Process for backbone deprotection of oligonucleotides containing terminal alkylphosphonate groups

JP2025500287A5Pending Publication Date: 2025-12-26DICERNA PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024536327
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-22
Filing Date
2022-12-22
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

The existing process for backbone deprotection of oligonucleotides containing terminal alkylphosphonate groups results in undesirable side reactions, leading to the formation of alkyl transfer impurities, particularly affecting uracil nucleobases, which cannot be effectively removed in downstream processing.

Method used

A process involving the use of nucleophilic organic bases such as (1,4-diazabicyclo[2.2.2]octane (DABCO) in organic solvents like acetonitrile, with controlled flow rates and recirculation, to suppress or reduce alkyl transfer impurities during the deprotection of oligonucleotides.

Benefits of technology

The process effectively minimizes alkyl transfer impurities to less than 0.5% and cyanoethyl impurities to less than 1.0% in the crude oligonucleotide stage, improving the purity of the final product.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2023122728000001
    Figure 2023122728000001
  • Figure 2023122728000002
    Figure 2023122728000002
Patent Text Reader

Abstract

The present invention relates to a compound of formula I, 1 is C 1-4 is an alkyl group, R 2 is fluoro, hydroxyl, or C 1-4 where X is alkoxy, X is sulfur or oxygen, the term nucleobase represents an optionally modified adenine, cytosine, guanine, or uracil, and the term oligostrand represents the remaining P-linked oligonucleotide strand, where the oligostrand comprises at least one uracil nucleobase, and the process is performed under conditions in which the levels of alkyl migration impurities and the levels of cyanoethyl (CNET) impurities in the linear P-linked oligonucleotide of formula I are substantially reduced. TIFF2025500287000016.tif110170
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of European Patent Application No. 21216879.3, filed December 22, 2021, which is incorporated by reference in its entirety.

[0002] The present invention relates to a compound of formula I [ka] wherein R1 is a C1-4 alkyl group, R2 is fluoro, hydroxyl, or C1-4 alkoxy, X is sulfur or oxygen, the term nucleobase represents an optionally modified adenine, cytosine, guanine, or uracil, and the term oligostrand represents the remainder of the P-linked oligonucleotide strand, wherein the oligostrand comprises at least one uracil nucleobase. [Background technology]

[0003] The P-linked oligonucleotide having an alkylphosphonate group at the 5'-end of formula I is a therapeutically valuable compound that can target various mRNAs as an antisense strand, thereby blocking the expression of the corresponding genes. As an example, the P-linked oligonucleotide having an alkylphosphonate group at the 5'-end of formula I can be an antisense strand that targets HBsAg mRNA, which translates HBV surface antigen (HBsAg), resulting in knockdown of HBsAg gene expression, and therefore can be useful for the treatment of HBV infection (Patent Document 1).

[0004] The process is represented by formula II [ka] (wherein R1, R2, X, the terms nucleobase, and the oligo chain are as defined above), using a nucleophilic organic base in the presence of an organic solvent to remove the cyanoethyl group and one C1-4 alkyl group.

[0005] Oligonucleotide synthesis is essentially the stepwise addition of nucleoside residues to the 5' end of a growing chain until the desired sequence is assembled.

[0006] In principle, each addition is called a synthesis cycle, and in principle: a1) deblocking the 5' protected hydroxyl group on the solid support; a2) coupling the first nucleoside as an activated phosphoramidite to a free hydroxyl group on a solid support; a3) oxidizing or sulfurizing each P-linked nucleoside to form a respective phosphodiester (P=O) or a respective phosphorothioate (P=S); a4) optionally capping any unreacted hydroxyl groups on the solid support; a5) deblocking the 5' hydroxyl group of the first nucleoside bound to the solid support; a6) coupling a second nucleoside as an activated phosphoramidite to form the respective PO-linked dimer; a7) oxidizing or sulfurizing each PO-linked dinucleoside to form the respective phosphodiester (P=O) or the respective phosphorothioate (P=S); a8) optionally capping any unreacted 5' hydroxyl groups; a9) Repeating the above steps a5 to a8 until the desired sequence is assembled.

[0007] The reaction sequence may alternatively begin with deblocking the 5' protected hydroxyl group of the nucleoside preloaded on the solid support, with subsequent steps following the order outlined above.

[0008] Finally, the assembled oligonucleotide is treated with a soluble organic base to remove the cyanoethyl protecting groups, treated with aqueous base to effect global base deprotection and cleavage from the solid support (commonly referred to as cleavage and deprotection), and finally subjected to subsequent downstream processing and purification methods to provide the desired pure oligonucleotide.

[0009] Backbone deprotection, ie removal of cyanoethyl groups from phosphodiester or phosphorothioate bonds, is in principle standard and well known in the art.

[0010] US Pat. No. 5,399,633 describes a standard procedure and discloses the removal of the cyanoethyl group using an amine such as diethylamine in acetonitrile solution.

[0011] The removal of one alkyl group from an oligonucleotide compound of formula II is described in US Pat. No. 5,399,633 using concentrated ammonia at 55° C. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] International Publication No. WO2019 / 079781 [Patent Document 2] U.S. Patent No. 6,887,990 [Patent Document 3] PCT International Publication No. WO2018 / 045317 Summary of the Invention [Problem to be solved by the invention]

[0013] It has been observed that during this process, alkyl group tends to alkylate the uracil nucleobase adjacent to alkylphosphonate nucleotide, which leads to the so-called alkyl migration impurity that cannot be significantly reduced in the subsequent downstream processing steps.The oligo structure with methylated uracil nucleobase is shown in formula III.R2 has the meaning outlined above. [ka]

[0014] It was therefore an object of the present invention to further improve the process for backbone deprotection, i.e. for removing the cyanoethyl group and one C1-4 alkyl group from the oligonucleotide compound of formula II. In particular, the challenge was to find reaction conditions which suppress or at least reduce undesired side reactions such as the formation of alkyl migration impurities and the formation of cyanoethyl (CNET) impurities. [Means for solving the problem]

[0015] 1. A process for producing a linear P-linked oligonucleotide having an alkylphosphonate group at the 5' end of formula I, comprising: [ka] wherein R1 is a C1-4 alkyl group, R2 is fluoro, hydroxyl, or C1-4 alkoxy, X is sulfur or oxygen, the term nucleobase represents an optionally modified adenine, cytosine, guanine, or uracil, and the term oligostrand represents the remainder of the P-linked oligonucleotide strand, where the oligostrand comprises at least one uracil nucleobase. Formula II [ka] (In the formula, R 1 , R 2It has now been found that this objective can be achieved using a process which comprises removing the cyanoethyl group and one C1-4 alkyl group from an oligonucleotide compound of formula (III), X, the term nucleobase, and the term oligo chain being as defined above, using a nucleophilic organic base in the presence of an organic solvent.

[0016] The following definitions are set forth to illustrate and define the meaning and scope of various terms used herein to describe the invention.

[0017] The term nucleobase refers to optionally modified adenine, cytosine, guanine, or uracil, hi some embodiments, the nucleobase is uracil.

[0018] The term C1-4 alkyl denotes a straight or branched alkyl group having 1 to 4 C atoms. Representatives are methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl or t-butyl. Preferred C1-4 alkyl groups for the purposes of the present invention are methyl and ethyl, more preferably methyl.

[0019] The term C1-4 alkoxy denotes a straight or branched alkyl group having 1 to 4 C atoms covalently bonded to an oxygen atom. Representative are methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, i-butoxy or t-butoxy. Preferred C1-4 alkoxy groups for the purposes of the present invention are methoxy and ethoxy, more preferably methoxy.

[0020] The term oligonucleotide as used herein is defined as commonly understood by those skilled in the art as a molecule containing two or more covalently linked nucleotides. For use as therapeutically valuable oligonucleotides, oligonucleotides are typically synthesized as 10-40 nucleotides in length, preferably 10-25 nucleotides in length.

[0021] The oligonucleotides may be composed of optionally modified DNA, RNA or LNA nucleoside monomers, or combinations thereof.

[0022] LNA nucleoside monomers are modified nucleosides that contain a linker group or bridge between the C2' and C4' of the ribose sugar ring of the nucleotide. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs).

[0023] As used herein, optionally modified refers to a nucleoside that is modified by the introduction of one or more modifications in the sugar or nucleobase moieties compared to the equivalent DNA, RNA, or LNA nucleoside. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety, and may, for example, comprise one or more 2'-substituted nucleosides and / or one or more LNA nucleosides. The term modified nucleoside may also be used herein interchangeably with the term "nucleoside analog" or the term modified "unit" or modified "monomer".

[0024] DNA, RNA, or LNA nucleosides are linked, as a rule, by phosphodiester (P=O) and / or phosphorothioate (P=S) internucleoside linkages that covalently link two nucleosides together.

[0025] Thus, in some oligonucleotides, all of the internucleoside linkages may be composed of phosphodiester (P=O), in other oligonucleotides, all of the internucleoside linkages may be composed of phosphorothioate (P=S), or in still other oligonucleotides, the sequence of the internucleoside linkages varies and includes both phosphodiester (P=O) and phosphorothioate (P=S) internucleoside linkages.

[0026] Oligonucleotide configurations may be shown from 5' end (left) to 3' end (right) using a three letter code in which each nucleotide is written with three letters, where: - The first letter defines the sugar moiety (f = 2'-fluoro-2'-deoxyribonucleotide, g = 2'-modified GalNAc ribonucleotide, m = 2'-O-methyl ribonucleotide, p = 4'-O-(methylphosphonate-2'-O-methyl ribonucleotide isostere), - The second letter defines the nucleobase (A=adenine, C=cytosine, G=guanine, U=uracil), - The third letter defines the phosphoro backbone (o=phosphodiester, s=phosphorothioate).

[0027] The term modified nucleobase includes nucleobases having a protecting group, but is not limited to, selected from tert. butylphenoxyacetyl, phenoxyacetyl, benzoyl, acetyl, isobutyryl, or dimethylformamidino (see Wikipedia, Phosphoramidit-Synthese, https: / / de.wikipedia.org / wiki / Phosphoramidit-Synthese (March 24, 2016)).

[0028] The principles of oligonucleotide synthesis are well known in the art (see, e.g., Oligonucleotide synthesis, Wikipedia, the free encyclopedia, https: / / en.wikipedia.org / wiki / Oligonucleotide synthesis (March 15, 2016)).

[0029] Recently, large scale oligonucleotide synthesis is carried out automatically using computer-controlled synthesizers.

[0030] In principle, oligonucleotide synthesis is a solid-phase synthesis method in which the assembled oligonucleotides are covalently attached to a solid support via their 3'-terminal hydroxyl groups and remain attached to it throughout the entire chain assembly process.Suitable supports are commercially available macroporous polystyrene supports such as Primer support 5G from Cytiva and NittoPhase® HL support from Kinovate, or controlled pore glass supports such as the nucleobase-preloaded CPG supports provided by LGC.

[0031] As outlined above, oligonucleotide synthesis is, in principle, the stepwise addition of nucleoside residues to the 5' end of a growing chain until the desired sequence is assembled as outlined above.

[0032] Backbone deprotection can be carried out according to the process of the invention as outlined below: Subsequent cleavage from the resin can be carried out using concentrated aqueous ammonia.

[0033] In a preferred embodiment, the present invention provides a compound of formula Ia [ka] wherein R1 is a C1-4 alkyl group, R2 is fluoro, hydroxyl, or C1-4 alkoxy, X is sulfur or oxygen, and the oligostrand represents the remainder of the P-linked oligonucleotide chain, and the process includes the steps of:

[0034] The oligonucleotide compound of formula II, which is the starting compound for the process of the present invention, can be prepared according to the disclosure of PCT International Publication No. WO2018 / 045317.

[0035] In a preferred embodiment, the oligonucleotide compound of formula II has the formula IIa: [ka]

[0036] As outlined above, R1 is a C1-4 alkyl group and R2 is fluoro, hydroxyl, or C1-4 alkoxy. In a preferred embodiment, R1 is methyl and R2 is fluoro, hydroxyl, or methoxy. In a more preferred embodiment, R1 is methyl and R2 is fluoro or methoxy.

[0037] Nucleophilic organic bases are typically organic amines that can be characterized by their nucleophilicity according to the Mayr nucleophilicity scale: J. Phys. Org. Chem. 2008, 21, 584-595) and their pKa according to Wikipedia, Acid dissociation constant, https: / / en.wikipedia.org / wiki / Acid_dissociation_constant (October 24, 2021).

[0038] Typically, the nucleophilic organic base has a nucleophilicity of greater than 15, preferably 15-30, more preferably 16-25.

[0039] Suitable nucleophilic organic bases (protonated organic bases) have a pKa value of less than 10.5, preferably 6 to 10.5, and more preferably 8 to 10.5.

[0040] Preferred nucleophilic organic bases are tertiary amines which may be selected from morpholine, N,N-dimethylethylamine, N-methyl-pyrrolidine, or (1,4-diaza-bicyclo[2.2.2]octane.

[0041] A preferred nucleophilic organic base is (1,4-diazabicyclo[2.2.2]octane) (DABCO).

[0042] The process requires the presence of an organic solvent which may be selected from acetonitrile, pyridine, and toluene, or mixtures thereof. The preferred organic solvent is acetonitrile.

[0043] The concentration of the nucleophilic organic base in the organic solvent is selected in principle in the range of 5% by weight to 100% by weight, preferably 10% by weight to 50% by weight, more preferably 15% by weight to 25% by weight.

[0044] The amount of nucleophilic organic base applied is typically in the range of 1.5 CV to 30.0 CV.

[0045] The solution of the nucleophilic organic base in the organic solvent is typically delivered for a time period ranging from 10 minutes to 6 hours, preferably from 20 minutes to 4 hours.

[0046] Flow rates in the range of 0.1 CV / min to 2.0 CV / min, preferably 0.1 CV / min to 0.5 CV / min, have been found to be workable.

[0047] After complete delivery, the solution of the nucleophilic organic base in the organic solvent can be recirculated over the synthesis column for 60 min to 4 h, preferably 90 min to 120 min. This is a more preferred embodiment, since the reaction time can be extended, if necessary, without the need to add fresh organic base.

[0048] As a typical example, 3.75 CV of nucleophilic organic base in acetonitrile is loaded onto the column over 30 minutes and then recirculated on the column at 0.125 CV / min for 90 minutes.

[0049] As mentioned above, the intended purpose was to suppress or at least reduce the undesired formation of alkyl migration impurities and cyanoethyl (CNET) impurities, as illustrated in the oligo structure of formula III below having a methylated uracil nucleobase, since the alkyl group (R1) tends to alkylate the uracil nucleobase adjacent to the alkylphosphonate nucleotide, thereby resulting in the so-called alkyl migration impurity. [ka]

[0050] These impurities cannot be significantly depleted in subsequent downstream processing steps.

[0051] Since alkyl migration impurities, or preferably methyl migration impurities, can affect the uracil nucleobases of the oligonucleotide chains in the oligonucleotide compounds of formula II or formula IIa, and in the resulting linear P-linked oligonucleotides of formula I or formula Ia, the oligonucleotides, in some embodiments, contain at least one uracil nucleobase.

[0052] Because of the tendency for uracil nucleobases to be alkylated and for alkyl transfer impurities to increase the closer the uracil nucleobase is located on the oligostrand to the 5' end, the term adjacent means that the uracil nucleobase is typically within positions 2-20, preferably within positions 2-10, and more preferably within positions 2-6 of the oligostrand, counting from the 5' end.

[0053] Thus, further embodiments of the process of the invention include carrying out the process under conditions where the level of alkyl migration impurities, expressed as "total N+ alkyl impurities" in the linear P-linked oligonucleotide of formula I is less than 4.0%, less than 3.0%, less than 2.0%, less than 1.0%, or most preferably less than 0.5%. The % values ​​are "area %" determined from the area % of the UV peak corrected by the MS intensity of the N+ alkyl impurity group.

[0054] In a preferred embodiment, the N+ alkyl impurity is an N+ methyl impurity.

[0055] Further embodiments of the process of the invention include carrying out the process under conditions where the level of CNET impurity, expressed as "total cyanoethyl (CNET) impurity" in the linear P-linked oligonucleotide of formula I is less than 2.0%, less than 1.0%, or less than 0.5%. The % values ​​are "area %" determined from the area % of the UV peak corrected by the MS intensity of the CNET impurity group.

[0056] These values ​​can be achieved and measured at the crude oligonucleotide stage, i.e., in the case of this oligonucleotide, after cleavage and deprotection and before any downstream processing such as purification or ultrafiltration is applied.

[0057] By way of illustration, the oligonucleotide may be selected from: pUs.fUs.fAs.mUo.fUo.mGo.fUo.fGo.mAo.fGo.mGo.fAo.mUo.fUo.mUo.fUo.mGo.fUo.mCs.mGs.mG Here, the oligonucleotide structure is shown from 5' end (left) to 3' end (right) using a three letter code in which each nucleotide is written with three letters, where: - the first letter defines the sugar moiety (f = 2'-fluoro-2'-deoxyribonucleotide, g = 2'-modified GalNAc ribonucleotide, m = 2'-O-methyl ribonucleotide, p = methylphosphonate-2'-O-methyl ribonucleotide isostere); - The second letter defines the nucleobase (A=adenine, C=cytosine, G=guanine, U=uracil), - The third letter defines the phosphoro backbone (o=phosphodiester, s=phosphorothioate).

[0058] The compounds disclosed herein have the following nucleobase sequences: SEQ ID NO: 1 UUAUUGUGAGGAUUUUUGUCGG EXAMPLES

[0059] Abbreviation: Ac2O = acetic anhydride ETT = 5-ethylthiotetrazole Bz = benzoyl CNET=Cyanoethyl DABCO = 1,4-diazobicyclo[2.2.2]octane DCA = dichloroacetic acid DEA = diethylamine DNA = 2'-deoxyribonucleic acid DMEA = N'N Dimethylethylamine DMT = 4,4'-dimethoxytrityl CV = column volume MeCN = acetonitrile NA=Not Applicable NMI = N-methylimidazole NMP = N-methyl-pyrrolidine PhMe = toluene TBA = tert-butylamine PhMe = toluene

[0060] Example 1. Synthesis of pUs.fUs.fAs.mUo.fUo.mGo.fUo.fGo.mAo.fGo.mGo.fAo.mUo.fUo.mUo.fUo.mGo.fUo.mCs.mGs.mG Here, the oligonucleotide structure is shown from 5' end (left) to 3' end (right) using a three letter code in which each nucleotide is written with three letters, where: - The first letter defines the sugar moiety (f = 2'-fluoro-2'-deoxyribonucleotide, g = 2'-modified GalNAc ribonucleotide, m = 2'-O-methyl ribonucleotide, p = 4'-O-(methylphosphonate-2'-O-methyl ribonucleotide isostere), - The second letter defines the nucleobase (A=adenine, C=cytosine, G=guanine, U=uracil), - The third letter defines the phosphoro backbone (o=phosphodiester, s=phosphorothioate).

[0061] The title compound was generated by standard phosphoramidite chemistry on solid phase on a 2.62 mmol scale using an AKTA Oligopilot 100 and a preloaded polystyrene solid support (NittoPhase HL preloaded 358).

[0062] The following phosphoramidites were used in each cycle: [Table 1]

[0063] Typically, 2.0 equivalents of phosphoramidite were used. All reagents were used as received from commercial sources, and reagent solutions were prepared at appropriate concentrations (see details below). Cleavage and deprotection were achieved using ammonium hydroxide to give crude oligonucleotides. [Table 2]

[0064] The crude solution from the cleavage and deprotection steps was concentrated in vacuum to remove excess ammonia. The concentrated solution was lyophilized to obtain the crude oligonucleotide as a solid. The pale yellow solid was sampled and subjected to LC-UV-MS analysis. The impurities were grouped according to their assigned structures. The sum of all N+ methyl impurities and the sum of all CNET impurities were used for the analysis of process parameters.

[0065] Example 2 Backbone Deprotection Example The organic amines used have pKa and nucleophilicity values ​​listed in the table below. Nucleophilicity values ​​can be found in Mayr's Database of Reactivity Parameters (https: / / www.cup.lmu.de / oc / mayr / reaktionsdatenbank / fe / showclass / 40) and pKa values ​​can be found in Correlation of the Base Strengths of Amines, J. Am. Chem. Soc. 1957, 79, 20, 5441-5444>>. For the pKa of DABCO, see Basicity of 1,s-bis(dimethy1amino)-naphthalene and 1,4-diazabicyclo[2.2.2]octane in water and dimethylsulfoxide, Can. J. Chem. 1987, 65, 996. [Table 3]

[0066] Backbone deprotection was carried out using solutions of various organic amines in toluene, pyridine, or acetonitrile, as outlined in the table below. [Table 4]

[0067] The process parameters are listed in a separate table below. [Table 5]

[0068] Examples 2e, 2j, 2k, 2l, and 2m are considered preferred, with example 2k being most preferred.

Claims

1. 1. A method for producing a linear P-linked oligonucleotide having an alkylphosphonate group at the 5′ end of the following formula: 【Chemistry 1】 (In the formula, R 1 is C 1-4 is an alkyl group, and R 2 is fluoro, hydroxyl, or C 1-4 alkoxy, X is sulfur or oxygen, the term nucleobase refers to an optionally modified adenine, cytosine, guanine, or uracil, and the term oligostrand refers to the remainder of the P-linked oligonucleotide strand, wherein said oligostrand comprises at least one uracil nucleobase. Formula II 【Chemistry 2】 (In the formula, R 1 , R 2 , X, the term nucleobase, and the term oligo chain are as defined above), in the presence of an organic solvent, a cyanoethyl group and one C 1-4 removing the alkyl group.

2. R 1 The method of claim 1 , wherein is methyl.

3. R 2 The method of claim 1 , wherein is fluoro or methoxy.

4. 2. The method of claim 1, wherein the nucleobase is adenine, cytosine, guanine, or uracil.

5. 2. The method of claim 1, wherein the nucleophilic organic base has a nucleophilicity of greater than 15, preferably 15-30, more preferably 16-25.

6. 2. The method of claim 1, wherein the nucleophilic organic base has a pKa of the protonated organic base of less than 10.5, preferably between 6 and 10.5, more preferably between 8 and 10.

5.

7. 2. The method of claim 1, wherein the nucleophilic organic base is a tertiary amine selected from morpholine, N,N-dimethylethylamine, N-methyl-pyrrolidine, or 1,4-diazabicyclo[2.2.2]octane.

8. 2. The method of claim 1, wherein the nucleophilic organic base is (1,4-diazabicyclo[2.2.2]octane) (DABCO).

9. 10. The method of claim 1, wherein the organic solvent is selected from acetonitrile, pyridine, and toluene, or a mixture thereof.

10. 2. The method of claim 1, wherein the organic solvent is acetonitrile.

11. 2. The method according to claim 1, wherein the concentration of said nucleophilic organic base in said organic solvent is selected in the range of 5% by weight to 100% by weight, preferably 10% by weight to 50% by weight, more preferably 15% by weight to 25% by weight.

12. 2. The method of claim 1, wherein the amount of nucleophilic organic base applied is in the range of 1.5 CV to 30.0 CV, and the flow rate is selected in the range of 0.1 CV / min to 2.0 CV / min, preferably 0.1 CV / min to 0.5 CV / min.

13. 2. The method of claim 1, wherein the method is carried out under conditions where the level of alkyl migration impurities, expressed as "sum of N+alkyl impurities," in the linear P-linked oligonucleotide of Formula I is less than 4.0%, less than 3.0%, less than 2.0%, less than 1.0%, or less than 0.5%.

14. 2. The method of claim 1, wherein the method is performed under conditions where the level of cyanoethyl (CNET) impurity, expressed as "total CNET impurities," in the linear P-linked oligonucleotide of Formula I is less than 2.0%, less than 1.0%, or less than 0.5%.