Compounds and methods for reducing PCDH19 expression

JP2025500438A5Pending Publication Date: 2026-01-06IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024538028
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-22
Filing Date
2022-12-21
Publication Date
2026-01-06

AI Technical Summary

Technical Problem

Current treatments are lacking for neurodevelopmental diseases and disorders associated with PCDH19 mutations, such as PCDH19 epilepsy, which cause seizures, cognitive impairment, and other symptoms.

Method used

Development of oligomeric agents and pharmaceutical compositions that reduce PCDH19 expression by targeting PCDH19 RNA or protein levels in cells, using modified oligonucleotides with specific nucleobase sequences and sugar or internucleoside linkages to inhibit PCDH19 activity.

Benefits of technology

These agents effectively alleviate symptoms of PCDH19-associated disorders by reducing PCDH19 expression, providing therapeutic benefits for conditions like PCDH19 epilepsy, cognitive impairment, and other neurodevelopmental issues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2023122681000001
    Figure 2023122681000001
  • Figure 2023122681000002
    Figure 2023122681000002
Patent Text Reader

Abstract

Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of Protocadherin 19 (PCDH19) RNA in a cell or subject, and in certain instances, for reducing the amount of PCDH19 protein in a cell or subject. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of a neurodevelopmental disease or disorder. Such neurodevelopmental diseases or disorders include PCDH19 epilepsy. Such symptoms or characteristics include seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Sequence Listing This application has been filed with an electronic sequence listing, which is provided in a file entitled BIOL0443SEQ.xml, created on December 16, 2022, and which is 1.37 MB in size. The information in the electronic format of this sequence listing is incorporated herein by reference in its entirety.

[0002] Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of Protocadherin 19 (PCDH19) RNA in a cell or subject, and in certain instances, for reducing the amount of PCDH19 protein in a cell or subject. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of a neurodevelopmental disease or disorder. Such neurodevelopmental diseases or disorders include PCDH19 epilepsy. Such symptoms or characteristics include seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD). [Background technology]

[0003] The X-linked gene encoding protocadherin 19 (PCDH19) is primarily expressed in the central nervous system and is involved in cell-cell adhesion and synaptic function. PCDH19 mutations result in PCDH19-associated neurodevelopmental diseases and disorders, including PCDH19-girl cluster epilepsy (GCE) epilepsy (also known as PCDH19-girl cluster epilepsy (GCE) epilepsy, PCDH19 disorder, and female-limited mental retardation (EFMR)) (Hoshima, N., et al., 2021, Science, Apr16;372(6539):eaaz3893.doi:10.1126 / science.aaz3893). PCDH19 epilepsy is the second most common cause of epilepsy, with approximately 1 in 10 girls with seizures by age 5 having PCDH19 epilepsy. PCDH19 epilepsy has a unique inheritance pattern due to random X-chromosome inactivation, and PCDH19 epilepsy is associated with mosaic expression of mutant PCDH19. This mutation results in abnormal neurodevelopment and is found in women who are heterozygous for PCDH19 mutations and in men who are mosaic carriers of somatic PCDH19 mutations. Hemizygous men generally do not experience symptoms or have a more subtle phenotype (Thomas, P., et al., 2018, Neuron, 97, 59-66). PCDH19 mutations are associated with seizures (including clusters of seizures, generalized tonic-clonic seizures and / or focal seizures that can evolve into bilateral tonic-clonic seizures), cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity disorder, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD). Upon reaching adolescence, there may be a reduction or remission of seizures, but one or more of the following may remain: cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD) (Kolc., KL, et al., 2019, Mol. Psych. 24, 241-251; Kolc, KL, et al., 2020, Transl. Psych. 10, 127).

[0004] Currently, there are no acceptable options for treating diseases and disorders associated with PCDH19 mutations. Therefore, it is an object of the present invention to provide compounds and pharmaceutical compositions for treating such diseases and disorders. Summary of the Invention

[0005] Certain embodiments of the oligomeric agents, oligomeric compounds, and pharmaceutical compositions described herein are useful for reducing or inhibiting PCDH19 expression in cells or subjects. In certain embodiments, PCDH19 RNA levels or protein levels can be reduced in cells or subjects. Methods for treating PCDH19 epilepsy are also provided. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0006] It should be understood that both the foregoing Summary of the Invention and the following Detailed Description are merely exemplary and explanatory, and not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the term "including" and other forms of "includes" and "included" are not limiting. Also, terms such as "element" or "component" encompass both elements and components that include one unit, and elements and components that include two or more subunits, unless expressly stated otherwise.

[0007] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0008] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0009] Unless otherwise indicated, the following terms have the following meanings. As used herein, "2'-deoxyribonucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D structure as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside or a nucleoside that includes an unmodified 2'-deoxyribosyl sugar moiety can include a modified nucleobase or can include an RNA nucleobase (uracil).

[0010] As used herein, "2'-MOE" refers to a 2'-OCH substituted for the 2'-OH group in a furanosyl sugar moiety. 2 CH 2 OCH 3 A "2'-MOE sugar moiety" or a "2'-O-methoxyethyl sugar moiety" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. 2 CH 2 OCH 3 "MOE" refers to a sugar moiety having a 2'-MOE group. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0011] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0012] As used herein, "2'-OMe" refers to a 2'-OCH substituted for the 2'-OH group of a furanosyl sugar moiety. 3 A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. 3 Unless otherwise indicated, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0013] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0014] As used herein, "2'-F" means a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-O-fluoro sugar moiety" or "2'-F sugar moiety" means a sugar moiety having a 2'-OF group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-F sugar moiety is in the β-D-ribosyl configuration.

[0015] As used herein, "Xylo 2'-F" refers to a 2'-F sugar moiety of β-D-xylosyl configuration.

[0016] As used herein, "2'-substituted nucleoside" means a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with reference to the sugar moiety means the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0017] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0018] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0019] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0020] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not linked to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0021] As used herein, "administration" or "administering" means providing a pharmaceutical agent or composition to an animal.

[0022] As used herein, "ameliorating" with respect to a disease or condition means an improvement in at least one symptom of the disease or condition relative to the same symptom in the absence of treatment. In certain embodiments, amelioration is a decrease in the severity or frequency of a symptom, or a delay in the onset or progression of the severity or frequency of a symptom.

[0023] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0024] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl sugar moiety.

[0025] As used herein, "blunt" or "blunt ended" in reference to an oligomeric duplex formed by two oligonucleotides means that there are no unpaired nucleotides at the ends (i.e., there are no overhanging nucleotides). One or both ends of the oligomeric duplex can be blunt.

[0026] As used herein, "cell targeting moiety" means a conjugate group or a portion of a conjugate group that is capable of binding to a particular cell type or types of cells.

[0027] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space around the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.

[0028] As used herein, a "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0029] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite orientations. As used herein, "complementary nucleobases" means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (C) and 5-methylcytosine (D) and 5-methylcytosine (E). mThe term "fully complementary" or "100% complementary" as used herein with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or a target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0030] As used herein, a "region of complementarity" with respect to an oligonucleotide is the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0031] As used herein, "conjugate group" refers to a group of atoms directly or indirectly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0032] As used herein, "conjugate linker" means a single bond or a group of atoms that contains at least one bond that connects a conjugate moiety to an oligonucleotide.

[0033] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0034] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0035] As used herein, "constrained ethyl" or "cEt" refers to a 4' to 2' bridge in place of the 2'OH group of the ribosyl sugar moiety, the bridge being a 4'-CH(CH 3 A "cEt sugar moiety" is a bicyclic sugar moiety having a 4' to 2' bridge in place of the 2' OH group of a ribosyl sugar moiety, the bridge being 4'-CH(CH 3 )-O-2', where the bridging methyl group is in the S configuration. "cEt" means constrained ethyl.

[0036] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0037] As used herein, "chirally enriched" refers to a plurality of molecules of the same molecular formula, where the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereo-random. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereo-random chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that includes a modified oligonucleotide.

[0038] As used herein, "chirally controlled" with respect to an internucleoside linkage means that the chirality of that linkage is enriched in a particular stereochemical configuration.

[0039] As used herein, a "deoxy region" refers to a region of 5-12 contiguous nucleotides, at least 70% of the nucleosides being 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0040] As used herein, "double stranded" with respect to a region or oligonucleotide means a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that are folded back on themselves (e.g., a hairpin structure).

[0041] As used herein, "duplex" or "double-stranded region" refers to the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

[0042] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage located between external regions having one or more nucleosides, the nucleosides comprising the internal region being chemically distinct from the nucleosides or nucleosides comprising the external region. The internal region may be referred to as a "gap" and the external region may be referred to as a "wing" or "wing segment." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5' end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides of the gap being 2'-β-D-deoxynucleosides. As used herein, "MOE gapmer" refers to a gapmer having a gap comprising wings comprising 2'-β-D-deoxynucleosides and 2'-MOE nucleosides. As used herein, the term "mixed winged gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0043] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0044] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Without being limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligomeric duplexes and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0045] As used herein, "internucleoside linkage" refers to a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphodiester internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0046] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as depicted herein.

[0047] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having 3' to 3' and / or 5' to 5' internucleoside linkages.

[0048] As used herein, "linked nucleosides" are nucleosides that are joined in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0049] As used herein, "linker-nucleoside" refers to a nucleoside that links an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker-nucleoside is located within the conjugate linker of an oligomeric compound. The linker-nucleoside is not considered part of the oligonucleotide portion of the oligomeric compound, even if they are contiguous with the oligonucleotide.

[0050] "Lipid nanoparticles" or "LNPs" are vesicles that contain a lipid layer that encapsulates a pharma- ceutically active molecule, such as a nucleic acid molecule, e.g., RNAi or a plasmid into which RNAi is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0051] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence, or target nucleic acid, when the first and second nucleic acid sequences are aligned in opposing orientations.

[0052] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0053] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0054] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0055] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" refers to adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" refers to an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0056] As used herein, "nucleoside" refers to a compound or fragment of a compound that includes a nucleobase and a sugar moiety. Each of the nucleobase and sugar moieties is independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside that contains a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0057] As used herein, "nucleoside overhang" refers to unpaired nucleotides at either or both ends of a duplex formed by hybridization of two oligonucleotides.

[0058] As used herein, "oligomeric agent" refers to an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds.

[0059] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not pair with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an oligomeric compound that is not paired. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0060] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside bonds, where each nucleoside and internucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications. An oligonucleotide may or may not be paired with a second oligonucleotide that is complementary to the oligonucleotide. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0061] As used herein, an "oligonucleotide duplex" refers to a duplex formed by two pairs of oligonucleotides having complementary nucleobase sequences. Each oligo of an oligonucleotide duplex is a "double-stranded oligonucleotide" or a "double-stranded oligonucleotide."

[0062] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to an animal. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by an animal. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0063] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects.

[0064] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to an animal. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0065] As used herein, "reducing the amount or activity" means a reduction or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete abolition of transcriptional expression or activity.

[0066] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0067] As used herein, "RNAi agent" refers to an antisense compound that acts, at least in part, via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act via RNase H.

[0068] As used herein, "RNase H agent" refers to an antisense compound that acts via RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single stranded. In certain embodiments, the RNase H agent is double stranded. The RNase H agent may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act primarily via RISC / Ago2.

[0069] As used herein with respect to oligonucleotides, "self-complementary" means an oligonucleotide that at least partially hybridizes to itself.

[0070] As used herein, "single-stranded" refers to nucleic acids (including, but not limited to, oligonucleotides) that are unpaired and not part of a double strand. Single-stranded compounds can hybridize with complementary nucleic acids to form double strands, at which point they are no longer single-stranded.

[0071] As used herein, a "stabilized phosphate group" refers to a 5' phosphate analog that is more metabolically stable than the 5' phosphate naturally occurring on DNA or RNA.

[0072] As used herein, "standard cellular assay" and "standard in vitro assay" are used interchangeably herein and the terms refer to the assay described in Example 1 and reasonable variations thereof.

[0073] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules with a stereorandom chiral center (S) configuration can be, but is not necessarily, the same as the number of molecules with a stereorandom chiral center (R) configuration. The stereochemical configuration of a chiral center is considered to be random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0074] As used herein, "subject" means a human or non-human animal. The terms "subject," "animal," and "individual" are used interchangeably. In certain embodiments, the subject is a human.

[0075] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or a sugar surrogate.

[0076] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be incorporated at one or more positions in an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.

[0077] As used herein, "symptom or characteristic" means any physical feature or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristic is apparent upon invasive diagnostic testing, including but not limited to post-mortem testing.

[0078] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0079] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0080] As used herein, "terminal group" refers to a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0081] As used herein, "treating" means improving a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom as compared to the same symptom without treatment. In certain embodiments, treating reduces the severity or frequency of a symptom, delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.

[0082] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that provides a therapeutic effect to an animal. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0083] As used herein, "antisense activity" refers to any detectable and / or measurable change that can be caused by the hybridization of antisense compound to its target nucleic acid.In certain embodiments, antisense activity is the reduction of the amount or expression of target nucleic acid or protein encoded by such target nucleic acid compared to the target nucleic acid level or target protein level in the absence of antisense compound.In certain embodiments, antisense activity is the regulation of splicing of target pre-mRNA.

[0084] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0085] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0086] As used herein, a "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0087] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises an oligonucleotide portion of an antisense compound that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0088] As used herein, "sense oligonucleotide" means an oligonucleotide that contains an oligonucleotide portion of a sense compound that is capable of hybridizing to an antisense oligonucleotide.

[0089] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0090] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a PCDH19 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0091] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of SEQ ID NOs: 15-482, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0092] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or 16 consecutive nucleobases of any of SEQ ID NOs: 15-560, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0093] Embodiment 4. The oligomeric compound according to embodiment 2 or 3, wherein the modified oligonucleotide has a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 15 to 560.

[0094] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of SEQ ID NOs: 561-1028, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0095] Embodiment 6. The oligomeric compound according to embodiment 5, wherein the modified oligonucleotide has a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 561-1028.

[0096] Embodiment 7.1 A modified oligonucleotide consisting of 2 to 50 linked nucleosides, An isometric portion of nucleobases 4,743 to 4,767 of SEQ ID NO: 1; an isometric portion of nucleobases 12,319 to 12,346 of SEQ ID NO: 1; an isometric portion of nucleobases 34,364 to 34,389 of SEQ ID NO: 1; or 1. An oligomeric compound having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an isometric portion of nucleobases 84, 408 to 84, 431 of SEQ ID NO:1, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0097] Embodiment 8.1 A modified oligonucleotide consisting of 2 to 50 linked nucleosides, SEQ ID NO: 132, 228, 284, 330, or 440, SEQ ID NO: 416, 72, 129, or 204, SEQ ID NO: 371, 425, 20, or 111, or 1. An oligomeric compound having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of a sequence selected from SEQ ID NOs: 367, 407, 24, 93, or 218, An oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0098] Embodiment 9. The oligomeric compound of any one of embodiments 1 to 8, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to either the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2 when measured over the entire nucleobase sequence of the modified oligonucleotide.

[0099] Embodiment 10. The modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 1 10. The oligomeric compound according to any one of embodiments 1 to 9, consisting of 7 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0100] Embodiment 11. The oligomeric compound according to any one of embodiments 1 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside.

[0101] Embodiment 12. The oligomeric compound according to embodiment 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0102] Embodiment 13 The oligomeric compound of embodiment 12, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0103] Embodiment 14. The bicyclic sugar moiety is -O-CH 2 - and -O-CH(CH 3 14. The oligomeric compound of embodiment 13, comprising a 2'-4' bridge selected from:

[0104] Embodiment 15. The oligomeric compound according to any one of embodiments 11 to 14, wherein at least one modified nucleoside of the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0105] Embodiment 16. The oligomeric compound according to embodiment 15, wherein at least one modified nucleoside of the modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge and a non-bicyclic modified sugar moiety.

[0106] Embodiment 17. The non-bicyclic modified sugar moiety is 2'-O(CH 2 ) 2 -OCH 3 The oligomeric compound according to embodiment 15 or 16, wherein the sugar moiety is a ribosyl sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0107] Embodiment 18. The oligomeric compound according to any one of embodiments 1 to 17, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0108] Embodiment 19. The oligomeric compound of embodiment 18, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate selected from morpholino and PNA.

[0109] Embodiment 20. The oligomeric compound according to any one of embodiments 1 to 19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0110] Embodiment 21 The oligomeric compound according to embodiment 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0111] Embodiment 22. The oligomeric compound according to embodiment 20 or 21, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0112] Embodiment 23. The oligomeric compound according to embodiment 20 or 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0113] Embodiment 24. The oligomeric compound of any one of embodiments 20, 22, or 23, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, or a phosphorothioate internucleoside linkage.

[0114] Embodiment 25. The oligomeric compound according to any one of embodiments 20 or 22 to 24, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

[0115] Embodiment 26. The oligomeric compound according to any one of embodiments 20-22, 24 or 25, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0116] Embodiment 27. The oligomeric compound according to any one of embodiments 20 or 22 to 26, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from 5'-ssssssssssssssssssss-3', 5'-sssssssssssssssss-3', 5'-soooossssssssssssss-3', and ssooooooooooooooooooooss, wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0117] Embodiment 28. The oligomeric compound according to any one of embodiments 1 to 27, wherein the modified oligonucleotide comprises a modified nucleobase.

[0118] Embodiment 29. The oligomeric compound according to embodiment 28, wherein the modified nucleobase is 5-methylcytosine.

[0119] Embodiment 30. The oligomeric compound according to any one of embodiments 1 to 29, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 16 to 18, 18 to 22, 18 to 25, 18 to 20, 20 to 25, or 21 to 23 linked nucleosides, or a pharma- ceutically acceptable salt thereof.

[0120] Embodiment 31. The oligomeric compound according to embodiment 30, wherein the modified oligonucleotide is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0121] Embodiment 32. The oligomeric compound according to any one of embodiments 1 to 31, wherein the modified oligonucleotide consists of 16 linked nucleosides.

[0122] Embodiment 33. The oligomeric compound according to any one of embodiments 1 to 31, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0123] Embodiment 34. The oligomeric compound according to any one of embodiments 1 to 31, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0124] Embodiment 35. The oligomeric compound according to any one of embodiments 1 to 31, wherein the modified oligonucleotide consists of 21 linked nucleosides.

[0125] Embodiment 36. The oligomeric compound according to any one of embodiments 1 to 31, wherein the modified oligonucleotide consists of 23 linked nucleosides.

[0126] Embodiment 37. An oligomeric compound according to any one of embodiments 1 to 35, wherein the oligomeric compound activates RNase H.

[0127] Embodiment 38 The oligomeric compound according to embodiment 37, wherein the modified oligonucleotide is a gapmer.

[0128] Embodiment 39. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; the 3'-terminal nucleoside of the 5'-region and the 5'-terminal nucleoside of the 3'-region comprise a modified sugar moiety; 35. The oligomeric compound of any one of embodiments 1-34, wherein each of the central region nucleosides is selected from nucleosides that include a 2'-β-D-deoxyribosyl sugar moiety and nucleosides that include a 2'-substituted sugar moiety, and the central region comprises at least 6 nucleosides that include a 2'-β-D-deoxyribosyl sugar moiety and no more than 2 nucleosides that include a 2'-substituted sugar moiety.

[0129] Embodiment 40. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; The oligomeric compound of any one of embodiments 1 to 39, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0130] Embodiment 41. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; Each of the 5'-region nucleosides and each of the 3'-region nucleosides are 2'-O(CH 2 ) 2 -OCH 3 The oligomeric compound of embodiment 40, comprising a ribosyl modified sugar moiety, wherein each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0131] Embodiment 42. The modified oligonucleotide comprises: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of three linked 3' region nucleosides; The oligomeric compound of embodiment 40, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a cEt sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0132] Embodiment 43. A chirally enriched population of oligomeric compounds according to any one of embodiments 1 to 42, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0133] Embodiment 44. A chirally enriched population according to embodiment 43, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Sp) or (Rp) configuration.

[0134] Embodiment 45. The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0135] Embodiment 46. The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0136] Embodiment 47. The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp configuration, the Sp configuration, and the Rp configuration.

[0137] Embodiment 48. A population of oligomeric compounds according to any one of embodiments 1 to 42, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random.

[0138] Embodiment 49. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound according to any one of embodiments 1 to 42.

[0139] Embodiment 50. The oligomeric duplex of embodiment 49, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0140] Embodiment 51. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 561 to 1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0141] Embodiment 52. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 561 to 1028; and and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1029-1496, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0142] Embodiment 53. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises any one of the nucleic acid base sequences of SEQ ID NOs: 561 to 1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 1029-1496, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0143] Embodiment 54 The oligomeric duplex of any one of embodiments 49 to 53, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5'-stabilizing phosphate group.

[0144] Embodiment 55. The oligomeric duplex of embodiment 54, wherein the 5'-stabilizing phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

[0145] Embodiment 56 The oligomeric duplex of any one of embodiments 49 to 53, wherein the modified oligonucleotide of the first oligomeric compound comprises a glycol nucleic acid (GNA) sugar surrogate.

[0146] Embodiment 57 The oligomeric duplex of any one of embodiments 49 to 55, wherein the modified oligonucleotide of the first oligomeric compound comprises a 2'-NMA sugar moiety.

[0147] Embodiment 58 The oligomeric duplex of any one of embodiments 49 to 57, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0148] Embodiment 59 The oligomeric duplex of embodiment 58, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0149] Embodiment 60. The bicyclic sugar moiety of the second modified oligonucleotide is -O-CH 2 - and -O-CH(CH 3 60. The oligomeric duplex of embodiment 59, comprising a 2'-4' bridge selected from:

[0150] Embodiment 61 The oligomeric duplex of embodiment 59 or 60, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0151] Embodiment 62 The oligomeric duplex of embodiment 61, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0152] Embodiment 63 The oligomeric duplex of any one of embodiments 49 to 62, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

[0153] Embodiment 64 The oligomeric duplex of any one of embodiments 49 to 63, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage.

[0154] Embodiment 65 The oligomeric duplex of embodiment 64, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0155] Embodiment 66 The oligomeric duplex of any one of embodiments 49 to 65, wherein the second modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0156] Embodiment 67. The oligomeric duplex of any one of embodiments 49 to 66, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0157] Embodiment 68. The oligomeric duplex of any one of embodiments 49 to 67, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooooooss, wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0158] Embodiment 69. The oligomeric duplex of any one of embodiments 49 to 68, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0159] Embodiment 70 The oligomeric duplex of embodiment 69, wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

[0160] Embodiment 71 The oligomeric duplex of any one of embodiments 49 to 70, wherein the second modified oligonucleotide comprises a conjugate group.

[0161] Embodiment 72 The oligomeric duplex of embodiment 71, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0162] Embodiment 73. The oligomeric duplex of embodiment 71 or 72, wherein the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide.

[0163] Embodiment 74. The oligomeric duplex of embodiment 71 or 72, wherein the conjugate group is attached to a second modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0164] Embodiment 75. The oligomeric duplex of embodiment 71 or 72, wherein the conjugate group is attached to the second modified nucleotide via a modified internucleoside linkage.

[0165] Embodiment 76. The oligomeric duplex of any one of embodiments 71-75, wherein the conjugate group comprises C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0166] Embodiment 77 The oligomeric duplex of any one of embodiments 71 to 76, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.

[0167] Embodiment 78. The conjugate group has the following structure: [ka] 75. The oligomeric duplex of any one of embodiments 71 to 74, comprising:

[0168] Embodiment 79. The oligomeric duplex of any one of embodiments 71 to 78, wherein the conjugate group comprises a cell targeting moiety.

[0169] Embodiment 80 The oligomeric duplex of any one of embodiments 49 to 79, wherein the second modified oligonucleotide comprises a terminal group.

[0170] Embodiment 81 The oligomeric duplex of embodiment 80, wherein the terminal group is an abasic sugar moiety.

[0171] Embodiment 82. The second modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 82. The oligomeric duplex of any one of embodiments 49-81, consisting of 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0172] Embodiment 83. The oligomeric duplex of any one of embodiments 49 to 81, wherein the modified oligonucleotide of the first oligomeric compound consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.

[0173] Embodiment 84. The oligomeric duplex of embodiment 83, wherein the modified oligonucleotide of the first oligomeric compound has a sugar motif (5' to 3') of yfyyyyyyyyyyfyyyyyyy and the second modified oligonucleotide has a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyyy, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0174] Embodiment 85. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of embodiments 1 to 42.

[0175] Embodiment 86. An antisense agent, wherein the antisense agent is an oligomeric duplex according to any one of embodiments 49 to 84.

[0176] Embodiment 87. The antisense agent is i. an RNase H agent capable of reducing the amount of PCDH19 nucleic acid by activating RNase H, or ii. The antisense agent of embodiment 85 or 86, which is an RNAi agent capable of reducing the amount of PCDH19 nucleic acid by activating RISC / Ago2.

[0177] Embodiment 88. The antisense agent of any one of embodiments 85 to 87, wherein the conjugate group is a cell targeting moiety.

[0178] Embodiment 89. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 42, a population according to any one of embodiments 43 to 48, an oligomeric duplex according to any one of embodiments 49 to 84, or an antisense agent according to any one of embodiments 85 to 88, and a pharma- ceutically acceptable diluent.

[0179] Embodiment 90. The pharmaceutical composition of embodiment 89, wherein the pharma- cerebrospinal fluid is artificial cerebrospinal fluid (aCSF) or PBS.

[0180] Embodiment 91. The pharmaceutical composition of embodiment 90, wherein the pharmaceutical composition consists essentially of the oligomeric compound, population, oligomeric duplex, or antisense agent, and aCSF.

[0181] Embodiment 92. The pharmaceutical composition of embodiment 90, wherein the pharmaceutical composition consists essentially of the oligomeric compound, population, oligomeric duplex, or antisense agent, and PBS.

[0182] Embodiment 93. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1 to 42, a population according to any one of embodiments 43 to 48, an oligomeric duplex according to any one of embodiments 49 to 84, an antisense agent according to any one of embodiments 85 to 88, or a pharmaceutical composition according to any one of embodiments 89 to 92.

[0183] Embodiment 94. The method of embodiment 93, wherein the subject has a disease associated with PCDH19.

[0184] Embodiment 95. The method of embodiment 93, wherein the subject has PCDH19 epilepsy.

[0185] Embodiment 96. A method for treating a disease associated with PCDH19, comprising administering to a subject having or at risk of developing a disease associated with PCDH19 a therapeutically effective amount of an oligomeric compound according to any one of embodiments 1 to 42, a population according to any one of embodiments 43 to 48, an oligomeric duplex according to any one of embodiments 49 to 84, an antisense agent according to any one of embodiments 85 to 88, or a pharmaceutical composition according to any one of embodiments 89 to 92, thereby treating the disease associated with PCDH19.

[0186] Embodiment 97 The method of embodiment 96, wherein the disease associated with PCDH19 is a neurodevelopmental disease.

[0187] Embodiment 98. The method of embodiment 96 or 97, wherein the disease associated with PCDH19 is PCDH19 epilepsy.

[0188] Embodiment 99. The method of any one of embodiments 96 to 98, wherein at least one symptom or characteristic of a disease associated with PCDH19 is alleviated.

[0189] Embodiment 100. The method of embodiment 99, wherein the symptom or characteristic is seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD).

[0190] Embodiment 101. The method of embodiment 100, wherein the seizures are any of clusters of seizures, generalized tonic-clonic seizures, focal seizures, or bilateral seizures.

[0191] Embodiment 102. The method of any one of embodiments 96-101, wherein administering the oligomeric compound of any one of embodiments 1-42, the population of any one of embodiments 43-48, the oligomeric duplex of any one of embodiments 49-84, the antisense agent of any one of embodiments 85-88, or the pharmaceutical composition of any one of embodiments 89-92 reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism spectrum disorder, reduces behavioral problems, reduces aggression, reduces anxiety, reduces obsessive-compulsive behavior, reduces hyperactivity, reduces symptoms of Attention Deficit Disorder (ADD), or reduces symptoms of Attention Deficit Hyperactivity Disorder (ADHD) in the subject.

[0192] Embodiment 103. The method of any one of embodiments 93 to 102, wherein the subject is a human.

[0193] Embodiment 104. A method for reducing expression of PCDH19 in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 42, a population according to any one of embodiments 43 to 48, an oligomeric duplex according to any one of embodiments 49 to 84, an antisense agent according to any one of embodiments 85 to 88, or a pharmaceutical composition according to any one of embodiments 89 to 92.

[0194] Embodiment 105. The method of embodiment 104, wherein the cell is a neuron.

[0195] Embodiment 106 The method of embodiment 104 or 105, wherein the cell is a human cell.

[0196] Embodiment 107. Use of an oligomeric compound according to any one of embodiments 1 to 42, a population according to any one of embodiments 43 to 48, an oligomeric duplex according to any one of embodiments 49 to 84, an antisense agent according to any one of embodiments 85 to 88, or a pharmaceutical composition according to any one of embodiments 89 to 92 for treating a disease associated with PCDH19.

[0197] Embodiment 108. Use of an oligomeric compound according to any one of embodiments 1 to 42, a population according to any one of embodiments 43 to 48, an oligomeric duplex according to any one of embodiments 49 to 84, or an antisense agent according to any one of embodiments 85 to 88 in the manufacture of a medicament for treating a disease associated with PCDH19.

[0198] Embodiment 109. The use according to embodiment 107 or 108, wherein the disease associated with PCDH19 is PCDH19 epilepsy.

[0199] Certain Oligomeric Agents and Compounds Certain embodiments provide oligomeric agents that target PCDH19 nucleic acids. In certain embodiments, the PCDH19 nucleic acid has a sequence as set forth in SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15, version 104, May 2021), SEQ ID NO: 2 (cDNA of ENSEMBL Accession No. ENST00000373034.8, version 104:May2021), or both, each of which is incorporated by reference in its entirety. In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is an oligomeric double-stranded.

[0200] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a PCDH19 nucleic acid, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the PCDH19 nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or 2.

[0201] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-560.

[0202] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-482.

[0203] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 15 to 560.

[0204] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the modified oligonucleotide has nucleobases consisting of any of the nucleobases of SEQ ID NOs: 15-482.

[0205] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has nucleobases consisting of any of the nucleobases of SEQ ID NOs: 483-560.

[0206] In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a PCDH19 nucleic acid, the PCDH19 nucleic acid having the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0207] In any of the oligomeric compounds provided herein, the modified oligonucleotide may be 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16- 50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0208] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide may contain a modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic sugar moiety, e.g., -O-CH 2- and -O-CH(CH 3 )-. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0209] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound may include a sugar surrogate.

[0210] In any of the oligomeric compounds provided herein, at least one internucleoside bond of the modified oligonucleotide may include a modified internucleoside bond, such as a phosphorothioate internucleoside bond. In certain embodiments, each internucleoside bond of the modified oligonucleotide may be a modified internucleoside bond, or each internucleoside bond of the modified oligonucleotide may be a phosphorothioate internucleoside bond. In certain embodiments, at least one internucleoside bond of the modified oligonucleotide may be a phosphodiester internucleoside bond. In certain embodiments, each internucleoside bond of the modified oligonucleotide may be independently selected from a phosphodiester or phosphorothioate internucleoside bond. In certain embodiments, at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside bonds of the modified oligonucleotide may be a phosphodiester internucleoside bond. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.

[0211] In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide may be a modified nucleobase, such as 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

[0212] In any of the oligomeric compounds provided herein, the modified oligonucleotide can include a deoxy region consisting of 5-12 contiguous 2'-deoxynucleosides. In certain embodiments, each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is adjacent on the 5' side to a 5' region consisting of 1-6 linked 5' region nucleosides and on the 3' side to a 3' region consisting of 1-6 linked 3' region nucleosides, the 3' terminal nucleoside of the 5' region comprises a modified sugar moiety, and the 5' terminal nucleoside of the 3' region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 3' region comprises a modified sugar moiety.In certain embodiments, each nucleoside of the 5' region comprises a modified sugar moiety.

[0213] In certain embodiments, the compound comprises or consists of a modified oligonucleotide consisting of 16-50 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence set forth in any one of SEQ ID NOs: 483-560, wherein the modified oligonucleotide is a gap segment consisting of 10 linked 2'-deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; A gap segment is disposed between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt nucleoside, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0214] In certain embodiments, the compound comprises or consists of a modified oligonucleotide consisting of 16-50 linked nucleosides and having a nucleobase sequence comprising a nucleobase sequence listed in any one of SEQ ID NOs: 15-482, wherein the modified oligonucleotide is a gap segment consisting of 10 linked 2'-deoxynucleosides; a 5' wing segment consisting of 5 linked nucleosides; and a 3' wing segment consisting of 5 linked nucleosides, A gap segment is disposed between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2'-MOE nucleoside and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides and the internucleoside linkage motif for the modified oligonucleotide is (5' to 3') sooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0215] In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate linker consists of a single bond, the conjugate linker is cleavable, the conjugate linker comprises 1-3 linker-nucleosides, the conjugate linker does not comprise a linker nucleoside, the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide, or the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0216] In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0217] In certain embodiments, the conjugate group has the structure: [ka]

[0218] Certain oligomeric duplexes Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound.

[0219] In certain embodiments, the oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15 to 560; and and a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0220] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0221] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide consists of any one of the nucleic acid base sequences of SEQ ID NOs: 15 to 560; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0222] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0223] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 561 to 1028; and and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0224] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0225] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 561 to 1028; and and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1029-1496, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0226] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0227] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises any one of the nucleic acid base sequences of SEQ ID NOs: 561 to 1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 1029-1496, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0228] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0229] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 723 / 1029, 724 / 1030, 725 / 1031, 561 / 1032, 562 / 1033, 563 / 1034, 726 / 1035, 727 / 1036, 728 / 1037, 729 / 1038, 730 / 1039, 731 / 1040, 732 / 1041, 733 / 1042, 734 / 1043, 735 / 1044, 736 / 1045, 737 / 1046, 738 / 1047, 739 / 1050, 739 / 1051, 739 / 1052, 739 / 1053, 739 / 1054, 739 / 1055, 739 / 1056, 739 / 1057, 739 / 1058, 739 / 1060, 739 / 1061, 739 / 1062, 739 / 1063, 739 / 1064, 739 / 1065, 739 / 1066, 739 / 1067, 739 / 1068, 740 / 1069, 740 / 1069, 740 / 1069, 740 / 106 35, 727 / 1036, 728 / 1037, 564 / 1038, 729 / 1039, 730 / 1040, 731 / 1041, 732 / 1042, 733 / 1043, 565 / 1044, 734 / 1045, 566 / 1046, 735 / 1047, 567 / 1048, 736 / 1 049, 737 / 1050, 738 / 1051, 568 / 1052, 739 / 1053, 740 / 1054, 741 / 1055, 742 / 1056, 743 / 1057, 569 / 1058, 744 / 1059, 745 / 1060, 746 / 1061, 747 / 1062, 748 / 1063, 570 / 1064, 749 / 1065, 571 / 1066, 750 / 1067, 751 / 1068, 572 / 1069, 573 / 1070, 574 / 1071, 575 / 1072, 576 / 1073, 577 / 1074, 578 / 1075, 752 / 1076, 753 / 1077, 579 / 1078, 580 / 1079, 754 / 1080, 581 / 1081, 582 / 1082, 755 / 1083, 756 / 1084, 583 / 1085, 584 / 1086, 757 / 1087, 758 / 1088, 585 / 1089, 586 / 1090, 58 7 / 1091, 588 / 1092, 589 / 1093, 590 / 1094, 591 / 1095, 592 / 1096, 759 / 1097, 593 / 1098, 594 / 1099, 760 / 1100, 595 / 1101, 596 / 1102, 761 / 1103, 597 / 1104, 5 98 / 1105, 762 / 1106, 763 / 1107, 599 / 1108, 764 / 1109, 765 / 1110, 766 / 1111, 600 / 1112, 767 / 1113, 768 / 1114, 769 / 1115, 770 / 1116, 601 / 1117, 771 / 1118,602 / 1119、772 / 1120、773 / 1121、774 / 1122、603 / 1123、604 / 1124、775 / 1125、605 / 1126、606 / 1127、776 / 1128、777 / 1129、778 / 1130、779 / 1131、780 / 1132、781 / 1133、782 / 1134、783 / 1135、784 / 1136、607 / 1137、785 / 1138、786 / 1139、787 / 1140、788 / 1141、608 / 1142、609 / 1143、610 / 1144、789 / 1145、611 / 1146、790 / 1147、612 / 1148、613 / 1149、791 / 1150、614 / 1151、792 / 1152、615 / 1153、793 / 1154、616 / 1155、794 / 1156、795 / 1157、617 / 1158、796 / 1159、797 / 1160、798 / 1161、618 / 1162、799 / 1163、619 / 1164、800 / 1165、801 / 1166、620 / 1167、621 / 1168、802 / 1169、803 / 1170、804 / 1171、805 / 1172、622 / 1173、806 / 1174、807 / 1175、808 / 1176、809 / 1177、623 / 1178、810 / 1179、811 / 1180、624 / 1181、812 / 1182、625 / 1183、813 / 1184、626 / 1185、814 / 1186、815 / 1187、627 / 1188、816 / 1189、817 / 1190、818 / 1191、628 / 1192、819 / 1193、629 / 1194、820 / 1195、630 / 1196、821 / 1197、631 / 1198、632 / 1199、822 / 1200、823 / 1201、824 / 1202、825 / 1203、633 / 1204、634 / 1205、826 / 1206、827 / 1207、635 / 1208、636 / 1209、828 / 1210、637 / 1211、638 / 1212、829 / 1213、830 / 1214、831 / 1215、832 / 1216、833 / 1217、834 / 1218、639 / 1219、640 / 1220、835 / 1221、641 / 1222、836 / 1223、642 / 1224、837 / 1225、838 / 1226、839 / 1227、840 / 1228、841 / 1229、842 / 1230、643 / 1231、644 / 1232、843 / 1233、645 / 1234、646 / 1235、844 / 1236、845 / 1237、846 / 1238、647 / 1239、847 / 1240、848 / 1241、849 / 1242、850 / 1243、851 / 1244、852 / 1245、648 / 1246、853 / 1247、854 / 1248、855 / 1249、856 / 1250、857 / 1251、858 / 1252、859 / 1253、649 / 1254、650 / 1255、651 / 1256、860 / 1257、861 / 1258、862 / 1259、863 / 1260、864 / 1261、652 / 1262、653 / 1263、865 / 1264、866 / 1265、867 / 1266、868 / 1267、654 / 1268、869 / 1269、655 / 1270、870 / 1271、871 / 1272、656 / 1273、872 / 1274、657 / 1275、873 / 1276、658 / 1277、659 / 1278、874 / 1279、875 / 1280、660 / 1281、876 / 1282、877 / 1283、878 / 1284、879 / 1285、880 / 1286、661 / 1287、662 / 1288、663 / 1289、881 / 1290、882 / 1291、883 / 1292、884 / 1293、885 / 1294、664 / 1295、886 / 1296、887 / 1297、888 / 1298、665 / 1299、666 / 1300、667 / 1301、889 / 1302、668 / 1303、890 / 1304、891 / 1305、892 / 1306、669 / 1307、893 / 1308、670 / 1309、671 / 1310、894 / 1311、672 / 1312、673 / 1313、895 / 1314、896 / 1315、674 / 1316、897 / 1317、675 / 1318、676 / 1319、677 / 1320、898 / 1321、899 / 1322、900 / 1323、901 / 1324、678 / 1325、902 / 1326、679 / 1327、903 / 1328、904 / 1329、905 / 1330、906 / 1331、907 / 1332、908 / 1333、680 / 1334、909 / 1335、910 / 1336、911 / 1337、912 / 1338、913 / 1339、681 / 1340、914 / 1341、915 / 1342、916 / 1343、917 / 1344、918 / 1345、919 / 1346、920 / 1347、921 / 1348、922 / 1349、923 / 1350、924 / 1351、925 / 1352、926 / 1353、927 / 1354、682 / 1355、928 / 1356、929 / 1357、930 / 1358、683 / 1359、684 / 1360、931 / 1361、932 / 1362、933 / 1363、934 / 1364、935 / 1365、685 / 1366、936 / 1367、937 / 1368、938 / 1369、939 / 1370、940 / 1371、941 / 1372、942 / 1373、943 / 1374、944 / 1375、945 / 1376、946 / 1377、947 / 1378、948 / 1379、949 / 1380、950 / 1381、951 / 1382、686 / 1383、687 / 1384、688 / 1385、689 / 1386、952 / 1387、690 / 1388、953 / 1389、691 / 1390、954 / 1391、692 / 1392、966 / 1411、967 / 1412、700 / 1413、701 / 1414、968 / 1415、702 / 1416、969 / 1417、970 / 1418、971 / 1419、972 / 1420、973 / 1421、703 / 1422、704 / 1423、974 / 1424、975 / 1425、705 / 1426、976 / 1427、977 / 1428、978 / 1429、979 / 1430、980 / 1431、981 / 1432、982 / 1433、983 / 1434、984 / 1435、985 / 1436、706 / 1437、986 / 1438、987 / 1439、707 / 1440、988 / 1441、989 / 1442、708 / 1443、709 / 1444、990 / 1445、991 / 1446、992 / 1447、993 / 1448、710 / 1449、994 / 1450、995 / 1451、996 / 1452、711 / 1453、997 / 1454、998 / 1455、999 / 1456、1000 / 1457、712 / 1458、1001 / 1459、1002 / 1460、713 / 1461、1003 / 1462、1004 / 1463、1005 / 1464、1006 / 1465、1007 / 1466、1008 / 1467、1009 / 1468、714 / 1469, 715 / 1470, 716 / 1471, 1010 / 1472, 717 / 1473, 718 / 1474, 1011 / 1475, 1012 / 1476, 719 / 1477, 720 / 1478, 1013 / 1479, 1014 / 1480, 1015 / 1481, 1016 / 1482, 1017 / 1483, 1018 / 1484, 1019 / 1485, 1020 / 1486, 102 1 / 1487, 1022 / 1488, 721 / 1489, 1023 / 1490, 722 / 1491, 693 / 1393, 694 / 1394, 695 / 1395, 955 / 1396, 956 / 1397, 957 / 1398, 958 / 1399, 696 / 1400, 959 / 1401, 697 / 1402, 960 / 1403, 698 / 1404, 699 / 1405, 961 / 1406, 962 / 1 407, 963 / 1408, 964 / 1409, 965 / 1410, 1024 / 1492, 1025 / 1493, 1026 / 1494, 1027 / 1495, or 1028 / 1496, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO set forth in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO set forth in the pair.

[0230] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 723 / 1029, 724 / 1030, 725 / 1031, 561 / 1032, 562 / 1033, 563 / 1034, 726 / 1035, 727 / 1036, 728 / 1037, 564 / 1038, 729 / 1039, 730 / 1040, 731 / 1041, 732 / 1042, 733 / 1043, 565 / 1044, 734 / 1045, 566 / 1046, 735 / 1047, 567 / 1048, 736 / 104 9, 737 / 1050, 738 / 1051, 568 / 1052, 739 / 1053, 740 / 1054, 741 / 1055, 742 / 1056, 743 / 1057, 569 / 1058, 744 / 1059, 745 / 1060, 746 / 1061, 747 / 1062, 748 / 10 63, 570 / 1064, 749 / 1065, 571 / 1066, 750 / 1067, 751 / 1068, 572 / 1069, 573 / 1070, 574 / 1071, 575 / 1072, 576 / 1073, 577 / 1074, 578 / 1075, 752 / 1076, 753 / 1077, 579 / 1078, 580 / 1079, 754 / 1080, 581 / 1081, 582 / 1082, 755 / 1083, 756 / 1084, 583 / 1085, 584 / 1086, 757 / 1087, 758 / 1088, 585 / 1089, 586 / 1090, 587 / 1091, 588 / 1092, 589 / 1093, 590 / 1094, 591 / 1095, 592 / 1096, 759 / 1097, 593 / 1098, 594 / 1099, 760 / 1100, 595 / 1101, 596 / 1102, 761 / 1103, 597 / 1104, 5 98 / 1105, 762 / 1106, 763 / 1107, 599 / 1108, 764 / 1109, 765 / 1110, 766 / 1111, 600 / 1112, 767 / 1113, 768 / 1114, 769 / 1115, 770 / 1116, 601 / 1117, 771 / 1118,602 / 1119、772 / 1120、773 / 1121、774 / 1122、603 / 1123、604 / 1124、775 / 1125、605 / 1126、606 / 1127、776 / 1128、777 / 1129、778 / 1130、779 / 1131、780 / 1132、781 / 1133、782 / 1134、783 / 1135、784 / 1136、607 / 1137、785 / 1138、786 / 1139、787 / 1140、788 / 1141、608 / 1142、609 / 1143、610 / 1144、789 / 1145、611 / 1146、790 / 1147、612 / 1148、613 / 1149、791 / 1150、614 / 1151、792 / 1152、615 / 1153、793 / 1154、616 / 1155、794 / 1156、795 / 1157、617 / 1158、796 / 1159、797 / 1160、798 / 1161、618 / 1162、799 / 1163、619 / 1164、800 / 1165、801 / 1166、620 / 1167、621 / 1168、802 / 1169、803 / 1170、804 / 1171、805 / 1172、622 / 1173、806 / 1174、807 / 1175、808 / 1176、809 / 1177、623 / 1178、810 / 1179、811 / 1180、624 / 1181、812 / 1182、625 / 1183、813 / 1184、626 / 1185、814 / 1186、815 / 1187、627 / 1188、816 / 1189、817 / 1190、818 / 1191、628 / 1192、819 / 1193、629 / 1194、820 / 1195、630 / 1196、821 / 1197、631 / 1198、632 / 1199、822 / 1200、823 / 1201、824 / 1202、825 / 1203、633 / 1204、634 / 1205、826 / 1206、827 / 1207、635 / 1208、636 / 1209、828 / 1210、637 / 1211、638 / 1212、829 / 1213、830 / 1214、831 / 1215、832 / 1216、833 / 1217、834 / 1218、639 / 1219、640 / 1220、835 / 1221、641 / 1222、836 / 1223、642 / 1224、837 / 1225、838 / 1226、839 / 1227、840 / 1228、841 / 1229、842 / 1230、643 / 1231、644 / 1232、843 / 1233、645 / 1234、646 / 1235、844 / 1236、845 / 1237、846 / 1238、647 / 1239、847 / 1240、848 / 1241、849 / 1242、850 / 1243、851 / 1244、852 / 1245、648 / 1246、853 / 1247、854 / 1248、855 / 1249、856 / 1250、857 / 1251、858 / 1252、859 / 1253、649 / 1254、650 / 1255、651 / 1256、860 / 1257、861 / 1258、862 / 1259、863 / 1260、864 / 1261、652 / 1262、653 / 1263、865 / 1264、866 / 1265、867 / 1266、868 / 1267、654 / 1268、869 / 1269、655 / 1270、870 / 1271、871 / 1272、656 / 1273、872 / 1274、657 / 1275、873 / 1276、658 / 1277、659 / 1278、874 / 1279、875 / 1280、660 / 1281、876 / 1282、877 / 1283、878 / 1284、879 / 1285、880 / 1286、661 / 1287、662 / 1288、663 / 1289、881 / 1290、882 / 1291、883 / 1292、884 / 1293、885 / 1294、664 / 1295、886 / 1296、887 / 1297、888 / 1298、665 / 1299、666 / 1300、667 / 1301、889 / 1302、668 / 1303、890 / 1304、891 / 1305、892 / 1306、669 / 1307、893 / 1308、670 / 1309、671 / 1310、894 / 1311、672 / 1312、673 / 1313、895 / 1314、896 / 1315、674 / 1316、897 / 1317、675 / 1318、676 / 1319、677 / 1320、898 / 1321、899 / 1322、900 / 1323、901 / 1324、678 / 1325、902 / 1326、679 / 1327、903 / 1328、904 / 1329、905 / 1330、906 / 1331、907 / 1332、908 / 1333、680 / 1334、909 / 1335、910 / 1336、911 / 1337、912 / 1338、913 / 1339、681 / 1340、914 / 1341、915 / 1342、916 / 1343、917 / 1344、918 / 1345、919 / 1346、920 / 1347、921 / 1348、922 / 1349、923 / 1350、924 / 1351、925 / 1352、926 / 1353、927 / 1354、682 / 1355、928 / 1356、929 / 1357、930 / 1358、683 / 1359、684 / 1360、931 / 1361、932 / 1362、933 / 1363、934 / 1364、935 / 1365、685 / 1366、936 / 1367、937 / 1368、938 / 1369、939 / 1370、940 / 1371、941 / 1372、942 / 1373、943 / 1374、944 / 1375、945 / 1376、946 / 1377、947 / 1378、948 / 1379、949 / 1380、950 / 1381、951 / 1382、686 / 1383、687 / 1384、688 / 1385、689 / 1386、952 / 1387、690 / 1388、953 / 1389、691 / 1390、954 / 1391、692 / 1392、966 / 1411、967 / 1412、700 / 1413、701 / 1414、968 / 1415、702 / 1416、969 / 1417、970 / 1418、971 / 1419、972 / 1420、973 / 1421、703 / 1422、704 / 1423、974 / 1424、975 / 1425、705 / 1426、976 / 1427、977 / 1428、978 / 1429、979 / 1430、980 / 1431、981 / 1432、982 / 1433、983 / 1434、984 / 1435、985 / 1436、706 / 1437、986 / 1438、987 / 1439、707 / 1440、988 / 1441、989 / 1442、708 / 1443、709 / 1444、990 / 1445、991 / 1446、992 / 1447、993 / 1448、710 / 1449、994 / 1450、995 / 1451、996 / 1452、711 / 1453、997 / 1454、998 / 1455、999 / 1456、1000 / 1457、712 / 1458、1001 / 1459、1002 / 1460、713 / 1461、1003 / 1462、1004 / 1463、1005 / 1464、1006 / 1465、1007 / 1466、1008 / 1467、1009 / 1468、714 / 1469, 715 / 1470, 716 / 1471, 1010 / 1472, 717 / 1473, 718 / 1474, 1011 / 1475, 1012 / 1476, 719 / 1477, 720 / 1478, 1013 / 1479, 1014 / 1480, 1015 / 1481, 1016 / 1482, 1017 / 148 3, 1018 / 1484, 1019 / 1485, 1020 / 1486, 1021 / 1487, 1022 / 1488, 721 / 1489, 1023 / 1490, 722 / 1491, 693 / 1393, 694 / 1394, 695 / 1395, 955 / 1396, 956 / 1397, 957 / 1398, 958 / 139 9, 696 / 1400, 959 / 1401, 697 / 1402, 960 / 1403, 698 / 1404, 699 / 1405, 961 / 1406, 962 / 1407, 963 / 1408, 964 / 1409, 965 / 1410, 1024 / 1492, 1025 / 1493, 1026 / 1494, 1027 / 1495, or 1028 / 1496, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO set forth in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO set forth in the pair.

[0231] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 723 / 1029, 724 / 1030, 725 / 1031, 561 / 1032, 562 / 1033, 563 / 1034, 726 / 1035, 727 / 1036, 728 / 1038, 729 / 1039, 730 / 1040, 731 / 1041, 732 / 1042, 733 / 1043, 734 / 1044, 735 / 1045, 736 / 1046, 737 / 1047, 738 / 1048, 739 / 1050, 740 / 1051, 741 / 1052, 742 / 1053, 743 / 1054, 744 / 1055, 745 / 1056, 746 / 1057, 747 / 1058, 748 / 1059, 750 / 1060, 751 / 1061, 752 / 1062, 753 / 1063, 754 / 1064, 755 / 1065, 756 / 1066, 757 / 1067, 758 / 1068, 759 / 1070, 759 / 1071, 759 / 1072, 759 36, 728 / 1037, 564 / 1038, 729 / 1039, 730 / 1040, 731 / 1041, 732 / 1042, 733 / 1043, 565 / 1044, 734 / 1045, 566 / 1046, 735 / 1047, 567 / 1048, 736 / 1049, 737 / 1 050, 738 / 1051, 568 / 1052, 739 / 1053, 740 / 1054, 741 / 1055, 742 / 1056, 743 / 1057, 569 / 1058, 744 / 1059, 745 / 1060, 746 / 1061, 747 / 1062, 748 / 1063, 570 / 1064, 749 / 1065, 571 / 1066, 750 / 1067, 751 / 1068, 572 / 1069, 573 / 1070, 574 / 1071, 575 / 1072, 576 / 1073, 577 / 1074, 578 / 1075, 752 / 1076, 753 / 1077, 579 / 1078, 580 / 1079, 754 / 1080, 581 / 1081, 582 / 1082, 755 / 1083, 756 / 1084, 583 / 1085, 584 / 1086, 757 / 1087, 758 / 1088, 585 / 1089, 586 / 1090, 587 / 1091, 58 8 / 1092, 589 / 1093, 590 / 1094, 591 / 1095, 592 / 1096, 759 / 1097, 593 / 1098, 594 / 1099, 760 / 1100, 595 / 1101, 596 / 1102, 761 / 1103, 597 / 1104, 598 / 1105, 7 62 / 1106, 763 / 1107, 599 / 1108, 764 / 1109, 765 / 1110, 766 / 1111, 600 / 1112, 767 / 1113, 768 / 1114, 769 / 1115, 770 / 1116, 601 / 1117, 771 / 1118, 602 / 1119,772 / 1120、773 / 1121、774 / 1122、603 / 1123、604 / 1124、775 / 1125、605 / 1126、606 / 1127、776 / 1128、777 / 1129、778 / 1130、779 / 1131、780 / 1132、781 / 1133、782 / 1134、783 / 1135、784 / 1136、607 / 1137、785 / 1138、786 / 1139、787 / 1140、788 / 1141、608 / 1142、609 / 1143、610 / 1144、789 / 1145、611 / 1146、790 / 1147、612 / 1148、613 / 1149、791 / 1150、614 / 1151、792 / 1152、615 / 1153、793 / 1154、616 / 1155、794 / 1156、795 / 1157、617 / 1158、796 / 1159、797 / 1160、798 / 1161、618 / 1162、799 / 1163、619 / 1164、800 / 1165、801 / 1166、620 / 1167、621 / 1168、802 / 1169、803 / 1170、804 / 1171、805 / 1172、622 / 1173、806 / 1174、807 / 1175、808 / 1176、809 / 1177、623 / 1178、810 / 1179、811 / 1180、624 / 1181、812 / 1182、625 / 1183、813 / 1184、626 / 1185、814 / 1186、815 / 1187、627 / 1188、816 / 1189、817 / 1190、818 / 1191、628 / 1192、819 / 1193、629 / 1194、820 / 1195、630 / 1196、821 / 1197、631 / 1198、632 / 1199、822 / 1200、823 / 1201、824 / 1202、825 / 1203、633 / 1204、634 / 1205、826 / 1206、827 / 1207、635 / 1208、636 / 1209、828 / 1210、637 / 1211、638 / 1212、829 / 1213、830 / 1214、831 / 1215、832 / 1216、833 / 1217、834 / 1218、639 / 1219、640 / 1220、835 / 1221、641 / 1222、836 / 1223、642 / 1224、837 / 1225、838 / 1226、839 / 1227、840 / 1228、841 / 1229、842 / 1230、643 / 1231、644 / 1232、843 / 1233、645 / 1234、646 / 1235、844 / 1236、845 / 1237、846 / 1238、647 / 1239、847 / 1240、848 / 1241、849 / 1242、850 / 1243、851 / 1244、852 / 1245、648 / 1246、853 / 1247、854 / 1248、855 / 1249、856 / 1250、857 / 1251、858 / 1252、859 / 1253、649 / 1254、650 / 1255、651 / 1256、860 / 1257、861 / 1258、862 / 1259、863 / 1260、864 / 1261、652 / 1262、653 / 1263、865 / 1264、866 / 1265、867 / 1266、868 / 1267、654 / 1268、869 / 1269、655 / 1270、870 / 1271、871 / 1272、656 / 1273、872 / 1274、657 / 1275、873 / 1276、658 / 1277、659 / 1278、874 / 1279、875 / 1280、660 / 1281、876 / 1282、877 / 1283、878 / 1284、879 / 1285、880 / 1286、661 / 1287、662 / 1288、663 / 1289、881 / 1290、882 / 1291、883 / 1292、884 / 1293、885 / 1294、664 / 1295、886 / 1296、887 / 1297、888 / 1298、665 / 1299、666 / 1300、667 / 1301、889 / 1302、668 / 1303、890 / 1304、891 / 1305、892 / 1306、669 / 1307、893 / 1308、670 / 1309、671 / 1310、894 / 1311、672 / 1312、673 / 1313、895 / 1314、896 / 1315、674 / 1316、897 / 1317、675 / 1318、676 / 1319、677 / 1320、898 / 1321、899 / 1322、900 / 1323、901 / 1324、678 / 1325、902 / 1326、679 / 1327、903 / 1328、904 / 1329、905 / 1330、906 / 1331、907 / 1332、908 / 1333、680 / 1334、909 / 1335、910 / 1336、911 / 1337、912 / 1338、913 / 1339、681 / 1340、914 / 1341、915 / 1342、916 / 1343、917 / 1344、918 / 1345、919 / 1346、920 / 1347、921 / 1348、922 / 1349、923 / 1350、924 / 1351、925 / 1352、926 / 1353、927 / 1354、682 / 1355、928 / 1356、929 / 1357、930 / 1358、683 / 1359、684 / 1360、931 / 1361、932 / 1362、933 / 1363、934 / 1364、935 / 1365、685 / 1366、936 / 1367、937 / 1368、938 / 1369、939 / 1370、940 / 1371、941 / 1372、942 / 1373、943 / 1374、944 / 1375、945 / 1376、946 / 1377、947 / 1378、948 / 1379、949 / 1380、950 / 1381、951 / 1382、686 / 1383、687 / 1384、688 / 1385、689 / 1386、952 / 1387、690 / 1388、953 / 1389、691 / 1390、954 / 1391、692 / 1392、966 / 1411、967 / 1412、700 / 1413、701 / 1414、968 / 1415、702 / 1416、969 / 1417、970 / 1418、971 / 1419、972 / 1420、973 / 1421、703 / 1422、704 / 1423、974 / 1424、975 / 1425、705 / 1426、976 / 1427、977 / 1428、978 / 1429、979 / 1430、980 / 1431、981 / 1432、982 / 1433、983 / 1434、984 / 1435、985 / 1436、706 / 1437、986 / 1438、987 / 1439、707 / 1440、988 / 1441、989 / 1442、708 / 1443、709 / 1444、990 / 1445、991 / 1446、992 / 1447、993 / 1448、710 / 1449、994 / 1450、995 / 1451、996 / 1452、711 / 1453、997 / 1454、998 / 1455、999 / 1456、1000 / 1457、712 / 1458、1001 / 1459、1002 / 1460、713 / 1461、1003 / 1462、1004 / 1463、1005 / 1464、1006 / 1465、1007 / 1466、1008 / 1467、1009 / 1468、714 / 1469、715 / 1470, 716 / 1471, 1010 / 1472, 717 / 1473, 718 / 1474, 1011 / 1475, 1012 / 1476, 719 / 1477, 720 / 1478, 1013 / 1479, 1014 / 1480, 1015 / 1481, 1016 / 1482, 1017 / 1483, 1018 / 1484, 1019 / 1485, 1020 / 1486, 1021 / 1487, 1022 / 1488, 721 / 1489, 1023 / 1490, 722 / 1491, 693 / 1393, 694 / 1394, 695 / 1395, 955 / 1396, 956 / 1397, 957 / 1398, 958 / 1399, 696 1024 / 1492, 1025 / 1493, 1026 / 1494, 1027 / 1495, or 1028 / 1496, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO set forth in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO set forth in the pair.

[0232] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties, such as -O-CH 2 - and -O-CH(CH 3 )-, and non-bicyclic sugar moieties such as a 2'-MOE sugar moiety, a 2'-F sugar moiety, a 2'-OMe sugar moiety, or a 2'-NMA sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0233] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, and the sugar surrogate may be a GNA.

[0234] In any of the oligomeric duplexes described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond.

[0235] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0236] In any of the oligomeric duplexes described herein, the internucleoside linkages of each of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from phosphodiester, phosphorothioate internucleoside linkages.

[0237] In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the second modified oligonucleotide may be ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0238] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0239] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can include a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilized phosphate group comprises a cyclopropylphosphonate or an (E)-vinylphosphonate.

[0240] In any of the oligomeric duplexes described herein, the first modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0241] In any of the oligomeric duplexes described herein, the second modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0242] In certain embodiments, the antisense agent comprises an antisense compound comprising an oligomeric compound or oligomeric duplex as described herein. In certain embodiments, the antisense agent may comprise an oligomeric compound or oligomeric duplex as described herein and is an RNAi agent capable of reducing the amount of PCDH19 nucleic acid by activating RISC / Ago2. In certain embodiments, the antisense agent may comprise an oligomeric compound or oligomeric duplex as described herein and is an RNAse H agent capable of reducing the amount of PCDH19 nucleic acid by activating RNAse H.

[0243] Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, the oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, the oligomeric agent comprises two or more of the same oligomeric duplexes, which may be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together at their 3' ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker.

[0244] I. Certain Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides consisting of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0245] A. Certain modified nucleosides Modified nucleosides include modified sugar moieties or modified nucleobases or both modified sugar moieties and modified nucleobases. In certain embodiments, modified nucleosides including the following modified sugar moieties and / or the following modified nucleobases can be incorporated into modified oligonucleotides:

[0246] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to other types of modified sugar moieties.

[0247] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring containing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be present at any position of the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of a non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include 2'-F, 2'-OCH 3 ("OMe" or "O-methyl"), and 2'-O(CH 2 ) 2 OCH 3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O.C. 1 -C 10 Alkoxy, OC 1 -C 10 Substituted alkoxy, OC 1 -C 10 Alkyl, OC 1 -C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1 -C 10 Alkyl, -O(CH 2 ) 2 ON(CH 3 ) 2 ("DMAOE"), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 ("DMAEOE"), Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents include hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at 3'. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at 4'. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include more than one non-bridging sugar substituent, e.g., 2'-F-5'-methyl sugar moieties, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0248] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH 2 , N 3 , OCF 3 , O.C.H. 3 , O(CH 2 ) 3 NH 2 , C.H. 2 CH=CH 2 , O.C.H. 2 CH=CH 2 , O.C.H. 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 and N-substituted acetamides (OCH 2 C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10 It is an alkyl.

[0249] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside is F, OCF 3 , O.C.H. 3 , O.C.H. 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 )2 N(CH 3 ) 2 , O(CH 2 ) 2 ON(CH 3 ) 2 ("DMAOE"), O(CH 2 )2O(CH2) 2 N(CH 3 ) 2 ("DMAEOE") and OCH 2 C(=O)-N(H)CH 3 ("NMA").

[0250] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, OCH 3 and OCH 2 CH 2 OCH 3 The sugar moiety comprises a non-bridging 2' substituent selected from:

[0251] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric structure. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric structures other than the naturally occurring β-D-deoxyribosyl structure. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional chiral center at the 2' position compared to 2'-deoxyfuranosyl sugar moieties. Thus, such sugar moieties have a total of 16 possible isomeric structures. 2'-modified sugar moieties described herein are β-D-ribosyl isomeric structures unless otherwise specified.

[0252] In naturally occurring nucleic acids, the sugars are linked to each other 3' to 5'. In certain embodiments, an oligonucleotide comprises one or more nucleosides or sugar moieties linked at alternating positions, e.g., 2' or conversely, 5' to 3'. For example, if the linkage is at the 2' position, the 2'-substituent may instead be at the 3' position.

[0253] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. 2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include 4'-CH 2 -2',4'-(CH 2 ) 2 -2',4'-(CH 2 ) 3 -2',4'-CH 2 -O-2' ("LNA"), 4'-CH 2 -S-2',4'-(CH 2 ) 2 -O-2' ("ENA"), 4'-CH(CH 3 )-O-2' (when in the S configuration, called "constrained ethyl" or "cEt"), 4'-CH 2 -O-CH 2 -2',4'-CH 2 -N(R)-2',4'-CH(CH 2 OCH 3 )-O-2' ("constrained MOE" or "cMOE") and their analogs (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 8,022,193), 4'-C(CH 3 )(CH 3 )-O-2' and analogs thereof (see, e.g., Seth et al., US8,278,283), 4'-CH 2 -N(OCH 3)-2' and its analogs (see, e.g., Prakash et al., US8,278,425), 4'-CH 2 -ON(CH 3 )-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH 2 -C(H)(CH 3 )-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH 2 -C(=CH 2 )-2' and analogs thereof (see, e.g., Seth et al., US8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2',4'-CH 2 -ON(R)-2' and 4'-CH 2 -N(R)-O-2', but is not limited thereto; a , and R b are independently H, a protecting group, or C 1 -C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0254] In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 linking groups selected from -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and N(Ra)-; During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each Ra and Rb is independently selected from H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl J1 and J2 are independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0255] The molecular weight of the particles was obtained by analyzing the solvent, Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490; al.US6,770,748; Imanishi et al.,USRE44,779; Wengel et al.,US6,794,499; al., US8,034,909, Wengel et al., US8,153,365, Wengel et al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356 al.,WO1999 / 014226;Seth et al.,WO2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka]

[0256] α-L-Methyleneoxy(4'-CH 2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase the stability of siRNAs in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in the exemplary embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0257] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0258] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substitution at the 5' position.

[0259] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides including additional modified THP compounds having the formula: [ka] wherein, independently for each such modified THP nucleoside: Bx is a nucleobase moiety, T 3 and T 4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or 3 and T 4 is an internucleoside linking group that connects the modified THP nucleoside to the remainder of the oligonucleotide, and T 3 and T 4 the other is H, a hydroxyl protecting group, an attached conjugate group, or a 5'- or 3'-terminal group; q 1 , q 2 , q 3 , q4 , q 5 , q 6 and q 7 are each independently H, C 1 -C 6 Alkyl, substituted C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl, substituted C 2 -C 6 Alkenyl, C 2 -C 6 Alkynyl or substituted C 2 -C 6 is alkynyl, R 1 and R 2 Each of the groups is hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 , S.J. 1 , N 3 , OC(=X)J 1 ,OC(=X)NJ 1 J 2 , N.J. 3 C(=X)NJ 1 J 2 and CN, where X is O, S or NJ 1 and each J 1 , J 2 , and J 3 are independently H or C 1 -C 6 It is an alkyl.

[0260] In certain embodiments, q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 and each R is H. In certain embodiments, q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 At least one of R is methyl. 1 and R 2 and R is F. In certain embodiments, modified THP nucleosides are provided in which R 1 is F and R 2 is H, and in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy, and R 2 is H.

[0261] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]

[0262] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0263] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876. In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0264] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is an unlocked acyclic nucleic acid in which any of the sugar bonds are removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0265] In certain embodiments, the sugar surrogate is glycerol, such as found in GNA (glycol nucleic acid) nucleosides, as shown below: [ka] In the formula, Bx represents any nucleic acid base.

[0266] Many other bicyclic and tricyclic sugars and sugar surrogates that can be used in modified nucleosides are known in the art.

[0267] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, which are referred to as abasic nucleosides.In certain embodiments, modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides that contain hypoxanthine nucleobases).

[0268] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl (-C≡C-CH 3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-a The bases are selected from adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, general bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0269] Publications which teach the preparation of certain of the above and other modified nucleobases include, but are not limited to, Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al. al., US6,005,096.

[0270] 3. Certain modified internucleoside linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide may be linked to one another using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphates, including phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S"). Exemplary non-phosphorus-containing internucleoside linkage groups include methylenemethylimino (-CH 2 -N(CH 3 )-O-CH 2 -), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH 2 -O-), and N,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 )-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0271] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing sterically random internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are sterically random. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, each distinct phosphorothioate of each distinct oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0272] In certain embodiments, the modified internucleoside linkage comprises a linking group having the formula: [ka] and for each internucleoside linkage group of the modified oligonucleotide, independently: X is selected from O or S; R 1 , H, C 1 -C 6 Alkyl and substituted C 1 -C 6 alkyl, T is SO 2 R 2 , C(=O)R 3 , and P(=O)R 4 R 5 is selected from R 2 is an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, C 1 -C 6 Alkoxy, C 1 -C 6 Alkyl, C 1 -C 6 Alkenyl, C 1 -C 6 Alkynyl, Substituted C 1-C 6 Alkyl, substituted C 1 -C 6 Alkenyl-substituted C 1 -C 6 alkynyl, and a conjugate group; R 3 is aryl, substituted aryl, CH 3 , N(CH 3 ) 2 , O.C.H. 3 and a conjugate group; R 4 is OCH 3 , O.H., C. 1 -C 6 Alkyl, substituted C 1 -C 6 alkyl, and a conjugate group; R 5 is OCH 3 , O.H., C. 1 -C 6 Alkyl and substituted C 1 -C 6 is selected from alkyl.

[0273] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula: [ka]

[0274] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidate each include one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can have a specific stereochemical configuration.

[0275] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH 2 -N(CH 3 )-O-5'), Amide-3 (3'-CH 2 -C(=O)-N(H)-5'), amide-4 (3'-CH 2 -N(H)-C(=O)-5'), formacetal (3'-O-CH 2 -O-5'), methoxypropyl (MOP), and thioform acetal (3'-S-CH 2 -O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research, YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580, Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include mixed N, O, S, and CH 2 Non-ionic bonds involving constituent moieties are included.

[0276] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides, as shown below: [ka] In the formula, each Bx independently represents any nucleobase.

[0277] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0278] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., the last nucleoside at one end of an oligonucleotide), and thus only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.

[0279] In certain embodiments, the nucleic acids can be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are shown below. [ka] In the formula, each Bx represents any nucleobase.

[0280] B. A specific motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif refers to modifications to the nucleobases, regardless of the sequence of the nucleobases).

[0281] 1. Certain glyco-motifs In certain embodiments, an oligonucleotide comprises one or more modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in a defined pattern or sugar motif, which in certain instances includes, but is not limited to, any of the sugar modifications discussed herein.

[0282] Gapmer Oligonucleotides In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleoside of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing that is most adjacent to the gap (the 3'-terminal nucleoside of the 5'-wing and the 5'-terminal nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).

[0283] In certain embodiments, a gapmer wing comprises 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0284] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0285] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-OMe sugar moiety.

[0286] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [nucleoside number in the 5'-wing]-[nucleoside number in the gap]-[nucleoside number in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing.

[0287] In certain embodiments, modified oligonucleotides have a sugar motif of 5' to 3': eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety.

[0288] In certain embodiments, modified oligonucleotides have the 5' to 3' sugar motif: kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety.

[0289] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine and all of the other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0290] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.

[0291] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0292] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a sterically random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0293] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are sterically random. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioate and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0294] C. A certain length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of target RNA, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0295] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is equal to or less than Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13~19, 13~20, 13~21, 13~22, 13~23, 13~24, 13~25, 13~26, 13~27, 13~28, 13~29, 13~30, 14~15, 14~16, 14~17, 14~18, 14~19, 14~20, 14~21, 14~22, 14~23, 14~24, 14~25, 14~26, 14~27, 14~28, 14~29, 14~3 0, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16 ~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20,19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27 , 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0296] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0297] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereo-random population or a chirally enriched population. All chiral centers of all modified oligonucleotides are stereo-random in a stereo-random population. In a chirally enriched population, at least one specific chiral center is not stereo-random in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereo-random. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0298] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified) are further described by their nucleobase sequence. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0299] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to either or both termini of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached at the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached at the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0300] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0301] A. Certain Conjugate Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0302] In certain embodiments, the conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred to herein as a ribose-replaced modified subunit ("RRMS"), which is a modified sugar moiety. The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0303] In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, such as a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0304] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0305] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0306] In certain embodiments, the conjugate group has the general formula: [ka] has.

[0307] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0308] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0309] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide by a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide by a single bond). In certain embodiments, the conjugate linker comprises a chain structure (such as a hydrocarbyl chain) or an oligomer of repeating units (such as ethylene glycol, nucleoside, or amino acid units).

[0310] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0311] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0312] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional conjugate group, for example, one known in the art to be useful for attaching a conjugate moiety to a compound, such as an oligonucleotide, provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site of the compound, and the other is selected to bind to a composite group. Examples of functional groups useful in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups, and nucleophiles for reacting with electrophilic groups. In certain embodiments, a bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0313] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C 1 -C 10 Alkyl, substituted or unsubstituted C 2 -C 10 Alkenyl, or substituted or unsubstituted C 2 -C 10 and alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0314] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker-nucleoside is preferably cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0315] Herein, linker-nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide comprised of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising a linker-nucleoside, these linker-nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percent complementarity to the oligonucleotide of the reference nucleic acid. For example, an oligomeric compound can comprise (1) a modified oligonucleotide comprised of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound can comprise a modified oligonucleotide comprised of 8-30 nucleosides and does not comprise a conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker-nucleoside.

[0316] In certain embodiments, it is preferred that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but once the oligomeric compound is taken up, it is desirable to cleave the conjugate group and release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers can include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0317] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0318] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0319] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0320] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0321] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand, hi certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to a branching group.

[0322] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor on target cell.In certain embodiments, each ligand has affinity for at least one receptor on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0323] In certain embodiments, the oligomeric compound comprises a conjugate group that comprises a cell targeting moiety that has affinity for the transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including, but not limited to, those described in WO1991 / 004753, WO2013 / 103800, WO2014 / 144060, WO2016 / 081643, WO2016 / 179257, WO2016 / 207240, WO2017 / 221883, WO2018 / 129384, WO2018 / 124121, WO2019 / 151539, WO2020 / 132584, WO2020 / 028864, US7,208,174, US9,034,329, and US10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is a F(ab')2, Fab, Fab', Fv, or scFv.

[0324] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2019 / 140050, WO2020 / 037150, WO2020 / 124032, and US10,138,483.

[0325] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2013 / 163303, WO2019 / 033051, and WO2020 / 245198.

[0326] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate group. Stabilized 5'-phosphate groups include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0327] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense agents. In certain embodiments, an antisense agent has antisense activity when it reduces or inhibits the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense agent selectively affects one or more target nucleic acids. Such antisense agents include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in a manner that provides significant undesirable antisense activity.

[0328] In certain antisense activities, hybridization of an antisense agent or a portion thereof or an antisense agent to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense agents result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, described herein are antisense agents that include antisense oligomeric compounds that include antisense oligonucleotides that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are permitted.

[0329] In certain antisense activity, antisense agent or part of antisense agent is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense agent leads to cleavage of target nucleic acid by Argonaute.The antisense agent incorporated into RISC is an RNAi agent.RNAi agent can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0330] In certain embodiments, hybridization of an antisense agent, or a portion thereof, to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, to a target nucleic acid results in alteration of the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, to a target nucleic acid results in alteration of the translation of the target nucleic acid.

[0331] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0332] IV. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0333] A. Complementarity / Mismatch and Double-Stranded Complementarity with Target Nucleic Acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region of 100% or full complementarity to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0334] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity with bcl-2 mRNA and three mismatches with bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of two or three sequences of the tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest level than either the 28 or 42 nucleobase oligonucleotides.

[0335] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, while the activity against the non-target is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5'-end of the gap region. In certain embodiments, the mismatches are at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3'-end of the gap region. In certain embodiments, the mismatches are at 1, 2, 3, or 4 positions from the 5'-end of the wing region. In certain embodiments, the mismatches are at 4, 3, 2, or 1 positions from the 3'-end of the wing region.

[0336] B.PCDH19 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide complementary to a target nucleic acid, and the target nucleic acid is a PCDH19 nucleic acid. In certain embodiments, the PCDH19 nucleic acid has a nucleobase sequence as set forth in SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15, version 104, May 2021), SEQ ID NO: 2 (cDNA of ENSEMBL Accession No. ENST00000373034.8, version 104:May2021), or both. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PCDH19 RNA, and in certain embodiments, reduces the amount of PCDH19 protein. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PCDH19 RNA in the cell, and in certain embodiments, reduces the amount of PCDH19 protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the oligomeric compound is composed of a modified oligonucleotide. In certain embodiments, the oligomeric compound is composed of a modified oligonucleotide and a conjugate group. In certain embodiments, the oligomeric compound is paired with an additional oligomeric compound in an oligomeric duplex. In certain embodiments, the oligomeric duplex comprises a conjugate group.

[0337] In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of PCDH19 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in standard cell assays. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of PCDH19 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of PCDH19 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of PCDH19 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of PCDH19 RNA in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of PCDH19 protein in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0338] In certain embodiments, contacting cells in animals with oligomeric compounds alleviates one or more symptoms or characteristics of neurodevelopmental disease or disorder. In certain embodiments, the neurodevelopmental disease or disorder is PCDH19 epilepsy. In certain embodiments, the symptoms or characteristics are any of seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD). In certain embodiments, the seizures are any of clusters of seizures, generalized tonic-clonic seizures, or focal seizures, which can evolve into bilateral tonic-clonic seizures.

[0339] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a region complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue that comprises the central nervous system. Such tissues include the brain and spinal cord.

[0340] IV. Certain Methods and Uses Certain embodiments provided herein relate to a method for reducing or inhibiting PCDH19 expression or activity, which may be useful for treating, preventing, or alleviating a disease associated with PCDH19. In certain embodiments, the disease associated with PCDH19 is a neurodevelopmental disease. In certain embodiments, the disease associated with PCDH19 is PCDH19 epilepsy.

[0341] In certain embodiments, the method comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to a PCDH19 nucleic acid. In certain embodiments, the subject has a neurodevelopmental disease. In certain embodiments, the subject has PCDH19 epilepsy.

[0342] In certain embodiments, a method of treating a disease associated with PCDH19 comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to a PCDH19 nucleic acid. In certain embodiments, the subject has or is at risk of developing a disease associated with PCDH19. In certain embodiments, the subject has a neurodevelopmental disease. In certain embodiments, the subject has PCDH19 epilepsy. In certain embodiments, at least one symptom or characteristic of a disease associated with PCDH19 is alleviated. In certain embodiments, the at least one symptom or characteristic is seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD). In certain embodiments, the seizures are any of clusters of seizures, generalized tonic-clonic seizures, focal seizures, or bilateral seizures. In certain embodiments, administering the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent to a subject reduces or delays the onset or progression of seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD) in the subject.

[0343] In certain embodiments, the method of reducing expression of PCDH19 nucleic acid, e.g., RNA, or reducing expression of PCDH19 protein in a cell comprises contacting a cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to a PCDH19 nucleic acid. In certain embodiments, the subject has or is at risk of developing a disease associated with PCDH19. In certain embodiments, the subject has a neurodevelopmental disease. In certain embodiments, the subject has PCDH19 epilepsy. In certain embodiments, the cell is a neuron. In certain embodiments, the cell is a human cell.

[0344] Certain embodiments are directed to oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents, any of which have a nucleobase sequence complementary to a PCDH19 nucleic acid, for use in treating a disease associated with PCDH19 or for use in the manufacture of a medicament for treating a disease associated with PCDH19. In certain embodiments, the disease associated with PCDH19 is a neurodevelopmental disease. In certain embodiments, the disease associated with PCDH19 is PCDH19 epilepsy.

[0345] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent may be any of those described herein.

[0346] V. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0347] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0348] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dianhydrous dihydrate, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to a range of about 7.1 to 7.3, or about 7.2, using a suitable pH adjusting agent, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0349] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0350] In certain embodiments, the oligomeric compounds can be mixed with pharma- ceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for the formulation of pharmaceutical compositions depends on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0351] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides upon administration to animals, including humans, can provide (directly or indirectly) biologically active metabolites or residues thereof. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharma- ceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, and the conjugate groups are cleaved in the body by endogenous nucleases.

[0352] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0353] Lipid moieties are used in nucleic acid therapeutics in various ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes made with a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to certain cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to lipid tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissues.

[0354] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0355] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0356] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% (w / v) benzyl alcohol, 8% (w / v) of the non-polar surfactant Polysorbate 80™, and 65% (w / v) of polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary significantly without significantly changing their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0357] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water, or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0358] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and associated with cations (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution is in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms, in equilibrium at all of its positions. The term "oligonucleotide" is intended to include all such forms. The illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. As used herein, a structure of a compound's free acid followed by the term "or a salt thereof" or "or a pharma- ceutically acceptable salt thereof" expressly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation or combination of cations. In certain embodiments, one or more certain cations are specified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure of a compound's free acid followed by the term "or a pharma- ceutically acceptable salt thereof" expressly includes all such forms that may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0359] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to the desired pH.

[0360] In this specification, certain specific dosages are described. The dosage may be in the form of dosage units. For clarity, the dosage (or dosage unit) of modified oligonucleotide or oligomeric compound in milligrams shall represent the mass of modified oligonucleotide or oligomeric compound in free acid form. As mentioned above, in aqueous solution, free acid is in equilibrium with anion form and salt form. However, for the purpose of calculating dosage, it is assumed that modified oligonucleotide or oligomeric compound exists as solvent-free, sodium acetate-free, anhydrous, free acid.

[0361] In certain embodiments, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound can be partially or completely deprotonated and associated with sodium ions. However, the mass of protons is still counted in the weight of the dose, and the mass of sodium ions is not counted in the weight of the dose. Thus, for example, a dose or dosage unit of 10 mg is the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated compound number 1549516.

[0362] In certain embodiments, when the modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, that contains sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still counted in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the weight of the dose.

[0363] In certain embodiments, when an oligomeric compound contains a conjugate group, the mass of the conjugate group may be included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of the dosage calculation.

[0364] VI. Specific hotspot areas In certain embodiments, the nucleobases within the ranges specified below comprise hotspot regions of PCDH19 nucleic acids. In certain embodiments, modified oligonucleotides complementary to hotspot regions of PCDH19 nucleic acids achieve an average of more than 50% reduction in PCDH19 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to hotspot regions of PCDH19 nucleic acids achieve an average of 50% or more reduction in PCDH19 RNA in vivo in a standard in vivo assay.

[0365] 1. Nucleic acid bases 4743 to 4767 of SEQ ID NO:1 In certain embodiments, nucleobases 4743-4767 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 4743-4767 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0366] The nucleobase sequences of SEQ ID NOs: 132, 228, 284, 330, and 440 are complementary to nucleobases 4743 to 4767 of SEQ ID NO:1.

[0367] The nucleobase sequences of compound numbers 1549744, 1549855, 1549749, 1549523, and 1549712 are complementary to nucleobases 4743 to 4767 of SEQ ID NO:1.

[0368] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 4743-4767 of SEQ ID NO:1 achieve at least 81% reduction in PCDH19 mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 4743-4767 of SEQ ID NO:1 achieve an average of 86% reduction in PCDH19 mRNA in a standard in vitro assay.

[0369] 2. Nucleic acid bases 12,319 to 12,346 of SEQ ID NO:1 In certain embodiments, nucleobases 12,319-12,346 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 12,319-12,346 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0370] The nucleobase sequences of SEQ ID NOs: 416, 72, 129, and 204 are complementary to nucleobases 12,319 to 12,346 of SEQ ID NO:1.

[0371] The nucleobase sequences of compound numbers 1549581, 1549876, 1549736, and 1549694 are complementary to nucleobases 12,319 to 12,346 of SEQ ID NO:1.

[0372] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 12,319-12,346 of SEQ ID NO:1 achieve at least 65% reduction in PCDH19 mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 12,319-12,346 of SEQ ID NO:1 achieve an average of 69% reduction in PCDH19 mRNA in a standard in vitro assay.

[0373] 3. Nucleic acid bases 34364 to 34389 of SEQ ID NO:1 In certain embodiments, nucleobases 34364-34389 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 34364-34389 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0374] The nucleobase sequences of SEQ ID NOs: 371, 425, 20, and 111 are complementary to nucleobases 34364 to 34389 of SEQ ID NO:1.

[0375] The nucleobase sequences of compound numbers 1549753, 1549642, 1549562, and 1549613 are complementary to nucleobases 34364 to 34389 of SEQ ID NO:1.

[0376] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 34364-34389 of SEQ ID NO:1 achieve at least 64% reduction of 34389 of SEQ ID NO:1, achieving an average of 80% reduction of PCDH19. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 34364-34389 of SEQ ID NO:1 achieve an average of 80% reduction of PCDH19 mRNA in a standard in vitro assay.

[0377] 4. Nucleic acid bases 84,408 to 84,431 of SEQ ID NO:1 In certain embodiments, nucleobases 84,408-84,431 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 84,408-84,431 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0378] The nucleobase sequences of SEQ ID NOs: 367, 407, 24, 93, and 218 are complementary to nucleobases 84,408 to 84,431 of SEQ ID NO:1.

[0379] The nucleobase sequences of compound numbers 1549714, 1549528, 1549617, 1549514, and 1549790 are complementary to nucleobases 84,408 to 84,431 of SEQ ID NO:1.

[0380] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 84,408-84,431 of SEQ ID NO:1 achieve at least 65% reduction in PCDH19 mRNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 84,408-84,431 of SEQ ID NO:1 achieve an average of 74% reduction in PCDH19 mRNA in a standard in vitro assay.

[0381] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0382] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to be limiting thereof. Each of the references, GenBank accession numbers, etc. listed in this application are incorporated herein by reference in their entirety.

[0383] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in reality these sequences can be modified by any combination of chemical modifications. Those skilled in the art will readily appreciate that such designations, such as "RNA" or "DNA", indicate that the modified oligonucleotide is arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar moiety (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine instead of uracil (methylated uracil) of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those set forth in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases, unless otherwise specified. By way of further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" is intended to be illustrative, but not limiting, of such compounds that contain RNA bases, e.g., those having the sequence "AUCGAUCG", as well as any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including those that have some DNA bases and some RNA bases, e.g., "AUCGATCG". m CGAUCG” (in the formula, m(C represents a cytosine base containing a methyl group at position 5). Finally, for clarity, unless otherwise indicated, the phrase "nucleobase sequence of SEQ ID NO:X" refers only to the nucleobase sequence of SEQ ID NO:X, independent of any sugar or internucleoside linkage modifications also set forth in such SEQ ID NO.

[0384] Efforts have been made to accurately describe the compounds in the attached sequence listing, but in the event of any discrepancy between the description in this specification and the attached sequence listing, the description in this specification, and not the sequence listing, is the accurate description.

[0385] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry, such as (R) or (S), α or β (e.g., for sugar anomers), or (D) or (L) (e.g., for amino acids). Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound depicted. Compounds provided herein that are depicted or described without a defined stereochemistry include all such possible isomers, including stereo-random and optically pure forms, unless otherwise indicated. Similarly, all cis and trans isomers and tautomeric forms of the compounds described herein are included, unless otherwise indicated. Oligomeric compounds described herein include chirally pure or enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random.Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0386] The compounds described herein include modifications in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isomeric substitutions encompassed by the compounds herein include: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 In certain embodiments, non-radioactive isotope substitution can provide novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0387] The following examples are illustrative of certain specific embodiments of the present disclosure, but are not intended to be limiting. Moreover, when specific embodiments are provided, the inventors contemplate the general application of those specific embodiments.

[0388] Example 1: Effect of 5-10-5 MOE modified oligonucleotides with mixed PS / PO internucleoside linkages complementary to human PCDH19 RNA in vitro at a single dose Modified oligonucleotides complementary to human PCDH19 nucleic acid were designed and tested for their single dose effect on PCDH19 RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0389] The modified oligonucleotides in the table below are 5-10-5 MOE modified oligonucleotides with mixed PS / PO internucleoside linkages. The modified oligonucleotides are 20 nucleosides in length. The sugar motif of the modified oligonucleotides is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5' to 3') sooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0390] "Start position" indicates the 5' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15, version 104:May 2021), SEQ ID NO: 2 (cDNA of ENSEMBL Accession No. ENST00000373034.8, version 104:May 2021), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0391] SHSY5Y cells seeded at a density of 15,000 cells / well were differentiated for 10 days in Neurobasal medium supplemented with B27 (ThermoFisher), penicillin / streptomycin (ThermoFisher), and 10 μM retinoic acid (Sigma). Differentiated SH-SY5Y cells were treated with modified oligonucleotides at a concentration of 15,000 nM by free uptake. After a treatment period of approximately 5 days, total RNA was isolated from the cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human primer probe set RTS53390 (forward sequence GCTAACCACATCTACCATCACTC, designated herein as SEQ ID NO: 3; reserved sequence GCTATTCACGTAGTTGGAGTCA, designated herein as SEQ ID NO: 4; probe sequence TTTCAGTCTCAGGCAGAGGCACAC, designated herein as SEQ ID NO: 5). PCDH19 RNA levels were normalized to total RNA content as measured by RIBOGREEN®. Reduction of PCDH19 RNA is expressed in the table below as a percentage (UTC%) of PCDH19 RNA relative to the amount in untreated control cells.

[0392] Each individual experiment described in this example is identified by an assay identification letter in the table row labeled "AID." [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12]

[0393] Example 2: Effect of modified oligonucleotides on human PCDH19 in vitro, multiple doses SHSY5Y cells seeded at a density of 10,000 cells / well were differentiated for 10 days in Neurobasal medium supplemented with B27 (ThermoFisher), penicillin / streptomycin (ThermoFisher), and 10 μM retinoic acid (Sigma). Differentiated SH-SY5Y cells were treated with modified oligonucleotides at the concentrations shown in the table below by free uptake. After a treatment period of approximately 5 days, total RNA was isolated from the cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human PCDH19 primer probe set RTS53390 (described herein above). PCDH19 RNA levels were normalized to total RNA content measured by GAPDH. Human GAPDH was measured using human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO:6, reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO:7, probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO:8). Reduction of PCDH19 RNA is expressed in the table below as percent (UTC%) of PCDH19 RNA relative to untreated control cells. "NC" refers to not calculated value.

[0394] Linear regression of the log / linear plot of the data in Excel was used to calculate the half maximal inhibitory concentration (IC) for each modified oligonucleotide. 50 ) were calculated and are also shown in the table below. [Table 2] [Table 3]

[0395] Example 3: Effect of 3-10-3cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages complementary to human PCDH19 RNA in vitro at a single dose Modified oligonucleotides complementary to human PCDH19 nucleic acid were designed and tested for their single dose effect on PCDH19 RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0396] The modified oligonucleotides in the table below are 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages. The modified oligonucleotides are 16 nucleosides in length. The sugar motif of the modified oligonucleotides is (5' to 3') kkkddddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5' to 3') sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0397] "Start position" indicates the 5'-terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3'-terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (described hereinabove), SEQ ID NO:2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0398] SHSY5Y cells seeded at a density of 10,000 cells / well were differentiated for 10 days in Neurobasal medium supplemented with B27 (ThermoFisher), penicillin / streptomycin (ThermoFisher), and 10 μM retinoic acid (Sigma). Differentiated SH-SY5Y cells were treated with modified oligonucleotides at a concentration of 6,000 nM by free uptake. After a treatment period of about 5 days, total RNA was isolated from the cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human primer probe set RTS53390 (described hereinabove). PCDH19 RNA levels were normalized to total RNA content measured by RIBOGREEN®. PCDH19 RNA reduction is expressed in the table below as a percentage (UTC%) of PCDH19 RNA relative to the amount in untreated control cells.

[0399] Each individual experiment described in this example is identified by an assay identification letter in the table row labeled "AID." [Table 4-1] [Table 4-2]

[0400] Example 4: Effect of modified oligonucleotides on human PCDH19 in vitro, multiple doses SHSY5Y cells seeded at a density of 8,000 cells / well were differentiated for 10 days in Neurobasal medium supplemented with B27 (ThermoFisher), penicillin / streptomycin (ThermoFisher), and 10 μM retinoic acid (Sigma). Differentiated SH-SY5Y cells were treated with modified oligonucleotides at the concentrations shown in the table below by free uptake. After a treatment period of about 5 days, total RNA was isolated from the cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human PCDH19 primer probe set RTS53390 (described hereinabove). PCDH19 RNA levels were normalized to total RNA content measured by GAPDH. Human GAPDH was measured using human primer probe set RTS104 (described hereinabove). PCDH19 RNA reduction is expressed in the table below as a percentage (UTC%) of PCDH19 RNA relative to untreated control cells.

[0401] Linear regression of the log / linear plot of the data in Excel was used to calculate the half maximal inhibitory concentration (IC) for each modified oligonucleotide. 50 ) were calculated and are also shown in the table below. [Table 5]

[0402] Example 5: Design of 5-10-5 MOE gapmer modified oligonucleotides with PS internucleoside linkages targeting human PCDH19 nucleic acid Modified oligonucleotides complementary to human PCDH19 nucleic acids have been designed and described as shown in the table below. "Start position" indicates the 5' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (described hereinabove), SEQ ID NO:2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide has two or more mismatches to that particular target nucleic acid sequence.

[0403] The modified oligonucleotides in the following table are 5-10-5 MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages. The modified oligonucleotides are 20 nucleosides in length, with the central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consisting of 5 2'-MOE nucleosides. The sugar motif of the modified oligonucleotides is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5' to 3') sssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. All cytosine nucleobases are 5-methylcytosines. [Table 6]

[0404] Example 6: Design of RNAi compounds targeting human PCDH19 nucleic acid RNAi compounds comprising antisense RNAi oligonucleotides complementary to human PCDH19 nucleic acids and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

[0405] In each case, the antisense RNAi oligonucleotides are 23 nucleosides in length and have a sugar motif (5' to 3') of yfyyyyyyyyyyyfyyyyyyy, where each "y" represents a 2'-O-methylribosyl sugar moiety, each "f" represents a 2'-fluororibosyl sugar, and an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooooss, where "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is an unmethylated cytosine. Each antisense RNAi oligonucleotide has a terminal phosphate at the 5' end. The antisense RNAi oligonucleotides are listed in Tables 7 and 8 below.

[0406] "Start position" indicates the 5' terminal nucleoside to which the antisense RNAi oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the antisense RNAi oligonucleotide is complementary within the target nucleic acid sequence. Each antisense RNAi oligonucleoside listed in Table 7 below is 100% complementary to SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15, Version 104:May 2021), SEQ ID NO: 2 (ENSEMBL Accession No. ENST00000373034.8, Version 104:May 2021), or both. "N / A" indicates in Table 7 below that the antisense RNAi oligonucleotide is not 100% complementary to that particular target nucleic acid sequence. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4]

[0407] "Start position" indicates the 5' terminal nucleoside to which the antisense RNAi oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the antisense RNAi oligonucleotide is complementary within the target nucleic acid sequence. Each antisense RNAi oligonucleoside listed in Table 8 below is complementary to SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15, Version 104:May 2021), SEQ ID NO: 2 (ENSEMBL Accession No. ENST00000373034.8, Version 104:May 2021), or both, except for a single mismatch at position 1 (5' to 3') of the antisense RNAi oligonucleotide. "N / A" indicates in Table 8 below that the antisense RNAi oligonucleotide has two or more mismatches to that particular target nucleic acid sequence. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7]

[0408] In each case, the sense RNAi oligonucleotides are 21 nucleosides in length and have a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyy, where "y" represents a 2'-O-methyl ribosyl sugar, "f" represents a 2'-fluoro ribosyl sugar, and an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooss, "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage. The sense RNAi oligonucleotides are listed in Table 9 below.

[0409] Each antisense RNAi oligonucleotide is complementary to the target nucleic acid (PCDH19), and each sense RNAi oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, with the last two 3' nucleosides of the antisense RNAi oligonucleotide not paired with the sense RNAi oligonucleotide (they are overhanging nucleosides).The sense RNAi oligonucleotides and siRNAs are listed in Table 9 below. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6] [Table 9-7] [Table 9-8] [Table 9-9] [Table 9-10] [Table 9-11]

[0410] Example 7: Effects of RNAi Compounds on Human PCDH19 in Vitro, Single Dose The double-stranded RNAi compounds described above are tested in a series of experiments for their single-dose effects on PCDH19 RNA in vitro in cultured cells expressing PCDH19.

[0411] Cultured cells are treated with double-stranded RNAi. RNA is isolated from cells and PCDH19 RNA levels are measured by quantitative real-time RTPCR. RNA levels are measured using human PCDH19 primer probe set. PCDH19 RNA levels are normalized to total RNA content measured by RIBOGREEN®.

[0412] Example 8: Effects of modified oligonucleotides on human PCDH19 RNA levels in neurons differentiated from iPS cells, multiple administrations Modified oligonucleotides selected from the above examples were tested at various doses in neurons differentiated from IPSCs (Gibco, Catalog No. A18945). IPSCs were differentiated into neurons using Elixirgen Scientific Quick Neuron™ Excitatory Kit (Cat. No. EX-SeV-L). Neurons were aged for 2 weeks and treated with various concentrations of modified oligonucleotides by free uptake, as specified in the table below.

[0413] After 7 days of treatment, total RNA was isolated from cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR. RNA levels were measured as described above using human PCDH19 primer probe set RTS53390 (described hereinabove). PCDH19 RNA levels were normalized to total RNA content measured by human GAPDH. Human GAPDH was amplified using human primer probe set RTS104 (described hereinabove). PCDH19 RNA reduction is expressed in the table below as a percentage (UTC%) of PCDH19 RNA relative to the amount of PCDH19 in untreated control cells.

[0414] The half maximal inhibitory concentration (IC) of each modified oligonucleotide was calculated using GraphPad Prism. 50 ) were calculated and are also shown in the table below. [Table 10] [Table 11]

[0415] Example 9: Effects of modified oligonucleotides on human PCDH19 protein levels in neurons differentiated from iPS cells, multiple administrations Modified oligonucleotides selected from the above examples were tested at various doses in neurons differentiated from IPSCs (derived from neurons as described herein above). Neurons were aged for 2 weeks and treated by free uptake with various concentrations of modified oligonucleotides, as specified in the table below.

[0416] After 7 days of treatment, human PCDH19 protein levels in treated neurons were determined using Western blot analysis to detect PCDH19 using PCDH19 polyclonal antibody from Bethyl Laboratories (catalog number A304-468A). Reduction of PCDH19 protein is expressed in the table below as a percentage (UTC%) of PCDH19 protein relative to the amount of PCDH19 in untreated control cells. [Table 12]

[0417] Example 10: Effect of RNAi compounds targeting human PCDH19 nucleic acid in vitro, single dose The RNAi compounds described in the above examples were tested for their single dose effects on PCDH19 RNA in vitro. The RNAi compounds were tested in a series of experiments with similar culture conditions.

[0418] HEK293 cells cultured at a density of 10,000 cells per well were treated with RNAi compounds at a concentration of 200 nM by Lipofectamine RNAiMAX. After a treatment period of about 72 hours, total RNA was isolated from the cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human primer probe set RTS53390 (described hereinabove). PCDH19 RNA levels were normalized to total RNA content measured by RIBOGREEN®. PCDH19 RNA reduction is expressed in the following table as a percentage (UTC%) of PCDH19 RNA relative to the amount in untreated control cells. Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region. Each table below represents a separate experiment. [Table 13-1]

Table 13-2

Table 14-1

Table 14-2

Table 15-1

Table 15-2

Table 16-1

Table 16-2

Table 17-1

Table 17-2

Table 18-1

Table 18-2

Claims

1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides: a) the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a PCDH19 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage; or b) an isometric portion of nucleobases 4,743 to 4,767 of SEQ ID NO: 1; an isometric portion of nucleobases 12,319 to 12,346 of SEQ ID NO: 1; an isometric portion of nucleobases 34,364 to 34,389 of SEQ ID NO: 1; or an isometric portion of nucleobases 84,408 to 84,431 of SEQ ID NO: 1; and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage; Oligomeric compounds.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides; a) the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of SEQ ID NOs: 132, 15-131, or 133-482, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage; b) the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or 16 contiguous nucleobases of any of SEQ ID NOs: 132, 15-131, or 133-560, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage, optionally the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 132, 15-131, or 133-560; c) the nucleobase sequence of said modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of SEQ ID NOs: 561-1028, and said modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage, optionally said modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 561-1028; or d) SEQ ID NO: 132, 228, 284, 330, or 440; SEQ ID NO: 416, 72, 129, or 204; SEQ ID NO: 371, 425, 20, or 111; or having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from SEQ ID NOs: 367, 407, 24, 93, or 218; the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage; Oligomeric compounds.

3. the nucleobase sequence of said modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to either the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of said modified oligonucleotide; and / or The modified oligonucleotide is 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17 25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; 3. The oligomeric compound of claim 1 or 2.

4. The method of claim 1, wherein the modified oligonucleotide comprises at least one modified nucleoside, optionally: i) the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety, and further optionally, the modified sugar moiety comprises a bicyclic sugar moiety, e.g., the bicyclic sugar moiety is -O-CH 2 - and -O-CH(CH 3 )-; and / or ii) at least one modified nucleoside of said modified oligonucleotide comprises a non-bicyclic modified sugar moiety, optionally at least one modified nucleoside of said modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge and a non-bicyclic modified sugar moiety; and / or The non-bicyclic modified sugar moiety is 2'-O(CH 2 ) 2 -OCH 3 a ribosyl sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; and / or b) the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate, optionally wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate selected from morpholino and PNA; 3. The oligomeric compound of claim 1 or 2.

5. A) The modified oligonucleotide is a) containing at least one modified internucleoside linkage, optionally: i) each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage; and / or ii) at least one internucleoside linkage is a phosphorothioate internucleoside linkage; or b) comprising at least one modified internucleoside linkage, optionally wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage, further optionally: i) the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage; ii) each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage; iii) at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages; and / or iv) the internucleoside linkage motif of said modified oligonucleotide is selected from 5'-sssssssssssssssssss-3', 5'-sssssssssssssss-3', 5'-sooooossssssssssssoooss-3', and ssoooooooooooooooooooooooss, wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage; or c) comprising at least one modified internucleoside linkage, optionally each internucleoside linkage being a phosphorothioate internucleoside linkage; and / or B) the modified oligonucleotide comprises a modified nucleobase, optionally wherein the modified nucleobase is 5-methylcytosine; 3. The oligomeric compound of claim 1 or 2.

6. 3. The oligomeric compound of claim 1 or 2, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 16 to 18, 18 to 22, 18 to 25, 18 to 20, 20 to 25, or 21 to 23 linked nucleosides, or a pharmaceutically acceptable salt thereof, optionally wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

7. A) The modified oligonucleotide comprising: a) consists of 16 linked nucleosides; b) consists of 18 linked nucleosides; c) consists of 20 linked nucleosides; d) consists of 21 linked nucleosides; or e) consisting of 23 linked nucleosides; and / or B) the oligomeric compound activates RNase H; optionally, the modified oligonucleotide is a gapmer; 3. The oligomeric compound of claim 1 or 2.

8. A) The modified oligonucleotide comprising: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; the 3'-terminal nucleoside of the 5'-region and the 5'-terminal nucleoside of the 3'-region comprise a modified sugar moiety; each of the central region nucleosides is selected from nucleosides comprising a 2'-β-D-deoxyribosyl sugar moiety and nucleosides comprising a 2'-substituted sugar moiety, the central region comprising at least six nucleosides comprising a 2'-β-D-deoxyribosyl sugar moiety and no more than two nucleosides comprising a 2'-substituted sugar moiety; and / or B) The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; having a glycomotif comprising: each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety; optionally: a) the modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; having a glycomotif comprising: Each of the 5' region nucleosides and each of the 3' region nucleosides are 2'-O(CH 2 ) 2 -OCH 3 ribosyl-modified sugar moieties, wherein each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety; or b) the modified oligonucleotide is: a 5' region consisting of three linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3' region consisting of three linked 3' region nucleosides; having a glycomotif comprising:

3. The oligomeric compound of claim 1, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a cEt sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

9. 3. The population of oligomeric compounds of claim 1 or 2, wherein the modified oligonucleotides contain at least one phosphorothioate internucleoside linkage, and all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random.

10. An oligomeric duplex comprising: a) a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein said first oligomeric compound is the oligomeric compound of claim 1 or 2, optionally wherein said second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal-length portion of said first modified oligonucleotide; b) a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of said first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 561-1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal-length portion of said first modified oligonucleotide; c) a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides, wherein the nucleobase sequence of said first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 561-1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1029-1496, and said nucleobase sequence of said second modified oligonucleotide is at least 90% complementary to an equal-length portion of said first modified oligonucleotide; or d) a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of said first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 561-1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1029-1496, and said nucleobase sequence of said second modified oligonucleotide is at least 90% complementary to an equal length portion of said first modified oligonucleotide; Oligomeric duplex.

11. A) said modified oligonucleotide of said first oligomeric compound comprises: a) comprises a 5'-stabilized phosphate group and / or comprises a 2'-NMA sugar moiety, optionally wherein the 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate; or b) containing glycol nucleic acid (GNA) sugar surrogates; B) At least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety, optionally wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety, and further optionally wherein the bicyclic sugar moiety of the second modified oligonucleotide is -O-CH 2 - and -O-CH(CH 3 )-, and / or the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety, e.g., the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety; C) at least one nucleoside of said second modified oligonucleotide comprises a sugar surrogate; D) the second modified oligonucleotide comprises at least one modified internucleoside linkage, optionally wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage; E) the second modified oligonucleotide comprises at least one phosphodiester internucleoside linkage; F) each internucleoside linkage of said second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage; G) the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage; and / or H) the second modified oligonucleotide comprises at least one modified nucleobase, optionally wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine; The oligomeric duplex of claim 10.

12. A) the second modified oligonucleotide comprises a conjugate group, optionally the conjugate group comprises a conjugate linker and a conjugate moiety; and / or a) the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide; b) the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide; or c) the conjugate group is attached to the second modified nucleotide via a modified internucleoside linkage; B) the conjugate group comprises a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, a C5 alkyl, a C22 alkenyl, a C20 alkenyl, a C16 alkenyl, a C10 alkenyl, a C21 alkenyl, a C19 alkenyl, a C18 alkenyl, a C15 alkenyl, a C14 alkenyl, a C13 alkenyl, a C12 alkenyl, a C11 alkenyl, a C9 alkenyl, a C8 alkenyl, a C7 alkenyl, a C6 alkenyl, or a C5 alkenyl; C) the conjugate moiety is a 6-palmitamidohexyl conjugate moiety; and / or D) the conjugate group comprises a cell targeting moiety; The oligomeric duplex of claim 10.

13. A) the second modified oligonucleotide comprises a conjugate group, optionally the conjugate group comprises a conjugate linker and a conjugate moiety; and / or a) the conjugate group is attached to the second modified oligonucleotide at the 5′ end of the second modified oligonucleotide; and / or b) the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide; B) The conjugate group has the following structure: 【Chemistry 1】 and / or C) the conjugate group comprises a cell targeting moiety; The oligomeric duplex of claim 10.

14. A method according to claim 1, wherein: a) the second modified oligonucleotide comprises a terminal group, optionally, the terminal group being an abasic sugar moiety; and / or b) the second modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 1 consisting of 7-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; wherein the modified oligonucleotide of the first oligomeric compound consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides; optionally, the modified oligonucleotide of the first oligomeric compound has a sugar motif (5' to 3') of yfyyyyyyyyyfyyyyyyy and the second modified oligonucleotide has a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyy, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; The oligomeric duplex of claim 10.

15. 3. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to claim 1 or 2, optionally a) the antisense agent is i. an RNase H agent capable of reducing the amount of PCDH19 nucleic acid by activating RNase H, or ii. is an RNAi agent capable of reducing the amount of PCDH19 nucleic acid by activating RISC / Ago2; and / or b) the modified oligonucleotide comprises a conjugate group, and the conjugate group is a cell-targeting moiety; Antisense agents.

16. 10. A pharmaceutical composition comprising the oligomeric compound of claim 1 or 2 and a pharmaceutically acceptable diluent, optionally wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or PBS, and further optionally comprising: a) said pharmaceutical composition consists essentially of said oligomeric compound and aCSF; or b) said pharmaceutical composition consists essentially of said oligomeric compound and PBS; Pharmaceutical compositions.

17. A pharmaceutical composition for use in therapy, said pharmaceutical composition comprising an oligomeric compound according to claim 1 or 2, optionally comprising: a) the pharmaceutical composition is administered to a subject with a disease associated with PCDH19 or PCDH19 epilepsy; and / or b) the pharmaceutical composition is administered to a human subject; Pharmaceutical compositions.

18. 10. A pharmaceutical composition for use in a method of treating a disease associated with PCDH19, said pharmaceutical composition comprising the oligomeric compound of claim 1 or 2, said method comprising administering said pharmaceutical composition to a subject having or at risk of developing a disease associated with PCDH19; and thereby treating the disease associated with PCDH19, optionally comprising: a) the PCDH19-associated disease is a neurodevelopmental disease; b) the disease associated with PCDH19 is PCDH19 epilepsy; c) at least one symptom or feature of the PCDH19-associated disease is alleviated, optionally wherein the symptom or feature is seizures, cognitive impairment, intellectual disability, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD), and further optionally wherein the seizures are any of cluster seizures, generalized tonic-clonic seizures, focal seizures, or bilateral seizures; d) administering the pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism spectrum disorder, reduces behavioral problems, reduces aggression, reduces anxiety, reduces obsessive-compulsive behavior, reduces hyperactivity, reduces symptoms of attention deficit disorder (ADD), or reduces symptoms of attention deficit hyperactivity disorder (ADHD) in the subject; and / or e) the subject is a human; Pharmaceutical compositions.

19. 3. Use of the oligomeric compound of claim 1 or 2 in the manufacture of a medicament for treating a disease associated with PCDH19, optionally wherein the disease associated with PCDH19 is PCDH19 epilepsy.