Flow cell and method

Abstract

An example of a flow cell includes a substrate having recesses separated by a gap region. A first and a second primer are immobilized within the recess. A first transposome complex is immobilized within the recess, the first transposome complex comprising a first amplification domain. A second transposome complex is also immobilized within the recess, the second transposome complex comprising a second amplification domain. A portion of the first transposome complex, or a portion of the second transposome complex, or a portion of both the first and second transposome complexes comprises a modification that reduces tagmentation efficiency.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 293,494, filed December 23, 2021, U.S. Provisional Patent Application No. 63 / 323,890, filed March 25, 2022, U.S. Provisional Patent Application No. 63 / 371,165, filed August 11, 2022, and U.S. Provisional Patent Application No. 63 / 380,878, filed October 25, 2022, each of which is incorporated by reference in its entirety herein.

[0002] (Reference to sequence listing) The sequence listing submitted herewith is incorporated by reference in its entirety. The file is named "ILI228BPCT_IP-2481-PCT_Sequence_Listing_ST25.txt", the file size is 12,576 bytes, and the file creation date is December 16, 2022. [Background technology]

[0003] Double-stranded DNA (dsDNA) target molecules can be fragmented and tagged to generate a library of smaller single-stranded DNA molecules (ssDNA). These smaller single-stranded DNA molecules can be used as templates in DNA sequencing reactions. The templates can allow short read lengths to be obtained, and then during data analysis, overlapping short sequence reads can be aligned to reconstruct longer nucleic acid sequences. Some methods for fragmentation and tagging of double-stranded DNA generate excessive waste, involve expensive equipment for fragmentation, and are time-consuming.

[0004] Prior to fragmentation and tagging, dsDNA target molecules may be extracted from whole blood samples, bone marrow aspirates, tissue samples, blood spots, or saliva. Some extraction processes utilize one or more reagents that inhibit the enzymatic reactions that occur during fragmentation and / or tagging. Thus, the extracted dsDNA target molecules may be subjected to a purification process before being subjected to further preparation techniques. Summary of the Invention [Means for solving the problem]

[0005] Several flow cells are disclosed herein that include transposome complexes and primers bound to a surface within the flow cell. Other flow cells are disclosed herein that allow a first type of transposome complex to assemble on a first portion of the flow cell and a second type of transposome complex (e.g., a preassembled transposome complex) to bind to a second portion of the flow cell. In these other flow cells, primers bind to both the first and second portions. As part of the surface chemistry of each of these flow cells, the transposome complexes and primers allow DNA sample tagmentation and extension amplification to occur on the flow cell surface, thus eliminating the need for off-flow cell library preparation (e.g., off-flow cell DNA sample tagmentation).

[0006] Some of the flow cells disclosed herein contain transposome complexes that are asymmetrically bound to the surface within the flow cell. By "asymmetrically bound" it is meant that one transposome complex is bound to the flow cell surface via its 5' end, and the other transposome complex is bound to the flow cell via its 3' end. In these examples, the ratio of asymmetrically bound transposome complexes is skewed such that there are more 3' end bound transposome complexes. The asymmetric binding and ratio reduces the occurrence of fragmented strands that have identical amplification domains at both the 3' and 5' ends as a result of extension amplification. Reducing the occurrence of these particular fragmented strands can increase the percentage of reads that pass the filter (i.e., the index used to describe clusters that pass the chastity threshold and are used for further processing and analysis of sequencing data).

[0007] Still other examples of flow cells disclosed herein contain only one type of transposome complex bound to a surface within the flow cell. In these examples, a second tagmentation step can be formed away from the flow cell or by introducing additional transposome complexes into the flow cell at some point in the workflow.

[0008] Also disclosed herein are methods for attaching transposome complexes to the surface of a flow cell. These methods are efficient and can be performed during flow cell manufacture or as part of the initial setup of the flow cell.

[0009] Also disclosed herein is a method for increasing the insert size of a tagmented DNA sample. Larger inserts are useful when aligning reads to a reference, since the positive and negative strand reads (e.g., read 1 and read 2) are further apart. Larger inserts also reduce the chance of overlapping reads 1 and 2, which can help with GC bias and improve sequencing accuracy of otherwise difficult regions (e.g., short tandem repeats (STRs), homopolymers, etc.).

[0010] After tagmentation, a chaotropic agent may be introduced to remove the transposase from the transposome complex. Some of the methods disclosed herein include the introduction of a chelator of the chaotropic agent after the introduction of the chaotropic agent. The chelator can sequester the chaotropic agent, thus preventing denaturation of enzymes (e.g., ligases, polymerases) used in downstream processes, such as extension and amplification reactions.

[0011] Further methods are disclosed herein for extracting DNA from a sample selected from the group consisting of whole blood samples, bone marrow aspirates, tissue samples, blood spots, or saliva. The methods utilize a specific lysis buffer for extracting DNA and the aforementioned chelating agent for sequestering the chaotropic agent in the lysis buffer. The methods produce a complexed crude lysate that can be used in various library preparation methods, including the on-flow cell DNA sample tagging fragmentation disclosed herein, without the need to first be exposed to a purification process. Thus, the methods can reduce the amount of time involved between extracting DNA and generating library fragments from the extracted DNA.

[0012] Features of examples of the present disclosure will become apparent upon reference to the following detailed description and the drawings in which like reference numbers correspond to similar, but possibly not identical, components. For purposes of brevity, reference numbers or features having previously described functions may or may not be described in conjunction with the other drawings in which they appear. [Brief description of the drawings]

[0013] [Figure 1A] FIG. 2 is a schematic diagram of one well of an example of a flow cell disclosed herein containing a transposome complex in dimeric form grafted onto a polymer hydrogel. [Figure 1B] FIG. 2 is a schematic diagram of one well of an example of a flow cell disclosed herein containing a single transposome complex grafted to a polymer hydrogel. [Figure 1C] FIG. 1C is a schematic diagram of the recess of FIG. 1B after a DNA sample has undergone tagmentation. [Figure 1D] FIG. 1D is a schematic diagram of the well of FIG. 1C after transposase removal and extension reactions. [Figure 2A] FIG. 2 is a schematic diagram of one well of another example of a flow cell disclosed herein containing transposome complexes bound to a polymer hydrogel via a biotin-containing linker. [Figure 2B] FIG. 13 is a schematic diagram of one well of yet another example of a flow cell disclosed herein, containing transposome complexes and primers bound to a polymer hydrogel via a biotin-containing linker. [Figure 3A] FIG. 2 is a schematic diagram of one well of an example flow cell disclosed herein containing spatially separated transposome complexes and primers. [Figure 3B] FIG. 1 is a schematic diagram of one multi-depth well of an example flow cell disclosed herein containing spatially separated transposome complexes and primers. [Figure 4]FIG. 1 is a schematic diagram of one well of another example of a flow cell disclosed herein, containing spatially separated transposome complexes and primers. [Diagram 5] FIG. 13 is a schematic diagram of one well of yet another example of a flow cell disclosed herein, containing spatially separated transposome complexes and primers. [Figure 6] FIG. 1 is a graph showing the percentage of reads (Y-axis) with insert sizes (in base pairs) shown on the X-axis after tagmentation of controls and examples when spermidine was added with the DNA samples. [Figure 7] FIG. 13 is a graph showing the percentage of reads (Y-axis) with insert sizes (in base pairs) shown on the X-axis after tagmentation for a control (using unmodified transposome complexes) and an example where the transposome complexes are modified by a step of removing the 5' phosphate from the non-transferred strand. [Figure 8] FIG. 13 shows the percentage of reads (Y-axis) with insert sizes (in base pairs) shown on the X-axis after tagmentation for a control (Illumina PCR-free DNA preparation in a tube) and four different examples where the transposome complex was modified by: i) removing the 5' phosphate from the non-transferred strand and adding a 3' dye to the non-transferred strand; ii) adding a 3' dye to the non-transferred strand; and iii) removing the 5' phosphate from the non-transferred strand. [Figure 9] Graph showing the percentage of reads (Y-axis) with insert sizes (in base pairs) shown on the X-axis after tagmentation for five different examples of controls (using unmodified transposome complexes) and when the transposome complexes are modified by a step that adds a 3' dideoxycytosine to the transferred strand. [Figure 10]Graphs showing i) insert size (base pairs), ii) percentage of Q30 bases, iii) percentage of mapped reads, iv) coverage, and v) percentage of reads passing filter (% PF) for library fragments generated using two different control methods and library fragments generated from whole blood samples using an exemplary method disclosed herein. [Figure 11] Figures 11A, 11B, 11C, and 11D each show an automated electrophoresis gel image (reproduced in black and white) showing the effect that beta-cyclodextrin has on sodium dodecyl sulfate (SDS) during polymerase chain reaction (PCT) with two different polymerases. [Figure 12] 1 is a graph showing quantitative polymerase chain reaction (qPCR) yields (nM, Y-axis) versus the percentage of beta-cyclodextrin used in the gap-filling ligation step for two different control samples and an example sample. [Figure 13A] FIG. 1 is a schematic diagram of one recess of an example of a flow cell disclosed herein containing transposome complexes bound asymmetrically within the recess. [Figure 13B] FIG. 13B is a schematic diagram of the recess of FIG. 13A after a DNA sample has undergone tagmentation. [Figure 13C] FIG. 13C is a schematic diagram of the well of FIG. 13B after transposase removal and before the extension reaction. [Figure 13D] FIG. 13C is a schematic diagram of the well of FIG. 13B after dehybridization. [Figure 14A] An example of an asymmetrically bound transposome complex is shown diagrammatically in FIG. 13A. [Figure 14B] Another example of an asymmetrically bound transposome complex is shown diagrammatically in FIG. 13A. [Figure 15A]FIG. 1 is a schematic diagram of one of the recesses of another example of a flow cell disclosed herein, where the recess comprises different chemistries for assembling a first type of transposome complex on a first portion of the flow cell and for binding a second type of transposome complex (i.e., a preassembled transposome complex) to a second portion of the flow cell. [Figure 15B] FIG. 15B is a schematic diagram of the recess of FIG. 15A with a first type of transposome complex assembled on a first portion and a preassembled transposome complex bound to a second portion. [Figure 15C] FIG. 15C is a schematic diagram of the recess of FIG. 15B after tagmentation of a DNA sample. [Figure 15D] FIG. 15D is a schematic diagram of the well of FIG. 15C after transposase removal. [Figure 15E] FIG. 15D is a schematic diagram of the recess of FIG. 15D after a strand displacement reaction. [Figure 15F] FIG. 15F is a schematic diagram of the recess of FIG. 15E after cleaning. [Figure 15G] FIG. 15C is a schematic diagram of the recess of FIG. 15F after hybridization. [Figure 15H] FIG. 15G is a schematic diagram of the recess of FIG. 15G after polymerase extension. [Figure 15I] FIG. 15C is a schematic diagram of the recess of FIG. 15H after cleavage of the orthogonally cleavable bond. [Figure 15J] FIG. 15I is a schematic diagram of the recesses of FIG. 15I after clustering. [Figure 16A] An example of an assembled transposome complex is shown diagrammatically in FIG. 15B. [Figure 16B] An example of a preassembled transposome complex is shown diagrammatically in FIG. 15B. [Figure 17] FIG. 1 is a schematic diagram of an exemplary primer set that can be used in some examples of the flow cell disclosed herein. [Figure 18]FIG. 1 is a bar graph showing DNA yields for blood samples extracted manually or via an automated process, where proteinase K was added to the lysis buffer or pre-dried onto the sample collection tip. [Figure 19] Graphs showing i) insert size (base pairs), ii) percentage of Q30 bases, iii) percentage of mapped reads, iv) coverage, and v) percentage of reads passing filter (% PF) for library fragments generated from whole blood samples using three exemplary methods disclosed herein. [Figure 20] Graphs showing i) insert size (base pairs), ii) percentage of Q30 bases, iii) percentage of mapped reads, iv) coverage, and v) percentage of filter passing reads (% PF) for library fragments generated from DNA samples using flow cells prepared with liquid streptavidin and lyophilized and reconstituted streptavidin. [Figure 21] Graphs showing i) insert size (base pairs), ii) percentage of Q30 bases, iii) percentage of mapped reads, iv) coverage, and v) percentage of reads passing through the filter (% PF) for library fragments generated from whole blood samples prepared using liquid lysis buffer and lyophilized and reconstituted lysis buffer. [Figure 22] Graphs showing i) insert size (base pairs), ii) percentage of Q30 bases, iii) percentage of mapped reads, iv) coverage, and v) percentage of filter passing reads (% PF) for library fragments generated from DNA samples prepared in liquid tagmentation buffer and lyophilized and reconstituted tagmentation buffer. [Figure 23]Graphs showing i) insert size (base pairs), ii) percentage of Q30 bases, iii) percentage of mapped reads, iv) percentage of reads passing filter for library fragments (% PF), and v) coverage generated from DNA samples prepared and sequenced using a commercially available NextSeq® 2K sequencing kit and the exemplary workflow described herein. [Figure 24] FIG. 1 is a schematic diagram of an example tagmentation kit. [Diagram 25] Graphs showing i) insert size (base pairs), ii) occupancy or % occupancy, iii) percentage of Q30 bases, iv) percentage of mapped reads, and v) percentage of reads passing filter (% PF) for library fragments generated from DNA samples prepared and sequenced using flow cells in which coupling chemistry (BCN-biotin-streptavidin) was introduced via different methods. [Figure 26A] FIG. 1 is a schematic diagram illustrating an exemplary method, showing recesses of multiple depths into which a polymer hydrogel is introduced. [Figure 26B] FIG. 1 is a schematic diagram illustrating an exemplary method, showing the introduction of a first transposome and primer set into one portion of a multi-depth recess, while the other portion of the multi-depth recess is masked with an insoluble photoresist. [Figure 26C] FIG. 13 is a schematic diagram illustrating an exemplary method, showing the introduction of a second transposome and primer set into the other portion of the multi-depth well. [Figure 26D] FIG. 1 is a schematic diagram illustrating an exemplary method, showing tagmentation across recesses of multiple depths. [Figure 27] FIG. 1 is a schematic flow diagram showing different exemplary methods starting with one type of transposome complex in a flow cell well. [Figure 28]Graphs showing i) insert size (base pairs), ii) occupancy or % occupancy, iii) percentage of Q30 bases, iv) percentage of mapped reads, and v) percentage of reads passing filter (% PF) for library fragments generated from DNA samples prepared and sequenced using flow cells in which linking chemistry (BCN-biotin-streptavidin) was introduced via different methods. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] An example of a flow cell disclosed herein includes a transposome complex immobilized on the surface of the flow cell. By incorporating a transposome complex on the surface of the flow cell, tagmentation of DNA samples can be performed on the surface of the flow cell. In the flow cell, tagmentation produces DNA sample fragments (or library fragments of a larger DNA sample) on the same surface where fragment amplification and sequencing are performed. This eliminates the need for off-flow cell DNA sample preparation to produce library fragments, thus providing a more streamlined and efficient process.

[0015] In some instances, the transposome complexes and / or reagents used in tagmentation are modified to increase the insert size of the fragmentation products, which may be desirable.

[0016] In some of the methods disclosed herein, a chelator of chaotropic agent is used to sequester chaotropic agent after tagmentation is performed.Sequestering in the manner described herein allows chaotropic agent to remain undenatured for enzymes (e.g., ligase, polymerase) used in downstream processes, and also eliminates the need for washing after tagmentation.When a bead-based tagmentation process is used, sequestering in the manner described herein also eliminates the need for a magnet to separate beads from tagmentation buffer.

[0017] In some examples, the DNA sample used to generate the DNA sample fragments is prepared from a whole blood sample in a manner that allows it to be directly exposed to library preparation without first being exposed to purification.

[0018] In yet another example, the transposome complex used in tagmentation binds asymmetrically to reduce the generation of fragment strands that have identical amplification domains at both the 3' and 5' ends.

[0019] definition Terms used herein shall be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are described below.

[0020] As used herein, the singular refers to both the singular as well as the plural, unless the context clearly dictates otherwise. As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0021] References throughout this specification to "one example," "another example," "an example," etc. mean that a particular element (e.g., a feature, structure, composition, configuration, and / or characteristic) described in connection with an example is included in at least one example described herein, and may or may not be present in other examples. In addition, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0022] As used throughout this disclosure, including the claims, the terms "substantially" and "about" are used to describe and account for small variations, such as those due to variations in processing, etc. For example, these terms can refer to ±5% or less from the stated value, such as ±2% or less from the stated value, ±1% or less from the stated value, ±0.5% or less from the stated value, ±0.2% or less from the stated value, ±0.1% or less from the stated value, or ±0.05% or less from the stated value.

[0023] Adapter: A linear oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. Suitable adapter lengths can range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. An adapter can include any combination of nucleotides and / or nucleic acids. In some examples, an adapter can include an amplification domain, e.g., having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, an adapter can include a sequence complementary to at least a portion of a flow cell surface-bound primer (including a universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to a complementary flow cell surface-bound primer during amplification and cluster generation. In some examples, an adapter can also include a sequencing primer sequence (i.e., a sequencing binding site), or a sequencing sample index (i.e., a barcode sequence). A combination of different adapters can be incorporated into a nucleic acid molecule, such as a DNA fragment generated via tagmentation.

[0024] Amplification domain: A portion of an adapter that has a universal nucleotide sequence, such as the P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation.

[0025] Asymmetrically bound: within a population of transposome complexes, some bind to the flow cell surface via the 3' end of the non-transferred strand, and other parts bind to the flow cell surface via the 5' end of the transferred strand.

[0026] Complex crude lysate: A product produced by exposing a sample selected from the group consisting of a whole blood sample, a bone marrow aspirate, a tissue sample, a blood spot, and saliva to i) a lysis buffer free of inorganic salts, ii) inactivation of proteases contained in the lysis buffer free of inorganic salts, and iii) a chelating agent of a chaotropic agent in the lysis buffer free of inorganic salts, which product can be used in downstream library preparation techniques without first being exposed to a purification method.

[0027] Deposition: any suitable application technique, which may be manual or automated, possibly resulting in modification of surface properties. In general, deposition may be performed using deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g. ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0028] Recess: A discrete concave feature in a substrate or layer of a substrate (e.g., a patterned resin) having a surface opening at least partially surrounded by a void region(s) of the substrate or layer. The recess can take any of a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The recess may have a more complex architecture, such as ridges, steps, etc.

[0029] DNA sample: A polymeric form of nucleotides of any length, including deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides, derived from an RNA (ribonucleic acid) sample. A DNA sample is double-stranded. A DNA sample may include naturally occurring DNA that includes a backbone containing nitrogenous heterocyclic bases (nucleobases such as adenine, thymine, cytosine, and / or guanine), sugars (specifically, deoxyribose, i.e., sugars lacking the hydroxyl group present at the 2' position of ribose), and phosphodiester bonds. Analog structures may have alternative backbone linkages, including any of a variety known in the art.

[0030] The DNA sample may be genomic DNA (gDNA), which may be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva), or tissues. gDNA may be prepared by lysing cells containing DNA. The cells may be lysed under conditions that substantially preserve the integrity of the gDNA of the cells. In one particular example, heat lysis may be used to lyse the cells. In another particular example, exposure of the cells to an alkaline pH may be used to lyse the cells while causing relatively little damage to the gDNA. Any of a variety of basic compounds may be used for lysis, including, for example, potassium hydroxide and sodium hydroxide. In addition, relatively undamaged gDNA may be obtained from cells lysed by enzymes that degrade the cell wall. Cells lacking a cell wall, either naturally or due to enzymatic removal, may also be lysed by exposure to osmotic stress. Other conditions that may be used to lyse the cells include exposure to detergents, mechanical disruption, sonication heat, pressure differentials such as a French press apparatus, or Dounce homogenization. Agents that stabilize gDNA may be included in the cell lysate or isolated gDNA sample, including, for example, nuclease inhibitors, chelating agents, salts, and buffers. In some examples, crude cell lysate containing gDNA may be used directly without further isolation of gDNA. In one example, a whole blood sample may be lysed using a lysis buffer that does not contain inorganic salts, and the crude lysate may be exposed to certain processing steps to generate a complex crude lysate as defined herein. This complexed crude lysate may also be used as a DNA sample without further isolation or purification.

[0031] Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to all items in the collection. Exceptions may occur where explicit disclosure or context clearly dictates otherwise.

[0032] Flow cell: A vessel having a flow path in which a reaction can take place, an inlet for delivering a reagent(s) to the chamber, and an outlet for removing the reagent(s) from the chamber. In some examples, the flow cell allows for detection of the reaction occurring therein. For example, the flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, and the like.

[0033] Flow Channel: An area defined between two bound or otherwise associated components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between two patterned or unpatterned sequencing surfaces and thus may be in fluid communication with one or more components of the sequencing surface(s).

[0034] Fragment: A portion or piece of a DNA sample. A "partially matched fragment" is a portion or fragment of a DNA sample that has been tagmented, and therefore includes an adaptor ligated to the 5' end of the DNA fragment. A "perfectly matched fragment" is a portion or fragment of a DNA sample that has adaptors incorporated at both the 3' and 5' ends of the DNA fragment.

[0035] Inorganic salt-free lysis buffer: A lysis buffer that does not contain inorganic salts, such as sodium salts, such as sodium chloride, sodium sulfate, and sodium carbonate, potassium salts, such as potassium chloride, and lithium salts, such as lithium chloride. Inorganic salt-free lysis buffers may contain organic salts, including those that function as chelating agents or surfactants.

[0036] Primer: A single-stranded nucleic acid molecule that can hybridize to a target sequence, such as an adaptor attached to a fragment. In one example, the flow cell surface can serve as a starting point for fragment amplification and cluster generation. In another example, a primer (e.g., a sequencing primer) can be introduced that can hybridize to a fragment or fragment amplicon to prime the synthesis of a new strand complementary to the fragment or fragment amplicon. Any primer can include any combination of nucleotides or their analogs. In some examples, the primer is a single-stranded oligonucleotide or polynucleotide. The length of the primer can be any number of bases long. In one example, each of the flow cell surfaces is attached to a primer, and the capture primer or sequencing primer is single-stranded, ranging from 10 to 60 bases, or 20 to 40 bases.

[0037] Tagmentation: The process by which a DNA sample is cleaved / fragmented and tagged (e.g., with adapters) for analysis. Tagmentation is an in vitro transposition reaction.

[0038] Transferred and non-transferred strands: The term "transferred strand" refers to a sequence that includes a transferred portion of a transposon end. Similarly, the term "non-transferred strand" refers to a sequence that includes a non-transferred portion of a transposon end. The 3' end of the transferred strand is joined or transferred to a double-stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to a double-stranded fragment during tagmentation. In one example, the transferred strand and the non-transferred strand include at least partially complementary portions that are covalently linked to each other.

[0039] Transposase: An enzyme that can form a functional complex containing a transposon end-containing composition (e.g., a transposon, a transposon end, a transposon end composition) and catalyze the insertion or transposition of the transposon end-containing composition into a double-stranded DNA sample with which it is incubated, for example, in an in vitro transposition reaction (i.e., tagmentation). Transposases provided herein can also include integrases from retrotransposons and retroviruses. Many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, but it is understood that any transposase capable of inserting a transposon end with sufficient efficiency to 5' tag and fragment a DNA sample for the intended purpose can be used.

[0040] Transposome complex: A complex formed between a transposase and a double-stranded nucleic acid that contains a transposase integration recognition site. For example, a transposome complex can be a transposase enzyme pre-incubated with double-stranded transposon DNA under conditions that support non-covalent complex formation. The double-stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions, or other double-stranded DNA that can interact with transposase, such as hyperactive Tn5 transposase.

[0041] Transposon end: A double-stranded nucleic acid strand that exhibits only the nucleotide sequence required to form a complex with a transposase that functions in tagmentation ("transposon end sequence"). The double-stranded nucleic acid strand at the transposon end can comprise any nucleic acid or nucleic acid analogue suitable for forming a functional complex with a transposase. For example, the transposon end can comprise natural DNA, or a DNA analogue (including modified bases or backbones), and can contain a nick in one or both strands.

[0042] It should be understood that the prime (') designation for any of the reference numbers, e.g., primer 36', amplification domain 26', etc., does not refer to a complementary sequence to the corresponding element primer 36, amplification domain 26, but rather is a further example of the element. When used to describe a specific primer, e.g., P5' or P7', prime (') refers to a complementary sequence.

[0043] Transposome complex 1A, 1B, 1C, and 1D show several examples of transposome complexes 10, 10', as disclosed herein, immobilized in a flow cell recess 12. Although a single set of transposome complexes 10, 10' is shown in each of these figures, it should be understood that several sets of transposome complexes 10, 10' may be bound in a single recess 12. The set of transposome complexes 10, 10' in FIG. 1A is shown in a dimeric form, while the set of transposome complexes 10, 10' shown in FIGS. 1B-1D is shown as a single transposome complex 10, 10'. In the examples shown in FIGS. 1A-1D, the transposome complexes 10, 10' are immobilized in the recess 12. The transposome complexes 10, 10' may also be immobilized in a spatially separated manner, as described herein below with reference to FIGS. 3A-5.

[0044] The example transposome complexes 10, 10' (or 10A, 10B described herein with reference to Figures 13A-13D, 14A and 14B, or 10C, 10D described with reference to Figures 15A-15J) are separate entities, but form dimers when in solution and bound to a flow cell surface. It should be understood that for simplicity, a single transposome complex is shown in Figures 1B-5. Dimeric forms of some of the example transposomes are shown, for example, in Figure 1A, and in several figures in the Figures 13 and 15 series (see, for example, Figures 13A and 15B).

[0045] As noted and shown in Figures 1A and 1B, transposome complexes 10, 10' comprise a transposase enzyme 14, 14' non-covalently bound to a transposon end 16, 16'. Each transposon end 16, 16' is a double-stranded nucleic acid strand, one strand 30, 30' of which is part of the transferred strand 18, 18' and the other strand 32, 32' of which is part of the non-transferred strand 20, 20'. In other words, transposon end 16, 16' comprises a portion of the transferred strand 18, 18' (strand 30, 30') that is hybridized to a portion of the non-transferred strand 20, 20' (e.g., strand 32, 32').

[0046] The transferred strand 18 comprises a 5'-end functional group 22, a first amplification domain 26, and a sequencing primer sequence 28 attached to one strand 30 of the transposon end 16, which can be covalently or non-covalently attached directly or indirectly to a surface functional group of the polymer hydrogel 24 in the flow cell recess 12. The strand 30 of the transposon end 16 is located at the 3'-end of the transferred strand 18. Similar to the transferred strand 18, the transferred strand 18' comprises a 5'-end functional group 22', a second amplification domain 26', and a sequencing primer sequence 28' attached to one strand 30' of the transposon end 16', which can be covalently attached to a surface functional group of the polymer hydrogel 24 in the flow cell recess 12. The strand 30' of the transposon end 16 is located at the 3'-end of the transferred strand 18'.

[0047] The 5' end functional groups 22, 22' may be any functional group capable of covalently or non-covalently binding, directly or indirectly, to the surface functional groups of the polymer hydrogel 24, and thus will depend on the surface functional groups of the polymer hydrogel 24. In one example, the polymer hydrogel 24 includes azide or tetrazine surface groups, and the 5' end functional groups 22, 22' include a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). In another example, the polymer hydrogel 24 is functionalized with biotin surface groups (referred to herein as biotinylated polymer hydrogel 24'), and the 5' end functional groups 22, 22' also include biotin. In these examples, additional streptavidin or avidin is added to indirectly bind the biotin groups to each other.

[0048] The first and second amplification domains 26, 26' have different sequences from each other but have the same sequences as the first and second primers 36, 36', respectively, bound to the polymer hydrogel 24. The first amplification domain 26 and primer 36, together with the second amplification domain 26' and primer 36', allow for the amplification of DNA sample fragments generated during tagmentation.

[0049] Examples of suitable sequences for the first amplification domain 26 / primer 36 and the second amplification domain 26' / primer 36' include the P5 and P7 primer sequences; the P15 and P7 primer sequences; or any combination of the PA, PB, PC, and PD primer sequences described herein. Examples of P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc., for example, for sequencing on HiSeq®, HiSeqX®, MiSeq®, MiSeqDX®, MiNISeq®, NextSeq®, NextSeqDX®, NovaSeq®, iSEQ®, Genome Analyzer®, and other instrument platforms.

[0050] The P5 primer sequence is as follows: P5 #1:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 1) Here, "n" is a uracil in the sequence. P5 #2:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 2) Here, "n" is the alkene-thymidine (i.e., alkene-dT) in the sequence.

[0051] The P7 primer sequence can be any of the following: P7 #1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 3) P7 #2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 4) Here, "n" is 8-oxoguanine in each sequence.

[0052] The P15 primer sequence is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 5) where "n" is allyl-T.

[0053] Other primers mentioned above (PA-PD) include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 6) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 7) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 8) PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 9)

[0054] Although not shown in the exemplary sequence for PA-PD, it should be understood that any of these sequences may contain a cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) at any point in the strand. The sequences of the first amplification domain 26 / primer 36 and the second amplification domain 26' / primer 36' may be selected to have orthogonal cleavage sites (i.e., one cleavage site is not sensitive to the cleavage agent used at the other cleavage site) so that after amplification, either the forward or reverse strand may be cleaved, leaving the other of the reverse or forward strand for sequencing.

[0055] The primer 36, 36' may also include a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region includes 2 T bases to 20 T bases. As specific examples, the poly-T region may include 3, 4, 5, 6, 7, or 10 T bases.

[0056] The sequencing primer sequences 28, 28' have different sequences that each bind to a sequencing primer that was introduced into the flow cell after tagmentation and amplification. By way of example, the sequencing primer sequence 28 may bind to a sequencing primer that primes the synthesis of a new strand that is complementary to the forward strand fragment / fragment amplicon, and the sequencing primer sequence 28' may bind to a sequencing primer that primes the synthesis of a new strand that is complementary to the reverse strand fragment / fragment amplicon.

[0057] The transposon end 16, 16' of each transposome complex 10, 10' comprises a strand 30, 30' hybridized to a strand 32, 32', respectively. Thus, strands 30 and 32 are complementary, and strands 30', 32' are complementary. Each double-stranded transposon end 16, 16' can form a complex with a transposase 14, 14'. As examples, strands 30, 32 and 30', 32' of transposon ends 16, 16' can be related but non-identical 19 base pair (bp) outer end (e.g., strands 30, 30') and inner end (e.g., strands 32, 32') sequences that function as substrates for Tn5 transposase activity, or mosaic ends recognized by wild-type or mutant Tn5 transposase, or the R1 ends (e.g., strands 30, 30') and R2 ends (strands 32, 32') recognized by MuA transposase.

[0058] 1C shows recess 12 after a DNA sample has been introduced. The DNA sample may be introduced along with a tagmentation buffer, which may include water, optionally a co-solvent (e.g., dimethylformamide), a metal cofactor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., tris(hydroxymethyl)aminomethane (Tris or Tris) acetate, pH 7.6). In one example, the optional co-solvent may be present in an amount up to about 11%, the metal cofactor may be present at a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present at a concentration ranging from about 7 mM to about 12 mM.

[0059] When a DNA sample (shown fragmented with reference number 34) is introduced into a flow cell containing transposome complexes 10, 10', the DNA sample is fragmented and the 5' ends of both strands 35, 37 of the double-stranded fragment 34 are ligated to the 3' ends of each of the transferred strands 18, 18' of the transposome complexes 10, 10'. The fragmentation and ligation can occur at a temperature of 30° C. or higher. In one example, the temperature can range from about 30° C. to about 55° C. In another example, the temperature can range from about 35° C. to about 45° C. The 3' end of the double-stranded fragment 34 is not ligated to the 5' end of the non-transferred strand 20, 20'. Thus, a gap 39 exists between the 3' end of the DNA fragment strand 35 and the 5' end of the non-transferred strand 20', and a gap 39' exists between the 3' end of the DNA fragment strand 37 and the 5' end of the non-transferred strand 20'. In one example, each gap 39, 39' is 9 base pairs long.

[0060] As shown in FIG. 1D, the transposase 14, 14' is then removed from the complex 10, 10', where the complex 10, 10' is attached to the fragment via the transfer strand 18, 18'. Removal of the transposase 14, 14' can be achieved, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell to about 60° C. Thus, after tagmentation, some exemplary methods include introducing a wash solution into the flow cell, heating the flow cell containing the wash solution to about 60° C., and then introducing an extension amplification mix into the flow cell. Before introducing the extension amplification mix, the temperature may be reduced to about 38° C.

[0061] It has been found that heating the flow cell after tagmentation can be sufficient to denature the transposase 14, 14' without additional buffers or reagents. An exemplary extension amplification mix includes a recombinase, a polymerase, and accessory proteins. An exemplary wash solution is an aqueous solution that includes a buffer (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN® polysorbate), and / or a chelating agent (e.g., EDTA). In one example, the wash solution includes water, a salt at a concentration ranging from about 25 mM to about 50 mM, a surfactant in an amount ranging from about 0.01% to about 0.1% by weight, and, optionally, a chelating agent. The wash solution can have a relatively high pH (e.g., ranging from about 7 to about 10).

[0062] When removal of transposase 14, 14' is accomplished using sodium dodecyl sulfate (SDS) or other chaotropic agents, the presence of this agent may act as an inhibitor of subsequent enzymatic reactions involving, for example, recombinases, ligases, polymerases, etc. Thus, the presence of chaotropic agents may have a detrimental effect on subsequent library preparation reactions and / or amplification reactions. In this exemplary method, a chelator of the chaotropic agent may be added to separate the chaotropic agent. The chelator used depends on the chaotropic agent used. In one example, the chaotropic agent is sodium dodecyl sulfate and the chelator of the chaotropic agent is a cyclodextrin selected from the group consisting of alpha cyclodextrin, beta cyclodextrin, and methyl beta cyclodextrin. An aqueous solution containing about 1% to about 4% by weight of cyclodextrin may be used. In another example, the aqueous solution may contain about 1% to about 2% by weight of cyclodextrin. Cyclodextrins are cup-shaped structures with a hydrophilic exterior and a hydrophobic core. These compounds have the ability to form complexes with hydrophilic molecules (e.g., SDS or other chaotropic agents used to remove transposase 14,14'). In particular, the long hydrophobic tail of SDS is drawn into the cyclodextrin cup, which effectively locks SDS after transposase 14,14' removal and prevents it from denaturing enzymes, including those used in downstream library preparation and / or amplification.

[0063] Whether heat or chaotropic agents are used, removal of the transposases 14, 14' releases the partially adapted DNA fragments, including the transferred strands 18, 18' and the DNA fragments 35, 37 bound thereto, respectively. Following this purification step to remove the transposases 14, 14', the non-transferred strands 20, 20' are dehybridized and an extension reaction using an exclusion amplification reagent (e.g., ExAmp reagent available from Illumina Inc.) adds additional sequences (adapters) to the 3' ends of the partially adapted fragments. It should be understood that in examples where the SDS or other chaotropic agent is chelated with cyclodextrin, the extension reaction can be performed without the need to perform one or more wash cycles to remove the SDS or other chaotropic agent from the flow cell. The extension reaction involves the addition of nucleotides from the 3' ends of the DNA fragments 35, 37 in a template-dependent manner, using each of the transferred strands 18', 18' as templates. Thus, DNA fragment 35 is extended along sections 30', 28', and 26' to generate complementary sections 30'C, 28'C, and 26'C bound to DNA fragment 35, and DNA fragment 37 is extended along sections 30, 28, and 26 to generate complementary sections 30C, 28C, and 26C bound to DNA fragment 37.

[0064] In summary, one example of the method shown in Figures 1C and 1D includes the steps of introducing a DNA sample into a flow cell including recesses 12 separated by gap regions 38, a first primer 36 and a second primer 36' immobilized within each recess 12, a first transposome complex 10 immobilized within each recess 12 or on the gap region 38, the first transposome complex 10 comprising a first amplification domain 26, and a second transposome complex 10' immobilized within each recess 12 or on the gap region 38, the second transposome complex 10' comprising a second amplification domain 26. The method includes a flow cell 26', in which tagmentation of the DNA sample occurs in a portion of the first transposome complex 10 and the second transposome complex 10' to generate a plurality of partially adapted DNA fragments, a step of introducing a chaotropic agent into the flow cell to remove the transposase 14 of the first transposome complex 10 and the second transposome complex 10', a step of introducing a chelating agent for the chaotropic agent to separate the chaotropic agent, and a step of performing an extension reaction to add additional adapters to the partially adapted DNA fragments.

[0065] The introduction of chaotropic and chelating agents may also be used in methods in which transposome complexes 10, 10' are bound to other substrate surfaces, such as beads (e.g., magnetic beads). This exemplary method more generally includes the steps of performing a tagmentation reaction using the DNA sample and surface-bound transposome complexes 10, 10', thereby generating a plurality of partially adapted DNA fragments, introducing a chaotropic agent to remove the transposase 14, 14' of the transposome complexes 10, 10', introducing a chelating agent for the chaotropic agent to separate the chaotropic agent, and performing an extension reaction to add additional adapters to the partially adapted DNA fragments. This method may be performed away from the flow cell, and then the beads (with the fully adapted DNA fragments bound thereto) may be added to a flow cell containing capture sites (for binding the beads) and primers 36, 36'. The beads can bind to the capture sites and then perfectly matched DNA fragments can be released from the beads and exposed to amplification using primers on the flow cell surface.

[0066] Referring back to FIG. 1C, the sequences obtained from the extension reaction convert the partially matched fragments into fully matched fragments, ready for further amplification and cluster generation.

[0067] In one example of cluster generation, the perfectly matched fragments shown in FIG. 1D are denatured from each other and looped to hybridize to adjacent complementary primers 36, 36', and the polymerase copies the copied template to form a double-stranded bridge, which is denatured to form two single strands. These two strands loop over to hybridize to adjacent complementary primers 36, 36' and extend again to form two new double-stranded loops. This process is repeated for each template copy by cycles of isothermal denaturation and amplification to create a compact clonal cluster. Each cluster of double-stranded bridge structures is denatured. In one example, the reverse strand is removed (e.g., specific base cleavage) by a cleavage agent appropriate to the cleavage site of the primer 36 or 36' to which the reverse strand is bound, leaving the forward template strand / amplicon. In another example, the forward strand is removed (e.g., specific base cleavage) by a cleavage agent appropriate to the cleavage site of primer 36 or 36' to which the forward strand binds, leaving the reverse template strand / amplicon. Clustering results in the formation of several template strands immobilized on recess 12.

[0068] Since several of each of the transposome complexes 10, 10' may be present within a single recess 12 of the flow cell, multiple perfectly matched fragments may be present within a single recess 12 after tagmentation and extension. Amplification of multiple perfectly matched fragments may result in polyclonality within the recess 12 (i.e., multiple amplicons of each perfectly matched fragment), which may make signal resolution of any one type of amplicon more difficult. In some of the examples disclosed herein, the transposome complexes 10 and / or 10' are modified to reduce the tagmentation efficiency of the complexes 10 and / or 10'. These modifications may render some of the transposome complexes 10 and / or 10' within one or more recesses 12 across the flow cell completely unable to participate in tagmentation, thus increasing the insert size of the DNA fragments generated and may also reduce the number of perfectly matched fragments within a given recess 12.

[0069] Some of the transposome complexes 10 and / or 10' modifications are performed at the 3' end of the non-transferred strand 20, 20'.

[0070] In one example, the modification to reduce tagmentation efficiency is a fluorophore attached to the 3' end of the non-transferred strand 20, 20' of i) part of the first transposome complex 10, or ii) part of the second transposome complex 10', or iii) part of both the first and second transposome complexes 10, 10'. Examples of suitable fluorophores include the ALEXA FLUOR® family of fluorophores available from Molecular Probes, Inc. (e.g., ALEXA FLUOR® 647, etc.), TET™ Dye Phosphoramidite available from Thermo Fisher Scientific, etc. The fluorophore can be added to the 3' end of the non-transferred strand 20, 20' during its synthesis and before the transposome complexes 10 and / or 10' are bound to the flow cell surface. This modification partially inactivates the transposome complex 10 or 10', which results in fewer tagmentation events or in DNA sample binding but no tagmentation.

[0071] Others of the transposome complexes 10 and / or 10' modifications are made at the 5' end of the non-transferred strand 20, 20'.

[0072] In one example, a modification to reduce tagmentation efficiency is the elimination of a phosphate group at the 5' end of the non-transferred strand 20, 20' of i) part of the first transposome complex 10, or ii) part of the second transposome complex 10', or iii) part of both the first and second transposome complexes 10, 10'. The non-transferred strand 20, 20' can be synthesized without a 5' phosphate. This modification partially inactivates the transposome complex 10 or 10', which results in fewer tagmentation events or results in DNA sample binding but no tagmentation.

[0073] In another example, the modification to reduce tagmentation efficiency is a fluorophore attached to the 5' end of the non-transferred strand 20, 20' of i) part of the first transposome complex 10, or ii) part of the second transposome complex 10', or iii) part of both the first and second transposome complexes 10, 10'. The fluorophore may be added to the 5' end of the non-transferred strand 20, 20' during the production of the transposome complex 10, 10'.

[0074] In yet another example, the modification to reduce tagmentation efficiency comprises altering or removing the last one or more bases from the 5' end of the non-transferred strand 20, 20' of i) a portion of the first transposome complex 10, or ii) a portion of the second transposome complex 10', or iii) a portion of both the first and second transposome complexes 10, 10'. By way of example, the 5' terminal bases CAT or CAC may reduce tagmentation efficiency, e.g., compared to CAG.

[0075] Yet another of the transposome complexes 10 and / or 10' modifications is performed at the 3' end of the transferred strand 18, 18'. One example of this modification to reduce tagmentation efficiency is a dideoxycytosine, thymine, or cytosine attached to the 3' end of the transferred strand 18, 18', i) part of the first transposome complex 10, or ii) part of the second transposome complex 10', or iii) part of both the first and second transposome complexes 10, 10'. The presence of dideoxycytosine at the 3' end of the transferred strand 18 and / or 18' completely inactivates the transposome complex 10 or 10', which results in DNA sample binding but not tagmentation. The inclusion of thymine or cytosine at the 3' end of the transferred strand 18 and / or 18' reduces the efficiency of tagmentation.

[0076] Additionally, any of the modifications that may be performed at the 5' end of the non-transferred strand(s) 20, 20' may be combined with any of the modifications that may be performed at the 3' end of the non-transferred strand(s) 20, 20' or any of the modifications that may be performed at the 3' end of the transferred strand 18, 18'. Additionally, any of the modifications that may be performed at the 3' end of the non-transferred strand 20, 20' may be combined with any of the modifications that may be performed at the 3' end of the transferred strand 18, 18'.

[0077] 13A, 13B, 13C, and 13D show other examples of transposome complexes 10A, 10B as disclosed herein immobilized within a flow cell recess 12.

[0078] An example of each of the transposome complexes 10A, 10B is shown in more detail in Figures 14A and 14B, respectively. As shown, each complex 10A, 10B includes a transposase enzyme 14A, 14B non-covalently bound to a transposon end 16A, 16B. Each transposon end 16A, 16B is a double-stranded nucleic acid strand, one strand 30A, 30B of which is part of a transferred strand 18A, 18B and the other strand 32A, 32B of which is part of a non-transferred strand 20A, 20B. In other words, the transposon end 16A, 16B includes a portion of the transferred strand 18A, 18B (strand 30A, 30B) that is hybridized to a portion of the non-transferred strand 20A, 20B (e.g., strand 32A, 32B).

[0079] In this example of transposome complex 10A, transferred strand 18A includes a first amplification domain 26A and a sequencing primer sequence 28A attached to one strand 30A of transposon end 16A. Strand 30A of transposon end 16A is located at the 3' end of transferred strand 18A.

[0080] Similar to transferred strand 18A, transferred strand 18B of transposome complex 10B includes a second amplification domain 26B and a sequencing primer sequence 28B attached to one strand 30B of transposon end 16B. Strand 30B of transposon end 16B is located at the 3' end of transferred strand 18B.

[0081] Similar to the first and second amplification domains 26, 26' of the transposome complexes 10, 10', the first and second amplification domains 26A, 26B of the transposome complexes 10A, 10B have sequences different from each other, but identical to the sequences of the first and second primers 36A, 36B, respectively, bound to the polymer hydrogels 24, 24' (which may be biotinylated, as described below). The first amplification domain 26A and primer 36A, together with the second amplification domain 26B and primer 36B, allow amplification of the DNA sample fragments generated during tagmentation. Any of the sequences described herein for the first amplification domain 26 / primer 36 and the second amplification domain 26' / primer 36' may be used for the first amplification domain 26A / primer 36A and the second amplification domain 26B / primer 36B, respectively.

[0082] Similar to sequencing primer sequences 28, 28', sequencing primer sequences 28A, 28B have different sequences that each bind to a sequencing primer introduced into the flow cell after tagmentation and amplification.

[0083] Transposon end 16A, 16B of each transposome complex 10A, 10B comprises strand 30A, 30B hybridized to strand 32A, 32B, respectively. Thus, strands 30A and 32A are complementary, and strands 30B, 32B are complementary. Double-stranded transposon end 16A, 16B can form a complex with transposase 14A, 14B, respectively. By way of example, strands 30A, 32A and 30B, 32B of transposon ends 16A, 16B can be related but non-identical 19 base pair (bp) outer end (e.g., strands 30, 30') and inner end (e.g., strands 32, 32') sequences that function as substrates for Tn5 transposase activity, or mosaic ends recognized by wild-type or mutant Tn5 transposase, or the R1 ends (e.g., strands 30, 30') and R2 ends (strands 32, 32') recognized by MuA transposase.

[0084] The transposome complexes 10A, 10B are configured for asymmetric binding to the flow cell surface (as shown in FIG. 13A). Thus, one of the complexes, e.g., complex 10A, includes a 3′ end group 22A for binding to the flow cell surface, and the other of the complexes, e.g., complex 10B, includes a 5′ end group 22B for binding to the flow cell surface. Thus, as shown in FIGS. 13A, 14A, and 14B, the non-transferred strand 20A of complex 10A includes a 3′ end group 22A, and the transferred strand 18B of complex 10B includes a 5′ end group 22B. The 3′ end group 22A and the 5′ end group 22B may be any functional group that can be covalently or non-covalently bound directly or indirectly to the surface functional groups of the polymer hydrogel 24, 24′, and thus depends on the surface functional groups of the polymer hydrogel 24, 24′. In one example, the polymer hydrogel 24 comprises azide or tetrazine surface groups and the 3' and 5' end groups 22A and 22B each comprise a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). In another example, the biotinylated polymer hydrogel 24' resides within the flow cell recess 12 and each of the 3' and 5' end groups 22A and 22B is biotin. In these examples, additional streptavidin or avidin is added to indirectly bind the biotin groups to each other.

[0085] Referring back to FIG. 13A, transposome complexes 10A, 10B can be introduced into a flow cell, which includes recesses 12 separated by gap regions 38 and examples of polymer hydrogels 24 or 24' within recesses 12 (the latter of which are described in detail with reference to FIGS. 2A and 2B).

[0086] The transposome complexes 10A, 10B may also be included in a carrier liquid at a concentration ranging from about 0.1 μM to about 1 μM. The carrier liquid in this example of a transposome complex fluid may be water. If a polymer hydrogel 24 is used, a buffer and / or salt may be added to the carrier liquid to graft the transposome complexes 10A, 10B to the appropriate functional groups of the polymer hydrogel 24. The buffer has a pH ranging from 5 to 12. Any of the neutral buffers and / or salts described herein may be added to this example of a transposome complex fluid.

[0087] For grafting, the transposome complex fluid is introduced into the flow cell. The transposome complex fluid can be introduced using flow-through deposition. Grafting can be carried out at a temperature ranging from about 35° C. to about 45° C. for a time ranging from about 30 hours to about 120 hours. During grafting, the transposome complexes 10A, 10B bind to at least a portion of the azide or tetrazine groups of the polymer hydrogel 24 and have no affinity for the interstitial region 38 or edge portion of the flow cell.

[0088] When a biotinylated polymer hydrogel 24' is used, binding of the transposome complexes 10A, 10B to the flow cell surface can be performed using any of the examples described in more detail herein with reference to Figures 2A-5. Briefly, it should be understood that avidin or streptavidin can be used to bind the 3' and 5' ends 22A, 22B (which in this example are biotinylated) to the biotinylated polymer hydrogel 24' as described in the "Flow Cell" section herein. As examples, avidin or streptavidin may be pre-bound to the 3' and 5' biotinylated ends 22A, 22B before the complexes 10A, 10B are introduced to the flow cell and incubated; avidin or streptavidin may be introduced to the flow cell with the 3' and 5' biotinylated transposome complexes 10A, 10B and incubated; avidin or streptavidin may be introduced to the flow cell and incubated with the polymer hydrogel 24, and then the 3' and 5' biotinylated transposome complexes 10A, 10B are added and incubated; or avidin or streptavidin and biotin may be pre-bound to each other and then introduced to the flow cell where the biotin is reacted with the R A The biotinylated transposome complexes 10A, 10B may then be coupled via some of the groups (directly or via a linker) to the surface of a polymer hydrogel 24, and the biotinylated transposome complexes 10A, 10B may then be introduced into a flow cell that contains a streptavidin-biotin binding pair as part of the polymer hydrogel 24'. As noted above, further details of each of these methods are described herein with reference to Figures 2-5.

[0089] The flow cell shown in Figure 13A also includes primers 36A, 36B. Any of the primers 36, 36' and suitable attachment mechanisms for primers 36, 36' to polymer hydrogel 24 or 24' described herein can be used for primers 36A, 36B.

[0090] In this example, a plurality of first transposome complexes (e.g., transposome complex 10A, which may be referred to herein as 3'-linked transposome complex 10A) and a plurality of second transposome complexes (e.g., transposome complex 10B, which may be referred to herein as 5'-linked transposome complex 10B) are present in the flow cell at a ratio ranging from greater than 1:1 to 5:1. In another example, 3'-biotinylated transposome complex 10A and 5'-biotinylated transposome complex 10B are introduced into the flow cell at a ratio of 4:1. As described in more detail with reference to Figures 13C and 13D, asymmetrically linked complexes 10A, 10B introduced to the flow cell surface and thus present on the flow cell surface at a ratio within a given range may improve the pass filter percentage.

[0091] 13B shows recess 12 after a DNA sample has been introduced. The DNA sample may be introduced along with a tagmentation buffer, which may include water, optionally a co-solvent (e.g., dimethylformamide), a metal cofactor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate, pH 7.6). In one example, the optional co-solvent may be present in an amount up to about 11%, the metal cofactor may be present at a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present at a concentration ranging from about 7 mM to about 12 mM.

[0092] When a DNA sample (shown fragmented with reference number 34) is introduced into a flow cell containing 3' and 5' linked transposome complexes 10A, 10B, the DNA sample is fragmented and the 5' ends of both strands 35, 37 of the double stranded fragment 34 are ligated to the 3' ends of each of the transferred strands 18A, 18B of the transposome complexes 10A, 10B. The fragmentation and ligation can occur at a temperature of 30°C or higher. In one example, the temperature can range from about 30°C to about 55°C. In another example, the temperature can range from about 35°C to about 45°C. The 3' end of the double stranded fragment 34 is not ligated to the 5' ends of the non-transferred strands 20A, 20B. Thus, there is a gap 39A between the 3' end of DNA fragment strand 37 and the 5' end of non-transferred strand 20A, and there is a gap 39B between the 3' end of DNA fragment strand 35 and the 5' end of non-transferred strand 20B. In one example, each gap 39A, 39B is 9 base pairs long.

[0093] The transposases 14A, 14B are then removed from the complexes 10A, 10B, where the complexes 10A, 10B bind to the fragments 35, 37 via the transferred strands 18A, 18B. The transposase removal 14A, 14B can be achieved by heating the flow cell. In this example, a wash solution is introduced into the flow cell. The flow cell containing the wash solution is heated to about 60° C., and then an extension amplification mix is ​​introduced into the flow cell. The temperature may be reduced to about 38° C. prior to the introduction of the extension amplification mix.

[0094] An extension mix is ​​then added to form fully extended fragments with adapters at both ends. Two examples of extension reactions are shown in Figures 13C and 13D. In both examples, extension of fragments 35, 37 involves the addition of nucleotides in a template-dependent manner from the 3' ends of DNA fragments 35, 37. Figure 13C shows extension when at least a portion of strands 18A, 20A and 18B, 20B remain hybridized after transposase removal 14A, 14B. In this example, the extension reaction displaces non-transferred strands 20A, 20B and allows transferred strands 18A, 18B to be copied, thus forming fully extended (perfectly matched) fragments (similar to the example shown in Figure ID). Figure 13D shows extension when at least a portion of strands 18A, 20A and 18B, 20B dehybridize during transposase removal 14A, 14B. Since the non-transferred strands 20A, 20B are relatively short, their melting temperature may be low (e.g., about 40°C to about 50°C). Thus, the transposase removal temperature may be sufficient to dehybridize at least a portion of the transposon ends. In contrast, the longer fragments 35, 37 may remain hybridized. It should be understood that the longer fragments 35, 37 may dehybridize at regions with lower melting temperatures (e.g., AT-rich regions), but the overall insert size includes regions with higher melting temperatures that do not dehybridize. These regions keep the longer double-stranded fragments 35, 37 from scattering. If the transposase removal temperature is increased above 60°C, the insert size may shift, which may result in dehybridization of some of the double-stranded fragments 35, 37.

[0095] In other examples, transposase removal 14A, 14B is accomplished using sodium dodecyl sulfate (SDS) or proteinase, followed by the introduction of a wash solution, dehybridization of the non-transferred strand 20B, and an extension amplification reaction.

[0096] It should be understood that in any of the embodiments disclosed herein, random tagmentation can be performed during the tagmentation process. By "random tagmentation" is meant that the 5' ends of both strands of a double-stranded fragment are ligated to the 3' end of each of the same type of transposome complexes 10A or 10B (or 10 or 10'). An example of random tagmentation is shown in FIG. 13B, where each of strands 35', 37' is ligated to the 3' end of the transferred strand 18A (of complex 10A). After the extension amplification reaction, these perfectly matched fragments have the same amplification domain 26A at both ends (e.g., the original transferred strand 18A and the complementary portion). Although not shown, it should be understood that both strands of a double-stranded fragment can alternatively be ligated to the 3' end of each of the transferred strands 18B (of complex 10B). After the extension reaction, these perfectly matched fragments have identical amplification domains 26B at both ends (eg, in the original transferred strand 18B and the complementary section).

[0097] Perfectly matched fragments with identical amplification domains 26A or 26B at both ends can reduce the percentage of reads that can pass the filter. However, asymmetric binding of transposome complexes 10A, 10B and the ratio of 3'-linked transposome complexes 10A to 5'-linked transposome complexes 10B produces a higher yield of perfectly matched fragments with different amplification domains 26A, 26B at their ends.

[0098] Flow Cell As disclosed herein, the transposome complexes 10, 10', 10A, 10B, 10C, 10D, whether modified or unmodified, are immobilized on a flow cell surface. As shown in Figures 1A-1D, in one example, the transposome complexes 10, 10' are bound to a polymer hydrogel 24 in a recess 12 of a flow cell. As shown in Figures 13A-13D, in another example, the transposome complexes 10A, 10B are asymmetrically bound to a polymer hydrogel 24, 24' in a recess 12 of a flow cell. Although the recesses 12 are shown in each of these examples, it should be understood that multiple recesses 12 may be formed in an array across a substrate surface as described herein.

[0099] Each example of a flow cell disclosed herein includes a substrate 40 having recesses 12 separated by interstitial regions 38 (see FIGS. 1A-1D) and a polymer hydrogel 24 within the recesses 12. Substrates of this type may be referred to as patterned substrates, and the flow cell may include two patterned substrates bonded together or may include a single patterned substrate bonded to a lid.

[0100] The flow channel is defined between the substrate(s) and the lid. The depth of the flow channel 12 can be as thick as a monolayer when microcontact, aerosol, or inkjet printing is used to deposit material to bond the substrate(s) and the lid. In other examples, the depth of the flow channel can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth can range from about 10 μm to about 100 μm. In another example, the depth can range from about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of the flow channel can be greater than, less than, or between the values ​​specified above.

[0101] Each flow path is in fluid communication with an inlet and an outlet (not shown), which may be located at opposite ends of the flow cell. The inlet and outlet of each flow path may be located anywhere along the length and width of the flow path that allows for the desired fluid flow.

[0102] The inlets allow fluids to be introduced into the flow paths, and the outlets allow fluids to be withdrawn from the flow paths, each of which is fluidly connected to a fluid control system (including, for example, reservoirs, pumps, valves, waste containers, etc.) that controls the introduction and removal of fluids.

[0103] Substrate 40 may be a single layer base support having recesses 12 defined therein, or it may be a multi-layer structure including other layers disposed thereon and having recesses 12 defined therein.

[0104] Examples of suitable single layer base supports include epoxy siloxanes, glass, modified or functionalized glass, plastics (including acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, etc.), nylon (polyamide), ceramics / ceramic oxides, silica, fused silica, silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metals, and inorganic glasses.

[0105] An example of a multi-layer structure includes a base support and at least one other layer on the base support.

[0106] The other layers may be inorganic oxides such as tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), etc. The inorganic oxides may be selectively applied, for example, via vapor deposition, aerosol printing, or inkjet printing, to form the recesses 12 and interstitial regions 38.

[0107] Alternatively, the other layer may be a polymeric resin that can be applied to the base support and then patterned. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins, non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opening epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, paddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, and the like.

[0108] In one example, substrate 40 may be a circular sheet, panel, wafer, die, etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or may be a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). Although example dimensions have been provided, it should be understood that substrate 40 having any suitable dimensions may be used.

[0109] The recesses 12 may be formed in the substrate 40 using any suitable patterning technique, such as photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, and the like.

[0110] Many different layouts of the recesses 12 and interstitial regions 38 can be envisioned, including regular, repeating, and non-regular patterns. In one example, the recesses 12 or interstitial regions 38 are arranged to create a hexagonal grid to pack closely together and improve density. Other layouts may include, for example, rectangular layouts, triangular layouts, and the like. In some examples, the layout or pattern may be an xy format with rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of the recesses 12 and interstitial regions 38. In yet other examples, the layout or pattern may be a random arrangement of the recesses 12 and interstitial regions 38.

[0111] The layout or pattern can be characterized in terms of the density (number) of the recesses 12 within a defined area. For example, the recesses 12 may be spaced apart from each other by 1 mm 2 For example, the number of nuclei may be approximately 2 million per mm. 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1 mm 2 Approximately 5 million per mm 2 Approximately 10 million per mm 2The density can be adjusted to different densities, including densities of about 50 million per unit area, or more or less than that. It should be further understood that the density can be between one of the lower values ​​and one of the upper values ​​selected from the ranges above, or other densities (outside the given ranges) can be used. As an example, a high density array can be characterized as having a plurality of recesses 12 separated by less than about 100 nm, a medium density array can be characterized as having a plurality of recesses 12 separated by about 400 nm to about 1 μm, and a low density array can be characterized as having a plurality of recesses 12 separated by more than about 1 μm.

[0112] The layout or pattern of the plurality of recesses 12 may additionally or alternatively be characterized in terms of the average pitch, or the spacing from the center of one recess 12 to the center of an adjacent recess 12 (center-to-center spacing), or the spacing from the right edge of one recess 12 to the left edge of an adjacent recess 12 (edge-to-edge spacing). The pattern may be regular such that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.15 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm, or more or less. The average pitch of a particular pattern may be between one of the lower values ​​and one of the upper values ​​selected from the ranges above. In one example, the recesses 12 have a pitch (center-to-center spacing) of about 1.5 μm. Although examples of average pitch values ​​have been provided, it is understood that other average pitch values ​​may also be used.

[0113] The size of each recess 12 may be characterized by its volume, opening area, depth, and / or diameter (if recess 12 is circular), or length and width. For example, the volume may be about 1×10 -3 μm 3 ~about 100μm 3 For example, about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm3 , about 10μm 3 In another example, the opening area is about 1×10 -3 μm 2 ~about 100μm 2 For example, about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 In yet another example, the depth may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. In another example, the depth may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. In yet another example, the diameter or each of the length and width may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0114] The substrate 40 may include an edge region that extends the length of the channels and defines a gap-like region that separates one channel from an adjacent channel. The edge region provides a bonding area where two substrates 40 may be attached to one another or where one substrate 40 may be attached to a lid.

[0115] The recesses 12 provide designated areas for polymer hydrogel 24. In one example disclosed herein, the polymer hydrogel 24 comprises an acrylamide copolymer. In this example, the acrylamide copolymer has the following structure:

[0116] [ka]

[0117] During the ceremony, R A is an azide, or a tetrazine, or any other functional group that can be attached to an alkyne, RB is H or optionally substituted alkyl; R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally substituted, p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0118] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM).

[0119] One of ordinary skill in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative, and that the monomer subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0120] The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a particular example, may be about 312 kDa.

[0121] In some instances, the acrylamide copolymer is a linear polymer, hi other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0122] In some examples, the gel material can be a variation of structure (I). In one example, the acrylamide unit is N,N-dimethylacrylamide.

[0123] [ka]

[0124] In another embodiment, the acrylamide unit in structure (I) may be replaced by:

[0125] [ka]

[0126] where R D , R E , and R F are each H or C1-C6 alkyl, R G , and R H are each C1-C6 alkyl (not H as in acrylamide). In this example, q can be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can be used. In this example, structure (I) contains, in addition to the repeating "n" and "m" features,

[0127] [ka]

[0128] wherein R D , R E , and R F are each H or C1-C6 alkyl, R G and R H is each C1 to C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0129] As another example of a polymer hydrogel, the "n" repeating features in structure (I) can be replaced with a heterocyclic azide group-containing monomer having structure (II):

[0130] [ka]

[0131] In the formula, R1 is H or C1-C6 alkyl, R2 is H or C1-C6 alkyl, L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon atoms and any nitrogen atoms in the chain, E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon atoms and any nitrogen atoms in the chain, A is an N-substituted amide with H or C1-C4 alkyl attached to the N, and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0132] As yet another example, the gel material may include repeat units of each of structures (III) and (IV):

[0133] [ka]

[0134] In the formula, R 1a , R 2a , R 1b and R 2b each is independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; 3a and R 3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; L 1 and L 2 Each of is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0135] In some examples, the polymer hydrogel 24 is biotinylated. In these examples, the biotin is AThe biotin is attached to the surface of the polymer hydrogel 24 via some of the functional groups (i.e., azide, tetrazine, or other functional groups that can be attached to an alkyne). A The linker is linked to a linker, such as bicyclo[6.1.0]nonyne (BCN), which can be covalently attached to a portion of the group. The combination of biotin and the linker is one example of a biotin-containing linker, shown at least in Figures 2A and 2B as reference numeral 42.

[0136] In another example, streptavidin and biotin are conjugated to each other, and biotin is R A The biotin is attached to the surface of the polymer hydrogel 24 via some of the functional groups (i.e., azide, tetrazine, or other functional groups that can be attached to an alkyne). A The linker may be linked to a linker, such as bicyclo[6.1.0]nonyne (BCN), which can be covalently attached to a portion of the group. In this example, the biotin-containing linker includes a linker, biotin, and streptavidin.

[0137] In yet another example, a bicyclo[6.1.0]nonyne (BCN) linker is included in the R A In these examples, the biotin can be added after the polymer hydrogel 24 is applied to the recesses 12.

[0138] To introduce the polymer hydrogel 24 into the recesses 12, a mixture of the polymer hydrogel 24 can be generated and then applied to the substrate 40. In one example, the polymer hydrogel 24 can be in a mixture (e.g., with water, or with ethanol and water). The mixture can then be applied to the substrate surface using spin coating, or immersion or dip coating, or flow of material under positive or negative pressure, or other suitable techniques. These types of techniques deposit the polymer hydrogel 24 into the recesses 12 and over the gap regions 38. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to deposit the polymer hydrogel 24 specifically into the recesses 12 and not over the gap regions 38.

[0139] In some examples, the substrate 40 may be activated and then the mixture (including the polymer hydrogel 24) may be applied to the substrate surface. In one example, a silane or silane derivative (e.g., norbornene silane) may be deposited on the surface of the substrate 40 using vapor deposition, spin coating, or other deposition methods. In another example, the substrate 40 may be exposed to plasma ashing to generate surface-activating agent(s) (e.g., -OH groups) that can bond to the polymer hydrogel 24.

[0140] The applied mixture may be exposed to a curing process to harden the polymer hydrogel 24. In one example, curing can occur at a temperature ranging from room temperature (e.g., about 25° C.) to about 95° C. for a time ranging from about 1 millisecond to about several days.

[0141] In some examples, polishing may then be performed to remove the polymer hydrogel 24 from the gap regions 38 while leaving the polymer hydrogel 24 in the recesses 12 at least substantially intact. The polishing process may be performed using a chemical slurry (e.g., including abrasives, buffers, chelating agents, surfactants, and / or dispersants) that can remove the polymer hydrogel 24, 26 from the gap regions 38 without adversely affecting the underlying substrate in those regions 38. Alternatively, polishing may be performed with a solution that does not include abrasive particles.

[0142] The chemical slurry may be used in a chemical mechanical polishing system to polish the surface of the gap region 38. The polishing head(s) / pad(s) or other polishing tool(s) may polish the polymer hydrogel 24 that may be present on the gap region 38 while leaving the polymer hydrogel 24 at least substantially intact within the recesses 12. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head.

[0143] A cleaning and drying process may be performed after polishing. The cleaning process may utilize a water bath and sonication. The water bath may be maintained at a relatively low temperature, ranging from about 22° C. to about 30° C. The drying process may involve drying via spin drying or another suitable technique.

[0144] Each example of a flow cell also includes a primer 36, 36' and a transposome complex 10, 10'. The primer 36, 36' includes any two of the primer sequences described herein for the first and second amplification domains 26, 26'. The 5' end of the primer 36, 36' varies depending on the chemistry of the polymer hydrogel 24. With reference to Figures 1A, 2A, 2B, 3A, 3B, 4, and 5, different examples of how the primer 36, 36' and the transposome complex 10, 10' may be combined within a flow cell are described.

[0145] 1A, both primers 36, 36' and both transposome complexes 10, 10' are bound to a polymer hydrogel 24 within recess 12. In one example, the 5' ends of primers 36, 36' and transposome complexes 10, 10' include functional groups that can covalently bond to azide and / or tetrazine functional groups of polymer hydrogel 24. By way of example, 5' terminal functional group 22, 22' may be a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)).

[0146] The primers 36, 36' may be included in the carrier liquid at a concentration ranging from about 0.5 μM to about 100 μM. In one example, the primer concentration ranges from about 5 μM to about 25 μM.

[0147] The carrier liquid of the primer fluid may be water. Buffers and / or salts may be added to the carrier liquid to graft the primers 36, 36' to the appropriate functional groups of the polymer hydrogel 28. The buffers have a pH in the range of 5-12, and the buffer used depends on the alkyne at the 5' end of the primers 36, 36'. Neutral buffers and / or salts may be added to the primer fluid for grafting BCN-terminated primers, while alkaline buffers may be added to the primer fluid for copper-assisted grafting methods (e.g., click reactions). Any of the primer fluids used in copper-assisted grafting methods may contain a copper catalyst. Examples of neutral buffers include tris(hydroxymethyl)aminomethane (Tris or TRIS) buffers, such as Tris-HCl, or Tris-EDTA, or carbonate buffers (e.g., 0.25M to 1M). Sodium sulfate (e.g., 1M to 2M) is a suitable salt that may be used. Examples of alkaline buffers include tris(hydroxymethyl)aminomethane (CHES), 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS), and alkaline buffer (Sigma-Aldrich).

[0148] For grafting, a primer fluid is introduced into the flow cell. The primer fluid may be introduced using flow-through deposition. Grafting can be carried out at a temperature ranging from about 55° C. to about 65° C. for a time ranging from about 20 hours to about 60 hours. In one example, grafting is carried out at 60° C. for about 30 minutes or 60 minutes. It should be understood that lower temperatures and longer times, or higher temperatures and shorter times, may also be used. Some primer grafting techniques, such as those involving BCN grafting to tetrazine units, may be carried out at room temperature (e.g., 18° C. to about 25° C.). During grafting, the primer 36, 36' binds to at least a portion of the azide or tetrazine groups of the polymer hydrogel 24 and has no affinity for the gap region 38 or the edge portion of the flow cell.

[0149] The transposome complexes 10, 10' may also be contained in a carrier liquid at a concentration ranging from about 0.1 μM to about 1 μM.

[0150] The carrier liquid of the transposome complex fluid may be water. Buffers and / or salts may be added to the carrier liquid to graft the transposome complexes 10, 10' to the appropriate functional groups of the polymer hydrogel 24. The buffer has a pH in the range of 5-12. Any of the neutral buffers and / or salts described herein may be added to the transposome complex fluid.

[0151] For grafting, the transposome complex fluid is introduced into the flow cell. The transposome complex fluid can be introduced using flow-through deposition. Grafting can be carried out at a temperature ranging from about 35° C. to about 45° C. for a time ranging from about 30 hours to about 120 hours. In one example, grafting is carried out at 37° C. for about 90 minutes or 120 minutes. During grafting, the transposome complex 10, 10′ binds to at least a portion of the azide or tetrazine groups of the polymer hydrogel 24 and has no affinity for the interstitial region 38 or the edge portion of the flow cell.

[0152] As shown in Figure 1A, the separate transposome complexes 10, 10' form dimers in solution, and these dimers bind to a polymer hydrogel 24. It should be understood that Figures 1B-1C show one transposome complex 10 from one dimer and one transposome complex 10' from another dimer for simplicity and ease of illustration.

[0153] Grafting of the transposome complexes 10, 10' can be performed during flow cell fabrication. Alternatively, the transposome complex fluid may be contained in a reagent cartridge and grafting of the transposome complexes 10, 10' may be performed on the sequencing instrument prior to sample preparation.

[0154] Similar to Figure 1A, Figures 2A and 2B show both primers 36, 36' and transposome complexes 10, 10' bound to polymer hydrogel 24 within recess 12. The binding mechanism in Figures 2A and 2B utilizes non-covalent interactions between biotin and streptavidin.

[0155] In the example shown in Figures 2A and 2B, the polymer hydrogel 24 is biotinylated. The biotinylated polymer hydrogel 24' contains a biotin-containing linker 42 grafted to the surface of the polymer hydrogel 24. The biotinylated polymer hydrogel 24' can be prepared by grafting bicyclononyne-biotin (BCN-biotin) to some of the terminal azide or tetrazine groups of the polymer hydrogel 24. The biotin-containing linker 42 can be grafted to the polymer hydrogel 24 before the polymer hydrogel 24 is added to the flow cell surface or after the polymer hydrogel 24 is added to the flow cell surface.

[0156] In one exemplary method, the polymer hydrogel 24 is applied to the recess 12 as described with reference to FIG. 1A, and then the biotin-containing linker 42 is grafted onto the surface of the polymer hydrogel 24. In this example, the biotin-containing linker 42 may be added to a carrier fluid (e.g., a neutral buffer and / or water containing salt as described herein) and the fluid may be introduced into the flow cell and incubated. The grafting reaction may be carried out at a temperature ranging from about 50° C. to about 70° C. for a time ranging from about 30 hours to about 120 hours. In one example, the grafting of the biotin-containing linker 42 is carried out at 60° C. for about 120 minutes. During grafting, the biotin-containing linker 42 binds to at least a portion of the azide or tetrazine groups of the polymer hydrogel 24 and has no affinity for the interstitial region 38 or the edge portion of the flow cell. Once grafted, the biotin 44 of the biotin-containing linker 42 is on the surface and therefore available for interaction with the subsequently introduced streptavidin 46 .

[0157] In the example shown in Figure 2A, primers 36, 36' are grafted to the terminal azide or other of some of the tetrazine groups of the biotinylated polymer hydrogel 24'. Primer grafting can be performed as described herein with reference to Figure 1A.

[0158] It should be understood that the transposome complexes 10, 10' used in the example shown in Figure 2A contain biotin as a 5' terminal functional group 22, 22'. Thus, the transferred strands 18, 18' of these exemplary transposome complexes 10, 10' contain a 5' biotinylated end.

[0159] In one example, these biotinylated transposome complexes 10, 10' are introduced into a flow cell that includes recesses 12 separated by gap regions 38 and biotinylated polymer hydrogels 24' within the recesses 12. The exemplary method also includes the steps of introducing streptavidin 46 into the flow cell and incubating the transposome complexes 10, 10' and the streptavidin 46 in the flow cell, whereby the streptavidin 46 binds the 5' biotinylated ends 22, 22' of at least some of the transposome complexes 10, 10' to the biotinylated polymer hydrogel 24', respectively. Incubation of the transposome complexes 10, 10' and the streptavidin 46 in the flow cell may be performed at room temperature (e.g., about 18°C ​​to about 25°C) for a time period ranging from about 15 minutes to about 60 minutes. In one example, this incubation is carried out at about 22° C. for about 30 minutes.

[0160] In this example, transposome complexes 10, 10' and streptavidin 46 may be added in a weight ratio ranging from about 1:1 to about 1:2 such that a sufficient amount of streptavidin is present to graft transposome complexes 10, 10' to the biotin-containing linker 42.

[0161] As shown in FIG. 2A, streptavidin 46 interacts with biotin on the surface of the biotinylated polymer hydrogel 24' and interacts with the 5'-terminal biotin functional groups 22, 22'.

[0162] The example shown in Figure 2B is similar to the example shown in Figure 2A, except that primers 36, 36' are also biotinylated. Instead of the 5' end of primers 36, 36' containing an alkyne, the 5' end contains biotin 44'. These primers 36, 36' are referred to as biotinylated primers.

[0163] In this example, the biotinylated transposome complex (i.e., complex 10, 10', having a 5'-terminal biotin functional group 22, 22') and the biotinylated primer (i.e., primer 36, 36', having a 5'-terminal biotin) are each bound to the biotin-containing linker 42 of the biotinylated polymer hydrogel 24'. In this example, streptavidin 46 is introduced into the flow cell together with the biotinylated transposome complex to achieve the desired biotin 44-streptavidin 46-biotin 22, 22' interaction, and streptavidin 46 is introduced into the flow cell together with the biotinylated primer to achieve the desired biotin 44-streptavidin 46-biotin 44' interaction. Thus, in this example, the first and second biotinylated primers (36, 36' and 44') are immobilized to the biotinylated polymer hydrogel 24' via streptavidin 46. The first biotinylated transposome (10' having a biotin 5' end functional group 22) is immobilized to the biotinylated polymer hydrogel 24' via streptavidin 46, and the second biotinylated transposome complex (10' having a biotin 5' end functional group 22') is immobilized to the biotinylated polymer hydrogel 24' via streptavidin 46.

[0164] Since the biotin-streptavidin interaction is reversible, the example flow cell shown in FIG. 2B may be reusable. For example, after DNA sample tagmentation, fragment amplification, clustering, and sequencing, a biotin-streptavidin cleavage composition can be introduced into the flow cell. Examples of biotin-streptavidin cleavage compositions include about 95% formamide and about 10 mM ethylenediaminetetraacetic acid (EDTA), or about 10% to about 50% by volume of formamide reagent, with the remainder being salt buffer. At the appropriate reaction temperature, these cleavage compositions disrupt the biotin-streptavidin interaction, thus releasing the bound biotin 22, 22', 44' (e.g., DNA fragments, nascent strands, etc.). Alternatively, a heat wash with biotin and / or desthiobiotin allows newly added biotin and / or desthiobiotin to compete with already bound biotin.

[0165] Thus, the example shown in FIG. 2B is a reusable flow cell comprising a substrate 40 including recesses 12 separated by gap regions 38, a biotinylated polymer hydrogel 24' within the recesses 12, first and second biotinylated primers (36, 36' and 44') immobilized within the recesses 12, a first biotinylated transposome complex (10' having a biotin 5' end functional group 22) immobilized within the recesses 12, the first biotinylated transposome complex comprising a first amplification domain 26, and a second biotinylated transposome complex (10' having a biotin 5' end functional group 22') immobilized within the recesses 12, the second biotinylated transposome complex comprising a second amplification domain 26'.

[0166] In other examples, streptavidin 46 may be introduced into the flow cell before the biotinylated transposome complexes 10, 10' are introduced into the flow cell. The streptavidin 46 may be introduced into the flow cell at room temperature, and binding of the streptavidin 46 to the biotin 44 of the polymer hydrogel 24' may occur in less than 30 minutes. The biotinylated transposome complexes 10, 10' may then be introduced into the flow cell and incubated to bind to the preassembled streptavidin 46.

[0167] In yet another example, streptavidin 46 may be mixed with the biotinylated transposome complexes 10, 10' prior to being introduced into the flow cell. The streptavidin 46 and biotinylated transposome complexes 10, 10' may be incubated at room temperature for up to about 30 minutes. This preassembles the streptavidin onto the biotinylated transposome complexes 10, 10'. The streptavidin-biotinylated transposome complexes 10, 10' may then be introduced into the flow cell and incubated to bind to the biotin on the polymer hydrogel 24'.

[0168] In yet another example, streptavidin 46 and biotin 44 are pre-bound to each other to form a streptavidin-biotin binding pair, and then biotin 44 of the streptavidin-biotin binding pair is reacted with R A The biotin 44 of the streptavidin-biotin binding pair is attached to the surface of the polymer hydrogel 24 via some of the functional groups (i.e., azide, tetrazine, or other functional groups capable of binding to an alkyne). A The biotinylated transposome complex 10, 10' may be coupled to a linker, such as bicyclo[6.1.0]nonyne (BCN), which may be covalently attached to part of the group. In this example, the biotinylated transposome complex 10, 10' may be introduced into a flow cell, which contains a streptavidin-biotin binding pair as part of the polymer hydrogel 24'.

[0169] In yet another example, the transposome complex 10, 10' can be fully assembled using biotin-streptavidin-biotin linkers 22, 22', where the biotin is bound to streptavidin 46, which is bound to other biotin 44. In this example, a polymer hydrogel 24 is used that includes surface groups or surface-bound linkers, such as bicyclo[6.1.0]nonyne (BCN), that can bind to the biotin 44 of the fully assembled transposome complex 10, 10'.

[0170] One particular example of a flow cell shown in Figures 1A, 2A, and 2B includes a substrate 40 having recesses 12 separated by a gap region 38, a first and a second primer 36, 36' immobilized in the recesses 12, a first transposome complex 10 immobilized in the recesses 12, the first transposome complex including a first amplification domain 26, and a second transposome complex 10' immobilized in the recesses 12, the second transposome complex 10' including a second amplification domain 26', where i) a portion of the first transposome complex 10, or ii) a portion of the second transposome complex 10', or iii) a portion of both the first and second transposome complexes 10, 10' include a modification to reduce tagmentation efficiency. Any of the transposome complex modifications described herein can be used, and any of the binding mechanisms described with reference to Figures 1A, 2A, and 2B can be used.

[0171] Other examples of flow cells contain transposome complexes 10, 10' bound to a substrate surface in a spatially separated arrangement. Some examples are shown in Figures 3A, 3B, 4, and 5. These examples of flow cells include a substrate 40 having recesses 12 separated by a gap region 38, first and second primers 36, 36' immobilized within the recesses 12, a first transposome complex 10 comprising a first amplification domain 26, and a second transposome complex 10' comprising a second amplification domain 26', where i) the first and second transposome complexes 10, 10' are immobilized in different regions A, B of the recesses 12, respectively (Figures 3A and 3B), or ii) the first and second transposome complexes 10, 10' are immobilized in the recesses 12 and on the gap region 38, respectively (Figure 4), or iii) the first and second transposome complexes 10, 10' are immobilized in different regions C, D of the gap region 38, respectively (Figure 5).

[0172] 3A, the polymer hydrogel 24 includes two regions A and B. A first primer 36 and a first transposome complex 10 are bound to one region A, and a second primer 36' and a second transposome complex 10' are bound to the other region B.

[0173] In one example, the polymer hydrogel 24 is chemically identical across regions A, B, and a suitable technique can be used to immobilize the primers 36, 36' and transposome complexes 10, 10' to each region A, B. For example, the polymer hydrogel 24 across both regions A, B can include azides and / or tetrazines that can be coupled to alkynes (e.g., BCN). One example of a suitable technique can include the use of a photoresist. In this example, the photoresist is developed to mask one region A and add surface chemistry (e.g., primers 36, 36' and transposome complexes 10, 10') to the other region B. The photoresist is then removed and surface chemistry is added to region A under conditions that do not adversely affect region B or its surface chemistry. Another example of a suitable technique can include the use of a sacrificial layer, such as aluminum. In this example, the sacrificial layer is applied to the substrate 40 to mask a portion (e.g., half) of the recess 12. The other portion (e.g., the other half) of the recess 12 remains exposed. The exposed portions of the recesses may be activated, for example, by depositing a suitable silane (e.g., depositing norbornene silane using CVD). In this example, a polymer hydrogel 24, A is applied over the sacrificial layer and over the exposed and activated portions of the recesses 12. The sacrificial layer is then lifted off, thereby removing the overlying polymer hydrogel 24 and exposing the previously covered portions of the recesses 12. The polymer hydrogel 24, A on the other portions of the recesses 12 remains intact. The primer 36 and transposome complexes 10 may then be grafted to the polymer hydrogel 24, A. In one example, the primer 36 grafting includes azide reduction of the polymer hydrogel 24, A, followed by application of an NHS-tetrazine agent, followed by grafting of the BCN-terminated transposome complexes 10 and the BCN-terminated primer 36. The polymer hydrogel 24, A may be exposed to a capping reagent to deactivate any unreacted tetrazine groups. Because substrate 40 has no affinity for primer 36 and composite 10, the exposed portions of recess 12 are unaffected.The substrate 40 can then be activated, for example, by exposure to a solution of norbornene silane. The polymer hydrogel 24, B can then be applied under conditions that do not adversely affect region A or its surface chemistry, for example, under high ionic strength (e.g., in the presence of 10x PBS, NaCl, KCl, etc.). The primer 36' and transposome complexes 10' can be grafted to the polymer hydrogel 24, B. Yet another example of a suitable technique may include pre-grafted primers 36, 36' and transposome complexes 10, 10', and sequentially and selectively applying pre-grafted polymeric material to regions A, B. Although several exemplary methods are provided, it should be understood that any other method may be used to immobilize the primers 36, 36' and transposome complexes 10, 10' to their respective regions A, B.

[0174] In yet another example, the regions A and B of the polymer hydrogel 24 may be chemically different (i.e., orthogonal, such that one region A may graft the primer 36 and the other region B may graft the primer 36'). In one example, a biotinylated polymer hydrogel 24 may be applied as region A and an azide or tetrazine terminated polymer hydrogel 24 may be applied as region B for binding of each primer 36, 36' and transposome complex 10, 10'. In another example, the polymer hydrogel 24 in region A has tetrazine end groups and the polymer hydrogel 24 in region B has alkyne (non-BCN) end groups. In this example, the primer 36 and complex 10 terminated with trans-cyclooctene (TCO) and the primer 36' and complex 10' terminated with picolyl azide may be simultaneously grafted to region A and region B of the polymer hydrogel 24, respectively. In yet another example, the polymer hydrogel 24 in region A has tetrazine end groups and the polymer hydrogel 24 in region B has dibenzocyclooctyne end groups. In this example, a primer 36 and conjugate 10 terminated with trans-cyclooctene (TCO) and a primer 36' and conjugate 10' terminated with picolyl azide can be simultaneously grafted to region A and region B of the polymer hydrogel 24, respectively. Although several examples are provided, it should be understood that any combination of orthogonal chemistries can be used in regions A and B to graft the primers 36 and 36', respectively.

[0175] In the example shown in FIG. 4, the polymer hydrogel 24 includes two regions A, B. In one region A, a first primer 36 and a first transposome complex 10 are bound, and in the other region B, a second primer 36' is bound. In this example, the second transposome complex 10' is bound to the gap region 38. Using the method described with reference to FIG. 3A, the primer 36 and the first transposome complex 10 can be bound to the region A, and the primer 36' can be bound to the region B. In this example, the gap region 38 can selectively have a material 48 added thereto that can bind the second transposome complex 10' thereto. To selectively apply the material 48 onto the gap region 38, a selective deposition technique or a salt exclusion method can be used.

[0176] In the example shown in Figure 5, the polymer hydrogel 24 comprises two regions A, B. In one region A, a first primer 36 is bound, and in the other region B, a second primer 36' is bound. In this example, the first and second transposome complexes 10, 10' are bound to a region of the interstitial region 38. The primer 36 can be bound to region A and the primer 36' to region B using the method described with reference to Figure 3A. The linkers 22, 22' of the transposome complexes 10, 10' can be selected to bind to a material 48 applied to the interstitial region 38 or to the substrate 40 (if no material 48 is used).

[0177] Any of the examples of primers 36, 36' and transposome complexes 10, 10' disclosed herein may be used in the flow cells described with reference to FIGS. 3A, 4 and 5.

[0178] In yet another example, spatially separated arrangement of transposome complexes 10, 10' is achieved using multiple depth recesses 12'. Recesses 12' are shown in FIG. 3B. In addition to allowing spatial separation, the use of this particular recess 12' may also result in increased insert size.

[0179] Multi-depth recess 12' includes a shallow portion 84 and a deep portion 86. The depths of shallow portion 84 and deep portion 86 are within the ranges described herein for recess 12, however, deep portion 86 has a greater depth than shallow portion 84.

[0180] As shown in Figure 3B, polymer hydrogel 24 is applied onto the surfaces within multi-deep recesses 12'. Although not shown in Figure 3B, it should be understood that polymer hydrogel 24 may be conformally coated along all of the surfaces within multi-deep recesses 12', including the bottom and sidewalls, so long as interstitial regions 38 remain free of polymer hydrogel 24. Any of the examples of polymer hydrogel 24 described herein may be used in this example.

[0181] As shown in FIG. 3B, a first primer set (including a cleavable first primer 36C1 and a non-cleavable second primer 36D1) is immobilized on a surface in the shallow portion 84, a first transposome complex 10 is immobilized on a surface in the shallow portion 84, the first transposome complex 10 includes a first amplification domain 26 described herein, a second primer set (a non-cleavable first primer 36C2 and a cleavable second primer 36D2) is immobilized on a surface in the deep portion 86, and a second transposome complex 10' is immobilized on a surface in the deep portion 86, the second transposome complex 10' including a second amplification domain 26'. The cleavable first primer 36C1, the non-cleavable second primer 36D1, the non-cleavable first primer 36C2, and the cleavable second primer 36D2 are described in more detail with reference to FIG. 17. In these examples, the first amplification domain 26 has, for example, the same sequence as the non-cleavable first primer 36C2 and the cleavable first primer 36C1, and the second amplification domain 26 has, for example, the same sequence as the cleavable second primer 36D2 and the non-cleavable second primer 36D1.

[0182] Primers 36C1, 36D1, 36C2, 36D2, and transposome complexes 10, 10' contain 5' functional groups that allow them to be attached to a polymer hydrogel 24. Any of the examples described herein can be used, such as a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)).

[0183] An example of a method for making the configuration shown in Figure 3B is shown generally in Figures 26A-26D. Although a single multi-depth recess 12' is shown, it should be understood that the method may produce an array of multi-depth recesses 12' in the substrate 40.

[0184] The method generally includes the steps of applying a polymer hydrogel 24 onto a substrate 40 having multiple depth recesses 12' separated by gap regions 38, each multiple depth recess 12' including a deep portion 86 and a shallow portion 84 (Figure 26A); removing the polymer hydrogel 24 from the gap regions 38 (Figure 26B); developing the photoresist to produce insoluble photoresist 82 in the deep portions 86, thereby leaving the shallow portions 84 exposed (Figure 26B); immobilizing a first primer set and a first transposome complex 10 on the surface of the shallow portions 84 while the insoluble photoresist 82 is in the deep portions 86 (Figure 26B); removing the insoluble photoresist (Figure 26C); and immobilizing a second primer set and a second transposome complex 10' on the surface of the shallow portions 84 (Figure 26C).

[0185] At the beginning of the method, multiple depth recesses 12' are formed in the substrate 40. The multiple depth recesses 12' may be formed using nanoimprint lithography. As an example, a working stamp is pressed into the substrate 40 (e.g., a single layer base support, or a layer disposed on a base support) while the substrate material is soft, thereby creating an imprint (negative replica) of the working stamp features in the substrate 40. The substrate 40 may then be cured with the working stamp in place.

[0186] Curing may be accomplished by exposure to actinic radiation, such as visible or ultraviolet (UV) radiation, if a radiation curable resin material is used, or by exposure to heat, if a thermosetting resin material is used. Curing may promote polymerization and / or crosslinking. As an example, curing may include multiple stages, including a soft bake (e.g., to drive any liquid carrier that may be used to deposit the resin) and a hard bake. The soft bake may be performed at a lower temperature (e.g., in the range of about 50°C to about 150°C) for a time ranging from more than 0 seconds to about 3 minutes. The duration of the hard bake may last from about 5 seconds to about 10 minutes at a temperature in the range of about 100°C to about 300°C. Examples of devices that can be used for soft baking and / or hard baking include hot plates, ovens, and the like.

[0187] After curing, the working stamp is removed, thereby creating topographical features in the substrate 40.

[0188] Next, the polymer hydrogel 24 is applied onto the substrate 40. The polymer hydrogel 24 may be applied using any suitable deposition technique. When initially applied, the polymer hydrogel 24 conformally covers the entire substrate 40, including the surface interstitial regions 38 of the plurality of depth recesses 12'.

[0189] The polymer hydrogel 24 located above the gap regions 38 is removed, for example, using a polishing process. The polishing process may be performed using a chemical slurry (e.g., including an abrasive, a buffer, a chelating agent, a surfactant, and / or a dispersant) that can remove the polymer hydrogel 24 from the gap regions 38 without adversely affecting the underlying substrate 40 in those regions 38. Alternatively, polishing may be performed with a solution that does not include abrasive particles. The chemical slurry may be used in a chemical mechanical polishing system to polish the surface of the gap regions 38. A polishing head(s) / pad(s), or other polishing tool(s), can polish the polymer hydrogel 24 that may be present above the gap regions 38 while leaving the polymer hydrogel 24 at least substantially intact within the recess(es) 12. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head. A cleaning and drying process may be performed after polishing. The cleaning process may utilize a water bath and ultrasonic treatment. The water bath may be maintained at a relatively low temperature, ranging from about 22° C. to about 30° C. The drying process may involve spin drying or drying via another suitable technique.

[0190] The polymer hydrogel 24 within the multiple depth recesses 12' is shown in FIG. 26A.

[0191] A photoresist is then applied onto the polymer hydrogel 24. The photoresist may be a negative or positive photoresist. Examples of suitable positive photoresists include the MICROPOSIT® S1800 series or the AZ® 1500 series, both of which are available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR™-220 (manufactured by DuPont). Suitable negative photoresists include the SU-8 series and the KMPR® series (both available from Kayaku Advanced Materials, Inc.), the UVN™ series (available from DuPont), or the NR® series photoresists (available from Futurrex). The positive or negative photoresist may be applied using any suitable deposition technique disclosed herein.

[0192] If a positive photoresist is used, the portions of the positive photoresist in the depths 86 are not exposed to light of a particular wavelength to form insoluble photoresist 82. The exposed portions remain soluble and can be removed with an appropriate developer. Examples of suitable developers for positive photoresist 38 include aqueous alkaline solutions, such as an aqueous solution of dilute sodium hydroxide, dilute potassium hydroxide, or metal ion free organic TMAH (tetramethylaminohydroxide).

[0193] If a negative photoresist is used, the portions of the negative photoresist in the depths 86 are exposed to light of a particular wavelength to form insoluble photoresist 82. The unexposed portions remain soluble and can be removed with a suitable developer. Examples of suitable developers for negative photoresists include aqueous alkaline solutions such as dilute sodium hydroxide, dilute potassium hydroxide, or an aqueous solution of metal ion-free organic TMAH (tetramethylammoniumhydroxide).

[0194] In either example, a mask can be used to selectively expose the photoresist to light in the desired manner. If a negative photoresist is used, a backside exposure (e.g., through substrate 40) may be used, so long as light is prevented from penetrating substrate 40 to deep portion 86 and from penetrating substrate 40 to shallow portion 84. In this particular example, the thicknesses of substrate 40 at deep portion 86 and shallow portion 84 can be selected to be light transmissive and light blocking, respectively.

[0195] Removal of the soluble photoresist exposes the polymer hydrogel 24 in the interstitial regions 38 and shallow portions 84, while leaving the insoluble photoresist 82 in the deeper portions, as shown in Figure 26B.

[0196] While the insoluble photoresist 82 is in the deep portion 86, the first primer set and the first transposome complex 10 are immobilized on the surface of the polymer hydrogel 24 in the shallow portion 84 (FIG. 26B). For immobilization, the transposome complex 10 and the primers 36C1, 36D1 may be included in a carrier liquid at a concentration ranging from about 0.1 μM to about 1 μM. The carrier liquid may be water. A buffer and / or a salt may be added to the carrier liquid to graft the transposome complex 10 and the primers 36C1, 36D1 to the appropriate functional groups of the polymer hydrogel 24. The buffer has a pH ranging from 5 to 12. Any of the neutral buffers and / or salts described herein may be used.

[0197] Fluid containing transposome complex 10 and primers 36C1, 36D1 can be introduced using flow-through deposition. Grafting can be carried out at a temperature ranging from about 35° C. to about 45° C. for a time ranging from about 30 hours to about 120 hours. During grafting, transposome complex 10 and primers 36C1, 36D1 bind to at least a portion of the azide or tetrazine groups of polymer hydrogel 24 and have no affinity for interstitial regions 38.

[0198] A wash solution can be passed through the flow cell to remove ungrafted transposome complexes 10 and / or primers 36C1, 36D1.

[0199] The insoluble photoresist 82' may then be removed. The insoluble positive photoresist may be lifted off with a remover such as methyl sulfoxide (DMSO) using ultrasonic treatment, or with an acetone cleaning solution, or with a propylene glycol monomethyl ether acetate cleaning solution, or with an NMP (N-methyl-2-pyrrolidone) based stripper cleaning solution. The insoluble negative photoresist may be lifted off with a remover such as methyl sulfoxide (DMSO) using ultrasonic treatment, or with acetone, or with an NMP (N-methyl-2-pyrrolidone) based stripper.

[0200] The second primer set and the second transposome complex 10' are then immobilized on the surface of the deep portion 86, as shown in FIG. 26C. For immobilization, the transposome complex 10' and the primers 36C2, 36D2 may be included in a carrier liquid at a concentration ranging from about 0.1 μM to about 1 μM. The carrier liquid containing the transposome complex 10' and the primers 36C2, 36D2 may be water or may include a buffer and / or salt. This carrier fluid may be introduced into the flow cell using flow-through deposition, and grafting may be performed as described herein.

[0201] The second primer set and second transposome complex 10' are substantially blocked from grafting to the polymer hydrogel 24 in the shallow portion 84 by the presence of transposome complex 10 and primers 36C1, 36D1.

[0202] A wash solution can be passed through the flow cell to remove non-grafted transposome complexes 10' and primers 36C2, 36D2.

[0203] The DNA sample 34 can then be introduced into the flow cell and subjected to tagmentation and extension to generate perfectly matched DNA fragments. The fragments can be cleaved from the transposome complex 10, 10', seeded with one of the primers 36C1, 36D1, 36C2, 36D2, and subjected to amplification across both primer sets. The amplification generates forward and reverse strands in both the deep portion 86 and the shallow portion 84. However, the cleavage sites (described with reference to FIG. 17) in each of the cleavable primers 36C1, 36D2 allow the forward strand to be cleaved from either the deep portion 86 or the shallow portion 84, and the reverse strand to be cleaved from the other of the shallow portion 84 or the deep portion 86. Thus, the reverse strand remains in portion 86 or 84, and the forward strand remains in portion 84 or 86. This allows paired-end sequencing to be performed simultaneously.

[0204] In the example shown in Figure 3A, cluster generation can form three different types of bridged and fully extended (fully adapted) fragment amplicons: fully adapted fragment amplicons formed on polymer hydrogel 24,A have identical amplification domains 26 at both ends (e.g., P5-P5) because the same transposome 10 and the same primer 36 are present on polymer hydrogel 24,A; similarly, fully adapted fragment amplicons formed on polymer hydrogel 24,B have identical amplification domains 26' at both ends (e.g., P7-P7) because the same transposome 10' and the same primer 36' are present on polymer hydrogel 24,B. In contrast, fully adapted fragment amplicons formed on both polymer hydrogels 24,A and 24,B (i.e., those bridging hydrogels 24,A and 24,B) have different amplification domains 26,26' at the opposing ends (e.g., P5-P7). This is because the tagmentation and amplification, which is performed across both polymer hydrogels 24,A and 24,B, involves both transposomes 10,10' and both primers 36,36'.

[0205] Due to orthogonal cleavage groups in the amplification domains 26, 26' of the perfectly matched fragment amplicons, when specific base cleavage is performed, one type of cross-linked perfectly matched fragment amplicon (e.g., those formed on the polymer hydrogel 24, A) is removed, while the other type of cross-linked perfectly matched fragment amplicon (e.g., those formed on the polymer hydrogel 24, B) remains cross-linked. As an example, specific base cleavage targets the cleavage group in the amplification domain 26. In this example, specific base cleavage also linearizes the perfectly matched fragment amplicons that have different amplification domains 26, 26' at the opposite ends, which in this example leaves them bound to the polymer hydrogel 24, B. These linearized perfectly matched fragment amplicons are sequenced, and then the sequenced products are removed.

[0206] Clustering is then performed again using the previously linearized perfectly matched fragment amplicons (e.g., those formed on polymer hydrogel 24, B) and primer 36 on the other polymer hydrogel 24, A. Perfectly matched fragment amplicons (e.g., those formed on polymer hydrogel 24, B) that remain cross-linked after the first round of sequencing do not participate in clustering. In this example, specific base cleavage is performed such that the remaining cross-linked perfectly matched fragment amplicons (e.g., those formed on polymer hydrogel 24, B) are removed. In this particular example, the specific base cleavage targets the cleavage group in amplification domain 26'. This specific base cleavage linearizes the newly generated perfectly matched fragment amplicons with different amplification domains 26, 26' at the opposite ends, which in this example leaves them bound to polymer hydrogel 24, A. These linearized perfectly matched fragment amplicons are sequenced and then the sequenced products are removed.

[0207] In the example of Figure 3A, perfectly matched fragments with different amplification domains 26, 26' are confined to a region spanning two polymer hydrogels 24,A and 24,B, which may affect intensity during sequencing. Other example flow cells and methods can be used to increase the number of perfectly matched fragments with different amplification domains 26, 26' at opposing ends that are formed. This example flow cell is shown in Figure 15A, and an example method is shown generally in Figures 15A-15J.

[0208] The flow cell shown in FIG. 15A includes a substrate 40 having recesses 12 separated by gap regions 38, a first polymer hydrogel 24, A disposed in a first portion of each recess 12 and a second polymer hydrogel 24, B disposed in a second portion of each recess 12, a transposome precursor 52 immobilized on the first polymer hydrogel 24, A via an orthogonal cleavable bond 54, a capture primer 56 immobilized on the second polymer hydrogel 24, B, and first and second primers 36C, 36D of an amplification primer set immobilized on each of the first and second polymer hydrogels 24A, 24B.

[0209] The substrate 40 may be any of the examples described herein.

[0210] Primers 36C, 36D of the amplification primer set can be any of the examples described herein for primers 36, 36', so long as they have orthogonal cleavage sites. In another example, further described with reference to Figure 17, each of the first and second primers of the amplification primer set includes both a cleavable primer and a non-cleavable primer.

[0211] The capture primer 56 can hybridize to the preassembled transposome complex 10D, but does not otherwise participate in the amplification because it is orthogonal to primers 36C, 36D in the amplification primer set. As discussed in more detail herein, the capture primer comprises a sequence complementary to the non-transferred strand 20D (FIGS. 15B and 16B) of the preassembled transposome complex 10D. As an example, the sequence of the capture primer 56 (PX) can be as follows: PX 5'→3' AGGAGGAGGAGGAGGAGGAGGAGG (SEQ ID NO: 10)

[0212] The capture primer 56 may also include a poly-T sequence at the 5' end of the primer sequence. The capture primer 56 does not include a cleavage site.

[0213] The transposome precursor 52 includes, from its 5' end to its 3' end, an orthogonally cleavable bond 54, an amplification domain 26C, a sequencing primer sequence 28C, and a strand 30C that can form a transposon end 16C (see FIG. 16A). As shown in FIG. 16A, the transposome precursor 52 becomes the transferred strand 18C of a transposome complex 10C that is assembled on the flow cell surface.

[0214] The orthogonally cleavable bond 54 has an orthogonal cleavage chemistry to primers 36C, 36D of the amplification primer set. Thus, the orthogonally cleavable bond 54 is not susceptible to the cleavage agent used at either of the cleavage sites of primers 36C, 36D, and the cleavage sites of primers 36C, 36D are not susceptible to the cleavage agent used at the orthogonally cleavable bond 54. In addition to containing a cleavage site, the orthogonally cleavable bond 54 is bifunctional in that it can be covalently attached at its 3' end to the amplification domain 26C and covalently or non-covalently attached at its 5' end to a surface functional group of the polymer hydrogel 24,A. The orthogonally cleavable bond 54 may be a vicinal diol bond (which may be cleaved by oxidation, such as by treatment with a periodate reagent), a disulfide bond (e.g., cleavable under reducing conditions (e.g., in the presence of dithiothreitol (DTT)) or in the presence of a phosphine), an ortho-nitrobenzyl group (e.g., cleavable by photolysis), an azobenzene bond (e.g., cleavable in the presence of Na2SO4), an alkyl-selenium bond (e.g., cleavable by oxidation, such as by treatment with hydrogen peroxide), a silyl ether bond (e.g., cleavable by fluoride ion, acid, or base), or an allyl carbamate bond (e.g., cleavable in the presence of a palladium complex). Some examples of orthogonally cleavable bonds 54 include aliphatic linkers with vicinal diols, poly(ethylene glycol) linkers with disulfides, and the like.

[0215] The transposome precursor 52 also includes an amplification domain 26C. The amplification domain 26C of the transposome precursor 52 has a sequence identical to that of the first primer 36C, except that the amplification domain 26C does not include the cleavage site of the first primer 36C.

[0216] The transposome precursor 52 also includes a sequencing primer sequence 28C, which is capable of binding to a sequencing primer that is introduced into the flow cell after tagmentation and amplification.

[0217] The transposome precursor 52 also includes strand 30C. Strand 30 can form a transposon end 16C with strand 32C, which is subsequently introduced into the flow cell along with transposase 14C (see FIG. 15B). Thus, strand 30C is complementary to strand 32C. An example of strand 30 can be used for strand 30C.

[0218] Similar to the example shown in Figure 3A, the polymer hydrogel 24 includes two regions A and B. One region A has a transposome precursor 52 and primers 36C and 36D bound thereto, and the other region B has a capture primer 56 and primers 36C and 36D bound thereto.

[0219] In one example, the polymer hydrogel 24 is chemically identical throughout regions A, B. In this example, the polymer hydrogel 24 may be applied as described herein with reference to Figures 1A-1D, for example using blanket deposition and then polishing to remove the polymer hydrogel 24 from the gap regions 38. In this example, a blanket grafting technique may be used to immobilize the primers 36C, 36D to both regions A, B, or the primers 36C, 36D may be pre-grafted to the polymer hydrogel 24 and then applied to the recesses 12. Techniques may then be used to selectively immobilize the transposome precursors 52 to region A and the capture primers 56 to region B. A suitable selective immobilization technique is described with reference to Figure 3A. In instances where the polymer hydrogel 24 is chemically identical throughout regions A and B, the 5' terminal functional groups of primers 36C, 36D and the 5' terminal functional group of orthogonally cleavable bond 54 can be identical so long as the cleavage sites of entities 36C, 36D, 54 are orthogonal.

[0220] In another example, the polymer hydrogel 24 is chemically distinct in regions A and B. In this example, one region A is configured to graft primers 36C, 36D and a portion of the transposome precursor 52, and the other region B is configured to graft primers 36C, 36D and another portion of the capture primer 56. Thus, the portion of the primers 36C, 36D may have a different 5' end functional group than the other portion of the primers 36C, 36D to achieve the desired binding to the chemically distinct regions A and B. Any of the covalent or non-covalent binding mechanisms described herein may be used, so long as the primers 36C, 36D and a portion of the transposome precursor 52 bind to the polymer hydrogel 24, A, and the primers 36C, 36D and another portion of the capture primer 56 bind to the polymer hydrogel 24, B. In this example, a portion of primers 36C, 36D and transposome precursors 52 may be pre-grafted to polymer hydrogel 24,A, and polymer hydrogel 24,A may be selectively applied to a first portion of recesses 12, and another portion of primers 36C, 36D and capture primer 56 may be pre-grafted to polymer hydrogel 24,B, and polymer hydrogel 24,B may be selectively applied to a second portion of recesses 12. Alternatively, polymer hydrogels 24,A and 24,B may be selectively applied, and then binding of primers 36C, 36D, transposome precursors 52, and capture primer 56 may occur simultaneously, since they are configured to bind to regions A and B of polymer hydrogel 24, respectively.

[0221] FIG. 15B shows on-flow cell assembly of transposome complex 10C and on-flow cell binding of preassembled transposome complex 10D.

[0222] On-flow cell assembly of transposome complexes 10C can be achieved by introducing a first fluid, including a plurality of transposase enzymes 14C and a plurality of non-transferred strands 20C, into a flow cell as shown in FIG. 15A.

[0223] In the first fluid, the transposase enzyme 14C may be any of the examples described herein for the transposase 14, 14'. Also in the first fluid, the non-transferred strand 20C is strand 32C, which can form the transposon end 16C with the strand 30C bound to the polymer hydrogel 24A. Thus, the non-transferred strand 20C, 32C is complementary to the strand 30C. The example of strand 32 can be used for the strands 32C, 20C. The concentration of each of the transposase enzyme 14C and the non-transferred strands 20C, 32C in the first fluid can depend on the number of transposome precursors 52 bound to the polymer hydrogel 24. An excess of each of the transposase enzyme 14C and the non-transferred strands 20C, 32C relative to the transposome precursors 52 can be used to ensure that a desired number of transposome complexes 10C are formed. Any unreacted transposase enzyme 14C and the non-transferred strands 20C, 32C can be removed in the wash solution.

[0224] The first fluid also includes a carrier liquid, which may be water.

[0225] Upon introduction into the flow cell of FIG. 15A, the first fluid is incubated within the flow cell such that at least a portion of the plurality of transposome precursors 52, the plurality of non-transferred strands 20C, 32C, and the plurality of transposase enzymes 14C interact to form a plurality of transposome complexes 10C immobilized on the polymer hydrogel 24A. The first fluid is incubated at a temperature suitable for hybridization of the non-transferred strands 20C, 32C in the first fluid with the strands 30C (of the transposome precursors 52). The hybridized strands 30C, 32C form transposon ends 16C to which the transposase enzyme 14C can be non-covalently bound. The resulting transposome complexes 10C are shown in both FIG. 15B and FIG. 16A.

[0226] As shown in detail in FIG. 16A, transposome complex 10C includes transferred strand 18C hybridized to non-transferred strand 20C, 32C at transposon end 16C. Transferred strand 18C includes amplification domain 26C and orthogonally cleavable bond 54 (attached to polymer hydrogel 24, A). As described above, amplification domain 26C has a sequence identical to first primer 36C, except for the cleavage site. This allows transposome complex 10C to participate in amplification using primers 36C, 36D and to be cleaved separately from primers 36C, 36D.

[0227] After the transposome complex 10C is assembled on the flow cell, the preassembled transposome complex 10D can be bound to the polymer hydrogel 24,B within the flow cell.

[0228] Preassembled transposome complex 10D is shown in FIG. 15B (after attachment to polymer hydrogel 24,B) and in FIG. 16B (before attachment to polymer hydrogel 24,B). Preassembled transposome complex 10D includes transposase enzyme 14D non-covalently attached to transposon end 16D. Transposon end 16D is a double-stranded nucleic acid strand, one strand 30D of which is part of transferred strand 18D and the other strand 32D of which is part of non-transferred strand 32D. Any example of transposase enzyme 14, strand 30, and strand 32, respectively, can be used for transposase enzyme 14D, strand 30D, and strand 32D.

[0229] Transferred strand 18D contains a branched adaptor attached to strand 30D of transposon end 16D. The branched adaptor contains an amplification domain 26D and a sequencing primer sequence 28D. The branched adaptor does not bind to polymer hydrogel 24,B. The amplification domain 26D has a sequence identical to a second primer 36D, and the sequencing primer sequence 28D can bind to a sequencing primer during downstream sequencing.

[0230] Non-transferred strand 20D includes two stranded portions, one of which is strand 32D at transposon end 16D, and the other is strand 58. As shown in FIG. 16B, strand 58 is attached to the 3' end of strand 32D. Strand 58 has a sequence complementary to capture primer 56, thus providing pre-assembled transposome complex 10D with a hybridization mechanism for binding to polymer hydrogel 24,B to which capture primer 56 is attached.

[0231] Preassembled transposome complex 10D may be prepared in solution outside the flow cell. First, strands 18D and 20D may be synthesized, then strand portions 30D and 32D are hybridized together to form a branched adapter. Transposase enzyme 14D is added and forms a complex with transposon end 16D.

[0232] The preassembled transposome complexes 10D can be added to a carrier fluid to form a second fluid. The concentration of the preassembled transposome complexes 10D in the second fluid can depend on the number of capture primers 56 bound to the polymer hydrogel 24,B. The carrier liquid of the second fluid can be water. An excess of preassembled transposome complexes 10D relative to the capture primers 56 can be used to ensure that the desired number of transposome complexes 10D are bound. Any unreacted preassembled transposome complexes 10D can be removed in a wash solution.

[0233] On-flow cell binding of preassembled transposome complexes 10D may be accomplished by introducing a second fluid containing multiple preassembled transposome complexes 10D into the flow cell after transposome complexes 10C are assembled. The second fluid is incubated at a temperature suitable for hybridization of partial strands 58 (see FIG. 16B) with capture primers 56. This binds transposome complexes 10D to the polymer hydrogel 24,B, as shown in FIG. 15B.

[0234] In another exemplary method, preassembled transposome complex 10D can be bound to a polymer hydrogel 24, B prior to on-flow cell assembly of complex 10C.

[0235] The DNA sample is then introduced into the flow cell of Figure 15B. The DNA sample can be introduced along with an example tagmentation buffer disclosed herein.

[0236] 15C shows recess 12 after a DNA sample has been introduced. The DNA sample is fragmented into DNA fragments 35, 37, the 5' ends of which are ligated to the 3' end of one of the transferred strands 18C or 18D, respectively. More specifically, in this example, the 5' ends of DNA fragments 35A, 37A are ligated to the 3' end of each of the transferred strands 18C of transposome complex 10C. The 5' ends of DNA fragments 35B, 37B are ligated to the 3' end of each of the transferred strands 18D of preassembled transposome complex 10D, and the 5' ends of DNA fragments 35C, 37C are ligated to the 3' end of each of the transferred strands 18D, 18C of transposome complex 10D, 10C. Thus, DNA fragments 35A, 37A bind to polymer hydrogel 24A, DNA fragments 35B, 37B bind to polymer hydrogels 24,B, and DNA fragments 35C, 37C crosslink polymer hydrogels 24,A and 24,B.

[0237] Fragmentation and ligation can occur at a temperature of 30° C. or higher. In one example, the temperature can range from about 30° C. to about 55° C.

[0238] As shown in Figure 15C, the 3' ends of DNA fragments 35A, 37A, 35B, 37B, 35C, 37C are not ligated to the 5' ends of non-transferred strands 20C, 20D. Thus, a gap 39 exists between the 3' end of each of DNA fragment strands 35A, 35B, 35C and the 5' end of non-transferred strand 20C or 20D, and a gap 39' exists between the 3' end of DNA fragment strands 37A, 37B, 37C and the 5' end of non-transferred strand 20D or 20C. In one example, each gap 39, 39' is 9 base pairs long.

[0239] The method then includes removing the transposase enzymes 14C and 14D of each of the preassembled transposome complexes 10D. Removal of the transposase enzymes 14C, 14D can be accomplished using, for example, sodium dodecyl sulfate (SDS) or proteinases or other denaturants. Figure 15D shows the flow cell recess 12 after removal of the transposase enzymes.

[0240] This example of the method then includes initiating a strand displacement reaction to generate complementary copies 60, 62 of the transferred strands 18C, 18D of the plurality of transposome complexes 10C and the plurality of preassembled transposome complexes 10D. The flow cell after the strand displacement reaction is shown in FIG. 15E.

[0241] For strand displacement extension, a nucleotide mixture containing nucleotides and a strand displacement enzyme is introduced into the flow cell. The nucleotide mixture can be water and / or an ionic salt buffer, such as millimolar to molar citrate saline, sodium chloride, potassium chloride, phosphate buffered saline, etc., and / or other buffers, such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES). The liquid carrier can also be Mg 2+ , Mn 2+For strand displacement extension reactions, catalytic metals such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,

[0242] The enzyme used in the strand displacement reaction extends the 3' ends of DNA fragment strands 35A, 37A, 35B, 37B, 35C, and 37C with nucleotides in the mixture using transferred strands 18C and 18D as respective template strands. Examples of suitable strand displacement enzymes include Bst DNA polymerase or Bsu DNA polymerase.

[0243] During the strand displacement reaction, the enzyme displaces the non-transferred strands 20C, 20D. As a result, the DNA fragments 35B, 37B, 35C, 37C become separated from the second polymer hydrogel 24,B, as shown in FIG. 15E. This is due to the fact that the strand 58 of the non-transferred strand 20D, which was hybridized to each surface-bound capture primer 56, is displaced. Without the binding to the capture primer 56, the DNA sample fragments 35B, 37B, 35C, 37C would no longer bind to the polymer hydrogel 24,B. The non-transferred strand 20C of the transposome complex 10C is also displaced during the strand displacement reaction.

[0244] The separated and displaced strands may then be subjected to a denaturation and washing process. In one example, the denaturation and washing is performed using a formamide solution. This process removes any strands that are not covalently attached to the polymer hydrogel 24 from the flow cell.

[0245] Although not shown in FIG. 15E, it should be understood that the denaturation and washing process may also denature the cross-linked fragments 35A, 37A, 35B, 37B, 35C, 37C. Whether cross-linked or single-stranded, after the strand displacement reaction and washing, the DNA sample fragments 35A, 37A, 37C remain bound to the polymer hydrogel 24, A, as shown in FIG. 15E. This is due to the fact that these DNA sample fragments 35A, 37A, 37C are bound to the polymer 24 via orthogonally cleavable bonds 54, and not via the capture primer 56. Although a single remaining DNA sample fragment 37C is shown in FIG. 15E, it should be understood that any of the DNA sample fragments 37C bridging regions A, B of the polymer hydrogel 24 remain bound to the flow cell surface via the attached transfer strand 18C. Thus, at least one of the complementary copies 62 of the transfer strand 18D of the plurality of preassembled transposome complexes 10D remains bound to the first polymer hydrogel 24, A via at least one of the transfer strands 18C of the plurality of transposome complexes 10C.

[0246] The method includes hybridizing at least one of the complementary copies 62 of the transferred strand 18D of a plurality of preassembled transposome complexes 10D to at least one of the second primers 36D on the first polymer hydrogel 24, A or the second polymer hydrogel 24, B. In FIG. 15G, the complementary copy 62 is hybridized to one of the second primers 36D on the polymer hydrogel 24, B. Hybridization can be initiated by raising the temperature of the flow cell, and thus its contents, to a suitable DNA hybridization temperature (e.g., 65° C.).

[0247] Then, as shown in FIG. 15H, polymerase extension is initiated along the DNA sample fragment 37C that binds to at least one of the hybridized complementary copies 62 to generate at least one amplicon 64 that binds to at least one of the second primers 36D on the first polymer hydrogel 24, A or the second polymer hydrogel 24mB.

[0248] For polymerase extension, a nucleotide mixture containing nucleotides and a polymerase is introduced into the flow cell. Any polymerase that can accept nucleotides and successfully incorporate the base of the nucleotide at the 3' end of primer 36D can be used. Examples of polymerases include polymerases from family A, such as Bsu Polymerase, Bst Polymerase, Taq Polymerase, T7 Polymerase, and many others; polymerases from families B and B2, such as Phi 29 polymerase and other highly processive polymerases (family B2), Pfu polymerase (family B), KOD polymerase (family B), 9oN (family B); polymerases from family C, such as Escherichia coli DNA Pol III, and many others, polymerases from family D, such as Pyrococcus furiosus DNA Pol II, and many others; polymerases from family X, such as DNA Pol μ, DNA Pol β, DNA Pol σ, and many others. The nucleotide mixture can be water and / or an ionic salt buffer, such as millimolar to molar citrate saline, sodium chloride, potassium chloride, phosphate buffered saline, and the like, and / or other buffers, such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES). The liquid carrier can also be Mg 2+ , Mn 2+A single catalytic metal or a combination of catalytic metals may be used, and the total concentration may range from about 0.01 mM to about 100 mM.

[0249] The temperature of the flow cell can be adjusted to initiate the template extension reaction, allowing the polymerase to extend the 3' end of primer 36D using complementary copy 62, DNA fragment 37C, and transferred strand 18C as templates.

[0250] After the amplicon(s) 64 are generated, a cleaving agent for the orthogonally cleavable bond 54 is introduced into the cell. The cleaving agent may be a chemical or enzymatic cleaving agent depending on the orthogonally cleavable site 54. Cleavage of the orthogonally cleavable bond 54 cleaves the transferred strand 18C, thus detaching the DNA fragments 35A, 37A, 37C from the polymer hydrogel 24, A. In one example, a diol cleaving agent is introduced to detach the DNA sample fragments 35A, 37A, 37C bound to the first polymer hydrogel 24, A via the diol cleavage site of the bond 54.

[0251] The detached strands 35A, 37A can then be washed from the flow cell using the example washing solutions described herein.

[0252] As shown in Figure 15I, after cleavage of orthogonally cleavable bond 54 and washing, DNA sample fragment 37C and its amplicon 64 remain bound to polymer hydrogel 24, B. This is due to the fact that DNA sample fragment 37C is bound to polymer 24 (region A or B) through hybridization of complementary portion 62 to primer 36D, not through transferred strand 18C. Although a single remaining DNA sample fragment 37C and amplicon 64 are shown in Figure 15I, it should be understood that both DNA sample fragment 37C and amplicon 64 hybridized to primer 36D remain after cleavage of orthogonally cleavable bond 54.

[0253] Amplicon 64 is a perfectly matched fragment (containing amplification domains 26C, 26D or their complements at opposite ends) that can undergo amplification across recess 12 using primers 36C, 36D. The perfectly matched DNA sample fragment 37C (also containing amplification domains 26C, 26D or their complements at both ends) shown in FIG. 15I can be removed via denaturation. Amplicon 64 is then exposed to clustering. In particular, single-stranded amplicon 64 loops over and hybridizes to adjacent complementary primer 36C, and polymerase copies amplicon 64 to form another double-stranded bridge, which is denatured to form two single strands bound to polymer hydrogel 24 (A or B). These two strands loop over and hybridize to adjacent complementary primers 36C, 36D and are extended again to form two new double-stranded loops. This process is repeated for each template copy by cycles of isothermal denaturation and amplification to create a compact clonal cluster, as shown in FIG. 15J. Each cluster of double-stranded bridge structures is denatured. In one example, the reverse strand is removed (e.g., specific base cleavage) by a cleavage agent appropriate to the cleavage site of primer 36C or 36D to which the reverse strand is bound, leaving the forward template strand / amplicon. In another example, the forward strand is removed (e.g., specific base cleavage) by a cleavage agent appropriate to the cleavage site of primer 36C or 36D to which the forward strand is bound, leaving the reverse template strand / amplicon. Clustering results in the formation of several template strands immobilized on recess 12.

[0254] 15A-15J, a gap is present between polymer hydrogel regions 24, A, B. When a gap is included, at least one of DNA fragments 35C, 37C bridges the gap, thus imposing a lower limit on the size of the fragment amplicon that can be generated. In other examples, regions A, B of polymer hydrogel 24 may abut one another within recess 12, thus imposing no lower limit on the size of the fragment amplicon that can be generated.

[0255] The amplification primer sets described with reference to Figures 15A-15J allow for sequential paired-end sequencing. Using sequential paired-end sequencing, a forward strand / fragment amplicon can be sequenced and removed, which is generated across both regions A, B of the polymer hydrogel 24, and then a reverse strand / fragment amplicon can be generated, sequenced and removed across both regions A, B of the polymer hydrogel 24. In other examples, the amplification primer sets allow for simultaneous paired-end sequencing. An example of this method is shown and described with reference to Figure 17.

[0256] The primer set shown in Figure 17 includes two primer subsets 66, 68. These primer subsets 66, 68 allow a single template strand (e.g., DNA fragment 35C) to be amplified and clustered across both primer subsets 66, 68 (as described with reference to Figures 15A-15J), and also allow a cluster of forward strands to be generated in one region A of the polymer hydrogel 24 and a cluster of reverse strands to be generated in the other region B of the polymer hydrogel 24. To allow the latter, the primer subsets 66, 68 are controlled such that the cleavage (linearization) chemistry is orthogonal in the different polymer hydrogel regions 24,A and 24,B.

[0257] More specifically, primer subsets 66, 68 are related in that one set 66 includes a cleavable first primer 36C1 and a non-cleavable second primer 36D1, and the other set 68 includes a non-cleavable first primer 36C2 and a cleavable second primer 36D2. Thus, the non-cleavable first and second primers 36C2, 36D1 of primer sets 68, 66 are non-cleavable during linearization of the cluster.

[0258] Primer subset 66 includes a cleavable first primer 36C1 and a non-cleavable second primer 36D1, and primer subset 68 includes a non-cleavable first primer 36C2 and a cleavable second primer 36D2.

[0259] The cleavable first primer 36C1 and the non-cleavable second primer 36D1 are, for example, an oligonucleotide pair in which the cleavable first primer 36C1 is a forward amplification primer and the non-cleavable second primer 36D1 is a reverse amplification primer, or the non-cleavable second primer 36D1 is a forward amplification primer and the cleavable first primer 36C1 is a reverse amplification primer. In primer subset 66, the cleavable first primer 36C1 includes a cleavage site 70, while the non-cleavable second primer 36D1 does not include a cleavage site.

[0260] The non-cleavable first primer 36C2 and the cleavable second primer 36D2 are, for example, an oligonucleotide pair in which the non-cleavable first primer 36C2 is a forward amplification primer and the cleavable second primer 36D2 is a reverse amplification primer, or the cleavable second primer 36D2 is a forward amplification primer and the cleavable first primer 36C2 is a reverse amplification primer. In the primer set 68, the cleavable second primer 36D2 includes a cleavage site 70 or 70', while the non-cleavable first primer 36C2 does not include a cleavage site.

[0261] It should be understood that the non-cleavable first primer 36C2 and the cleavable first primer 36C1 have identical nucleotide sequences (e.g., both are forward amplification primers), except that the cleavable first primer 36C1 includes a cleavage site 70 incorporated into the primer sequence or a linked molecule attached to the primer sequence. Similarly, the cleavable second primer 36D2 and the non-cleavable second primer 36D1 have identical nucleotide sequences (e.g., both are reverse amplification primers), except that the cleavable second primer 36D2 includes a cleavage site 70 or 70' incorporated into the primer sequence or a linked molecule attached to the primer sequence.

[0262] It should be understood that where the first primers 36C1 and 36C2 are forward amplification primers, the second primers 36D1 and 36D2 are reverse primers, and vice versa.

[0263] The non-cleavable primers 36D1, 36C2 may be any primer sequence having a universal sequence for amplification purposes, such as P5 and P7 primers, P15 and P7 primers, or any combination of PA, PD, PC, PD primers (e.g., PA and PB, or PA and PD, etc.), and do not contain the cleavage site 70, 70' (e.g., U or "n" in some of the sequences described herein).

[0264] In contrast, the cleavable primers 36C1, 36D2 may be any of the primer sequences shown herein, such as P5 and P7 primers, P15 and P7 primers, or other universal sequence primers (e.g., PA, PB, PC, PD primers), with each cleavage site 70, 70' (e.g., U or "n" in some of the sequences described herein) incorporated into the primer sequence or a linking molecule attached to the primer sequence. The cleavage site 70 may be the same in each of the cleavable primers 36C1, 36D2, or the cleavage sites 70, 70' may be different in each of the cleavable primers 36C1, 36D2, as long as the cleavage site 70 or 70 and 70' is orthogonal to the cleavage site of the orthogonally cleavable linker 54.

[0265] In addition, the flow cells shown in Figures 15A-15J may utilize different attachment mechanisms for the preassembled transposomes 10D. In this example, the flow cell does not include a capture primer 56, but rather the polymer hydrogel 24, B includes transposome capture functional groups, while the first polymer hydrogel 24, A does not (i.e., the first polymer hydrogel 24, A does not). In one example, the polymer hydrogel 24, B includes functional groups that can be covalently attached to the 5' end of the transposome complex 10D, and the polymer hydrogel 24, A does not include these particular functional groups. In another example, the polymer hydrogel 24, B is functionalized with biotin surface groups (i.e., it is a biotinylated polymer hydrogel 24'), and the polymer hydrogel 24, A does not include biotin surface groups. The 5' end functional group of transposome complex 10D can be any of the examples described herein (eg, streptavidin, streptavidin-biotin, etc.) that are capable of binding to a biotin surface group.

[0266] How to increase insert size As mentioned herein, examples of modified transposome complexes 10, 10' (e.g., having modifications at the 3' or 5' non-transferred strand 32, 32', or the 3' end of the transferred strand 18, 18') can be used to increase the insert size of the fragmentation product. The following description provides several other methods that can be used to increase the insert size. These methods can be used in conjunction with any of the modified or unmodified transposome complexes 10, 10' disclosed herein.

[0267] In one example, a method for increasing the insert size of a deoxyribonucleic acid (DNA) sample includes the steps of introducing a DNA sample into any example of a flow cell disclosed herein and introducing a condensation agent or tagmentation inhibitor together with the DNA sample, wherein the condensation agent is selected from the group consisting of polycationic amines (e.g., spermidine, chitosan, protamine, etc.), polyethylene glycol, and histones, or the tagmentation inhibitor is selected from the group consisting of a cation (Zn 2+ ), a pH adjuster (e.g., glutamic acid), and a chromatin assembly kit; and incubating the DNA sample in the flow cell in the presence of a condensation agent or a tagmentation inhibitor, whereby tagmentation of the DNA sample is carried out in a portion of the first transposome complex 10 and the second transposome complex 10'.

[0268] In these examples, the percentage of transposome complexes 10, 10' that engage in tagmentation is lower than the percentage of transposome complexes 10, 10' that engage in tagmentation in the absence of a condensing agent or tagmentation inhibitor.

[0269] Spermidine, chitosan, and protamine are examples of DNA condensing agents. In one example, about 2 mM to about 10 mM of spermidine or chitosan or protamine can be added with the DNA sample. Spermidine, chitosan, and protamine are cationic polymers that create a compact, round structure when added with the DNA sample. The compact, round structure is effective in blocking a portion of the transposase 14, 14' from the DNA sample. Thus, less transposase 14, 14' can access the DNA sample for tagmentation. This increases the size of the DNA fragments resulting from tagmentation.

[0270] Polyethylene glycol is another example of a DNA condensing agent in the presence of sodium chloride. In one example, polyethylene glycol can be added to the DNA sample in an amount of more than 2% (by volume) with more than 25 mM NaCl. In some examples, polyethylene glycol can be added to the DNA sample in an amount of more than 5% (by volume) with more than 25 mM NaCl. Polyethylene glycol acts as a crowding agent when incorporated into the DNA sample, and is therefore effective in blocking some of the transposase 14, 14' from the DNA sample. Thus, less transposase 14, 14' can access the DNA sample for tagmentation. This increases the size of the DNA fragments resulting from tagmentation.

[0271] Zinc 2+ Cations such as Zn, or pH adjusters such as glutamic acid may be added as tagmentation inhibitors. These agents can be added to reduce the efficiency of tagmentation. In one example, Zn 2+ The cation may be present in the aqueous solution at a concentration ranging from about 0.02 mM to about 5 mM. In another example, glutamic acid may be present in the aqueous solution at a concentration ranging from about 0.25 mM to about 100 mM.

[0272] The chromatin assembly kit includes reagents that can generate assembled chromatin in the presence of a DNA sample. The chromatin packs a portion of the DNA, thus preventing transposase 14, 14' from accessing the DNA sample for tagmentation. This increases the size of the DNA fragments resulting from tagmentation.

[0273] Sample preparation As described herein, the DNA sample is introduced into a flow cell where tagmentation is performed. Some exemplary methods disclosed herein include preparing a DNA sample. One exemplary method includes exposing a sample selected from the group consisting of whole blood, tissue sample, blood spot, and saliva to an inorganic salt-free lysis buffer containing serine protease, less than 2 mM ethylenediaminetetraacetic acid, a chaotropic agent, and water at the active temperature of the protease, thereby extracting deoxyribonucleic acid from the whole blood sample and generating a crude lysate; inactivating the protease in the crude lysate using heat or an inhibitor; and adding a chelating agent of a chaotropic agent to the crude lysate to generate a complexed crude lysate.

[0274] In this exemplary method, the sample is first exposed to a lysis buffer that does not contain inorganic salts at a temperature at which the proteases in the lysis buffer are active. During exposure to the lysis buffer, gDNA is extracted from white blood cells in the sample. In one example of this method, the volume of the sample ranges from about 20 μL to about 50 μL.

[0275] The inorganic salt-free lysis buffer comprises, and in some instances consists of, a protease (e.g., a serine protease, such as heat labile proteinase K, trypsin, etc.), less than 2 mM ethylenediaminetetraacetic acid (EDTA), a chaotropic agent, and water.

[0276] A protease (e.g., a serine protease such as proteinase K, heat-labile proteinase K, or trypsin) is included in the inorganic salt-free lysis buffer to digest proteins that may adversely affect the gDNA during extraction and to protect the extracted gDNA from nucleases. The temperature at which the protease is active will depend on the protease used. Proteinase K is active at temperatures ranging from about 25°C to about 65°C and can be fully inactivated at about 80°C. Alternatively, proteinase K can be inactivated when exposed to a protease inhibitor, such as tetrapeptidyl chloromethyl ketone (TCK). Heat-labile proteinase K is active at low temperatures ranging from about 20°C to about 40°C and can be fully inactivated at about 55°C. Trypsin is active at temperatures ranging from about 4°C to about 65°C and can be inactivated when exposed to a protease inhibitor, such as 4-(2-aminoethyl)-benzenesulfonyl fluoride. This type of protease inhibitor does not contain DNA contaminants and therefore can remain in the lysate during library preparation. The ability to inactivate proteases, such as proteinase K, heat labile proteinase K, or trypsin, helps minimize damage to enzymes used in downstream processes performed at higher temperatures (e.g., subsequent library preparation processes performed at higher temperatures). The inorganic salt-free lysis buffer contains 1 unit to 5 units of protease, i.e., a concentration ranging from about 5 units / mL to about 20 units / mL. In one example, the inorganic salt-free lysis buffer contains 3.6 units of heat labile proteinase K. In another example, the inorganic salt-free lysis buffer contains about 0.8 mg / mL of proteinase K.

[0277] The inorganic salt-free lysis buffer contains less than 2 mM ethylenediaminetetraacetic acid (EDTA). For DNA extraction from whole blood samples, EDTA may be used as a chelating agent to chelate metal ions present in enzymes, which act as a cofactor to increase the catalytic activity of the enzyme. Although EDTA readily inactivates DNase enzymes (which digest DNA), some of the metal ions chelated by EDTA may be desirable for enzymatic activity occurring in subsequent library preparation techniques. The relatively low EDTA concentration in the inorganic salt-free lysis buffer allows for desirable metal ion chelation during the lysis procedure without inhibiting the activity of these enzymes during library preparation. In one example, the concentration of EDTA ranges from about 0.5 mM to 1.5 mM. In another example, the concentration of EDTA is about 1 mM.

[0278] The inorganic salt-free lysis buffer includes a chaotropic agent. Chaotropic agents can be useful in DNA extraction, but can also act as inhibitors of enzymatic reactions occurring during library preparation. One example of a chaotropic agent is sodium dodecyl sulfate (SDS), which inhibits the transposase Tn5 used during the tagmentation reaction. Another example of a chaotropic agent is guanidine hydrochloride. In one example, the chaotropic agent is present in the inorganic salt-free lysis buffer in an amount of about 0.1% w / v to about 0.5% w / v. As one particular example, the chaotropic agent is present in the inorganic salt-free lysis buffer in an amount of about 0.2% w / v.

[0279] The remainder of the lysis buffer, without inorganic salts, is water, such as deionized water or other form of purified water.

[0280] In some examples, the inorganic salt-free lysis buffer also includes a suitable lysis buffer additive, such as a neutral buffer, e.g., Tris-HCl (pH 8), and a non-ionic surfactant, e.g., TWEEN® 20 (a polyoxyethylene sorbitol ester commercially available from Croda, Inc.). The neutral buffer may be present at a concentration ranging from about 25 mM to about 100 mM, and the non-ionic surfactant may be present in an amount ranging from about 0.5% active w / v to about 0.75% active w / v. In one example, the inorganic salt-free lysis buffer includes about 50 mM Tris-HCl (pH 8), and about 0.5% active w / v TWEEN® 20.

[0281] As described herein, the lysis buffer does not contain inorganic salt(s).Inorganic salt(s), including sodium chloride, may be beneficial during DNA extraction, but it / they may also function as inhibitors of one or more enzyme(s) used in library preparation process.The elimination of inorganic salts contributes to the fact that the complex crude lysate disclosed herein does not need to undergo purification before being used in library preparation.

[0282] Exposure of the whole blood sample to a lysis buffer free of inorganic salts at the lysis temperature produces a crude lysate. The proteases in the crude lysate are then inactivated using heat or inhibitors. The inactivation agent used depends on the proteases present.

[0283] In another example, the temperature of the crude lysate (and contents contained therein) can be raised to about 55° C., which inactivates the heat labile Proteinase K. In another example, the temperature of the crude lysate (and contents contained therein) can be raised to about 80° C., which inactivates Proteinase K. It is understood that the inactivation temperature can vary depending on the protease used.

[0284] In other examples, inhibitors may be added to the crude lysate. In one specific example, when the inorganic salt-free lysis buffer contains trypsin, the step of inactivating trypsin in the crude lysate includes exposing the crude lysate to an inhibitor, where the inhibitor is 4-(2-aminoethyl)-benzenesulfonyl fluoride. In another specific example, when the inorganic salt-free lysis buffer contains proteinase K, the step of inactivating proteinase K in the crude lysate includes exposing the crude lysate to an inhibitor, where the inhibitor is tetrapeptidyl chloromethyl ketone (TPK). In one example, the ratio of inhibitor:serine protease ranges from 1:1: to 50:1. In one example, the inhibitor (e.g., TPK) introduced to the flow cell is present in an example tagmentation buffer in an amount ranging from about 0.04 mg / mL to about 0.1 mg / mL. Any inhibitor selected should be free of DNA contaminants so that the crude lysate containing the inhibitor can be used in library preparation without first being exposed to purification.

[0285] After or when the proteases in the crude lysate (e.g., proteinase K, heat labile proteinase K, or trypsin) are inactivated, a chaotropic chelator is added to the crude lysate to generate a complex crude lysate. The chelator used depends on the chaotropic agent used. As an example, the chaotropic chelator is a cyclodextrin selected from the group consisting of alpha cyclodextrin, beta cyclodextrin, and methyl beta cyclodextrin. As mentioned above, cyclodextrins are cup-shaped structures with a hydrophilic exterior and a hydrophobic core. These compounds have the ability to form complexes with hydrophilic molecules, such as SDS or other chaotropic agents, in the lysis buffer. In particular, the long hydrophobic tail of SDS is drawn into the cup of the cyclodextrin, which effectively immobilizes SDS after lysis and prevents it from denaturing enzymes, including those used in downstream library preparation. Thus, the complex crude lysate can be used directly in library preparation without first being exposed to purification.

[0286] In some examples, the chelating agent is in a dry form, and the dry form of the chelating agent is part of an encapsulation complex that includes a coating material that surrounds the dry form of the chelating agent. The chelating agent may be lyophilized or otherwise dried to form microspheres that are then encapsulated by the coating material. In these examples, adding the chelating agent to the crude lysate includes adding the encapsulated complex to the crude lysate, then inducing release of the chelating agent in dry form from the encapsulation complex, and rehydrating the chelating agent in dry form. Rehydration of the chelating agent precedes any activity of the chelating agent. The release mechanism used depends on the type of coating material that surrounds the chelating agent in dry form.

[0287] In one example, the coating material is a temperature sensitive wax, and the step of inducing the release of the chelating agent in dry form includes heating the crude melt above the melting temperature of the temperature sensitive wax. Some examples of suitable temperature sensitive waxes include paraffin wax, or soy wax, each of which melt at a temperature ranging from about 40° C. to about 50° C. Other examples of suitable temperature sensitive waxes include beeswax, microcrystalline polyethylene wax, or carnauba wax, each of which melt at a temperature ranging from about 60° C. to about 80° C. In these examples, the crude melt is heated to a desired temperature to melt the wax and release the chelating agent in dry form. The chelating agent can be rehydrated and sequester the chaotropic agent to form a complex crude melt. Rehydration can be accomplished using water or other aqueous rehydration solutions.

[0288] In other examples, the coating material is a temperature-sensitive polymer, and the step of inducing the release of the chelating agent in dry form comprises heating the crude lysate above the solubilization temperature of the temperature-sensitive polymer. Examples of suitable temperature-sensitive polymers include poly(acrylamide-co-acrylonitrile), agarose, or gelatin, each of which is solubilized at temperatures above 30° C. Other examples of suitable temperature-sensitive polymers include poly(N-isopropylacrylamide), methylcellulose, or poloxamer, each of which is solubilized at temperatures below 30° C. In these examples, the crude lysate is heated to a desired temperature to solubilize the polymer and release the chelating agent in dry form. The chelating agent can be rehydrated (e.g., with water or an aqueous solution) to sequester the chaotropic agent and form a complex crude lysate.

[0289] In yet another example, the coating material is a pH-sensitive polymer and the step of inducing the release of the chelating agent in the dry form includes adjusting the pH of the crude lysate. Examples of suitable pH-sensitive polymers include EUDRAGIT® L100 (methacrylic acid copolymer, type B from Evonik, Inc.) or KOLLICOAT® MAE-100 (methacrylic acid copolymer, type A from BASF Corp.), each of which is soluble at a pH above 6. Other examples of suitable pH-sensitive polymers include EUDRAGIT® RL / RS 100 (ammonio methacrylate from Evonik, Inc.) or carboxymethyl cellulose, each of which is soluble at a pH above 8. Still other examples of suitable pH-sensitive polymers include EUDRAGIT® E (aminodimethyl methacrylate copolymer from Evonik, Inc.) or chitosan, each of which is soluble at a pH below 3. In these instances, the pH of the crude lysate is adjusted below the pH to which the polymer is sensitive (e.g., if solubility is at or below pH X) or above the pH to which the polymer is sensitive (e.g., if solubility is at or above pH X), and the polymer solubilizes. Solubilization of the polymer releases the chelating agent in a dry form. The chelating agent can be rehydrated as described herein to sequester the chaotropic agent and form a complexed crude lysate.

[0290] In further examples, the coating material is a time-sensitive polymer, and the step of inducing the release of the chelating agent in dry form includes incubating the encapsulated complex in the crude lysate for a predetermined time. Examples of suitable time-sensitive polymers include hydroxypropyl methylcellulose (a commercially available example of which is METHOCEL® from DuPont), ethylcellulose (a commercially available example of which is ETHOCEL® from DuPont), cellulose acetate (a commercially available example of which is OPADRY® CA from Colorcon), and poly(lactic-co-glycolic acid). In these examples, the crude lysate with the encapsulated complex therein is incubated for a predetermined time that depends on the type of polymer, the thickness of the polymer coating, and the temperature and configuration (e.g., pH) of the reaction that occurs. Over time, the polymer degrades, releasing the chelating agent in dry form. The chelating agent can be rehydrated and sequester the chaotropic agent to form the crude lysate of the complex.

[0291] The encapsulated complex may be formed by forming a dispersion of the coating material, spray coating the dispersion onto a dry form of the chelating agent in a fluidized bed, and drying the complex. Other suitable coating techniques (e.g., pan coating, spray drying, etc.) may be used to effectively form a film of the coating material on the dry form of the chelating agent.

[0292] The chelator (encapsulated or not) may be mixed with a tagmentation buffer, such as a combination of Tris-acetate, magnesium acetate, and water. The use of a tagmentation buffer may be particularly desirable when a complex crude lysate is used in the tagmentation library preparation process. It should be understood that the tagmentation buffer may initiate the release of the chelator in dry form, and thus the incorporation of the encapsulated chelator and tagmentation buffer may depend on the coating of the encapsulated chelator, its solubility characteristics, and the desired timing to achieve complex formation.

[0293] In some instances, inhibitors of proteases and chelators of chaotropic agents (whether encapsulated or not) may also be mixed with the tagmentation buffer. In this instance, inactivation of proteases and generation of complex crude lysate may occur simultaneously.

[0294] When incorporated into the tagmentation buffer, the amount of chelating agent can range from about 2% w / v to about 5% w / v.

[0295] The complex crude lysate can then be subjected to a library preparation technique. The extracted DNA sample in the complex crude lysate can be subjected to tagmentation or any library preparation technique that fragments longer fragments of genetic material and incorporates desired adapters at the ends of the fragments.

[0296] In one example, the complex crude lysate disclosed herein may be introduced into any of the examples of flow cells disclosed herein, and flow cell tagmentation may be performed as described herein. Thus, some examples of the method include introducing the complex crude lysate into a flow cell containing transposome complexes 10, 10' and primers 36, 36' immobilized on a surface within the flow cell. In this example, the extracted deoxyribonucleic acid (in the complex crude lysate) is exposed to tagmentation by introducing a tagmentation buffer into the flow cell as the complex crude lysate is introduced, and bringing the flow cell to a temperature of 30° C. or higher (as described herein with reference to FIG. 1C). In this example, the transposase 14, 14' may be removed, and amplification is performed by introducing a wash solution into the flow cell, heating the flow cell containing the wash solution to about 60° C., and then introducing an extension amplification mix into the flow cell (as with reference to FIG. 1D).

[0297] In one example, the DNA sample preparation methods disclosed herein, i.e., the exposing, inactivating, and adding steps, are performed in a lysis tube or chamber that is not mounted on a flow cell.

[0298] If a lysis tube is used, the complex crude lysate can be loaded from the lysis tube into the sample input port of the sequencing instrument, and the fluid delivery system of the sequencing instrument then delivers the complex crude lysate to the flow cell for tagmentation and subsequent processing.

[0299] The chamber may be a DNA sample preparation chamber, which is a component of a sequencing instrument. Thus, when the chamber is used, the complex crude lysate may be transported from the chamber to a flow cell for tagmentation and subsequent processing.

[0300] Another exemplary sample preparation method includes exposing a cell sample to a zinc oxide nanomaterial at a temperature ranging from about 18° C. to about 25° C., thereby initiating detergent-free extraction of deoxyribonucleic acid or ribonucleic acid from the cell sample to generate a crude lysate, and exposing the extracted deoxyribonucleic acid or ribonucleic acid in the crude lysate to tagmentation. In one example, the zinc oxide nanomaterial is added to the cell sample. In another example, the zinc oxide nanomaterial is dispersed in water and the dispersion is added to the cell sample. In the latter example, the cell sample may be in the form of a cell pellet that is added to the zinc oxide nanomaterial dispersion.

[0301] The cell sample can be from any eukaryotic or prokaryotic cell, as well as fungal cells. Some examples of cell samples include whole blood, bone marrow aspirate, serum, plasma, tissue, blood spots, saliva, and other bodily fluids.

[0302] The zinc oxide nanomaterial may be in the form of nanoparticles, nanotubes, nanowires, etc. The nanoparticles may have an average particle size ranging from about 1 nm to about 1000 nm. The nanotubes or nanowires may have an average diameter ranging from about 1 nm to about 1000 nm. In one example, the zinc oxide nanoparticles have an average particle size ranging from about 10 nm to about 950 nm. In one example, the zinc oxide nanoparticles have an average particle size of about 300 nm. The average particle size may represent an average value of a distribution of particles that may be related to the basis of distribution calculations (number, surface area, or volume). Thus, in some examples, the average particle size may represent a volume average diameter, a number average diameter, or a surface average diameter. The average particle size may be determined using a particle size analyzer, or using X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), etc. The use of zinc oxide nanomaterials allows this DNA or RNA extraction to be surfactant-free.

[0303] At the beginning of this exemplary method, the cell sample and zinc oxide nanomaterial are mixed together in a volume:volume ratio of 1.5:1 to 1:1.5. volume ratio or volume:weight ratio. In one example, the cell sample and zinc oxide nanomaterial are mixed together in a volume of 1:1. volume ratio or volume:weight ratio. In one example of the method, the volume of each of the cell sample and zinc oxide nanoparticles ranges from about 20 μL to about 100 μL. The cell sample and zinc oxide nanomaterial are mixed together and incubated for a time period ranging from about 2 minutes to about 30 minutes. During the incubation, the cells are disrupted, which results in DNA or RNA extraction. The mechanism by which the disruption occurs is the release of excess Zn from the zinc oxide nanomaterial. 2+ This could be a chemical mechanism whereby zinc oxide nanomaterials adsorb to the cell membrane surface and then penetrate the cell wall causing destruction, and / or a biological mechanism whereby zinc oxide nanomaterials induce a reactive oxygen species (ROS) response leading to apoptotic cell death and the collapse of cellular structures.

[0304] DNA (e.g., gDNA) or RNA extraction using zinc oxide nanomaterials can be performed at room temperature, e.g., about 18°C ​​to about 25°C, and therefore, no additional heating or heating equipment is utilized.

[0305] In one example, a crude lysate is generated in a sample collection device (e.g., a lysis tube, a MITRA® tip, a dried blood spot card, etc.) and zinc nanomaterials are dried onto the surface of the sample collection device. In this example, the addition of a cell sample activates the lysis.

[0306] In some examples, the zinc oxide nanomaterial is mixed with a protease. A protease (e.g., a serine protease, e.g., a thermolabile proteinase K) may be included to digest proteins that may adversely affect the DNA or RNA during extraction and to protect the extracted DNA or RNA from nucleases. The protease may be added in an amount ranging from 1 unit to 5 units, i.e., at a concentration ranging from about 5 units / mL to about 20 units / mL. The temperature at which the protease is active will depend on the protease used. Thermolabile proteinase K is active at low temperatures ranging from about 20°C to about 40°C and can be completely inactivated at about 55°C. The ability to inactivate proteases (e.g., a thermolabile proteinase K) helps minimize damage to enzymes used in downstream processes performed at higher temperatures (e.g., subsequent library preparation processes performed at higher temperatures).

[0307] When the cell sample is a blood sample, hemoglobin interference may occur. To avoid hemoglobin interference, the zinc nanomaterial can be mixed with a hemoglobin capture agent, such as HemogloBind® (manufactured by Biotech Support Group) and EasySep™ Direct RapidSpheres® (manufactured by StemCell Technologies). Each of these hemoglobin capture agents can be used as directed by the manufacturer.

[0308] As noted herein, zinc oxide nanomaterials can induce the production of reactive oxygen species. These species can potentially damage extracted DNA or RNA, and therefore it may be desirable to add a ROS scavenger to reduce the potential for extracted DNA or RNA damage. The amount of ROS scavenger can depend on the amount of zinc present. In one example, the ROS scavenger is added in an amount ranging from about 2 mM to about 50 mM.

[0309] Exposure of the cell sample to the zinc oxide nanomaterial produces a crude lysate, which can then be exposed to a library preparation technique.

[0310] In some examples of this method, the zinc oxide nanomaterial is combined with a protease, and prior to exposing the extracted deoxyribonucleic acid in the crude lysate to tagmentation, the method further comprises the step of inactivating the protease using heat. For example, the temperature of the crude lysate (and contents contained therein) can be raised to about 55° C., which inactivates the thermolabile proteinase K. It should be understood that the inactivation temperature can vary depending on the protease used.

[0311] For library preparation, the extracted DNA or RNA sample in crude lysate can be subjected to tagmentation or any other library preparation technique that fragments longer pieces of genetic material (s) and incorporates desired adapters at the ends of the fragments.

[0312] In one example, the crude lysate produced via this example of the method may be introduced into any example of a flow cell disclosed herein, where on-flow cell tagmentation may be performed as described herein. Thus, some examples of the method include introducing the crude lysate into a flow cell that contains transposome complexes 10, 10' and primers 36, 36' immobilized on a surface within the flow cell. In this example, the extracted deoxyribonucleic acid or ribonucleic acid (in the crude lysate) is exposed to tagmentation by introducing a tagmentation buffer into the flow cell at the time the crude lysate is introduced and bringing the flow cell to a temperature of 30° C. or higher (as described herein with reference to FIG. 1B). In this example, the tagmentation buffer includes water, an optional co-solvent (e.g., dimethylformamide), and a buffer salt (e.g., Tris acetate, pH 7.6). Some examples of this tagmentation buffer also include a metal cofactor (e.g., magnesium acetate). The crude lysate is subjected to Zn 2+ Since the tagmentation buffer in this example contains zinc oxide, the tagmentation buffer in this example may alternatively not contain a metal cofactor (e.g., magnesium acetate) for the transposase of the transposome complex. In this particular example, zinc oxide material can be used in excess. After tagmentation, the transposase is removed, and amplification can be performed by heating the flow cell to about 60° C., flushing a wash solution through the flow cell (as described with reference to FIG. 1C), and introducing an amplification mixture into the flow cell.

[0313] In one example, the DNA sample preparation method utilizing zinc oxide nanomaterials is carried out in a chamber that is not mounted on a flow cell. The chamber may be a DNA sample preparation chamber that is a component of a sequencing instrument. Thus, if a chamber is used, crude lysate can be transported from the chamber to a flow cell for on-flow cell tagmentation and subsequent processing.

[0314] In another example, the DNA sample preparation method utilizing zinc oxide nanomaterials and tagmentation is performed in a lysis tube. When a lysis tube is used, bead-based tagmentation or solution-based tagmentation may be used.

[0315] For bead-based tagmentation, a solid support (i.e., a bead) has surface-bound transposome complexes (similar to 10, 10') and surface-bound primers (similar to 36, 36'). Tagmentation occurs on the surface of the solid support, such that the resulting DNA fragments are bound to the surface. The solid support, including the tagmentation buffer, surface-bound transposome complexes and surface-bound primers, is introduced into a lysis tube, where tagmentation, ligation, and extension are performed (e.g., as described in Figures 1A-1C). In this example, the tagmentation buffer includes water, optional co-solvents (e.g., dimethylformamide), buffer salts (e.g., Tris acetate, pH 7.6), recombinase, polymerase, accessory proteins, and optional metal cofactors.

[0316] In the case of solution-based tagmentation, tagmentation is performed in solution using floating transposomes and primers. A tagmentation buffer is introduced into a lysis tube where tagmentation, ligation, and extension are performed (e.g., as described in Figures 1A-1C). In this example, the tagmentation buffer includes transposomes, primers, water, optional cosolvents (e.g., dimethylformamide), buffer salts (e.g., Tris acetate, pH 7.6), recombinase, polymerase, accessory proteins, and optional metal cofactors.

[0317] Dry Reagents In any of the examples described herein, one or more of the reagents for flow cell preparation and / or sample preparation may be dried and stored in the cartridge before being introduced onto the flow cell. Drying may be performed using freeze drying, spray drying, vacuum drying, or microwave drying. Each of the dried reagents may be reconstituted in water before being used to prepare the flow cell and / or sample.

[0318] Lyophilization is a freeze-drying process in which water is removed from reagents after they are frozen and placed under vacuum. Lyophilization can be carried out at temperatures ranging from about -30°C to about -50°C, and pressures ranging from about 30 MPa to about 90 MPa. This process produces solid microspheres of the reagent components, which are therefore more condensed (than the corresponding liquids) and more stable for storage and transport.

[0319] In one example, the transposome buffer is dried. The transposome buffer is used to introduce the transposome complexes 10, 10', 10A, 10B, 10C, 10D into the flow cell. The transposome buffer contains any example of the transposomes 10, 10', 10A, 10B, 10C, 10D in a buffer solution. Before drying, the transposome buffer solution may contain a buffering agent (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN® polysorbate), optionally a lyophilization excipient (e.g., trehalose), and water.

[0320] In another example, streptavidin is dried. According to some of the methods disclosed herein, streptavidin is used to bind transposome complexes 10, 10', 10A, 10B, 10C, 10D to biotinylated polymer hydrogels. Prior to drying, streptavidin may be contained in a buffer solution that contains a buffering agent (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN® polysorbate), optionally a lyophilization excipient (e.g., trehalose), and water.

[0321] In yet another example, the inorganic salt-free dissolution buffer disclosed herein can be dried. Any example of the inorganic salt-free dissolution buffer may be dried. When lyophilization is used, any example of the inorganic salt-free dissolution buffer disclosed herein is mixed with a lyophilization excipient before lyophilization is performed.

[0322] In yet another example, the tagmentation buffers disclosed herein may be dried. Any example of the tagmentation buffer may be dried. If lyophilization is used, any example of the tagmentation buffers disclosed herein are mixed with a lyophilization excipient before lyophilization is performed.

[0323] In any of the lyophilized reagents, the lyophilization excipients may be present at a concentration ranging from about 200 mM to about 700 mM.

[0324] Sequencing Instruments Any example of a flow cell can be incorporated into a sequencing instrument that includes a flow cell receptacle, a fluidic control system including delivery fluids that each deliver a DNA sample (e.g., a complex crude lysate), wash solutions, extension amplification mix, and other reagents to a flow cell disposed in the flow cell receptacle, an illumination system positioned to illuminate the flow cell positioned in the flow cell receptacle, a detection system positioned to capture images of the flow cell positioned in the flow cell receptacle, and a controller in operative communication with the fluidic control system, the illumination system, and the detection system. When in the proper position, the flow cell is in fluid communication with the fluidic control system (e.g., pumps, valves, etc.) and in optical communication with the illumination system and the detection system.

[0325] The sequencing instrument may also include a DNA sample preparation chamber, where, for example, a whole blood sample (e.g., a complex crude lysate) or other similar sample is introduced and exposed to lysis or other techniques, and then introduced into the flow cell for tagmentation, amplification, and sequencing. The DNA sample preparation chamber may have a heater in position to heat the sample introduced therein to a desired temperature. Fluid delivery lines may connect the DNA sample preparation chamber and the flow cell, and a valve may be positioned at the input port of the flow cell to open and close the flow cell.

[0326] The fluidic system of the sequencing instrument may also include a receptacle for receiving a reagent cartridge (an example of which is shown diagrammatically in FIG. 24 at reference numeral 76). Reagent cartridge 76 includes a fluid input port 78 that can receive a sample (e.g., a blood sample, a bone marrow aspirate, etc.) and fluidic receptacles 80A, 80B, 80C, 80D that are isolated from one another for storing different reagents (liquid or dry form). Although not shown in FIG. 24, each fluidic receptacle 80A, 80B, 80C, 80D is selectively fluidly connected to a fluidic line that can deliver reagents contained therein to a mixing chamber (not shown) for reconstitution prior to delivery to the flow cell (reference numeral 74 in FIG. 24), or to the flow cell 74 when both the reagent cartridge 76 and the flow cell 72 are inserted into their respective positions within the sequencing instrument.

[0327] kit Any of the flow cells and reagents disclosed herein may be included in a tagmentation kit. An exemplary kit is shown in Figure 24. In one example, kit 72 includes a flow cell 74 and a reagent cartridge 76. Flow cell 74 may be any of the examples described herein.

[0328] In some exemplary kits 72, the flow cell 74 includes immobilized transposome complexes 10, 10' or 10A, 10B described herein, and the kit 72 further includes a tagmentation buffer, a lysis buffer without inorganic salts, and / or an inhibitor of a chaotropic agent. In one example, the kit 72 includes a combined tagmentation buffer and an inhibitor of a chaotropic agent. Each of these fluids can be contained within a separate receptacle, 80A, 80B, 80C, 80D, of the reagent cartridge 76.

[0329] In another exemplary kit 72, flow cell 74 contains different chemicals for assembling transposome complex 10C and for binding transposome complex 10D (as described herein), and kit 72 further includes a transposome buffer with components for forming transposome complex 10C, a second transposome buffer with transposome complex 10D, and a tagmentation buffer. Each of these fluids can be contained within separate receptacles 80A, 80B, 80C of reagent cartridge 76. This exemplary kit 72 may also include any of the lysis buffers, inhibitors, or other fluids disclosed herein.

[0330] In yet other exemplary kits 72, flow cell 74 does not initially contain any of the transposomes disclosed herein.

[0331] In one example of this type of kit 72, a reagent cartridge 76 is loaded with reagent(s) for introducing transposomes 10, 10'. For example, a flow cell 74 may include a substrate 40 having recesses 12 separated by a gap region 38, first and second primers 36, 36' immobilized in each of the recesses 12, and a biotin-containing linker 42 immobilized in each of the recesses 12 (e.g., bound to a polymer hydrogel 24). The reagent cartridge 76 may include a fluid input port 78, and receptacles 80A, 80B, 80C, 80D each containing a transposome buffer and a tagmentation buffer, each containing a first transposome complex 10, each having a first amplification domain 26 and a 5' biotinylated end 22, and a second transposome complex 10', each having a second amplification domain 26' and a 5' biotinylated end 22'.

[0332] In another example of this type of kit 72, a reagent cartridge 76 is loaded with reagent(s) to prepare the flow cell surface for transposome introduction and to introduce transposomes 10, 10'. For example, a flow cell 74 can include a substrate 40 having recesses 12 separated by gap regions 38, a first and second primer 36, 36' immobilized in each of the recesses 12, a reagent cartridge 76 including a fluid input port 78, and receptacles 80A, 80B, 80C, 80D each containing a transposome buffer including a biotin-containing linker 42, a first transposome complex 10 each having a first amplification domain 26 and a 5' biotinylated end 22, and a second transposome complex 10' each having a second amplification domain 26' and a 5' biotinylated end 22'.

[0333] In any of these exemplary kits 72, when the sample introduced into the reagent cartridge 76 is selected from the group consisting of whole blood, a tissue sample, a blood spot, and saliva, the reagent cartridge 76 may further include any example of an inorganic salt-free lysis buffer in one of the receptacles 80A, 80B, 80C, 80D. In these examples, i) the inorganic salt-free lysis buffer is a liquid and the inorganic salt-free lysis buffer further includes water, or ii) the inorganic salt-free buffer is a dry solid and the reagent cartridge 76 further includes a reconstitution fluid (e.g., water) in the other of the receptacles 80A, 80B, 80C, 80D. Also, in these examples, the reagent cartridge 76 may further include an inhibitor of the chaotropic agent in the other of the receptacles 80A, 80B, 80C, 80D.

[0334] First to use one transposome type Some of the examples disclosed herein utilize two different transposome complexes 10, 10' or 10A, 10B, etc. The exemplary method shown in FIG. 27 begins with one type of transposome complex 10 or 10' (but not both) in the flow cell recess 12, and then the other type of transposome complex 10' or 10 is introduced. In this manner, transposome complexes 10, 10' are loaded sequentially. One example of the method of FIG. 27 moves from A to B to C. Another example of the method moves from A to D. Yet another example of the method moves from A to E to F.

[0335] Next, the exemplary method of FIG. 27, including A, B, and C, will be described. In FIG. 27, A, a portion of the bottom surface of the recess 12 is shown. The recess 12 includes a polymer hydrogel 24, one type of transposome complex 10 immobilized on the polymer hydrogel 24, and primers 36, 36' immobilized on the polymer hydrogel 24. The immobilization can be achieved using any of the functional groups described herein. In one example, the polymer hydrogel 24 includes azide or tetrazine surface groups, and the 5' end groups of the complex 10 and the primers 36, 36' each include a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)).

[0336] As described herein, one (first) type of transposome complex 10 comprises a transposon end 16 having a portion 30 of the transferred strand 18 hybridized to the non-transferred strand 20, 32, where the transferred strand 18 comprises a first amplification domain 26.

[0337] This exemplary method includes the steps of generating double-stranded DNA fragments 35, 37 on a flow cell surface using a plurality of surface-bound first type transposome complexes 10, each of which is bound at their 5' end to the 3' end of a first transferred strand 18 (see FIG. 27B), and introducing a plurality of second type transposome complexes 10' into the flow cell, thereby tagmenting the double-stranded DNA fragments 35, 37 to generate new double-stranded DNA fragments 351, 371 and 352, 372, each of which is bound at its 5' end to the 3' end of a second transferred strand 18' (see FIG. 27C).

[0338] In this example, generating double-stranded DNA fragments 35, 37 includes introducing a DNA sample and a tagmentation buffer into a flow cell and performing tagmentation of the DNA sample using a first type of transposome complex 10. Details of tagmentation are described herein with reference to FIG. 1C. After tagmentation, the flow cell may be flushed with examples of wash solutions disclosed herein.

[0339] A second type of transposome complex 10' is then introduced into the flow cell. The previously fragmented DNA fragments 35, 37 are fragmented again, and the 5' ends of the newly fragmented strands 371, 352 are ligated to the 3' ends of each of the transferred strands 18' of the transposome complex 10'. A second tagmentation is shown in FIG. 27C. In this example, the second occurrence of tagmentation can occur at a temperature of 30° C. or higher. In one example, the temperature can range from about 30° C. to about 55° C.

[0340] The second tagmentation results in fragmented new DNA fragments 351, 371 and 352, 372. The 5' ends of 351, 371 bind to transferred strands 18, 18' of different transposome complexes 10, 10', respectively, and the 5' ends of 352, 372 bind to transferred strands 18', 18' of different transposome complexes 10', 10', respectively. As shown in C, the 3' ends of the newly fragmented strands 351, 372 are not ligated to the 5' end of the non-transferred strand 32' (from complex 10'). Thus, there is a gap between the 3' end of the DNA fragment strands 351, 372 and the 5' end of the corresponding non-transferred strand 32'.

[0341] The method then includes removing the transposase enzymes 14, 14' of the first and second type transposome complexes 10, 10', respectively, and performing an extension reaction to add additional adapters to the new double-stranded DNA fragments.

[0342] The transposase enzyme 14, 14' can be removed using SDS or other chaotropic agents, or heat, as described herein. If SDS or other chaotropic agents are used for transposase removal, a wash solution can be flushed through the flow path before initiating the extension reaction. This removes the chaotropic agent, which may interfere with downstream enzyme activity. Alternatively, a chelator of the chaotropic agent can be introduced, as described herein.

[0343] To initiate the extension reaction, an extension amplification mix is ​​placed into the flow cell. An exemplary extension amplification mix includes a recombinase, a polymerase, and accessory proteins. The flow cell can be at about 38° C. when the extension amplification mix is ​​introduced.

[0344] Prior to the extension reaction, the non-transferred strands 32, 32' may first be dehybridized using heat.

[0345] Additional sequences (adapters) are added to the 3' ends of the partially matched fragments by an extension reaction using an exclusion amplification reagent (e.g., ExAmp reagent available from Illumina Inc.). The extension reaction involves the template-dependent addition of nucleotides from the 3' ends of DNA fragments 351, 371 and 352, 372 using each transferred strand 18, 18' as a template. The sequences resulting from the extension reaction render the partially matched DNA fragments 351, 371 and 352, 372 fully matched and ready for further amplification and cluster generation. Cluster generation can be performed as described herein with reference to FIG. 1C.

[0346] In this example, the density of transposome complexes 10 introduced onto the flow cell surface is controlled at a low level (e.g., <0.05 μM) so that (desirably) one transposome complex 10 is loaded into one recess 12.

[0347] Next, the exemplary method of FIG. 27 including A and D will be described. In this example, one tagmentation process is performed off the flow cell and a second tagmentation process is performed on the flow cell. The method includes the steps of tagmenting a DNA sample in solution using a plurality of transposome complexes 10′, each including a transposon end 16′ with a portion of the transferred strand 18′ hybridized to the non-transferred strand 20′, the transferred strand 18′ including an amplification domain 26′ and an index sequence 86, thereby generating double-stranded fragments 35, 37, each attached at its 5′ end to the 3′ end of the transferred strand 18′, and transferring the solution including the double-stranded DNA fragments 35, 37 to a plurality of other types of transposomes immobilized on their surfaces. and introducing into a flow cell the complex 10 and another type of transposome complex 10, in which a portion of the transferred strand 18 comprises a transposon end 16 hybridized to the non-transferred strand 20, where the transferred strand 18 hybridized to the non-transferred strand 20 comprises an amplification domain 26 and does not comprise an index sequence, thereby tagmenting the double-stranded DNA fragments 35, 37 to generate new double-stranded DNA fragments 353, 373, 354, 374, each attached at its 5' end to the 3' end of the transferred strand 18.

[0348] The tagmentation process carried out away from the flow cell is shown between A and D of FIG. 27. In this example, the DNA sample and transposome complex 10' are added to a tagmentation buffer in a reaction vessel. In solution, the DNA sample is tagmented. Although transposome complex 10' is shown, it should be understood that complex 10 can be used for tagmentation in solution. Additionally, complex 10 bound to the flow cell surface can also include an index / barcode sequence.

[0349] The tagmented double-stranded DNA fragments 35, 37 with bound transposome complexes 10' are then introduced into a flow cell as shown in A. On the flow cell, the already fragmented DNA fragments 35, 37 are fragmented again, and the 5' ends of the newly fragmented strands 373, 354 are tagmented to the respective 3' ends of the transferred strands 18 of the surface-bound transposome complexes 10. The second tagmentation is shown in D of FIG. In this example, the second occurrence of fragmentation can occur at a temperature of 30° C. or higher. In one example, the temperature can range from about 30° C. to about 55° C.

[0350] The second tagmentation results in new fragmented DNA fragments 353, 373 and 354, 374. The 5' ends of 353, 37 bind to transferred strands 18', 18 of different transposome complexes 10', 10', respectively, and the 5' ends of 354, 374 bind to transferred strands 18, 18' of different transposome complexes 10, 10', respectively. As shown in E, the 3' ends of the newly fragmented strands 353, 374 are not ligated to the 5' end of the non-transferred strand 32 (from complex 10). Thus, there is a gap between the 3' end of the DNA fragment strands 353, 374 and the 5' end of the corresponding non-transferred strand 32.

[0351] The method then includes removing the transposase enzymes 14, 14' of the first and second type transposome complexes 10, 10', respectively, and performing an extension reaction to add additional adapters to the new double-stranded DNA fragments.

[0352] Removal of transposase enzyme 14, 14' and extension reactions can be performed as described herein. The sequences resulting from the extension reactions fully match the partially matched DNA fragments 353, 373 and 354, 374, ready for further amplification and cluster generation. Cluster generation can be performed as described herein with reference to FIG. 1C.

[0353] 27, including A, E, and F, is described below. The method includes the steps of introducing one transposome complex 10 of a single type into a well 12 of a flow cell, the transposome complex 10 including a transposon end 16 having a portion 30 of a transferred strand 18 hybridized to a non-transferred strand 20, the transferred strand 18 including a first amplification domain 26; and introducing a DNA sample into the flow cell, whereby the one transposome complex tagmentes the DNA sample such that a first strand 35 is bound at its 5' end to the 3' end of the transferred strand 18 and is not bound at its 3' end to a second strand 26. generating double-stranded DNA fragments 35, 375 in which the second strand 375 is unbound at both its 3' and 5' ends (see FIG. 27E); and introducing into the flow cell a second type of transposome complex 10' in which a portion 30' of the second transferred strand 18' comprises a second transposon end 16' hybridized to a second non-transferred strand 20', the second transferred strand 18' comprising a second amplification domain 26', whereby the 5' end of the second strand 375 of the double-stranded DNA fragment is bound to the second transferred strand 18'.

[0354] In this example, the density of transposome complexes 10 introduced to the flow cell surface is controlled at a low level (e.g., <0.05 μM) such that (desirably) one transposome complex 10 is loaded into one recess 12. Thus, during tagmentation, the DNA sample is loosely bound such that one end is bound to a transposome complex 10 in recess 12 and the other end is suspended in the bulk tagmentation fluid (as shown at E).

[0355] After washing the flow cell with a washing solution, another transposome complex 10' may be introduced into the flow cell. The 3' end of the transferred strand 18' of the newly introduced transposome complex 10' binds to the 5' end of the second strand 375, thereby partially mating the second strand 375.

[0356] The method then includes removing the transposase enzymes 14, 14' of the first and second type transposome complexes 10, 10', respectively, and performing an extension reaction to add additional adapters to the new double-stranded DNA fragments.

[0357] Removal of the transposase enzyme 14, 14' and extension reaction can be performed as described herein. The sequences resulting from the extension reaction fully match the partially matched DNA fragments 35, 375, ready for further amplification and cluster generation. Cluster generation can be performed as described herein with reference to FIG. 1C.

[0358] The embodiments shown in A, E, and F of FIG. 27 may be arranged in combination with the methods shown in A, B, and C, where the tagmentation(s) shown in E and F may occur at or near the end of the DNA sample (e.g., not long enough to reach the next anchored transposome complex 10).

[0359] To further illustrate the present disclosure, examples are provided herein. It should be understood that these examples are provided for illustrative purposes and are not to be construed as limiting the scope of the present disclosure.

[0360] Non-limiting examples Example 1 A flow cell was used containing PAZAM and grafted P5 and P7 primers in the wells.

[0361] A P5 primer with a 3' mosaic end and a 5' BCN linker was mixed with an equal amount of a complementary mosaic end (containing a 5' phosphate). The mixture was incubated at about 95°C for about 2 minutes and then cooled to 10°C at a rate of -0.1°C / sec. This formed transposon P5. Transposon P5 was mixed with 2 times the amount of Tn5 transposase in a buffer solution and the mixture was incubated at 37°C for 12 to 24 hours. This formed BCN-P5 transposomes. The same procedure was performed using a P7 primer with a 3' mosaic end to form BCN-P7 transposomes.

[0362] BCN-P5 and BCN-P7 transposome complexes were grafted onto PAZAM in two different flow cells. BCN-P5 and BCN-P7 transposome complexes were diluted in sodium sulfate grafting buffer to form a transposome mixture. The flow cells were washed with deionized water, flushed with sodium sulfate solution, and heated to 37°C. The transposome mixture was added to each flow cell and incubated for approximately 2 hours. After the desired incubation period, the flow cells were flushed with buffer and cooled to room temperature.

[0363] DNA samples were prepared in water to give a total input of 300 ng to 800 ng. Additional water was added along with the tagmentation buffer.

[0364] As a control, a DNA sample (approximately 150 μL) was introduced into one of the flow cells and tagmentation was allowed to occur. Controls were performed in duplicate.

[0365] In one example, the DNA sample (approximately 150 μL) was introduced with 5 mM spermidine to allow tagmentation to occur. The example was performed twice.

[0366] The insert size of the tagmented control DNA sample and the tagmented example DNA sample was determined by sequencing and aligning the data using Illumina's Dynamic Read Analysis for Genomics (DRAGEN) software. The results are shown in Figure 6. As shown, the presence of spermidine increased the insert size.

[0367] Example 2 A flow cell was used containing PAZAM and grafted P5 and P7 primers in the wells.

[0368] As controls, we used the BCN-P5 and BCN-P7 transposome complexes from Example 1. They were introduced into the control flow cell in the same manner as described in Example 1.

[0369] As an example, BCN-P5 and BCN-P7 transposome complexes without a 5' phosphate on the non-transferred strand were prepared as described in Example 1, except that the complementary mosaic ends did not contain a 5' phosphate. BCN-P5 and BCN-P7 transposome complexes without a 5' phosphate on the non-transferred strand were introduced into the example flow cell in the same manner as described in Example 1.

[0370] DNA samples were prepared as described in Example 1 and introduced into each of the control and example flow cells and tagmentation was allowed to occur.

[0371] The insert size of the tagmented DNA samples in the control flow cell and the example flow cell was determined by sequencing and aligning the data using Illumina's Dynamic Read Analysis for Genomics (DRAGEN) software. The results are shown in FIG. 7. As shown, elimination of the 5' phosphate increased the insert size. These results indicate that modifications to the transposon can affect the insert size.

[0372] Example 3 A flow cell was used containing PAZAM and grafted P5 and P7 primers in the wells.

[0373] As a first example, we used the BCN-P5 and BCN-P7 transposome complexes (with 5' non-phosphate-transferred strands) from Example 1. They were introduced into the flow cell of the first example in the same manner as described in Example 1.

[0374] As a second example, BCN-P5 and BCN-P7 transposome complexes with no 5' phosphate on the non-transferred strand and 3' ALEXA FLUOR® 647 dye on the non-transferred strand were prepared as described in Example 1, except that the complementary mosaic ends did not contain a 5' phosphate and contained 3' ALEXA FLUOR® 647 dye. BCN-P5 and BCN-P7 transposome complexes with no 5' phosphate on the non-transferred strand and 3' ALEXA FLUOR® 647 dye were introduced into the flow cell of the second example in the same manner as described in Example 1.

[0375] As a third example, BCN-P5 and BCN-P7 transposome complexes with a 5' phosphate on the non-transferred strand and a 3' ALEXA FLUOR® 647 dye on the non-transferred strand were prepared as described in Example 1, except that the complementary mosaic ends contained the 3' ALEXA FLUOR® 647 dye. The BCN-P5 and BCN-P7 transposome complexes with a 5' phosphate and a 3' ALEXA FLUOR® 647 dye on the non-transferred strand were introduced into the flow cell of the third example in the same manner as described in Example 1.

[0376] As a fourth example, BCN-P5 and BCN-P7 transposome complexes without a 5' phosphate on the non-transferred strand were prepared as described in Example 1, except that the complementary mosaic ends did not contain a 5' phosphate. BCN-P5 and BCN-P7 transposome complexes without a 5' phosphate on the non-transferred strand were introduced into the flow cell of the fourth example in the same manner as described in Example 1.

[0377] As a control, an Illumina PCR-free DNA preparation was performed in a tube. A control sample was introduced into one of the flow cells and tagmentation was allowed to occur.

[0378] A DNA sample was prepared as described in Example 1 and introduced into each of the first, second, third, and fourth flow cells and tagmentation was allowed to occur.

[0379] The insert sizes of the tagmented control DNA sample and the tagmented DNA samples using the first, second, third, and fourth example flow cells were determined by sequencing and aligning the data using Illumina's Dynamic Read Analysis for Genomics (DRAGEN) software. The results are shown in Figure 8. As shown, removal of the 5' phosphate from the non-transferred strand, alone or in combination with the addition of a 3' fluorophore to the non-transferred strand, increased the insert size.

[0380] Example 4 A flow cell was used containing PAZAM and grafted P5 and P7 primers in the wells.

[0381] The BCN-P5 and BCN-P7 transposome complexes (with a 5' non-phosphate transferred strand) from Example 1 were used as active transposome complexes.

[0382] Inactive BCN-P5 and BCN-P7 transposome complexes bearing a 3' dideoxycytosine on the transferred strand were also prepared as described in Example 1, except that the P5 primer had a 3' dideoxycytosine attached to the mosaic end.

[0383] Active BCN-P5 and BCN-P7 transposome complexes were introduced into different flow cells together with different proportions of inactive BCN-P5 and BCN-P7 transposome complexes, ranging from 20% to 60%, in increments of 10%.

[0384] DNA samples were prepared as described in Example 1 and introduced into each of the flow cells and tagmentation was allowed to occur.

[0385] The insert size of DNA samples in various flow cells was determined by sequencing and aligning the data using Illumina's Dynamic Read Analysis for Genomics (DRAGEN) software. The results are shown in FIG. 9, where samples are identified by the percentage of inactive BCN-P5 and BCN-P7 transposome complexes in the flow cells. As shown, inclusion of 3' dideoxycytosine on the transferred strand increased the insert size. Furthermore, insert size increased as the percentage of inactive BCN-P5 and BCN-P7 transposome complexes increased.

[0386] Example 5 25 μl of whole blood was added to a lysis tube containing an example of lysis buffer without inorganic salts, which consisted of 3.6 units of heat labile proteinase K (TLPK), 0.2% sodium dodecyl sulfate, 50 mM Tris HCl (pH 8), 1 mM EDTA, 0.5% TWEEN® 20, and demineralized water. Lysis was carried out at 37° C. (using a heat block) for approximately 15 minutes to generate a crude lysate.

[0387] The temperature of the crude lysate was then raised to 55° C. for approximately 10 minutes to inactivate the cultured TLPK.

[0388] A mixture of alpha cyclodextrin and tagmentation buffer (water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6) was added to the lysis tube to generate a crude complex lysate.

[0389] Crude complex lysates were subjected to tagmentation on a flow cell containing PAZAM, P5 and P7 primers grafted to PAZAM, and BCN-P5 and BCN-P7 transposome complexes from Example 1 grafted to PAZAM (with 5' phosphate non-transferred strands). The fragments resulting from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0390] As a first control, Illumina's PCR-free DNA preparation was performed in a tube to generate a DNA library. The DNA library was denatured using NaOH and Tris HCl and added to a flow cell containing PAZAM and P5 and P7 primers grafted to PAZAM. The DNA library was amplified to generate clusters in the recesses of the flow cell. The reverse strand was cleaved and the forward strand was sequenced.

[0391] As a second control, DNA was used, which was prepared in the same manner as the complex crude lysates.

[0392] The insert sizes of the tagmented control DNA samples and the tagmented complex crude lysate samples were determined by sequencing and aligning the data using Illumina's Dynamic Read Analysis for Genomics (DRAGEN) software. The results are shown in Figure 10. As shown, the insert size of the tagmented complex crude lysate was smaller and there was a larger bias towards smaller fragments.

[0393] Sequencing metrics presented in FIG. 10 include percentage of Q30 bases, percentage of mapped reads, coverage, and percentage of reads passing the filter.

[0394] Q30 is equivalent to a 1 in 1000 chance of an incorrect base call. This means that the accuracy of the base call (i.e., the probability of a correct base call) is 99.9%. A lower base calling accuracy of 99% (Q20) is a step down with a 1 in 100 chance of an incorrect base call, i.e., every 100 base pair sequencing read can contain an error. When sequencing quality reaches Q30, virtually all reads are perfect and free of errors and ambiguities.

[0395] Mapped read percentage refers to the percentage of reads that are aligned to the reference genome.

[0396] Coverage depth refers to the average number of sequencing reads that align to or "cover" each base in the sequenced sample. The Lander / Waterman formula is a method for calculating coverage (C) based on read length (L), number of reads (N), and haploid genome length (G): C=LN / G.

[0397] A higher mapped read percentage and a higher coverage depth indicate sequencing accuracy.

[0398] Passing filter (PF) is a metric used to describe clusters that pass a chastity threshold and are used for further processing and analysis of sequencing data. The %PF calculation involves the application of a chastity filter to each cluster. "Chastity" is defined as the brightest base intensity divided by the sum of the brightest and second brightest base intensities. A cluster "passes the filter" if no more than one base call has a chastity value of less than 0.6 in the first 25 cycles. This filtering process removes the least reliable clusters from the image analysis results. Thus, a higher %Passing Filter (%PF) result indicates an increased yield of usable sequencing data.

[0399] The Q30 score, percentage of mapped reads, and coverage for the complex crude lysate sample were comparable to both control samples (note that all of the samples were downsampled, however). The %PF and GC bias for the complex crude lysate sample were comparable to the second control sample, but the first control sample was higher.

[0400] This example shows that 30x human genomes can be obtained from crude lysates on a flow cell using on-board tagmentation, amplification, and sequencing.

[0401] Example 6 This example was carried out to evaluate the efficiency of beta-cyclodextrin in protecting two different polymerases from the effects of SDS during the polymerase chain reaction.

[0402] PCR was performed on a 350 base pair lambda DNA target. The polymerases used were Q5® High-Fidelity DNA Polymerase (from NEB) and a low fidelity polymerase. For each polymerase, 16 samples were tested. Eight samples were tested without SDS and with different concentrations (0% to 8%) of beta cyclodextrin, and eight samples were tested with 5 μL of 1% SDS (final concentration 0.05%) and different concentrations (0% to 8%) of beta cyclodextrin.

[0403] Size analysis of PCR products was performed using an Agilent TapeStation® system and a D1000 ScreenTape® assay. Black and white reproductions of gel images for i) samples containing Q5® high fidelity DNA polymerase without SDS, ii) samples containing Q5® high fidelity DNA polymerase with SDS, iii) samples containing low fidelity polymerase without SDS, and iv) samples containing low fidelity polymerase with SDS are shown in Figures 11A, 11B, 11C, and 11D, respectively.

[0404] As shown in Figures 11A and 11C, amplification products without SDS are shown in all lanes. Results in Figures 11B and 11D show that when SDS was present at 0.05%, each polymerase was unable to amplify DNA in the absence of beta cyclodextrin or when low levels (0.5%) of beta cyclodextrin were included. These results indicate that SDS may have a detrimental effect on polymerase activity. Results in Figures 11B and 11D also show that polymerase activity was restored when the level of beta cyclodextrin was increased to about 1% (for the Q5® high fidelity DNA polymerase sample) and about 2% (for the low fidelity polymerase). This clearly indicates the sequestering effect that beta cyclodextrin has on SDS. At higher beta cyclodextrin concentrations (e.g., about 6% to about 8%), amplification was somewhat inhibited. Thus, the upper limit for this chaotropic agent chelator may be 6% or 8%.

[0405] Example 7 This example was performed to evaluate the efficiency of β-cyclodextrin in protecting the gap-fill ligation enzyme from the effects of SDS during Illumina PCR-free DNA preparation.

[0406] The first control sample followed the Illumina protocol for PCR-free DNA preparation. DNA was exposed to the following workflow: 50 μL tagmentation buffer → 10 μL 1% SDS → 1 wash → 50 μL gap-fill ligation using beta-cyclodextrin titration (concentrations varied from 0% to 5%) → removal of supernatant → addition of NaOH → addition of solid-phase reversible immobilization (SPRI) beads to reversibly bind DNA.

[0407] The second control sample followed a modified protocol for PCR-free DNA preparation from Illumina, adjusting reagent volumes. DNA was exposed to the following workflow: 20 μL tagmentation buffer → 5 μL 0.6% SDS → 1 wash → 100 μL gap-filling ligation using beta-cyclodextrin titration (concentrations varied from 0% to 5%) → removal of supernatant → addition of NaOH → addition of SPRI beads to reversibly bind DNA.

[0408] The third sample followed a modified protocol for PCR-free DNA preparation from Illumina, in which the wash steps were completely removed. The DNA was exposed to the following workflow: 20 μL tagmentation buffer → 5 μL 0.6% SDS → 100 μL gap-fill ligation using beta-cyclodextrin titration (concentrations varied from 0% to 5%) → removal of supernatant → addition of NaOH → addition of SPRI beads to reversibly bind the DNA.

[0409] Each sample was subjected to quantitative PCR and the results are shown in Figure 12. A washing step in the first and second control samples was performed to remove both SDS and the transposase used during tagmentation. This was done to prevent inhibition of the enzymes used in subsequent steps (e.g., gap-filling ligation enzymes). The results for the third sample, which does not contain beta-cyclodextrin, show the strong negative impact of SDS if it is not washed away. The results for the third sample, which has 1%, 2%, and 3% beta-cyclodextrin, show the steps where beta-cyclodextrin counteracts SDS. These results show that the addition of small amounts of beta-cyclodextrin does not reintroduce the deleterious effects of the chaotropic agent and allows for the removal of washing steps, which can therefore help streamline the library preparation process.

[0410] Example 8 In this example, manual DNA extraction was performed and automated DNA extraction was performed using a HAMILTON® device. In both experiments, Mitra chips were used for blood sample collection. In the first experiment, proteinase K was added to the lysis buffer (from the Illumina DNA PCR-free kit), and in the second experiment, proteinase K was pre-dried on the Mitra chip before blood collection. DNA yields from each experiment were determined and the results are shown in FIG. 18. As shown, the results of each treatment type were comparable, but the pre-dried example was particularly effective. It is believed that similar results could be achieved using zinc oxide nanoparticles instead of proteinase K.

[0411] Example 9 In this example, lysis of whole blood was compared using three different workflows, different examples of inorganic salt-free lysis buffer, and different protease inactivation techniques.

[0412] In the first workflow, 25 μl of whole blood was added to a lysis tube containing an example of lysis buffer without inorganic salts. The lysis buffer without inorganic salts consisted of 3.6 units of heat labile proteinase K (TLPK), 0.2% sodium dodecyl sulfate, 50 mM Tris HCl (pH 8), 1 mM EDTA, 0.5% TWEEN® 20, and demineralized water. Lysis was carried out at 37° C. (using a heat block) for about 15 minutes to generate a crude lysate. The temperature of the crude lysate was then increased to 55° C. for about 10 minutes to inactivate the cultured TLPK. A mixture of alpha cyclodextrin (2.7%) and tagmentation buffer (consisting of water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6) was added to the lysis tube to generate a first complex crude lysate.

[0413] In the second workflow, 25 μl of whole blood was added to a lysis tube containing another example of lysis buffer without inorganic salts. The lysis buffer without inorganic salts consisted of 0.8 mg / mL proteinase K (PK), 0.2% sodium dodecyl sulfate, 50 mM Tris HCl (pH 8), 1 mM EDTA, 0.5% TWEEN® 20, and deionized water. Lysis was carried out at 37° C. (using a heat block) for about 15 minutes to generate a crude lysate. The temperature of the crude lysate was then increased to 80° C. for about 10 minutes to about 15 minutes to inactivate the PK. A mixture of alpha cyclodextrin (2.7%) and tagmentation buffer (consisting of water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6) was added to the lysis tube to generate a second complex crude lysate.

[0414] In the third workflow, 25 μl of whole blood was added to a lysis tube containing another example of lysis buffer without inorganic salts. The lysis buffer without inorganic salts consisted of 0.8 mg / mL proteinase K (PK), 0.2% sodium dodecyl sulfate, 50 mM Tris HCl (pH 8), 1 mM EDTA, 0.5% TWEEN® 20, and deionized water. Lysis was carried out at 37° C. (using a heat block) for approximately 15 minutes to generate a crude lysate. A mixture of alpha cyclodextrin (2.7%), tetrapeptidyl chloromethyl ketone (0.08 mg / mL), and tagmentation buffer (water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6) was added to the lysis tube to inactivate PK and generate a third complex crude lysate.

[0415] Each of the first complex crude lysate, the second complex crude lysate, and the third complex crude lysate was subjected to tagmentation on a flow cell containing PAZAM, P5 and P7 primers grafted to PAZAM, and BCN-P5 and BCN-P7 transposome complexes from Example 1 grafted to PAZAM (with 5' phosphate non-transferred strands). The fragments resulting from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0416] The insert size and sequencing index (i.e., percentage of Q30 bases, percentage of mapped reads, coverage, and percentage of reads passing the filter) were determined as described in Example 5, except that the samples were not downsampled. The results are shown in FIG. 19. As shown in FIG. 19, the insert size of the first complex crude lysate was slightly smaller than the second and third complex crude lysates. Overall, each of the workflows, as well as its lysis buffer and inactivation technique, e.g., heat or TCK as inhibitor, produced suitable insert sizes and resulted in similar sequencing indices. This example also shows that more than 30× of the human genome can be obtained from crude lysates on a flow cell using on-board tagmentation, amplification, and sequencing.

[0417] Example 10 Some of the reagents described herein (streptavidin, lysis buffer, tagmentation buffer, and transposome buffer) were lyophilized to determine the effect of lyophilization compared to non-lyophilized reagents.

[0418] Streptavidin reagent was prepared using 2 μM streptavidin, 100 mM Tris (pH 7.5), 60 mM NaCl, 0.2% TWEEN® 20, 540 mM trehalose, and deionized water.

[0419] Lysis buffer without inorganic salts was prepared using 0.056 mM proteinase K (PK), 0.4% sodium dodecyl sulfate, 100 mM Tris HCl (pH 8), 2 mM EDTA, 1% TWEEN® 20, 440 mM trehalose, and deionized water.

[0420] The tagmentation buffer was prepared using 10 mM magnesium acetate, 20 mM Tris acetate (pH 7.6), 571 mM trehalose, and deionized water.

[0421] A transposome buffer was prepared using asymmetric transposome complexes. P7 transposome complexes contained biotin at the 3' end of the non-transferred strand, and P5 transposome complexes contained biotin at the 5' end of the transferred strand. The final transposome concentrations were 0.4 μM and 0.5 μM (80% P7 transposome complexes and 20% P5 transposome complexes), respectively. The 0.4 μM transposome buffer contained 0.64% glycerol, 63.36 mM NaCl, 101.68 mM Tris (pH 7.5), 0.034 mM DTT, 0.003% TRITON® X-100, 0.003 mM EDTA, 0.2% TWEEN® 20, and 18% trehalose. The 0.5 μM transposome buffer contained 0.8% glycerol, 64.2 mM NaCl, 102.1 mM Tris (pH 7.5), 0.042 mM DTT, 0.004% TRITON® X-100, 0.004 mM EDTA, 0.2% TWEEN® 20, and 18% trehalose.

[0422] For each reagent, a liquid sample was prepared and a lyophilized sample was prepared. Lyophilization was performed at temperatures ranging from about -25°C to about -50°C and pressures ranging from about 30 MPa to about 90 MPa. The weight average molecular weights and / or concentrations of the reagent components in the resulting microspheres or single blocks (cake format) are shown in Tables 1 to 4.

[0423] [Table 1]

[0424] [Table 2]

[0425] [Table 3]

[0426] [Table 4]

[0427] Each of the lyophilized samples (microspheres or blocks) was reconstituted with water.

[0428] Streptavidin Results The liquid and reconstituted lyophilized streptavidin samples were loaded onto each flow cell, containing biotinylated PAZAM (biotin is attached to PAZAM via a BCN linker), and P5 and P7 primers grafted to PAZAM with biotin-P5 and biotin-P7 transposome complexes. A wash solution was run through the flow cell to remove unbound streptavidin and transposome complexes. Next, a DNA sample (500 ng) in tagmentation buffer was introduced into each flow cell. The fragments resulting from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0429] Insert size and sequencing index (i.e. percentage of Q30 bases, percentage of mapped reads, coverage, and percentage of reads passing the filter) were determined as described in Example 5, except that samples were not downsampled. Insert size and sequencing index for DNA analyzed on a flow cell prepared using liquid and reconstituted lyophilized streptavidin samples are shown in FIG. 20. As shown, the use of lyophilized reconstituted streptavidin to bind transposome complexes did not adversely affect downstream DNA processing in terms of insert size or sequencing index.

[0430] Lysis Buffer Results 25 μl of whole blood was added to each of the liquid sample and the reconstituted lyophilized lysis buffer sample. Lysis was performed at 37° C. (using a heat block) for about 15 minutes to generate each crude lysate. The temperature of the crude lysate was then raised to 80° C. for about 10 minutes to about 15 minutes to inactivate PK. A mixture of alpha cyclodextrin (2.7%) and tagmentation buffer (consisting of water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6) was added to the lysis tube to generate a complex crude lysate. Each of the complex crude lysates (formed with liquid lysis buffer and reconstituted lyophilized lysis buffer, respectively) was exposed to tagmentation on a flow cell containing PAZAM, P5 and P7 primers grafted to PAZAM, and BCN-P5 and BCN-P7 transposome complexes from Example 1 grafted to PAZAM (with 5′ phosphate non-transferred strands). The fragment resulting from the tagmentation was amplified using primers: the reverse strand was cleaved and the forward strand was sequenced.

[0431] Insert size and sequencing index (i.e. percentage of Q30 bases, percentage of mapped reads, coverage, and percentage of reads passing the filter) were determined as described in Example 5, except samples were not downsampled. Results are shown in Figure 21. As shown, the use of lyophilized and reconstituted lysis buffer to generate crude lysates from whole blood samples did not adversely affect downstream DNA processing in terms of insert size or sequencing index.

[0432] Tagmentation Buffer Results DNA samples (500 ng) were introduced into each liquid and reconstituted lyophilized tagmentation buffer. These samples were then introduced into each flow cell containing PAZAM, P5 and P7 primers grafted to PAZAM, and BCN-P5 and BCN-P7 transposome complexes from Example 1 grafted to PAZAM (with 5' phosphate non-transferred strand). The fragments obtained from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0433] Insert size and sequencing index (i.e. percentage of Q30 bases, percentage of mapped reads, coverage, and percentage of reads passing the filter) were determined as described in Example 5, except samples were not downsampled. Results are shown in Figure 22. As shown, the use of lyophilized and reconstituted tagmentation buffer during tagmentation did not adversely affect downstream DNA processing in terms of insert size or sequencing index.

[0434] The results in this example show that lyophilization can be used for a variety of reagents used in flow cell preparation and sample preparation without adversely affecting downstream sequencing.

[0435] Transposome Results Liquid and reconstituted lyophilized transposome buffer samples were loaded onto each flow cell, containing biotinylated PAZAM (biotin is attached to PAZAM via a BCN linker) and P5 and P7 primers grafted to PAZAM. A wash solution was run through the flow cell to remove unbound streptavidin and transposome complexes. Next, DNA samples (500 ng) in tagmentation buffer were introduced into each flow cell. The fragments resulting from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0436] Insert size and some of the sequencing indices (i.e., percentage of Q30 bases, percentage of mapped reads, and percentage of reads passing the filter) were determined as described in Example 5 (except the samples were not downsampled). In this example, occupancy or % occupancy was also determined. As used herein, "occupancy or % occupancy" refers to the percentage of recesses containing clusters versus empty recesses. Insert size and sequencing indices for DNA analyzed on a flow cell prepared using liquid and reconstituted lyophilized streptavidin samples are shown in FIG. 28. As shown, the use of lyophilized and reconstituted transposomes at different concentrations did not adversely affect downstream DNA processing in terms of insert size or sequencing indices.

[0437] Example 11 As a control, Illumina's PCR-free DNA preparation (NEXTSEQ™ 2K protocol) was performed in a tube to generate a gDNA library. The gDNA library was denatured using NaOH and Tris HCl and added to a flow cell containing PAZAM and P5 and P7 primers grafted to PAZAM. The gDNA library was amplified to generate clusters in the wells of the flow cell. The reverse strand was cleaved and the forward strand was sequenced.

[0438] For the examples, a flow cell was used that contained biotinylated PAZAM (streptavidin bound to biotin, which is bound to PAZAM via a BCN linker) and grafted P15 and P7 primers in the recesses. Biotin-P15 and biotin-P7 transposomes were taken up in buffer (50 mM Tris (pH 7.5), 30 mM NaCl, 0.1% Tween® 20, and water) and grafted to biotinylated PAZAM via streptavidin. The flow cell was washed with high salt buffer. The transposome mixture was added to each flow cell and incubated at room temperature for about 30 minutes. After the desired incubation period, the control flow cell was flushed with buffer.

[0439] As an example, 500 ng of gDNA was incorporated into tagmentation buffer (consisting of water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6). The gDNA was exposed to tagmentation in one of the flow cells. The fragments resulting from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0440] In other examples, 300 μL of complex crude lysate was used. Whole blood was added to a lysis tube containing an example of lysis buffer without inorganic salts. The lysis buffer without inorganic salts consisted of 3.6 units of heat labile proteinase K (TLPK), 0.2% sodium dodecyl sulfate, 50 mM Tris HCl (pH 8), 1 mM EDTA, 0.5% TWEEN® 20, and demineralized water. Lysis was performed at 37° C. (using a heat block) for about 15 minutes to generate a crude lysate. The temperature of the crude lysate was then increased to 55° C. for about 10 minutes to inactivate the cultured TLPK. A mixture of alpha cyclodextrin (2.7%) and tagmentation buffer (consisting of water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6) was added to the lysis tube to generate a complex crude lysate. The complex crude lysate was exposed to tagmentation on another one of the flow cells. The fragment resulting from the tagmentation was amplified using primers: the reverse strand was cleaved and the forward strand was sequenced.

[0441] Insert size and sequencing index (i.e. percentage of Q30 bases, percentage of mapped reads, coverage, and percentage of reads passing the filter) were determined for the control and examples (samples were downsampled) as described in Example 5. The results are shown in Figure 23. As shown in Figure 23, the insert size of both the example gDNA and crude lysate was slightly smaller than the control gDNA. Overall, the sequencing index was comparable to the control.

[0442] Example 12 This example compares two different methods for preparing the flow cell surface using BCN-biotin and streptavidin for subsequent introduction of biotinylated transposome complexes.

[0443] In one example, BCN-biotin was added to a flow cell containing PAZAM in the wells. The BCN-biotin-streptavidin was incubated for approximately 2 hours at 60° C. Streptavidin was then added and incubated at room temperature for 30 minutes.

[0444] In another example, BCN-biotin (20 μL) and streptavidin (20 μL) were preincubated in 20 μL of buffer (50 mM Tris (pH 7.5), 30 mM NaCl, 0.1% Tween® 20, and water) for 30 minutes. After 30 minutes, the mixture was diluted with 140 μL of Na2SO4 buffer. The diluted BCN-biotin-streptavidin was then added to a flow cell containing PAZAM in the well and incubated at 60° C. for approximately 2 hours.

[0445] 500 ng of gDNA was incorporated into tagmentation buffer (water, 5 mM magnesium acetate, and 10 mM Tris acetate, pH 7.6). Each gDNA sample was subjected to tagmentation on each flow cell. The fragments resulting from tagmentation were amplified using primers. The reverse strand was cleaved and the forward strand was sequenced.

[0446] Insert size and sequencing indices (i.e. percentage of Q30 bases, percentage of mapped reads, occupancy, and percentage of reads passing the filter) were determined for the examples as described in Examples 5 and 10. The results are shown in Figure 25. As shown in Figure 25, any of the methods for introducing BCN-biotin-streptavidin can be used without adversely affecting downstream indices.

[0447] Additional Notes In any of the examples disclosed herein, the substrate may include a single lane defined therein rather than multiple recesses. Within the lane, polymer hydrogel may be selectively deposited to form individual pads. The pads are similar to the polymer hydrogel within the recesses and may be used in any of the examples disclosed herein.

[0448] It is to be understood that all combinations of the foregoing concepts and further concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as part of the inventive subject matter disclosed herein. It is also to be understood that the terms expressly used herein, and which may also appear in any disclosures incorporated by reference, are to be given the meaning most consistent with the particular concepts disclosed herein.

[0449] References throughout this specification to "one example," "another example," "an example," etc. mean that a particular element (e.g., a feature, structure, and / or characteristic) described in connection with an example is included in at least one example described herein, and may or may not be present in other examples. In addition, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0450] Although several examples have been described in detail, it is understood that the disclosed examples may be modified, and therefore the foregoing description is to be considered as non-limiting.

Claims

1. a substrate including a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a first transposome complex immobilized in each of the recesses, the first transposome complex comprising a first amplification domain; a second transposome complex immobilized in each of the recesses and comprising a second amplification domain; A flow cell, wherein i) a portion of the first transposome complex, or ii) a portion of the second transposome complex, or iii) a portion of both the first transposome complex and the second transposome complex comprise a modification that reduces tagmentation efficiency.

2. The flow cell of claim 1, wherein the modification that reduces the tagmentation efficiency is the elimination of a phosphate group at the 5' end of the non-transferred strand of i) a portion of the first transposome complex, or ii) a portion of the second transposome complex, or iii) a portion of both the first transposome complex and the second transposome complex.

3. The flow cell of claim 1, wherein the modification that reduces the tagmentation efficiency is a fluorophore attached to the 5' end of a non-transferred strand of i) a portion of the first transposome complex, or ii) a portion of the second transposome complex, or iii) a portion of both the first transposome complex and the second transposome complex.

4. The flow cell of claim 1, wherein the modification that reduces the tagmentation efficiency is a fluorophore attached to the 3' end of a non-transferred strand of i) a portion of the first transposome complex, or ii) a portion of the second transposome complex, or iii) a portion of both the first transposome complex and the second transposome complex.

5. 2. The flow cell of claim 1, wherein the modification that reduces the tagmentation efficiency is a dideoxycytosine, thymine, or cytosine attached to the 3' end of the transferred strand of i) a portion of the first transposome complex, or ii) a portion of the second transposome complex, or iii) a portion of both the first transposome complex and the second transposome complex.

6. a substrate including a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a first transposome complex comprising a first amplification domain; a second transposome complex comprising a second amplification domain, i) the first transposome complex and the second transposome complex are each immobilized in a different region of each of the recesses; or ii) the first transposome complex and the second transposome complex are immobilized within each of the recesses and on each of the interstitial regions, respectively; or iii) A flow cell, wherein the first transposome complex and the second transposome complex are each immobilized in different regions of the gap region.

7. Each of the first transposome complex and the second transposome complex comprises The transposon ends, and a transposase enzyme non-covalently bound to the transposon ends.

8. 1. A method for increasing the insert size of a deoxyribonucleic acid (DNA) sample, comprising: Introducing a DNA sample into a flow cell, the flow cell comprising: a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a first transposome complex immobilized in each of the recesses or on the gap region, the first transposome complex comprising a first amplification domain; a second transposome complex immobilized within each of the recesses or on the gap region, the second transposome complex comprising a second amplification domain; introducing a condensation agent or a tagmentation inhibitor to the DNA sample, wherein the condensation agent is selected from the group consisting of polycationic amines, polyethylene glycol, and histones, or the tagmentation inhibitor is selected from the group consisting of cations, pH adjusters, and chromatin assembly kits; and incubating the DNA sample in the flow cell in the presence of the condensation agent or the tagmentation inhibitor, thereby causing tagmentation of the DNA sample in a portion of the first transposome complex and the second transposome complex.

9. After said tagmentation, introducing a wash solution into the flow cell; heating the flow cell containing the wash solution to about 60° C.; and The method of claim 8, further comprising the step of: introducing the extension amplification mix into a flow cell.

10. Introducing the transposome complex into a buffer solution, the transposome complex comprising: a transposon end comprising a portion of the transferred strand hybridized to a portion of the non-transferred strand, the transferred strand comprising a 5' terminal alkyne functionality; a transposase enzyme non-covalently bound to the transposon ends; introducing the buffer solution containing the transposome complexes into a flow cell comprising recesses separated by gap regions, the recesses having therein a polymer hydrogel having terminal azide or tetrazine groups; and binding the 5' terminal alkyne functional groups of at least a portion of the transposome complexes to at least a portion of the terminal azide or tetrazine groups, respectively, by incubating the buffer solution in the flow cell.

11. The method of claim 10, wherein the 5' terminal alkyne functionality is bicyclo[6.1.0]nonyne.

12. the buffer solution is sodium sulfate, 12. The method of claim 11, wherein the incubation is carried out at about 37°C for about 2 hours.

13. Introducing the transposome complex into a flow cell, The transposome complex is a transposon end comprising a portion of the transferred strand hybridized to a portion of the non-transferred strand, the transferred strand comprising a 5' biotinylated end; a transposase enzyme non-covalently bound to the transposon ends, The flow cell comprises: and recesses separated by gap regions. a biotinylated polymer hydrogel within the recess; introducing streptavidin into the flow cell; and incubating the transposome complexes and the streptavidin in the flow cell, thereby causing the streptavidin to bind the 5' biotinylated ends of at least a portion of the transposome complexes to the biotinylated polymer hydrogel.

14. 14. The method of claim 13, further comprising preparing a biotinylated polymer hydrogel by grafting bicyclo[6.1.0]nonyne-biotin to the terminal azide or tetrazine groups of the polymer hydrogel.

15. 15. The method of claim 13 or 14, wherein the streptavidin is pre-bound to the 5' biotinylated end of each transposome complex and is therefore introduced as part of each transposome complex.

16. The method of claim 13 or 14, wherein the streptavidin is introduced into the flow cell before the transposome complex is introduced into the flow cell.

17. the transposome complexes, or the streptavidin, or both the transposome complexes and the streptavidin, are dried; The method further comprising: reconstituting the transposome complexes in a buffer prior to introducing the transposome complexes into the flow cell; or reconstituting the streptavidin in a buffer prior to introducing the streptavidin into the flow cell; or 17. The method of claim 13, further comprising the step of reconstituting each of the transposome complexes and the streptavidin in a respective buffer prior to introduction into the flow cell.

18. a substrate including a plurality of recesses separated by gap regions; a biotinylated polymer hydrogel within the recess; a first biotinylated primer and a second biotinylated primer immobilized in each of the recesses; a first biotinylated transposome complex immobilized in each of the recesses, the first biotinylated transposome complex comprising a first amplification domain; a second biotinylated transposome complex immobilized in each of said wells, the second biotinylated transposome complex comprising a second amplification domain.

19. 20. The reusable flow cell of claim 18, wherein the first biotinylated primer and the second biotinylated primer are immobilized on the biotinylated polymer hydrogel via streptavidin.

20. the first biotinylated transposome complex is immobilized on the biotinylated polymer hydrogel via streptavidin; 20. The reusable flow cell of claim 18 or 19, wherein the second biotinylated transposome complex is immobilized on the biotinylated polymer hydrogel via streptavidin.

21. extracting deoxyribonucleic acid from a sample selected from the group consisting of whole blood, bone marrow aspirate, tissue sample, blood spot, and saliva by exposing the sample to a lysis buffer containing a protease, less than 2 mM ethylenediaminetetraacetic acid, a chaotropic agent, and water, free of inorganic salts, at an activity temperature of the protease, to produce a crude lysate; inactivating the proteases in the crude lysate using heat or inhibitors; adding a chelating agent of the chaotropic agent to the crude lysate to produce a complex crude lysate.

22. 22. The method of claim 21, further comprising the step of introducing the complex crude lysate into a flow cell containing transposome complexes and primers immobilized on a surface within the flow cell.

23. The method further comprises exposing the extracted deoxyribonucleic acid to tagmentation, the tagmentation comprising: introducing a tagmentation buffer into the flow cell when the complex crude lysate is introduced; and bringing the flow cell to a temperature of 30° C. or greater.

24. introducing a wash solution into the flow cell; heating the flow cell containing the wash solution to about 60° C.; and then 24. The method of claim 23, further comprising the step of: introducing an extension amplification mix into the flow cell.

25. 24. The method of claim 23, wherein the exposing, inactivating, and doping steps are performed in a lysis tube or chamber not mounted to the flow cell.

26. 22. The method of claim 21, further comprising exposing the complex crude lysate to a library preparation technique.

27. 27. The method of any one of claims 21 to 26, wherein the chelating agent of the chaotropic agent is a cyclodextrin selected from the group consisting of alpha cyclodextrin, beta cyclodextrin, and methyl beta cyclodextrin.

28. the chelating agent is in dry form; the chelating agent in dry form is part of an encapsulation complex that includes a coating material around the chelating agent in dry form; The step of adding a chelating agent comprises: adding the encapsulation complex to the crude lysate; then inducing release of the dry form of the chelating agent from the encapsulation complex; and rehydrating the chelating agent in dry form.

29. the coating material is a temperature sensitive wax; 30. The method of claim 28, wherein inducing the release of the dry form of the chelating agent comprises heating the crude melt to the melting temperature of the temperature sensitive wax.

30. the coating material is a temperature sensitive polymer; 30. The method of claim 28, wherein inducing the release of the dry form of the chelating agent comprises heating the crude lysate to a solubilization temperature of the temperature sensitive polymer.

31. the coating material is a pH-sensitive polymer; 30. The method of claim 28, wherein inducing the release of the chelating agent in dry form comprises adjusting the pH of the crude lysate.

32. the coating material is a time-sensitive polymer; 30. The method of claim 28, wherein inducing the release of the dry form of the chelating agent comprises incubating the encapsulated complex in a crude lysate for a predetermined period of time.

33. the inorganic salt-free lysis buffer comprises trypsin; inactivating trypsin in the crude lysate comprises exposing the crude lysate to the inhibitor; 27. The method of any one of claims 21 to 26, wherein the inhibitor is 4-(2-aminoethyl)-benzenesulfonyl fluoride.

34. the protease in the inorganic salt-free lysis buffer is a protein kinase; inactivating said protein kinase in said crude lysate comprises exposing said crude lysate to said heat; 27. The method of any one of claims 21 to 26, wherein the heat is about 80°C.

35. the protease in the inorganic salt-free lysis buffer is a protein kinase; inactivating said protein kinase in said crude lysate comprises exposing said crude lysate to said inhibitor; 27. The method of any one of claims 21 to 26, wherein the inhibitor is a tetrapeptidyl chloromethyl ketone.

36. drying said inorganic salt-free lysis buffer prior to exposing said sample to said inorganic salt-free lysis buffer; 27. The method of any one of claims 21 to 26, further comprising the step of reconstituting the dried inorganic salt-free lysis buffer with water.

37. performing a tagmentation reaction using the DNA sample and the surface-bound transposome complexes, thereby generating a plurality of partially matched DNA fragments; introducing a chaotropic agent to remove transposase from the surface-bound transposome complexes; introducing a chelator for the chaotropic agent to dissociate the chaotropic agent; and performing an extension reaction to add additional adaptors to the partially adapted DNA fragments.

38. the chaotropic agent is sodium dodecyl sulfate; 38. The method of claim 37, wherein the chelating agent of the chaotropic agent is a cyclodextrin selected from the group consisting of alpha cyclodextrin, beta cyclodextrin, and methyl beta cyclodextrin.

39. Introducing a DNA sample into a flow cell, the flow cell comprising: a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a first transposome complex immobilized in each of the recesses or on the gap region, the first transposome complex comprising a first amplification domain; a second transposome complex immobilized in each of the recesses or on the gap region, the second transposome complex comprising a second amplification domain; performing tagmentation of the DNA sample in the first transposome complex and a portion of the second transposome complex to generate a plurality of partially matched DNA fragments; introducing a chaotropic agent into the flow cell to remove transposase from the first transposome complex and the second transposome complex; introducing a chelator for the chaotropic agent to dissociate the chaotropic agent; and performing an extension reaction to add additional adaptors to the partially adapted DNA fragments.

40. the chaotropic agent is sodium dodecyl sulfate; 40. The method of claim 39, wherein the chelating agent of the chaotropic agent is a cyclodextrin selected from the group consisting of alpha cyclodextrin, beta cyclodextrin, and methyl beta cyclodextrin.

41. A flow cell comprising: a substrate including a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a plurality of first transposome complexes, each of the plurality of first transposome complexes being anchored in one of the recesses by a 3′ end of a non-transferred strand of the first transposome complex; a plurality of second transposome complexes, each of the plurality of second transposome complexes being anchored in one of the recesses by a 5′ end of a transferred strand of the second transposome complex; A flow cell, wherein the plurality of first transposome complexes and the plurality of second transposome complexes are present in the flow cell in a ratio ranging from greater than 1:1 to 5:

1.

42. Each of the plurality of first transposome complexes comprises: a first transposon end comprising a portion of the non-transferred strand of the first transposome complex hybridized to a portion of the transferred strand of the first transposome complex; a first transposase enzyme non-covalently bound to the first transposon end.

43. Each of the plurality of second transposome complexes comprises: a second transposon end comprising a portion of the transferred strand of the second transposome complex hybridized to a portion of the non-transferred strand of the second transposome complex; and a second transposase enzyme non-covalently bound to the second transposon end.

44. 44. The flow cell of any one of claims 41 to 43, wherein the ratio of the plurality of first transposome complexes to the plurality of second transposome complexes is 4:

1.

45. each of said recesses containing a layer of polymer hydrogel therein; the 3' end is attached to the polymer hydrogel; 45. The flow cell of any one of claims 41 to 44, wherein the 5' end is attached to the polymer hydrogel.

46. each of said recesses containing a layer of biotinylated polymer hydrogel therein; each of the 3' end and the 5' end being biotinylated; 45. The flow cell of any one of claims 41 to 44, wherein each of the biotinylated 3' and 5' ends is bound to the biotinylated polymer hydrogel via streptavidin.

47. Introducing the DNA sample and the tagmentation buffer into a flow cell, the flow cell comprising: a substrate including a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a plurality of first transposome complexes, each of the plurality of first transposome complexes being anchored in one of the recesses by a 3′ end of a non-transferred strand of the first transposome complex; a plurality of second transposome complexes, each of the plurality of second transposome complexes being anchored in one of the recesses by a 5′ end of a transferred strand of the second transposome complex; the plurality of first transposome complexes and the plurality of second transposome complexes are present in the flow cell in a ratio ranging from greater than 1:1 to 5:1; and incubating the DNA sample and the tagmentation buffer in the flow cell, thereby tagmenting the DNA sample to generate DNA sample fragments bound to at least a portion of the transferred strand of the second transposome complex and to at least a portion of the transferred strand of the first transposome complex.

48. releasing transposase from the plurality of first transposome complexes and the plurality of second transposome complexes by heating the flow cell to about 60° C.; removing the released transposase by flowing a wash solution through the flow cell; 48. The method of claim 47, further comprising the step of: introducing an extension amplification mix into the flow cell.

49. Releasing transposase from the first transposome complexes and the second transposome complexes by introducing sodium dodecyl sulfate or a proteinase into the flow cell; heating the flow cell to a dehybridization temperature of the first transposome complex and the second transposome complex; removing the released transposase and the released non-transferred strand of the second transposome complexes by flowing a wash solution through the flow cell; 49. The method of claim 48, further comprising the step of: introducing an extension amplification mix into the flow cell.

50. a substrate including a plurality of recesses separated by gap regions; a first polymer hydrogel disposed in a first portion of each recess; a second polymer hydrogel disposed in a second portion of each recess; a transposome precursor immobilized on the first polymer hydrogel via an orthogonally cleavable bond; a capture primer immobilized on the second polymer hydrogel; a first primer and a second primer of an amplification primer set immobilized on the first polymer hydrogel and the second polymer hydrogel, respectively.

51. the transposome precursor comprises a first amplification domain having a sequence identical to that of the first primer; 51. The flow cell of claim 50, wherein the capture primer comprises a sequence complementary to the non-transferred strand of a preassembled transposome complex.

52. the first primer and the second primer immobilized on the first polymer hydrogel comprise a non-cleavable first primer and a cleavable second primer; the first primer and the second primer immobilized on the second polymer hydrogel comprise a cleavable first primer and a non-cleavable second primer; 51. The flow cell of claim 50, wherein each of the cleavable second primer cleavage site, the cleavable first primer cleavage site, and the orthogonally cleavable bond is responsive to a different cleavage chemistry.

53. A flow cell comprising: a substrate including a plurality of recesses separated by gap regions; a first polymer hydrogel disposed in a first portion of each recess; a second polymer hydrogel disposed in a second portion of each recess; a transposome precursor immobilized on the first polymer hydrogel via an orthogonally cleavable bond; a capture primer immobilized on the second polymer hydrogel; a flow cell comprising a first primer and a second primer of an amplification primer set immobilized on the first polymer hydrogel and the second polymer hydrogel, respectively; a first fluid comprising a transposase enzyme and a non-transferred strand for assembling transposome precursors and transposome complexes; a second fluid comprising preassembled transposome complexes that hybridize to the capture primer.

54. the transposome precursor comprises a first amplification domain having a sequence identical to that of the first primer; 54. The kit of claim 53, wherein the preassembled transposome complex comprises a non-transferred strand that is complementary to a sequence of the capture primer and a transferred strand that includes a second amplification domain having a sequence identical to that of the second primer.

55. the first primer and the second primer immobilized on the first polymer hydrogel comprise a non-cleavable first primer and a cleavable second primer; the first primer and the second primer immobilized on the second polymer hydrogel comprise a cleavable first primer and a non-cleavable second primer; 54. The kit of claim 53, wherein each of the cleavable second primer cleavage site, the cleavable first primer cleavage site, and the orthogonally cleavable bond is responsive to a different cleavage chemistry.

56. Introducing a first fluid comprising a plurality of transposase enzymes and a plurality of non-transferred strands into a flow cell, the flow cell comprising: a substrate including a plurality of recesses separated by gap regions; a first polymer hydrogel disposed in a first portion of each recess; a second polymer hydrogel disposed in a second portion of each recess; a plurality of transposome precursors immobilized on the first polymer hydrogel via respective orthogonally cleavable bonds; a plurality of capture primers immobilized on the second polymer hydrogel; a first primer and a second primer of an amplification primer set immobilized on each of the first polymer hydrogel and the second polymer hydrogel, each of the first primers having a sequence identical to a first amplification domain of each of the plurality of transposome precursors; interacting with at least a portion of the plurality of transposome precursors, the plurality of non-transferred strands, and the plurality of transposase enzymes to form a plurality of transposome complexes immobilized on the first polymer hydrogel; introducing a second fluid containing a plurality of preassembled transposome complexes into the flow cell, whereby at least some of the non-transferred strands of the plurality of preassembled transposome complexes each hybridize to at least some of the plurality of capture primers; and tagmenting the DNA sample to generate DNA sample fragments bound to the transferred strands of the plurality of transposome complexes and the transferred strands of the plurality of preassembled transposome complexes by incubating the DNA sample in the flow cell.

57. the transferred strand of the plurality of preassembled transposome complexes comprises a second amplification domain having a sequence identical to that of the second primer; removing the plurality of transposase enzymes and the transposase enzyme of each of the plurality of preassembled transposome complexes; initiating a strand displacement reaction to generate complementary copies of the transferred strands of the plurality of transposome complexes and the plurality of preassembled transposome complexes, and separating the DNA sample fragments from the second polymer hydrogel, so that at least one of the complementary copies of the transferred strands of the plurality of preassembled transposome complexes remains bound to the first polymer hydrogel via at least one of the transferred strands of the plurality of transposome complexes; hybridizing at least one of the complementary copies of the transferred strand of the plurality of preassembled transposome complexes to at least one of the second primers on the first polymer hydrogel or the second polymer hydrogel; initiating polymerase extension along the DNA sample fragments bound to at least one of the hybridized complementary copies to generate at least one amplicon bound to at least one of the second primers on the first polymer hydrogel or the second polymer hydrogel; 57. The method of claim 56, further comprising the step of: introducing a diol cleaving agent to sever the DNA sample fragments bound to the first polymer hydrogel via the orthogonally cleavable bonds.

58. a substrate including a plurality of recesses separated by gap regions; a first polymer hydrogel disposed in a first portion of each recess; a transposome precursor immobilized on the first polymer hydrogel via an orthogonally cleavable bond; a second polymer hydrogel disposed in a second portion of each well, the second polymer hydrogel comprising a transposome-capture functional group that is not present in the first polymer hydrogel; a first primer and a second primer of an amplification primer set immobilized on the first polymer hydrogel and the second polymer hydrogel, respectively.

59. initiating detergent-free extraction of deoxyribonucleic acid or ribonucleic acid from a cell sample by exposing the cell sample to a zinc oxide nanomaterial at a temperature ranging from about 18° C. to about 25° C. to generate a crude lysate; exposing the extracted deoxyribonucleic acid or ribonucleic acid in the crude lysate to tagmentation.

60. The zinc oxide nanomaterial is combined with a protease; 60. The method of claim 59, further comprising the step of inactivating the protease using heat prior to exposing the extracted deoxyribonucleic acid or ribonucleic acid in the crude lysate to tagmentation.

61. 61. The method of claim 60, wherein the protease is a thermolytic protein kinase.

62. 62. The method of any one of claims 59 to 61, wherein exposing the extracted deoxyribonucleic acid or ribonucleic acid in the crude lysate to tagmentation comprises introducing the crude lysate to a flow cell comprising transposome complexes and primers immobilized on a surface within the flow cell.

63. introducing a tagmentation buffer into the flow cell as the crude lysate is introduced; 63. The method of claim 62, further comprising the step of: bringing the flow cell to a temperature of 30° C. or greater.

64. heating the flow cell to about 60° C.; flowing a wash solution through the flow cell; 64. The method of claim 63, further comprising the step of: introducing an amplification mix into the flow cell.

65. 65. The method of claim 63 or 64, wherein the tagmentation buffer comprises a metal cofactor for the transposase of the transposome complex.

66. 60. The method of claim 59, wherein the crude lysate is produced in a lysis tube, and exposing the extracted deoxyribonucleic acid or ribonucleic acid in the crude lysate to tagmentation comprises introducing a tagmentation buffer and a solid support comprising surface-bound transposome complexes and surface-bound primers into the lysis tube.

67. 67. The method of claim 66, wherein the tagmentation buffer comprises a metal cofactor for the transposase of the surface-bound transposome complex.

68. 60. The method of claim 59, wherein the crude lysate is produced in a sample collection device and the zinc oxide nanomaterial is dried onto a surface of the sample collection device.

69. 69. The method of any one of claims 59 to 68, wherein exposing the cell sample to the zinc oxide nanomaterial is carried out for a time period ranging from about 2 minutes to about 30 minutes.

70. 70. The method of any one of claims 59 to 69, wherein the cell sample and the zinc oxide nanomaterial are present in a 1:1 volume ratio.

71. 60. The method of claim 59, wherein the tagmentation is carried out in solution.

72. A tagmentation kit comprising a flow cell, a reagent cartridge and streptavidin, The flow cell comprises: a substrate including a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; a biotin-containing linker immobilized within each of said recesses; The reagent cartridge comprises: A fluid input port; a plurality of receptacles each containing a transposome buffer and a tagmentation buffer; the transposome buffer comprises a plurality of first transposome complexes, each having a first amplification domain and a 5′ biotinylated end, and second transposome complexes, each having a second amplification domain and a 5′ biotinylated end; A tagmentation kit, wherein the streptavidin is either attached to a biotin-containing linker or contained within a receptacle of the reagent cartridge.

73. 73. The tagmentation kit of claim 72, wherein said reagent cartridge further comprises in one of said receptacles a lysis buffer free of inorganic salts, said lysis buffer free of inorganic salts comprising a protease, less than 2 mM ethylenediaminetetraacetic acid, and a chaotropic agent.

74. i) the inorganic salt-free lysis buffer is liquid and the inorganic salt-free lysis buffer further comprises water; or 74. The tagmentation kit of claim 73, wherein ii) the inorganic salt-free buffer is a dry solid, and the reagent cartridge further comprises a reconstitution fluid in another of the plurality of receptacles.

75. 75. The tagmentation kit of claim 73 or 74, wherein the reagent cartridge further comprises an inhibitor of the chaotropic agent in another one of the receptacles.

76. A tagmentation kit comprising a flow cell and a reagent cartridge, The flow cell comprises: a substrate including a plurality of recesses separated by gap regions; a first primer and a second primer immobilized in each of the recesses; The reagent cartridge comprises: A fluid input port; a plurality of receptacles each containing a biotin-containing linker and a transposome buffer; A tagmentation kit, wherein the transposome buffer comprises a plurality of first transposome complexes, each having a first amplification domain and a 5' biotinylated end, and a plurality of second transposome complexes, each having a second amplification domain and a 5' biotinylated end.

77. 77. The tagmentation kit of claim 76, wherein the reagent cartridge further comprises in one of the plurality of receptacles a lysis buffer free of inorganic salts, the lysis buffer free of inorganic salts comprising a protease, less than 2 mM ethylenediaminetetraacetic acid, and a chaotropic agent.

78. i) the inorganic salt-free lysis buffer is liquid and the inorganic salt-free lysis buffer further comprises water; or 78. The tagmentation kit of claim 77, wherein ii) the inorganic salt-free buffer is a dry solid, and the reagent cartridge further comprises a reconstitution fluid in another of the plurality of receptacles.

79. 80. The tagmentation kit of claim 77 or 78, wherein the reagent cartridge further comprises an inhibitor of the chaotropic agent in another one of the plurality of receptacles.

80. A flow cell comprising: a substrate having a plurality of recesses of different depths separated by gap regions, each of the plurality of recesses including a deep portion and a shallow portion; a polymer hydrogel disposed on an interior surface of each of the deep and shallow sections; a first primer set immobilized on a surface of the shallow portion; a first transposome complex immobilized on a surface of the shallow portion, the first transposome complex comprising a first amplification domain; A second primer set immobilized on the surface of the deep region; a second transposome complex immobilized on the surface of the deep section, the second transposome complex comprising a second amplification domain.

81. applying a polymer hydrogel onto a substrate having a plurality of recesses of different depths separated by gap regions, each of the plurality of recesses including a deep portion and a shallow portion; removing the polymer hydrogel from the gap areas; developing the photoresist to produce insoluble photoresist in the deeper portion, thereby leaving the shallower portion exposed; immobilizing a first primer set and a first transposome complex on a surface of the shallow portion while the insoluble photoresist is in the deep portion; removing the insoluble photoresist; immobilizing a second primer set and a second transposome complex on a surface of the shallow portion.

82. 82. The method of claim 81, wherein the polymer hydrogel is removed from the gap areas using abrasion.

83. 83. The method of claim 81 or 82, wherein the photoresist is a negative photoresist or a positive photoresist.

84. tagmenting a DNA sample in solution using a plurality of first type transposome complexes, each comprising a first transposon end, with a portion of the first transferred strand hybridized to a first non-transferred strand, wherein the first transferred strand comprises a first amplification domain and an index sequence, thereby generating double-stranded DNA fragments each bound at their 5' end to the 3' end of the initially transferred strand; introducing the solution containing the double-stranded DNA fragments into a flow cell containing a plurality of second type transposome complexes immobilized on a surface of the flow cell, the second type transposome complexes comprising a second transposon end having a portion of a second transferred strand hybridized to a second non-transferred strand, the second transferred strand comprising a second amplification domain and no index sequence, thereby tagmenting the double-stranded DNA fragments to generate new double-stranded DNA fragments each attached at their 3' and 5' ends to the second transferred strand.

85. the flow cell further comprising a first primer and a second primer immobilized on the surface; the first amplification domain and the first primer have the same sequence; 85. The method of claim 84, wherein the second amplification domain and the second primer have the same sequence.

86. dehybridizing the first non-transferred strand and the second non-transferred strand; 86. The method of claim 84 or 85, further comprising the step of performing an extension reaction to add additional adapters to the new double-stranded DNA fragments.

87. generating double-stranded DNA fragments on a surface of a flow cell using a plurality of surface-bound first type transposome complexes, the first type transposome complexes comprising a first transposon end having a portion of a first transferred strand hybridized to a first non-transferred strand, the first transferred strand comprising a first amplification domain, the double-stranded DNA fragments each binding at their 5' ends to the 3' ends of the first transferred strand; introducing a plurality of second type transposome complexes into the flow cell, the second type transposome complexes comprising a second transposon end having a portion of a second transferred strand hybridized to a second non-transferred strand, the second transferred strand comprising a second amplification domain, thereby tagmenting the double-stranded DNA fragments to generate new double-stranded DNA fragments, each attached at its 5' end to the 3' end of the second transferred strand.

88. The step of generating double-stranded DNA fragments comprises: introducing a DNA sample and a tagmentation buffer into the flow cell; and performing tagmentation of the DNA sample using the first type of transposome complex.

89. removing a transposase enzyme from each of the first type transposome complexes and the second type transposome complexes; 89. The method of claim 87 or 88, further comprising the step of performing an extension reaction to add additional adapters to the new double-stranded DNA fragments.

90. introducing a first type of transposome complex into a well of a flow cell, the first type of transposome complex comprising a transposon end having a portion of the transferred strand hybridized to a non-transferred strand, the transferred strand comprising a first amplification domain; introducing a DNA sample into the flow cell, whereby the first type of transposome complexes tagment the DNA sample to generate double-stranded DNA fragments having a first strand that is bound at its 5' end to the 3' end of the transferred strand and unbound at its 3' end, and a second strand that is unbound at both its 3' end and 5' end; introducing a second type of transposome complex into the flow cell, the second type of transposome complex comprising a second transposon end having a portion of a second transferred strand hybridized to a second non-transferred strand, the second transferred strand comprising a second amplification domain, whereby a 5' end of the second strand of the double-stranded DNA fragment binds to the second transferred strand.

91. removing a transposome enzyme from each of the first type transposome complex and the second type transposome complex; 91. The method of claim 90, further comprising the step of performing an extension reaction to add additional adaptors to the double-stranded DNA fragments.

Images