction, including, but not limited to, phospho-eIF2a, ATF4, phospho-ULK1, phospho-4EBP1, phospho-eIF2a, phospho-Akt, and phospho-p70S6K. Total protein loading controls, such as GAPDH, actin, or tubulin, as well as unmodified (i.e., unphosphorylated) signaling proteins (i.e., eIF2a is used as a control for phospho-eIF2a) are probed as loading controls. The methods described in this Example can be adapted for use to assess activation of the GCN2 starvation signaling pathway, the autophagy pathway, and / or inhibition of the mTOR pathway upon delivery of uTREM.

[0602] Example 18: Assay for activity of mis-stressed TREM (mTREM) This example describes an assay to test the functionality of mTREM produced in a cell line using in vitro misloading after plasmid transfection.

[0603] In this example, mTREM can translate mutant mRNA into wild-type (WT) protein by incorporating the WT amino acid in the protein, despite the mRNA containing the mutated codon. GFP mRNA molecules with either the T203I or E222G mutation, which prevent GFP excitation at wavelengths of 470 nm and 390 nm, respectively, are used for this example. GFP mutants that prevent GFP fluorescence can also be used as reporter proteins in this assay. Briefly, an in vitro translation assay is used using rabbit reticulocyte lysate containing GFP E222G mutant mRNA (GAG → GGG mutation) and excess mTREM, in this case tRNA-Glu-CCC. As a negative control, no mischarged TREM is added to the reaction. The method described in this example can be adapted for use in assessing the functionality of mTREM.

[0604] Example 19: Identification of disease-associated SMCs that may be ameliorated by TREM modulation This example describes the selection of SMC-containing protein targets for TREM-based therapy. SMCs can be understood as silent mutations that alter the codon sequence to a synonymous codon but may affect translational or post-translational properties. The selection method was segmented into three progressive selection steps: (1) identification of SMCs, (2) examination of tRNA frequency, and (3) annotation of disease associations. These steps are described in further detail below.

[0605] Identification of SMCs A curated, comprehensive list of all known SNPs was used as the starting point for SMC selection. In this example, the dbSNP NCBI mutation database (https: / / www.ncbi.nlm.nih.gov / and FTP site ftp: / / ftp.ncbi.nih.gov / snp / organisms / ) was filtered to select for SMCs, also known as synonymous SNPs (i.e., single nucleotide changes in coding sequences that do not result in an amino acid change). Briefly, the mutant sequences were aligned to the human genome (here, GRCh38p7), and the SNPs were classified into variants and mutation types, such as non-coding or coding variants and synonymous or non-synonymous mutations. Those classified as coding variants with synonymous mutations were designated as SMCs and proceeded to the next selection step.

[0606] tRNA frequency testing For each SMC, tRNAs corresponding to each wild-type codon and mutant codon (SMC) were identified. The abundance of tRNAs for each wild-type codon and mutant codon (SMC) was determined from tRNA sequencing data. In this example, we utilized tRNA-seq data previously determined from HEK293T cells (Zheng et al., Nature Methods 12, 835-837 (2015)). SNPs with large differences in tRNA abundance, e.g., >10-fold changes, were preferentially selected for subsequent selection.

[0607] Determining disease association The SNP IDs were mapped to a group of known disease-associated SNPs to determine which SNPs had disease correlations. In this example, we utilized GWAS (Genome Wide Associated Studies) (https: / / www.ebi.ac.uk / gwas / ) or similar resources to determine which SNPs had known disease correlations. Those with treatment-relevant disease correlations (e.g., association with tumorigenicity or neurological disorders) were carried forward to the next step.

[0608] Final Choice The filtered list of SMCs contains (1) SMCs that do not modify the amino acid coding sequence; (2) SMCs with differences, e.g., large differences, in tRNA populations; and (3) SMCs with disease associations in the coding region. In this example, the final selection is based on the disease of interest, e.g., pancreatic cancer. For example, the BCAR1 gene is known to be associated with pancreatic cancer and contains a SNP (rs7190458) that causes a change from codon CUC to CUU. This coding sequence change results in a corresponding change in the incorporated TREM. In some embodiments, the incorporated mutant TREM has, for example, an approximately 100-fold decrease in abundance, making it a potential target for upregulation and / or amelioration of the disease phenotype.

[0609] Example 20: PNPL3A SMC The method of Example 19 was used to identify an SMC in the PNPL3A gene. The PNPL3A gene has the rs738408 polymorphism, which has been identified as a predisposing factor for nonalcoholic fatty liver disease, fibrosis, and elevated serum alanine transaminase in humans. The rs738408 polymorphism is an SMC located in the ORF and changes the codon from CCC to CCU. Both the CCC and CCU codons encode a proline amino acid, resulting in a polypeptide sequence identical to the wild-type PNPL3A ORF at that position in the chain. This polypeptide chain is the adiponutrin protein.

[0610] Example 21: TERT SMC The method of Example 19 was used to identify an SMC in the TERT gene. The TERT gene has the rs2736098 polymorphism, which has been identified as a susceptibility factor for pancreatic cancer and non-small cell lung cancer in humans. The rs2736098 polymorphism is an SMC located in the ORF and changes the codon from GCG to GCA. Both GCG and GCA codons encode the amino acid alanine, resulting in a polypeptide sequence identical to the wild-type TERT ORF at that position in the chain. This polypeptide chain is the telomerase reverse transcriptase protein.

[0611] Example 22: ACHE SMC The method of Example 19 was used to identify an SMC in the ACHE gene. The ACHE gene has the rs7636 polymorphism, which has been identified as a susceptibility factor for type 2 diabetes in Asian populations. The rs7636 polymorphism is an SMC located in the ORF and changes the codon from CCC to CCT. Both the CCC and CCT codons encode the amino acid proline, resulting in a polypeptide sequence identical to the wild-type ACHE ORF at that position in the chain. This polypeptide chain is the acetylcholinesterase (AChE) protein, the primary enzyme responsible for the hydrolytic metabolism of the neurotransmitter acetylcholine (ACh) to choline and acetate.

[0612] Example 23: CFTR SMC The method of Example 19 was used to identify an SMC in the CFTR gene. The CFTR gene has the rs1042077 polymorphism, which is present in patients with CFTR-related disorders. The rs1042077 polymorphism is an SMC located in the ORF and changes the codon from ACT to ACG. Both the ACT and ACG codons encode a threonine amino acid, resulting in a polypeptide sequence identical to the wild-type CFTR ORF at that position in the chain. This polypeptide chain is the cystic fibrosis transmembrane conductance regulator (CFTR).

[0613] Example 24: MAP3K1 SMC The method of Example 19 was used to identify an SMC in the MAP3K1 gene. The MAP3K1 gene has the rs2229882 polymorphism, which has been identified as a susceptibility factor for early-onset breast cancer. The rs2229882 polymorphism is an SMC located in the ORF and changes the codon from ACC to ACT. Both the ACC and ACT codons encode the amino acid threonine, resulting in a polypeptide sequence identical to the wild-type MAP3K1 ORF at that position in the chain. This polypeptide chain is mitogen-activated protein kinase kinase kinase 1 (MAP3K1), a serine / threonine kinase that regulates the ERK and JNK MAPK pathways as well as the transcription factor NF-κB pathway.

[0614] Example 25: Generation of candidate TREMs complementary to SMCs via mammalian cell purification This example describes the production of TREM in mammalian host cells.

[0615] Plasmid production To generate a plasmid containing a TREM containing a tRNA gene, in this example tRNA-Ser-AGA, the sequence [ka] A DNA fragment containing at least one copy of the tRNA gene with the nucleotide sequence 'A' is synthesized and cloned into the pLKO.1puro backbone plasmid with a U6 promoter (or any other RNA polymerase III-recruiting promoter) according to the manufacturer's instructions and standard molecular cloning techniques.

[0616] Transfection 1 mg of the above plasmid is used to transfect adapted HEK293T cells (Freestyle 293-F cells) in a suspension of 1 x 10 cells / mL in 1 L of culture. Cells are harvested 24, 48, 72, or 96 hours after transfection to determine the optimal time point for TREM expression as determined by quantitative methods such as Northern blot, quantitative PCR (q-PCR), and nanopore sequencing.

[0617] purification At the optimized collection time point, lyse the cells and purify total RNA using a method such as phenol-chloroform. Using the manufacturer's instructions / small RNA isolation kit, isolate RNAs smaller than 200 nucleotides from the lysate to create a small RNA (sRNA) fraction.

[0618] TREMs containing tRNA-Ser-AGA are purified by incubating the sRNA fraction with annealing buffer and a biotinylated capture probe corresponding to a DNA probe complementary to a unique region of the target TREM to be purified. In this example, the probe has the sequence 3'biotin-CCAATGGATTTCTATCCATCGCCTTAACCACTCGGCCACGACTACAAAA (SEQ ID NO: 457). The mixture is incubated at 90°C for 2-3 minutes, rapidly cooled to 45°C, and incubated overnight at 45°C. The mixture is then incubated with binding buffer and streptavidin-conjugated RNase-free magnetic beads preheated to 45°C for 3 hours to allow the DNA-tRNA complex to bind to the beads. The mixture is then loaded onto a pre-equilibrated column in a magnetic separator rack and washed four times. The TREMs retained on the beads are eluted three times by adding elution buffer preheated to 80°C and then mixed with pharmaceutically acceptable excipients to generate the test TREM product.

[0619] Example 26: Generation of candidate TREMs complementary to SMCs via bacterial cell purification This example describes the production of TREM in bacterial host cells.

[0620] Plasmid production In this example, the sequence [ka] A DNA fragment containing at least one copy of the tRNA-Lys-UUU gene with the following sequence is synthesized and cloned into a bacterial tRNA expression vector as previously described in Ponchon et al., Nat Protoc 4, 947-959 (2009).

[0621] Transformation 1 × 10 grown from competent bacteria transformed with the TREM expression plasmid 9Bacteria are harvested at various cell density points, in this example OD(600)=0.5, OD(600)=0.7, and OD(600)=0.9, to determine the optimal point for TREM expression as determined by quantitative methods such as Northern blot, quantitative PCR (q-PCR), and nanopore sequencing.

[0622] purification At the optimized harvest cell density point, TREMs are purified as previously described in Cayama et al., Nucleic Acids Research. 28(12), e64 (2000). Briefly, short RNAs (e.g., tRNAs) are recovered from cells by phenol extraction and concentrated by ethanol precipitation. Next, total tRNAs in the precipitate are separated from larger nucleic acids (including rRNA and DNA) by stepwise isopropanol precipitation under high salt conditions. The elution fraction containing TREMs is further purified via probe binding. TREMs containing tRNA-Lys-UUU are purified by incubating the TREM fraction with annealing buffer and a biotinylated capture probe corresponding to a DNA probe complementary to a unique region of the target TREM to be purified. In this example, the probe has the sequence CAGAUUAAAAGUCUG (SEQ ID NO: 458) conjugated to biotin at the 3' end. The mixture is incubated at 90°C for 2-3 minutes, rapidly cooled to 45°C, and incubated at 45°C overnight. The mixture is then incubated with binding buffer preheated to 45°C and streptavidin-conjugated RNase-free magnetic beads for 3 hours to allow the DNA-tRNA complexes to bind to the beads. The mixture is then loaded onto a pre-equilibrated column in a magnetic separator rack and washed four times. The TREMs retained on the beads are eluted three times by adding elution buffer preheated to 80°C and then mixed with pharmaceutically acceptable excipients to form the test TREM product.

[0623] Example 27: Generation of candidate TREMs complementary to SMCs via chemical synthesis This example describes the production of TREM using chemical synthesis.

[0624] array [ka] A TREM, in this example tRNA-Thr-CGT, is chemically synthesized using the nucleotide sequence shown in Figure 1. This TREM is generated by solid-phase chemical synthesis using phosphoramidite chemistry, as previously described, for example, in Zlatev et al. (2012) Current Protocols, 50(1), 1.28.1-1.28.16. Briefly, protected RNA phosphoramidites are sequentially added in the desired order to a growing chain immobilized on a solid support (e.g., controlled pore glass). Each cycle of addition involves multiple steps, including (i) deblocking the DMT group protecting the 5'-hydroxyl of the growing chain, (ii) coupling the growing chain to the incoming phosphoramidite building block, (iii) capping all chain molecules still featuring a 5'-hydroxyl, i.e., those that failed to couple to the desired incoming building block, and (iv) oxidation of the newly formed tricoordinate phosphite triester linkage. After coupling and oxidation of the final building block, the chain is cleaved from the solid support and all protecting groups are removed except for the DMT group protecting the 5'-hydroxyl. The chain is then purified by RP-HPLC (e.g., DMT-on purification), and the chain-containing fraction is subjected to deprotection of the DMT group under acidic conditions to yield the final TREM. The TREM will be characterized by a 5'-phosphate and a 3'-OH. The TREM is then mixed with a pharmaceutically acceptable excipient to produce the test TREM product.

[0625] If a TREM needs to be loaded, the TREM produced by chemical synthesis is aminoacylated in vitro using an aminoacyl-tRNA synthetase, as previously described by Stanley, Methods Enzymol 29:530-547 (1974). Briefly, the TREM is incubated with its synthetase and its cognate amino acid, in this example with threonyl-tRNA synthetase and threonine, respectively, at 37°C for 30 min, followed by phenol extraction, filtration using a Nuc-trap column, and ethanol precipitation. The TREM is then mixed with a pharmaceutically acceptable excipient to produce the test TREM product.

[0626] Example 28: Generation of candidate TREMs complementary to SMCs via in vitro transcription This example describes the generation of TREM using in vitro transcription (IVT).

[0627] TREM, in this example tRNA-Leu-CAA, has the sequence [ka] The TREMs are generated using in vitro transcription by . Briefly, a DNA plasmid containing a bacteriophage T7 promoter followed by a tRNA-Leu-CAA gene sequence is linearized and in vitro transcribed with T7 RNA polymerase at 37°C for 45 minutes, followed by phenol extraction, filtration using a Nuc-trap column, and ethanol precipitation. The TREMs are then mixed with pharmaceutically acceptable excipients to generate the test TREM products.

[0628] If TREM need to be loaded, the TREM produced by the IVT reaction is aminoacylated in vitro using an aminoacyl-tRNA synthetase, as previously described by Stanley, Methods Enzymol 29:530-547 (1974). Briefly, the TREM is incubated with its synthetase and its cognate amino acid, in this example with leucyl-tRNA synthetase and leucine, respectively, at 37°C for 30 min, followed by phenol extraction, filtration using a Nuc-trap column, and ethanol precipitation. The TREM is then mixed with pharmaceutically acceptable excipients to generate the test TREM product.

[0629] Example 29: Regulation of tRNA pools via administration of TREM to cells This example describes the administration of a TREM to a cell to modulate the tRNA pool in the cell.

[0630] TREMs produced as in Examples 25-28 are delivered to cells via electroporation as previously described in Nature Methods 3, 67-68 (2006). Briefly, 10-10 cells, in this example human epithelial MCF10A cells, are placed in an electroporation cuvette and 1-30 μg of TREMs, in this example the sequence [ka] After addition of tRNA-Thr-CGT, mix gently. Transfer the cuvette to an electroporator and discharge the device (a voltage of 200–350 V is used). Place the cuvette on ice and transfer the electroporated cells to a culture dish with complete medium and transfer to an incubator for 24–48 h.

[0631] After delivery, changes in the tRNA pool can be quantified by methods such as nanopore sequencing, tRNA sequencing, Northern blotting, and quantitative RT-PCR. In this example, changes in the tRNA pool are monitored using Oxford Nanopore direct RNA sequencing, as previously described in Sadaoka et al., Nature Communications (2019) 10, 754.

[0632] Briefly, lyse TREM-transfected cells and purify total RNA using a method such as phenol-chloroform. Using the manufacturer's instructions / small RNA isolation kit, isolate RNAs less than 200 nucleotides from the lysate to create a small RNA (sRNA) fraction.

[0633] The sRNA fraction is deacylated with 100 mM Tris-HCl (pH 9.0) for 30 min at 37° C. An equal volume of 100 mM Na-acetate / acetic acid (pH 4.8) and 100 mM The solution is neutralized by adding NaCl, followed by ethanol precipitation. The deacylated sRNA is dissolved in water and its integrity is verified by agarose gel electrophoresis. The deacylated sRNA is then polyadenylated using a yeast poly(A) tailing kit according to the manufacturer's instructions to create a polyadenylated sRNA pool. After polyadenylation, a reverse transcription reaction is performed to generate cDNA using SuperScript III reverse transcriptase (Thermo Fisher Scientific) or a thermostable group II intron RT (TGIRT, InGex LLC), which is insensitive to RNA structure and modifications. Sequencing adapters are ligated to the cDNA mixture by incubating the cDNA mixture with RNA adapters, T4 ligase, and ligation buffer according to Oxford Nanopore's standard protocol. Nanopore sequencing is then performed on the library, and the sequences are mapped to a genomic database, in this example, the GtRNAdb genomic tRNA database. The methods described in this example can be adapted for use in assessing tRNA pools in cells in which TREM has been administered compared to those in which TREM has not been administered.

[0634] Example 30: Regulation of tRNA pools through TREM administration to cells using liposomes This example describes the administration of TREM to cells using liposomal vesicles to modulate tRNA pools in cells.

[0635] TREMs produced as in Examples 25-28 are delivered to cells in vesicles or other lipid-based carriers, such as liposomes or lipid nanoparticles. In this example, TREMs, in this example, sequences, are delivered to cells using a liposome kit (from Sigma or other vendors) according to the manufacturer's instructions. [ka] Liposomes containing tRNAThr-CGT are prepared. In this example, the human cell line HEK293T is used. Cells are seeded to achieve 70-80% confluency on the day of transfection. 30 minutes before transfection, the medium is replaced with serum-free medium, and then liposomes are added to the cell culture medium.

[0636] After delivery, changes in the tRNA pool can be quantified by methods such as nanopore sequencing, tRNA sequencing (Zheng et al., Nature Methods 12, 835-837 (2015)), Northern blotting, and quantitative RT-PCR. In this example, tRNA sequencing is used to monitor changes in the tRNA pool. Briefly, TREM-transfected cells are lysed and total RNA is purified using methods such as phenol-chloroform. RNAs smaller than 200 nucleotides are isolated from the lysate using the manufacturer's instructions / small RNA isolation kit to create a small RNA (sRNA) fraction.

[0637] m located on the Watson-Crick surface 1 A, m 1 G and m 3 To remove C modifications, the sRNA fraction is treated with a demethylase mixture. Following demethylation of the tRNA pool, a cDNA library is generated from the tRNA using a thermostable group II intron RT (TGIRT), which is not affected by tRNA structure. This reverse transcriptase adds RNA sequencing adapters to the tRNA by template switching, without the need for RNA ligation. Illumina sequencing is then performed on the tRNA-generated library, and the sequences are mapped to a genomic database, in this example, the GtRNAdb genomic tRNA database. The method described in this example can be adapted for use in assessing tRNA pools in cells treated with TREM compared to those not treated with TREM.

[0638] Example 31: Regulation of tRNA pools via delivery of TREM-encoding plasmids into cells This example describes the delivery of a TREM-encoding plasmid into a cell to modulate the tRNA pool in the cell.

[0639] TREMs are expressed in cells via delivery of a TREM-encoding plasmid using a vesicle-based carrier. To express TREMs in human cells, a tRNA gene, in this example the sequence [ka] A plasmid containing tRNA-Gly-GCC with the sequence: (I) is generated using seamless assembly of DNA fragments, in this example using the NEBuilder HiFi Assembly Master Mix. In this example, a linearized mammalian expression vector of interest, in this example pLKO.1-puro-turboGFP linearized by PpuMI enzyme restriction, is fused to a DNA fragment containing a tRNA gene. In this example, the DNA fragment contains the following elements, in 5' to 3' order: a 25-nucleotide sequence from the 3' end of the vector linearization site, a U6 promoter, a tRNA sequence, an RNA polymerase III termination signal, and a 25-nucleotide sequence from the 5' end of the vector linearization site.

[0640] After constructing the plasmid, a human cell line, in this example HEK293T, is transfected with the TREM-encoding plasmid using Lipofactamine 3000 according to the manufacturer's instructions. After delivery, changes in the tRNA pool can be quantified using methods such as nanopore sequencing, tRNA sequencing (Zheng et al., Nature Methods 12, 835-837 (2015)), Northern blotting, and quantitative RT-PCR. In this example, tRNA sequencing is used to monitor changes in the tRNA pool. Briefly, TREM-transfected cells are lysed, and total RNA is purified using methods such as phenol-chloroform. RNAs smaller than 200 nucleotides are isolated from the lysate using the manufacturer's instructions / small RNA isolation kit to generate a small RNA (sRNA) fraction.

[0641] m located on the Watson-Crick surface 1 A, m 1 G and m 3 To remove C modifications, the sRNA fraction is treated with a demethylase mixture. Following demethylation of the tRNA pool, a cDNA library is generated from the tRNA using a thermostable group II intron RT (TGIRT), which is not affected by tRNA structure. This reverse transcriptase adds RNA sequencing adapters to the tRNA by template switching, without the need for RNA ligation. Illumina sequencing is then performed on the tRNA-generated library, and the sequences are mapped to a genomic database, in this example, the GtRNAdb genomic tRNA database. The method described in this example can be adapted for use in assessing tRNA pools in cells treated with TREM compared to those not treated with TREM.

[0642] Example 32: Regulation of tRNA pools via delivery of TREM-encoding viral vectors into cells This example describes the delivery of a TREM-encoding viral vector into a cell to modulate the tRNA pool in the cell.

[0643] TREM is expressed in cells via delivery of a TREM-encoding viral vector. In this example, a lentiviral packaging and delivery system encoding TREM is used. Briefly, TREM, in this example, is expressed using the sequence [ka] A TREM-encoding viral vector was constructed by first creating a plasmid containing tRNA-Gly-GCC with the sequence 'Gly'. Plasmids are generated using seamless assembly of DNA fragments. In this case, the pLKO.1-puro-turboGFP linearized vector was ligated to a DNA fragment containing the tRNA sequence, as described in Example 31. To prepare TREM-expressing lentivirus, HEK293T cells were co-transfected with 3 μg of each packaging vector (pRSV-Rev, pCMV-VSVG-G, and pCgpV) and 9 μg of a TREM-containing plasmid using Lipofectamine 3000 according to the manufacturer's instructions. After 24 hours, the medium was replaced with fresh antibiotic-free medium. After 48 hours, the virus-containing supernatant was collected, centrifuged at 2000 rpm for 10 minutes, and then filtered through a 0.45 μm filter.

[0644] Next, the cells of interest are infected with the virus. In this example, 100,000 HeLa cells are transduced with 2 mL of prepared virus in the presence of 8 μg / mL polybrene. 48 hours after transduction, cells are selected with puromycin (2 μg / mL) antibiotics for 2-7 days along with a population of untransduced control cells to select for cells that have integrated TREM into their genome for expression.

[0645] Changes in the tRNA pool can be quantified by methods such as nanopore sequencing, tRNA sequencing (Zheng et al., Nature Methods 12, 835-837 (2015)), Northern blotting, and quantitative RT-PCR. In this example, quantitative RT-PCR (Korniy et al., Nucleic Acids Research (2019), gkz202) is used to monitor changes in the tRNA pool. Briefly, TREM-transfected cells are lysed and total RNA is purified using methods such as phenol-chloroform. RNAs smaller than 200 nucleotides are isolated from the lysate using the manufacturer's instructions / small RNA isolation kit to create a small RNA (sRNA) fraction.

[0646] m located on the Watson-Crick surface 1 A, m 1 G and m 3 To remove the C modification, the sRNA fraction is treated with a demethylase mixture. Following demethylation, the pool is reverse transcribed into cDNA using a stem-loop adapter complementary to the 3' end of the tRNA of interest. This step involves reverse transcription (RT) using the Superscript III First-Strand Synthesis System (ThermoFisher Scientific). Quantitative PCR is then performed using the QuantiTect SYBR Green Kit (Qiagen) according to the manufacturer's protocol, with a forward primer complementary to the region of the cDNA encoded by the tRNA of interest and a universal primer complementary to the stem-loop adapter added during RT. The method described in this example can be adapted for use in assessing the levels of glycine-specific molecules capable of pairing with the CGT codon in cells treated with TREM compared to those not treated with TREM.

[0647] Example 33: System for testing the effect of TREM administration on SMC-containing ORFs This example describes a system, in this example a cell line, expressing an SMC-containing ORF to test the effects of TREM administration.

[0648] To test the effect of TREM administration on the rs2229882 polymorphism in an SMC-containing ORF (in this example, the MAP3K1 gene), an established cell line (in this example, human breast epithelial cells, e.g., MCF10A or 184A1 cells) was genome-edited using CRISPR-Cas to knock out the expression of an endogenous gene of interest (in this example, the MAP3K1 gene). MAP3K1 knockout cells were generated using the CRISPR-Cas9 system to insert a 1-bp fragment into the coding exon of MAP3K1, resulting in a frameshift mutation, as previously described (e.g., Bauer et al., J. Vis. Exp., (95), doi:10.3791 / 52118(2015)). Briefly, online design tools predicting the most effective guide RNAs for genome editing, such as https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design, are used to select high-scoring guide RNAs (gRNAs) containing 20-base pair (bp) target sequences that minimize genome matches to reduce the risk of off-target site cleavage. In this example, the targeting sequence is CAGTGTGTGAAGACGGCTGC (SEQ ID NO: 461). The targeting sequence is cloned into the pSpCas9(BB) plasmid (pX330) (Addgene plasmid ID 42230). HEK293T cells are transiently transfected with a CRISPR / Cas9 construct targeting MAP3K1 and a puromycin expression construct for clonal selection. The following day, cells are selected with puromycin for two days and subcloned to form single colonies. MAP3K1 KO clones are identified by PCR screening. The resulting clones are validated by qPCR and immunoblot using an antibody against MAP3K1.

[0649] Once generated, the cell lines are used to overexpress WT or SMC-containing mRNAs via transient plasmid transfection or stable lentiviral transduction. The TREM of interest is then administered to each cell line, and its effect on the SMC-containing ORF compared to the WT ORF is assessed using assays such as those described in Examples 19-24.

[0650] Example 34: Determining that administration of TREM affects protein expression levels of SMC-containing ORFs This example describes the administration of TREM to alter the expression levels of SMC-containing ORFs.

[0651] To generate a system for testing the effect of TREM administration on the protein expression levels of SMC-containing proteins, in this example, derived from the PNPL3A gene encoding adiponutrin, a plasmid containing the PNPL3A rs738408 ORF sequence was transfected into the normal human hepatocyte cell line THLE-3, which was then edited by CRISPR / Cas to contain a frameshift mutation in the coding exon of PNPLA3, knocking out endogenous PNPLA3 (THLE-3_PNPLA3KO cells). As a control, an aliquot of THLE-3_PNPLA3KO cells was transfected with a plasmid containing the wild-type PNPL3A ORF sequence.

[0652] TREM is delivered to THLE-3_PNPLA3KO cells containing the rs738408 ORF sequence, as well as to THLE-3_PNPLA3KO cells containing the wild-type PNPL3A ORF sequence. In this example, the TREM contains a proline isoacceptor containing an AGG anticodon paired with a CCT codon. That is, the sequence [ka] The time course is performed ranging from 30 minutes to 6 hours, with interval time points spanning 1 hour. At each time point, cells are trypsinized, washed, and lysed. Cell lysates are analyzed by Western blotting, and blots are probed with antibodies against adiponutrin protein. Total protein loading controls, such as GAPDH, actin, and tubulin, are also probed as loading controls.

[0653] The methods described in this example can be adapted for use in assessing the expression levels of adiponutrin protein in cells containing the rs738408 ORF.

[0654] Example 35: TREM administration alters protein translation rates of SMC-containing ORFs This example describes the administration of TREM to alter the rate of protein translation of an SMC-containing ORF.

[0655] To monitor the effect of TREM addition on translation elongation rate, an in vitro translation system, in this example the RRL system manufactured by Promega, is used. In this case, the fluorescence time course of a reporter gene, in this example GFP, is a surrogate for translation rate. First, rabbit reticulocyte lysate is prepared in which endogenous tRNAs are depleted using an antisense oligonucleotide targeting the sequence between the anticodon and the variable loop (see, e.g., Cui et al. 2018. Nucleic Acids Res. 46(12):6387-6400). In this example, a nucleotide sequence containing an alanine isoacceptor containing a UGC anticodon paired with a GCA codon, i.e., the sequence [ka] TREM, having a nucleotide sequence similar to that shown in Table 1, is added to in vitro translation assay lysates at 0.1-0.5 μg / μL in addition to mRNA encoding the wild-type TERT ORF fused to the GFP ORF by a linker or mRNA encoding the rs2736098 TERT ORF fused to the GFP ORF by a linker. The progress of GFP mRNA translation is monitored by fluorescence increase on a microplate reader at 37°C, with data points collected every 30 seconds over a 1-hour period using λex485 / λem528. The fluorescence change is plotted over time to determine the rate of translation elongation of the wild-type ORF compared to the rs2736098 ORF with and without TREM addition. The method described in this example can be adapted for use in assessing the translation rates of the rs2736098 ORF and the wild-type ORF in the presence or absence of TREM.

[0656] Example 36: Determining whether modulation of TREMs complementary to SMC alters the function of proteins derived from SMC-containing ORFs This example describes the administration of TREM to alter the function of an SMC-containing ORF.

[0657] An in vitro translation (IVT) system (e.g., the RRL system from Promega) is used to translate wild-type and SMC-containing mRNA in the presence and absence of TREM. In this example, the SMC-containing gene is AChE, which encodes the acetylcholinesterase protein, and the TREM contains a proline isoacceptor containing an AGG anticodon paired with a CCU codon. [ka] It has.

[0658] To determine whether the addition of TREM alters the functional activity of an SMC-containing protein, in this example, an acetylcholinesterase protein, a functional assay using DTNB to quantify the thiocholine produced from the hydrolysis of acetylthiocholine by AChE is used. Briefly, the translation reaction is incubated with the kit's AChE reaction mixture for 10-30 minutes at room temperature, after which the absorbance of the DTNB adduct at OD 410 nm, which is proportional to AChE activity, is used to measure the amount of thiocholine formed. The method described in this example can be adapted for use in assessing the AChE activity of proteins obtained from the translation of rs7636 AChE mRNA or wild-type AChE mRNA.

[0659] Example 37: Determining that modulation of TREM complementary to SMC alters the localization of proteins derived from SMC-containing ORFs This example describes the administration of TREM to alter the localization of an SMC-containing ORF.

[0660] To generate a system to test the effect of TREM administration on the protein localization of SMC-containing ORFs, a plasmid containing the CFTR rs1042077 ORF sequence tagged with a reporter such as GFP or myc was transfected into the human lung epithelial cell line MRC-5. As a control, a plasmid containing the reporter-tagged wild-type CFTR ORF sequence was also transfected into MRC-5 cells in parallel.

[0661] To determine whether TREM addition alters CFTR localization, cells are seeded onto coverslips and, 24 hours later, transfected with a TREM complementary to the CFTR SMC or a control TREM. In this example, the TREM complementary to the CFTR SMC contains a threonine isoacceptor containing a CGU anticodon paired with an ACG codon. That is, the sequence [ka] The control TREM consisted of either a scrambled sequence or an altered threonine sequence at the 5' end of the TREM to prevent loading. After 24 hours, cells were fixed, stained for CFTR and its reporter, and visualized under a microscope. The method described in this example can be adapted for use in assessing the localization of wild-type CFTR and rs1042077 CFTR.

[0662] Example 38: Determining that modulation of TREM complementary to SMC alters the folding of proteins translated from SMC-containing ORFs This example describes the administration of TREM to alter the folding of an SMC-containing ORF.

[0663] Plasmid preparation and transfection To identify SMCs that cause protein misfolding, an SMC-ORF-containing protein, in this example the rs7190458 BCAR1 ORF, is synthesized and cloned into a plasmid containing a CMV promoter (or any other mammalian promoter) and a purification tag, in this example the FLAG tag (DYKDDDDK epitope (SEQ ID NO: 466)), according to the manufacturer's instructions and standard molecular cloning techniques. Here, the pFLAG-CMV-1 plasmid is used. The plasmid is transfected into a human HeLa cell line. In this example, a plasmid containing a leucine isoacceptor containing a UUG anticodon, base paired with the CUU codon, i.e., the sequence [ka] TREM, carrying the SMC BCAR1 ORF, is also transfected into HeLa cells. As a control, BCAR1 KO cells are transfected with the SMC BCAR1 ORF-containing plasmid alone and with a plasmid containing the wild-type BCAR1 ORF sequence individually.

[0664] purification At the optimized harvest time point, in this example 72 hours post-transfection, cells are lysed and centrifuged at 12,000 x g for 10 minutes. The supernatant is loaded onto a pre-packed and equilibrated anti-Flag-Pak M2 agarose column under gravity flow. The column is washed with 10-20 column volumes of TBS (TrisHCl, NaCl) or a salt-containing buffer. To elute the FLAG-tagged protein from the beads, the beads are incubated with the FLAG tag peptide. The eluate is run on an SDS-PAGE gel for purity quality control. This purification is performed on cells transfected with WT BCAR1 ORF and SMC BCAR1 ORF in the presence and absence of TREM.

[0665] Initial testing of protein folding To examine the effects of protein folding, thermal melting is used to monitor the stability of purified proteins derived from WT and SMC-containing ORFs. In this example, differential scanning fluorometry (DSF) is used, which measures changes in binding of an intercalator dye to unfolded proteins using a fluorescent dye (Sypro Orange). Alterations in protein folding result in variations in the thermal melting curves. This method is used to compare SMC ORF-derived proteins with and without TREM addition to control wild-type BCAR1. The method described in this example can be adapted for use in assessing the thermal melting curves of proteins derived from SMC-containing ORFs.

[0666] Example 39: Determining that modulation of TREMs complementary to SMC alters cellular phenotypes resulting from translation of SMC-containing ORFs This example describes the administration of TREM to alter the cell phenotype of SMC-containing ORFs.

[0667] To generate a system to test the effect of TREM administration on a cellular process, in this example, cell migration, the human pancreatic cancer cell line PANC-1, in which BCAR1 was knocked out using CRISPR / Cas, was transfected with a plasmid containing an SMC-containing ORF, in this example, the rs7190458 BCAR1 ORF sequence. As a control, PANC-1 BCAR1 KO cells were transfected with a plasmid containing the WT BCAR1 ORF sequence.

[0668] In this example, the leucine isoacceptor contains a UUG anticodon that pairs with the CUU codon, i.e., the sequence [ka] TREM containing the following is delivered to PANC-1 cells. Delivery of a control TREM containing either a scrambled sequence or an altered leucine sequence at the 5' end of the TREM to prevent loading is used as a control. Cells are grown in a monolayer to 80% confluence and scratched across the center of the well with a new 1 ml pipette tip. Cells are rinsed twice to remove floating cells and the medium is replenished. After 48 hours, cells are fixed and stained with crystal violet. The stained monolayer is photographed and the gap distance is quantified. The method described in this example can be adapted for use in assessing the migration phenotype of cells administered with TREM.

[0669] Example 40: Modulation of TREM to ameliorate disease states resulting from translation of SMC-containing ORFs This example describes increasing TREM levels to ameliorate disease conditions resulting from SMC-containing ORFs.

[0670] To generate a system to test the effect of TREM administration on a disease state, in this example, breast cancer development, a human non-transformed breast cell line, MCF10A, in which BCAR1 has been knocked out using CRISPR / Cas, is transfected with a plasmid containing an SMC-containing ORF, in this example, the rs2229882 MAP3K1 ORF sequence. As a control, MCF10A MAP3K1 KO cells are transfected with a plasmid containing the wild-type MAP3K1 ORF sequence.

[0671] In this example, the threonine isoacceptor contains an AGU anticodon that pairs with the ACU codon, i.e., the sequence [ka] TREM containing the following is delivered into MCF10A cells. Delivery of control TREM containing either a scrambled sequence or an altered threonine sequence at the 5' end of TREM to prevent loading is used as a control. Cells are monitored for increased MAPK signaling by Western blotting using antibodies against the phosphorylation status of ERK and JNK kinases. Total protein loading controls, such as GAPDH, actin, or tubulin, as well as unmodified (i.e., unphosphorylated) signaling proteins (i.e., ERK is used as a control for phospho-ERK) are probed as loading controls. Cells are also monitored for cell proliferation and invasion using standard proliferation and transwell invasion assays. To monitor breast cancer progression, cells are injected subcutaneously or into the mammary fat pad of SCID mice, and tumor volume is monitored daily using calipers to measure the length, width, and height of the tumor. The methods described in this example can be adapted for use in assessing tumor phenotype. The present invention provides, for example, the following items. (Item 1) 1. A method for modulating a tRNA pool in a cell containing an endogenous open reading frame (ORF) that includes a codon having a first sequence, the method comprising: optionally, obtaining knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the cell, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence; contacting the cell with a composition comprising a TREM in an amount and for a time sufficient to modulate the relative amounts of the first tRNA moiety and the second tRNA moiety in the cell, wherein the TREM is a codon that encodes either (a) a codon having the first sequence or (b) a codon that encodes ... contacting a nucleic acid sequence having an anticodon that pairs with a codon other than the codon that pairs with the nucleic acid sequence; thereby regulating the tRNA pool in the cell. A method comprising: (Item 2) 1. A method for modulating a tRNA pool in a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, the method comprising: optionally, obtaining knowledge about the abundance of one or both of (i) and (ii) in said subject, e.g., obtaining knowledge about the relative amounts of (i) and (ii) in said subject, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of said ORF having said first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having said first sequence in said subject; contacting the subject with a composition comprising a TREM in an amount and for a time sufficient to modulate the relative amounts of the first tRNA moiety and the second tRNA moiety in the subject, the TREM having an anticodon that pairs with either (a) a codon having the first sequence or (b) a codon other than the codon having the first sequence; thereby regulating the tRNA pool in said subject; A method comprising: (Item 3) 1. A method for assessing a tRNA pool in a cell having an endogenous ORF (which ORF includes a codon having a first sequence), the method comprising obtaining, e.g., directly or indirectly, knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the cell, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence in the cell, thereby assessing the tRNA pool in the cell. (Item 4) A method for assessing a tRNA pool in a subject having an endogenous ORF that includes a codon having a first sequence, the method comprising obtaining, e.g., directly or indirectly, knowledge about the abundance of one or both of (i) and (ii), e.g., obtaining knowledge about the relative amounts of (i) and (ii) in the subject, wherein (i) is a tRNA moiety (first tRNA moiety) having an anticodon that pairs with a codon of the ORF having the first sequence, and (ii) is an isoacceptor tRNA moiety (second tRNA moiety) having an anticodon that pairs with a codon other than the codon having the first sequence in the cell, thereby assessing the tRNA pool in the subject. (Item 5) 5. The method of any one of items 1 to 4, comprising obtaining knowledge about (i). (Item 6) 5. The method of any one of items 1 to 4, comprising obtaining knowledge about (ii). (Item 7) 5. The method of any one of items 1 to 4, comprising obtaining knowledge about (i) and (ii). (Item 8) Obtaining knowledge about (i) can provide a value for the abundance, e.g., relative abundance, of (i). 8. The method according to any one of items 1 to 5 or 7, comprising obtaining (Item 9) 8. The method of any one of items 1 to 4 or 6 to 7, wherein obtaining knowledge about (ii) comprises obtaining a value for the abundance, e.g., relative abundance, of (ii). (Item 10) 10. The method of claim 8 or 9, wherein the method comprises contacting the cell or subject with a composition comprising a TREM in an amount and for a time sufficient to adjust the relative amounts of the first tRNA portion and the second tRNA portion in response to the value, wherein the TREM has an anticodon that pairs with (a) a codon having the first sequence or (b) a codon other than the codon having the first sequence. (Item 11) The method according to any one of items 1 to 2 or 5 to 10, wherein the composition comprising TREM is a pharmaceutical composition comprising TREM or a GMP-grade composition comprising TREM. (Item 12) 12. The method according to any one of items 1 to 2 or 5 to 11, wherein the TREM does not contain an anticodon paired with a stop codon. (Item 13) 1. A method for modulating a tRNA pool in a subject or cell that contains an endogenous open reading frame (ORF) that includes a codon containing a synonymous mutation (synonymous mutation codon or SMC), the method comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety comprising an anticodon sequence that pairs with the SMC (the TREM); contacting the subject with a composition comprising said TREM, or in the case of a cell, contacting said cell with a TREM from said TREM-comprising composition, in an amount and / or for a time sufficient to modulate the tRNA pool in said subject or in said cell; thereby regulating the tRNA pool in said subject or in said cell. A method comprising: (Item 14) 14. The method of claim 13, wherein prior to contact with the composition comprising a TREM, the subject or cell comprises a first tRNA portion having an anticodon that pairs with the SMC (the first tRNA portion) and a second tRNA portion having an anticodon that pairs with a codon other than the SMC (the second tRNA portion). (Item 15) 1. A method of treating a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with a codon of an ORF having the first sequence or an anticodon that pairs with a codon other than the codon having the first sequence; contacting the subject with a composition comprising the TREM in an amount and / or for a time sufficient to treat the subject; thereby treating said subject. A method comprising: (Item 16) 1. A method of treating a subject having an endogenous ORF that includes a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: providing a composition comprising a TREM, wherein the TREM comprises an isoacceptor tRNA moiety having an anticodon that pairs with the SMC (the TREM); contacting the subject with the composition comprising a TREM in an amount and for a time sufficient to treat the subject; thereby treating said subject. A method comprising: (Item 17) 1. A method of treating a subject having an endogenous ORF that includes a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: (i) obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject, and identifying the subject as having SMC; and (ii) in response to said value, administering to said subject a composition comprising a TREM, said TREM comprising an isoacceptor tRNA moiety having an anticodon that pairs with said SMC; thereby treating said subject. A method comprising: (Item 18) 1. A method of treating a subject having an endogenous ORF that includes a codon having a first sequence, comprising: (i) obtaining, e.g., directly or indirectly, a value for the status of a codon having the first sequence in the subject, the value comprising a measure of the presence or absence of a codon having the first sequence in a sample from the subject, and identifying the subject as having a codon having the first sequence; and (ii) in response to said value, administering to said subject a composition comprising a TREM, said TREM comprising an isoacceptor tRNA moiety having an anticodon that pairs with a codon having said first sequence; thereby treating said subject. A method comprising: (Item 19) 1. A method for evaluating a subject having an endogenous open reading frame (ORF) that includes a codon having a first sequence, comprising: obtaining, e.g., directly or indirectly, a value for the status of a codon having the first sequence in the subject, the value comprising a measure of the presence or absence of a codon having the first sequence in a sample from the subject; and identifying the subject as having a codon having the first sequence; and evaluating said subject thereby. A method comprising: (Item 20) 1. A method for evaluating a subject having an endogenous ORF containing a codon containing a synonymous mutation (synonymous mutation codon or SMC), comprising: obtaining, e.g., directly or indirectly, a value for the subject's SMC status, the value comprising a measure of the presence or absence of SMC in a sample from the subject; and identifying the subject as having SMC; and evaluating said subject thereby. A method comprising: (Item 21) 21. The method of any one of items 2 to 20, wherein the subject has or is identified as having a disorder or condition selected from Table 1. (Item 22) 21. The method of any one of items 1 or 3 to 20, wherein the cell is associated with a disorder or condition selected from Table 1. (Item 23) 23. The method of any one of items 1 to 22, wherein (a) the ORF codon having the first sequence or (b) the SMC is associated with a phenotype, e.g., an undesirable phenotype, e.g., a disorder or condition, e.g., a disorder or condition selected from Table 1, in the absence of contact with a composition comprising a TREM. (Item 24) 24. The method according to any one of items 21 to 23, wherein the disorder or condition is selected from the group of diseases provided in Table 1, such as cardiovascular, dermatological, endocrine, immunological, neurological, oncological, ophthalmological or respiratory. (Item 25) 24. The method of any one of items 21 to 23, wherein the disorder is cardiac hypertrophy. (Item 26) 24. The method according to any one of items 21 to 23, wherein the disorder is coronary artery disease. (Item 27) 24. The method of any one of items 21 to 23, wherein the disorder is hypertension. (Item 28) 24. The method according to any one of items 21 to 23, wherein the disorder or condition is an obesity-related trait. (Item 29) 24. The method according to any one of items 21 to 23, wherein the disorder is type 1 diabetes. (Item 30) 24. The method according to any one of items 21 to 23, wherein the disorder is type 2 diabetes. (Item 31) 24. The method according to any one of items 21 to 23, wherein the disorder is psoriasis. (Item 32) 24. The method of any one of items 21 to 23, wherein the disorder is endometriosis. (Item 33) 24. The method according to any one of items 21 to 23, wherein the disorder is a chronic inflammatory disease, such as ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis or pleiotropy. (Item 34) 24. The method according to any one of items 21 to 23, wherein the disorder is Crohn's disease. (Item 35) 24. The method of any one of items 21 to 23, wherein the disorder is Graves' disease. (Item 36) 24. The method of any one of items 21 to 23, wherein the disorder is Alzheimer's disease, such as age-onset Alzheimer's disease or familial Alzheimer's disease. (Item 37) 24. The method of any one of items 21 to 23, wherein the disorder is major depressive disorder. (Item 38) 24. The method according to any one of items 21 to 23, wherein the disorder is migraine. (Item 39) 24. The method according to any one of items 21 to 23, wherein the disorder is Parkinson's disease. (Item 40) 24. The method of any one of items 21 to 23, wherein the disorder is schizophrenia. (Item 41) 24. The method of any one of items 21 to 23, wherein the disorder or condition is an adverse reaction to chemotherapy, such as neutropenia or leukopenia. (Item 42) 24. The method according to any one of items 21 to 23, wherein the disorder is breast cancer, for example early-onset breast cancer. How to post. (Item 43) 24. The method of any one of items 21 to 23, wherein the disorder is ovarian cancer. (Item 44) 24. The method of any one of items 21 to 23, wherein the disorder is colorectal cancer. (Item 45) 24. The method according to any one of items 21 to 23, wherein the disorder is carboplatin abscission in epithelial ovarian cancer. (Item 46) 24. The method of any one of items 21 to 23, wherein the disorder is Clostridium difficile infection in multiple myeloma. (Item 47) 24. The method according to any one of items 21 to 23, wherein the disorder is endometrial cancer, for example due to endometrioid histology. (Item 48) 24. The method of any one of items 21 to 23, wherein the disorder is esophageal squamous cell carcinoma. (Item 49) 24. The method of any one of items 21 to 23, wherein the disorder is glioblastoma. (Item 50) 24. The method of any one of items 21 to 23, wherein the disorder is lung cancer. (Item 51) 24. The method according to any one of items 21 to 23, wherein the disorder or symptom is macrophage migration inhibitory factor levels. (Item 52) 24. The method according to any one of items 21 to 23, wherein the disorder is oral cancer and pharyngeal cancer. (Item 53) 24. The method of any one of items 21 to 23, wherein the disorder is pancreatic cancer. (Item 54) 24. The method according to any one of items 21 to 23, wherein the disorder is myopia. (Item 55) 24. The method according to any one of items 21 to 23, wherein the disorder is COPD. (Item 56) 24. The method of any one of items 21 to 23, wherein the disorder is asthma. (Item 57) 57. The method of any one of items 1 to 56, wherein the ORF codon having the first sequence or the SMC is located in a transcript provided in Table 1. (Item 58) 58. The method of any one of items 1 to 57, wherein the ORF codon or the SMC having the first sequence comprises a codon provided in Table 1, such as a codon listed in the "Previous / Next Codon" column of Table 1, such as a second codon listed in said column of Table 1. (Item 59) 59. The method of any one of items 1 to 58, wherein the first tRNA portion comprises an endogenous tRNA and a TREM. (Item 60) 60. The method of any one of items 1 to 59, wherein the second tRNA portion comprises an endogenous tRNA and a TREM. (Item 61) The compositions comprising a TREM can be produced by the methods described herein, for example, by synthetic methods (e.g., synthesized using solid-phase synthesis or liquid-phase synthesis), by using in vitro transcription (IVT), or by expressing a vector encoding a TREM in a cell. The method according to any one of items 1 to 2 or 10 to 60, wherein the (Item 62) 62. The method of any one of items 1 to 61, wherein the ORF or the SMC-containing ORF encodes a polypeptide. (Item 63) 63. The method of any one of items 1 to 62, wherein the ORF or the SMC-containing ORF is a chromosomal ORF or a mitochondrial ORF. (Item 64) 64. The method of any one of items 1 to 2 or 10 to 63, wherein the composition comprising TREM is a pharmaceutical composition comprising TREM. (Item 65) 65. The method of any one of items 1-2 or 10-64, wherein the composition comprising a TREM comprises a pharmaceutical excipient. (Item 66) 66. The method of any one of items 1-2 or 10-65, wherein the composition comprising a TREM is administered via a delivery agent, such as a liposome, a polymer (e.g., a polymer conjugate), a particle, a microsphere, a microparticle, or a nanoparticle. (Item 67) 66. The method of any one of items 1-2 or 10-65, wherein the composition comprising a TREM is administered without a carrier, e.g., via naked delivery of a TREM. (Item 68) 68. The method of any one of paragraphs 1-2 or 10-67, wherein the TREM comprises a cognate adaptor function, and optionally the TREM mediates acceptance and incorporation of an amino acid naturally associated with the anticodon of the TREM in the initiation or elongation of a peptide chain. (Item 69) 69. The method of any one of items 1-2 or 10-68, wherein the TREM comprises an RNA sequence that is at least 80% identical to an RNA encoded by a DNA sequence listed in Table 2, or a fragment or functional fragment thereof. (Item 70) 70. The method of any one of items 1-2 or 10-69, wherein the TREM comprises an RNA sequence encoded by a DNA sequence listed in Table 2, or a fragment thereof. (Item 71) 71. The method of any one of items 1-2 or 10-70, wherein the TREM comprises an RNA sequence or fragment thereof that is at least XX% identical to an RNA sequence encoded by a DNA sequence listed in Table 2, where XX is selected from 80, 85, 90, 95, 96, 97, 98 or 99.

Claims

[Claim 1] The invention described in the specification.