Compositions and methods for purifying polyribonucleotides
Patent Information
- Application Number
- JP2024537431
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-12-22
- Filing Date
- 2022-12-22
- Publication Date
- 2026-01-06
AI Technical Summary
There is a need for new compositions and methods to effectively separate and purify polyribonucleotides, particularly linear polyribonucleotides, from mixtures containing both linear and circular forms, to enhance the expression of open reading frames (ORFs) encoding polypeptides.
A method involving the use of oligonucleotides that hybridize to target regions on linear polyribonucleotides, conjugated to particles such as magnetic beads or resins, to separate linear polyribonucleotides from a mixture, utilizing techniques like hybridization, immobilization, and elution to achieve purification.
The method significantly increases the expression level of circular polyribonucleotide ORFs by at least 10% post-purification, enriching the population of circular polyribonucleotides and reducing impurities, thereby improving the efficiency of polypeptide encoding and delivery.
Smart Images

Figure 00000102_0000 
Figure 00000102_0001 
Figure 00000102_0002
Abstract
Description
[Technical field]
[0001] Sequence Listing This application has been filed electronically in Extensible Markup Language (XML) format and contains a Sequence Listing, which is incorporated by reference in its entirety. The XML copy, created on December 22, 2022, is named 51509-056WO2_Sequence_Listing_12_21_22.XML and is 3,683 bytes in size. [Background technology]
[0002] Polyribonucleotides are useful in a variety of therapeutic and modifying applications. Thus, new compositions and methods for separating and purifying polyribonucleotides are needed. Summary of the Invention [Means for solving the problem]
[0003] In one aspect, the disclosure features a method of separating a linear polyribonucleotide from a plurality of polyribonucleotides. The plurality of polyribonucleotides includes a mixture of linear and cyclic polyribonucleotides that includes an open reading frame (ORF) encoding a polypeptide. The method includes: (a) providing a sample having a plurality of polyribonucleotides, a subset of which includes linear polyribonucleotides; (b) binding a target region to the linear polyribonucleotide; and (c) contacting the sample with an oligonucleotide that hybridizes to the target region. The method further includes (d) separating the linear polyribonucleotide having the target region hybridized to the oligonucleotide from the plurality of polyribonucleotides in the sample.
[0004] In some embodiments, the oligonucleotide is conjugated (e.g., directly or indirectly) to a particle. The particle may be, for example, a magnetic bead. In some embodiments, the oligonucleotide is conjugated to a resin comprising a plurality of particles. The resin may comprise, for example, cross-linked poly[styrene-divinylbenzene], agarose, or SEPHAROSE® agarose. In some embodiments, a column comprises the resin.
[0005] In some embodiments, the separation of the linear polyribonucleotides comprises immobilizing the oligonucleotides.
[0006] In some embodiments, separating the linear polyribonucleotides comprises recovering a portion of the sample that is not hybridized to the oligonucleotide. For example, the portion of the sample that is not hybridized to the oligonucleotide may comprise a circular polyribonucleotide.
[0007] In some embodiments, the level of expression from the ORF of the purified circular polyribonucleotide is increased by at least 10% relative to the level of expression from the ORF before purification.
[0008] In another aspect, the disclosure features a method of separating a linear polyribonucleotide from a plurality of polyribonucleotides. The plurality of polyribonucleotides includes a mixture of linear polyribonucleotides and cyclic polyribonucleotides. The method includes: (a) providing a sample having a plurality of polyribonucleotides, a subset of which includes linear polyribonucleotides; (b) binding a target region to the linear polyribonucleotides; and (c) contacting the sample with a column that includes a resin having a plurality of particles conjugated to oligonucleotides that hybridize to the target region. The method further includes (d) recovering an eluate from the plurality of polyribonucleotides in the sample, the eluate including a portion of the sample that is not hybridized to the oligonucleotide.
[0009] In some embodiments, the portion of the sample that is not hybridized to the oligonucleotide comprises a circular polyribonucleotide.
[0010] In some embodiments, the resin comprises cross-linked poly[styrene-divinylbenzene], agarose, or SEPHAROSE® agarose.
[0011] In some embodiments of any of the above aspects, the method includes, prior to step (a), circularizing the circular polyribonucleotide from a linear precursor. For example, the linear precursor may include a 5' self-splicing intron fragment and a 3' self-splicing intron fragment, and the circular polyribonucleotide is generated by self-splicing of the linear precursor. Each of the 5' self-splicing intron fragment and the 3' self-splicing intron fragment may be, for example, a group I or group II self-splicing intron fragment.
[0012] In another aspect, the disclosure features a method of separating a linear polyribonucleotide from a plurality of polyribonucleotides. The plurality of polyribonucleotides includes a mixture of linear polyribonucleotides and cyclic polyribonucleotides. The method includes: (a) circularizing a linear precursor to form a cyclic polyribonucleotide; (b) providing a sample including a plurality of polyribonucleotides, a subset of which includes linear polyribonucleotides; (c) binding a target region to the linear polyribonucleotide; and (d) contacting the sample with an oligonucleotide that hybridizes to the target region. The method further includes (e) separating the linear polyribonucleotide having the target region hybridized to the oligonucleotide from the plurality of polyribonucleotides in the sample.
[0013] In some embodiments, circularization of the circular polyribonucleotide is effected by splint ligation of a linear precursor.
[0014] In some embodiments, the linear precursor comprises a 5' self-splicing intron fragment and a 3' self-splicing intron fragment, and the circular polyribonucleotide is generated by self-splicing of the linear precursor.
[0015] In some embodiments, the 5' self-splicing intron fragment and the 3' self-splicing intron fragment are group I or group II self-splicing intron fragments, respectively.
[0016] In some embodiments of any of the above aspects, the circular polyribonucleotide comprises an ORF. The ORF can, for example, encode a polypeptide.
[0017] In some embodiments of any of the above aspects, the circular polyribonucleotide comprises an internal ribosome entry site (IRES). The ORF may be operably linked to the IRES.
[0018] In some embodiments, the method includes attaching the target region to the 3' or 5' end of the linear polyribonucleotide. For example, the method may include attaching the target region to the 3' end of the linear polyribonucleotide. The attaching step may include polyadenylating the 3' end of the linear polyribonucleotide. The polyadenylation may include providing a polyA polymerase, e.g., E. coli polyA polymerase. In another embodiment, the attaching step includes ligating the target region to the 3' end of the linear polyribonucleotide.
[0019] In some embodiments, the linear polyribonucleotide of step (a) comprises a target region (e.g., prior to attaching the target region in step (b)). Such embodiments thus provide a further purification method, in which a first copy of the target region is present in the linear polyribonucleotide before step (b), and a second copy of the target region is attached to the linear polyribonucleotide during step (b). The target region present in the linear polyribonucleotide of step (a) can be the same or different (e.g., in sequence and length) relative to the target region attached to the linear polyribonucleotide in step (b). In some embodiments, the linear precursor comprises, operably linked, the following in 5' to 3' order: a target region, a first circularization sequence (e.g., a first self-splicing intron fragment), a polyribonucleotide cargo (e.g., optionally including one or more of a spacer, an IRES, and an open reading frame), and a second circularization sequence (e.g., a second self-splicing intron fragment).
[0020] In some embodiments, the cyclic polyribonucleotide does not contain adenosine nucleotides adjacent to a polyA sequence (e.g., at least 10, e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, e.g., at least 15, at least 20, at least 25, or at least 30 polyA sequences).
[0021] In some embodiments, the target region includes a polyA sequence (eg, a polyA sequence of at least 10 contiguous adenosine nucleotides).
[0022] In some embodiments, the oligonucleotide that binds to a target comprises a polyU or polydT sequence. The polyU or polydT sequence may comprise at least 10 (e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, e.g., at least 15, at least 20, at least 25, or at least 30) uridine or thymidine residues. In some embodiments, the polydT is (dT) 25 Includes.
[0023] In some embodiments, the oligonucleotide is conjugated to a particle. The particle may be, for example, a magnetic bead. In some embodiments, the oligonucleotide is conjugated to a resin comprising a plurality of particles. The resin may comprise, for example, cross-linked poly[styrene-divinylbenzene], agarose, or SEPHAROSE® agarose. In some embodiments, a column comprises the resin.
[0024] In some embodiments, the separation of the linear polyribonucleotides comprises immobilizing the oligonucleotides.
[0025] In some embodiments, separating the linear polyribonucleotides comprises recovering a portion of the sample that is not hybridized to the oligonucleotide. For example, the portion of the sample that is not hybridized to the oligonucleotide may comprise a circular polyribonucleotide.
[0026] In some embodiments of any of the above aspects, the method further comprises washing the linear polyribonucleotide having the target region hybridized to the oligonucleotide one or more times.
[0027] In some embodiments of any of the above aspects, the method further includes eluting the linear polyribonucleotide having the target region from the oligonucleotide.
[0028] In some embodiments, the methods include providing a plurality of oligonucleotides, where each oligonucleotide hybridizes to a different target region.
[0029] In some embodiments, the oligonucleotide has a length of at least 5 nucleotides (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleotides). In some embodiments, the oligonucleotide is, for example, 5-100, 5-95, 10-90, 10-80, 12-60, 15-50, 15-40, 15-30, 18-30, 20-25, or 20-22 nucleotides in length. In some embodiments, the oligonucleotide is 23 nucleotides in length. In some embodiments, the oligonucleotides have at least 80% (eg, at least 85%, 90%, 95%, 97%, 99%, or 100%) complementarity to an equal length portion of the target region.
[0030] In some embodiments, the method includes providing an oligonucleotide at a molar ratio of 10:1 to 1:10 to a linear polyribonucleotide having the target region.
[0031] In some embodiments, the level of expression from the ORF of the purified circular polyribonucleotide is increased by at least 10% relative to the level of expression from the ORF before purification.
[0032] In some embodiments of any of the above aspects, the method separates at least 500 μg (e.g., at least 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, or more) of linear polyribonucleotide having a target region. In some embodiments, the method separates between 500 μg and 1,000 mg of linear polyribonucleotide comprising a target region.
[0033] In another aspect, the disclosure features a population of polyribonucleotides produced by a method described herein (e.g., of any aspect).
[0034] In some embodiments, the population comprises, for example, cyclic polyribonucleotides lacking a target region, and the cyclic polyribonucleotides comprise at least 40%, (e.g., at least 50%, 60%, 70%, 80%, 855, 90%, 95%, 97%, 99%, or 100%) (mol / mol) of the total polyribonucleotides in the composition.
[0035] In some embodiments, the population comprises less than 40% (e.g., less than 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1%) (mol / mol) linear polyribonucleotides of the total polyribonucleotides in the composition.
[0036] In some embodiments, the total weight of polyribonucleotides in the population of polyribonucleotides is at least 500 μg (e.g., at least 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, or more). In some embodiments, the total weight of polyribonucleotides in the population of polyribonucleotides is 500 μg to 1000 mg.
[0037] In another aspect, the disclosure features a pharmaceutical composition that includes a population of polyribonucleotides of any of the above embodiments (e.g., produced by a method described herein) and a diluent, carrier, or excipient.
[0038] definition To facilitate understanding of the present disclosure, several terms are defined below. Terms defined herein have the meanings as commonly understood by those skilled in the art in the areas relevant to the present disclosure. Terms such as "a", "an" and "the" are not intended to refer to a singular entity only, but also include general classes, specific examples of which may be used for illustration. The term "or" is used to mean "and / or" unless expressly specified to refer to alternatives only or the alternatives are not mutually exclusive, but the present disclosure supports a definition that refers to alternatives only and "and / or". Although the terms in this specification are used to describe specific embodiments, their use should not be construed as limiting, except as outlined in the claims.
[0039] As used herein, any value provided in a range of values includes both the upper and lower limits, as well as any value subsumed within the upper and lower limits.
[0040] As used herein, the term "about" refers to a value within ±10% of the recited value.
[0041] As used herein, the term "adjuvant" refers to a composition (e.g., a compound, a polypeptide, a nucleic acid, or a lipid) that increases an immune response, e.g., increases the specific immune response to an immunogen. Increasing the immune response includes enhancing or broadening the specificity of either or both the antibody and cellular immune responses.
[0042] As used herein, the term "carrier" refers to a compound, composition, reagent, or molecule that facilitates the transport or delivery of a composition (e.g., cyclic polyribonucleotide) to a cell, via a partially or fully encapsulated agent, or a combination thereof, by covalent modification of the cyclic polyribonucleotide. Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), nanoparticles (e.g., nanoparticles encapsulated or covalently attached to cyclic polyribonucleotides), liposomes, fusosomes, exosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently attached to polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfection reagents).
[0043] As used herein, the terms "cyclic polyribonucleotide", "circular RNA", and "circRNA" are used interchangeably and refer to polyribonucleotide molecules having a structure with no free ends (i.e., free 3' and / or 5' ends), e.g., polyribonucleotide molecules that form a circular or endless structure through covalent or non-covalent bonds. A circular polyribonucleotide may be, for example, a covalently closed polyribonucleotide.
[0044] The term "diluent" refers to a medium containing an inert solvent in which a composition described herein (e.g., a composition containing a cyclic polyribonucleotide) can be diluted or dissolved. The diluent can be an RNA solubilizing agent, a buffer, an isotonic agent, or a mixture thereof. The diluent can be a liquid diluent or a solid diluent. Non-limiting examples of liquid diluents include water or other solvents, solubilizing agents and emulsifying agents, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan, and 1,3-butanediol. Non-limiting examples of solid diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium lactose phosphate, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, or powdered sugar.
[0045] As used herein, the terms "disease," "disorder," and "condition" each refer to a state of less than optimal health, e.g., a condition that is or would be normally diagnosed or treated by a medical professional.
[0046] As used herein, the term "expressed sequence" is a nucleic acid sequence that codes for a product, e.g., a peptide or polypeptide. An exemplary expressed sequence that codes for a peptide or polypeptide includes multiple nucleotide triads, each of which can code for an amino acid, referred to as a "codon."
[0047] As used herein, the term "GC content" refers to the percentage of guanine (G) and cytosine (C) in a nucleic acid sequence. The formula for calculating GC content is (G+C) / (A+G+C+U)×100% (for RNA) or (G+C) / (A+G+C+T)×100% (for DNA). Similarly, the term "uridine content" refers to the percentage of uridine (U) in a nucleic acid sequence. The formula for calculating uridine content is U / (A+G+C+U)×100%. Similarly, the term "thymidine content" refers to the percentage of thymidine (T) in a nucleic acid sequence. The formula for calculating thymidine content is T / (A+G+C+T)×100%.
[0048] "Heterologous" means occurring under a situation other than the naturally occurring (natural) situation. A "heterologous" polynucleotide sequence indicates that the polynucleotide sequence is used in a manner other than that found in the sequence's native genome. For example, a "heterologous promoter" is used to drive the transcription of a sequence that is not naturally transcribed by that promoter; therefore, a "heterologous promoter" sequence is often included in an expression construct using recombinant nucleic acid technology. The term "heterologous" is also used to refer to a given sequence that is placed in a non-naturally occurring relationship with another sequence; for example, a heterologous coding or non-coding nucleotide sequence is commonly inserted into a genome by genome transformation techniques, resulting in a genetically modified or recombinant genome.
[0049] As used herein, the term "intron fragment" refers to a portion of an intron, where a first intron fragment and a second intron fragment together form an intron, such as a catalytic intron. The intron fragment may be a 5' portion of an intron (e.g., the 5' portion of a catalytic intron) or a 3' portion of an intron (e.g., the 3' portion of a catalytic intron), whereby the 5' intron fragment and the 3' intron fragment together form a functional intron, e.g., a functional intron capable of catalytic self-splicing. The term intron fragment is intended to refer to an intron split into two portions. The term intron fragment is not intended to state, imply, or suggest that the two portions or halves are equal in length. The term intron fragment is used synonymously with the term split intron and may be used in place of the term "half intron".
[0050] As used herein, the term "impurity" refers to an undesired substance present in a composition, e.g., a pharmaceutical composition described herein. In some embodiments, the impurity is a process-related impurity. In some embodiments, the impurity is a product-related substance other than the desired product in the final composition, e.g., other than the active pharmaceutical ingredient, e.g., a circular polyribonucleotide, as described herein. As used herein, the term "process-related impurity" refers to a substance used, present, or produced in the making of a composition, preparation, or product, other than the linear polyribonucleotides described herein, that is undesired in the final composition, preparation, or product. In some embodiments, the process-related impurity is an enzyme used in the synthesis or cyclization of polyribonucleotides. As used herein, the term "product-related substance" refers to a substance or by-product produced during the synthesis of a composition, preparation, or product, or any intermediate thereof. In some embodiments, the product-related substance is a deoxyribonucleotide fragment. In some embodiments, the product-related substance is a deoxyribonucleotide monomer. In some embodiments, product-related materials are derivatives or fragments of polyribonucleotides described herein, e.g., one or more fragments of 10, 9, 8, 7, 6, 5, or 4 ribonucleic acids, monoribonucleic acids, diribonucleic acids, or triribonucleic acids.
[0051] As used herein, "increasing fitness" or "promoting fitness" of a subject refers to any favorable alteration in the physiology or any activity carried out by a subject organism as a result of administration of a peptide or polypeptide described herein, including, but not limited to, any one or more of the following desired effects: (1) increased resistance to biotic or abiotic stress; (2) increased yield or biomass; (3) altered flowering time; (4) increased resistance to pests or pathogens, (5) increased resistance to herbicides; (6) increased population of a subject organism (e.g., an agriculturally important insect); (7) increased reproductive rate of a subject organism (e.g., an insect, e.g., a honeybee or silkworm); (8) increased motility of a subject organism (e.g., an insect, e.g., a honeybee or silkworm); (9) increased activity of a subject organism (e.g., an insect, e.g., a honeybee or silkworm); (10) increased activity of a subject organism (e.g., an insect, e.g., a honeybee or silkworm); (9) an increase in the body weight of a target organism (e.g., an insect, e.g., a honeybee or a silkworm); (10) an increase in pollination (e.g., the number of plants pollinated in a given period) by a target organism (e.g., an insect, e.g., a honeybee or a silkworm); (11) an increase in the production of by-products (e.g., honey from a honeybee or silkworm) by a target organism (e.g., an insect, e.g., a honeybee or a silkworm); (12) an increase in the nutrient content (e.g., protein, fatty acid, or amino acid) of a target organism (e.g., an insect); or (13) an increase in the resistance of a target organism to a pesticide (e.g., a neonicotinoid (e.g., imidacloprid) or an organophosphate insecticide (e.g., a phosphorothioate, e.g., fenitrothion)), (14) an increase in the health or reduction of disease of a target organism, such as a human or non-human animal. The increase in host fitness can be determined in comparison to a target organism to which the modulator is not administered.Conversely, a "reduced fitness" of a subject refers to any undesirable alteration in the physiology or of any activity carried out by the subject organism as a result of administration of a peptide or polypeptide described herein, including, but not limited to, any one or more of the following intended effects: (1) reduced resistance to biotic or abiotic stress; (2) reduced yield or biomass; (3) altered flowering time; (4) reduced resistance to pests or pathogens; (5) reduced resistance to herbicides; (6) reduced population of the subject organism (e.g., an agriculturally important insect); (7) reduced reproductive rate of the subject organism (e.g., an insect, e.g., a honeybee or silkworm); (8) reduced motility of the subject organism (e.g., an insect, e.g., a honeybee or silkworm); (9) reduced body weight of the subject organism (e.g., an insect, e.g., a honeybee or silkworm). (9) a decrease in metabolic rate or activity of a target organism (e.g., an insect, such as a honeybee or silkworm); (10) a decrease in pollination (e.g., the number of plants pollinated in a given period) by a target organism (e.g., an insect, such as a honeybee or silkworm); (11) a decrease in the production of by-products (e.g., honey from honeybees or silkworms) by a target organism (e.g., an insect, such as a honeybee or silkworm); (12) a decrease in the nutrient content (e.g., protein, fatty acid, or amino acid) of a target organism (e.g., an insect); or (13) a decrease in the resistance of a target organism to a pesticide (e.g., a neonicotinoid (e.g., imidacloprid) or an organophosphate insecticide (e.g., a phosphorothioate, such as fenitrothion)), (14) a decrease in the health or a decrease in disease of a target organism, such as a human or non-human animal. The decrease in host fitness can be determined in comparison to a target organism to which the modulator is not administered. It will be apparent to one of skill in the art that certain changes in a subject's physiology, phenotype, or activity, such as altering the flowering time in a plant, can be considered to increase the fitness of the subject or decrease the fitness of the subject, depending on the situation (e.g., to adapt to changes in climate or other environmental conditions).For example, a delay in flowering (e.g., about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% reduction in plants in a population that flower on a given calendar date) may be a beneficial adaptation to later or cooler spring seasons and therefore may be considered to increase the fitness of the plant; conversely, a similar delay in flowering in the context of earlier or warmer spring seasons may be considered to decrease the fitness of the plant.
[0052] As used interchangeably herein, the term "linear counterpart" or "linear precursor" refers to a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) and has two free ends (i.e., a non-circularized version (and fragments thereof) of a circularized polyribonucleotide). In some embodiments, a linear counterpart (e.g., a pre-circularized version) is a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) and the same or similar nucleic acid modification as a circular polyribonucleotide and has two free ends (i.e., a non-circularized version (and fragments thereof) of a circularized polyribonucleotide). In some embodiments, a linear counterpart is a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween) and a nucleic acid modification that is different or absent relative to a circular polyribonucleotide, and has two free ends (i.e., a non-circularized version (and fragments thereof) of a circularized polyribonucleotide). In some embodiments, a fragment of a polyribonucleotide molecule that is a linear counterpart is any portion of the linear counterpart polyribonucleotide molecule that is shorter than the linear counterpart polyribonucleotide molecule. In some embodiments, the linear counterpart further comprises a 5' cap. In some embodiments, the linear counterpart further comprises a polyadenosine tail. In some embodiments, the linear counterpart further comprises a 3' UTR. In some embodiments, the linear counterpart further comprises a 5' UTR.
[0053] As used herein, the terms "linear polyribonucleotide," "linear RNA," and "linear polyribonucleotide molecule" are used interchangeably and refer to a polyribonucleotide molecule having a 5' and a 3' end. One or both of the 5' and 3' ends may be free ends or may be linked to another moiety. Linear RNA includes RNA that has not been circularized (e.g., pre-circularized) and can be used as starting material for circularization, e.g., via split ligation or chemical, enzymatic, ribozyme, or splicing catalyst circularization methods.
[0054] As used herein, the term "modified oligonucleotide" means an oligonucleotide containing nucleotides having at least one modification to the sugar, nucleobase, or internucleotide linkage.
[0055] As used herein, the term "modified ribonucleotide" means a ribonucleotide containing a nucleoside having at least one modification to the sugar, nucleobase, or internucleoside linkage.
[0056] As used herein, the term "naked delivery" refers to a formulation for delivery to cells without the aid of a carrier or covalent modification of moieties that aid in delivery to cells. Naked delivery formulations do not include transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. For example, a naked delivery formulation of cyclic polyribonucleotide is a formulation that includes cyclic polyribonucleotide without covalent modification and does not include a carrier.
[0057] As used herein, the terms "nicked RNA," "nicked linear polyribonucleotide," and "nicked linear polyribonucleotide molecule" are used interchangeably and refer to a polyribonucleotide molecule having 5' and 3' ends resulting from the nicking or degradation of a circular RNA. "Nicked circular RNA" refers to a circular RNA that has been nicked.
[0058] As used herein, the term "non-circular RNA" refers to the totality of nicked and linear RNA.
[0059] The term "optionally substituted X" as used herein is intended to be equivalent to "X, optionally substituted X" (e.g., "alkyl, optionally substituted alkyl"). It is not intended to imply that the feature "X" (e.g., alkyl) is optional in nature. The term "optionally substituted" as used herein refers to having 0, 1, or more substituents (e.g., 0-25, 0-20, 0-10, or 0-5 substituents). For example, C 1 The alkyl group, i.e., methyl, can be substituted with oxo to form a formyl group, and with -OH or -NH 2 may be further substituted with to form a carboxyl group or an amide group.
[0060] The term "pharmaceutical composition" is also intended to disclose that the cyclic polyribonucleotides contained within the pharmaceutical composition can be used for the treatment of the human or animal body by therapy, and is therefore intended to correspond to "cyclic polyribonucleotides for use in therapy."
[0061] As used herein, the term "polynucleotide" refers to a molecule comprising one or more nucleic acid subunits or nucleotides, and may be used interchangeably with "nucleic acid" or "oligonucleotide." A polynucleotide may comprise one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. A nucleotide is a unit of a nucleoside and at least one, two, three, four, five, six, seven, eight, nine, ten, or more phosphates (POs). 3) group. A nucleotide may contain a nucleobase, a pentose sugar (either ribose or deoxyribose), and one or more phosphate groups. A ribonucleotide is a nucleotide in which the sugar is ribose. Polyribonucleotide, ribonucleic acid, or RNA may refer to a polymer containing multiple ribonucleotides polymerized through phosphodiester bonds. A deoxyribonucleotide is a nucleotide in which the sugar is deoxyribose.
[0062] Polydeoxyribonucleotide, deoxyribonucleic acid, and DNA refer to a polymer comprising multiple deoxyribonucleotides polymerized via phosphodiester bonds. Nucleotides can be nucleoside monophosphates or nucleoside polyphosphates. Nucleotides refer to deoxyribonucleoside polyphosphates, such as deoxyribonucleoside triphosphates (dNTPs), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP), and deoxythymidine triphosphate (dTTP) dNTPs, including detectable tags (e.g., fluorophores), such as luminescent tags and markers. Nucleotides can include any subunit that can be incorporated into a growing nucleic acid chain. Such subunits may be A, C, G, T, or U, or any other subunits that are specific to one or more complementary A, C, G, T, or U, or that are complementary to purines (i.e., A or G, or variants thereof) or pyrimidines (i.e., C, T, or U, or variants thereof). In some instances, the polynucleotide is a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or a derivative or variant thereof. In some instances, the polynucleotide is a small interfering RNA (siRNA), a microRNA (miRNA), a plasmid DNA (pDNA), a small hairpin RNA (shRNA), a small nuclear RNA (snRNA), a messenger RNA (mRNA), a pre-mRNA (pre-mRNA), an antisense RNA (asRNA), to name a few, and includes both nucleotide sequences and any structural embodiment thereof, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some instances, the polynucleotide molecule is circular. The polynucleotide may have a variety of lengths. The nucleic acid molecule can have a length of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 50 kb, or more. Polynucleotides can be isolated from cells or tissues.Polynucleotide sequence embodiments can include isolated and purified DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogs.
[0063] Polynucleotide embodiments, such as polyribonucleotides or polydeoxyribonucleotides, include polynucleotides that contain one or more nucleotide variants, including non-standard nucleotides, non-natural nucleotides, nucleotide analogs, or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, Examples of nucleotides include 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), butoxocine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. In some cases, the nucleotides include modifications of their phosphate moieties, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include longer phosphate chains (e.g., phosphate chains having 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications of the thiol moiety (e.g., α-thiotriphosphate and β-thiotriphosphate).In some embodiments, the nucleic acid molecule is also modified at the base moiety, sugar moiety, or phosphate backbone (e.g., at one or more atoms typically available to form hydrogen bonds with complementary nucleotides, and / or at one or more atoms typically not available to form hydrogen bonds with complementary nucleotides). The nucleic acid molecule may also include amine-modified groups such as aminoallyl-dUTP (aa-dUTP) and aminohexylacrylamide-dCTP (aha-dCTP) to allow covalent attachment of amine-reactive moieties such as N-hydroxysuccinimide ester (NHS). Alternatives to standard DNA or RNA base pairs in the oligonucleotides of the present disclosure may provide high bit density per cubic mm, higher safety (resistance to accidental or deliberate synthesis of natural toxins), easier identification in photoprogrammed polymerases, or subsecondary structures. Such alternative base pairs compatible with natural and mutant polymerases for de novo or amplicon synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. 2012, 8(7):612-4, incorporated herein by reference for all purposes.
[0064] As used herein, the term "polyribonucleotide cargo" herein includes any sequence comprising at least one polyribonucleotide. In an embodiment, the polyribonucleotide cargo comprises one or more expressed (or coding) sequences, each expressed (or coding) sequence encoding a polypeptide. In an embodiment, the polyribonucleotide cargo comprises one or more expressed sequences, each expressed sequence encoding a polypeptide. In an embodiment, the polyribonucleotide cargo comprises one or more non-coding sequences, such as polyribonucleotides having regulatory or catalytic functions. In an embodiment, the polyribonucleotide cargo comprises a combination of expressed and non-coding sequences. In an embodiment, the polyribonucleotide cargo comprises one or more polyribonucleotide sequences as described herein, for example, one or more regulatory elements, internal ribosome entry site (IRES) elements, or spacer sequences.
[0065] As used interchangeably herein, the terms "polyA" and "polyA sequence" refer to an untranslated flanking region of a nucleic acid molecule that is at least 5 nucleotides in length and consists of adenosine residues. In some embodiments, the polyA sequence is at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 nucleotides in length. In some embodiments, the polyA sequence is located 3' to (e.g., downstream of) an open reading frame (e.g., an open reading frame encoding a polypeptide), and the polyA sequence is present 3' to a termination sequence (e.g., a stop codon) such that the polyA is not translated. In some embodiments, the polyA sequence is located 3' to the termination sequence and the 3' untranslated region.
[0066] As used herein, nucleic acid elements are "operably connected" or "operably linked" when they are placed in a vector such that they can be transcribed to form a linear polyribonucleotide and then circularized to a circular polyribonucleotide using the methods provided herein.
[0067] As used herein, "polypeptide" refers to a polymer of amino acid residues (natural or non-natural) linked together, most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs thereof. Polypeptides can be single molecules or multi-molecular complexes such as dimers, trimers, or tetramers. Polypeptides can also include single chain or multi-chain polypeptides such as antibodies or insulin, which can be associated or linked. Disulfide bonds are most commonly found in multi-chain polypeptides. The term polypeptide can also be applied to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.
[0068] As used herein, the term "plant-modifying polypeptide" refers to a polypeptide that can modify a genetic property (e.g., increase gene expression, decrease gene expression, or otherwise modify the nucleotide sequence of DNA or RNA), an epigenetic property, or a biochemical or physiological property of a plant in a manner that results in a change in the physiology or phenotype of the plant, e.g., an increase or decrease in plant fitness.
[0069] As used herein, the terms "purify," "purifying," and "purification" refer to one or more steps or processes in which impurities (e.g., process-related impurities (e.g., enzymes), process-related substances (e.g., deoxyribonucleotide fragments, deoxyribonucleotide monomers)) or by-products (e.g., linear RNA) are removed from a sample containing a mixture of circular RNA and linear RNA, among other substances, to produce a composition containing an enriched population of circular RNA in which the levels of impurities (e.g., process-related impurities (e.g., enzymes), process-related substances (e.g., deoxyribonucleotide fragments, deoxyribonucleotide monomers)) or by-products (e.g., linear RNA) are reduced compared to the original mixture, or the linear RNA or substances are reduced by 40% or more (e.g., 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, or 99% or more) on a mass basis compared to the starting mixture.
[0070] As used herein, the terms "pure" and "purity" refer to the degree to which an analyte (e.g., circular RNA) is isolated and free from other components. In the context of nucleic acids (e.g., polyribonucleotides), the purity of an isolated nucleic acid (e.g., circular RNA) can be expressed in terms of a population of nucleic acids that is free of any contaminants, impurities, or by-products (e.g., linear RNA and other substances). For example, the purity of a population of circular RNA indicates how much circular RNA is present in the population per total mass of isolated material, and can be determined, for example, using pure circular RNA as a reference. The purity levels found in the present disclosure can be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, more than 95%, or more than 99% (w / w). In some embodiments, the level of contaminants or impurities or by-products is about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (w / w) or less. Purity can be determined by detecting the level of a particular analyte (e.g., circular RNA) or a particular impurity or by-product (e.g., linear RNA) using gel electrophoresis, spectrophotometry (e.g., NanoDrop by ThermoFisher Scientific), or other techniques suitable for measuring the purity of a population of nucleic acids, and calculating the percentage (w / w) of the analyte relative to the total nucleic acid content (e.g., as determined by assays known in the art).
[0071] As used herein, the phrase "substantially free of one or more impurities or by-products" refers to a characteristic of a sample that is free of one or more impurities or by-products (e.g., one or more impurities or by-products disclosed herein) or contains a minimal amount of one or more impurities or by-products, e.g., a sample that contains an enriched population of circular RNA. The minimal amount of one or more impurities or by-products may be 20% (w / w) or less (e.g., 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w) or less, or less). In another example, a sample or enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount of less than 15% (w / w) (e.g., 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w) or less, or less). In another example, a sample or enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount of less than 10% (w / w) (e.g., 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w) or less, or less). In another example, a sample or enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount of less than 5% (w / w) (e.g., 4%, 3%, 2%, 1% (w / w) or less or less). In yet another example, a sample or enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount of less than 1% (0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% (w / w) or less or less).
[0072] As used herein, a "regulatory element" is a portion of a nucleic acid sequence or the like that alters the expression of an expression sequence within a circular or linear polyribonucleotide.
[0073] As used herein, the term "replication elements" are sequences and / or motifs that are useful for the replication or initiation of transcription of a circular polyribonucleotide.
[0074] As used herein, "spacer" refers to any adjacent nucleotide sequence (eg, of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions.
[0075] As used herein, the term "sequence identity" is determined by alignment of two peptide sequences or two nucleotide sequences using a global or local alignment algorithm. Sequences are called "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity when optimally aligned (aligned by a program such as GAP or BESTFIT using default parameters). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Generally, the default parameters of GAP are used: gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignment and sequence identity percentage scores are determined using computer programs such as, for example, GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or EmbossWin version 2.10.0 (using the program "Needle"). Alternatively or additionally, percent identity is determined by searching in a database, for example, using algorithms such as FASTA, BLAST, etc. Sequence identity refers to sequence identity over the entire length of the sequence.
[0076] A "signal sequence" refers to a polypeptide sequence, eg, 10-45 amino acids in length, present at the N-terminus of a polypeptide sequence of a nascent protein that targets the polypeptide sequence to the secretory pathway.
[0077] As used herein, a "termination element" is a portion, such as a nucleic acid sequence, that terminates translation of an expressed sequence in a circular or linear polyribonucleotide.
[0078] As used herein, the term "total ribonucleotide molecules" refers to the total amount of any ribonucleotide molecules, including linear polyribonucleotide molecules, cyclic polyribonucleotide molecules, monomeric ribonucleotides, other polyribonucleotide molecules, fragments thereof, and modified variations thereof, as measured by the total mass of the ribonucleotide molecules.
[0079] As used herein, the term "translation initiation sequence" is a nucleic acid sequence that initiates translation of an expression sequence in a circular polyribonucleotide.
[0080] As used herein, the term "yield" refers to the relative amount of an analyte (e.g., a population of cyclic polyribonucleotides) obtained after a purification step or process compared to the amount of the analyte in the starting material (e.g., a mixed population of polyribonucleotides, e.g., cyclic polyribonucleotides and linear polyribonucleotides, etc.) (w / w). The yield can be expressed as a percentage. In the context of the present disclosure, the amount of the analyte (e.g., cyclic polyribonucleotides) in the starting material and the analyte obtained after a purification step can be measured using an assay (e.g., gel electrophoresis or spectrophotometry). The methods of the present disclosure can be used to provide a yield of an enriched population of cyclic polyribonucleotides of about 20% (w / w) or more compared to the amount present in the starting material, e.g., a mixed population of polyribonucleotides. For example, the methods can be used to result in yields of purified circular polyribonucleotide of about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, or 90% (w / w) or more.
[0081] Other features and advantages of the invention will be apparent from the following detailed description, drawings, and claims. [Brief description of the drawings]
[0082] [Figure 1] Schematic diagram showing the method described herein. On the left is a linear polyribonucleotide. The linear polyribonucleotide is circularized. A target region is attached to the non-circularized linear polyribonucleotide. An oligonucleotide conjugated to a particle is added to the mixture. The oligonucleotide hybridizes to the target on the linear polyribonucleotide, while the circular polyribonucleotide is not attached by the oligonucleotide, thereby separating the linear polyribonucleotide containing the target region from the circular polyribonucleotide lacking the target region. An additional target region can be optionally present at the 5' end of the linear precursor as shown. [Diagram 2] Schematic diagram showing the method described herein. On the left is a linear polyribonucleotide. The linear polyribonucleotide is circularized. The non-circularized linear polyribonucleotide is polyadenylated, thereby generating a 3' polyA tail. A polyDT oligonucleotide conjugated to a particle is added to the mixture. The oligo hybridizes to the polyA target on the linear polyribonucleotide, while the circular polyribonucleotide is not bound by the oligo, thereby separating the linear polyribonucleotide containing a polyA tail from the circular polyribonucleotide lacking a polyA tail. An additional polyA region can optionally be present at the 5' end of the linear precursor, as shown. [Figure 3A] 3B shows a chromatogram of a sample generated by in vitro transcription (IVT) from Example 1. The chromatogram is annotated with flow-through (FT), elution peak 1 (E1), and elution peak 2 (E2) characterized by SDS PAGE as described in Example 1 and shown in FIG. [Figure 3B]3 is a gel (6% TBE gel) showing SDS PAGE analysis of the IVT-generated mixture of circular and linear RNA in Example 1 after purification and polyadenylation. The first lane is the (L)IVT-generated circRNA and linRNA sample mixture initially loaded onto the column; the second lane is an analysis of the column flow-through (FT); the third and fourth lanes are an analysis of elution peak E1 (containing fractions B7 and B8); and the fifth and sixth lanes are an analysis of peak E2 (containing fractions C4 and C5). The analyzed fractions correspond to the fractions (FT, E1, and E2) collected from the column chromatography shown in FIG. 3A. The percent purity calculated from the PAGE analysis is shown. [Figure 4] 1 is a gel showing the linear by-products in the IVT mixture when circular RNA is generated by self-splicing. The gel shows the desired circular RNA product, unspliced linear RNA, partially spliced linear RNA, nicked circular RNA, and a spliced intron. [Diagram 5] Gels (6% TBE gels) showing SDS-PAGE analysis of IVT-generated mixtures of circular and linear RNA by-products from oligo(dT) magnetic bead purification runs (Runs A and B) in Example 2. The second and fifth lanes are sample mixtures of IVT-generated circRNA and linRNA by-products first incubated with oligo(dT) magnetic beads (L) (Runs A and B, respectively); the third and sixth lanes are analysis of the oligo flow-through (FT) (Runs A and B, respectively); the fourth and seventh lanes are analysis of the elution (Runs A and B, respectively). [Figure 6](FIG. 6A) Chromatogram of IVT-generated sample from Example 2. The chromatogram is annotated with flow-through (FT), break-through (BT), elution peak 1 (E1), and elution peak 2 (E2) characterized by SDS PAGE as described in Example 2 and shown in FIG. 6B. (FIG. 6B) Gel (6% TBE gel) showing SDS-PAGE analysis of IVT-generated mixture of circular and linear RNA by-products from oligo(dT) column purification run in Example 2. The second lane is the sample mixture of IVT-generated circRNA and linRNA by-products initially loaded onto the column (L); the third lane is the analysis of column flow-through (FT); the fourth lane is the analysis of break-through (BT); the fifth lane is the analysis of elution peak E1; and the sixth lane is the analysis of peak E2. The analyzed fractions correspond to the fractions collected from the column chromatography shown in FIG. 6A (FT, BT E1, and E2). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0083] The present disclosure describes compositions and methods for processing, e.g., purifying, polyribonucleotides. Polyribonucleotides, such as linear or cyclic polyribonucleotides, can be used for a variety of modification or therapeutic purposes. However, when polyribonucleotides are produced through certain biological reactions, various impurities, by-products, or incomplete products may be observed. The present invention features methods useful for reducing or removing these impurities, by-products, or incomplete products from a sample to produce a composition having a desired polyribonucleotide composition, amount, and / or purity, or a population containing a plurality of polyribonucleotides having a desired polyribonucleotide composition, amount, and / or purity.
[0084] In certain embodiments, the method is useful for purifying polyribonucleotides undergoing a splicing reaction. In such embodiments, the method can be used to separate spliced polyribonucleotides from unspliced polyribonucleotides, or unspliced polyribonucleotides from spliced polyribonucleotides. In some embodiments, the method can be used to separate circular polyribonucleotides (e.g., spliced) from linear polyribonucleotides, or linear polyribonucleotides from circular polyribonucleotides. Such purified compositions containing desired polyribonucleotides can be useful for various downstream applications, such as delivery of polynucleotide cargo (e.g., encoding genes or proteins) to target cells. The compositions and methods are described in more detail below.
[0085] method The methods described herein include separating a polyribonucleotide having a target region from a plurality of polyribonucleotides. The method includes providing a sample comprising a plurality of polyribonucleotides. The plurality of polyribonucleotides includes a mixture of linear polyribonucleotides and cyclic polyribonucleotides. The cyclic polyribonucleotides may include an open reading frame (ORF) encoding a polypeptide. A subset of the plurality of polyribonucleotides is a linear polyribonucleotide. The method further includes binding the target region to the linear polyribonucleotides. The method also includes contacting the sample with an oligonucleotide that hybridizes to the target region, and separating the linear polyribonucleotide having the target region hybridized to the oligonucleotide from the plurality of polyribonucleotides in the sample (FIG. 1). In some embodiments, the binding includes polyadenylation, and the oligonucleotide includes a poly-T sequence (FIG. 2).
[0086] In some embodiments, the methods described herein include separating linear polyribonucleotides from a plurality of polyribonucleotides. The plurality of polyribonucleotides includes a mixture of linear polyribonucleotides and cyclic polyribonucleotides. The method includes providing a sample having a plurality of polyribonucleotides, a subset of which includes linear polyribonucleotides; binding a target region to the linear polyribonucleotides; and contacting the sample with a column comprising a resin having a plurality of particles conjugated to oligonucleotides that hybridize to the target region. The method further includes recovering an eluate from the plurality of polyribonucleotides in the sample, the eluate comprising a portion of the sample that is not hybridized to the oligonucleotide.
[0087] In some embodiments, the methods described herein include separating the linear polyribonucleotide from the plurality of polyribonucleotides. The plurality of polyribonucleotides includes a mixture of linear polyribonucleotides and cyclic polyribonucleotides. The method includes: circularizing a linear precursor to form a cyclic polyribonucleotide; providing a sample comprising a plurality of polyribonucleotides, a subset of which comprises linear polyribonucleotides; binding a target region to the linear polyribonucleotide; and contacting the sample with an oligonucleotide that hybridizes to the target region. The method further includes separating the linear polyribonucleotide having the target region hybridized to the oligonucleotide from the plurality of polyribonucleotides in the sample.
[0088] In some embodiments of any of the methods described herein, the target region is located at the 5' or 3' end of a polyribonucleotide (e.g., a circular or linear polyribonucleotide) and the target region does not contain a polyA sequence. In some embodiments, the target region is located at the 3' end of a polyribonucleotide and does not contain a polyA sequence.
[0089] In some embodiments, the oligonucleotide is conjugated (e.g., directly or indirectly) to a particle. The particle may be, for example, a magnetic bead. In some embodiments, the oligonucleotide is conjugated to a resin comprising a plurality of particles. The resin may comprise, for example, cross-linked poly[styrene-divinylbenzene], agarose, or SEPHAROSE® agarose. In some embodiments, a column comprises the resin.
[0090] In some embodiments of any of the methods described herein, the separating comprises immobilizing the oligonucleotides. The method may comprise, for example, immobilizing the oligonucleotides, the particles, or a combination thereof.
[0091] In some embodiments, the particles are magnetic particles. The method may include applying a force, such as a magnetic force, to the magnetic particles. The particles or beads may be, for example, cross-linked agarose, such as SEPHAROSE® beads. The method may include applying a force, such as a mechanical force, an optical force, a centrifugal force, or an acoustic force, to the beads or particles.
[0092] As described herein, the method can be used to separate, e.g., splice, from unspliced polyribonucleotides. In some embodiments, the method described herein includes separating spliced polyribonucleotides from unspliced or partially spliced polyribonucleotides. In some embodiments, the spliced polyribonucleotide is a circular polyribonucleotide. In some embodiments, the spliced polyribonucleotide is a linear polyribonucleotide. In some embodiments, the spliced polyribonucleotide lacks an intron or a portion thereof, e.g., after a splicing (e.g., self-splicing) event during production. In some embodiments, the polyribonucleotide having an intron or a portion thereof is a linear polyribonucleotide.
[0093] In some embodiments, the method further comprises washing the bound polyribonucleotides having the target region one or more times (e.g., two, three, four, five, or more times). Washing may occur after the contacting step and / or after the separating step.
[0094] In some embodiments, the method further comprises performing a first elution step to release bound polyribonucleotides comprising the target region from the polyribonucleotides having the target region. The first elution step may comprise adding a first buffer and / or heating the sample, for example, to at least 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or higher.
[0095] In some embodiments, the method further comprises performing a second elution step. The second elution step may comprise adding a second buffer and / or heating the sample, for example, to at least 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or higher. In some embodiments, the second buffer comprises a denaturing agent, for example, formamide or urea. The second buffer may comprise, for example, about 40% to about 60% formamide (e.g., about 40%, 45%, 50%, 55%, or 60% formamide).
[0096] In some embodiments, the method comprises incubating the sample with the oligonucleotide for at least 10 minutes (e.g., at least 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 70 minutes, 80 minutes, 90 minutes, 100 minutes, 110 minutes, 120 minutes, or more).
[0097] In some embodiments, the method includes recovering a portion of the sample that is not bound by the oligonucleotide.
[0098] In some embodiments, the method includes providing a plurality of oligonucleotides, each of which hybridizes to a different target region. Each oligonucleotide can be, for example, conjugated to a particle, such as a magnetic particle or bead.
[0099] In some embodiments, the method includes providing the oligonucleotide at a molar ratio of 10:1 to 1:10 (e.g., 10:1, 5:1, 2:1, 1:2, 1:5, or 1:10) to the polyribonucleotide (e.g., a polyribonucleotide having a target region).
[0100] In some embodiments, the method includes preparing a sample of particles, e.g., beads, e.g., magnetic beads. The particles can be in a container, e.g., a microcentrifuge tube, or can be packed in a column. The particles can be conjugated to oligonucleotides. The method can include flowing a mixture of polyribonucleotides through a column containing the particles. As such, the polyribonucleotides bound by the oligonucleotides will bind to the column. In some embodiments, the particles are directly conjugated to oligonucleotides, e.g., designed to hybridize to a target region of the polyribonucleotides.
[0101] In some embodiments, for example when using magnetic particles, the method may include pelleting the magnetic particles in a container (eg, a microcentrifuge tube), for example by providing a permanent magnet.
[0102] In some embodiments, the methods described herein enrich the amount of a desired polyribonucleotide in a sample. For example, the methods may enrich the amount of a desired (e.g., spliced, e.g., circular) polyribonucleotide by at least 10% (e.g., at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or more) compared to the sample prior to purification.
[0103] In some embodiments, the method of purification results in cyclic polyribonucleotides having less than 50% (mol / mol) (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1% (mol / mol)) linear polyribonucleotides.
[0104] In some embodiments, the methods described herein separate at least 500 μg (e.g., at least 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, or more) of linear polyribonucleotide having a target region. In some embodiments, the methods separate between 500 μg and 1,000 mg of linear polyribonucleotide comprising a target region.
[0105] How to join The methods described herein include attaching a target region to a linear polyribonucleotide. For example, the methods may include attaching a target region to the 3' or 5' end of a linear polyribonucleotide. In some embodiments, the methods include attaching a region to the 3' or 5' end of a linear polyribonucleotide, where the target region is not located at the 3' or 5' end of the linear polyribonucleotide. For example, a polyribonucleotide comprising a target region can be attached to an end, where the target region is ligated to an end of the linear polyribonucleotide, while the flanking region forms a new 5' or 3' end of the linear polyribonucleotide, e.g., after attachment. Attachment can be performed by ligating the target region or a portion thereof to the linear polyribonucleotide. In other embodiments, attachment can be performed by polyadenylation, where one or more adenosine ribonucleotides are added to an end (e.g., 3' end) of the linear polyribonucleotide, e.g., to generate a poly-A tail. Such methods include providing a polyA polymerase that attaches an adenosine monophosphate unit from adenosine triphosphate to the RNA while cleaving and removing the pyrophosphate. In some embodiments, a portion of the target region is attached during the attaching step. For example, in some embodiments, the linear polyribonucleotide includes a portion of the target region and the attaching step includes attaching a remaining portion of the target region.
[0106] The target region or a polyribonucleotide comprising the target region can be attached according to any available technique, including but not limited to chemical and enzymatic methods.
[0107] Such enzymatic methods include, for example, providing a ligase (e.g., an RNA ligase) that binds to free ends of a linear RNA, such as the 3' end of a linear polyribonucleotide and the 5' end of a target region or the 5' end of a linear polyribonucleotide and the 3' end of a target region.
[0108] In one example, either the 5' or 3' end of a linear polyribonucleotide may encode a ligase ribozyme sequence such that during in vitro transcription, the resulting linear polyribonucleotide contains an active ribozyme sequence capable of ligating the 5' end of the linear polyribonucleotide or the 3' end of the linear polyribonucleotide to a target region. The ligase ribozyme may be derived from a group I intron, hepatitis delta virus, a hairpin ribozyme, or may be selected by SELEX (Systematic Evolution of Ligands by Exponential Enrichment).
[0109] In another example, the target region can be attached to the linear polyribonucleotide using at least one non-nucleic acid moiety. For example, the at least one non-nucleic acid moiety can react with a region or feature near the 5' end or near the 3' end of the linear polyribonucleotide to attach to the linear polyribonucleotide. In another example, the at least one non-nucleic acid moiety can be located at, linked to, or near the 5' end or 3' end of the linear polyribonucleotide. The non-nucleic acid moiety can be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety can be a bond such as a hydrophobic bond, an ionic bond, a biodegradable bond, or a cleavable bond. As another non-limiting example, the non-nucleic acid moiety can be a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety can be an oligonucleotide or peptide moiety, such as an aptamer or a non-nucleic acid linker as described herein.
[0110] In another example, the linear polyribonucleotide may be spliced to the target region. In some embodiments, the linear polyribonucleotide and the target region may both include a loop E sequence for ligation. In another embodiment, the linear polyribonucleotide and the target region may include a circularization intron, such as a 5' and 3' slice junction, or a circularization catalytic intron, such as a group I, group II, or group III intron. Non-limiting examples of group I intron self-splicing sequences may include the self-splicing permuted intron-exon sequence from the T4 bacteriophage gene td and the Tetrahymena intervening sequence (IVS) rRNA.
[0111] In another example, the target region may be attached to the linear polyribonucleotide by a non-nucleic acid moiety that is attractive between atoms at, near, or connected to the 5' and 3' ends of the linear polyribonucleotide, between molecular surfaces. The linear polyribonucleotide may be attached to the target region by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonant bonds, agnostic bonds, dipole bonds, conjugation, hyperconjugation, and antibonds.
[0112] In another example, a linear polyribonucleotide may contain a ribozyme RNA sequence near the 5' end and the target region may contain a ribozyme RNA sequence near the 3' end, or vice versa. The ribozyme RNA sequence may be covalently linked to a peptide when the sequence is exposed to the remainder of the ribozyme. Peptides covalently linked to the ribozyme RNA sequence near the 5' and 3' ends may associate with each other, thereby binding the target region to the linear polyribonucleotide. A non-limiting list of ribozymes used in the linear primary constructs or linear polyribonucleotides of the invention, or methods for incorporating or covalently linking peptides, is provided in U.S. Patent Publication No. 20030082768, the contents of which are incorporated herein by reference in their entirety.
[0113] In yet another example, a target region can be attached to a linear polyribonucleotide using chemical methods of circularization. Such methods may include, but are not limited to, click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiaminal-imine crosslinking, base modification, and any combination thereof.
[0114] Cyclization Method Circularization can be performed using methods including, for example, recombinant technology or chemical synthesis. For example, the DNA molecules used to generate the RNA circles can include DNA sequences of the original naturally occurring nucleic acid sequence, modified versions thereof, or DNA sequences encoding synthetic polypeptides not normally found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques including, but not limited to, classical mutagenesis and recombinant techniques, such as site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures and ligation of mixed groups to "build" a mixture of nucleic acid molecules, and combinations thereof.
[0115] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized. In some embodiments, the linear polyribonucleotide for circularization is circularized in vitro before separation, formulation, and / or delivery. In some embodiments, the circular polyribonucleotide is a mixture with the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide has the same nucleic acid sequence as the circular polyribonucleotide.
[0116] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized using a chemical method to form a circular polyribonucleotide. In some chemical methods, the 5'-end and 3'-end of a nucleic acid (e.g., the linear polyribonucleotide for circularization) contain chemically reactive groups that, when brought together, can form a new covalent bond between the 5'-end and 3'-end of the molecule. The 5'-end may contain an NHS-ester reactive group, and the 3'-end may contain a 3'-amino-terminating nucleotide, such that in an organic solvent, the 3'-amino-terminating nucleotide on the 3'-end of the linear RNA molecule undergoes nucleophilic attack on the 5'-NHS-ester moiety to form a new 5'- / 3'-amide bond.
[0117] In some embodiments, a 5'-phosphorylated nucleic acid molecule (e.g., a linear polyribonucleotide for circularization) is enzymatically ligated to the 3'-hydroxyl group of a nucleic acid (e.g., a linear nucleic acid) using a DNA or RNA ligase to form a new phosphorodiester bond. In an example reaction, a linear polyribonucleotide for circularization is incubated with 1-10 units of T4 RNA ligase (New England Biolabs, Ipswich, MA) for 1 hour at 37°C according to the manufacturer's protocol. The ligation reaction can occur in the presence of a linear nucleic acid capable of base pairing with both the proximal 5' and 3' regions and supporting the enzymatic ligation reaction. In some embodiments, the ligation is a splint ligation. For example, a splint ligase such as SplintR® ligase can be used for splint ligation, RNA ligase II, T4 RNA ligase, or T4 DNA ligase. In the case of splint ligation, a single-stranded polynucleotide (splint), such as a single-stranded RNA, can be designed to hybridize to both ends of a linear polyribonucleotide, thereby bringing the two ends into juxtaposition upon hybridization with the single-stranded splint. Thus, a splint ligase can catalyze the ligation of the two juxtaposed ends of a linear polyribonucleotide to generate a circular polyribonucleotide.
[0118] In some embodiments, DNA or RNA ligases are used in the synthesis of circular polynucleotides. In some embodiments, either the 5' or 3' end of the linear polyribonucleotide for circularization may encode a ligase ribozyme sequence such that during in vitro transcription, the resulting linear polyribonucleotide for circularization contains an active ribozyme sequence capable of ligating the 5' end of the linear polyribonucleotide for circularization to the 3' end of the linear polyribonucleotide for circularization. The ligase ribozyme may be derived from a group I intron, hepatitis delta virus, a hairpin ribozyme, or may be selected by SELEX (Systematic Evolution of Ligands by Exponential Enrichment). The ribozyme ligase reaction may take 1 to 24 hours at a temperature of 0 to 37°C.
[0119] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized by using at least one non-nucleic acid moiety. In one embodiment, the at least one non-nucleic acid moiety reacts with a region or feature near the 5' end and / or near the 3' end of the linear polyribonucleotide for circularization to circularize or concatemerize the linear polyribonucleotide for circularization. In another embodiment, the at least one non-nucleic acid moiety is located at, linked to, or near the 5' end and / or 3' end of the linear polyribonucleotide for circularization. The contemplated non-nucleic acid moiety can be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety is a bond such as a hydrophobic bond, an ionic bond, a biodegradable bond, and / or a cleavable bond. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety is an oligonucleotide or a peptide moiety, such as an aptamer or a non-nucleic acid linker as described herein.
[0120] In some embodiments, linear polyribonucleotides for circularization are synthesized using IVT and RNA polymerase, where the nucleotide mixture used for IVT may contain an excess of guanosine monophosphate relative to guanosine triphosphate to preferentially produce RNA with a 5' monophosphate; purified IVT products may be circularized using splint DNA.
[0121] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized due to the non-nucleic acid moiety that attracts between atoms, molecular surfaces, near, or connected to the 5'-end and 3'-end of the linear polyribonucleotide for circularization. As a non-limiting example, one or more linear polyribonucleotides for circularization may be circularized or concatemerized by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonant bonds, agnostic bonds, dipole bonds, conjugation, hyperconjugation, and antibonds.
[0122] In some embodiments, the linear polyribonucleotide for circularization contains ribozyme RNA sequences near the 5' and 3' ends. The ribozyme RNA sequences can be covalently linked to peptides when the sequences are exposed to the remainder of the ribozyme. In one embodiment, the peptides covalently linked to the ribozyme RNA sequences near the 5' and 3' ends can associate with each other and cause circularization or concatemerization of the linear polyribonucleotide for circularization. In another embodiment, the peptides covalently linked to the ribozyme RNA near the 5' and 3' ends can cause circularization or concatemerization of the linear primary construct or linear mRNA after being ligated using various methods known in the art, including but not limited to protein ligation. A non-limiting list of examples of ribozymes or methods for incorporating or covalently linking peptides for use in the linear primary constructs or linear RNAs of the present invention are described in U.S. Patent Application Publication No. 20030082768, the contents of which are incorporated by reference herein in their entirety.
[0123] In some embodiments, the linear polyribonucleotides for circularization comprise a 5' triphosphate of a nucleic acid that has been converted to a 5' monophosphate, for example, by contacting the 5' triphosphate with RNA 5' pyrophosphohydrolase (RppH) or ATP diphosphohydrolase (apyrase). In some embodiments, the 5' end of at least a portion of the linear polyribonucleotides comprises a monophosphate moiety. In some embodiments, a population of polyribonucleotides comprising circular and linear polyribonucleotides is contacted with RppH prior to digesting at least a portion of the linear polyribonucleotides with a 5' exonuclease and / or a 3' exonuclease. Alternatively, conversion of the 5' triphosphate of a linear polyribonucleotide for circularization to a 5' monophosphate can occur by a two-step reaction including: (a) contacting the 5' nucleotide of the linear polyribonucleotide for circularization with a phosphatase (e.g., Antarctic phosphatase, shrimp alkaline phosphatase, or calf intestinal phosphatase) to remove all three phosphates; and (b) contacting the 5' nucleotide after step (a) with a kinase (e.g., polynucleotide kinase) that adds a single phosphate.
[0124] In some embodiments, the linear polyribonucleotide comprises an internal splicing element where the spliced ends are joined together when duplicated. Some examples include splice site sequences and short inverted repeats (30-40 nt) such as AluSq2, AluJr, and AluSz, inverted sequences in flanking introns, Alu sequences in flanking introns, and motifs found in cis sequence elements proximal to backsplice events (four suptable enriched motifs), such as sequences present 200 bp forward (upstream) or backward (downstream) to the backsplice site with the flanking exon. In some embodiments, the linear polyribonucleotide comprises at least one repeated nucleotide sequence described elsewhere herein as an internal splicing element. In such embodiments, the repeated nucleotide sequence comprises a repeated sequence from the Alu family of introns. In some embodiments, ribosome binding proteins associated with splicing may regulate the biosynthesis of circular polyribonucleotides (eg, Muscleblind and Quaking (QKI) splicing factors).
[0125] In some embodiments, the linear polyribonucleotide comprises canonical splice sites flanking the head-to-tail junction of the circular polyribonucleotide.
[0126] In some embodiments, the linear polyribonucleotide comprises a bulge-helix-bulge motif, which comprises a four base pair stem flanked by two three nucleotide bulges. Cleavage occurs at a site within the bulge region, generating characteristic fragments with terminal 5'-hydroxyl groups and 2',3'-cyclic phosphates. Circularization proceeds by nucleophilic attack of the 5'-OH group on the 2',3'-cyclic phosphate of the same molecule, forming a 3',5'-phosphodiester bridge.
[0127] In some embodiments, the linear polyribonucleotide comprises a multimeric, repetitive RNA sequence that harbors an HPR element. The HPR comprises a 2',3'-cyclic phosphate and a 5'-OH terminus. The HPR element self-processes the 5' and 3' ends of the linear polyribonucleotide, thereby ligating the ends together.
[0128] In embodiments, the linear polyribonucleotide is circularized or ligated by self-splicing. In some embodiments, the linear polyribonucleotide comprises a sequence that mediates self-ligation. In one embodiment, the linear polyribonucleotide comprises an HDV sequence for self-ligation, for example, an HDV replication domain conserved sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC(Beeharry et al 2004) (SEQ ID NO: 2) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO: 3) In one embodiment, the linear polyribonucleotide comprises a loop E sequence (e.g., of PSTVd) for self-ligation. In another embodiment, the linear polyribonucleotide comprises a self-circularizing intron, e.g., a 5' and 3' splice junction, or a self-circularizing catalytic intron, such as a group I, group II, or group III intron. Non-limiting examples of group I intron self-splicing sequences include the self-splicing permuted intron-exon sequence from the T4 bacteriophage gene td, and the intervening sequence (IVS) rRNA of Tetrahymena, the pre-tRNA gene of the cyanobacterium Anabaena, or the pre-rRNA of Tetrahymena.
[0129] In some embodiments, the linear polyribonucleotide comprises a catalytic intron fragment, for example, the 3' half of a group I catalytic intron fragment and the 5' half of a group I catalytic intron fragment. The first and second annealing regions can be located within the catalytic intron fragment. Group I catalytic introns are self-splicing ribozymes that catalyze their own excision from mRNA, tRNA, and rRNA precursors via a two metal ion phosphoryl transfer mechanism. Importantly, the RNA itself self-catalyzes intron removal without the need for exogenous enzymes such as ligases.
[0130] In some embodiments, the 3' half of the group I catalytic intron fragment and the 5' half of the group I catalytic intron fragment are derived from the cyanobacterial Anabaena pre-tRNA-Leu gene or Tetrahymena pre-rRNA.
[0131] In some embodiments, the 3' half of the group I catalytic intron fragment and the 5' half of the group I catalytic intron fragment are derived from the cyanobacterium Anabaena pre-tRNA-Leu gene, the 3' exon fragment comprises a first annealing region, and the 5' exon fragment comprises a second annealing region. The first annealing region may comprise, for example, 5 to 50, e.g., 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides, and the second annealing region may comprise, for example, 5 to 50, e.g., 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides.
[0132] In some embodiments, the 3' half of the group I catalytic intron fragment and the 5' half of the group I catalytic intron fragment are derived from Tetrahymena pre-rRNA, and the 3' half of the group I catalytic intron fragment comprises a first annealing region and the 5' exon fragment comprises a second annealing region. In some embodiments, the 3' exon fragment comprises a first annealing region and the 5' half of the group I catalytic intron fragment comprises a second annealing region. The first annealing region may comprise, for example, 6 to 50, e.g., 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides and the second annealing region may comprise, for example, 6 to 50, e.g., 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.
[0133] In some embodiments, the 3' half of the group I catalytic intron fragment and the 5' half of the group I catalytic intron fragment are derived from the cyanobacterium Anabaena pre-tRNA-Leu gene, Tetrahymena pre-rRNA, or T4 phage td gene.
[0134] In some embodiments, the 3' half of the group I catalytic intron fragment and the 5' group I catalytic intron fragment are derived from a T4 phage td gene. The 3' exon fragment may comprise a first annealing region and the 5' half of the group I catalytic intron fragment may comprise a second annealing region. The first annealing region may comprise, for example, 2-16, e.g., 10-16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides and the second annealing region may comprise, for example, 2-16, e.g., 10-16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.
[0135] In some embodiments, the 3' half of the Group I catalytic intron fragment is the 5' end of the linear polynucleotide.
[0136] In some embodiments, the 5' half of the Group I catalytic intron fragment is the 3' end of a linear polyribonucleotide.
[0137] In some embodiments, the linear polyribonucleotide for circularization comprises complementary sequences within individual introns or through flanking introns, including either repetitive or non-repetitive nucleic acid sequences.
[0138] In some embodiments, chemical methods of circularization can be used to generate circular polyribonucleotides. Such methods may include, but are not limited to, click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiaminal-imine crosslinking, base modification, and any combination thereof.
[0139] In some embodiments, enzymatic methods of circularization can be used to generate circular polyribonucleotides. In some embodiments, a ligation enzyme, such as a DNA or RNA ligase, can be used to generate a circular polyribonucleotide or a complementary template, a complementary strand of a circular polyribonucleotide, or a circular polyribonucleotide.
[0140] In another embodiment, the circular polyribonucleotides are produced by using a deoxyribonucleotide template that is transcribed in a cell-free system (e.g., by in vitro transcription) to produce linear polyribonucleotides that can self-splice to produce circular polyribonucleotides.
[0141] In some embodiments, a circular polyribonucleotide is generated (e.g., in a cell-free system) by providing a linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide, thereby generating a circular polyribonucleotide.
[0142] In some embodiments, a circular polyribonucleotide is generated by providing deoxyribonucleotides encoding a linear polyribonucleotide; transcribing the deoxyribonucleotides in a cell-free system to generate a linear polyribonucleotide; optionally purifying a splicing-competent linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide, thereby generating a circular polyribonucleotide.
[0143] In some embodiments, the circular polyribonucleotide is produced by preparing deoxyribonucleotides encoding linear polyribonucleotides; transcribing the deoxyribonucleotides in a cell-free system to produce linear polyribonucleotides, thereby producing circular polyribonucleotides, where the transcription is performed in solution under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5' split intron and a 3' split intron (e.g., a self-splicing construct for producing circRNA). In some embodiments, the linear polyribonucleotide comprises a 5' annealing region and a 3' annealing region.
[0144] In some embodiments, the linear polyribonucleotide is generated from a deoxyribonucleic acid, such as a deoxyribonucleic acid described herein, such as a DNA vector, a linearized DNA vector, or a cDNA. In some embodiments, the linear polyribonucleotide is transcribed from the deoxyribonucleic acid by transcription in a cell-free system (e.g., in vitro transcription).
[0145] In some embodiments, the circular polyribonucleotide is generated in a cell, e.g., a prokaryotic or eukaryotic cell. In some embodiments, an exogenous polyribonucleotide is provided to the cell (e.g., a linear polyribonucleotide described herein or a DNA molecule encoding the transcription of a linear polyribonucleotide described herein). The linear polyribonucleotide may be transcribed intracellularly from an exogenous DNA molecule provided to the cell. The linear polyribonucleotide may be transcribed intracellularly from an exogenous recombinant DNA molecule transiently provided to the cell. In some embodiments, the exogenous DNA molecule is not integrated into the genome of the cell. In some embodiments, the linear polyribonucleotide is transcribed intracellularly from a recombinant DNA molecule integrated into the genome of the cell.
[0146] Methods for making the circular polyribonucleotides described herein are described, for example, in Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); Muller and Appel, from RNA Biol, 2017, 14(8):1018-1027; and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012). Other methods of making cyclic polyribonucleotides are described, for example, in WO 2022 / 247943, U.S. Pat. No. 11000547, WO 2018 / 191722, WO 2019 / 236673, WO 2020 / 023595, WO 2022 / 204460, WO 2022 / 204464, and WO 2022 / 204466.
[0147] Various methods of making circular polyribonucleotides have been described elsewhere (see, e.g., U.S. Pat. No. 6,210,931, U.S. Pat. No. 5,773,244, U.S. Pat. No. 5,766,903, U.S. Pat. No. 5,712,128, U.S. Pat. No. 5,426,180, U.S. Patent Publication No. 20100137407, WO 1992001813, WO 2010084371, and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015); the contents of each of which are incorporated herein by reference in their entirety).
[0148] Oligonucleotides The oligonucleotides described herein are designed to hybridize to a target region of a polyribonucleotide. In some embodiments, the oligonucleotide has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) complementarity with an equal length portion of the target region. In some embodiments, the oligonucleotide has at most 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mismatch to the target region of the polyribonucleotide. In some embodiments, the oligonucleotide has no mismatch to the target region. In some embodiments, the oligonucleotide may be a modified oligonucleotide (e.g., with modified phosphates, sugars, or bases). In some embodiments, the oligonucleotide contains a portion designed to hybridize to the target region and a portion that does not hybridize to the target region (e.g., terminal regions).
[0149] The oligonucleotides may be, for example, at least 5 nucleotides (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleotides) in length. In some embodiments, the oligonucleotides are, for example, 5-100, 5-95, 10-90, 10-80, 12-60, 15-50, 15-40, 15-30, 18-30, 20-25, or 20-22 nucleotides in length.
[0150] The oligonucleotide may have a GC content of, for example, 30 to 70%, for example, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%. The oligonucleotide may have a melting temperature (Tm) of, for example, about 45°C to about 75°C, for example, about 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C.
[0151] In some embodiments, the oligonucleotide comprises a poly(dT) or poly(U) sequence. Such sequences can be useful for binding (e.g., hybridizing) to polyA or poly(dA) target regions. In some embodiments, the oligonucleotide comprises at least 10 (e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more, e.g., at least 25) consecutive thymidines or uridines. In some embodiments, the oligonucleotide comprises poly(dT) 25 It is.
[0152] target area The target region of the polyribonucleotide described herein is designed to hybridize to an oligonucleotide. In some embodiments, the target region has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) complementarity with an equal length portion of the oligonucleotide. In some embodiments, the target region has at most 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mismatch to the oligonucleotide. In some embodiments, the target region has no mismatch to the oligonucleotide. In some embodiments, the target region may contain modified nucleotides (e.g., with modified phosphates, sugars, or bases). In some embodiments, the target region contains a portion that is designed to hybridize to an oligonucleotide and a portion that does not hybridize to the oligonucleotide (e.g., terminal regions).
[0153] A target region may be, for example, at least 5 nucleotides (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleotides) in length. In some embodiments, a target region is, for example, 5-100, 5-95, 10-90, 10-80, 12-60, 15-50, 15-40, 15-30, 18-30, 20-25, or 20-22 nucleotides in length.
[0154] The target region may have a GC content of, for example, 30-70%, e.g., 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%. The target region may have a melting temperature (Tm) of, for example, about 45°C to about 75°C, e.g., about 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C.
[0155] In some embodiments, the target region comprises a polyA or polydA sequence. Such sequences may be useful for binding (e.g., hybridizing) to polyT or polyU oligonucleotides. In some embodiments, the target region comprises at least 10 (e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more, e.g., at least 25) consecutive adenines or deoxyadenines. In some embodiments, the target region comprises a poly(A) 25 Includes.
[0156] particle The oligonucleotides described herein can be conjugated (e.g., directly or indirectly) to a particle, such as a magnetic particle or bead. In some embodiments, an oligonucleotide is conjugated to a plurality of particles. In some embodiments, a particle is conjugated to a plurality of oligonucleotides.
[0157] The magnetic particles include at least one component that is responsive to magnetic forces. The magnetic particles may be entirely magnetic or may contain components that are non-magnetic. The magnetic particles may be magnetic beads, e.g., substantially spherical magnetic beads. The magnetic particles may be entirely magnetic or may contain one or more magnetic cores surrounded by one or more additional materials, e.g., one or more functional groups and / or modifications for binding to one or more target molecules. In some examples, the magnetic particles may contain a magnetic component and a surface modified with one or more silanol groups. This type of magnetic particle may be used to bind to target nucleic acid molecules.
[0158] The particles, e.g., magnetic particles or beads, may be porous, non-porous, hollow, solid, semi-solid, semi-fluid, fluid, and / or combinations thereof. In some cases, the particles, e.g., beads, may be dissolvable or degradable. In some cases, the particles, e.g., beads, may not be degradable. In some embodiments, the beads are composed of cross-linked agarose, e.g., SEPHAROSE® agarose.
[0159] The particles, e.g., magnetic particles or beads, may comprise natural and / or synthetic materials. For example, the particles, e.g., beads, may comprise natural polymers, synthetic polymers, or both natural and synthetic polymers. Examples of natural polymers include proteins and sugars, e.g., deoxyribonucleic acid, gums, cellulose, starches (e.g., amylose, amylopectin), proteins, enzymes, polysaccharides, silk, polyhydroxyalkanoates, chitosan, dextran, collagen, carrageenan, ispaghula, acacia, agar, gelatin, shellac, karaya gum, xanthan gum, corn sugar gum, guar gum, gum karaya, agarose, alginic acid, alginates, or natural polymers thereof. Examples of synthetic polymers include acrylic, nylon, silicone, spandex, viscose rayon, polycarboxylic acids, polyvinyl acetate, polyacrylamide, polyacrylate, polyethylene glycol, polyurethane, polylactic acid, silica, polystyrene, polyacrylonitrile, polybutadiene, polycarbonate, polyethylene, polyethylene terephthalate, poly(chlorotrifluoroethylene), poly(ethylene oxide), poly(ethylene terephthalate), polyethylene, polyisobutylene, poly(methyl methacrylate), poly(oxymethylene), polyformaldehyde, polypropylene, polystyrene, poly(tetrafluoroethylene), poly(vinyl acetate), poly(vinyl alcohol), poly(vinyl chloride), poly(vinylidene dichloride), poly(vinylidene difluoride), poly(vinyl fluoride), and / or combinations (e.g., copolymers) thereof. Beads may also be formed from materials other than polymers, including lipids, micelles, ceramics, glass-ceramics, material composites, metals, other inorganic materials, and others.
[0160] The crosslinks may be permanent or reversible, depending on the particular crosslinker used. Reversible crosslinks may allow the polymer to linearize or dissociate under appropriate conditions. In some cases, reversible crosslinks may also allow for reversible binding of materials bound to the surface of the beads.
[0161] The particles, e.g., beads or magnetic particles, may be of uniform or non-uniform size. In some cases, the diameter of the particles, e.g., beads, may be at least about 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 250 μm, 500 μm, 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, or more. In some cases, the particles, e.g., beads, may have a diameter of less than about 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 250 μm, 500 μm, 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, 10 mm or less. In some cases, the particles, e.g., beads, may have a diameter in the range of about 40-75 μm, 30-75 μm, 20-75 μm, 40-85 μm, 40-95 μm, 20-100 μm, 10-100 μm, 1-100 μm, 20-250 μm, or 20-500 μm, 500 μm-1 mm, 1 mm-2 mm, 1-5 mm, or 1-10 mm.
[0162] The particles may be of any suitable shape. Examples of particle, e.g., magnetic particle or bead, shapes include, but are not limited to, spherical, non-spherical, oval, oblong, amorphous, toroidal, cylindrical, and variations thereof.
[0163] Linker In some embodiments, a linker is used to conjugate two or more components used in the compositions or methods described herein. For example, a linker can be used to conjugate an oligonucleotide to a particle (e.g., a bead), a target region to a linear polyribonucleotide, or any combination or variation thereof. In some embodiments, the target region is conjugated to a linear polyribonucleotide by a chemical linker. In some embodiments, the oligonucleotide is conjugated to a particle by a chemical linker. The chemical linker can be conjugated to the 3' or 5' end of the oligonucleotide. Alternatively, the chemical linker can be conjugated to an internal region of the oligonucleotide. The particle can be, for example, a magnetic particle or a bead. The bead can be, for example, cross-linked agarose, for example, SEPHAROSE® beads. In some embodiments, the oligonucleotide is directly conjugated to a particle (e.g., a bead, for example, a magnetic bead or a cross-linked agarose, for example, SEPHAROSE® beads).
[0164] A chemical linker provides space, rigidity, and / or flexibility, for example, between an oligonucleotide and a particle or a target region and a linear polyribonucleotide. In some embodiments, the linker can be a bond, for example a covalent bond, for example an amide bond, a disulfide bond, a CO bond, a CN bond, an NN bond, a CS bond, or any type of bond resulting from a chemical reaction, for example chemical conjugation. In some embodiments, the linker is 250 or less atoms (e.g., 1-2, 1-4, 1-6, 1-8, 1-10, 1-12, 1-14, 1-16, 1-18, 1-20, 1-25, 1-30, 1-35, 1-40, 1-45, 1-50, 1-55, 1-60, 1-65, 1-70, 1-75, 1-80, 1-85, 1-90, 1-95, 1-100, 1-110, 1-120, 1-130, 1-140, 1-150, 1-160, 1-170, 1-180, 1- 190, 1-200, 1-210, 1-220, 1-230, 1-240, or 1-250 atoms; 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 28, 26, 24, 22, 20, 18, 16, 14, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 atom).In some embodiments, the linker has 250 or fewer non-hydrogen atoms (e.g., 1-2, 1-4, 1-6, 1-8, 1-10, 1-12, 1-14, 1-16, 1-18, 1-20, 1-25, 1-30, 1-35, 1-40, 1-45, 1-50, 1-55, 1-60, 1-65, 1-70, 1-75, 1-80, 1-85, 1-90, 1-95, 1-100, 1-110, 1-120, 1-130, 1-140, 1-150, 1-160, 1-170, 1-180, 1-19 0, 1 to 200, 1 to 210, 1 to 220, 1 to 230, 1 to 240, or 1 to 250 non-hydrogen atoms; 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 28, 26, 24, 22, 20, 18, 16, 14, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non-hydrogen atom). In some embodiments, the backbone of the linker is 250 or less atoms (e.g., 1-2, 1-4, 1-6, 1-8, 1-10, 1-12, 1-14, 1-16, 1-18, 1-20, 1-25, 1-30, 1-35, 1-40, 1-45, 1-50, 1-55, 1-60, 1-65, 1-70, 1-75, 1-80, 1-85, 1-90, 1-95, 1-100, 1-110, 1-120, 1-130, 1-140, 1-150, 1-160, 1-170, 1-180, 1 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 28, 26, 24, 22, 20, 18, 16, 14, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 atom). The "backbone" of a linker refers to the atoms in the linker that together form the shortest path from one portion of the conjugate to the other portion of the conjugate. The atoms in the backbone of the linker are directly involved in connecting one part of the conjugate to another part of the conjugate.For example, a hydrogen atom attached to a carbon in the backbone of a linker is not considered to be directly involved in linking one portion of the conjugate to another portion of the conjugate.
[0165] In some embodiments, the linker may include a synthetic group derived, for example, from a synthetic polymer (e.g., a polyethylene glycol (PEG) polymer). A chemical linker may include, for example, triethylene glycol (TEG). In some embodiments, the linker may include one or more amino acid residues. In some embodiments, the linker may be an amino acid sequence (e.g., 1-25 amino acids, 1-10 amino acids, 1-9 amino acids, 1-8 amino acids, 1-7 amino acids, 1-6 amino acids, 1-5 amino acids, 1-4 amino acids, 1-3 amino acids, 1-2 amino acids, or 1 amino acid sequence). In some embodiments, the linker may include one or more optionally substituted C 1 ~C 20 Alkylene, optionally substituted C 1 ~C 20 Heteroalkylene (e.g., PEG units), optionally substituted C 2 ~C 20 Alkenylene (e.g., C 2 alkenylene), optionally substituted C 2 ~C 20 Heteroalkenylene, optionally substituted C 2 ~C 20 Alkynylene, optionally substituted C 2 ~C 20 Heteroalkynylene, optionally substituted C 3 ~C 20 Cycloalkylene (e.g., cyclopropylene, cyclobutylene), optionally substituted C 2 ~C 20 Heterocycloalkylene, optionally substituted C 4 ~C 20 Cycloalkenylene, optionally substituted C 4 ~C 20 Heterocycloalkenylene, optionally substituted C 8 ~C20 Cycloalkynylene, optionally substituted C 8 ~C 20 Heterocycloalkynylene, optionally substituted C 5 ~C 15 Arylenes (e.g., C 6 arylene), optionally substituted C 3 ~C 15 Heteroarylene (e.g., imidazole, pyridine), O, S, NRi (where Ri is H, optionally substituted C 1 ~C 20 Alkyl, optionally substituted C 1 ~C 20 Heteroalkyl, optionally substituted C 2 ~C 20 Alkenyl, optionally substituted C 2 ~C 20 Heteroalkenyl, optionally substituted C 2 ~C 20 Alkynyl, optionally substituted C 2 ~C 20 Heteroalkynyl, optionally substituted C 3 ~C 20 Cycloalkyl, optionally substituted C 2 ~C 20 Heterocycloalkyl, optionally substituted C 4 ~C 20 Cycloalkenyl, optionally substituted C 4 ~C 20 Heterocycloalkenyl, optionally substituted C 8 ~C 20 Cycloalkynyl, optionally substituted C 8 ~C 20 Heterocycloalkynyl, optionally substituted C 5 ~C 15 Aryl or optionally substituted C 3 ~C 15 Heteroaryl), P, carbonyl, thiocarbonyl, sulfonyl, phosphate, phosphoryl, or imino.
[0166] Covalent conjugation of two or more components in a conjugate using a linker can be achieved using well-known organic chemical synthesis techniques and methods. Complementary functional groups on two components can react with each other to form a covalent bond. Examples of complementary reactive functional groups include, but are not limited to, maleimide and cysteine, amine and activated carboxylic acid, thiol and maleimide, activated sulfonic acid and amine, isocyanate and amine, azide and alkyne, and alkene and tetrazine. Site-specific conjugation to a polypeptide can be achieved using techniques known in the art.
[0167] resin In some embodiments, the methods described herein include using a resin having a plurality of particles conjugated to oligonucleotides that hybridize to a target region. The method may include using a column that includes the resin. The method may include recovering an eluate from the plurality of polyribonucleotides in the sample that includes a portion of the sample that is not hybridized to the oligonucleotide (e.g., not bound to the resin). In some embodiments, the resin includes cross-linked poly[styrene-divinylbenzene], agarose, or SEPHAROSE® agarose.
[0168] The compositions and methods of the present invention can use a surface that is linked to an oligonucleotide that contains a sequence designed to hybridize to a target region. Such oligonucleotides may include, for example, polyT, polyU, or polyT / U. The surface of the resin refers to the part of the support structure (e.g., substrate) that is accessible to contact with one or more reagents or oligonucleotides. The shape, form, material, and modification of the surface of the resin can be selected from various options depending on the application. In one embodiment, the surface of the resin is SEPHAROSE® agarose. In one embodiment, the surface of the resin is agarose.
[0169] The surface of the resin may be substantially flat or planar. Alternatively, the surface of the resin may be rounded or contoured. Exemplary contours that may be included on the surface of the resin are wells, depressions, pillars, ridges, channels, and the like.
[0170] Exemplary materials that can be used as the surface of the resin include, but are not limited to, acrylic, carbon (e.g., graphite, carbon fiber), cellulose (e.g., cellulose acetate), ceramics, controlled pore glass, cross-linked polysaccharides (e.g., agarose or SEPHAROSE® agarose), gels, glass (e.g., modified or functionalized glass), gold (e.g., atomically flat Au(l11)), graphite, inorganic glass, inorganic polymers, latex, metal oxides (e.g., SiO2, TiO2, stainless steel), metalloids, metals (e.g., atomically flat Au(l11)), mica, molybdenum disulfide, nanomaterials (e.g., highly oriented nanoparticles, such as nanotubes, nanotubes, nanoclay ... Examples of suitable resins include: heterojunction pyrolytic graphite (HOPG) nanosheets, nitrocellulose, NYLON™, optical fiber bundles, organic polymers, paper, plastics, polyacryloylmorpholide, poly(4-methylbutene), polyethylene terephthalate, poly(vinyl butyrate), polybutylene, polydimethylsiloxane (PDMS), polyethylene, polyformaldehyde, polymethacrylate, polypropylene, polysaccharides, polystyrene, polyurethane, polyvinylidene fluoride (PVDF), quartz, rayon, resins, rubber, semiconductor materials, silica, silicon (e.g., silicon surface oxide), sulfides, and TEFLON. A single material or a mixture of several different materials may form a resin useful in the present invention.
[0171] In some embodiments, the surface of the resin comprises a polymer.
[0172] In some embodiments, the surface of the resin comprises SEPHAROSE® agarose. Examples are shown below (where n is any positive integer): [ka]
[0173] In some embodiments, the surface of the resin comprises agarose. Examples are shown below (where n is any positive integer): [ka] Structure of agarose: D-galactose and 3,6-anhydro-aL-galactopyranose repeating units.
[0174] In some embodiments, the surface of the resin comprises a polystyrene-based polymer. A synthesis schematic of polystyrene divinylbenzene copolymer is shown below: [ka]
[0175] In some embodiments, the resin surface comprises an acrylic-based polymer. Poly(methyl methacrylate) is an example shown below (where n is any positive integer): [ka]
[0176] In some embodiments, the surface of the resin comprises a dextran-based polymer. Examples of dextran are shown below: [ka]
[0177] In some embodiments, the surface of the resin comprises silica. Examples are shown below: [ka]
[0178] In some embodiments, the surface of the resin comprises polyacrylamide. An example crosslinked to N-N-methylenebisacrylamide is shown below: [ka]
[0179] In some embodiments, the surface of the resin comprises a tentacle-based, for example, methacrylate-based, phase.
[0180] Several surfaces known in the art are suitable for use in the methods of the present invention. Suitable surfaces may include materials including, but are not limited to, borosilicate glass, agarose, SEPHAROSE® agarose, magnetic beads, polystyrene, polyacrylamide, membranes, silica, semiconductor materials, silicon, organic polymers, ceramics, glass, metals, plastics polycarbonate, polycarbonate, polyethylene, polyethylene glycol terephthalate, polymethylmethacrylate, polypropylene, polyvinyl acetate, polyvinyl chloride, polyvinylpyrrolidinone, and soda lime glass.
[0181] In one embodiment, the surface of the resin is modified to contain channels, patterns, layers, or other configurations (e.g., patterned surfaces). The surface can be in the form of a bead, a box, a column, a cylinder, a disk, a dish (e.g., glass dish, petri dish), a fiber, a film, a filter, a microtiter plate (e.g., a 96-well microtiter plate), a multi-blade stick, a net, a pellet, a plate, a ring, a rod, a roll, a sheet, a slide, a stick, a tray, a tube, or a vial. The surface can be a single individual body (e.g., a single tube, a single bead), any number of multiple surface bodies (e.g., a rack of 10 tubes, several beads), or a combination thereof (e.g., a tray containing multiple microtiter plates, a column packed with beads, a microtiter plate packed with beads).
[0182] In some embodiments, the surface may comprise a membrane-based resin matrix. In some embodiments, the resin surface comprises a porous or non-porous resin. Examples of porous resins include additional agarose-based resins (e.g., cyanogen bromide-activated SEPHAROSE® agarose (GE); WorkBeads™ 40 ACT and WorkBeads 40 / 10000ACT (Bioworks)), methacrylates: (such as Tosoh's 650M derivatives), polystyrene divinylbenzene (Life Tech's Poros medium / GE's Source medium), fractogel, polyacrylamide, silica, controlled pore glass, dextran derivatives, acrylamide derivatives, additional polymers, and combinations thereof.
[0183] In some embodiments, the surface may include one or more pores, hi some embodiments, the pore size may be between 300 and 8,000 angstroms, for example between 500 and 4,000 angstroms.
[0184] The resins described herein include a plurality of particles. Examples of particle sizes include 5 μm to 500 μm, 20 μm to 300 μm, and 50 μm to 200 μm. In some embodiments, the particle size can be 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 110 μm, 120 μm, 130 μm, 140 μm, 150 μm, 160 μm, 170 μm, 180 μm, 190 μm, or 200 μm.
[0185] The oligonucleotides can be immobilized, coated, bound, affixed, adhered, or conjugated to any of the forms of surfaces described herein (e.g., beads, boxes, columns, cylinders, disks, dishes (e.g., glass dishes, petri dishes), fibers, films, filters, microtiter plates (e.g., 96-well microtiter plates), multi-blade sticks, nets, pellets, plates, rings, rods, rolls, sheets, slides, sticks, trays, tubes, or vials).
[0186] In one embodiment, the surface is modified to contain chemical modification sites that can be used to attach (e.g., either covalently or non-covalently) oligonucleotides to discrete sites or locations on the surface. Chemical modification sites include, for example, the addition of a pattern of chemical functional groups, including amino, carboxy, oxo, and thiol groups, that can be used to covalently attach oligonucleotides, and generally also contain corresponding reactive functional groups. Examples of surface functionalization include amino derivatives, thiol derivatives, aldehyde derivatives, formyl derivatives, azide derivatives (click chemistry), biotin derivatives, alkyne derivatives, hydroxyl derivatives, activated hydroxyl or derivatives, carboxylic acid derivatives, activated carboxylic acid derivatives, activated carbonates, activated esters, NHS esters (succinimidyl), NHS carbonates (succinimidyl), imidoesters or derivatives, cyanogen bromide derivatives, maleimide derivatives, haloacteyl derivatives. , iodoacetamide / iodoacetyl derivatives, epoxide derivatives, streptavidin derivatives, tresyl derivatives, dienes / conjugated diene derivatives (Diels-Alder type reactions), alkene derivatives, substituted phosphate derivatives, bromohydrins / halohydrins, substituted disulfides, pyridyl-disulfide derivatives, aryl azides, acyl azides, azlactones, hydrazide derivatives, halobenzene derivatives, nucleoside derivatives, branched / multifunctional linkers, dendrimer functionality, nucleoside derivatives, or any combination thereof.
[0187] In some embodiments, the binding capacity of the linked surface can be at least 1 mg / mL, 5 mg / mL, 10 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, 50 mg / mL, or more.
[0188] In some embodiments, the column containing the resin is designed to bind at least 500 μg (e.g., at least 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, or more) of polyribonucleotide, e.g., to a target region. In some embodiments, the column is designed to bind between 500 μg and 1,000 mg of polyribonucleotide, e.g., to a target region.
[0189] composition As described herein, the invention features compositions comprising a population of polyribonucleotides produced by the methods described herein. The population may, for example, comprise cyclic polyribonucleotides lacking a target region, where the cyclic polyribonucleotides comprise at least 1% (e.g., at least 5%, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) (mol / mol) of the total polyribonucleotides in the composition. In some embodiments, the population has less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) (mol / mol) of linear polyribonucleotides in the composition.
[0190] In other embodiments, the population comprises, e.g., polyribonucleotides in a first configuration having a target region and polyribonucleotides in a second configuration having a target region, wherein the polyribonucleotides in the first configuration comprise at least 1%, e.g., at least 5%, e.g., at least 10%, at least 20%, at least 30%, or at least 40% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) (mol / mol) of the total polyribonucleotides in the composition.
[0191] In some embodiments described herein, the invention features a composition comprising a mixture of polyribonucleotides. A first subset of the mixture comprises cyclic polyribonucleotides lacking a target region, and a second subset of the plurality of polyribonucleotides comprises linear polyribonucleotides having a target region. The first subset comprises at least 1%, e.g., at least 5%, e.g., at least 10%, at least 20%, at least 30%, or at least 40% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) (mol / mol) of the total polyribonucleotides in the composition. In some embodiments, the linear polyribonucleotides comprise a variety of different linear polyribonucleotide species, e.g., each containing a target region.
[0192] In some embodiments described herein, the invention provides a composition comprising a polyribonucleotide having a target region and an oligonucleotide designed to hybridize to the target region, where the oligonucleotide is conjugated to a particle, e.g., via a linker.
[0193] In some embodiments of any of the compositions described herein, the linear polyribonucleotide comprises an intron or a portion thereof. The target region may be located 5' or 3' to the intron or portion thereof.
[0194] In some embodiments, the polyribonucleotide may be a modified polyribonucleotide.
[0195] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), or 100% (w / w) pure by mass. Purity can be measured by any one of several analytical techniques known to those skilled in the art, including, for example and without limitation, the use of separation techniques such as chromatography (column-based, paper-based, gel-based, HPLC-based, UHPLC-based, etc., or by IC, SEC, reversed-phase, anion-exchange, mixed-mode, etc.) or electrophoresis (urea-PAGE, chip-based, polyacrylamide gel, RNA, capillary, c-IEF, etc.), with or without the use of detection techniques based on mass spectrometry, UV-visible light, fluorescence, light scattering, refractive index, or pre- or post-separation derivatization methods using silver or dye stains or radioactive decay for detection. Alternatively, purity can be measured without the use of separation techniques by mass spectrometry, by microscopy, by circular dichroism (CD) spectroscopy, by UV or UV-vis spectrophotometry, by fluorescence measurements (e.g., Qubit), by RNase H analysis, by surface plasmon resonance (SPR), or by methods using silver or dye stains or radioactive decay for detection.
[0196] In some embodiments, purity can be measured by biological testing methods (e.g., cell-based or receptor-based tests). In some embodiments, at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), or 100% (w / w) of the total ribonucleotide population in the preparations described herein is contained in circular polyribonucleotide molecules. The percentage can be measured by any one of several analytical techniques known to those skilled in the art, including, for example and without limitation, using separation techniques such as chromatography (column-based, paper-based, gel-based, HPLC-based, UHPLC-based, etc., or by IC, SEC, reversed-phase, anion-exchange, mixed-mode, etc.) or electrophoresis (urea-PAGE, chip-based, polyacrylamide gel, RNA, capillary, c-IEF, etc.), with or without the use of detection techniques based on mass spectrometry, UV-visible light, fluorescence, light scattering, refractive index, or pre- or post-separation derivatization methods using silver or dye stains or radioactive decay for detection. Alternatively, the purity can be measured without the use of separation techniques by mass spectrometry, by microscopy, by circular dichroism (CD) spectroscopy, by UV or UV-vis spectrophotometry, by fluorescence measurements (e.g., Qubit), by RNase H analysis, by surface plasmon resonance (SPR), or by methods using silver or dye stains or radioactive decay for detection.
[0197] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) has a concentration of at least 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 0.1 μg / mL, 0.5 μg / mL, 1 μg / mL, 2 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL , 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, 100 μg / mL, 200 μg / mL, 300 μg / mL, 500 μg / mL, 1000 μg / mL, 5000 μg / mL, 10,000 μg / mL, 100,000 μg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, 500 mg / mL, 600 mg / mL, 650 mg / mL, 700 mg / mL, or 750 mg / mL of cyclic polyribonucleotide. In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) is substantially free of mononucleotides or has a mononucleotide content of less than or equal to 1 pg / mL, 10 pg / mL, 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 1000 μg / mL, 5000 μg / mL, 10,000 μg / mL, or 100,000 μg / mL.In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) has a mononucleotide content from a limit of detection of at most 1 pg / mL, 10 pg / mL, 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 1000 μg / mL, 5000 μg / mL, 10,000 μg / mL, or 100,000 μg / mL.
[0198] In certain embodiments, the cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) comprises, by mass, 0.1% (w / w), 0.2% (w / w), 0.3% (w / w), 0.4% (w / w), 0.5% (w / w), 0.6% (w / w), 0.7% (w / w), 0.8% (w / w), 0.9% (w / w), 1% (w / w) of total nucleotides. ), 2% (w / w), 3% (w / w), 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), or any percentage therebetween, where the total nucleotide content is the total mass of deoxyribonucleotide and ribonucleotide molecules.
[0199] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) is administered at any concentration of 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 600 ng / mL, 1 μg / mL, 10 μg / mL, 20 μg / mL, 25 μg / mL, 30 ...20 μg / mL, In some embodiments, the linear RNA content is less than or equal to 1 mg / mL, 50 μg / mL, 100 μg / mL, 200 g / mL, 300 μg / mL, 400 μg / mL, 500 μg / mL, 600 μg / mL, 700 μg / mL, 800 μg / mL, 900 μg / mL, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 5 mg / mL, 10 mg / mL, 50 mg / mL, 100 mg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, 500 mg / mL, 600 mg / mL, 650 mg / mL, 700 mg / mL, or 750 mg / mL of linear RNA, e.g., linear RNA counterparts or RNA fragments.In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) has a concentration of at most 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 600 ng / mL, 1 μg / mL, 10 μg / mL, or more. In some embodiments, the linear RNA content, e.g., linear RNA counterparts or RNA fragments, from a detection limit of 100 μg / mL, 50 μg / mL, 100 μg / mL, 200 g / mL, 300 μg / mL, 400 μg / mL, 500 μg / mL, 600 μg / mL, 700 μg / mL, 800 μg / mL, 900 μg / mL, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 5 mg / mL, 10 mg / mL, 50 mg / mL, 100 mg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, 500 mg / mL, 600 mg / mL, 650 mg / mL, 700 mg / ml, or 750 mg / ml.
[0200] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) has a nicked RNA content of less than or equal to 10% (w / w), 9.9% (w / w), 9.8% (w / w), 9.7% (w / w), 9.6% (w / w), 9.5% (w / w), 9.4% (w / w), 9.3% (w / w), 9.2% (w / w), 9.1% (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5% (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1% (w / w), 0.5% (w / w), or 0.1% (w / w), or any percentage therebetween. In certain embodiments, a circular polyribonucleotide preparation (e.g., a circular polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a circular polyribonucleotide preparation) has a nicked RNA content as low as zero or is substantially free of nicked RNA.
[0201] In certain embodiments, a circular polyribonucleotide preparation (e.g., a circular polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a circular polyribonucleotide preparation) has a combined linear and nicked RNA content of less than or equal to 30% (w / w), 25% (w / w), 20% (w / w), 15% (w / w), 10% (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5% (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1% (w / w), 0.5% (w / w), or 0.1% (w / w), or any percentage therebetween. In certain embodiments, a circular polyribonucleotide preparation (e.g., a circular polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a circular polyribonucleotide preparation) has a combined content of nicked RNA and linear RNA as low as zero, or is substantially free of nicked and linear RNA.
[0202] In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) has linear RNA content, e.g., linear RNA counterparts or RNA fragments, below the detection limit of an analytical method such as a method using mass spectrometry, UV spectroscopy or fluorescence detectors, light scattering techniques, surface plasmon resonance (SPR), with or without the use of HPLC, including HPLC, chip or gel-based electrophoretic separation methods, derivatization methods either before or after separation, detection methods using silver or dye staining or radioactive decay, or with or without the use of microscopy, visual methods or spectrophotometers.
[0203] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) has no more than 0.1% (w / w), 1% (w / w), 2% (w / w), 3% (w / w), 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 35% (w / w), 40% (w / w), 45% (w / w), 50% (w / w) or less linear RNA, e.g., as measured by the method in Example 2.
[0204] In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation comprise a linear counterpart of a circular polyribonucleotide molecule or a fragment thereof. In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation comprise a linear counterpart (e.g., a pre-circularized version). In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation comprise a non-counterpart to a circular polyribonucleotide or a fragment thereof. In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation comprise a non-counterpart to a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide molecules comprise a combination of a counterpart of a circular polyribonucleotide and a non-counterpart of a circular polyribonucleotide or a fragment thereof. In some embodiments, the linear polyribonucleotide molecules comprise a combination of a counterpart of a circular polyribonucleotide and a non-counterpart of a circular polyribonucleotide. In some embodiments, linear polyribonucleotide molecule fragments are fragments that are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, or more nucleotides in length, or any number of nucleotides in between.
[0205] In some embodiments, the cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of the cyclic polyribonucleotide preparation) has an A260 / A280 absorbance ratio of about 1.6 to about 2.3, e.g., as measured by a spectrophotometer. In some embodiments, the A260 / A280 absorbance ratio is about 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, or any number therebetween. In some embodiments, the cyclic polyribonucleotide (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of the cyclic polyribonucleotide) has an A260 / A280 absorbance ratio of greater than about 1.8, e.g., as measured by a spectrophotometer. In some embodiments, the A260 / A280 absorbance ratio is about 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or greater.
[0206] In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) is substantially free of impurities or by-products. In various embodiments, the level of at least one impurity or by-product in a composition comprising a cyclic polyribonucleotide is reduced by at least 30% (w / w), at least 40% (w / w), at least 50% (w / w), at least 60% (w / w), at least 70% (w / w), at least 80% (w / w), at least 90% (w / w), or at least 95% (w / w) compared to the composition prior to purification or treatment to remove the impurity or by-product. In some embodiments, the level of at least one process-related impurity or by-product is reduced by at least 30% (w / w), at least 40% (w / w), at least 50% (w / w), at least 60% (w / w), at least 70% (w / w), at least 80% (w / w), at least 90% (w / w), or at least 95% (w / w) when compared to the composition prior to purification or treatment to remove the impurity or by-product. In some embodiments, the level of at least one product-related substance is reduced by at least 30% (w / w), at least 40% (w / w), at least 50% (w / w), at least 60% (w / w), at least 70% (w / w), at least 80% (w / w), at least 90% (w / w), or at least 95% (w / w) when compared to the composition prior to purification or treatment to remove the impurity or by-product. In some embodiments, the cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of the cyclic polyribonucleotide preparation) is further substantially free of process-related impurities or by-products.In some embodiments, the process-related impurities or by-products include proteins (e.g., cellular proteins such as host cell proteins), deoxyribonucleic acids (e.g., cellular deoxyribonucleic acids such as host cell deoxyribonucleic acids), monodeoxyribonucleotide or dideoxyribonucleotide molecules, enzymes (e.g., nucleases, e.g., endonucleases or exonucleases, or ligases), reagent components, gel components, or chromatographic materials. In some embodiments, the impurities or by-products are selected from buffer reagents, ligases, nucleases, ribonuclease inhibitors, ribonuclease R, deoxyribonucleotide molecules, acrylamide gel strips, and monodeoxyribonucleotide molecules. In some embodiments, the pharmaceutical preparation contains less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng, or 500 ng of protein contaminants per milligram (mg) of circular polyribonucleotide molecule.
[0207] In some embodiments, the cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediates in the production of the cyclic polyribonucleotide preparation) is substantially free of DNA content, e.g., the template DNA or cellular DNA (e.g., host cell DNA) has a DNA content as low as 0, or as low as 1 pg / mL, 10 pg / mL, 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, , 15ng / mL, 20ng / mL, 25ng / mL, 30ng / mL, 35ng / mL, 40ng / mL, 50ng / mL, 60ng / mL, 70ng / mL, 80ng / mL, 90ng / mL, 100ng / mL, 200ng / mL, 300ng / mL, 400ng / mL, 500ng / mL, 1000μg / mL, 5000μg / mL, 10,000μg / mL, or 100,000μg / mL.
[0208] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) is substantially free of DNA content, has a DNA content as low as 0, or has a DNA content of 0.001% (w / w), 0.01% (w / w), 0.1% (w / w), 1% (w / w), 2% (w / w), 3% (w / w), or less of total nucleotides by mass. and having a DNA content of 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 35% (w / w), 40% (w / w), 45% (w / w), 50% (w / w) or less, where total nucleotide molecules is the total mass of deoxyribonucleotide molecules and ribonucleotide molecules. In some embodiments, the cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) is substantially free of DNA content, as low as zero, as measured by quantitative liquid chromatography-mass spectrometry (LC-MS) following total DNA digestion with a nucleoside digesting enzyme (the DNA content is back-calculated from a calibration curve for each base (i.e., A, C, G, T) as measured by LC-MS). or has a DNA content of less than 0.001% (w / w), 0.01% (w / w), 0.1% (w / w), 1% (w / w), 2% (w / w), 3% (w / w), 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 35% (w / w), 40% (w / w), 45% (w / w), 50% (w / w) of total nucleotides on a mass basis.
[0209] In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) has less than 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / ml, or 500 ng / ml of protein (e.g., cellular proteins (CPs), e.g., enzymes, product-associated proteins, e.g., carrier proteins), contaminants, impurities, or by-products. In some embodiments, the cyclic polyribonucleotide (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide) has protein (e.g., cellular protein (CP), product-associated protein such as an enzyme), contaminant, impurity, or by-product from a detection limit of at most 0.1 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / ml, or 500 ng / ml.
[0210] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) has less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng, or 500 ng of protein (e.g., cellular protein (CP), product-associated protein such as an enzyme), contaminant, impurity, or by-product per milligram (mg) of cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide) has a detection level of at most 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng, or 500 ng of protein (e.g., cellular protein (CP), product-associated protein such as an enzyme), contaminant, impurity, or by-product per milligram (mg) of cyclic polyribonucleotide.
[0211] In certain embodiments, the cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of the cyclic polyribonucleotide preparation) has low levels of endotoxins or is substantially free of endotoxins, for example, as measured by the Limulus Amebocyte Lysate (LAL) test. In some embodiments, the pharmaceutical preparation or composition or intermediate in the production of the cyclic polyribonucleotide contains less than 20 EU / kg (by weight), 10 EU / kg, 5 EU / kg, 1 EU / kg, or is devoid of endotoxins, as measured by the Limulus Amebocyte Lysate Test. In certain embodiments, the cyclic polyribonucleotide composition has low levels or is free of nucleases or ligases.
[0212] In some embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or an intermediate in the production of a cyclic polyribonucleotide preparation) is about 50% (w / w), 45% (w / w), 40% (w / w), 35% (w / w), 30% (w / w), 25% (w / w), 20% (w / w), 19% (w / w), 18% (w / w), 17% (w / w), 20% (w / w), 25 ... ), 16% (w / w), 15% (w / w), 14% (w / w), 13% (w / w), 12% (w / w), 11% (w / w), 10% (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5% (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1% (w / w) or less of at least one enzyme, e.g., a polymerase, e.g., an RNA polymerase.
[0213] In certain embodiments, a cyclic polyribonucleotide preparation (e.g., a cyclic polyribonucleotide pharmaceutical preparation or composition or intermediate in the production of a cyclic polyribonucleotide preparation) is sterile or substantially free of microorganisms, e.g., the composition or preparation supports the growth of less than 100 viable microorganisms when tested under sterile conditions, the composition or preparation meets the USP <71> and / or the composition or preparation meets the criteria of U.S.P. <85> In some embodiments, the pharmaceutical preparation comprises a bioburden of less than 100 CFU / 100 ml, 50 CFU / 100 ml, 40 CFU / 100 ml, 30 CFU / 100 ml, 200 CFU / 100 ml, 10 CFU / 100 ml, or 10 CFU / 100 ml prior to sterilization.
[0214] In some embodiments, the circular polyribonucleotide preparation can be further purified to remove impurities or by-products using techniques known in the art, such as column chromatography or pH, vial inactivation, etc.
[0215] In some embodiments, the total weight of polyribonucleotides in the composition comprises at least 500 μg (e.g., at least 600 μg, 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1,000 mg, or more). In some embodiments, the total weight of polyribonucleotides in the population of polyribonucleotides is between 500 μg and 1000 mg.
[0216] Polynucleotides The present invention features polyribonucleotides used in methods of separation and / or purification and present in compositions described herein. The polyribonucleotides described herein may be linear polyribonucleotides, cyclic polyribonucleotides, or combinations thereof. In some embodiments, cyclic polyribonucleotides are generated from linear polyribonucleotides (e.g., by splicing compatible ends of a linear polyribonucleotide). In some embodiments, linear polyribonucleotides are transcribed from a deoxyribonucleotide template (e.g., a vector, a linearized vector, or a cDNA). Thus, the present invention features linear deoxyribonucleotides, cyclic deoxyribonucleotides, linear polyribonucleotides, and cyclic polyribonucleotides and compositions thereof that are useful in the generation of polyribonucleotides.
[0217] Linear Polyribonucleotides The invention features linear polyribonucleotides that can include one or more of the following: a 3' intron fragment; a 3' splice site; a 3' exon; a polyribonucleotide cargo; a 5' exon; a 5' splice site; and a 5' intron fragment. In some embodiments, the 3' intron fragment corresponds to a 3' portion of a catalytic group I intron, such as from the cyanobacteria Anabaena pre-tRNA-Leu gene, Tetrahymena pre-rRNA, T4 phage td gene, or a mutant thereof. In some embodiments, the 5' intron fragment corresponds to a 5' portion of a catalytic group I intron, such as from the cyanobacteria Anabaena pre-tRNA-Leu gene, Tetrahymena pre-rRNA, T4 phage td gene, or a mutant thereof.
[0218] A linear polyribonucleotide may include additional elements, for example, outside or between any of the above elements. For example, any of the above elements may be separated by a spacer sequence, as described herein. A target region as described herein may be present within any region of a linear polyribonucleotide as described herein. In some embodiments, a target region is present within an intron or a portion thereof.
[0219] In certain embodiments, provided herein are methods of generating linear polyribonucleotides by performing transcription in a cell-free system (e.g., in vitro transcription) using a deoxyribonucleotide provided herein (e.g., a vector, a linearized vector, or a cDNA) as a template (e.g., a vector, a linearized vector, or a cDNA provided herein in which an RNA polymerase promoter is positioned upstream of a region encoding the linear polyribonucleotide).
[0220] A deoxyribonucleotide template can be transcribed to produce a linear polyribonucleotide containing the components described herein. Upon expression, the linear polyribonucleotide can produce a splicing-compatible polyribonucleotide that can be spliced to produce a circular polyribonucleotide, for example, for later use.
[0221] In some embodiments, the linear polyribonucleotide is 50 to 20,000, e.g., 300 to 20,000 (e.g., 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1, A linear polyribonucleotide can be, for example, at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length.
[0222] Circular Polyribonucleotides In some embodiments, the invention features a circular polyribonucleotide. The circular polyribonucleotide may include a splice junction connecting a 5' exon and a 3' exon. The target region described herein may be present within any region of the circular polyribonucleotide described herein. The circular polyribonucleotide may lack an intron, for example, after splicing.
[0223] The circular polynucleotide may further comprise a polyribonucleotide cargo. The polyribonucleotide cargo may comprise an expressed sequence, a non-coding sequence, or a combination of expressed and non-coding sequences. The polyribonucleotide cargo may comprise an expressed sequence encoding a polypeptide. The polyribonucleotide may comprise an IRES operably linked to the expressed sequence encoding the polypeptide. In some embodiments, the circular polyribonucleotide further comprises a spacer region between the IRES and the 5' exon fragment or the 3' exon fragment. The spacer region may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. The spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. In some embodiments, the spacer region comprises a polyA sequence. In some embodiments, the spacer region comprises poly AC, poly AG, poly AU, or other heterogeneous or random sequences.
[0224] In some embodiments, a cyclic polyribonucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.
[0225] In some embodiments, the size of the circular polyribonucleotide can be sufficient to accommodate the binding site for ribosome.In some embodiments, the size of the circular polyribonucleotide can be sufficient to code useful polypeptides, and thus can generate lengths of at least 20,000 nucleotides, at least 15,000 nucleotides, at least 10,000 nucleotides, at least 7,500 nucleotides, at least 5,000 nucleotides, at least 4,000 nucleotides, at least 3,000 nucleotides, at least 2,000 nucleotides, at least 1,000 nucleotides, at least 500 nucleotides, at least 1400 nucleotides, at least 300 nucleotides, at least 200 nucleotides, at least 100 nucleotides.
[0226] In some embodiments, the circular polyribonucleotide comprises one or more elements as described herein. In some embodiments, the elements can be separated from each other by a spacer sequence. In some embodiments, the elements can be separated from each other by 1 ribonucleotide, 2 nucleotides, about 5 nucleotides, about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 80 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, about 900 nucleotides, about 1000 nucleotides, up to about 1 kb, at least about 1000 nucleotides, or any amount of nucleotides therebetween. In some embodiments, one or more elements are adjacent to each other, e.g., lacking a spacer element.
[0227] In some embodiments, the cyclic polyribonucleotide may include one or more repeat elements. In some embodiments, the cyclic polyribonucleotide includes one or more modifications described herein. In one embodiment, the cyclic polyribonucleotide includes at least one nucleoside modification. In one embodiment, up to 100% of the nucleosides of the cyclic polyribonucleotide are modified. In one embodiment, the at least one nucleoside modification is a uridine modification or an adenosine modification.
[0228] As a result of its circularization, a cyclic polyribonucleotide may contain certain features that distinguish it from linear polyribonucleotides. For example, a cyclic polyribonucleotide may contain more or less accessible target regions than a linear polyribonucleotide. In some embodiments, a cyclic polyribonucleotide may be less susceptible to degradation by exonucleases when compared to linear polyribonucleotides. As such, a cyclic polyribonucleotide may be more stable than a linear polyribonucleotide, especially when incubated in the presence of an exonuclease. The increased stability of a cyclic polyribonucleotide compared to a linear polyribonucleotide makes it more useful as a cell transformation reagent for producing polypeptides, and it can be stored more easily and for longer than a linear polyribonucleotide. The stability of an exonuclease-treated cyclic polyribonucleotide can be tested using methods standard in the art that determine whether RNA degradation has occurred (e.g., by gel electrophoresis). Furthermore, unlike linear polyribonucleotides, circular polyribonucleotides may be less susceptible to dephosphorylation when the circular polyribonucleotides are incubated with a phosphatase, such as calf intestinal phosphatase.
[0229] Polyribonucleotide Cargo The polyribonucleotide cargo described herein includes any sequence comprising at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo comprises an expressed sequence, a non-coding sequence, or an expressed sequence and a non-coding sequence. In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo comprises an IRES operably linked to an expressed sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having a biological effect on a subject.
[0230] The polyribonucleotide cargo may comprise, for example, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments the polyribonucleotide cargo comprises from 1 to 20,000 nucleotides, from 1 to 10,000 nucleotides, from 1 to 5,000 nucleotides, from 100 to 20,000 nucleotides, from 100 to 10,000 nucleotides, from 100 to 5,000 nucleotides, from 500 to 20,000 nucleotides, from 500 to 10,000 nucleotides, from 500 to 5,000 nucleotides, from 1,000 to 20,000 nucleotides, from 1,000 to 10,000 nucleotides, or from 1,000 to 5,000 nucleotides.
[0231] In embodiments, the polyribonucleotide cargo comprises one or more expressed (or coding) sequences, where each expressed (or coding) sequence encodes a polypeptide. In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences. In embodiments, the polyribonucleotide cargo consists entirely of non-coding sequences. In embodiments, the polyribonucleotide cargo comprises a combination of expressed (or coding) sequences and non-coding sequences.
[0232] In some embodiments, the polyribonucleotides produced as described herein are used as effectors in therapy or agriculture.For example, the cyclic polyribonucleotides produced by the methods described herein (e.g., the cell-free methods described herein) can be administered to a subject (e.g., in pharmaceutical, veterinary, or agricultural compositions).In another example, the cyclic polyribonucleotides produced by the methods described herein (e.g., the cell-free methods described herein) can be delivered to a cell.
[0233] In some embodiments, the polyribonucleotide comprises any feature, or any combination of features, as disclosed in PCT Publication No. WO 2019 / 118919, the entirety of which is incorporated herein by reference.
[0234] In some embodiments, the polyribonucleotide cargo comprises an open reading frame. In some embodiments, the open reading frame is operably linked to an IRES. The open reading frame may encode an RNA or a polypeptide. In some embodiments, the open reading frame encodes a polypeptide and the polyribonucleotide (e.g., a cyclic polyribonucleotide) provides increased expression of the polypeptide (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more), e.g., when compared to a linear polyribonucleotide encoding the polypeptide. In some embodiments, increasing the purity of polyribonucleotides, e.g., circular polyribonucleotides, results in increased expression of polypeptides (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more), e.g., when compared to a population of circular and linear polyribonucleotides.
[0235] Polypeptide Expression Sequences In some embodiments, a polyribonucleotide described herein (e.g., the polyribonucleotide cargo of a circular polyribonucleotide) comprises one or more expressed (or coding) sequences, where each expressed sequence encodes a polypeptide. In some embodiments, a circular polyribonucleotide comprises two, three, four, five, six, seven, eight, nine, ten or more expressed (or coding) sequences.
[0236] Each encoded polypeptide may be linear or branched. In an embodiment, the polypeptide has a length of about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, polypeptides have a length of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less that may be useful.
[0237] The polypeptides included herein may include naturally occurring or non-naturally occurring polypeptides. In some embodiments, the polypeptide is or includes a functional fragment or variant of a reference polypeptide (e.g., an enzymatically active fragment or variant of an enzyme). For example, the polypeptide may be a functionally active variant of any of the polypeptides described herein that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of a polypeptide described herein or a naturally occurring polypeptide, e.g., over a specific region or over the entire sequence. In some cases, a polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) identity to a protein of interest.
[0238] Some examples of polypeptides include, but are not limited to, a fluorescent tag or marker, an antigen, a therapeutic polypeptide, a plant modifying polypeptide, or a polypeptide for agricultural use.
[0239] The therapeutic polypeptide may be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., oxidoreductases, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, lysosomal enzymes, desaturases), a cytokine, an antigen-binding polypeptide (e.g., an antigen-binding antibody or antibody-like fragment, such as a single chain antibody, nanobody or other polypeptide comprising an Ig heavy or light chain), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenetic protein, an interferon, an interleukin, and a thrombolytic agent.
[0240] Polypeptides for agricultural use may be bacteriocins, lysins, antibacterial polypeptides, antifungal polypeptides, nodule C-rich peptides, bacteriocyte regulatory peptides, peptide toxins, pesticidal polypeptides (e.g., insecticidal or nematicidal polypeptides), antigen-binding polypeptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single chain antibodies, nanobodies or other Ig heavy or light chain-containing polypeptides), enzymes (e.g., nucleases, amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones, and transcription factors.
[0241] In some cases, the polyribonucleotide expresses a non-human protein.
[0242] In some embodiments, the polyribonucleotide expresses an antibody, such as an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the cyclic polyribonucleotide can be any isotype, such as IgA, IgD, IgE, IgG, IgM, etc. In some embodiments, the cyclic polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, or further portions thereof. In some embodiments, the cyclic polyribonucleotide expresses one or more portions of an antibody. For example, the cyclic polyribonucleotide can include two or more expression sequences, each of which expresses a portion of an antibody, the sum of which can constitute an antibody. In some cases, the cyclic polyribonucleotide includes one expression sequence that encodes a heavy chain of the antibody, and another expression sequence that encodes a light chain of the antibody. In some cases, when the cyclic polyribonucleotide is expressed in a cell or in a cell-free environment, the light and heavy chains can undergo appropriate modification, folding, or other post-translational modifications to form a functional antibody.
[0243] In embodiments, the polypeptide comprises multiple polypeptides, e.g., multiple copies of a single polypeptide sequence, or multiple different polypeptide sequences, In embodiments, the multiple polypeptides are connected by linker or spacer amino acids.
[0244] In an embodiment, the polynucleotide cargo comprises a sequence encoding a signal peptide. Many signal peptide sequences have been described, for example, the Tat (twin arginine translocation) signal sequence is typically an N-terminal peptide sequence containing a consensus SRRxFLK "twin arginine" motif that serves to translocate folded proteins containing such Tat signal peptides through lipid bilayers. Also see, for example, the publicly available signal peptide database at www.signalpeptide.de. Signal peptides are also useful for directing proteins to specific organelles; see, for example, the experimentally measured and computationally predicted signal peptides disclosed in the publicly available Spdb signal peptide database at proline.bic.nus.edu.sg / spdb.
[0245] In embodiments, the polynucleotide cargo comprises a sequence encoding a cell penetrating peptide (CPP). Hundreds of CPP sequences have been described; see, for example, CPPsite, a database of publicly available cell penetrating peptides at crdd[dot]osdd[dot]net / raghava / cppsite / . An example of a commonly used CPP sequence is a poly-arginine sequence, such as octoarginine or nonoarginine, which can be fused to the C-terminus of a CGI peptide.
[0246] In embodiments, the polynucleotide cargo comprises a sequence encoding a self-assembling peptide; see, e.g., Miki et al. (2021) Nature Communications, 21:3412, DOI:10.1038 / s41467-021-23794-6.
[0247] In some embodiments, the expressed sequence includes a polyA sequence (e.g., at the 3' end of the expressed sequence). In some embodiments, the length of the polyA sequence is more than 10 nucleotides in length. In one embodiment, the polyA sequence is more than 15 nucleotides in length (e.g., is at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides in length). In some embodiments, the polyA sequence is designed according to the description of polyA sequences in paragraphs
[0202] to
[0204] of WO 2019 / 118919 A1, the entirety of which is incorporated herein by reference. In some embodiments, the expression sequence lacks a polyA sequence (e.g., at the 3' end of the expression sequence).
[0248] In some embodiments, the cyclic polyribonucleotide comprises a polyA, lacks a polyA, or has a modified polyA to modulate one or more characteristics of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide lacks a polyA or has a modified polyA to improve one or more functional properties, such as immunogenicity (e.g., the level of one or more markers of an immune or inflammatory response), half-life, and / or expression efficiency.
[0249] Therapeutic Polypeptides In some embodiments, the polyribonucleotides described herein (e.g., the polyribonucleotide cargo of a cyclic polyribonucleotide) comprise at least one expression sequence that encodes a therapeutic polypeptide. A therapeutic polypeptide is a polypeptide that provides some therapeutic benefit when administered to or expressed in a subject. Administration of a therapeutic polypeptide to a subject or expression in a subject can be used to treat or prevent a disease, disorder, or condition or a symptom thereof. In some embodiments, a cyclic polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more therapeutic polypeptides.
[0250] In some embodiments, the polyribonucleotide comprises an expression sequence that encodes a therapeutic protein. The protein can treat a disease in a subject in need thereof. In some embodiments, the therapeutic protein can compensate for a mutated, under-expressed, or absent protein in a subject in need thereof. In some embodiments, the therapeutic protein can target, interact with, or bind to a cell, tissue, or virus in a subject in need thereof.
[0251] A therapeutic polypeptide can be a polypeptide that can be secreted from the cell or that can be localized in the cytoplasm, nucleus, or membrane compartment of the cell.
[0252] Therapeutic polypeptides can be any of a variety of therapeutic polypeptides, including hormones, neurotransmitters, growth factors, enzymes (e.g., oxidoreductases, metabolic enzymes, mitochondrial enzymes, oxygenases, dehydrogenases, ATP-independent enzymes, lysosomal enzymes, desaturases), cytokines, transcription factors, antigen-binding polypeptides (e.g., antigen-binding antibodies or antibody-like fragments, such as single chain antibodies, nanobodies, or other polypeptides comprising an Ig heavy or light chain), Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, interferons, interleukins, thrombolytic agents, antigens (e.g., tumor, viral, or bacterial antigens), nucleases (e.g., Cas proteins, endonucleases such as Cas9), membrane proteins (e.g., chimeric antigen receptors (CARs), transmembrane receptors, G protein-coupled receptors (GPCRs), receptor tyrosine kinases (RTKs), antigen receptors, ion channels, or membrane transporters), secreted proteins, gene editing proteins (e.g., CRISPR-Cas, TALENs, or Zn fingers), or gene writing proteins. The present invention may also be directed to a method for the preparation of a medicament for the treatment of a cancer, such as the administration of a medicament for the treatment of a cancer.
[0253] In some embodiments, the therapeutic polypeptide is an antibody, e.g., a full-length antibody, an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the polyribonucleotide (e.g., a cyclic polyribonucleotide) can be of any isotype, such as IgA, IgD, IgE, IgG, IgM, etc. In some embodiments, the polyribonucleotide expresses a portion of the expressed antibody, e.g., a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, or further portions thereof. In some embodiments, the polyribonucleotide expresses one or more portions of an antibody. For example, the polyribonucleotide can include two or more expression sequences, each of which expresses a portion of an antibody, the sum of which can constitute an antibody. In some cases, the polyribonucleotide includes one expression sequence that encodes a heavy chain of the antibody, and another expression sequence that encodes a light chain of the antibody. When the polyribonucleotide is expressed subcellularly, the light and heavy chains can undergo appropriate modification, folding, or other post-translational modifications to form a functional antibody.
[0254] In some embodiments, polyribonucleotides (e.g., cyclic polyribonucleotides) made as described herein are used as effectors in therapy or agriculture. For example, polyribonucleotides made by the methods described herein can be administered to a subject (e.g., in a pharmaceutical, veterinary, or agricultural composition). In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject of the method is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxonomic group such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In embodiments, the subject is an invertebrate that is an invertebrate agricultural pest or a parasite on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgo), fern, horsetail, club moss, or bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is an agriculturally or horticulturally important plant, such as row crops, fruit-bearing plants and trees, vegetables, trees, and ornamentals, e.g., ornamental flowers, shrubs, trees, ground covers, and turf.
[0255] Plant Modified Polypeptides In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one expressible sequence that encodes a plant modified polypeptide. A plant modified polypeptide refers to a polypeptide that can modify the genetic characteristics of a plant (e.g., increase gene expression, decrease gene expression, or otherwise modify the nucleotide sequence of DNA or RNA), modify the epigenetic characteristics, or modify the physiological or biochemical characteristics in a manner that results in a change in the plant's physiology or phenotype, such as an increase or decrease in the fitness of the plant. In some embodiments, a polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more different plant modified polypeptides, or multiple copies of one or more plant modified polypeptides. A plant modified polypeptide can be one that can modify the physiology or phenotype of various plants, or increase or decrease the fitness of various plants, or that can effect such changes in one or more particular plants (e.g., a particular species or genus of plants).
[0256] Examples of polypeptides that can be used herein include enzymes (e.g., metabolic recombinases, helicases, integrases, ribonucleases, deoxyribonucleases, or ubiquitinating proteins), pore-forming proteins, signaling ligands, cell-penetrating peptides, transcription factors, receptors, antibodies, nanobodies, gene editing proteins (e.g., CRISPR-Cas endonucleases, TALENs, or Zn fingers), riboproteins, protein aptamers, or chaperones.
[0257] Agricultural polypeptide In some embodiments, the polyribonucleotides described herein (e.g., the polyribonucleotide cargo of the polyribonucleotide) comprise at least one expression sequence encoding an agricultural polypeptide. An agricultural polypeptide is a polypeptide suitable for agricultural use. In embodiments, the agricultural polypeptide is applied to a plant or seed (e.g., by foliar spray, dusting, injection, or seed coating) or to the plant's environment (e.g., by soil drench or granular soil application) resulting in an alteration of the plant's physiology, phenotype, or fitness. Embodiments of agricultural polypeptides include polypeptides that alter the level, activity, or metabolism of one or more microorganisms resident in or on a plant or non-human animal host, which alteration results in an increase in the fitness of the host. In some embodiments, the agricultural polypeptide is a plant polypeptide. In some embodiments, the agricultural polypeptide is an insect polypeptide. In some embodiments, the agricultural polypeptide has a biological effect when contacted with a non-human vertebrate, invertebrate, microorganism, or plant cell.
[0258] In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more agricultural polypeptides, or multiple copies of one or more agricultural polypeptides.
[0259] Embodiments of polypeptides useful for agricultural applications include, for example, bacteriocins, lysins, antimicrobial peptides, rhizocine C-rich peptides, and fungal cell regulatory peptides. Such polypeptides can be used to modify the levels, activity, or metabolism of target microorganisms to increase the fitness of insects such as honeybees and silkworms. Embodiments of agriculturally useful polypeptides include peptide toxins, such as those naturally produced by insect pathogens (e.g., Bacillus thuringiensis, Photorhabdus luminescens, Serratia entomophila, or Xenorhabdus nematophila), as known in the art. Embodiments of agriculturally useful polypeptides include polypeptides (including small peptides such as cyclodipeptides or diketopiperazines) for controlling agriculturally important pests or pathogens, e.g., antibacterial or antifungal polypeptides for controlling disease in plants, or pesticidal polypeptides (e.g., insecticidal or nematocidal polypeptides) for controlling invertebrate pests such as insects or nematodes. Embodiments of agriculturally useful polypeptides include antibodies, nanobodies, and fragments thereof, e.g., antibodies or nanobody fragments that retain at least a portion (e.g., at least 10%) of the specific binding activity of an intact antibody or nanobody. Embodiments of agriculturally useful polypeptides include transcription factors, e.g., plant transcription factors; see, e.g., the "AtTFDB" database, which lists transcription factor families identified in the model plant Arabidopsis thaliana, publicly available at agris-knowledgebase[dot]org / AtTFDB / . Embodiments of agriculturally useful polypeptides include nucleases, e.g., exonucleases or endonucleases (e.g., Cas nucleases, such as Cas9 or Cas12a).Embodiments of agriculturally useful polypeptides further include cell penetrating peptides, enzymes (e.g., amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones (e.g., yeast mating pheromones, invertebrate reproductive and larval signaling pheromones, see, e.g., Altstein (2004) Peptides, 25:1373-1376).
[0260] As used herein, "increasing fitness" or "promoting fitness" of a subject refers to any favorable alteration in the physiology or any activity made by a subject organism as a result of administration of a peptide or polypeptide described herein, including, but not limited to, any one or more of the following desired effects: (1) increased tolerance to biotic or abiotic stress; (2) increased yield or biomass; (3) altered flowering time; (4) increased resistance to pests or pathogens; (4) increased resistance to herbicides; (5) increased population of the subject organism; (6) increased reproductive rate of the subject organism; (7) increased motility of the subject organism; (8) increased weight of the subject organism; (9) increased metabolic rate or activity of the subject organism; (10) increased pollination; (11) increased births of the subject organism; (12) increased nutrient content of the subject organism; (13) increased resistance of the subject organism to pesticides; or (14) enhanced health or reduced disease of the subject organism, such as a human or non-human animal. The increase in host fitness can be determined relative to the subject organism to which the modulating agent is administered. Conversely, "reducing the fitness" of a subject refers to any unfavorable change in physiology or any activity performed by the subject organism as a result of administration of a peptide or polypeptide described herein, including, but not limited to, a reduction in any one or more of the effects listed above.
[0261] Internal ribosome entry sites In some embodiments, the polyribonucleotides described herein contain one or more internal ribosome entry sites (IRES) elements. In some embodiments, the IRES is operably linked to one or more expression sequences (e.g., each IRES is operably linked to one or more expression sequences). In embodiments, the IRES is located between the heterologous promoter and the 5' end of the coding sequence.
[0262] IRES elements suitable for inclusion within a polyribonucleotide comprise an RNA sequence capable of associating with a eukaryotic ribosome, hi some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.
[0263] In some embodiments, the IRES element is derived from DNA of organisms including, but not limited to, viruses, mammals, and Drosophila. Such viral DNA can be derived from, but is not limited to, encephalomyocarditis virus (EMCV) cDNA and poliovirus cDNA, as well as picornavirus complementary DNA (cDNA). In one embodiment, the Drosophila DNA from which the IRES element is derived includes, but is not limited to, the antennapedia gene from Drosophila melanogaster.
[0264] In some embodiments, the IRES sequence is selected from the group consisting of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invictavirus 1, Rhopalopsis aphid virus, Reticuloendotheliosis virus, Fuman poliovirus 1, German winged stink bug enteric virus, Kashmir bee virus, Human rhinovirus 2 (HRV-2), Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, virus, Tea grass moth picorna-like virus, Encephalomyocarditis virus (EMCV), Drosophila C virus, Crucifer tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black queen brood virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus (AEV), Acute bee paralysis virus, Hibiscus chlorotic ringspot virus virus), classical swine fever virus, human FGF2, human SFTPAl, human AMLl / RUNXl, Drosophila antennapedia, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Salivirus, cosavirus, parechovirus, Drosophila hairless, yeast (S. cerevisiae) TFIID, yeast (S.cerevisiae YAP1, human c-src, human FGF-1, picomavirus, Turnip crinkle virus, Aichi virus, Kurohi virus, Echovirus 11, aptamer for eIF4G, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2) IRES sequence. In yet another embodiment, the IRES is a Coxsackievirus B3 (CVB3) IRES sequence. In a further embodiment, the IRES is an encephalomyocarditis virus (EMCV) IRES sequence. In a further embodiment, the IRES is a Theiler's encephalomyelitis virus IRES sequence.
[0265] In some embodiments, the IRES sequence has a modified sequence compared to the wild-type IRES sequence.In some embodiments, if the last nucleotide of the wild-type IRES is not a cytosine nucleic acid residue, the last nucleotide of the wild-type IRES sequence is modified so that it is a cytosine residue.For example, in some embodiments, the IRES sequence is the CVB3 IRES sequence, in which the terminal adenosine residue is modified to a cytosine residue.
[0266] In some embodiments, the IRES sequence is an Enterovirus 71 (EV17) IRES, in which the terminal guanosine residues of the EV17 IRES sequence are modified to cytosine residues.
[0267] In some embodiments, the polyribonucleotide comprises at least one IRES flanking at least one (e.g., two, three, four, five or more) expressed sequence. In some embodiments, an IRES flanks both sides of at least one (e.g., two, three, four, five or more) expressed sequence. In some embodiments, the polyribonucleotide comprises one or more IRES sequences on either or both sides of each expressed sequence, providing for isolation of the resulting peptides and / or polypeptides.
[0268] In some embodiments, a polyribonucleotide described herein comprises an IRES (eg, an IRES operably linked to a coding region). For example, polyribonucleotides are Chen et al. MOL. CELL 81(20):4300-18,2021; Jopling et al. ONCOGENE 20:2664-70,2001; Baranick et al. PNAS 105(12):4733-38,2008; Lang et al. MOLECULAR BIOLOGY OF THE CELL 13(5):1792-1801,2002; Dorokhov et al. PNAS 99(8):5301-06,2002; Wang et al. NUCLEIC ACIDS RESEARCH 33(7):2248-58,2005; Petz et al. NUCLEIC ACIDS RESEARCH 35(8):2473-82,2007; Chen et al. SCIENCE 268:415-417, 1995; Fan et al. NATURE COMMUNICATION 13(1):3751-3765, 2022, and WO 2021 / 263124 (each of which is incorporated by reference in its entirety).
[0269] Adjustment element In some embodiments, a polyribonucleotide described herein (e.g., a polyribonucleotide cargo of a polyribonucleotide) comprises one or more regulatory elements. In some embodiments, a polyribonucleotide comprises a regulatory element, e.g., a sequence that regulates expression of an expression sequence within the polyribonucleotide.
[0270] A regulatory element may comprise a sequence located adjacent to an expression sequence that codes for an expression product. The regulatory element may be operably linked to the adjacent sequence. The regulatory element may increase the amount of the expressed product compared to the amount or number of products expressed in the absence of the regulatory element. Furthermore, one regulatory element may increase the amount of the expressed product for multiple expression sequences linked side by side. Thus, one regulatory element can promote the expression of one or more expression sequences. Multiple regulatory elements may be used, for example, to individually regulate the expression of different expression sequences.
[0271] In some embodiments, the regulatory element is a translation modulator. The translation modulator may regulate the translation of an expressed sequence in the polyribonucleotide. The translation modulator may be a translation enhancer or suppressor. In some embodiments, the polyribonucleotide comprises at least one translation modulator adjacent to at least one expressed sequence. In some embodiments, the polyribonucleotide comprises a translation modulator adjacent to each expressed sequence. In some embodiments, the translation modulator is on one or both sides of each expressed sequence, resulting in the separation of the expression products, e.g., peptides and / or polypeptides.
[0272] In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.
[0273] Further examples of regulatory elements are described, for example, in paragraphs
[0154] to
[0161] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.
[0274] Translation initiation sequence In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one translation initiation sequence. In some embodiments, a polyribonucleotide comprises a translation initiation sequence that is operably linked to an expression sequence.
[0275] In some embodiments, the polyribonucleotide may encode a polypeptide and include a translation initiation sequence, e.g., a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the polyribonucleotide includes a translation initiation sequence, e.g., a Kozak sequence, flanking the expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, a translation initiation sequence, e.g., a Kozak sequence, is present on one or both sides of each expression sequence to provide separation of the expression products. In some embodiments, the polyribonucleotide includes at least one translation initiation sequence flanking the expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the polyribonucleotide. In some embodiments, the translation initiation sequence is within a substantially single-stranded region of the circular polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs
[0163] to
[0165] of WO 2019 / 118919, which is incorporated herein by reference in its entirety.
[0276] A polyribonucleotide may comprise two or more start codons, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60 or more than 60 start codons. Translation may begin at the first start codon or may begin downstream of the first start codon.
[0277] In some embodiments, the polyribonucleotide may initiate at the first start codon, e.g., a codon that is not AUG. Translation of the polyribonucleotide may initiate at an alternative translation start sequence, e.g., but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG. In some embodiments, translation initiates at an alternative translation start sequence under selective conditions, e.g., stress-inducing conditions. As a non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation start sequence, e.g., ACG. As another non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation start sequence, CTG / CUG. As another non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation start sequence, GTG / GUG. As another non-limiting example, a polyribonucleotide may initiate translation at alternative translation initiation sequences, including repeat-associated non-AUG (RAN) sequences, e.g., short stretches of repetitive RNA, e.g., CGG, GGGGCC, CAG, CTG.
[0278] Termination sequence In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one termination sequence. In some embodiments, the polyribonucleotide comprises a termination sequence that is operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination sequence.
[0279] In some embodiments, the polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence. In some embodiments, the polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence, such that the polyribonucleotide is continuously translated. Exclusion of the termination sequence may result in rolling circle translation or continuous expression of the expression product.
[0280] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, each of which may lack a termination sequence, such that the circular polyribonucleotide is translated continuously. The exclusion of the termination sequence may result in rolling circle translation or continuous expression of expression products, such as peptides or polypeptides, due to lack of ribosome stalling or shedding. In such embodiments, the rolling circle translation expresses continuous expression products through each expression sequence. In some other embodiments, the termination sequence of the expression sequence may be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide include a termination sequence. However, rolling circle translation or expression of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences in the circular polyribonucleotide is performed. In such cases, the expression product may be shedding from the ribosome when the ribosome encounters a termination sequence, such as a stop codon, and terminates translation. In some embodiments, translation is terminated while the ribosome, eg, at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.
[0281] In some embodiments, the circular polyribonucleotide comprises a termination sequence at the end of one or more expressed sequences. In some embodiments, the one or more expressed sequences comprise two or more subsequent termination sequences. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome is completely separated from the circular polyribonucleotide. In some such embodiments, the generation of the subsequent (e.g., second, third, fourth, fifth, etc.) expressed sequences in the circular polyribonucleotide may require the ribosome to reassociate with the circular polyribonucleotide before the start of translation. Generally, the termination sequence comprises an in-frame nucleotide triplet, e.g., UAA, UGA, UAG, that signals the termination of translation. In some embodiments, one or more termination sequences in the circular polyribonucleotide are frame-shifted termination sequences, such as, but not limited to, off-frame or -1 and +1 shifted reading frames (e.g., cryptic stops), that may terminate translation. Frameshifted termination sequences include the triple nucleotides TAA, TAG, and TGA that occur in the second and third reading frames of the expressed sequence.Frameshifted termination sequences can be important to prevent misreading of mRNA, which is often harmful to cells.In some embodiments, the termination sequence is a stop codon.
[0282] Further examples of termination sequences are described in paragraphs
[0169] to
[0170] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.
[0283] Untranslated Regions In some embodiments, the circular polyribonucleotide comprises an untranslated region (UTR). The UTR of a genomic region that comprises a gene may be transcribed but not translated. In some embodiments, the UTR may be included upstream of the translation initiation sequence of the expression sequence described herein. In some embodiments, the UTR may be included downstream of the expression sequence described herein. In some cases, one UTR for a first expression sequence is the same as, contiguous with, or overlaps with another UTR for a second expression sequence. In some embodiments, the intron is a human intron.
[0284] Exemplary untranslated regions are described in paragraphs
[0197] to
[0201] of International Publication No. 2019 / 118919, the entirety of which is incorporated herein by reference.
[0285] In some embodiments, the cyclic polyribonucleotide comprises a polyA sequence. Exemplary polyA sequences are described in paragraphs
[0202] to
[0205] of WO 2019 / 118919, the entirety of which is incorporated herein by reference. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence.
[0286] In some embodiments, the cyclic polyribonucleotide comprises a UTR that contains one or more stretches of adenosines and uridines. These AU-rich signatures may increase the turnover rate of the expression product.
[0287] The introduction, removal, or modification of AU-rich elements (AREs) in the UTRs can be useful for modulating the stability or immunogenicity (e.g., the level of one or more markers of immune or inflammatory response) of a cyclic polyribonucleotide. When modifying a particular cyclic polyribonucleotide, one or more copies of an ARE may be introduced into the cyclic polyribonucleotide, and the copies of the ARE may modulate the translation and / or production of the expression product. Similarly, AREs can be identified and removed or modified into a cyclic polyribonucleotide to modulate the intracellular stability, which in turn affects the translation and production of the resulting protein.
[0288] It should be understood that any UTR from any gene may be incorporated into each flanking region of the circular polyribonucleotide.
[0289] In some embodiments, the circular polyribonucleotide lacks a 5'UTR and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a 3'UTR and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a polyA sequence and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a termination sequence and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks an internal ribosome entry site and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a cap and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a 5'UTR, a 3'UTR, and an IRES and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding an exogenous gene, a sequence encoding a therapeutic, a regulatory element (e.g., a translation modulator, e.g., a translation enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids (e.g., siRNA, lncRNA, shRNA) targeting an endogenous gene, and a sequence encoding a therapeutic mRNA or protein.
[0290] In some embodiments, the cyclic polyribonucleotide lacks a 5' UTR. In some embodiments, the cyclic polyribonucleotide lacks a 3' UTR. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence. In some embodiments, the cyclic polyribonucleotide lacks a termination sequence. In some embodiments, the cyclic polyribonucleotide lacks an internal ribosome entry site. In some embodiments, the cyclic polyribonucleotide lacks susceptibility to degradation by exonucleases. In some embodiments, the fact that the cyclic polyribonucleotide lacks susceptibility to degradation can mean that the cyclic polyribonucleotide is not degraded by exonucleases or is degraded to a limited extent in the presence of exonucleases, e.g., is equivalent or similar in the absence of exonucleases. In some embodiments, the cyclic polyribonucleotide is not degraded by exonucleases. In some embodiments, the cyclic polyribonucleotide has reduced degradation when exposed to exonucleases. In some embodiments, the cyclic polyribonucleotide lacks binding to cap-binding proteins. In some embodiments, the circular polyribonucleotide lacks a 5' cap.
[0291] Stagger Element In some embodiments, the cyclic polyribonucleotide comprises at least one stagger element adjacent to the expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element adjacent to each expressed sequence. In some embodiments, the stagger element is on one or both sides of each expressed sequence, resulting in separation of the expression products, e.g., peptides and / or polypeptides. In some embodiments, the stagger element is a portion of one or more expressed sequences. In some embodiments, the cyclic polyribonucleotide comprises one or more expressed sequences, each of which is separated from the subsequent expressed sequence by a stagger element in the cyclic polyribonucleotide. In some embodiments, the stagger element prevents the generation of a single polypeptide from (a) two translations of a single expressed sequence, or (b) one or more translations of two or more expressed sequences. In some embodiments, the stagger element is a sequence separated from one or more expressed sequences. In some embodiments, the stagger element comprises a portion of an expressed sequence of one or more expressed sequences.
[0292] Examples of stagger elements are described in paragraphs
[0172] to
[0175] of International Publication No. WO 2019 / 118919, the entirety of which is incorporated herein by reference.
[0293] Non-coding sequences In some embodiments, a polyribonucleotide described herein (e.g., the polyribonucleotide cargo of a polyribonucleotide) comprises one or more non-coding sequences, e.g., sequences that do not code for expression of a polypeptide. In some embodiments, a polyribonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 non-coding sequences. In some embodiments, a polyribonucleotide does not code for a polypeptide expression sequence.
[0294] The non-coding sequence may be a natural or synthetic sequence. In some embodiments, the non-coding sequence may modify cell behavior, such as lymphocyte behavior. In some embodiments, the non-coding sequence is antisense to a cellular RNA sequence.
[0295] In some embodiments, the polyribonucleotide comprises a regulatory nucleic acid that is typically an RNA or RNA-like structure of about 5-500 base pairs (bp) (depending on the particular RNA structure (e.g., miRNA of 5-30 bp, lncRNA of 200-500 bp) and may have a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene in a cell. In embodiments, the circular polyribonucleotide comprises a regulatory nucleic acid that encodes an RNA precursor, e.g., a miRNA precursor, that is processable into a smaller RNA, which may be about 50 to about 1000 bp, that is processable into a smaller miRNA intermediate or mature miRNA.
[0296] Long non-coding RNA (IncRNA) is defined as a non-protein-coding transcript longer than 100 nucleotides. Many IncRNAs are characterized as tissue-specific. Diverse IncRNAs that are transcribed in the opposite direction to nearby protein-coding genes comprise a significant proportion (e.g., about 20% of all IncRNAs in mammalian genomes) and likely regulate the transcription of nearby genes. In one embodiment, the polyribonucleotide provided herein comprises the sense strand of an IncRNA. In one embodiment, the polyribonucleotide provided herein comprises the antisense strand of an IncRNA.
[0297] Protein Binding Sequences In some embodiments, the cyclic polyribonucleotide comprises one or more protein binding sites that allow proteins, such as ribosomes, to bind to internal sites within the RNA sequence.By designing a protein binding site, such as a ribosome binding site, into the cyclic polyribonucleotide, the cyclic polyribonucleotide can evade or reduce detection by the host's immune system by masking the cyclic polyribonucleotide from components of the host's immune system, regulating degradation, or regulating translation.
[0298] In some embodiments, the cyclic polyribonucleotide comprises at least one immunity protein binding site, e.g., to evade an immune response, e.g., a CTL (cytotoxic T lymphocyte) response. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and aids in masking the cyclic polyribonucleotide as exogenous. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and aids in masking the cyclic polyribonucleotide as exogenous or foreign.
[0299] The traditional mechanism of ribosome association to linear RNA involves ribosome binding to the capped 5' end of the RNA. The first peptide bond is formed as soon as the ribosome moves from the 5' end to the start codon. According to the present disclosure, internal initiation of translation of a circular polyribonucleotide (i.e., cap-independent) does not require a free or capped end. Rather, the ribosome binds to an uncapped internal site, whereby the ribosome initiates polypeptide elongation at the start codon. In some embodiments, the circular polyribonucleotide comprises one or more RNA sequences that include a ribosome binding site, e.g., a start codon.
[0300] Natural 5'UTRs have characteristics that play a role in translation initiation. They contain signatures such as the Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates the translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO:1), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another "G". 5'UTRs are also known to form secondary structures involved in elongation factor binding.
[0301] In some embodiments, the cyclic polyribonucleotide encodes a protein binding sequence that binds to a protein. In some embodiments, the protein binding sequence targets or localizes the cyclic polyribonucleotide to a specific target. In some embodiments, the protein binding sequence specifically binds to an arginine-rich region of a protein.
[0302] In some embodiments, the protein binding sites include, but are not limited to, ACIN1, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, EIF4G2, EL AVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMR1, FUS, FXR1, FXR2, GNL3, GTF2F1, HNRNPA1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPL, HNRNPM, HNRNPU, HNRNPUL1, IGF2BP1, IGF2BP2, IGF2BP3, ILF3, KHDRBS1, LARP7, LIN28A, LIN28B , m6A, MBNL2, METTL3, MOV10, MSI1, MSI2, NONO, NONO-, NOP58, NPM1, NUDT21, PCBP2, POLR2A, PRPF8, PTBP1, RBFO X2, RBM10, RBM22, RBM27, RBM47, RNPS1, SAFB2, SBDS, SF3A3, SF3B4, SIRT7, SLBP, SLTM, SMNDC1, SND1, SRRM4, SRS Binding sites for proteins such as F1, SRSF3, SRSF7, SRSF9, TAF15, TARDBP, TIA1, TNRC6A, TOP3B, TRA2A, TRA2B, U2AF1, U2AF2, UNK, UPF1, WDR33, XRN2, YBX1, YTHDC1, YTHDF1, YTHDF2, YWHAG, ZC3H7B, PDK1, AKT1, and any other protein that binds RNA.
[0303] Spacer sequence In some embodiments, the polyribonucleotides described herein comprise one or more spacer sequences. A spacer refers to any adjacent nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. A spacer may be present between any of the nucleic acid elements described herein. A spacer may also be present within the nucleic acid elements described herein.
[0304] The spacer may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, each spacer region is at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. Each spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a polyA sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a polyAC sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a poly-AG sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a poly-AT sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a random sequence.
[0305] Spacers may also be present within the nucleic acid regions described herein. For example, a polynucleotide cargo region may comprise one or more spacers. A spacer may separate regions within a polynucleotide cargo.
[0306] In some embodiments, the spacer sequence can be, for example, at least 10 nucleotides in length, at least 15 nucleotides in length, or at least 30 nucleotides in length. In some embodiments, the spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the spacer sequence is 20-50 nucleotides in length. In certain embodiments, the spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length.
[0307] The spacer sequence can be a polyA, polyAC, polyC, or polyU sequence.
[0308] In some embodiments, the spacer sequence can be polyAT, polyAC, polyAG, or a random sequence.
[0309] Spacer sequences can be used to separate the IRES from adjacent components to preserve the structure and function of the IRES or adjacent elements. Spacers can be specifically modified depending on the IRES. In some embodiments, RNA folding computer software such as RNAFold can be used to guide the design of various elements of the vector, including spacers.
[0310] In some embodiments, the polyribonucleotide comprises a 5' spacer sequence (e.g., between the 5' annealing region and the polyribonucleotide cargo). In some embodiments, the 5' spacer sequence is at least 10 nucleotides in length. In another embodiment, the 5' spacer sequence is at least 15 nucleotides in length. In further embodiments, the 5' spacer sequence is at least 30 nucleotides in length. In some embodiments, the 5' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is 20-50 nucleotides in length. In certain embodiments, the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 5' spacer sequence is a polyA sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In some embodiments, the 5' spacer sequence comprises a polyAG sequence. In some embodiments, the 5' spacer sequence comprises a polyAT sequence. In some embodiments, the 5' spacer sequence comprises a random sequence.
[0311] In some embodiments, the polyribonucleotide comprises a 3' spacer sequence (e.g., between the 3' annealing region and the polyribonucleotide cargo). In some embodiments, the 3' spacer sequence is at least 10 nucleotides in length. In another embodiment, the 3' spacer sequence is at least 15 nucleotides in length. In further embodiments, the 3' spacer sequence is at least 30 nucleotides in length. In some embodiments, the 3' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 3' spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 3' spacer sequence is 20-50 nucleotides in length. In certain embodiments, the 3'spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 3'spacer sequence is a polyA sequence. In another embodiment, the 5'spacer sequence is a polyAC sequence. In some embodiments, the 5'spacer sequence comprises a polyAG sequence. In some embodiments, the 5'spacer sequence comprises a polyAT sequence. In some embodiments, the 5'spacer sequence comprises a random sequence.
[0312] In one embodiment, the polyribonucleotide comprises a 5' spacer sequence but does not comprise a 3' spacer sequence. In another embodiment, the polyribonucleotide comprises a 3' spacer sequence but does not comprise a 5' spacer sequence. In another embodiment, the polyribonucleotide does not comprise a 5' or 3' spacer sequence. In another embodiment, the polyribonucleotide does not comprise an IRES sequence. In a further embodiment, the polyribonucleotide does not comprise an IRES sequence, a 5' spacer sequence or a 3' spacer sequence.
[0313] In some embodiments, the spacer sequence is at least 3 ribonucleotides, at least 4 ribonucleotides, at least 5 ribonucleotides, at least about 8 ribonucleotides, at least about 10 ribonucleotides, at least about 12 ribonucleotides, at least about 15 ribonucleotides, at least about 20 ribonucleotides, at least about 25 ribonucleotides, at least about 30 ribonucleotides, at least about 40 ribonucleotides, at least about 50 ribonucleotides, at least about 60 ribonucleotides, at least about 70 ribonucleotides, at least about 80 ribonucleotides, ribonucleotides, at least about 90 ribonucleotides, at least about 100 ribonucleotides, at least about 120 ribonucleotides, at least about 150 ribonucleotides, at least about 200 ribonucleotides, at least about 250 ribonucleotides, at least about 300 ribonucleotides, at least about 400 ribonucleotides, at least about 500 ribonucleotides, at least about 600 ribonucleotides, at least about 700 ribonucleotides, at least about 800 ribonucleotides, at least about 900 ribonucleotides, or at least about 100 ribonucleotides.
[0314] Bioreactor In some embodiments, any method of purifying polyribonucleotides (e.g., circular polyribonucleotides) described herein may be carried out in a bioreactor. A bioreactor refers to any container in which a chemical or biological process involving an organism or a biochemically active substance derived from such an organism is carried out. The bioreactor may be adapted for a cell-free method of producing or purifying circular RNA as described herein. The container for the bioreactor may include culture flasks, dishes, or bags, which may be single-use (disposable), autoclavable, or sterilizable. The bioreactor may be made of glass, or may be polymer-based, or may be manufactured from other materials.
[0315] Examples of bioreactors include, but are not limited to, stirred tank (e.g., well-mixed) and flat plate (e.g., plug flow) bioreactors, air-lift bioreactors, membrane stirred tanks, spin filter stirred tanks, vibratory mixers, fluidized bed reactors, and membrane bioreactors. The mode of operation of a bioreactor may be a batch or continuous process. A bioreactor is continuous when the streams of reagents and products are continuously fed and removed from the system. A batch bioreactor may have a continuous recirculation flow but may not have a continuous feed of reagents or product withdrawal.
[0316] Some methods of the present disclosure are directed to large-scale production of polyribonucleotides. For large-scale production methods, the methods can be carried out in volumes ranging from 1 liter (L) to 50 L or more (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L, or more). In some embodiments, the method can be performed with a volume of 5L to 10L, 5L to 15L, 5L to 20L, 5L to 25L, 5L to 30L, 5L to 35L, 5L to 40L, 5L to 45L, 10L to 15L, 10L to 20L, 10L to 25L, 20L to 30L, 10L to 35L, 10L to 40L, 10L to 45L, 10L to 50L, 15L to 20L, 15L to 25L, 15L to 30L, 15L to 35L, 15L to 40L, 15L to 45L, or 15L to 50L.
[0317] In some embodiments, the bioreactor may produce at least 1 g of RNA. In some embodiments, the bioreactor may produce 1-200 g of RNA (e.g., 1-10 g, 1-20 g, 1-50 g, 10-50 g, 10-100 g, 50-100 g, 50-200 g of RNA). In some embodiments, the amount produced is measured per liter (e.g., 1-200 g per liter), per batch or reaction (e.g., 1-200 g per batch or reaction), or per unit of time (e.g., 1-200 g per hour or day).
[0318] In some embodiments, two or more bioreactors can be utilized in series to increase production capacity (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 bioreactors can be used in series).
[0319] How to use In some embodiments, polyribonucleotides (e.g., circular polyribonucleotides) generated as described herein are used as effectors in therapy or agriculture.
[0320] For example, polyribonucleotides purified by the methods described herein may be administered to a subject (e.g., in a pharmaceutical, veterinary, or agricultural composition). In some embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxonomic group such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In embodiments, the subject is an invertebrate that is an invertebrate agricultural pest or a parasite on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgo), fern, horsetail, club moss, or bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is an agriculturally or horticulturally important plant, such as row crops, fruit-bearing plants and trees, vegetables, trees, and ornamentals, e.g., ornamental flowers, shrubs, trees, ground covers, and turf.
[0321] In some embodiments, the disclosure provides a method of modifying a subject by providing a composition or preparation described herein to the subject. In some embodiments, the composition or preparation is or comprises a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule described herein), and the polynucleotide is provided to a eukaryotic subject. In some embodiments, the composition or preparation is or comprises a eukaryotic or prokaryotic cell that contains a nucleic acid described herein.
[0322] In some embodiments, the disclosure provides a method of treating a condition in a subject in need thereof by providing to the subject a composition or preparation described herein. In some embodiments, the composition or preparation is or comprises a nucleic acid molecule (e.g., a DNA molecule or polyribonucleotide described herein), and the polynucleotide is provided to a eukaryotic subject. In some embodiments, the composition or preparation is or comprises a eukaryotic or prokaryotic cell that contains a nucleic acid described herein.
[0323] In some embodiments, the present disclosure provides methods of providing a polyribonucleotide (e.g., a circular polyribonucleotide) to a subject by providing to a subject a eukaryotic or prokaryotic cell that comprises a polynucleotide described herein.
[0324] preparation In some embodiments of the present disclosure, the polyribonucleotides described herein (e.g., cyclic polyribonucleotides) can be formulated in a composition, e.g., an agricultural, veterinary, or pharmaceutical composition, for delivery to a cell, a plant, an invertebrate, a non-human vertebrate, or a human subject. In some embodiments, the polyribonucleotides are formulated in a pharmaceutical composition. In some embodiments, the composition comprises a polyribonucleotide and a diluent, a carrier, an adjuvant, or a combination thereof. In certain embodiments, the composition comprises a polyribonucleotide described herein and a carrier or a diluent without any carrier. In some embodiments, a composition comprising a polyribonucleotide and a diluent without any carrier is used for naked delivery of a polyribonucleotide (e.g., cyclic polyribonucleotide) to a subject.
[0325] The pharmaceutical composition may optionally include one or more additional active substances, e.g., therapeutic and / or prophylactic active substances. The pharmaceutical composition may optionally include an inert substance that serves as a vehicle or medium for the composition described herein (e.g., a cyclic polyribonucleotide, e.g., a composition that includes any one of the inert ingredients approved by the United States Food and Drug Administration (FDA) and listed in the inactive ingredient database). The pharmaceutical composition of the present invention may be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference). Non-limiting examples of inert substances include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersion agents, suspension aids, surface active agents, isotonic agents, thickening agents, emulsifiers, preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersing agents, granulating agents, disintegrating agents, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof.
[0326] Although the description of pharmaceutical compositions provided herein is directed primarily to pharmaceutical compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are suitable for administration to any other animal, e.g., non-human animals, e.g., non-human mammals. Modifications of pharmaceutical compositions suitable for administration to humans that make the compositions suitable for administration to various animals are well understood, and a veterinary pharmacologist of ordinary skill can design and / or implement such modifications with no more than routine (if possible) experimentation. Subjects to which the pharmaceutical compositions are intended to be administered include, but are not limited to, humans and / or other primates; mammals, including commercially important mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially important birds such as poultry, chickens, ducks, geese, and / or turkeys.
[0327] The preparations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. Generally, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, forming and / or packaging the product.
[0328] In some embodiments, the reference standard for the amount of linear polyribonucleotide molecules present in the preparation is 1 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, 90 ng / mL, 100 ng / mL of linear polyribonucleotide molecules. , 200ng / mL, 300ng / mL, 400ng / mL, 500ng / mL, 600ng / mL, 1μg / ml, 10μg / mL, 50μg / mL, 100μg / mL, 200g / mL, 300μg / mL, 400μg / mL, 500μg / mL, 600μg / mL, 700μg / mL, 800μg / mL, 900μg / mL, 1mg / mL, 1.5mg / ml, or 2mg / ml or less.
[0329] In some embodiments, a reference standard for the amount of circular polyribonucleotide molecules present in a preparation is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), 100% (w / w), 110% (w / w), 120% (w / w), 130% (w / w), 140% (w / w), 150% (w / w), 160% (w / w), 170% (w / w), 180% (w / w), 190% (w / w), 200% (w / w), 21% (w / w), 22% (w / w), 23% (w / w), 24% (w / w), 25% (w / w), 26% (w / w), 27% (w / w), 28% (w / w), 29% (w / w), 30% (w / w), 31% (w / w), 32% (w / w), 33% (w / w), 34% (w / w), 35% (w / w), 36% (w / w), 37% (w / w), 38% (w / w), 39% (w / w), 40% (w / w), 40% (w / w), 40% (w / w), 40% (w / w), 40% (w / w), 40% (w / w 94%(w / w), 95%(w / w), 96%(w / w), 97%(w / w), 98%(w / w), 99%(w / w), 99.1%(w / w), 99.2%(w / w), 99.3%(w / w), 99.4%(w / w), 99.5%(w / w), 99.6%(w / w), 99.7%(w / w), 99.8%(w / w), 99.9%(w / w) or 100%(w / w) of the molecule.
[0330] In some embodiments, a reference standard for the amount of linear polyribonucleotide molecules present in a preparation is less than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) or less linear polyribonucleotide molecules of the total ribonucleotide molecules in the pharmaceutical preparation.
[0331] In some embodiments, a reference standard for the amount of nicked polyribonucleotide molecules present in a preparation is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) of nicked polyribonucleotide molecules of total ribonucleotide molecules in the pharmaceutical preparation.
[0332] In some embodiments, the reference standard for the amount of combination of nicks and linear polyribonucleotide molecules present in the preparation is 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) or less of combination of nicks and linear polyribonucleotide molecules of the total ribonucleotide molecules in the pharmaceutical preparation. In some embodiments, the pharmaceutical preparation is an intermediate pharmaceutical preparation of the final circular polyribonucleotide formulation. In some embodiments, the pharmaceutical preparation is a bulk drug or active pharmaceutical ingredient (API). In some embodiments, the pharmaceutical preparation is a formulation for administration to a subject.
[0333] In some embodiments, the preparation of circular polyribonucleotides is further processed (before, during or after reduction of linear RNA) to substantially remove DNA, protein contaminants, impurities or by-products (e.g., cellular proteins such as host cell proteins or process impurity proteins), endotoxins, mononucleotide molecules, and / or process-related impurities.
[0334] Preservatives The compositions or pharmaceutical compositions provided herein may include material for single administration or may include material for multiple administration (e.g., "multi-dose" kits). Polyribonucleotides may be present in either linear or cyclic form. The compositions or pharmaceutical compositions may include one or more preservatives, such as thiomersal or 2-phenoxyethanol. Preservatives may be used to prevent microbial contamination during use. Suitable preservatives include benzalkonium chloride, thimerosal, chlorobutanol, methylparaben, propylparaben, phenylethyl alcohol, edetate disodium, sorbic acid, Onamer M, or other agents known to those skilled in the art. In ophthalmic products, for example, such preservatives may be used at levels of 0.004% to 0.02%. In the compositions described herein, preservatives, such as benzalkonium chloride, may be used at levels of 0.001% to less than 0.01% by weight, for example, 0.001% to 0.008%, preferably about 0.005%.
[0335] Polyribonucleotides may be susceptible to ribonucleases that may be abundant in the surrounding environment. The compositions provided herein may include reagents that inhibit ribonuclease activity, thereby protecting polyribonucleotides from degradation. In some cases, the compositions or pharmaceutical compositions include any ribonuclease inhibitor known to those skilled in the art. Alternatively or additionally, the polyribonucleotides and cell permeation agents and / or pharma- ceutically acceptable diluents or carriers, vehicles, excipients, or other reagents in the compositions provided herein may be prepared in a ribonuclease-free environment. The compositions may be formulated in a ribonuclease-free environment.
[0336] In some cases, the compositions provided herein may be sterile.The compositions can be formulated as sterile solutions or suspensions in suitable media as known in the art.The compositions can be sterilized by conventional known sterilization techniques, for example, the compositions can be sterile filtered.
[0337] salt In some cases, the compositions or pharmaceutical compositions provided herein include one or more salts. To control osmolality, physiological salts such as sodium salts can be included in the compositions provided herein. Other salts can include potassium chloride, potassium dihydrogen phosphate, disodium phosphate, and / or magnesium chloride, and the like. In some cases, the compositions are formulated with one or more pharma- ceutically acceptable salts. The one or more pharma-ceutically acceptable salts can include those of inorganic ions, such as, for example, sodium, potassium, calcium, and magnesium ions. Such salts can include salts of inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluenesulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid, or maleic acid. Polyribonucleotides can exist in either linear or cyclic form.
[0338] Buffer / pH The compositions or pharmaceutical compositions provided herein may include one or more buffers, such as Tris buffer, borate buffer, succinate buffer, histidine buffer (e.g., with aluminum hydroxide adjuvant), or citrate buffer, etc. The buffers are in some cases within the range of 5-20 mM.
[0339] The compositions or pharmaceutical compositions provided herein can have a pH between about 5.0 and about 8.5, between about 6.0 and about 8.0, between about 6.5 and about 7.5, or between about 7.0 and about 7.8. The compositions or pharmaceutical compositions can have a pH of about 7. Polyribonucleotides can exist in either linear or circular form.
[0340] Detergents / Surfactants The compositions or pharmaceutical compositions provided herein may contain, depending on the intended route of administration, one or more detergents and / or surfactants, such as polyoxyethylene sorbitan ester surfactants (commonly referred to as "Tween®"), such as polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and / or butylene oxide (BO), such as linear EO / PO block copolymers, sold under the trade name DOWFAX™; octoxynols, which may vary in the number of repeating ethoxy(oxy-1,2-ethanediyl) groups, such as octoxynol-9 (Triton® X-100, or t-octylphenoxypolyethoxyethanol); (octylphenoxy)polyethoxyethanol (IGEPAL®); CA-630 / NP-40; phospholipids such as phosphatidylcholine (lecithin); nonylphenol ethoxylates such as the Tergitol™ NP series; polyoxyethylene fatty ethers derived from lauryl alcohol, cetyl alcohol, stearyl alcohol and oleyl alcohol (known as Brij® surfactants), such as triethylene glycol monolauryl ether (Brij® 30); and sorbitan esters (commonly known as “SPAN®”) such as sorbitan trioleate (Span® 85) and sorbitan monolaurate, octoxynol (such as octoxynol-9 (Triton® X-100) or t-octylphenoxypolyethoxyethanol), cetyltrimethylammonium bromide ("CTAB"), or sodium deoxycholate. One or more detergents and / or surfactants may be included only in trace amounts. In some examples, the composition may contain less than 1 mg / ml each of octoxynol-10 and polysorbate 80. Non-ionic surfactants may be used herein. Surfactants may be classified by their "HLB" (hydrophilic / lipophilic balance). In some examples, the surfactant has an HLB of at least 10, at least 15, and / or at least 16.The polyribonucleotide may be included in a linear or circular form.
[0341] Diluent In some embodiments, the compositions of the present disclosure comprise a polyribonucleotide and a diluent. In some embodiments, the compositions of the present disclosure comprise a linear polyribonucleotide and a diluent.
[0342] The diluent may be a non-carrier excipient. The non-carrier excipient serves as a vehicle or medium for the composition, such as the cyclic polyribonucleotide described herein. The non-carrier excipient serves as a vehicle or medium for the composition, such as the linear polyribonucleotide described herein. Non-limiting examples of non-carrier excipients include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersions, suspension aids, surfactants, isotonicity agents, thickening agents, emulsifiers, preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersants, granulating agents, disintegrants, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof. The non-carrier excipient may be any of the inactive ingredients listed in the Inactive Ingredient Database that are approved by the United States Food and Drug Administration (FDA) and do not exhibit cell-penetrating effects. A non-carrier excipient can be, for example, any inactive ingredient suitable for administration to a non-human animal suitable for veterinary use. Modifications of compositions suitable for administration to humans to make them suitable for administration to a variety of animals are well understood and a veterinary pharmacologist of ordinary skill can design and / or make such modifications with only routine experimentation, if any.
[0343] In certain embodiments, polyribonucleotides (e.g., cyclic polyribonucleotides) can be delivered as naked delivery formulations, such as those that include a diluent. Naked delivery formulations deliver polyribonucleotides to cells without a carrier and without modification or partial or complete encapsulation of polyribonucleotides, capped polyribonucleotides, or complexes thereof.
[0344] A naked delivery formulation is a formulation that does not contain a carrier, in which the polyribonucleotide (e.g., a cyclic polyribonucleotide) does not have a covalent modification attached to a moiety that aids in delivery to a cell, or is without partial or complete encapsulation of the polyribonucleotide. In some embodiments, the polyribonucleotide that does not have a covalent modification attached to a moiety that aids in delivery to a cell is a polyribonucleotide that is not covalently attached to a protein, small molecule, particle, polymer, or biopolymer. The polyribonucleotide that does not have a covalent modification attached to a moiety that aids in delivery to a cell does not contain a modified phosphate group. For example, the polyribonucleotide that does not have a covalent modification attached to a moiety that aids in delivery to a cell does not contain a phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoroamidate, phosphorodiamidate, alkyl or aryl phosphonate, or phosphotriester.
[0345] In some embodiments, the naked delivery formulation does not include any or all of a transfection reagent, a cationic carrier, a carbohydrate carrier, a nanoparticle carrier, or a protein carrier. In certain embodiments, the naked delivery formulation is selected from the group consisting of phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydrous modified phytoglycogen β-dextrin, lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-β-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 1-[2-(oleoyloxy)ethyl]-2-oleyl-3 -(2-Hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N,N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HCl), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.
[0346] In some embodiments, the naked delivery formulation comprises a non-carrier excipient. In some embodiments, the non-carrier excipient comprises an inactive ingredient that does not exhibit a cell-penetrating effect. In some embodiments, the non-carrier excipient comprises a buffer, such as PBS. In some embodiments, the non-carrier excipient is a solvent, a non-aqueous solvent, a diluent, a suspending aid, a surfactant, an isotonicity agent, a thickener, an emulsifier, a preservative, a polymer, a peptide, a protein, a cell, a hyaluronidase, a dispersant, a granulating agent, a disintegrant, a binder, a buffer, a lubricant, or an oil.
[0347] In some embodiments, the naked delivery formulation comprises a diluent. The diluent can be a liquid diluent or a solid diluent. In some embodiments, the diluent is an RNA solubilizing agent, a buffer, or an isotonic agent. Examples of RNA solubilizing agents include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of buffers include 2-(N-morpholino)ethanesulfonic acid (MES), Bis-Tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3-(N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), Tris, Tricine, Gly-Gly, Bicine, or phosphate. Examples of isotonicity agents include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose.
[0348] Carrier In some embodiments, the compositions of the present disclosure comprise a cyclic polyribonucleotide and a carrier. In some embodiments, the compositions of the present disclosure comprise a linear polyribonucleotide and a carrier.
[0349] In certain embodiments, the compositions comprise a circular polyribonucleotide as described herein in a vesicle or other membrane-based carrier. In certain embodiments, the compositions comprise a linear polyribonucleotide as described herein in a vesicle or other membrane-based carrier.
[0350] In other embodiments, the composition comprises a cyclic polyribonucleotide in or through a cell, vesicle, or other membrane-based carrier. In other embodiments, the composition comprises a linear polyribonucleotide in or through a cell, vesicle, or other membrane-based carrier. In one embodiment, the composition comprises a cyclic polyribonucleotide in a liposome or other similar vesicle. In one embodiment, the composition comprises a linear polyribonucleotide in a liposome or other similar vesicle. Liposomes are spherical vesicular structures composed of a mono- or multi-membrane lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood-brain barrier (BBB) (see, e.g., for review, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155 / 2011 / 469679).
[0351] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to produce liposomes as drug carriers. Methods for the preparation of multilamellar vesicle lipids are known in the art (see, for example, U.S. Pat. No. 6,693,086, the teachings of which are incorporated herein by reference for their related preparation of multilamellar vesicle lipids). When lipid membranes are mixed with aqueous solution, vesicle formation can occur spontaneously, but it can also be promoted by applying force in the form of shaking, by using homogenizers, sonicators, or extrusion devices (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011.doi:10.1155 / 2011 / 469679 for review). Extruded lipids can be prepared by extrusion through reduced size filters as described in Templeton et al., Nature Biotechnol., 15:647-52, 1997, the teachings of which regarding the preparation of extruded lipids are incorporated herein by reference.
[0352] In certain embodiments, the compositions of the present disclosure include polyribonucleotides and lipid nanoparticles, such as lipid nanoparticles, as described herein. In certain embodiments, the compositions of the present disclosure include linear polyribonucleotides and lipid nanoparticles. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for the polyribonucleotide molecules described herein. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for the linear polyribonucleotide molecules described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the properties of SLNs, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a new type of carrier that combines liposomes and polymers, can also be used. These nanoparticles have the complementary advantages of PNPs and liposomes. PLN consists of a core-shell structure; the polymer core provides a stable structure, and the phospholipid shell provides good biocompatibility. Thus, the two components increase drug encapsulation efficiency, facilitate surface modification, and prevent leakage of water-soluble drugs. For a review, see, for example, Li et al. 2017, Nanomaterials 7, 122; doi:10.3390 / nano7060122.
[0353] Further non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), protein carriers (e.g., proteins covalently bound to polyribonucleotides or proteins covalently bound to linear polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfection reagents). Non-limiting examples of carbohydrate carriers include phytoglycogen octenyl succinate, phytoglycogen β-dextrin, and anhydride-modified phytoglycogen β-dextrin. Non-limiting examples of cationic carriers include lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)-2-hydroxypropyl]-2-hydroxypropyl-2-hydroxypropyl, and the like. N,N-diisopropyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N\N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HC1), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), and N,N-dioleyl-N,N-dimethylammonium chloride (DODAC). Non-limiting examples of protein carriers include human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.
[0354] Exosomes may also be used as drug delivery vehicles for the compositions or preparations described herein. Exosomes may also be used as drug delivery vehicles for the linear polyribonucleotide compositions or preparations described herein. For review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-96, doi.org / 10.1016 / j.apsb.2016.02.001.
[0355] Ex vivo differentiated red blood cells may also be used as a carrier for the compositions or preparations described herein. Ex vivo differentiated red blood cells may also be used as a carrier for the linear polyribonucleotide compositions or preparations described herein. See, for example, WO 2015 / 073587; WO 2017 / 123646; WO 2017 / 123644; WO 2018 / 102740; WO 2016 / 183482; WO 2015 / 153102; WO 2018 / 151829; WO 2018 / 009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; U.S. Pat. No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. See USA.111(28):10131-10136.
[0356] For example, fusosome compositions as described in WO 2018 / 208728 may also be used as carriers for delivering the polyribonucleotide molecules described herein. For example, fusosome compositions as described in WO 2018 / 208728 may also be used as carriers for delivering the linear polyribonucleotide molecules described herein.
[0357] Virosomes and virus-like particles (VLPs) can also be used as carriers for delivering the polyribonucleotide molecules described herein to target cells. Virosomes and virus-like particles (VLPs) can also be used as carriers for delivering the linear polyribonucleotide molecules described herein to target cells.
[0358] Plant nanovesicles and plant messenger packs (PMPs), for example as described in International Patent Publication Nos. WO 2011 / 097480, WO 2013 / 070324, WO 2017 / 004526, or WO 2020041784, may also be used as carriers for delivering the compositions or preparations described herein. Plant nanovesicles and plant messenger packs (PMPs) may also be used as carriers for delivering the linear polyribonucleotide compositions or preparations described herein.
[0359] Microbubbles can also be used as carriers for delivering the polyribonucleotide molecules described herein.Microbubbles can also be used as carriers for delivering the linear polyribonucleotide molecules described herein.See, for example, U.S. Pat. No. 7,115,583;Beeri, R. et al., Circulation.2002 Oct 1;106(14):1756-1759;Bez, M. et al., Nat Protoc.2019 Apr;14(4):1015-1026;Hernot, S. et al., Adv Drug Deliv Rev.2008 Jun 30;60(10):1153-1166;Rychak, JJ et al., Adv Drug Deliv Rev.2014 Jun;72:82-93.In some embodiments, the microbubbles are albumin-coated perfluorocarbon microbubbles.
[0360] The carrier comprising polyribonucleotides described herein may comprise a plurality of particles. The particles may have a median article size of 30-700 nanometers (e.g., 30-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 100-500, 50-500, or 200-700 nanometers). The size of the particles may be optimized to favor deposition of the payload comprising polyribonucleotides into cells. Deposition of polyribonucleotides into specific cell types may favor different particle sizes. For example, the particle size may be optimized for deposition of polyribonucleotides into antigen-presenting cells. The particle size may be optimized for deposition of polyribonucleotides into dendritic cells. Additionally, the particle size may be optimized for deposition of polyribonucleotides into draining lymph node cells.
[0361] Lipid Nanoparticles The compositions, methods, and delivery systems provided by the present disclosure may use any suitable carrier or delivery modality, including, in certain embodiments, lipid nanoparticles (LNPs) as described herein. The lipid nanoparticles, in certain embodiments, include one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic, or amphoteric lipids); one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers as described in Table 5 of International Publication No. WO2019217941, which is incorporated herein by reference in its entirety); and one or more sterols (e.g., cholesterol).
[0362] Lipids (e.g., lipid nanoparticles) that can be used in nanoparticle formation include, for example, those described in Table 4 of WO2019217941, which is incorporated by reference - for example, a lipid-containing nanoparticle can include one or more of the lipids in Table 4 of WO2019217941. The lipid nanoparticle can include additional elements, such as a polymer, for example, a polymer described in Table 5 of WO2019217941, which is incorporated by reference.
[0363] In certain embodiments, the conjugated lipid, if present, is PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-0-(2',3'-di(tetradecyl)glycerol), PEG-glyceryl-2,3-diamino-2-(trimethylsilyl)-1,1-dimethylethyl)-2,2-dimethylethyl)-1,1-dimethylethyl)-2,3-dimethylethyl ... The polyoxyalkylene glycols may include one or more of the following: N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, N-(carbonyloxypropyl-l-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of WO2019051289 (incorporated by reference), as well as combinations of the above.
[0364] In some embodiments, sterols that may be incorporated into the lipid nanoparticles include one or more of cholesterol or cholesterol derivatives, such as those described in WO 2009 / 127060 or U.S. Patent Publication No. 2010 / 0130588, which are incorporated by reference. Further exemplary sterols include plant sterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated by reference herein.
[0365] In some embodiments, the lipid particles include an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be independently varied to achieve desired properties. For example, in some embodiments, the lipid nanoparticles include an ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid (in other embodiments, it can be 20-70% (mol), 30-60% (mol), or 40-50% (mol); about 50 mol% to about 90 mol% of the total lipid present in the lipid nanoparticle), a non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid, a conjugated lipid in an amount of about 0.5 mol% to about 20 mol% of the total lipid, and a sterol in an amount of about 20 mol% to about 50 mol% of the total lipid. The ratio of total lipid to nucleic acid can be varied as needed. For example, the ratio of total lipid to nucleic acid (mass or weight) can be about 10:1 to about 30:1.
[0366] In certain embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to obtain a desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. Generally, the total lipid content of the lipid nanoparticle formulation can range from about 5 mg / ml to about 30 mg / mL.
[0367] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the delivery of the compositions described herein, e.g., the nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)), include the following: [ka] In certain embodiments, an LNP comprising formula (i) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0368] [ka] In certain embodiments, an LNP comprising formula (ii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0369] [ka] In certain embodiments, an LNP comprising formula (iii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0370] [ka] In certain embodiments, an LNP comprising formula (v) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0371] [ka] In certain embodiments, an LNP comprising formula (vi) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0372] [ka] In certain embodiments, an LNP comprising formula (viii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0373] [ka] In certain embodiments, an LNP comprising formula (ix) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0374] [ka] During the ceremony, X 1 But, O, NR 1 or a direct bond, X 2 is C2-5 alkylene, and X 3 is C(=O) or a direct bond, and R 1 is H or Me, and R 3 is C1-3 alkyl, R 2 is C1-3 alkyl, or R 2 The nitrogen atom to which it is attached and X 2 together with 1 to 3 carbon atoms of X to form a 4-, 5-, or 6-membered ring, or 1 But NR 1 and R 1 and R 2 together with the nitrogen atom to which they are attached form a 5- or 6-membered ring, or R 2 But R 3 and together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered ring; Y 1 is C2-12 alkylene, and Y 2 but, [ka] is selected from n is 0 to 3, R 4is C1-15 alkyl, Z 1 is C1-6 alkylene or a direct bond, Z 2 but [ka] (in either orientation) or absent, with the proviso that Z 1 is a direct bond, and Z 2 If is non-existent; R 5 is C5-9 alkyl or C6-10 alkoxy, R 6 is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, R 7 is H or Me, or a salt thereof, with the proviso that R 3 and R 2 is a C2 alkyl group, and X 1 is O and X 2 is a linear C3 alkylene, and X 3 But C(=0) and Y 1 is a linear Ce alkylene, (Y 2 )nR 4 but, [ka] and R 4 is a linear C5 alkyl; Z 1 is C2 alkylene, and Z 2 is absent, W is methylene, and R 7 If H, then R 5 and R 6 But Cx is not alkoxy.
[0375] In certain embodiments, an LNP comprising formula (xii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell. [ka] In certain embodiments, an LNP comprising formula (xi) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0376] [ka] In certain embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).
[0377] [ka] In certain embodiments, an LNP comprising formula (xv) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0378] [ka] In some embodiments, an LNP comprising a formulation of formula (xvi) is used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.
[0379] [ka]
[0380] In certain embodiments, the lipid compounds used to form lipid nanoparticles for delivery of the compositions described herein, e.g., the nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)), are made by one of the following reactions: [ka]
[0381] In some embodiments, LNPs comprising formula (xxi) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxi) are LNPs described by WO2021113777 (e.g., lipids of formula (1), such as lipids in Table 1 of WO2021113777). [ka] During the ceremony, Each n is independently an integer from 2 to 15; L 1 and L 3 Each independently represents -OC(O)- * or -C(O)O- * In the formula, * " is R 1 or R 3 Refers to the point of attachment; R 1 and R 3are each independently oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclylalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclyl)(alkyl)aminoalkyl, heterocyclyl, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkyloxy, and optionally substituted by one or more substituents selected from the group consisting of dicarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclylalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl, and alkylsulfonealkyl. 9 ~C 20 Alkyl or C 9 ~C 20 alkenyl; and R 2 teeth, [ka] is selected from the group consisting of:
[0382] In some embodiments, LNPs comprising formula (xxii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxii) are LNPs described by WO2021113777 (e.g., lipids of formula (2), such as lipids in Table 2 of WO2021113777). [ka] During the ceremony, each n is independently an integer from 1 to 15; R 1 and R 2 are each independently [ka] is selected from the group consisting of: R 3 teeth, [ka] is selected from the group consisting of:
[0383] In some embodiments, LNPs comprising formula (xxiii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxiii) are LNPs described by WO2021113777 (e.g., lipids of formula (3), such as lipids in Table 3 of WO2021113777). [ka] During the ceremony, X is -O-, -S-, or -OC(O)-. * is selected from the group consisting of * is R 1 Refers to the point of attachment; R 1 teeth, [ka] is selected from the group consisting of R 2 teeth, [ka] is selected from the group consisting of:
[0384] In some embodiments, the compositions described herein (e.g., nucleic acids (e.g., circular polyribonucleotides, linear polyribonucleotides) or proteins) are provided in LNPs that include an ionizable lipid. In some embodiments, the ionizable lipid is heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), e.g., as described in Example 1 of U.S. Pat. No. 9,867,888, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is 9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecanedioate (LP01), e.g., as synthesized in Example 13 of WO 2015 / 095340, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is di((Z)-non-2-en-1-yl)9-((4-dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., as synthesized in Examples 7, 8, or 9 of U.S. Patent Publication No. 2012 / 0027803, which is incorporated herein by reference in its entirety. In one embodiment, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), for example, as synthesized in Examples 14 and 16 of WO 2010 / 053572, which is incorporated by reference in its entirety.In certain embodiments, the ionizable lipid is the imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,14,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, e.g., structure (I) from WO 2020 / 106946, which is incorporated herein by reference in its entirety.
[0385] In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, for example, a cationic lipid that may exist in a positively charged or neutral form depending on pH, or an amine-containing lipid that may be easily protonated. In some embodiments, the cationic lipid is a lipid that may be positively charged, for example, under physiological conditions. Exemplary cationic lipids include one or more amine groups with a positive charge. In some embodiments, the lipid particles include cationic lipids in a combination with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structured lipids (e.g., sterols), PEG, cholesterol, and polymer-conjugated lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids disclosed herein may have an effective pKa greater than 6.0. In some embodiments, the lipid nanoparticle may include a second cationic lipid that has a different effective pKa (e.g., higher than the first effective pKa) than the first cationic lipid. The lipid nanoparticles can include 40-60 mol percent cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and a therapeutic agent, such as a nucleic acid described herein (e.g., RNA (e.g., cyclic polyribonucleotides, linear polyribonucleotides)) encapsulated within or associated with the lipid nanoparticles. In some embodiments, the nucleic acid is formulated simultaneously with the cationic lipids. The nucleic acid can be adsorbed to the surface of the LNP, e.g., LNPs including cationic lipids. In some embodiments, the nucleic acid can be encapsulated within the LNP, e.g., LNPs including cationic lipids. In some embodiments, the lipid nanoparticles can include a targeting moiety, e.g., coated with a targeting agent. In some embodiments, the LNP formulation is biodegradable.In some embodiments, lipid nanoparticles comprising one or more lipids described herein, e.g., formula (i), (ii), (vii) and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98% or 100% of the RNA molecules.
[0386] Exemplary ionizable lipids that may be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of International Publication No. WO2019051289, which is incorporated herein by reference. Additional exemplary lipids include, but are not limited to, one or more of the following formulas: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; No. Ic; U.S. Patent Application Publication No. 2013 / 0178541, No. A; U.S. Patent Application Publication No. 2013 / 0303587 or U.S. Patent Application Publication No. 2013 / 0123338, No. I; U.S. Patent Application Publication No. 2015 / 0141678, No. I; U.S. Patent Application Publication No. 2015 / 0239926, No. II, III, IV, or V; U.S. Patent Application Publication No. 2017 / 0119904, No. I; WO 2017 / 117528, No. I or II; U.S. Patent Application Publication No. 2012 / 0149894 A; U.S. Patent Application Publication No. 2015 / 0057373 A; WO 2013 / 116126 A; U.S. Patent Application Publication No. 2013 / 0090372 A; U.S. Patent Application Publication No. 2013 / 0274523 A; U.S. Patent Application Publication No. 2013 / 0274504 A; U.S. Patent Application Publication No. 2013 / 0053572 A; WO 2013 / 0 16058, A; WO 2012 / 162210, A; U.S. Patent Application Publication No. 2008 / 042973, I; U.S. Patent Application Publication No. 2012 / 01287670, I, II, III, or IV; U.S. Patent Application Publication No. 2014 / 0200257, I or II; U.S. Patent Application Publication No. 2015 / 0203446, I, II, or III; U.S. Patent Application Publication No. 2015 / 0005363, I or III;U.S. Patent Application Publication No. 2014 / 0308304, I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV; U.S. Patent Application Publication No. 2013 / 0338210; WO 2009 / 132131, I, II, III, or IV; U.S. Patent Application Publication No. 2012 / 01011478, A; U.S. Patent Application Publication No. 2012 / 0027796, I or XXXV; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; No. 2013 / 0323269; U.S. Patent Application Publication No. I of U.S. Patent Application Publication No. 2011 / 0117125; U.S. Patent Application Publication No. I, II, or III of U.S. Patent Application Publication No. 2011 / 0256175; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, IX, X, XI, or XII of U.S. Patent Application Publication No. 2012 / 0202871; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011 / 0076335; U.S. Patent Application Publication No. 2006 / 008378 I or II of the specification; I of U.S. Patent Application Publication No. 2013 / 0123338; I or XAYZ of U.S. Patent Application Publication No. 2015 / 0064242; XVI, XVII, or XVIII of U.S. Patent Application Publication No. 2013 / 0022649; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I or II of U.S. Patent Application Publication No. 2010 / 0062967; U.S. Patent Application Publication No. 2013 / 0189351 I-X of US Patent Application Publication No. 2014 / 0039032; V of US Patent Application Publication No. 2018 / 0028664; I of US Patent Application Publication No. 2016 / 0317458; I of US Patent Application Publication No. 2013 / 0195920; 5, 6, or 10 of US Patent Application Publication No. 10,221,127; III-3 of WO 2018 / 081480; I-5 or I-8 of WO 2020 / 081938; 18 or 25 of US Patent Application Publication No. 9,867,888;US2019 / 0136231A;WO2020 / 219876II;US2012 / 0027803A1;US2019 / 0240349OF-02;US10,086,013A23;cKK-E12 / A6 of Miao et al (2020);C12-200 of WO2010 / 053572;7C1 of Dahlman et al (2017);Whitehead et al al., 304-O13 or 503-O13; TS-P4C2 of U.S. Pat. No. 9,708,628; I of WO 2020 / 106946; I of WO 2020 / 106946; and (1), (2), (3) or (4) of WO 2021 / 113777. Exemplary lipids further include any one of the lipids in Tables 1 to 16 of WO 2021 / 113777.
[0387] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,3lZ)-heptatriaconta-6,9,28,3l-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), as described in, for example, Example 9 of WO2019051289A9 (incorporated herein in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, as described in, for example, Example 10 of WO2019051289A9 (incorporated herein in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocosa-13,16-diene-1-amine (compound 32), e.g., as described in Example 11 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, e.g., as described in Example 12 of WO2019051289A9 (incorporated herein by reference in its entirety).
[0388] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidyl 16-O-dimethyl-1, ... PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), diercoyl phosphatidylcholine (DEPC), palmitoyl oleoyl ... dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine phatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Further exemplary lipids include, in certain embodiments, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. Such lipids include, in certain embodiments, plant lipids that have been shown to improve hepatic transfection with mRNA (e.g., DGTS).
[0389] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin, etc. Other non-cationic lipids are described in WO 2017 / 099823 or US 2018 / 0028664, the entire contents of which are incorporated herein by reference.
[0390] In some embodiments, the non-cationic lipid is oleic acid or a compound of formula I, II, or IV of US Patent Publication No. 2018 / 0028664 (herein incorporated by reference in its entirety). The non-cationic lipid may, for example, comprise 0-30% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticle. In embodiments, the molar ratio of ionizable lipid to neutral lipid is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).
[0391] In some embodiments, the lipid nanoparticles do not contain any phospholipids.
[0392] In some embodiments, the lipid nanoparticles may further comprise components such as sterols to provide membrane integrity. One exemplary sterol that may be used in the lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2 , 4'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO 2009 / 127060 and U.S. Patent Publication No. 2010 / 0130588, each of which is incorporated herein by reference in its entirety.
[0393] In some embodiments, components that provide membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipid present in the lipid nanoparticle (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components comprise 20-50% (mol) 30-40% (mol) of the total lipid content of the lipid nanoparticle.
[0394] In some embodiments, the lipid nanoparticles may contain polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit lipid nanoparticle aggregation and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a (methoxypolyethylene glycol)-conjugated lipid.
[0395] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-0-(2',3'-di(tetradecanoyloxy)propyl-1-methylethyl)-2-propanediol (DMG ... -0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-l,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Further exemplary PEG-lipid conjugates are described, for example, in U.S. Pat. No. 5,885,613, U.S. Pat. No. 6,287,591, U.S. Patent Application Publication No. 2003 / 0077829, and the like. No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904, U.S. Patent Application Publication No. 2018 / 0028664, and WO 099823, all of which are incorporated by reference in their entireties. In some embodiments, the PEG-lipid is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Application Publication No. 2018 / 0028664, the entire contents of which are incorporated herein by reference. In some embodiments, the PEG-lipid is of formula II of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224, both of which are incorporated herein by reference in their entireties.In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[β]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB ( PEG-lipids may be one or more of PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000], 3,4-ditetradecoxylbenzyl-[ω]-methyl-poly(ethylene glycol) ether, and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, ... [ka] The present invention includes a structure selected from the following:
[0396] In some embodiments, lipids conjugated with molecules other than PEG can be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates can be used in place of or in addition to PEG-lipids.
[0397] Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO2019051289A9, all of which are incorporated herein by reference in their entireties.
[0398] In some embodiments, the PEG or conjugated lipid may comprise 0-20% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipid present in the lipid nanoparticle. The molar ratios of ionizable lipid, non-cationic lipid, sterol, and PEG / conjugated lipid may be varied as needed. For example, the lipid particles may comprise 30-70% ionizable lipid per mole or total weight of the composition, 0-60% cholesterol per mole or total weight of the composition, 0-30% non-cationic lipid per mole or total weight of the composition, and 1-10% conjugated lipid per mole or total weight of the composition. Preferably, the composition comprises 30-40% ionizable lipid per mole or total weight of the composition, 40-50% cholesterol per mole or total weight of the composition, and 10-20% non-cationic lipid per mole or total weight of the composition. In some other embodiments, the composition is 50-75% ionizable lipid per mole or total weight of the composition, 20-40% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition and 1-10% conjugated lipid per mole or total weight of the composition. The composition may contain 60-70% ionizable lipid per mole or total weight of the composition, 25-35% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition. The composition may also contain up to 90% ionizable lipid per mole or total weight of the composition and 2-15% non-cationic lipid per mole or total weight of the composition.Formulations may also be used that contain, for example, 8-30% ionizable lipid per mole or total weight of the composition, 5-30% non-cationic lipid per mole or total weight of the composition, and 0-20% cholesterol per mole or total weight of the composition; 4-25% ionizable lipid per mole or total weight of the composition, 4-25% non-cationic lipid per mole or total weight of the composition, 2-25% cholesterol per mole or total weight of the composition, 10-35% conjugated lipid per mole or total weight of the composition, and 5% cholesterol per mole or total weight of the composition; or The lipid nanoparticle formulation may comprise 2-30% ionizable lipid per mole or total weight of the composition, 2-30% non-cationic lipid per mole or total weight of the composition, 1-15% cholesterol per mole or total weight of the composition, 2-35% conjugated lipid per mole or total weight of the composition, and 1-20% cholesterol per mole or total weight of the composition; or up to 90% ionizable lipid per mole or total weight of the composition and 2-10% non-cationic lipid per mole or total weight of the composition, or 100% cationic lipid per mole or total weight of the composition. In some embodiments, the lipid particle formulation comprises ionizable lipid, phospholipid, cholesterol, and PEGylated lipid in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipid, cholesterol, and PEGylated lipid in a molar ratio of 60:38.5:1.5.
[0399] In one embodiment, the lipid particle comprises an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, where the molar ratio of lipids is in the range of 20-70 mole percent for the ionizable lipid with a target of 40-60, the molar percent of the non-cationic lipid is in the range of 0-30 with a target of 0-15, the molar percent of the sterol is in the range of 20-70 with a target of 30-50, and the molar percent of the PEGylated lipid is in the range of 1-6 with a target of 2-5.
[0400] In one embodiment, the lipid particles comprise an ionizable lipid / non-cationic lipid / sterol / conjugated lipid molar ratio of 50:10:38.5:1.5.
[0401] In one aspect, the disclosure provides a lipid nanoparticle formulation comprising a phospholipid, a lecithin, a phosphatidylcholine, and a phosphatidylethanolamine.
[0402] In some embodiments, one or more additional compounds may also be included. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain other compounds in addition to the nucleic acid or at least a second nucleic acid different from the first nucleic acid. The other additional compounds may be selected from the group consisting of, but are not limited to, small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptidomimetics, nucleic acids, nucleic acid analogs and derivatives, extracts made from biological materials, or any combination thereof.
[0403] In some embodiments, the LNPs comprise a biodegradable, ionizable lipid, hi some embodiments, the LNPs comprise (9Z,l2Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,l2-dienoate (also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,l2Z)-octadeca-9,l2-dienoate)) or another ionizable lipid. See, e.g., the lipids in WO 2019 / 067992, WO 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086, and the references provided therein. In certain embodiments, the terms cationic and ionizable with respect to LNP lipids are synonymous, e.g., ionizable lipids are cationic depending on the pH.
[0404] In certain embodiments, the average LNP diameter of an LNP formulation can be tens of nm to hundreds of nm, e.g., as measured by dynamic light scattering (DLS). In certain embodiments, the average LNP diameter of an LNP formulation can be about 40 nm to about 150 nm, e.g., about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be about 80 nm. In certain embodiments, the average LNP diameter of the LNP formulation may be about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation is in the range of about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.
[0405] LNPs may be relatively homogeneous in some cases. Polydispersity index may be used to indicate the homogeneity of LNPs, e.g., the size distribution of lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow size distribution. LNPs may have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs may be about 0.10 to about 0.20.
[0406] The zeta potential of LNPs can be used to indicate the electrokinetic potential of a composition. In some embodiments, the zeta potential can represent the surface charge of LNPs. Lipid nanoparticles with relatively low positive or negative charges are generally desirable, since more highly charged species can undesirably interact with cells, tissues, and other elements in the body. In certain embodiments, the zeta potential of the LNP can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.
[0407] The efficiency of protein and / or nucleic acid encapsulation represents the amount of protein and / or nucleic acid encapsulated or otherwise associated with the LNP after preparation compared to the initial amount provided. It is desirable for the encapsulation efficiency to be high (e.g., near 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after disintegrating the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (e.g., RNA) in a solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid (e.g., RNA) in a solution. For the lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids may be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.
[0408] The LNPs may optionally include one or more coatings. In some embodiments, the LNPs may be formulated into capsules, films, or tablets with coatings. The capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.
[0409] Additional exemplary lipids, formulations, methods, and characterizations of LNPs are taught by WO 2020 / 061457 and WO 2021 / 113777, each of which is incorporated by reference in its entirety. Additional exemplary lipids, formulations, methods, and characterizations of LNPs are taught by Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). doi.org / 10.1038 / s41578-021-00358-0, which is incorporated by reference in its entirety (see, e.g., exemplary lipids and lipid derivatives in Figure 2 of Hou et al.).
[0410] In certain embodiments, in vitro or ex vivo cell lipofection is performed using LIPOFECTAMINE® MessengerMax (Thermo Fisher) or TransIT-mRNA Transfection Reagent (Mirus Bio). In certain embodiments, LNPs are formulated using GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, LNPs are formulated using 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or Dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3), the formulation and in vivo use of which are taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012), which is incorporated herein by reference in its entirety.
[0411] LNP formulations optimized for delivery of CRISPR-Cas systems, e.g., Cas9-gRNA RNP, gRNA, Cas9 mRNA, are described in WO2019067992 and WO2019067910 (both incorporated by reference) and are useful for delivery of circular polyribonucleotides and linear polyribonucleotides as described herein.
[0412] Additional specific LNP formulations useful for delivery of nucleic acids (e.g., circular polyribonucleotides, linear polyribonucleotides) are described in U.S. Pat. Nos. 8,158,601 and 8,168,775 (both of which are incorporated by reference), including the formulations used in patisiran, which is sold under the name ONPATTRO.
[0413] In embodiments, a polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) encoding at least a portion (e.g., an antigenic portion) of a protein or polypeptide described herein is formulated in an LNP: (a) the LNP comprises a cationic lipid, a neutral lipid, cholesterol, and a PEG lipid, (b) the LNP has an average particle size of 80 nm to 160 nm, and (c) the polyribonucleotide. In embodiments, the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) that has been formulated in the LNP is a vaccine.
[0414] A representative dose of polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) LNP may include about 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4, 5, 6, 8, 10, or 100 mg / kg (RNA). In some embodiments, the dose of the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) antigen compositions described herein is 30-200 mcg, e.g., 30 mcg, 50 mcg, 75 mcg, 100 mcg, 150 mcg, or 200 mcg.
[0415] kit In some aspects, the disclosure provides kits. In some embodiments, the kits include (a) a cyclic polyribonucleotide or pharmaceutical composition described herein, and, optionally, (b) informational material. In some embodiments, the cyclic polyribonucleotide or pharmaceutical composition may be part of a prescribed dosing regimen. The informational material may be explanatory, instructional, marketing, or other material relating to the methods described herein and / or the use of the pharmaceutical composition or cyclic polyribonucleotide for the methods described herein. The pharmaceutical composition or cyclic polyribonucleotide may include material for a single dose (e.g., a single dosage form) or may include material for multiple doses (e.g., a "multiple dose" kit).
[0416] The informational materials of the kit are not limited in form. In one embodiment, the informational materials may include information about the production of the pharmaceutical composition, drug substance, or pharmaceutical formulation, molecular weight of the pharmaceutical composition, drug substance, or pharmaceutical formulation, concentration, expiration date, batch or production site information, etc. In one embodiment, the informational materials relate to methods for administering a dosage form of the pharmaceutical composition. In one embodiment, the informational materials relate to methods for administering a dosage form of a cyclic polyribonucleotide.
[0417] In addition to the pharmaceutical compositions and cyclic polyribonucleotide dosage forms described herein, the kits may include other ingredients, such as solvents or buffers, stabilizers, preservatives, flavoring agents (e.g., bitter antagonists or sweeteners), fragrances, dyes or colorants, such as for tinting or coloring one or more components in the kit, or other cosmetic ingredients, and / or a second agent for treating a condition or disorder described herein. Alternatively, the other ingredients may be included in the kit, but not in a different composition or container than the pharmaceutical compositions or cyclic polyribonucleotides described herein. In such embodiments, the kits may include instructions for mixing the pharmaceutical compositions or nucleic acid molecules (e.g., cyclic polyribonucleotides) described herein and the other ingredients, or for using the pharmaceutical compositions or nucleic acid molecules (e.g., cyclic polyribonucleotides) described herein with the other ingredients.
[0418] In some embodiments, the components of the kit are stored under inert conditions (e.g., under nitrogen or another inert gas such as argon). In some embodiments, the components of the kit are stored under anhydrous conditions (e.g., in the presence of a desiccant). In some embodiments, the components are stored in light-tight containers such as amber vials.
[0419] The dosage form of the pharmaceutical composition or nucleic acid molecule (e.g., cyclic polyribonucleotide) described herein may be provided in any form, for example, liquid, dry or lyophilized form. It is preferred that the pharmaceutical composition or nucleic acid molecule (e.g., cyclic polyribonucleotide) described herein is substantially pure and / or sterile. When the pharmaceutical composition or nucleic acid molecule (e.g., cyclic polyribonucleotide) described herein is provided in a solution, the solution is preferably an aqueous solution, preferably a sterile aqueous solution. When the pharmaceutical composition or nucleic acid molecule (e.g., cyclic polyribonucleotide) described herein is provided as a dry form, reconstitution is generally by the addition of a suitable solvent. A solvent, for example, sterile water or buffer, can optionally be provided in the kit.
[0420] The kit may include one or more containers for the composition containing the dosage form described herein. In some embodiments, the kit contains separate containers, dividers, or compartments for the composition and the informational material. For example, the pharmaceutical composition or the circular polyribonucleotide may be contained in a bottle, vial, or syringe, and the informational material may be contained in a plastic sleeve or packet. In other embodiments, the separate elements of the kit are contained in a single undivided container. For example, the pharmaceutical composition or the dosage form of the nucleic acid molecule (e.g., the circular polyribonucleotide) described herein is contained in a bottle, vial, or syringe to which the informational material is attached in the form of a label. In some embodiments, the kit includes a plurality (e.g., packs) of individual containers, each containing one or more unit dosage forms of the pharmaceutical composition or the circular polyribonucleotide described herein. For example, the kit includes a plurality of syringes, ampoules, foil packets, or blister packs, each containing a single unit dose of the dosage form described herein.
[0421] The containers of the kits can be air tight, waterproof (eg, impermeable to moisture change or evaporation), and / or light-tight.
[0422] The kit optionally includes a device suitable for application of the dosage form, such as a syringe, pipette, forceps, measuring spoon, swab (eg, a cotton swab or wooden swab), or any such device.
[0423] The kits of the invention may include dosage forms of various strengths to provide a subject with dosages appropriate for one or more of the initiation phase regimens, induction phase regimens, or maintenance phase regimens described herein. Alternatively, the kits may include scored tablets that allow the user to administer divided doses as needed. EXAMPLES
[0424] The following examples are presented to provide one of ordinary skill in the art with an illustration of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely illustrative of the disclosure and are not intended to limit the scope of what the inventors regard as their invention.
[0425] Example 1. Purification of Circular Polyribonucleotides In vitro translation produced a mixture of circRNA and linear RNA. The mixture was purified using an RNA purification column and the buffer was exchanged with nuclease-free water using a 10K Amicon spin concentrator. The material was then polyadenylated using yeast polyA polymerase according to the manufacturer's specifications. The sample was adjusted to 0.5 M NaCl in 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, and 0.18 mg was loaded onto the column, which had been washed and equilibrated with 10 mM Tris-HCl, pH 7.4, 0.5 M NaCl, 1 mM EDTA. These results are shown in Figure 3A and Figure 3B. The first lane is the sample mixture of IVT-generated circRNA and linRNA that was first purified and polyadenylated; the second lane is the analysis of the column flow-through (FT); the third and fourth lanes are the analysis of elution peak E1 (containing fractions B7 and B8); the fifth and sixth lanes are the analysis of peak E2 (containing fractions C4 and C5). The sample was eluted with 10 mM Tris-HCl, 1 mM EDTA, pH 7.4, and the peak was observed as represented as E1 (containing fractions B7 and B8) in Figure 3A. The remainder of the material was then eluted with 10 mM Tris-HCl, 1 mM EDTA, pH 7.4, and the peak was observed as represented as E1 (containing fractions B7 and B8) in Figure 3A. 2 0 and a second elution peak (E2 containing fractions C4 and C5) was observed. Percent purity was calculated by SDS PAGE analysis and is shown in Figure 3B. The load contained 11.4% circRNA and 87.2% linear RNA. The FT pool contained 57.6% circRNA and 40.3% linear RNA. Elution peaks E1 and E2 contained 8.9-10.1% and 2.9-3.7% circRNA and 82.7-87.0% and 94.4-94.6% linear RNA, respectively.
[0426] Example 2: Linear RNA pull-down specifically captures linear RNA by-products and enriches circular RNA This example demonstrates the enrichment of circular RNA by capturing linear by-products via POLYA-oligo dT interactions.
[0427] In this example, the construct was designed to have the 3' half of the catalytic intron, exon fragment 2 (E2), a polyribonucleotide cargo containing the ORF, exon fragment 1 (E1), and the 5' half of the catalytic intron. Circular RNA was generated by self-splicing using the methods described herein. In vitro translation produced a mixture of circular and linear RNA by-products (Figure 4). The mixture was purified using an RNA purification column and eluted in nuclease-free water. The resulting material was then polyadenylated using E. coli polyA polymerase according to the manufacturer's specifications before a second column purification step was performed.
[0428] In the first experiment, a 20 μg sample of polyadenylated RNA containing a mixture of circular and linear RNA byproducts was diluted with oligo(dT) 25 Dynabeads magnetic beads (ThermoFisher) were used in duplicate (Run A and Run B). Briefly, RNA samples were added to binding buffer (20 mM Tris-HCl, 1.0 M LiCl, 2.0 mM EDTA) and oligo(dT) 25 The solution was incubated at room temperature with magnetic beads to selectively bind polyadenylated linear species. Application of a magnetic field and removal of the supernatant generated a volume of oligo flow-through (FT). The retained magnetic beads were washed twice with wash buffer (10 mM Tris-HCl, 0.15 M LiCl, 1.0 mM EDTA) before the bound RNA was eluted twice with nuclease-free water.
[0429] The percent purity was calculated by AEX-HPLC analysis and is shown in Table 1, with complementary SDS PAGE gel images (Figure 5). The load contained 42.35-43.27% circRNA and 56.73-57.65% linear RNA byproducts. The FT pool contained 68.25-68.78% circRNA and 31.75-31.22% linear RNA byproducts. Elution peaks E1 and E2 contained 17.53-20.44% circRNA and 79.56-82.47% linear RNA byproducts.
[0430] The concentrations of eluted circular and linear RNA by-products were measured using a spectrophotometer (NanoDrop™ Spectrophotometer A260, ThermoFisher) and are shown in Table 1.
[0431] [Table 1]
[0432] The results of this first experiment showed that oligo(dT) 25 It is shown that the beads selectively bind to polyadenylated linear RNA by-products that are released in the elution volume.
[0433] In the second experiment, a 1 mL oligo(dT) column was first washed and equilibrated with 20 mM Tris-HCl, pH 7.4, 0.5 M NaCl, 10.0 mM EDTA. The sample was adjusted to 0.5 M NaCl in 20 mM Tris-HCl, pH 7.4, 10 mM EDTA, and 8.7 mg was loaded onto the oligo column at a flow rate of 5 mL / min. 0.5 mL of RNA-containing fractions were collected throughout the run. Two distinct peaks were observed during the sample application period, represented as flow-through (FT) and break-through (BT), respectively, in Figure 6A.
[0434] The sample was eluted with 10 mM Tris-HCl, 1 mM EDTA, pH 8, and a peak was observed, designated as Elution 1 (E1) in Figure 6 A. The remainder of the material was then eluted using water, and a fourth elution peak (E2) was observed (Figure 6 A).
[0435] The percent purity was calculated by AEX-HPLC analysis and is shown in Table 2, with complementary SDS PAGE gel images (Figure 6B). The load contained 44.55% circRNA and 55.45% linear RNA by-products. The FT pool contained 76.46% circRNA and 23.54% linear RNA by-products. The BT pool contained 59.0% circRNA and 41.0% linear RNA by-products. Elution peaks E1 and E2 contained 29.14% and 15.52% circRNA and 70.86% and 84.48% linear RNA by-products, respectively.
[0436] The concentrations of eluted circular and linear RNA by-products were measured using a spectrophotometer (NanoDrop™ Spectrophotometer A260, ThermoFisher) and are shown in Table 2.
[0437] [Table 2]
[0438] Other embodiments While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications, and that this application is intended to cover any variations, uses, or adaptations of the invention which generally follow the principles of the invention and include such departures from the invention as are within known or customary practice within the art to which the invention pertains, and are applicable to the essential features described above and fall within the scope of the claims. Other embodiments are within the scope of the claims.
Claims
1. 1. A method for separating a linear polyribonucleotide from a plurality of polyribonucleotides comprising a mixture of linear and cyclic polyribonucleotides, the polyribonucleotide comprising an open reading frame (ORF) encoding a polypeptide, the method comprising: (a) providing a sample comprising said plurality of polyribonucleotides, a subset of which comprises said linear polyribonucleotide; (b) attaching a target region to said linear polyribonucleotide; (c) contacting the sample with an oligonucleotide that hybridizes to the target region; (d) separating the linear polyribonucleotide comprising the target region hybridized to the oligonucleotide from the plurality of polyribonucleotides in the sample; A method comprising:
2. The method of claim 1 , wherein the oligonucleotide is conjugated to a particle.
3. 3. The method of claim 2, wherein the particles comprise magnetic beads or the oligonucleotides are conjugated to a resin comprising a plurality of the particles.
4. 2. The method of claim 1, wherein separating the linear polyribonucleotides comprises immobilizing the oligonucleotides and / or recovering a portion of the sample that is not hybridized to the oligonucleotides.
5. The method of claim 4 , wherein the portion of the sample that is not hybridized to the oligonucleotide comprises the cyclic polyribonucleotide.
6. 1. A method for separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear and cyclic polyribonucleotides, comprising: (a) providing a sample comprising said plurality of polyribonucleotides, a subset of which comprises said linear polyribonucleotide; (b) attaching a target region to said linear polyribonucleotide; (c) contacting the sample with a column containing a resin comprising a plurality of particles conjugated to oligonucleotides that hybridize to the target region; (d) recovering an eluate from the plurality of polyribonucleotides in the sample, the eluate comprising a portion of the sample that is not hybridized to the oligonucleotide; A method comprising:
7. The method of claim 6 , wherein the portion of the sample that is not hybridized to the oligonucleotide comprises the cyclic polyribonucleotide.
8. 2. The method of claim 1, further comprising, prior to step (a), circularizing the cyclic polyribonucleotide from a linear precursor.
9. 9. The method of claim 8, wherein the linear precursor comprises a 5' self-splicing intron fragment and a 3' self-splicing intron fragment, and the circular polyribonucleotide is produced by self-splicing of the linear precursor.
10. 1. A method for separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear and cyclic polyribonucleotides, comprising: (a) circularizing a linear precursor to form said cyclic polyribonucleotide; (b) providing a sample comprising the plurality of polyribonucleotides, a subset of which comprises the linear polyribonucleotide; (c) attaching a target region to said linear polyribonucleotide; (d) contacting the sample with an oligonucleotide that hybridizes to the target region; (e) separating the linear polyribonucleotide comprising the target region hybridized to the oligonucleotide from the plurality of polyribonucleotides in the sample.
11. 7. The method of claim 6, wherein the circular polyribonucleotide comprises an ORF and / or an internal ribosome entry site (IRES), and optionally the ORF encodes a polypeptide.
12. 2. The method of claim 1, comprising attaching the target region to the 3' or 5' end of the linear polyribonucleotide.
13. 13. The method of claim 12, wherein the binding step comprises polyadenylating the 3' end of the linear polyribonucleotide and / or ligating the target region to the 3' end of the linear polyribonucleotide.
14. 2. The method of claim 1, wherein the cyclic polyribonucleotide does not include a polyA sequence, and optionally, the cyclic polyribonucleotide does not include a polyA sequence comprising at least 10 contiguous adenosine nucleotides.
15. 2. The method of claim 1, wherein the linear polyribonucleotide of step (a) comprises the target region.
16. 2. The method of claim 1, wherein the target region comprises a polyA sequence and / or the oligonucleotide comprises a polyU or polydT sequence, and optionally, the polyA sequence comprises at least 10 contiguous adenosine nucleotides.
17. 11. The method of claim 10, wherein the oligonucleotide is conjugated to a particle, optionally wherein the oligonucleotide is conjugated to a resin comprising a plurality of the particles, and optionally wherein a column comprises the resin.
18. 10. The method of claim 1, comprising providing a plurality of oligonucleotides, each oligonucleotide hybridizing to a different target region.
19. 10. The method of claim 1, wherein the oligonucleotides have at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% complementarity to equal length portions of the target region.
20. 20. A population of polyribonucleotides produced by the method of any one of claims 1 to 19, optionally wherein the population comprises cyclic polyribonucleotides lacking the target region, wherein the cyclic polyribonucleotides comprise at least 40% (mol / mol) of the total polyribonucleotides in the composition, and / or wherein the population comprises less than 40% (mol / mol) of linear polyribonucleotides of the total polyribonucleotides in the composition.